FR2777293A1 - ELECTRO-SEPARATION PROCESS OF A BIOLOGICAL SAMPLE AND IMPLEMENTATION DEVICE - Google Patents

Abstract

The invention concerns a method for treating by the action of an electric field in liquid medium a biological sample comprising both a nucleic material and a non-nucleic material, which consists in: a) providing a buffer solution; b) providing a permeable membrane, in contact on one side with the buffer solution, and having a predetermined interrupting threshold to stop the nucleic material, on said buffer solution side, when it is migrating under the action of the electric field; c) generating said electric field; d) placing the biological sample in the buffer solution, upstream of the membrane, along the nucleic material circulating direction by the electric field action. The invention is characterised in that it consists in: directly applying the electric field to the biological sample in the buffer solution, for a limited time interval determined by sufficient time for the nucleic material to arrive on the membrane and by its presence on the buffer solution side, and by the fact that at said time interval end the non-nucleic material has not migrated and/or is still in the process of migrating towards said membrane; removing the nucleic material after said time interval, and thereby electroeluting from the biological sample at least the nucleic material. The invention also concerns the implementing device.

Description

The present invention relates to a method of electro-separation of a

  nucleic fraction from a cell lysate, as well as any device, in particular for single use, for the implementation of said

electro-separation process.

  Various methods, but also devices, have been proposed or described to date, for the purpose of separating a nucleic material or a

  nucleic fraction, from a cell lysate.

  By "separation" is meant generically any process making it possible to enrich or concentrate a medium, to isolate or to determine (qualitatively and / or quantitatively) in a complex medium, at least one nucleic material, ie acid

  deoxyribonucleic (DNA) and / or ribonucleic acid (RNA).

  According to the document of the ISCO Company, called ISCO Applications (Bulletin 54, "Electroelution of Nucleic Acids and Proteins from Gels, and Electrophoretic Concentration of Macromolecules

  1989), an electro-elution device is described, not an electro-

  separation comprising: - a first reservoir for a first buffer solution, comprising two opposite compartments, each closed by a permeable membrane, one of large section, the other of small section, and each having a cut-off threshold making it possible to retain the nucleic or protein material of interest, - a second reservoir for a second buffer solution, identical or different from the first buffer solution, separated from the first reservoir by said membranes, - two electrodes in electrical contact with the second buffer solution, generating a electric field crossing the two permeable membranes, from that of large section to that of section

  weak, and therefore crossing the first buffer solution.

  This device is used to concentrate a nucleic or protein fraction, already relatively pure but diluted, by placing this fraction on the membrane of large section, and by collecting on the membrane of small section the same fraction, but concentrated. The concentration is obtained due to the transport of biomolecules by the field lines

  electric, which are concentrated at the level of the membrane of small section.

  It is therefore neither a process, nor a separation device, within the meaning of the preceding definition, that is to say in the sense that from a complex medium, a biological material is separated or isolated d 'interest. On the other hand, for the purpose of separating a nucleic material, there is known the patent application published under the number WO 97/41219, which discloses a method for capturing nucleic acids from a mixture consisting for example of lysed cells. The process requires depositing an electrode in the mixture, applying a voltage to the electrode to attract the nucleic acids, then removing the electrode covered by the nucleic acids. The electrode covered with nucleic acids is then immersed in a solution allowing, by reversing the current, to release the nucleic acids which are then directly amplifiable. The voltage applied to be able to carry out an amplification is preferably from 0.5 to 3 volts for approximately 30 seconds. This process, although useful for separating plasmids contained in heat-lysed E. coli cells, is not suitable for separating DNA and / or RNA from a more complex cell lysate,

  especially from a biological sample.

  At the end of this inventory, no method appears to make it possible to separate in a simple and efficient manner, a nucleic material from a non-nucleic material, in particular protein material, from a complex cell lysate. The present invention proposes to provide a solution to this unsolved problem. To do this, a first object according to the invention is a method of electro-separation of a biological sample containing both a nucleic material and a non-nucleic material, for example protein, according to which: (a) we have available a buffer solution, (b) there is a permeable membrane in contact on one side with the buffer solution, and having a predetermined cut-off threshold making it possible to stop the nucleic material at least, on the side of said buffer solution, (c) an electric field is established, the lines of force of which pass within said buffer solution, and pass through the permeable membrane, (d) the biological sample is placed in the buffer solution, upstream of the membrane, according to the direction of circulation of the nucleic material generated by the electric field, the process having as characteristic: - to apply the electric field for a defined duration, on the one hand, by the presence of the nucleic material at the level of the m on the other hand, by the fact that the non-nucleic material has not migrated and / or is in the process of migration,

  - to collect the nucleic material.

  The invention also relates to a process for the electro-separation of a biological sample containing cells containing nucleic material, according to which: (a) a buffer solution is available, (b) a membrane permeable in contact on one side with the buffer solution, and having a predetermined cut-off threshold making it possible to stop the nucleic material at least, on the side of said buffer solution, (c) an electric field is established, the lines of force of which pass through within the buffer solution, and pass through the permeable membrane, (d) the biological sample is placed in the buffer solution, upstream of the membrane, according to the direction of circulation of the nucleic material generated by the electric field, characterized in that 'it consists of - applying a first electric field to lyse the cells, - applying a second electric field for a defined period, on the one hand, by the presence of nucleic material at the level of membrane, and secondly, by the fact that the non-nucleic material has not migrated and / or is in the process of migration,

  - to collect the nucleic material.

