FR2835847A1 - New rat melatonin receptor MT1 nucleic acid, polypeptide, and antibodies, useful e.g. for drug screening and for detecting MT1 expression - Google Patents
New rat melatonin receptor MT1 nucleic acid, polypeptide, and antibodies, useful e.g. for drug screening and for detecting MT1 expression Download PDFInfo
- Publication number
- FR2835847A1 FR2835847A1 FR0201559A FR0201559A FR2835847A1 FR 2835847 A1 FR2835847 A1 FR 2835847A1 FR 0201559 A FR0201559 A FR 0201559A FR 0201559 A FR0201559 A FR 0201559A FR 2835847 A1 FR2835847 A1 FR 2835847A1
- Authority
- FR
- France
- Prior art keywords
- leu
- val
- ile
- ser
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Toxicology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Endocrinology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
<Desc/Clms Page number 1> <Desc / Clms Page number 1>
La présente invention porte sur l'identification d'un nouveau récepteur mélatoninergique, et plus particulièrement pour le récepteur de la mélatonine de rat de type MT]. Elle porte en particulier sur l'identification d'une séquence d'acides nucléiques codant ce récepteur ainsi que sur les vecteurs recombinants comportant ces séquences et les cellules hôtes contenant les vecteurs. Les utilisations des cellules hôtes pour le criblage de molécules agonistes ou antagonistes du récepteur de la mélatonine font également partie de l'invention. The present invention relates to the identification of a new melatoninergic receptor, and more particularly to the MT type rat melatonin receptor]. It relates in particular to the identification of a nucleic acid sequence encoding this receptor as well as to the recombinant vectors comprising these sequences and the host cells containing the vectors. The uses of host cells for screening for agonist or antagonist molecules of the melatonin receptor are also part of the invention.
De nombreuses études ont mis en évidence ces dix dernières années l'implication de la mélatonine (N-acétyl-5-méthoxytryptamine) dans de nombreux phénomènes physiopathologiques ainsi que dans le contrôle du rythme circadien. Numerous studies have highlighted the involvement of melatonin (N-acetyl-5-methoxytryptamine) in the last ten years in many pathophysiological phenomena as well as in the control of the circadian rhythm.
Ces différents effets s'exercent par l'intermédiaire de récepteurs spécifiques de la mélatonine. Ces récepteurs sont des protéines membranaires appartenant à la famille des récepteurs couplés aux protéines G. Ils sont exprimés à la surface des cellules et sont capables de recevoir un signal extracellulaire et de le transmettre à la cellule via leur interaction avec des protéines G. Des études de biologie moléculaire ont permis de cloner chez l'homme deux sous-types réceptoriels hMT, et hMT2 (Neuron, 1994, 13, pp 1177- 1185 ; Proc. Natl. Acad. Sci., 1995,92, pp 8734-8738). Des composés interagissant sélectivement avec l'un ou l'autre de ces récepteurs peuvent être pour le clinicien d'excellents médicaments potentiels pour le traitement des pathologies liées au système mélatoninergique. These various effects are exerted via specific melatonin receptors. These receptors are membrane proteins belonging to the family of receptors coupled to G proteins. They are expressed on the surface of cells and are capable of receiving an extracellular signal and transmitting it to the cell via their interaction with G proteins. of molecular biology have made it possible to clone in man two receptive subtypes hMT, and hMT2 (Neuron, 1994, 13, pp 1177-1185; Proc. Natl. Acad. Sci., 1995.92, pp 8734-8738) . Compounds interacting selectively with one or the other of these receptors can be for the clinician excellent potential drugs for the treatment of pathologies linked to the melatoninergic system.
Afin de pouvoir mieux comprendre les fonctions physiologiques de chacun de ces sous-types réceptoriels et de déterminer leur intérêt thérapeutique potentiel, des études chez l'animal, en particulier chez le rat, sont nécessaires. En effet, les fonctions physiologiques des récepteurs mélatoninergiques MT, et MT2 ne sont pas encore bien déterminées tant au niveau central que périphérique. Des études pharmacologiques réalisées sur récepteurs MT, humain et ovin transfectés dans des cellules eucaryotes ont montré des différences importantes entre ces deux espèces tant d'un point de vue affinité qu'activité (Soc. Neurosci. Abstract, 2001,184. 2). Ainsi, des études avec des ligands dont l'affinité et l'activité auront bien été caractérisées en fonction de l'espèce étudiée In order to be able to better understand the physiological functions of each of these receptive subtypes and to determine their potential therapeutic interest, studies in animals, in particular in rats, are necessary. Indeed, the physiological functions of the melatoninergic receptors MT, and MT2 are not yet well determined both at the central and peripheral level. Pharmacological studies carried out on MT receptors, human and ovine transfected into eukaryotic cells have shown significant differences between these two species both from an affinity and activity point of view (Soc. Neurosci. Abstract, 2001, 184. 2). Thus, studies with ligands whose affinity and activity will have been well characterized according to the species studied
<Desc/Clms Page number 2><Desc / Clms Page number 2>
permettront une meilleure approche thérapeutique. En particulier, les différences d'affinité observées sur les récepteurs humain et de rat permettront de corréler l'index thérapeutique d'une molécule au ratio dose minimale active/dose minimale dépourvue d'effet secondaire ou toxique obtenu dans les études de toxicologie réalisées chez le rat. will allow a better therapeutic approach. In particular, the differences in affinity observed on the human and rat receptors will make it possible to correlate the therapeutic index of a molecule to the ratio of minimum active dose / minimum dose devoid of side or toxic effect obtained in toxicology studies carried out in the rat.
Plus particulièrement, l'ADNc codant le récepteur complet MTi de rat a été cloné après amplification par RT-PCR à partir d'ARN de cerveau total de rat, puis séquencé. More particularly, the cDNA encoding the complete rat MTi receptor was cloned after amplification by RT-PCR from RNA from the total brain of the rat, then sequenced.
La séquence nucléotidique obtenue par le séquençage de l'ADNc est présentée à la figure 1 (SEQ ID NO 1). The nucleotide sequence obtained by sequencing the cDNA is presented in FIG. 1 (SEQ ID NO 1).
La séquence d'acides aminés déduite de la séquence de la figure 1 est présentée en figure 2 (SEQ ID NO 2). The amino acid sequence deduced from the sequence of Figure 1 is presented in Figure 2 (SEQ ID NO 2).
L'invention a ainsi pour objet une séquence d'acides nucléiques codant le récepteur mélatoninergique de rat de type Mati, caractérisée par la séquence de la figure 1. The subject of the invention is thus a nucleic acid sequence coding for the rat melatoninergic receptor of the Mati type, characterized by the sequence of FIG. 1.
Une séquence d'acides nucléiques selon l'invention comprend notamment :
une séquence d'ADN génomique, caractérisée par la séquence de la figure 1, une séquence d'ARN messager, produit de transcription de la séquence d'ADN génomique, - ou une séquence d'ADNc, produit de la transcription inverse de la séquence d'ARN messager. A nucleic acid sequence according to the invention notably comprises:
a genomic DNA sequence, characterized by the sequence of FIG. 1, a messenger RNA sequence, transcription product of the genomic DNA sequence, - or a cDNA sequence, product of the reverse transcription of the sequence messenger RNA.
Par séquence d'acides nucléiques , il doit être compris une séquence nucléotidique isolée de son contexte naturel. Il s'agit notamment de séquences isolées, amplifiées et/ou purifiées et éventuellement modifiées par génie génétique. By nucleic acid sequence, there must be understood a nucleotide sequence isolated from its natural context. These are in particular isolated, amplified and / or purified sequences and possibly modified by genetic engineering.
On entend par ADNc ou ADN complémentaire , un acide nucléique résultant de la transcription inverse d'un ARN messager. By cDNA or complementary DNA is meant a nucleic acid resulting from the reverse transcription of a messenger RNA.
Les inventeurs ont observé que la séquence codante d'ADN génomique du récepteur couplé aux protéines G selon l'invention était différente de la séquence d'ADNc isolée. Ils ont pu mettre en évidence la structure du gène, caractérisé par la présence de deux exons séparés par un intron. The inventors observed that the genomic DNA coding sequence of the G protein-coupled receptor according to the invention was different from the isolated cDNA sequence. They were able to demonstrate the structure of the gene, characterized by the presence of two exons separated by an intron.
