CA2328298A1 - Method for electroelution of a biological sample and implementing device - Google Patents

Method for electroelution of a biological sample and implementing device Download PDF

Info

Publication number
CA2328298A1
CA2328298A1 CA002328298A CA2328298A CA2328298A1 CA 2328298 A1 CA2328298 A1 CA 2328298A1 CA 002328298 A CA002328298 A CA 002328298A CA 2328298 A CA2328298 A CA 2328298A CA 2328298 A1 CA2328298 A1 CA 2328298A1
Authority
CA
Canada
Prior art keywords
buffer solution
nucleic
membrane
sample
use according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002328298A
Other languages
French (fr)
Inventor
Lyse Santoro
Patrick Broyer
Marc Rodrigue
Bruno Colin
Sophie Barral-Cadiere
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biomerieux SA
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2328298A1 publication Critical patent/CA2328298A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/06—Lysis of microorganisms
    • C12N1/066—Lysis of microorganisms by physical methods
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01D—SEPARATION
    • B01D57/00—Separation, other than separation of solids, not fully covered by a single other group or subclass, e.g. B03C
    • B01D57/02—Separation, other than separation of solids, not fully covered by a single other group or subclass, e.g. B03C by electrophoresis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1017—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by filtration, e.g. using filters, frits, membranes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Abstract

The invention concerns a method for treating by the action of an electric field in liquid medium a biological sample comprising both a nucleic material and a non-nucleic material, which consists in: a) providing a buffer solution; b) providing a permeable membrane, in contact on one side with the buffer solution, and having a predetermined interrupting threshold to stop the nucleic material, on said buffer solution side, when it is migrating under the action of the electric field; c) generating said electric field; d) placing the biological sample in the buffer solution, upstream of the membrane, along the nucleic material circulating direction by the electric field action. The invention is characterised in that it consists in: directly applying the electric field to the biological sample in the buffer solution, for a limited time interval determined by sufficient time for the nucleic material to arrive on the membrane and by its presence on the buffer solution side, and by the fact that at said time interval end the non-nucleic material has not migrated and/or is still in the process of migrating towards said membrane; removing the nucleic material after said time interval, and thereby electroeluting from the biological sample at least the nucleic material. The invention also concerns the implementing device.