  By “electro-separation” in the present invention, it is meant that molecules present together in a medium, and being able to present identical electrical charges, are distinguished from each other in said medium because of their respectively different kinetics in the same field. electric. The method according to the invention provides the essential advantage of quickly and easily obtaining a nucleic fraction free of other constituents, in particular proteins, directly amplifiable, from a cell lysate. We know the difficulties associated with amplification techniques, especially for respiratory type samples, in that the fraction to be amplified must be free of inhibitors. By implementing the method according to the invention, the protein inhibitors of

  amplification techniques are virtually eliminated.

  The fraction enriched in nucleic material, comprising DNA and / or RNA, which is obtained by the implementation of the method according to the invention, is directly amplifiable by the techniques commonly used, such as in particular the PCR technique for DNA and

NASBA technique for NRAs.

  In another embodiment according to the invention, the biological sample is placed on another membrane, on the side of

  the latter in contact with the buffer solution.

  In a preferred embodiment according to the invention, the time of application of the electric field is at most 30 minutes, and

  preferably between 5 and 30 minutes.

  In a very preferred embodiment according to the invention, the duration of migration of the nucleic fraction is from 10 to 20 minutes, from

preferably another 15 minutes.

  In a preferred embodiment according to the invention, the value of the molarity of the buffer solution is at least equal to 0.1 mol / I, and

  preferably between 0.1 and 5 mol / I.

  The molarity of the buffer solution being between 0.1 and 5 mol / l, it is actually possible either to put only one buffer solution in the two compartments, or to put two buffer solutions

  different in the two compartments.

  The molarity of the buffer solution can be the same in the two compartments and will be between 0.1 and 1 mol / li, preferably

another 0.1 mol / l.

  The molarity of the buffer solution can be different in the two compartments and will preferably be 0.1 mol / I respectively

  in the first compartment and 1 mol / I in the second compartment.

  In a preferred embodiment according to the invention, the electric field has a value between 100 and 250 V, and preferably equal to 150 V. In another very preferred embodiment according to the invention, the distance between the sample biological permeable membrane, following the lines of force of the electric field, is at least equal to 30

  mm, and preferably 75 mm.

  The cell lysate from which the process according to the invention is carried out can be a cell lysate originating from a simple or complex culture, that is to say comprising different cells, or can also be a biological sample, such as in particular blood , of

  urine and a respiratory type sputum.

  The cell lysate from which the nucleic fraction is obtained, then subjected to the method according to the invention, can be obtained by various lysis techniques, in particular lysis by mechanical shock,

by electric shock and others.

  In a preferred embodiment according to the invention, the biological sample results directly from the lysis of a cell sample, in particular by mechanical or electrical means. This embodiment is carried out in the same device, as is

  claimed in claim 2.

  In another preferred embodiment according to the invention, the cell lysate is obtained from a sample of a body fluid,

  for example blood or respiratory sputum.

  When the biological sample is blood, it is preferred that the

pH of the buffer solution is 7.

  The membrane recovering the fraction enriched in nucleic material has a predetermined cutoff threshold, preferably

less than 100 kDa.

  When the biological sample is blood, the porosity of the

  membrane at the cathode will preferably be greater than 10 kDa.

  In a preferred embodiment according to the invention,

  a proteinase to the biological sample.

  In yet another preferred embodiment according to the invention, the fraction enriched in nucleic material is directly

  subject to a subsequent amplification step.

  The cell lysis will preferably still be carried out by lysis

  electric in the presence of proteinase K and a detergent.

  A second object according to the invention is a single-use device for implementing a method according to the invention, comprising a support or base, in which the various means are assembled and integrated, as well as arranged between them , in particular electrodes, required for electro-separation, as well as means for interfacing said support with the outside, on the one hand for the transfer of the various fluids or liquids to and / or out of the support, including the biological sample, the buffer solution, and the fraction enriched in nucleic material, and on the other hand for the supply and control of the electrical means required for

  less for electro-separation, including that of the electric field.

  In a preferred embodiment according to the invention, the device comprises means for receiving the biological sample; a reservoir for the buffer solution, comprising a compartment closed by the permeable membrane, communicating at an end opposite to said compartment with the means for receiving the biological sample, said reservoir being intended to receive a first buffer solution; and a second reservoir for a second buffer solution, identical or different from the first buffer solution, separated from the first reservoir only by said membrane; two electrodes for generating the electric field, one in contact with the first buffer solution, upstream of the membrane in the direction of flow of the nucleic material, and the other in contact with the second buffer solution; and a means of extracting the fraction enriched in nucleic material from the compartment closed by the membrane. In a very preferred embodiment according to the invention, the reservoir comprises another compartment, for the reception of at least a fraction obtained from the biological sample, disposed upstream of said compartment according to the direction of circulation of the nucleic material. , communicating with the means for receiving the biological sample. In another preferred embodiment according to the invention, the two tanks communicate respectively with ventilation vents,

  and with at least one filling channel.

  In yet another preferred embodiment according to the invention, an intermediate well is arranged and communicates between the

  means for receiving the biological sample and the first reservoir.

  In yet another preferred embodiment according to the invention, the intermediate well is provided with means making it possible to

lyse a cell sample.

  In yet another preferred embodiment according to the invention, the intermediate well is provided with electrodes ensuring lysis

of said cell sample.

  In yet another preferred embodiment according to the invention, the device comprises, communicating with each other, a compartment for receiving the lysate, an intermediate lysis well, and

  a compartment for receiving the fraction enriched in nucleic material.

  In yet another preferred embodiment according to the invention, the volume of the lysate receiving compartment is greater than the volume of the receiving compartment of the fraction enriched in material

nucleic acid.

  In yet another preferred embodiment according to the invention, the proportion between the volumes of the compartments for receiving the lysate and for receiving the nucleic fraction is included

  between 1/2 and 1/50, especially between 1/5 and 1/20.