<Desc/Clms Page number 3> <Desc / Clms Page number 3>
Une séquence d'acides nucléiques selon l'invention peut être aisément isolée par amplification spécifique par RT-PCR à partir d'extraits d'ARN messager de cellules du cerveau de rat, ou par amplification d'ADN génomique de rat, par exemple à l'aide du couple d'amorces ci-dessous :
5'-GCGCGGGGCTACAGGATGAT-3'
5'-ACCCCAACCAGGGAGCGTAAC-3'. A nucleic acid sequence according to the invention can be easily isolated by specific amplification by RT-PCR from extracts of messenger RNA from rat brain cells, or by amplification of rat genomic DNA, for example using the couple of primers below:
GCGCGGGGCTACAGGATGAT 5'-3 '
5'-ACCCCAACCAGGGAGCGTAAC-3 '.
L'invention concerne aussi des variants de la séquence d'acides nucléiques de la figure 1. The invention also relates to variants of the nucleic acid sequence of FIG. 1.
Les variants de la séquence d'acides nucléiques sont notamment : - des séquences capables de s'hybrider dans des conditions stringentes avec une séquence d'acides nucléiques de la figure 1 ou une séquence complémentaire de celle-ci, et codant un polypeptide ayant essentiellement les mêmes propriétés que le récepteur codé par la séquence de la figure 1 ; les séquences d'acides nucléiques déduites de la séquence d'acides aminés de la figure 2, selon le code génétique, - des formes alléliques pathologiques de la séquence de la figure 1. The variants of the nucleic acid sequence are in particular: - sequences capable of hybridizing under stringent conditions with a nucleic acid sequence of FIG. 1 or a sequence complementary thereto, and encoding a polypeptide having essentially the same properties as the receiver coded by the sequence of Figure 1; the nucleic acid sequences deduced from the amino acid sequence of FIG. 2, according to the genetic code, - pathological allelic forms of the sequence of FIG. 1.
Par conditions stringentes , on entend les conditions qui permettent l'hybridation
spécifique de deux séquences d'ADN simple brin à environ 65 C par exemple dans une solution de 6 x SSC, 0, 5% SDS, 5X Denhardt's solution et 100 u. g d'ADN carrier non spécifique ou toute autre solution de force ionique équivalente et après un lavage à 65 C, par exemple dans une solution d'au plus 0,2 x SSC et 0, 1% SDS ou toute autre solution de force ionique équivalente. Les paramètres définissant les conditions de stringence dépendent de la température à laquelle 50% des brins appariés se séparent (Tm). Pour les séquences comprenant plus de 30 bases, Tm est définie par la relation : Tm = 81,5 + 0,41 (% G + C) + 16,6Log (concentration en cations)-0, 63 (% formamide) - (600/nombre de bases). Pour les séquences de longueur inférieure à 30 bases, Tm est définie par la relation : Tm = 4 (G+C) + 2 (A+T). Les conditions de stringence peuvent donc être adaptées par l'homme du métier selon la taille de la séquence, la teneur en GC et tout autre By stringent conditions is meant the conditions which allow hybridization
specific for two single-stranded DNA sequences at approximately 65 C for example in a solution of 6 x SSC, 0.5% SDS, 5X Denhardt's solution and 100 u. g of non-specific carrier DNA or any other solution of equivalent ionic strength and after washing at 65 ° C., for example in a solution of at most 0.2 × SSC and 0.1% SDS or any other solution of ionic strength equivalent. The parameters defining the stringency conditions depend on the temperature at which 50% of the paired strands separate (Tm). For sequences comprising more than 30 bases, Tm is defined by the relationship: Tm = 81.5 + 0.41 (% G + C) + 16.6 Log (cation concentration) -0.63 (% formamide) - ( 600 / number of bases). For sequences of length less than 30 bases, Tm is defined by the relation: Tm = 4 (G + C) + 2 (A + T). The stringency conditions can therefore be adapted by a person skilled in the art according to the size of the sequence, the GC content and any other
<Desc/Clms Page number 4><Desc / Clms Page number 4>
paramètre, selon notamment les protocoles décrits dans Sambrook et al., 2001 (Molecular Cloning : A laboratory Manual, 3rd Ed., Cold Spring Harbor, laboratory press, Cold Spring Harbor, New York). parameter, according in particular to the protocols described in Sambrook et al., 2001 (Molecular Cloning: A laboratory Manual, 3rd Ed., Cold Spring Harbor, laboratory press, Cold Spring Harbor, New York).
On entend par formes alléliques pathologiques , toute séquence isolée chez le rat correspondant à une forme mutée de la séquence de la figure 1, et dont les mutations sont impliquées dans une pathologie spécifique. Ces mutations peuvent être un ou plusieurs changement (s) nucléotidique (s) ou une ou plusieurs délétion (s) ou insertion (s) de fragments de séquences nucléotidiques. The expression pathological allelic forms means any sequence isolated in the rat corresponding to a mutated form of the sequence of FIG. 1, and the mutations of which are involved in a specific pathology. These mutations can be one or more nucleotide change (s) or one or more deletion (s) or insertion (s) of fragments of nucleotide sequences.
Les sondes d'hybridation pour la reconnaissance spécifique des séquences d'acides nucléiques codant un récepteur mélatoninergique de rat de type MT, selon l'invention font également partie de l'invention. De telles sondes sont caractérisées en ce qu'elles correspondent à un fragment d'une longueur d'au moins 50 nucléotides, de préférence entre 150 et 250 nucléotides d'une séquence d'acides nucléiques selon l'invention. Les sondes peuvent être couplées directement ou indirectement avec un marqueur radioactif ou non-radioactif, on peut citer notamment le 32Pou le 35S parmi les composés radioactifs ou encore la biotine, l'avidine et la streptavidine ou tout type de composés fluorescents ou bioluminescents ou chimioluminescents parmi les composés non-radioactifs. The hybridization probes for the specific recognition of the nucleic acid sequences encoding a melatoninergic receptor of the MT type rat, according to the invention also form part of the invention. Such probes are characterized in that they correspond to a fragment with a length of at least 50 nucleotides, preferably between 150 and 250 nucleotides of a nucleic acid sequence according to the invention. The probes can be coupled directly or indirectly with a radioactive or non-radioactive marker, mention may in particular be made of 32P or 35S among radioactive compounds or else biotin, avidin and streptavidin or any type of fluorescent or bioluminescent or chemiluminescent compounds among non-radioactive compounds.
L'invention fournit également des amorces utiles pour l'amplification et l'isolement des séquences d'acides nucléiques codant un récepteur mélatoninergique de rat de type MT, selon l'invention. Ces amorces ainsi définies comprennent notamment les séquences suivantes :
5'-GCGCGGGGCTACAGGATGAT-3'
5'-ACCCCAACCAGGGAGCGTAAC-3'. The invention also provides primers useful for the amplification and isolation of the nucleic acid sequences encoding a melatoninergic receptor of the MT type rat, according to the invention. These primers thus defined include in particular the following sequences:
GCGCGGGGCTACAGGATGAT 5'-3 '
5'-ACCCCAACCAGGGAGCGTAAC-3 '.
Les amorces peuvent comprendre en outre dans leur partie 5'des séquences non spécifiques du gène, notamment des sites de restriction pour faciliter le clonage des séquences amplifiées dans un vecteur, ou encore des séquences codant des étiquettes, épitopes ou séquences signal pour faciliter l'expression et/ou la purification des polypeptides. Des amorces comprenant une séquence étiquette et des sites de restriction The primers can also comprise, in their 5 ′ part, sequences which are not specific for the gene, in particular restriction sites to facilitate the cloning of the sequences amplified in a vector, or alternatively sequences coding for tags, epitopes or signal sequences to facilitate the expression and / or purification of the polypeptides. Primers comprising a tag sequence and restriction sites
<Desc/Clms Page number 5><Desc / Clms Page number 5>
appropriés pour le clonage du produit d'amplification dans un plasmide sont aussi décrites dans l'exemple 1. suitable for cloning the amplification product into a plasmid are also described in Example 1.
L'invention a trait également aux séquences d'acides nucléiques susceptibles d'être obtenues par l'amplification à l'aide des amorces définies ci-dessus. The invention also relates to the nucleic acid sequences capable of being obtained by amplification using the primers defined above.