Description

PROCÉDÉ D'ELECTRO-SÉPARATION D'UN ÉCHANTILLON BIOLOGIQUE ET
DISPOSITIF DE MISE EN OEUVRE
La présente invention concerne un procédé d'électro-séparation d'une fraction nucléique à partir d'un lysat cellulaire, ainsi que tout dispositif, notamment à usage unique, pour la mise en oeuvre dudit procédé d'électro-séparation.
Différents procédés, mais aussi dispositifs, ont été à ce jour proposés ou décrits, aux fins de séparer un matériel nucléique ou une fraction nucléique, à partir d'un lysat cellulaire.
t o Par " séparation ", on entend de manière générique tout processus permettant d'enrichir ou concentrer un milieu, isoler ou déterminer (de manière qualitative et/ou quantitative) dans un milieu complexe, au moins un matériel nucléique, c'est à dire de l'acide désoxyribonucléique (ADN) et/ou de l'acide ribonucléique (ARN).
Conformément au document de la Société ISCO, dénommé
ISCO Applications (Bulletin 54, ~ Electroelution of Nucleic Acids and Proteins from Gels, and Electrophoretic Concentration of Macromolecules 1989), mais aussi conformément au document US-G-4 164 464, i.l est décrit un dispositif d'électro-élution, et non d'électro-séparation, comprenant:
- un premier réservoir pour une première solution tampon, comportant deux compartiment opposés, fermés chacun par une membrane perméable, l'une de section importante, et l'autre de section faible, et présentant chacune un seuil de coupure permettant de retenir le matériel nucléique ou protéique d'intérët, - un second réservoir pour une deuxième solution tampon, identique ou différente de la première solution tampon, séparé du premier réservoir par lesdites membranes, - deux électrodes en contact électrique avec la seconde solution tampon, générant un champ électrique traversant les deux membranes perméables, de celle de section importante à celle de section faible, et donc traversant la premiêre solution tampon.
Ce dispositif sert à concentrer une fraction nucléique ou protéique, déjà relativement pure mais diluée, en disposant cette fraction sur la membrane de section importante, et en recueillant sur la membrane de section faible la même fraction, mais concentrée. La concentration est WO 99/53304 l'CT/FR99/00830 ELECTRO-SEPARATION PROCESS OF A BIOLOGICAL SAMPLE AND
IMPLEMENTATION DEVICE
The present invention relates to an electro-separation process of a nucleic fraction from a cell lysate, as well as any device, in particular for single use, for the implementation of said electro-separation process.
Various methods, but also devices, have been to date proposed or described, for the purpose of separating a nucleic material or a nucleic fraction, from a cell lysate.
to "separation" means generically everything process for enriching or concentrating an environment, isolating or determine (qualitatively and / or quantitatively) in an environment complex, at least one nucleic material, i.e. acid deoxyribonucleic (DNA) and / or ribonucleic acid (RNA).
In accordance with the document of the ISCO Company, called ISCO Applications (Bulletin 54, ~ Electroelution of Nucleic Acids and Proteins from Gels, and Electrophoretic Concentration of Macromolecules 1989), but also in accordance with document US-G-4 164 464, it is describes an electro-elution device, not an electro-separation device, including:
- a first reservoir for a first buffer solution, with two opposite compartments, each closed by a membrane permeable, one of large cross-section and the other of small cross-section, and each having a cutoff threshold for retaining the material nucleic or protein of interest, - a second reservoir for a second buffer solution, identical or different from the first buffer solution, separated from the first reservoir by said membranes, - two electrodes in electrical contact with the second solution buffer, generating an electric field crossing the two membranes permeable, from that of large section to that of small section, and therefore crossing the first buffer solution.
This device is used to concentrate a nucleic fraction or protein, already relatively pure but diluted, by disposing this fraction on the large section membrane, and collecting on the membrane of small cross section the same fraction, but concentrated. Concentration is