  A third object according to the invention is the use of the device described above for electro-separating a fraction of nucleic acids to

from a cell lysate.

  A fourth object according to the invention is the use of the electro-separated fraction by the implementation of the method according to the invention for detecting and / or identifying nucleic acids directly after amplification. Figure 1 shows schematically an electroelution apparatus for nucleic acids and proteins from gel, and electrophoretic concentration of macromolecules (Isco, Nebraska, USA) which is used in a different process, namely electro - separation according to the invention. Compartments A and B, in which two negative and positive electrodes are immersed respectively, are filled with TBE lx buffer; compartment C, comprising a part C1 and a part C2, and compartment Cf are filled with TBE 0.1x buffer. A dialysis membrane is placed at the interface of compartments Cf and B

  (porosity 100 kDa), and Cl and A (porosity 10 kDa).

  Figure 2 indicates the percentage of nucleic acids of S. epidermidis recovered in compartment Cf, after migration from a cell lysate obtained by mechanical shock, determined by analysis with a Vidas device (BioMerieux, France), according to example 2. On the abscissa is represented the migration time (minutes), and on the ordinate is represented the percentage of nucleic acids recovered in the

  compartment Cf, expressed in relative fluorescence unit.

  Figure 3 shows the kinetics of protein recovery from a cell lysate. The percentage of proteins of the bacterial lysate is recovered in compartment Cf after migration from a cell lysate obtained by mechanical shock, determined by Bradford assay, according to example 2. On the abscissa is represented the migration time (minutes), and on the ordinate is shown the percentage of nucleic acids recovered in the compartment Cf, expressed in optical density

(DO) at 595 nm.

  Figure 4 shows the kinetics of nucleic acid recovery from cell lysate. The percentage of nucleic acids of Staphycoccus epidermidis is recovered in compartment Cf after migration from a cell lysate obtained by electric shock, determined by analysis with a Vidas device, according to example 2. On the abscissa is represented the time from migration (minutes), and on the ordinate is represented the percentage of nucleic acids recovered in the

  compartment Cf, expressed in relative fluorescence unit.

  Figure 5 shows the amplification of purified nucleic acids from a cell lysate. The amount of amplicons produced by PCR from 10 μl of DNA molecules is recovered in compartment Cf from a cell lysate obtained by mechanical shock, after different migration times, according to example 2. On the abscissa is represented the migration time (minutes), and on the ordinate is represented the percentage of nucleic acids recovered in the

  compartment Cf, expressed in relative fluorescence unit.

  Figure 6 shows the amount of amplicons produced by PCR after lysis of different initial concentrations of bacteria by mechanical shock, and migration of their nucleic material for 15 minutes under an electric field, according to Example 2. On the abscissa is shown the number of initial bacteria for 200 μl of lysate, and on the ordinate is represented the signal obtained after PCR, expressed in relative unit of fluorescence. FIG. 7 illustrates the amount of amplicons produced by TMA after lysis of different initial concentrations of bacteria by mechanical shock, and migration of their nucleic material for 15 minutes under an electric field, according to example 2. On the abscissa is shown the number of initial bacteria per 200 fold of lysate, and on the ordinate is

  represented the signal obtained after TMA, expressed in OD x 1000.

  Figure 8 shows the percentage of blood proteins recovered in compartment Cf as a function of the migration time of a

  clinical blood sample lysed by mechanical shock, according to Example 3.

  On the abscissa is represented the migration time (minutes), and on the ordinate is represented the percentage of proteins recovered in the

  compartment Cf, expressed as OD at 595 nm.

  Figure 9 indicates the percentage of proteins of a sputum recovered in compartment Cf as a function of the migration time of a clinical sample of respiratory type lysed by mechanical shock, according to example 2. On the abscissa is represented the migration time (minutes), and on the ordinate is represented the percentage of proteins recovered in the

  compartment Cf, expressed as OD at 595 nm.

  Figure 10 shows the elimination of PCR inhibitors initially present in the respiratory type clinical sample. It indicates the quantity of DNA amplicons produced by PCR from

  different initial amounts of S. epidermidis DNA, according to Example 5.

  On the abscissa is represented the number of copies of initial DNA for 10 #I of sample, and on the ordinate is represented the signal obtained after PCR,

  expressed in relative fluorescence unit.

  Figure 11 indicates the quantity of amplicons produced from different initial quantities of lysed bacteria and deposited in compartment Cl. Each point represented on the graph represents an average value obtained from 13 different sputum and bronchial aspirations, according to Example 5. On the abscissa is represented the number of copies of initial DNA for 200 μl of sample, and on the ordinate is represented the signal obtained after PCR, expressed in relative unit of fluorescence. Figure 12 shows the amount of amplicons produced from different initial amounts of bacteria lysed by mechanical shock and deposited in compartment Cl, according to Example 5. The study was carried out in parallel on 4 different sputum. On the abscissa is represented the number of copies of initial DNA for 200 μl of sample, and on the ordinate is represented the signal obtained after TMA, expressed in OD x 1000. FIG. 13 represents a disposable device according to

the invention, seen in perspective.

  Figure 14 shows a bottom view of the device

shown in Figure 13.

  Figure 15 shows a top view of the

  device shown in Figure 13.

  FIG. 16 represents a sectional view, according to the

  cutting line shown in FIG. 15, of the device according to FIG. 13.

  Example 1: General procedure for implementing the

method according to the invention.