Les méthodes d'amplification à l'aide des amorces de l'invention sont connues de l'homme du métier et sont en particulier la méthode PCR qui comprend l'utilisation d'une polymérase thermostable ou la méthode RT-PCR qui permet l'amplification d'ADN à partir d'un échantillon d'ARN messager en effectuant préalablement à l'amplification une étape de transcription inverse. Il existe en outre de nombreuses techniques alternatives à la PCR. Citons à titre d'exemple, les méthodes d'amplification isotherme telles que la TMA (transcription mediated amplification), la NASBA (nucleic acid sequence based amplification), la 3SR (self sustained sequence replication) ou l'amplification par déplacement de brin (strand displacement amplification). The methods of amplification using the primers of the invention are known to those skilled in the art and are in particular the PCR method which comprises the use of a thermostable polymerase or the RT-PCR method which allows the amplification of DNA from a sample of messenger RNA by performing a reverse transcription step before amplification. There are also many alternative techniques to PCR. Examples include isothermal amplification methods such as TMA (transcription mediated amplification), NASBA (nucleic acid sequence based amplification), 3SR (self sustained sequence replication) or strand displacement amplification ( strand displacement amplification).
L'invention concerne aussi un vecteur recombinant comprenant une séquence d'acides nucléiques selon l'invention. Par vecteur, il faut comprendre tout type de vecteur permettant l'introduction de la séquence d'acides nucléiques dans une cellule hôte et éventuellement l'expression du polypeptide codé par la séquence d'acides nucléiques dans la cellule hôte. The invention also relates to a recombinant vector comprising a nucleic acid sequence according to the invention. The term “vector” should be understood to mean any type of vector allowing the introduction of the nucleic acid sequence into a host cell and possibly the expression of the polypeptide encoded by the nucleic acid sequence in the host cell.
Un tel vecteur est par exemple le plasmide pSrMT 1 déposé à la CNCM le 31.01. 2002 sous le numéro 1-2791. Such a vector is for example the plasmid pSrMT 1 deposited at the CNCM on January 31. 2002 under number 1-2791.
Dans un mode de réalisation préféré, le vecteur recombinant selon l'invention est caractérisé en ce qu'il comprend des séquences d'ADN nécessaires à l'expression dudit récepteur dans une cellule hôte. Ces séquences sont notamment des séquences promotrices appropriées pour l'expression des gènes dans les cellules hôtes et des séquences terminatrices en aval de la séquence codante qui incluent un site de poly-adénylation. Des exemples de séquences promotrices sont la séquence du promoteur du cytomégalovirus (CMV) ou encore la séquence du promoteur SV40 qui permettent une expression constitutive et forte des séquences codantes placées en aval respectivement dans les cellules de mammifères et les cellules d'insecte. In a preferred embodiment, the recombinant vector according to the invention is characterized in that it comprises DNA sequences necessary for the expression of said receptor in a host cell. These sequences are in particular promoter sequences suitable for the expression of genes in host cells and terminator sequences downstream of the coding sequence which include a polyadenylation site. Examples of promoter sequences are the sequence of the cytomegalovirus promoter (CMV) or the promoter sequence SV40 which allow a constitutive and strong expression of the coding sequences placed downstream in mammalian cells and insect cells respectively.
<Desc/Clms Page number 6> <Desc / Clms Page number 6>
Il existe un grand nombre de vecteurs d'expression utilisables. De tels vecteurs d'expression comprennent, entre autres, des vecteurs chromosomiques, épisomiques ou dérivés de virus, en particulier, des vecteurs dérivés des plasmides bactériens, des bactériophages, des transposons, des plasmides et chromosomes de levure, des virus tels que les baculovirus, les papovirus et en particulier SV40, les adénovirus, et les rétrovirus et des vecteurs dérivés de leurs combinaisons, notamment les cosmides et les phagemides. There are a large number of usable expression vectors. Such expression vectors include, among others, chromosomal, episomal or virus-derived vectors, in particular, vectors derived from bacterial plasmids, bacteriophages, transposons, plasmids and chromosomes of yeast, viruses such as baculoviruses , papoviruses and in particular SV40, adenoviruses, and retroviruses and vectors derived from their combinations, in particular cosmids and phagemids.
Parmi les vecteurs d'expression particulièrement préférés pour l'expression hétérologue de récepteurs membranaires dans les cellules de mammifères, on citera les vecteurs pCI-neo
(promega ; N'accession U47120) et pcDNA3 comprenant le promoteur du CMV, le vecteur bicistronique pIRESneo/pIREShyg (Clontech NO cat 6061-1) ou encore le vecteur pSG5 (Stratagène) comprenant le promoteur SV40. Among the expression vectors particularly preferred for the heterologous expression of membrane receptors in mammalian cells, mention will be made of the vectors pCI-neo
(promega; N'accession U47120) and pcDNA3 comprising the CMV promoter, the bicistronic vector pIRESneo / pIREShyg (Clontech NO cat 6061-1) or also the vector pSG5 (Stratagene) comprising the promoter SV40.
Pour permettre la sécrétion des protéines traduites dans la lumière du réticulum endoplasmique des cellules eucaryotes ou dans l'espace périplasmique des bactéries ou dans tout autre environnement extra-cellulaire, les vecteurs peuvent comprendre des séquences codant les signaux de sécrétion appropriés sur le polypeptide exprimé. To allow secretion of the proteins translated into the lumen of the endoplasmic reticulum of eukaryotic cells or in the periplasmic space of bacteria or in any other extracellular environment, the vectors can comprise sequences coding the appropriate secretion signals on the expressed polypeptide.
L'invention porte aussi sur les cellules hôtes transformées par les vecteurs recombinants. Dans un mode de réalisation particulier, les cellules hôtes sont des bactéries, telles que, par exemple, E. coli, les streptococci, les staphylococci, Streptomyces et B. subtilis, de préférence Escherichia coli. La transformation de cellules hôtes bactériennes est en particulier utile pour l'amplification et le stockage des vecteurs recombinants de l'invention. The invention also relates to host cells transformed by the recombinant vectors. In a particular embodiment, the host cells are bacteria, such as, for example, E. coli, streptococci, staphylococci, Streptomyces and B. subtilis, preferably Escherichia coli. The transformation of bacterial host cells is in particular useful for the amplification and storage of the recombinant vectors of the invention.
Dans un autre mode de réalisation de l'invention, les cellules hôtes sont des cellules eucaryotes. Des cellules hôtes eucaryotes utilisables sont notamment des cellules de levures telles que S. cerevisiae ou de champignons filamenteux tels que Aspergillus, des cellules d'insectes telles que les cellules S2 de Drosphila ou Sf9 de spodoptera, ou encore des cellules de plantes. In another embodiment of the invention, the host cells are eukaryotic cells. Eukaryotic host cells which can be used are in particular yeast cells such as S. cerevisiae or filamentous fungi such as Aspergillus, insect cells such as S2 cells from Drosphila or Sf9 from spodoptera, or even plant cells.
De manière préférée, les cellules hôtes eucaryotes sont des cellules de mammifères et en particulier des lignées cellulaires de mammifères, notamment les cellules CHO, COS, HeLa, C127, 3T3, HepG2, L (TK-), AtT20, Caco-2 et de manière encore préférée, les lignées CHO-K1 ou HEK 293. Preferably, the eukaryotic host cells are mammalian cells and in particular mammalian cell lines, in particular CHO, COS, HeLa, C127, 3T3, HepG2, L (TK-), AtT20, Caco-2 and more preferably, the CHO-K1 or HEK 293 lines.
<Desc/Clms Page number 7> <Desc / Clms Page number 7>
Il est ainsi possible d'exprimer le récepteur selon l'invention dans une cellule hôte appropriée, de préférence une cellule hôte eucaryote, par l'introduction dans la cellule hôte du vecteur recombinant de l'invention. It is thus possible to express the receptor according to the invention in an appropriate host cell, preferably a eukaryotic host cell, by the introduction into the host cell of the recombinant vector of the invention.