2 obtenue du fait du transport des biomolécules par les lignes de champ électrique, qui se concentrent au niveau de la membrane de faible section:
II ne s'agit donc ni d'un procédé; ni d'un dispositif de séparation, au sens de la définition précédente, c'est à dire au sens où à
partir d'un milieu complexe on sépare ou isole un matériel biologique d'intérêt.
Conformément à la figure 5 du document US-C- 5 415 758, il est décrit un procédé d'électro-élution en parallèle, au sein d'une multiplicité de puits 42 d'une plaque de titration 41. La plâque 41 est 1 o immergée dans un tampon 52, sans débordement de ce dernier à l'intérieur de chaque puits 42, et chaque puits comporte une membrane 53 fermant une ouverture 54 ménagée dans son fond, en sorte que une communication osmotique puisse s'établir entre le tampon 52 et un tampon 55 disposé
dans chaque puits 42. Dans chaque puits 42 s'établit un champ électrique, grâce à une cathode 24, distribuée entre les différents puits 42, et l'anode unique 14. L'échantillon biologique 44, comportant un matériel nucléique, par exemple une goutte de sang disposée sur un support poreux, est élué
par le flux électrolytique, en sorte que dans chaque puits le matériel nucléique se trouve dissous ou distribué, pour un prélèvement ultérieur, par 20 exemple avec une pipette.
De manière générale, le document US-C-5 415 758 décrit un procédé de traitement sous l'action d'un champ électrique en milieu liquide, d'un échantillon biologique comprenant à la fois un matériel nucléique et un matériel non nucléique, par exemple protéique, libres et mobiles dans ledit 25 milieu liquide sous l'action du champ électrique, procédé selon lequel a) on dispose d'une solution tampon, b) on dispose d'une membrane perméable, en contact d'un c&té
avec la solution tampon, et ayant un seuil de coupure prédéterminé pour arrêter le matériel nucléique, du côté de ladite solution tampon, lors de sa 3o migration sous l'action du champ électrique, c) on établit ledit champ électrique, en sorte que ses lignes de force passent au sein de la solution tampon, et traversent la membrane perméable.
d) on dispose l'échantillon biologique dans la solution tampon, 35 en amont de la membrane, selon le sens de circulation du matériel nucléique sous l'action du champ électrique, 2 obtained due to the transport of biomolecules by the field lines electric, which are concentrated at the level of the membrane of small section:
It is therefore neither a process; nor of a separation, within the meaning of the previous definition, i.e. in the sense that at from a complex environment we separate or isolate biological material of interest.
According to Figure 5 of US-C-5,415,758, it is described a process of electroelution in parallel, within a multiplicity of wells 42 of a titration plate 41. The plate 41 is 1 o immersed in a buffer 52, without overflowing the latter inside of each well 42, and each well has a membrane 53 closing an opening 54 formed in its bottom, so that a communication osmotic can be established between buffer 52 and buffer 55 disposed in each well 42. In each well 42 an electric field is established, thanks to a cathode 24, distributed between the different wells 42, and the anode unique 14. The biological sample 44, comprising a nucleic material, for example a drop of blood placed on a porous support, is eluted by the electrolytic flow, so that in each well the material nucleic acid is dissolved or distributed, for later collection, by 20 example with a pipette.
In general, document US-C-5 415 758 describes a treatment process under the action of an electric field in a liquid medium, a biological sample comprising both a nucleic material and a non-nucleic material, for example protein, free and mobile in said 25 liquid medium under the action of the electric field, method according to which a) a buffer solution is available, b) there is a permeable membrane in contact with one side with the buffer solution, and having a predetermined cutoff threshold for stop the nucleic material, on the side of said buffer solution, during its 3o migration under the action of the electric field, c) establishing said electric field, so that its lines of force pass through the buffer solution, and pass through the membrane permeable.
d) the biological sample is placed in the buffer solution, 35 upstream of the membrane, according to the direction of circulation of the material nucleic acid under the action of the electric field,

3 En pratique, un tel procédé ne permet pas de séparer le matériel nucléique de l'échantillon biologique, jusqu'au point d'éliminer pratiquement tout matériel non nucléique, par exemple protéique.
D'autre part, aux fins de séparer un matériel nucléique, on connaît la demande de brevet publiée sous le numéro WO 97/41219, qui divulgue un procédé pour capturer des acides nucléiques à partir d'un mélange constitué par exemple de cellules lysées. Le procédé nécessite de déposer une électrode dans le mélange, d'appliquer à l'électrode un voltage permettant d'attirer les acides nucléiques, puis d'enlever l'électrode recouverte par les acides nucléiques. L'électrode recouverte des acides nucléiques est alors plongée dans une solution permettant, par inversion du courant, de libérer les acides nucléiques qui sont ensuite directement amplifiables. Le voltage appliqué pour pouvoir effectuer une amplification est de préférence de 0,5 à 3 volts pendant environ 30 secondes. Ce ~ 5 procédé, bien qu'utile pour séparer des plasmides contenus dans des cellules E.coli lysées par chauffage, n'est pas adapté pour séparer l'ADN
et/ou l'ARN d'un lysat plus complexe de cellules, notamment provenant d'un échantillon biologique.
Conformément à la figure 1 du document WO 97134908, il est décrit un procédé de séparation d'un matériel nucléique à partir d'un échantillon biologique, en deux étapes - une première étape consiste à mettre en contact l'échantillon biologique lysé avec un adsorbant, de manière à fixer séparément le matériel nucléique, - une deuxième étape consiste à relarguer ce matériel nucléique, à partir de l'adsorbant.
Pour le refargage, on dispose dans un récipient 10 d'une solution tampon, soumise à un champ électrique entre deux électrodes 20a et 20b. Un récipient séparé 15, mais immergé dans ia solution tampon, est disposé dans le récipient 10: Ce récipient communique avec le reste du récipient 10, par l'intermédiaire d'un orifice 12, au travers duquel est disposée une membrane 30 permettant d'arréter le matériel nucléique en mouvement sous le champ électrique. Auprès de cet orifice est situé un puits 60 de prélèvement du matériel nucléique. Et c'est dans fa partie 17 du récipient 15, qu'est disposé l'élément adsorbant duquel ori veut relarguer le matériel nucléique.