  The operating mode is based on the use of a nucleic acid electroelution apparatus according to FIG. 1. A volume of biological sample is carefully deposited at the bottom of the compartment Cl. The two electrodes of the circuit are connected to a generator. A constant voltage of 150 V is applied across the generator. The intensity of the circuit varies from 15 to 20 mA and the temperature of the buffer in compartment C varies from 23 to 30 C. The biological molecules initially deposited at the bottom of compartment Cl migrate in the electric field thus created, at a speed defined as a function of their charge and their size. After different migration times, the voltage across the generator is stopped and the molecules that have migrated to the cathode and of apparent molecular weight less than or equal to 10 kDa are

  collected in compartment Cf in a final volume of 200 pI.

  The sample thus recovered is kept in ice before analysis.

  The biological sample deposited in compartment C1 can be a nucleic and / or protein material, purified or not, a cell lysate, coming from a biological sample such as blood, urine and a respiratory type sputum. The cell lysates studied were obtained from S. epidermidis, Gram + walled bacteria (A054). These bacteria are grown in BCC liquid medium (Brain Heart Broth, bioMerieux 41019). Before lysis, they are suspended, either in a clinical sample (liquefied and decontaminated sputum, blood, plasma, serum, etc.) or in lysis buffer (30 mM Tris-HCI, 5 mM EDTA, 100 mM NaCI pH 7.2). 300 μl of this cell suspension were lysed by essentially following two protocols: - Lysis protocol by mechanical shock: 90 μl of glass beads with a diameter between 90 and 150 μm, 3 iron balls with a diameter of 2 mm and 5 beads 3 mm diameter glass are placed in a Falcon tube in the presence of 300/1 of the cell suspension, as described

  in the patent (FR n 9712164). 6 mg / ml final proteinase K (PK) (E.C.

  3.4.21.14 Boehringer-Mannheim, ref. 1092766) can be added to the cell suspension. The closed tube is vortexed for two minutes, at maximum power of the device (Reax 2000, Heidolph). The bacterial suspension thus treated and recovered is immediately deposited in compartment C1 of the device described in Figure 1. If the PK is present in the cell solution, an additional incubation of 15

minutes at 37 C is achieved.

  - Lysis protocol by electric shock: 300 pI of the cell suspension are deposited in an electroporation tank characterized by a distance between the two electrodes of 2 mm, in the presence of 0.01 to 6 mg / ml final of PK. The tank is placed in an electrical circuit, the parameters of which are chosen as follows: voltage 500 V, resistance 186 Ohms, capacity of 500 or 1500 pjFD. After launching an electric pulse, the electric discharge takes place in a few milliseconds between the two electrodes. The lysate thus recovered is immediately deposited in compartment A of the device described

in Figure 1 (FR n 9706835).

  The percentage of nucleic acids collected at the cathode after migration is determined by measuring the OD (optical density) of the sample recovered at 260 nm. The percentage collected is equal to the ratio of the OD value at 260 nm after migration, over the OD value at 260 nm before migration. Likewise, the amount of protein collected at the cathode after migration is determined by Bradford assay and OD reading at 595 nm. The percentage of proteins collected is equal to

  ratio of the quantity of protein recovered to the initial quantity.

  The quantity of nucleic acids recovered at the cathode after migration is checked on 0.8% agarose gel; 10 μl of the sample are deposited per well, the electrophoretic migration is carried out at constant voltage (150 V) and the gel is stained with ethidium bromide (BET) before observation under ultraviolet radiation. In parallel, the proteins recovered at the cathode after migration can be observed on polyacrylamide gel in the presence of SDS (SDS-PAGE 10%); 5 to 10 μl of the sample are deposited per well, the electrophoretic migration is carried out at constant intensity (25 mA), and the gel is stained with blue

Coomassie.

  The quantity of nucleic acids recovered at the cathode is determined by specific detection according to a so-called sandwich hybridization technique using the Vidas device marketed by bioMérieux (France). Oligonucleotide probes for capture and specific detection of nucleic acids of S. epidermidis (EP 0632269) were chosen. The capture and detection oligonucleotides have respectively the sequence: 5'-GACCACCTGTCACTCTGTCCC-3 '(SEQ ID N: 1) and 5'GGAAGGGGAAAACTCTATCTC-3' (SEQ ID N: 2). The detection probe is labeled by coupling with alkaline phosphatase5 (AKP). The specific hybridization of these probes with the nucleic acids released in the lysate is a function of the quantity of nucleic acids

  present, but also their accessibility for the probes used.

  Two specific amplification protocols for DNA and RNA molecules of S. epidermidis were carried out from samples collected after migration: a POR protocol for DNA amplification

  and a NASBA protocol for the amplification of 6S rRNA.

  - PCR protocol: the POR technique followed is that described by Goodman in PCR Strategies, Ed: Innis, Gelford and Sninsky Academic press 1995, pp 17-31. Two amplification primers were used, they have the following sequences: Primer 1: 5'-ATCTTGACATCCTCTGACC-3 'SEQ ID N: 3 Primer 2: 5'-TCGACGGCTAGCTCCAAAT-3' SEQ ID N: 4 The following temperature cycles were used 1 time 3 minutes at 94 C 2 minutes at 65 C times 1 minute at 72 C 1 minute at 94 C 2 minutes at 65 C 1 time 5 minutes at 72 C - TMA protocol: the TMA technique followed is that described by Pasternack et al., Journal of Clinical Microbiol. 1997, 35: 676. Two amplification primers were used, they have the following sequences: Primer 1: 5'-TCGAAGCAACGCGAAGAACCTTACCA-3 'Primer 2: 5'-AATTCTAATACGACTCACTATAGGGAGGTT

TGTCACCGGCAGTCAACTTAGA -3 '

  pl or 50 I1 of collected sample are used for each PCR and TMA test, respectively. The amplicons produced by PCR are observed on 0.8% agarose gel and quantified on Vidas according to the protocol35 described above. The amplicons produced by TMA are detected and quantities on a microplate by hybridization with a capture probe and a detection probe specific for S. epidermidis, according to the method described by P. Cros et a /., Lancet 1992, 240: 870. The detection probe is coupled to "Horse Radish Peroxidase" (HRP). The two probes have the following sequences: Capture probe: 5'- GATAGAGTTTTCCCCTTC-3 '(SEQ ID N: 7) Detection probe: 5'- GACATCCTCTGACCCCTCTA -3' (SEQ

ID N: 8)

  Example 2: Kinetics of recovery of nucleic acids from

from cell lysate.