L'homme du métier sait aussi purifier ledit récepteur à partir des cellules eucaryotes l'exprimant. Différentes méthodes de purification des récepteurs couplés aux protéines G sont décrites dans l'état de la technique (Eckard CP et Beck-sickinger AG, Curr Med Chem 2000 7 : 897-910 ; Ohtaki T et al., J Biol Chem 1998 273 : 15464-15473 ; Hayashi MK, Haga TJ, Biochem (tokyo) 1996 120 : 1232-1238). Citons à titre d'exemple, les purifications par précipitation au sulfate d'ammonium ou à l'éthanol, sur colonne de chromatographie à échange d'ions, par chromatographie d'affinité, par chromatographie d'exclusion par la taille, par chromatographie en phase inverse ou encore par chromatographie liquide à haute performance. Il est aussi envisageable de purifier le récepteur de l'invention à l'aide des techniques électrophorétiques de séparation des protéines selon leur taille et/ou leur charge. Those skilled in the art also know how to purify said receptor from eukaryotic cells expressing it. Different methods of purifying G protein-coupled receptors are described in the prior art (Eckard CP and Beck-sickinger AG, Curr Med Chem 2000 7: 897-910; Ohtaki T et al., J Biol Chem 1998 273: 15464-15473; Hayashi MK, Haga TJ, Biochem (tokyo) 1996 120: 1232-1238). By way of example, let us cite the purifications by precipitation with ammonium sulphate or ethanol, on an ion exchange chromatography column, by affinity chromatography, by size exclusion chromatography, by reverse phase or by high performance liquid chromatography. It is also possible to purify the receptor of the invention using electrophoretic techniques for separating proteins according to their size and / or their charge.
La méthode de chromatographie d'affinité consiste en particulier à exprimer dans une cellule hôte, un récepteur recombinant présentant un épitope ou une séquence étiquette (tag) spécifique en amont ou en aval de la séquence codante, à récupérer les protéines membranaires ou les protéines totales de la cellule hôte puis à purifier les récepteurs sur colonne d'affinité fixant les protéines exprimant l'épitope ou tag spécifique. Selon ce mode de purification particulier, le vecteur d'expression comprend en plus les séquences étiquette (tag) pour la purification du polypeptide exprimé dans les cellules hôtes. The affinity chromatography method consists in particular in expressing in a host cell, a recombinant receptor exhibiting an epitope or a specific tag sequence (tag) upstream or downstream of the coding sequence, in recovering the membrane proteins or the total proteins of the host cell and then to purify the receptors on an affinity column fixing the proteins expressing the specific epitope or tag. According to this particular purification mode, the expression vector additionally comprises the tag sequences for the purification of the polypeptide expressed in the host cells.
L'invention concerne également un polypeptide caractérisé en ce qu'il est codé par une séquence d'acides nucléiques selon la séquence de la figure 1 (SEQ ID NO 1) ou par tout variant selon l'invention de la séquence de la figure 1. The invention also relates to a polypeptide characterized in that it is encoded by a nucleic acid sequence according to the sequence of FIG. 1 (SEQ ID NO 1) or by any variant according to the invention of the sequence of FIG. 1 .
En particulier, l'invention concerne un polypeptide comportant la séquence d'acides aminés de la figure 2 (SEQ ID NO 2). In particular, the invention relates to a polypeptide comprising the amino acid sequence of FIG. 2 (SEQ ID NO 2).
L'invention porte aussi sur les fragments de ce polypeptide présentant une activité de récepteur mélatoninergique, en particulier, les fragments de ce polypeptide comprenant les sept domaines transmembranaires. The invention also relates to the fragments of this polypeptide exhibiting melatoninergic receptor activity, in particular, the fragments of this polypeptide comprising the seven transmembrane domains.
<Desc/Clms Page number 8> <Desc / Clms Page number 8>
Il est en outre connu que certains fragments des récepteurs appartenant à la famille des récepteurs couplés aux protéines G sont capables de stimuler directement la protéine G indépendamment de la présence d'un agoniste. Par exemple, Hebert et al. ont montré que la deuxième et troisième boucle intracellulaire du récepteur couplé aux protéines G HT1AR permettent le couplage dudit récepteur aux protéines G et leur stimulation (Hebert TE et al., J Biol Chim 1996 271 : 16384-16392). Ainsi, l'invention porte sur les fragments du polypeptide décrit plus haut, lesdits fragments étant capables de stimuler directement les protéines G, et de mimer ainsi l'activité du récepteur en présence d'un agoniste. It is also known that certain fragments of the receptors belonging to the family of receptors coupled to G proteins are capable of directly stimulating the G protein independently of the presence of an agonist. For example, Hebert et al. have shown that the second and third intracellular loop of the receptor coupled to G proteins HT1AR allow the coupling of said receptor to G proteins and their stimulation (Hebert TE et al., J Biol Chim 1996 271: 16384-16392). Thus, the invention relates to the fragments of the polypeptide described above, said fragments being capable of directly stimulating the G proteins, and thus mimicking the activity of the receptor in the presence of an agonist.
Inversement, les fragments de récepteurs couplés aux protéines G délétés de tout ou partie des régions impliquées dans la dimérisation du récepteur ou dans l'interaction avec les protéines G peuvent être utilisés avantageusement afin d'inhiber l'action d'un agoniste (Varrault A. et al., J Biol Chem 1994 269 : 16720-16725). Par conséquent, l'invention porte aussi sur les fragments du polypeptide décrit plus haut, capables d'inhiber l'action d'un agoniste. Ainsi, selon les modes de réalisations de l'invention, les fragments de séquences polypeptidiques de l'invention sont compris dans un des 7 domaines transmembranaires ou dans la partie intracytoplasmique (première, deuxième et troisième boucle intracellulaire) ou encore dans la partie extérieure à la cellule (partie N-terminale ou première, deuxième ou troisième boucle extracellulaire). Conversely, fragments of receptors coupled to G proteins deleted from all or part of the regions involved in the dimerization of the receptor or in the interaction with G proteins can be advantageously used in order to inhibit the action of an agonist (Varrault A . et al., J Biol Chem 1994 269: 16720-16725). Consequently, the invention also relates to the fragments of the polypeptide described above, capable of inhibiting the action of an agonist. Thus, according to the embodiments of the invention, the fragments of polypeptide sequences of the invention are included in one of the 7 transmembrane domains or in the intracytoplasmic part (first, second and third intracellular loop) or even in the part external to the cell (N-terminal part or first, second or third extracellular loop).
Les polypeptides ou fragments de polypeptides de l'invention sont sous la forme des protéines natives ou font partie d'une protéine de fusion de taille plus importante. En particulier, les polypeptides de l'invention sont fusionnés à des séquences d'acides aminés supplémentaires qui contiennent les signaux nécessaires à la traduction, la stabilité, la sécrétion et/ou la purification de la protéine recombinante correspondante. The polypeptides or fragments of polypeptides of the invention are in the form of native proteins or are part of a larger fusion protein. In particular, the polypeptides of the invention are fused to additional amino acid sequences which contain the signals necessary for the translation, stability, secretion and / or purification of the corresponding recombinant protein.
Les anticorps dirigés contre les polypeptides et fragments de polypeptides décrits plus haut font également partie de l'invention. Ces anticorps trouvent leur intérêt pour détecter et/ou quantifier l'expression des récepteurs à la surface des cellules. Lorsque les anticorps sont spécifiquement dirigés contre le site de reconnaissance du ligand du récepteur, ces anticorps peuvent aussi être utilisés en tant qu'antagonistes du récepteur. The antibodies directed against the polypeptides and fragments of polypeptides described above also form part of the invention. These antibodies find their interest in detecting and / or quantifying the expression of receptors on the surface of cells. When the antibodies are specifically directed against the receptor ligand recognition site, these antibodies can also be used as receptor antagonists.
L'invention vise à la fois les anticorps polyclonaux et monoclonaux. The invention relates to both polyclonal and monoclonal antibodies.
<Desc/Clms Page number 9> <Desc / Clms Page number 9>
Les anticorps polyclonaux peuvent être obtenus par l'immunisation d'un hôte vivant approprié avec lesdits polypeptides purifiés ou leurs fragments contenant les épitopes que l'on souhaite identifier et/ou quantifier. Les anticorps formés à partir d'un sérum de l'hôte immunisé sont ensuite récupérés notamment par la mise en contact des sérums avec les polypeptides purifiés et par la récupération de ces anticorps à partir des complexes antigène-anticorps formés. Polyclonal antibodies can be obtained by immunization of an appropriate living host with said purified polypeptides or their fragments containing the epitopes which it is desired to identify and / or quantify. The antibodies formed from a serum of the immunized host are then recovered in particular by bringing the sera into contact with the purified polypeptides and by recovering these antibodies from the antigen-antibody complexes formed.