WO 99/53303 In practice, such a process does not make it possible to separate the material nucleic acid from the biological sample, to the point of practically eliminating any non-nucleic material, for example protein.
On the other hand, for the purpose of separating nucleic material, we knows the patent application published under number WO 97/41219, which discloses a method for capturing nucleic acids from a mixture consisting for example of lysed cells. The process requires deposit an electrode in the mixture, apply a voltage to the electrode to attract nucleic acids and then remove the electrode covered by nucleic acids. The acid-covered electrode nucleic acid is then immersed in a solution allowing, by inversion of the current, to release the nucleic acids which are then directly amplifiable. The voltage applied to be able to carry out an amplification is preferably 0.5 to 3 volts for about 30 seconds. This ~ 5 process, although useful for separating plasmids contained in E. coli cells lysed by heating, is not suitable for separating DNA
and / or the RNA of a more complex cell lysate, in particular from of a biological sample.
According to FIG. 1 of document WO 97134908, it is describes a method of separating nucleic material from a biological sample, in two stages - a first step is to put the sample in contact biological lysed with an adsorbent, so as to separately fix the nucleic material, - a second step consists in releasing this material nucleic acid, from the adsorbent.
For the refueling, there is in a container 10 a buffer solution, subjected to an electric field between two electrodes 20a and 20b. A separate container 15, but immersed in the buffer solution, is placed in container 10: This container communicates with the rest of the container 10, through an orifice 12, through which is arranged a membrane 30 for stopping the nucleic material by movement under the electric field. Next to this orifice is located a nucleic material collection well 60. And it's in part 17 of container 15, which is arranged the adsorbent element which ori wants release the nucleic material.

WO 99/5330

4 PCT/FR99/00830 Au terme de cet inventaire, aucun procédé n'apparaît permettre de séparer de manière simple et efficace, un matériel nucléique d'un matériel non nucléique, notamment protéique, à partir d'un lysat cellulaire complexe.
La présente invention se propose d'apporter une solution à ce problème non résolu.
Conformément à la présente invention, on a découvert qu'on pouvait électro-séparer au moins le matériel nucléique d'un échantillon biologique, de manière efficace, en traitant l'échantillon biologique directement sous l'action d'un champ électrique en milieu liquide, et en choisissant les conditions opératoires suivantes - on applique le champ électrique directement à l'échantillon biologique dans la solution tampon, pendant une durée limitée et définie, d'une part par le temps suffisant pour l'arrivée sur la membrane arrêtant ie matériel nucléique, et fa présence de matériel nucléique du côté de la solution tampon, et d'autre part par le fait qu'au terme de ladite durée le matériel non nucléique n'a pas migré et/ou demeure en cours de migration vers ladite membrane, - on prélève fe matériel nucléique au terme de ladite durée.
Par "ëlectro-séparation " dans la présente invention, on entend que des molécules présentes ensemble dans un milieu, et pouvant présenter des charges électriques identiques, sont distinguées les unes des autres dans ledit milieu en raison de leurs cinétiques respectivement différentes dans un même champ électrique.
Le procédé selon l'invention apporte l'avantage essentiel d'obtenir rapidement et facilement une fraction nucléique exempte d'autres constituants, notamment protéines, directement arnplifiable, à partir d'un lysat cellulaire. On contrait les difficultés liées aux techniques d'amplification, notamment pour les échantillons de type respiratoire, en ce que la fraction à amplifier doit être exempte d'inhibiteurs. Par la mise en oeuvre du procédé selon l'invention, les inhibiteurs protéiques des techniques d'amplification sont pratiquement éliminés.
La fraction enrichie en matériel nucléique, comprenant l'ADN
et/ou l'ARN, que l'on obtient par la mise en oeuvre du procédé selon l'invention, est directement amplifiable par les techniques couramment utilisées, telles que notamment la technique PCR pour les ADN et la technique NASBA ou TMA pour fes ARN.
Dans un autre mode de réalisation selon l'invention, l'échantüfon biologique est disposé sur une autre membrane, du côté de cette dernière 4 PCT / FR99 / 00830 At the end of this inventory, no process appears to allow to separate in a simple and efficient way, a nucleic material from a non-nucleic material, especially protein, from a cell lysate complex.
The present invention proposes to provide a solution to this unsolved problem.
In accordance with the present invention, it has been discovered that could electro-separate at least nucleic material from a sample biological, effectively, by processing the biological sample directly under the action of an electric field in a liquid medium, and choosing the following operating conditions - the electric field is applied directly to the sample biological in the buffer solution, for a limited and defined period, on the one hand by the time sufficient for the arrival on the membrane stopping ie nucleic material, and the presence of nucleic material on the side of the buffer solution, and secondly by the fact that at the end of said period the non-nucleic material has not migrated and / or remains in the process of migration towards said membrane, - Fe nucleic material is taken at the end of said period.
By "electro-separation" in the present invention means that molecules present together in a medium, and which can have identical electrical charges, are distinguished from others in said medium due to their kinetics respectively different in the same electric field.
The method according to the invention provides the essential advantage quickly and easily obtain a nucleic fraction free from others constituents, in particular proteins, directly arnplifiable, from a cell lysate. We overcome the difficulties related to the techniques amplification, especially for respiratory type samples, in that the fraction to be amplified must be free of inhibitors. By putting work of the process according to the invention, the protein inhibitors of amplification techniques are virtually eliminated.
The fraction enriched in nucleic material, including DNA
and / or RNA, which is obtained by implementing the method according to the invention is directly amplifiable by commonly used techniques used, such as in particular the PCR technique for DNA and NASBA or TMA technique for fes RNA.
In another embodiment according to the invention, the sample biological is placed on another membrane, on the side of the latter