  A suspension of Staphylococcus epidermidis (1-5.109 b./300p1l) is lysed by mechanical shock or by electric shock as described in the general protocol above. 200 μl of each lysate are deposited at the bottom of compartment C1. The electric field is applied for different times between the two electrodes. The amounts of nucleic acids or proteins present in the sample collected in compartment Cf are determined by analysis with a Vidas apparatus or Bradford assay, respectively. The quality of the molecules recovered has

  was assessed on agarose or acrylamide gel in the presence of SDS.

  -Lvsat cell obtained by mechanical shock: The nucleic acids of the lysate migrated into the compartment Cf gradually over time, as shown in FIG. 2. After 60 minutes, all of the nucleic material of the lysate is recovered, whatever the presence or not proteinase K during the lysis step. This result is in favor of good release and accessibility of nucleic acids in the lysate. The DNA molecules recovered have the same migration profile on 0.8% agarose gel as before migration into the lysate. In the presence of proteinase K during the lysis step, as shown in FIG. 3, only a negligible percentage of proteins is recovered after 60 minutes, while in the absence of protease, approximately 50% of

proteins are recovered.

  - Cell lysate obtained by electric shock.

  In the presence of PK during the lysis step, as shown in Figure 4, the nucleic acids of the lysate gradually migrate to the cathode. After 60 minutes, a large percentage of nucleic acids is recovered. The recovery of the nucleic material initially present in this lysate is similar to that of the material initially present in a lysate obtained by mechanical shock (cf. above). On the other hand, in the absence of PK during the lysis step, no nucleic acid can be detected in the compartment Cf, even after 60 minutes of migration (Vidas analysis and 0.8% agarose gel). On agarose gel, the DNA and RNA molecules of the lysate recovered can be observed separately after migration,

  when they are not initially in the lysate.

  Amplification of the purified nucleic acids from cell lvsat The S. epidermidis bacteria diluted in 300 μl of lysis buffer are lysed by mechanical shock in the absence of PK, as described in the general protocol of Example 1. 200 μl of the lysate are deposited at the bottom of compartment Cl. An electric field is applied between the two electrodes for different times. The nucleic material which has migrated into the compartment Cf is amplified by PCR (10 μl per test) or TMA (50 μl per test). The amount of amplicons produced is analyzed by hybridization

  specific on Vidas or microplate, respectively.

  - PCR amplification of the DNA molecules recovered after migration: For 104 initial lysed bacteria deposited in compartment Cl, different quantities of amplicons are produced, depending on the migration time. For 15 minutes of migration, as shown in FIG. 5, the DNA molecules recovered allow optimal production of amplicons by PCR. Before 15 minutes, less DNA molecules are recovered. For 20 minutes and thereafter, a greater quantity of DNA molecules are recovered, but of quality less suitable for optimal PCR amplification. The longer the migration, the more the structure of the nucleic acid can be altered. In order to obtain an optimal PCR amplification, a compromise between quantity and quality of the DNA molecules recovered at the cathode must be respected. This result was confirmed using initial suspensions of S.

  more concentrated epidermidis (105-106 initial bacteria / 200p1).

  As shown in FIG. 6, the DNA of a number greater than or equal to 1.103 initial bacteria (/ 200p1) can be amplified and detected after mechanical lysis of the cells and migration of the constituents of the lysate under an electric field; or 102 DNA molecules or bacteria per PCR test, given that the migrated material is recovered in 200 pI and that 10 pI of this material is used for each PCR test. 102 DNA molecules

  corresponds to the sensitivity limit of the PCR protocol, in general.

  This result demonstrates a high sensitivity for the recovery of bacterial DNA molecules after cell lysis by mechanical shock and purification.

  intracellular DNA molecules by electric field in solution.

  - TMA amplification of the RNA molecules recovered after migration: As shown in FIG. 7, the RNA of at least 40 initial bacteria (/ 200 pI) can be detected after lysis of the bacteria, migration of the cellular constituents under electric field and specific amplification rR16S from S. epidermidis; or 10 initial bacteria per TMA test, taking into account that the migrated nucleic material is recovered in 200 μl final and that 50 μl are added by TMA test. This result demonstrates a high sensitivity for recovery of bacterial 16S rRNA molecules after lysis by mechanical shock and purification of

  nucleic acids of the lysate by electric field.

  EXAMPLE 3 Kinetics of Recovery of Nucleic Acids

from a blood sample.

  The blood sample is used without pre-treatment.

  pI of this clinical sample is deposited at the bottom of compartment C1.

  A voltage of 150 V is applied between the two electrodes for different times, then the material recovered at the positive electrode in the compartment Cf is analyzed by assaying proteins according to the Bradford method, and on polyacrylamide gel in the presence of SDS ( SDS-PAGE%). In this example, the pH of the TBE buffer used for migration was fixed at pH 7.0, the isoelectric point of the hemoglobin being equal to 7.0. 50 or 100 kDa membranes were placed at the interface of compartments Cf and B. As shown in FIG. 8, after minutes of migration, a negligible percentage of proteins is recovered with the 100 kDa membrane, and 10 % of the proteins are recovered with the 50 kDa membrane. At pH 7.0, only 10% of negatively charged blood proteins at pH 7.0 have an apparent molecular weight greater than 50 kDa and less than 100 kDa. A negligible percentage of proteins are recovered after 15 minutes of

  migration, using either a 50 or 100 kDa membrane.