Les anticorps monoclonaux sont notamment obtenus selon la méthode classique de culture d'hybridomes de Kohler et Milstein. The monoclonal antibodies are in particular obtained according to the conventional method of culture of hybridomas of Kohler and Milstein.
Les anticorps selon l'invention peuvent aussi être des anticorps chimériques, des anticorps humanisés ou des fragments Fab ou F (ab') 2. Il est en particulier possible, de cloner les gènes codant les deux chaînes des anticorps monoclonaux produits par des hybridomes, ceux-ci pouvant être manipulés in vitro et réintroduits ensuite dans des cellules secrétrices, telles des lignées lymphoïdes ou autres, après leur réinsertion dans les vecteurs d'expression appropriés aux cellules choisies. The antibodies according to the invention can also be chimeric antibodies, humanized antibodies or Fab or F (ab ') 2 fragments. It is in particular possible to clone the genes encoding the two chains of the monoclonal antibodies produced by hybridomas, these can be manipulated in vitro and then reintroduced into secretory cells, such as lymphoid lines or the like, after their reinsertion into the expression vectors appropriate to the cells chosen.
Les anticorps selon l'invention sont aussi susceptibles d'être couplés à un autre composé, notamment un marqueur, afin d'obtenir un signal détectable ou quantifiable. The antibodies according to the invention are also capable of being coupled to another compound, in particular a marker, in order to obtain a detectable or quantifiable signal.
Les cellules hôtes exprimant le récepteur mélatoninergique de type MT 1 selon l'invention peuvent être utilisées dans des études de liaison au récepteur pour le criblage de molécules qui se fixent au récepteur, le procédé comprenant les étapes suivantes : a) la culture de cellules hôtes eucaryotes transformées par un vecteur recombinant selon l'invention permettant l'expression du récepteur MT 1 de rat ; b) la mise en contact des cellules hôtes en culture ou de leur membrane avec un composé candidat ; c) la détermination d'une liaison éventuelle au récepteur en présence du composé candidat par des études de compétition vis à vis de la mélatonine marquée, de la
2-iodo-mélatonine marquée ou de tout autre ligand marqué présentant une bonne affinité pour le récepteur de l'invention. The host cells expressing the melatoninergic receptor of the MT 1 type according to the invention can be used in studies of binding to the receptor for the screening of molecules which bind to the receptor, the method comprising the following steps: a) the culture of host cells eukaryotes transformed with a recombinant vector according to the invention allowing the expression of the rat MT 1 receptor; b) bringing the host cells in culture or their membrane into contact with a candidate compound; c) the determination of a possible binding to the receptor in the presence of the candidate compound by studies of competition with respect to the labeled melatonin, the
Labeled 2-iodo-melatonin or any other labeled ligand having good affinity for the receptor of the invention.
<Desc/Clms Page number 10> <Desc / Clms Page number 10>
Les cellules hôtes exprimant le récepteur mélatoninergique de type MT 1 selon l'invention peuvent être par ailleurs avantageusement utilisées pour le criblage de composés qui se fixent au récepteur et l'activent (agonistes de ce récepteur) ou qui inhibent l'activation dudit récepteur (antagonistes). The host cells expressing the melatoninergic receptor of the MT 1 type according to the invention can also be advantageously used for the screening of compounds which bind to the receptor and activate it (agonists of this receptor) or which inhibit the activation of said receptor ( antagonists).
L'invention porte ainsi sur un procédé de criblage pour l'identification de molécules agonistes du récepteur Mati, caractérisé en ce qu'il comprend les étapes suivantes : a) la culture de cellules hôtes eucaryotes transformées par un vecteur recombinant selon l'invention permettant l'expression dudit récepteur ; b) la mise en contact des cellules hôte en culture avec un composé candidat ; c) la détermination d'un signal éventuel généré par le récepteur mélatoninergique en présence du composé candidat. The invention thus relates to a screening method for the identification of agonist molecules of the Mati receptor, characterized in that it comprises the following steps: a) the culture of eukaryotic host cells transformed by a recombinant vector according to the invention allowing expression of said receptor; b) bringing the host cells in culture into contact with a candidate compound; c) determining a possible signal generated by the melatoninergic receptor in the presence of the candidate compound.
Selon les modes de réalisation du procédé, le signal à déterminer, généré par l'activation du récepteur MTl par le composé candidat peut être une stimulation ou une inhibition de l'adénylate cyclase, une liaison du 35SGTPy, une activité MAP kinase ou encore une augmentation de l'inositol triphosphate intracellulaire, et plus généralement tout type de signal susceptible d'être modulé positivement ou négativement par les protéines G. According to the embodiments of the method, the signal to be determined, generated by the activation of the MT1 receptor by the candidate compound can be a stimulation or an inhibition of adenylate cyclase, a binding of 35SGTPy, a MAP kinase activity or even a increase in intracellular inositol triphosphate, and more generally any type of signal capable of being modulated positively or negatively by G proteins.
Dans un mode de réalisation préféré, le signal généré par le récepteur MT 1 en présence d'un de ses agonistes est déterminé à l'aide d'un système rapporteur comprenant l'utilisation d'une cellule recombinante exprimant la sous-unité a de la protéine G16 de manière stable ou transitoire et la quantification de la concentration en calcium intracellulaire. L'expression constitutive de la sous-unité a de la protéine G16 permet que toute réponse antagoniste se traduise essentiellement par une augmentation de la concentration en calcium intracellulaire. In a preferred embodiment, the signal generated by the MT 1 receptor in the presence of one of its agonists is determined using a reporter system comprising the use of a recombinant cell expressing the α subunit of the G16 protein in a stable or transient manner and the quantification of the intracellular calcium concentration. The constitutive expression of the a subunit of the G16 protein allows any antagonistic response to be reflected essentially by an increase in the intracellular calcium concentration.
Ainsi, l'invention porte sur un procédé de criblage pour l'identification de molécules agonistes comprenant les étapes suivantes : Thus, the invention relates to a screening method for the identification of agonist molecules comprising the following steps:
<Desc/Clms Page number 11><Desc / Clms Page number 11>
a) la culture de cellules hôtes eucaryotes transformées par un vecteur recombinant selon l'invention permettant l'expression du récepteur MTl, lesdites cellules hôtes exprimant en plus une sous-unité a de la protéine G de manière constitutive ; b) la quantification de la concentration en calcium intracellulaire dans les cellules en culture en présence et en absence des molécules à cribler ; c) la sélection des molécules en présence desquelles la concentration en calcium intracellulaire est augmentée. a) the culture of eukaryotic host cells transformed by a recombinant vector according to the invention allowing the expression of the MT1 receptor, said host cells additionally expressing an α subunit of protein G constitutively; b) quantifying the concentration of intracellular calcium in the cells in culture in the presence and in the absence of the molecules to be screened; c) the selection of molecules in the presence of which the concentration of intracellular calcium is increased.
Dans le procédé ci-dessus, les cellules hôtes sont modifiées de telle manière que toute activation du récepteur conduit à une élévation de la concentration en calcium intracellulaire. On utilisera par exemple des cellules COS7, CHO ou HEK293 exprimant de façon stable ou transitoire la sous-unité Gal6. La concentration de calcium intracellulaire est déterminée à l'aide d'un marqueur, notamment un marqueur fluorescent. In the above method, the host cells are modified in such a way that any activation of the receptor leads to an increase in the concentration of intracellular calcium. We will use for example COS7, CHO or HEK293 cells expressing in a stable or transient way the Gal6 subunit. The concentration of intracellular calcium is determined using a marker, in particular a fluorescent marker.
L'invention porte également sur un procédé d'identification de la présence de molécules antagonistes comprenant les étapes suivantes : a) la culture de cellules hôtes eucaryotes transformées par un plasmide recombinant selon l'invention permettant l'expression du récepteur MTl en présence d'un agoniste ; b) la mise en contact des cellules hôtes en culture avec un composé candidat ; c) la détermination d'une diminution du signal éventuel généré par le récepteur couplé aux protéines G en présence du composé candidat et de l'agoniste par rapport au signal généré avec l'agoniste seul. The invention also relates to a method for identifying the presence of antagonistic molecules comprising the following steps: a) the culture of eukaryotic host cells transformed by a recombinant plasmid according to the invention allowing the expression of the MT1 receptor in the presence of an agonist; b) contacting the host cells in culture with a candidate compound; c) determining a decrease in the possible signal generated by the receptor coupled to the G proteins in the presence of the candidate compound and the agonist compared to the signal generated with the agonist alone.