5 en contact avec la solution tampon.
Dans un mode de réalisation préféré selon l'invention, le temps d'application du champ électrique est au plus de 30 minutes, et préférentiellement compris entre 5 et 30 minutes.
Dans un mode de réalisation très préféré selon l'invention, la durée de migration de la fraction nucléique est de 10 à 20 minutes, de préférence encore de 15 minutes.
Dans un mode de réalisation préféré selon l'invention, la valeur de la molarité de la solution tampon est au moins égaie à 0,1 mol/I, et préférentiellement comprise entre 0,1 et 5 mol/I.
La molarité de la solution tampon étant comprise entre 0,1 et 5 mol/I, on peut effectivement, soit ne mettre qu'une méme solution tampon dans les deux compartiments, soit mettre deux solutions tampon différentes dans les deux compartiments.
La molarité de la solution tampon peut être la même dans les deux compartiments et sera comprise entre 0,1 et 1 mol/I, de préférence encore de 0,1 mol/I:
La molarité de la solution tampon peut être différente dans les deux compartiments et sera respectivement de préférence de 0,1 molli dans le premier compartiment et de 1 mol/I dans le second compartiment.
Dans un mode de réalisation préféré selon l'invention, le champ électrique a une valeur comprise entre 100 et 250 V, et préférentiellement égale à 150 V.
Dans un autre mode de réalisation très préféré selon l'invention, la distance séparant l'échantillon biologique de la membrane perméable, en suivant les lignes de force du champ électrique, est au moins égale à 30 mm, et préférentiellement à 75 mm.
Le lysat cellulaire à partir duquel on effectue le procédé selon l'invention peut être un lysat cellulaire provenant d'une culture simple ou complexe, c'est à dire comprenant différentes cellules, ou peut être également un échantillon biologique, tel que notamment du sang, de l'urine et un crachat de type respiratoire.