  These conclusions were verified on polyacrylamide gel in the presence of 10% SDS-PAGE. The porosity of the membrane will preferably be greater than 10 kDa, so as not to obtain a too high percentage of proteins. EXAMPLE 4 Kinetics of Recovery of Nucleic Acids

  from a respiratory type sample.

  Before use, the respiratory sample is fluidized, decontaminated according to the standard protocol with N-acetyl-L-cysteine and

  soda (NALC / NaOH); then it is inactivated for 20 minutes at 95 C.

  In this example, the TBE buffer used for migration has a pH of 8.3 or 7.0, and membranes of different pore sizes have

  have been placed at the interface of compartments Cf and B: 10, 50 or 100 kDa.

  As shown in Figure 9, at pH 8.3, 10% of the proteins are recovered after 30 minutes, and 70-80% after 60 minutes with membranes of 50 or 10 kDa, which suggests that 70-80% of the proteins sputum are negatively charged at these pHs and have an apparent molecular weight greater than 50 kDa. At pH 7.0, approximately 0% of the proteins are recovered after 30 or 60 minutes of migration, whatever the size of the pores of the membrane used (within the sensitivity limit of the detection techniques used). At this pH, 55-60% of proteins

  previously recovered at pH 8.0 are no longer negatively charged.

  With 10 or 50 kDa membranes, a negligible percentage of sputum proteins is recovered after 15 minutes of migration. We have

  checked this point on polycrylamide gel in the presence of 10% SDS-PAGE.

  Example 5: Lifting of inhibition of amplification protocols by the respiratory type samples after migration The respiratory type samples are inhibitors of PCR and TMA reactions. 200 μl of these samples were deposited at the bottom of compartment C1 of the system described in FIG. 1. A constant voltage of 150 V was applied between the two electrodes for 15 minutes. A 10 kDa separation membrane between Cf and B was chosen. After migration, the sample recovered in compartment Cf (200 μl) was supplemented with different quantities of purified nucleic acids from S. epidermidis. 10 pI or 50 pI of this solution was used for each PCR or TMA test, respectively. As shown in Figure 10, up to 102-103 initial copies of DNA can be amplified in 10 µl of migrated sample. This result demonstrates that the migrated sputum has lost its PCR inhibitory character. Similar results have been obtained

with TMA amplification.

  1-5.109 S. epidermidis were seeded in 300 µl of fluidized sputum, decontaminated and inactivated as described in Example 4 above. These cells in suspension were lysed by mechanical shock in the absence of PK, and the lysate migrated for 15 minutes at 150 V with a 10 kDa membrane between compartments Cf and B, according to the diagram presented in Figure 1. The quantity of bacterial nucleic acids recovered in compartment Cf after migration was quantified by Vidas analysis specific to the bacterial species studied. The experiment was carried out from different sputum. On average, 80% of S. epidermidis nucleic acids are recovered. This result indicates that the sputum matrix molecules do not interfere with the migration of DNA and RNA molecules from the bacterial lysate into the electric field, under these conditions. On the contrary, it seems that the environment is

  conducive to better recovery and / or migration of these molecules.

  PCR amplification: The S. epidermidis bacteria were seeded in 300 μl of fluidized sputum, decontaminated, inactivated, then lysed by mechanical shock in the absence of PK as described in Example 1. 200 μl of the lysate migrated for 15 minutes under 150V with a 10 kDa membrane between compartments Cf and B. The nucleic material present in the sample was amplified by PCR (10 pI per test), and the amplicons produced were quantified by Vidas analysis. As shown in Figure 11, up to 104-103 initial lysed bacteria (/ 200pl lysate) can be detected after migration and amplification of DNA molecules (i.e. 100-10 DNA molecules / 10p1I PCR test) . This result, on the one hand confirms a very good recovery yield of the bacterial DNA molecules from the lysate in the sputum, and on the other hand demonstrates a very good elimination of the PCR inhibitors initially present in

sputum.

TMA amplification:

  As for the PCR amplification study described above

  before, the S. epidermidis bacteria were seeded in 300 μl of fluidized sputum, decontaminated, inactivated then lysed by mechanical shock in the absence of PK. 200 μl of the lysate migrated for 15 minutes at 150 V with a 10 kDa membrane between the compartments Cf and A. The rRNA molecules present in the recovered sample were amplified by TMA (50 μl per test), and the amplicons products were quantified by specific sandwich hybridization on microplate. As shown in Figure 12, at least 10o6-105 initial lysed bacteria (/ 200p1 of lysate) can be detected after migration and amplification of the molecules

  RNA (i.e. at least 5.104-5.103 initial bacteria / 50 pI TMA test).

  This result demonstrates the elimination of TMA inhibitors initially

present in sputum.

  Example 6: Electro-separation after lysis by electric shock.

  1-5.10e S. epidermidis were seeded in 300 pI of

  fluidized, decontaminated and inactivated sputum as described in Example 4.