Les agonistes et antagonistes identifiés par un tel procédé sont également visés par l'invention. The agonists and antagonists identified by such a method are also targeted by the invention.
L'invention porte aussi sur l'utilisation d'une séquence d'acides nucléiques codant un récepteur mélatoninergique de type MTl selon l'invention pour le criblage de molécules agonistes et antagonistes dudit récepteur. The invention also relates to the use of a nucleic acid sequence coding for a melatoninergic receptor of the MT1 type according to the invention for the screening of agonist and antagonist molecules of said receptor.
<Desc/Clms Page number 12> <Desc / Clms Page number 12>
Elle concerne également l'utilisation des cellules hôtes ci-dessus mentionnées pour le criblage de molécules agonistes et antagonistes dudit récepteur. It also relates to the use of the host cells mentioned above for the screening of agonist and antagonist molecules of said receptor.
Avantageusement, l'expression du transcrit codant le récepteur MT 1 dans des cellules ou des tissus est étudiée par hybridation des ADNc ou ARNm dans des kits constitués de puces à ADN , ou micro-réseaux ou macro-réseaux sur lesquels sont fixés des sondes spécifiques du gène de l'invention dont l'expression est recherchée. Advantageously, the expression of the transcript encoding the MT 1 receptor in cells or tissues is studied by hybridization of the cDNAs or mRNAs in kits made up of DNA chips, or micro-networks or macro-networks on which specific probes are fixed. of the gene of the invention whose expression is sought.
Par puce à ADN , il faut comprendre tout type de support permettant la fixation stable d'une quantité d'acides nucléiques, l'hybridation des acides nucléiques fixés sur le support avec une séquence contenue dans un extrait d'ADN ou d'ARN préalablement marqué, puis la quantification de l'hybridation. Les technologies des puces à ADN sont en particulier décrites par Sambrook et al. (voir plus haut). By DNA chip, it is necessary to understand any type of support allowing the stable fixation of a quantity of nucleic acids, the hybridization of the nucleic acids fixed on the support with a sequence contained in a DNA or RNA extract beforehand. labeled, then quantifying the hybridization. DNA chip technologies are in particular described by Sambrook et al. (see above).
De même, des kits permettant la détection de formes anormales du récepteur MT 1 font également partie de l'invention. Ces tests peuvent être de nature immunologique comprenant l'utilisation d'anticorps spécifiques de régions du récepteur susceptibles de contenir des structures anormales. Likewise, kits allowing the detection of abnormal forms of the MT 1 receptor are also part of the invention. These tests can be of an immunological nature including the use of antibodies specific for regions of the receptor which may contain abnormal structures.
Ces kits peuvent également être une puce à protéines constituée d'un support sur lequel est fixée une séquence d'acides aminés selon l'invention ou un anticorps ou fragment d'anticorps dirigé contre un polypeptide ou un fragment de polypeptide selon l'invention. De telles puces à protéines permettent la détection à grande échelle de structures anormales de plusieurs protéines, ou la détection des interactions particulières du récepteur avec d'autres molécules. These kits can also be a protein chip consisting of a support on which is fixed an amino acid sequence according to the invention or an antibody or antibody fragment directed against a polypeptide or a polypeptide fragment according to the invention. Such protein chips allow the large-scale detection of abnormal structures of several proteins, or the detection of specific interactions of the receptor with other molecules.
En particulier, l'invention porte sur une séquence nucléotidique anti-sens, capable d'inhiber l'expression des séquences d'acides nucléiques selon l'invention, et caractérisée en ce qu'elle correspond à une séquence d'acides nucléiques simple brin capable de s'hybrider dans des conditions stringentes au brin codant d'une séquence d'acides nucléiques selon l'invention. In particular, the invention relates to an antisense nucleotide sequence, capable of inhibiting the expression of the nucleic acid sequences according to the invention, and characterized in that it corresponds to a single-stranded nucleic acid sequence capable of hybridizing under stringent conditions to the strand coding for a nucleic acid sequence according to the invention.
<Desc/Clms Page number 13><Desc / Clms Page number 13>
DESCRIPTION DES FIGURES Figure 1 : Séquence d'acides nucléiques codant le récepteur mélatoninergique de rat de type MT, (SrMTi). (SEQ ID NO 1) Figure 2 : Séquence d'acides aminés du récepteur mélatoninergique de rat de type Mati. (SEQ ID NO 2) Figure 3 : Profil hydrophile du récepteur mélatoninergique de rat de type Mati. DESCRIPTION OF THE FIGURES Figure 1: Sequence of nucleic acids coding for the MT type rat melatoninergic receptor (SrMTi). (SEQ ID NO 1) Figure 2: Amino acid sequence of the Mati rat rat melatoninergic receptor. (SEQ ID NO 2) Figure 3: Hydrophilic profile of the Mati rat rat melatoninergic receptor.
Exemple 1-Identification et isolement d'une séquence d'acides nucléiques codant
un nouveau récepteur mélatoninergique de type MT 1 Les exons 1 et 2 codant pour le récepteur MT 1 de rat ont été isolés à partir d'ADN génomique par des techniques de RT-PCR en utilisant des amorces dégénérées ou non conçues à partir de la comparaison des séquences humaine et rat du récepteur MT 1 : Les amorces sens sont 5'-GGRMGRCCRCGRCCSTCSTGG-3'pour l'exon 1 et 5'TAGGATATACAGTAACAAGAAT-3'pour l'exon2. Les amorces antisens sont 5'TTRTTCTTCGAGTCCTTGMGT-3'pour l'exon 1 et 5'-ATGTAACTAGCCACGAAGAGC-3'pour l'exon 2. Les séquences nucléotidiques des deux exons ont été déterminées à partir d'une réaction de terminaison de chaîne et en utilisant un séquenceur d'ADN automatique ABI 377 (Applied Biosystems). Les séquences nucléotidiques des exons 1 et 2 ont permis de concevoir de nouvelles amorces nucléotidiques permettant d'amplifier le récepteur MT 1 de rat dans sa totalité (de-57 à +1104 ; +1 correspond au A du codon d'initiation ATG)
Un ADNc a été isolé par RT-PCR à partir d'ARNm de cerveaux de rats à l'aide des amorces sens 5'-GAGCTTAAGCTTGCGCGGGGCTACAGGATGAT-3'et anti sens 5'-GGATCCGGTACCACCCCAACCAGCGAGCGTAAC-3'. Example 1-Identification and isolation of a nucleic acid sequence encoding
a new melatoninergic MT 1 receptor Exons 1 and 2 encoding the rat MT 1 receptor were isolated from genomic DNA by RT-PCR techniques using degenerate primers or those not designed from the comparison human and rat sequences of the MT receptor 1: The primers are 5′-GGRMGRCCRCGRCCSTCSTGG-3 ′ for exon 1 and 5 ′ TAGGATATACAGTAACAAGAAT-3 ′ for exon2. The antisense primers are 5'TTRTTCTTCGAGTCCTTGMGT-3'for exon 1 and 5'-ATGTAACTAGCCACGAAGAGC-3'for exon 2. The nucleotide sequences of the two exons were determined from a chain termination reaction and in using an automatic DNA sequencer ABI 377 (Applied Biosystems). The nucleotide sequences of exons 1 and 2 made it possible to design new nucleotide primers making it possible to amplify the MT 1 receptor of the rat in its entirety (from -57 to +1104; +1 corresponds to the A of the initiation codon ATG)
A cDNA was isolated by RT-PCR from mRNA of rat brains using the primers sense 5'-GAGCTTAAGCTTGCGCGGGGCTACAGGATGAT-3 'and antisense 5'-GGATCCGGTACCACCCCAACCAGCGAGCGTAAC-3'.
Ces amorces ont été définies à partir de la séquence théorique obtenue, et contiennent en These primers were defined from the theoretical sequence obtained, and contain in
<Desc/Clms Page number 14><Desc / Clms Page number 14>
plus les séquences des sites de restriction Hind III et Kpn 1 (soulignées dans la séquence d'oligonucléotides) permettant un clonage orienté dans le vecteur d'expression nommé pcDNA3-Cflag. Ce vecteur a été obtenu en insérant, dans le vecteur pcDNA3.1 (+) (Invitrogen), une séquence codant pour le peptide DYKDDDDK en 3'du site Kpn I. plus the sequences of the Hind III and Kpn 1 restriction sites (underlined in the oligonucleotide sequence) allowing oriented cloning in the expression vector named pcDNA3-Cflag. This vector was obtained by inserting, in the vector pcDNA3.1 (+) (Invitrogen), a sequence coding for the peptide DYKDDDDK at 3 ′ from the Kpn I site.