s Le lysat cellulaire à partir duquel on obtient la fraction nucléique, soumis ensuite au procédé selon l'invention, peut étre obtenu par différentes techniques de lyse, notamment la lyse par choc mécanique, par choc électrique et autres.
Dans un mode de réalisation préféré selon l'invention, l'échantillon biologique résulte directement de la lyse d'un échantillon cellulaire, notamment par voie mécanique ou électrique. Ce mode de réalisation est effectué dans ie même dispositif, comme cela est décrit ci-après.
Dans un autre mode de réalisation préféré selon l'invention, le lysat cellulaire est obtenu à partir d'un prélèvement d'un liquide corporel, par exemple sang ou crachat respiratoire.
Lorsque l'échantillon biologique est du sang, on préfère que le pH de la solution tampon soit de 7.
~ 5 La membrane récupérant la fraction enrichie en matériel nucléique présente un seuil de coupure prédéterminée, de préférence inférieure à 100 kDa.
Lorsque l'échantillon biologique est du sang, la porosité de la membrane à la cathode sera de préférence supérieure à 10 kDa.
Dans un mode de réalisation préféré selon l'invention, on ajoute une protéinase à l'échantillon biologique.
Dans encore un autre mode de réalisation préféré selon l'invention, la fraction enrichie en matériel nucléique est directement soumise à une étape subséquente d'amplification.
La lyse cellulaire sera de préférence encore effectuée , par lyse électrique en présence de protéinase K et d'un détergent.
Un second objet selon l'invention est un dispositif à usage unique pour la mise en oeuvre d'un procëdé selon l'invention, comprenant un support ou base, dans lequel sont rassemblés et intégrés, ainsi 3o qu'agencés entre eux, les différents moyens, notamment électrodes, requis pour l'électroséparation, ainsi que des moyens d'interfaçage dudit support avec l'extérieur, d'une part pour ie transfert des différents fluides ou liquides vers etlou hors du support, dont l'échantillon biologique, la solution tampon, et la fraction enrichie en matériel nucléique, et d'autre part pour l'alimentation et la commande des moyens électriques requis au moins pour l'électroséparation, dont relie du champ électrique.