  These cells in suspension were lysed by electric shock in the presence of 10-2 mg / ml final of PK and 2% final of LLS (Lithium Lauryl Sulfate, Sigma). 200 μl of lysate migrated for 15 minutes at 150 V with a 10 kDa membrane between compartments Cf and B, according to the diagram presented in FIG. 1. The nucleic material recovered after migration (200 μI) was amplified by specific PCR of S. epidermidis (10 pI / test), and the amplicons produced were quantified by Vidas analysis. Up to 104-105 lysed initial bacteria (/ ml) can be detected after migration and amplification of the DNA molecules (i.e. 100molecules of DNA / 10 pI PCR test, which represents the sensitivity limit of the PCR technique used). In accordance with FIGS. 13 to 16, there is described below a single-use device, that is to say consumable, disposable, after use, making it possible to implement the electro-separation process described and

exemplified previously.

  Such a device comprises a support 1, or base, generally having a parallelepiped shape, comprising in particular an upper face lb, a lower face lc and a lateral flank la, shown

in Figures 13 and 14.

  In general, in this support 1, the various means, including electrodes required for electro-separation, are assembled and integrated, as well as arranged between them, as well as interfacing means corresponding to the side la of the support 1 with the exterior, on the one hand for the transfer of the various fluids or liquids to and / or out of the support 1, including the treated biological sample, the aqueous liquid medium (buffers) and the fraction enriched in nucleic material, and on the other share for the supply and control of the electrical means required for

  less for electro-separation, including that of the electric field.

  Not shown, by way of example, the two faces 1a and 1b of the device, or cards, are coated with a transparent, waterproof film, adhering to the support, and closing the various conduits and cavities.

  shown on the surface in Figures 13 and 14.

  This device also comprises: - a means 2 for receiving the treated biological sample - a first reservoir 3 for a first aqueous liquid medium (TBE buffers diluted 10-fold), itself comprising a compartment 31 closed by a permeable membrane 4 , for example having a capacity of the order of 100 μl, as well as another compartment 32, having a capacity of 1 ml, for the reception of at least a fraction obtained from biological samples; this other compartment is arranged upstream of the compartment according to the direction of circulation of the nucleic material, under the effect of the electric field, and communicates itself with the means 2 for receiving the biological sample - a second reservoir 5 for a second aqueous liquid medium (for example TBE buffer, once concentrated), identical or different from the first aqueous liquid, separated from the first reservoir 3, only by the membrane 4 - two electrodes 61 and 62 to generate an electric field, communicating with two pads 63 and 64 of electrical contact on the side la; One of the electrodes, namely 61, or cathode, is in contact with the first aqueous liquid medium in the first tank 3, and the other electrode 62, or anode, is in contact with the second aqueous medium in the second tank 5 - a means 9 for extracting the fraction enriched in nucleic material from compartment 31 closed by the membrane 4 The two reservoirs 3 and 5 communicate respectively with aeration vents 33 and 53, and with at least one filling channel

  34 communicating as far as it is concerned with the second reservoir 5.

  An intermediate well 7 is arranged and communicates between the

  means 2 for receiving the biological sample and the first reservoir 3.

  This well is not compulsory, since the lysate can be deposited directly in compartment 32. This well 7 is provided with means making it possible to lyse a cell sample to obtain a fraction then subjected to electro-separation; these means are electrodes 81 and 82, making it possible to expose the sample to one or more electrical pulses, in accordance with the method described elsewhere in the application

  French patent 97 06835 dated 05/29/97 in the name of the Applicant.

  These electrodes 81 and 82 communicate respectively with electrical contact pads 83 and 84 provided on the side la. There are therefore two electrical circuits, one associated with electrodes 81 and 82, and the other associated

at electrodes 61 and 62.

  I - Preparation of the device Before starting any reaction, fill the tanks 3 and buffer. The latter can be constituted by a TBE buffer (Tris-Borate-EDTA) whose concentration varies from one reservoir to another. The first reservoir 3, upper, is filled by the receiving means 2, with buffer diluted ten times, and the second reservoir 5, lower, by the channel 34 with buffer once concentrated. The ventilation vents 33 and 53 are pierced at the level of the waterproof films covering the faces 1a and 1b, in order to allow the air to escape when the tanks are filled. 1) Lyse The sample is introduced into the receiving means 2 using a pipette, manually or by an automated device. The volume of the sample is between 0 and 1 ml. It then arrives in the intermediate lysis well 7. The lysis is carried out by means of an electric discharge of 500 V for approximately 1 second, between the electrodes 81 and 82. In the case where the sample volume is greater than 50 pI, several lysis steps are carried out one after the other , the lysed fractions being transferred progressively to the compartment

32 reception.

  2) Electro-separation Once the sample has been lysed and transferred in its entirety to the compartment 32 for starting the electro-separation, the first electrical circuit of the electrodes 81 and 82 is open, the second of the electrodes 61 and 62 is closed. The constituents of the negatively charged lysate will then migrate to the anode 62. The nucleic acids being strongly negative will migrate faster. We can therefore selectively recover them above the membrane 4, at the receiving compartment 31

via the sampling channel 9.

  The current imposed for this migration is between O and mA, at a voltage of 150 V. The optimal duration of migration is

about 15 minutes.

  In order to recover the nucleic acids, the upper reservoir 3 is emptied until there is no longer a fluid connection between the compartment 32 and the receiving compartment 31. It is then withdrawn with a pipette, via the channel 9 , the 100 folds of buffer contained in compartment 31. Sampling can be done manually or by

through the automaton.

  We can also plan to recover the purified proteins. For this, two successive electro-purification passes must be carried out, the first allowing the fraction enriched in nucleic acids to be recovered and the second the fraction enriched in proteins. In this specific case, the nucleic acids must be recovered between the two passes, and without emptying the upper reservoir 3 of the buffer which contains the proteins which

haven't finished migrating.

  A device as described above may include only three electrodes. Indeed, the two cathodes 61 and 81, respectively assigned to the electro-separation circuit and to the lysis circuit, become the cathode common to the two circuits. In this case, the biological sample is lysed in compartment 32. Such a device can be used on the wafer. It will then be easy to integrate it into a PLC

thanks to this space saving.