La séquence amplifiée par RT-PCR a été insérée dans le vecteur d'expression pcDNA3-Cflag en phase avec la séquence codant pour les peptides DYKDDDDK puis la séquence nucléotidique a été déterminée à partir d'une réaction de terminaison de chaîne et en utilisant un séquenceur d'ADN automatique ABI 377 (Applied Biosystems). The sequence amplified by RT-PCR was inserted into the expression vector pcDNA3-Cflag in phase with the sequence coding for the peptides DYKDDDDK then the nucleotide sequence was determined from a chain termination reaction and using a automatic DNA sequencer ABI 377 (Applied Biosystems).
La traduction de la séquence nucléotidique théorique en acides aminés produit une séquence en protéine de 363 acides aminés. Cette séquence possède un certain nombre de critères structuraux typiques des récepteurs couplés aux protéines G : incluant 7 domaines transmembranaires contenant chacun environ 20-30 acides aminés hydrophobes et le motif NRY présent dans la deuxième boucle intracellulaire. The translation of the theoretical nucleotide sequence into amino acids produces a protein sequence of 363 amino acids. This sequence has a certain number of structural criteria typical of receptors coupled to G proteins: including 7 transmembrane domains each containing approximately 20-30 hydrophobic amino acids and the NRY motif present in the second intracellular loop.
La séquence nucléotidique (SRMTI) ainsi obtenue est présentée dans la figure 1 (SEQ ID NO 1). La séquence d'acides aminés, déduite de la séquence nucléotidique est présentée dans la figure 2 (SEQ ID NO 2). L'analyse du profil hydrophile de la séquence à l'aide de la méthode de Kyte et Doolittle est présentée en figure 3. Elle confirme l'existence de sept domaines transmembranaires hydrophobes ainsi que la présence du motif NRY dans la deuxième boucle intracellulaire. Ces résultats attestent que la séquence d'acides nucléiques isolée code pour un nouveau récepteur couplé aux protéines G de type mélatoninergique. The nucleotide sequence (SRMTI) thus obtained is presented in Figure 1 (SEQ ID NO 1). The amino acid sequence, deduced from the nucleotide sequence is presented in Figure 2 (SEQ ID NO 2). The analysis of the hydrophilic profile of the sequence using the Kyte and Doolittle method is presented in FIG. 3. It confirms the existence of seven hydrophobic transmembrane domains as well as the presence of the NRY motif in the second intracellular loop. These results attest that the isolated nucleic acid sequence codes for a new receptor coupled to G proteins of the melatoninergic type.
Exemple 2-Vecteur recombinant et lignées cellulaires exprimant de façon stable la séquence codant un récepteur MT 1 selon l'invention
L'ADNc tel qu'isolé dans l'Exemple 1 a été cloné dans le vecteur d'expression pcDNA3-Cflag (pcDNA3, Invitrogen). Ce vecteur, nommé pSrMT 1, comprend une origine Example 2-Recombinant vector and cell lines stably expressing the sequence encoding an MT 1 receptor according to the invention
The cDNA as isolated in Example 1 was cloned into the expression vector pcDNA3-Cflag (pcDNA3, Invitrogen). This vector, named pSrMT 1, includes an origin
<Desc/Clms Page number 15><Desc / CRUD Page number 15>
de réplication bactérienne permettant de multiplier le plasmide recombinant pcDNA3- SrMT 1-C flag obtenu en grand nombre de copies. Le vecteur comprend en outre un gène de résistance à l'ampicilline pour la sélection des clones bactériens, un gène de résistance à la généticine (G418) permettant la sélection de clones de cellules eucaryotes ayant incorporés l'ADNc SAMT, codant pour le récepteur MT 1 de rat. Enfin, les séquences clonées dans le vecteur sont sous le contrôle du promoteur du CMV qui permet une expression forte du gène cloné dans la cellule hôte eucaryote. of bacterial replication making it possible to multiply the recombinant plasmid pcDNA3-SrMT 1-C flag obtained in large number of copies. The vector further comprises an ampicillin resistance gene for the selection of bacterial clones, a geneticin resistance gene (G418) allowing the selection of clones of eukaryotic cells having incorporated the SAMT cDNA, coding for the MT receptor 1 rat. Finally, the sequences cloned in the vector are under the control of the CMV promoter which allows a strong expression of the cloned gene in the eukaryotic host cell.
Le plasmide recombinant décrit ci-dessus est introduit dans les cellules CHO-K1 (American type culture collection, CCL61) maintenues dans un milieu Ham-F12 avec 10% de sérum de veau foetal, 2mM de glutamine, 500 lU/ml de pénicilline et 500 g/ml de streptomycine en utilisant la méthode de transfection à la lipofectamine comme décrit par le fournisseur (Life Technologies, France). Les clones exprimant ledit récepteur sont sélectionnés avec 500 u-g/ml de G418 et testés pour l'expression du récepteur, par une technique d'immunofluorescence, en utilisant un anticorps IgG reconnaissant le peptide DYKDDDDK. Ces expériences permettent de confirmer l'expression du récepteur dans la cellule CHO-K1. The recombinant plasmid described above is introduced into CHO-K1 cells (American culture collection type, CCL61) maintained in Ham-F12 medium with 10% fetal calf serum, 2 mM glutamine, 500 lU / ml of penicillin and 500 g / ml streptomycin using the lipofectamine transfection method as described by the supplier (Life Technologies, France). The clones expressing said receptor are selected with 500 μg / ml of G418 and tested for the expression of the receptor, by an immunofluorescence technique, using an IgG antibody recognizing the peptide DYKDDDDK. These experiments make it possible to confirm the expression of the receptor in the CHO-K1 cell.
Exemple 3-Etude de liaison avec des radioli2ands Les expériences de liaison au récepteur sont réalisées en utilisant la 2-[1251]-iodomélatonine comme radioligand de référence (Pharmacol. Exp. Therap., 1999, 290, pp. 334-340). Example 3-Study of binding with radioli2ands The experiments of binding to the receptor are carried out using 2- [1251] -iodomelatonin as reference radioligand (Pharmacol. Exp. Therap., 1999, 290, pp. 334-340).
Une préparation membranaire de cellules transfectées (40 J, g/ml) diluée dans un tampon de liaison (50 mM Tris-HCl, pH 7,4 contenant 5 mM MgClz) est additionnée à la 2- [I]- iodomélatonine (0,025 nM) et au composé à tester. La liaison non spécifique est déterminée en présence de mélatonine 1 J. M. Après 60 minutes d'incubation à 37 C, la réaction est stoppée par filtration rapide à travers un filtre GF/B préimprégné avec une solution à 0, 5% (v/v) de polyethylèneimine. Les filtres sont lavés trois fois avec 1 ml de tampon Tris-HCl 50 mM, pH 7,4 froid. A membrane preparation of transfected cells (40 J, g / ml) diluted in a binding buffer (50 mM Tris-HCl, pH 7.4 containing 5 mM MgClz) is added to the 2- [I] - iodomelatonin (0.025 nM ) and the compound to be tested. The non-specific binding is determined in the presence of melatonin 1 JM After 60 minutes of incubation at 37 ° C., the reaction is stopped by rapid filtration through a GF / B filter prepreg with a 0.5% (v / v) solution. of polyethyleneimine. The filters are washed three times with 1 ml of 50 mM Tris-HCl buffer, cold pH 7.4.
La radioactivité retenue est déterminée à l'aide d'un compteur à scintillation liquide. The radioactivity retained is determined using a liquid scintillation counter.
Les résultats permettent de déterminer les affinités de liaison des composés testés (IC5o). The results make it possible to determine the binding affinities of the compounds tested (IC 50).
<Desc/Clms Page number 16> <Desc / Clms Page number 16>
Exemple 4-Procédé de criblage pour l'identification de molécule agoniste du récepteur MT 1 de rat Mesure du calcium intracellulaire au FLIPR Les cellules CHO-K1 exprimant le produit du gène codé par la séquence de la figure 1 et la sous-unité a de la protéine G16 sont dissociées la veille de l'expérience et ensemencées (45000 cellules/puits) sous un volume de 100 jl/puits dans des plaques de culture 96 puits (costar) noires à fond clair.
Le jour de l'expérience, 100p. l de kit calcium (Molecular Devices), 2, 5mM final de probénécide et 10 mM final de tampon Hépès sont ajoutés dans chaque puits et les cellules sont incubées pendant 1 heure à 37 C. Les plaques de cellules sont ensuite placées dans un fluorimètre de type FLIPR (Fluorometric Imaging Plate Reader). L'expérience est réalisée à température ambiante. Le temps d'exposition (0,4 sec) et l'intensité du laser (15 à 18 ampères) sont ajustés afin d'obtenir des valeurs basales de fluorescence entre 5000 et 10000 unités. La mesure de la fluorescence est effectuée sur toute la plaque toutes les secondes pendant les 60 premières secondes puis toutes les 6 secondes pendant 1 minute. On the day of the experiment, 100p. 1 of calcium kit (Molecular Devices), 2.5 mM final of probenecid and 10 mM final of Hepes buffer are added to each well and the cells are incubated for 1 hour at 37 C. The cell plates are then placed in a fluorimeter of FLIPR (Fluorometric Imaging Plate Reader) type. The experiment is carried out at room temperature. The exposure time (0.4 sec) and the intensity of the laser (15 to 18 amps) are adjusted in order to obtain basal fluorescence values between 5,000 and 10,000 units. The fluorescence measurement is carried out on the whole plate every second for the first 60 seconds and then every 6 seconds for 1 minute.
Des ligands de différentes catégories, préalablement solubilisés et répartis à une concentration définie sur des plaques 96 puits, sont mis en contact avec les cellules. L'addition des produits à tester s'effectue en cours d'expérience à 10 secondes grâce à un dispositif de distribution comprenant 96 cônes noirs (50 dz d'une solution [x5] sont ajoutés dans chaque puits à la vitesse de 70 J. l/sec et une hauteur de 200 1). La réponse calcique se caractérise par une augmentation transitoire de la fluorescence immédiatement après l'addition des ligands actifs. Des solutions d'ATP 10 M et de tampon HBSS sont incluses dans chaque plaque de ligands et servent respectivement de contrôle positif et négatif de la réponse calcique.Ligands of different categories, previously dissolved and distributed at a defined concentration on 96-well plates, are brought into contact with the cells. The addition of the products to be tested is carried out during the experiment at 10 seconds using a distribution device comprising 96 black cones (50 dz of a solution [x5] are added to each well at the speed of 70 J. l / sec and a height of 200 1). The calcium response is characterized by a transient increase in fluorescence immediately after the addition of the active ligands. Solutions of 10 M ATP and HBSS buffer are included in each ligand plate and serve respectively for positive and negative control of the calcium response.
Claims (48)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR0201559A FR2835847B1 (en) | 2002-02-08 | 2002-02-08 | NUCLEIC ACID SEQUENCE ENCODING A NOVEL MELATONIN RECEPTOR AND USES |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR0201559A FR2835847B1 (en) | 2002-02-08 | 2002-02-08 | NUCLEIC ACID SEQUENCE ENCODING A NOVEL MELATONIN RECEPTOR AND USES |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| FR2835847A1 true FR2835847A1 (en) | 2003-08-15 |
| FR2835847B1 FR2835847B1 (en) | 2004-12-03 |
Family
ID=27620022
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| FR0201559A Expired - Fee Related FR2835847B1 (en) | 2002-02-08 | 2002-02-08 | NUCLEIC ACID SEQUENCE ENCODING A NOVEL MELATONIN RECEPTOR AND USES |
Country Status (1)
| Country | Link |
|---|---|
| FR (1) | FR2835847B1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995035320A1 (en) * | 1994-06-17 | 1995-12-28 | The General Hospital Corporation | High-affinity melatonin receptors and uses thereof |
| WO1997004094A1 (en) * | 1995-07-24 | 1997-02-06 | Adir Et Cie | Nucleic sequences coding for melatonin receptors, and uses thereof |
-
2002
- 2002-02-08 FR FR0201559A patent/FR2835847B1/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995035320A1 (en) * | 1994-06-17 | 1995-12-28 | The General Hospital Corporation | High-affinity melatonin receptors and uses thereof |
| WO1997004094A1 (en) * | 1995-07-24 | 1997-02-06 | Adir Et Cie | Nucleic sequences coding for melatonin receptors, and uses thereof |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE EMBL [online] 5 October 2000 (2000-10-05), POREL,V.J. ET AL.: "Rattus norvegicus receptor (MT1) mRNA, partial cds.", XP002215247, Database accession no. AF130341 * |
| VANECEK JIRI: "Melatonin inhibits increase of intracellular calcium and cyclic AMP in neonatal rat pituitary via independent pathways.", MOLECULAR AND CELLULAR ENDOCRINOLOGY, vol. 107, no. 2, 1995, pages 149 - 153, XP002215246, ISSN: 0303-7207 * |
Also Published As
| Publication number | Publication date |
|---|---|
| FR2835847B1 (en) | 2004-12-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3628691B2 (en) | Human neuronal nicotinic acetylcholine receptor compositions and methods for their use | |
| JPWO2002103006A1 (en) | Guanosine triphosphate binding protein-coupled receptor | |
| JPH09502980A (en) | NF-AT polypeptides and polynucleotides | |
| US6890731B1 (en) | Isolated human G-protein coupled receptors that are members of the aminergic subfamily, nucleic acid molecules encoding human GPCR proteins, and uses thereof | |
| CA2428827A1 (en) | Human vanilloid receptor gene | |
| EP1117796A2 (en) | Calcium channel alpha-2/delta gene | |
| CA2404229A1 (en) | Human transporters and ion channels | |
| FR2835847A1 (en) | New rat melatonin receptor MT1 nucleic acid, polypeptide, and antibodies, useful e.g. for drug screening and for detecting MT1 expression | |
| EP1693456B1 (en) | Method of identifying modulators of a g protein-coupled receptor | |
| WO2001004299A1 (en) | AMYLOID β PROTEIN AGGLUTINATION CONTROLLING FACTOR | |
| JP2002522058A (en) | Canine growth hormone secretagogue receptor | |
| US6689585B1 (en) | GABA-B2 receptor | |
| US6576742B1 (en) | DNA sequence encoding a human imidazoline receptor and method for cloning the same | |
| US20030113789A1 (en) | Isolated human G-protein coupled receptors, nucleic acid molecules encoding human GPCR proteins, and uses thereof | |
| FR2746813A1 (en) | SEQUENCES ENCODING BETA2- AND BETA3- ADRENERGIC CANINE RECEPTORS AND THEIR APPLICATIONS AS PROBES AND FOR THE EXPRESSION OF PEPTIDES | |
| FR2822844A1 (en) | New nucleic acid encoding human G protein coupled receptors, useful for treating e.g. obesity, also derived polypeptides, antibodies and modulators | |
| FR2823762A1 (en) | New nucleic acid encoding G protein-coupled receptor, useful for identifying specific modulators, potentially useful for treating e.g. diabetes | |
| US6670150B1 (en) | Isolated human receptor proteins, nucleic acid molecules encoding human receptor proteins, and uses thereof | |
| US6682908B1 (en) | Mouse growth hormone secretagogue receptor | |
| WO1999061606A1 (en) | MAMMALIAN gb2 GABAB RECEPTORS | |
| FR2827612A1 (en) | New nucleic acid encoding G protein coupled receptor, useful for identifying modulators, potentially useful for treating e.g. diabetes or Parkinson's disease | |
| FR2827611A1 (en) | New nucleic acid encoding a G protein coupled receptor, useful for identifying modulators, potentially useful for treating e.g. diabetes or Parkinson's disease | |
| CA2437571A1 (en) | Receptors and membrane-associated proteins | |
| USRE42190E1 (en) | Method of identifying a compound for inhibiting or stimulating human G protein-coupled receptors | |
| JP2004049043A (en) | Method for isolating gpcr gene and new gpcr gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PLFP | Fee payment |
Year of fee payment: 15 |
|
| PLFP | Fee payment |
Year of fee payment: 16 |
|
| PLFP | Fee payment |
Year of fee payment: 17 |
|
| PLFP | Fee payment |
Year of fee payment: 18 |
|
| ST | Notification of lapse |
Effective date: 20201005 |