Claims (22)

  1. Method of electro-separation of a biological sample containing both nucleic material and non-nucleic material, for example protein, according to which: (a) a buffer solution is available, (b) a '' a permeable membrane in contact on one side with the buffer solution, and having a predetermined cutoff threshold making it possible to stop the nucleic material at least, on the side of said buffer solution, (c) an electric field is established, the lines of force pass through the buffer solution, and cross the permeable membrane, (d) the biological sample is placed in the buffer solution, upstream of the membrane, according to the direction of circulation of the nucleic material generated by the electric field , characterized in that it consists in - applying the electric field for a defined duration, on the one hand, by the presence of the nucleic material at the membrane level, and on the other hand, by the fact that the material does not nucl ic did not migrate and / or is being migrated,   - to collect the nucleic material.   2. Method of electro-separation of a biological sample containing cells containing nucleic material, according to which: (a) a buffer solution is available, (b) a permeable membrane is in contact with a side with the buffer solution, and having a predetermined cut-off threshold making it possible to stop the nucleic material at least, on the side of said buffer solution, (c) an electric field is established, the lines of force of which pass through the solution buffer, and pass through the permeable membrane, (d) the biological sample is placed in the buffer solution, upstream of the membrane, according to the direction of circulation of the nucleic material generated by the electric field, characterized in that it consists, - to apply a first electric field to lyse the cells, - to apply a second electric field for a defined duration, on the one hand, by the presence of the nucleic material at the level of the membrane, and on the other hand, by the fact that the non-nucleic material has not migrated and / or is in the process of migration,   - to collect the nucleic material.   3. Method according to claim 1 or 2, characterized in that the biological sample is placed on another membrane, on the side of   the latter in contact with the buffer solution.   4. Method according to claim 1 or 2, characterized in that the time of application of the electric field is at most 30 minutes, and   preferably between 5 and 30 minutes.   5. Method according to claim 1 or 2, characterized in that the value of the molarity of the buffer solution is at least equal to 0.1   mol / l, and preferably between 0.1 and 5 mol / l.   6. Method according to claim 1 or 2, characterized in that the electric field has a value between 100 and 250 V, and preferably equal to 150 V. 7. Method according to claim 1 or 2, characterized in that the distance separating the biological sample from the permeable membrane,   is at least equal to 30 mm, and preferably 75 mm.   8. Method according to claim 7, characterized in that the biological sample is obtained from a sample of a liquid   body, for example blood or respiratory sputum.   9. Method according to claim 1 or 2, characterized in that   a proteinase is added to the biological sample.   10. Method according to claim 1 or 2, characterized in that the fraction enriched in nucleic material is directly subjected to   a subsequent amplification step.   11. Single-use device for the implementation of a   method according to any one of the preceding claims,   characterized in that it comprises a support or base, in which are assembled and integrated, as well as arranged between them, the different means, in particular electrodes, required for electro-separation, as well as interfacing means (la, lb , lc) of said support with the outside, firstly for the transfer of the various fluids or liquids to and / or out of the support, including the biological sample, the buffer solution, and the fraction enriched in nucleic material, and d on the other hand for supplying and controlling the electrical means required at least for   electro-separation, including that of the electric field.   12. Device according to claim 11, characterized in that it comprises means for receiving (2) the biological sample; a reservoir (3) for the buffer solution, comprising a compartment (31) closed by the permeable membrane (4), communicating at an end opposite to said compartment (31) with the means for receiving (2) the biological sample, said tank being intended to receive a first buffer solution; and a second reservoir (5) for a second buffer solution, identical or different from the first buffer solution, separated from the first reservoir only by said membrane; two electrodes (61, 62) for generating the electric field, one (61) in contact with the first buffer solution, upstream of the membrane in the direction of circulation of the nucleic material, and the other (62) in contact second buffer solution; and a means of extraction (9) of the fraction enriched in nucleic material from the closed compartment (31) by the membrane.   13. Device according to claim 12, characterized in that the reservoir (3) comprises another compartment (32), for the reception of at least a fraction obtained from the biological sample, disposed upstream of said compartment (31 ) according to the direction of circulation of the nucleic material, communicating with the means of reception of the biological sample.   14. Device according to claim 12, characterized in that the two reservoirs (3,5) communicate respectively with vents   ventilation (33,53), and with at least one filling channel (34).   15. Device according to claim 12, characterized in that an intermediate well (7) is arranged and communicates between the means of   reception (2) of the biological sample and the first reservoir (3).   16. Device according to claim 15, characterized in that the intermediate well (7) is provided with means making it possible to lyse a cell sample.   17. Device according to claim 16, characterized in that the intermediate well (7) is provided with electrodes (81,82) ensuring a lysis of said cell sample.   18. Device according to claim 1 1, characterized in that it comprises, communicating with each other, a compartment (32) for receiving the lysate, an intermediate lysis well (7), and a reception compartment (31 ) of the fraction enriched in nucleic material. 19. Device according to claim 18, characterized in that the volume of the reception compartment (32) of the lysate is greater than the volume of the reception compartment (31) of the fraction enriched in nucleic material.   20. Device according to claim 19, characterized in that the proportion between the volumes of the compartments for receiving the lysate and for receiving the nucleic fraction is between Y1 / 2 and 1/50, especially between 1/5 and 1/20.   21. Use of the device according to claims 11 to 20,   to electro-separate a fraction or all of the nucleic acids to from a cell lysate.   22. Use of the electro-separated fraction by implementing the method according to claims 1 to 10 for detecting and / or   identify nucleic acids directly after amplification.