Dans un mode de réalisation préféré selon l'invention, le dispositif comprend un moyen de réception de l'échantillon biologique; un rëservoir pour la solution tampon, comportant un compartiment fermé par la membrane perméable, communiquant à une extrémité opposée audit compartiment avec le moyen de réception de l'échantillon biologique, ledit réservoir étant destiné à recevoir une première solution tampon; et un second réservoir pour une seconde solution tampon, identique ou différente de la première solution tampon, séparé du premier réservoir uniquement par ladite membrane; deux électrodes de génération du champ électrique, l'une au contact de la première solution tampon, en amont de la membrane selon le sens de circulation du matériel nucléique, et l'autre au contact de la seconde solution tampon; et un moyen d'extraction de la fraction enrichie en matériel nucléique du compartiment fermé par la membrane.
Dans un mode de réalisation très préféré selon l'invention, le T5 réservoir comprend un autre compartiment, pour la réception d'au moins une fraction obtenue à partir de l'échantillon biologique, disposé en amont dudit compartiment selon le sens de circulation du matériel nucléique, communiquant avec le moyen de réception de l'échantillon biologique.
Dans un autre mode de réalisation préféré selon l'invention, les deux réservoirs communiquent respectivement avec des évents d'aération, et avec au moins un cana! de remplissage.
Dans encore un autre mode de réalisation préféré selon l'invention, un puits intermédiaire est disposé et communique entre le moyen de réception de l'échantillon biologique et le premier réservoir.
Dans encore un autre mode de réalisation préféré selon l'invention, le puits intermédiaire est pourvu de moyens permettant de lyser un échantillon cellulaire.
Dans encore un autre mode de réalisation préféré selon l'invention, fe puits intermédiaire est pourvu d'électrodes assurant une lyse dudit échantillon cellulaire.
Dans encore un autre mode de réalisation préféré selon l'invention, le dispositif comprend, communiquant les uns avec les autres, un compartiment de réception du lysat, un puits intermédiaire de lyse, et un compartiment de réception de la fraction enrichie en matériel nucléique.
Dans encore un autre mode de réalisation préféré selon l'invention, le volume du compartiment de réception du iysat est supérieur au volume du compartiment de réception de la fraction enrichie en matériel nucléique.
Dans encore un autre mode de réalisation préféré selon ('invention, la proportion entre les volumes des compartiments de réception du lysat et de réception de la fraction nucléique est comprise entre %2 et 1 /50, notamment entre 1 /5 et 1 /20.
Un troisième objet selon l'invention est l'utilisation du dispositif décrit ci-dessus paur électro-séparer une fraction d'acides nucléiques à
partir d'un lysat cellulaire.
Un quatrième objet selon l'invention est l'utilisation de la fraction électro-séparée par la mise en oeuvre du procédé selon l'invention pour détecter etlou identifier des acides nucléiques directement après amplification.
La Figure 1 représente shématiquement un appareil ~ 5 d'éléctroélution d'acides nucléiques et de protéines à partir d'un gel, et de concentration électraphorétique de macromolécules (Isco, Nebraska, USA), que l'on utilise dans un procédé différent, à savoir d'électro-séparation selon l'invention. Les compartiments A et B, dans lequel sont plongés deux électrodes négative et positive respectivement, sont remplis de tampon 20 TBE 1x; le compartiment C, comprenant une partie C1 et une partie C2, et le compartiment Cf sont remplis de tampon TBE 0.1 x. Une membrane de dialyse est placée à l'interface des compartiments Cf et B (porosité
100 kDa), et des compartiments C1 et A (porosité 10 kDa).
La Figure 2 indique 1e pourcentage d'acides nucléiques de S.
25 epidermidis récupérés dans le compartiment Cf, après migration à partir d'un lysat cellulaire obtenu par chocs mécaniques, déterminé par analyse avec un appareil Vidas (BioMerieux, France), selon l'exemple 2. En abscisse est représenté le temps de migration (minutes), et en ordonnée est représenté le pourcentage d'acides nucléiques récupérés dans le 30 compartiment Cf, exprimé en unités relatives de fluorescence.
La Figure 3 présente !a cinétique de récupération des protéines d'un lysat cellulaire. Le pourcentage des protéines du fysat bactérien est récupéré dans le compartiment Cf, après migration à partir d'un lysat cellulaire obtenu par chocs mécaniques, déterminé par dosage Bradford, 35 selon l'exemple 2. En abscisse est représenté le temps de migration (minutes), et en ordonnée est représenté le pourcentage d'acides nucléiques récupérés dans le compartiment Cf, exprimé en densité optique (DO) à 595 nm.
La Figure 4 présente la cinétique de récupération d'acides nucléiques à partir de lysat cellulaire. Le pourcentage d'acides nucléiques de Staphycoccus epidermidis, récupéré dans le compartiment Cf après migration à partir d'un lysat cellulaire obtenu par chocs électriques, est déterminé par analyse avec un appareil Vidas, selon l'exemple 2. En abscisse est représenté le temps de migration (minutes?, et en ordonnée est représenté le pourcentage d'acides nucléiques récupérés dans le compartiment Cf, exprimé en unités relatives de fluorescence.
Lâ Figure 5 présente l'amplification des acides nucléiques purifiés à partir d'un lysat cellulaire. La quantité d'amplicons produits par PCR à partir de 10 NI de molécules d'ADN est récupérée dans le compartiment Cf, à partir d'un lysat cellulaire obtenu par chocs ~ 5 mécaniques, après différents temps de migration, selon l'exemple 2. En abscisse est représenté ie temps de migration (minutes), et en ordonnée est représenté le pourcentage d'acides nucléiques récupérés dans ie compartiment Cf, exprimë en unités relatives de fluorescence.
La Figure 6 présente la quantité d'amplicons produits par 2o amplification PCR, après lyse de différentes concentrations initiales de bactéries par chocs mëcaniques, et migration de leur matériel nucléique pendant 15 minutes sous un champ électrique, selon l'exemple 2. En abscisse est représenté le nombre de bactéries initiales pour 200 cul de lysat, et en ordonnée est représenté le signal obtenu après PCR, exprimé en 25 unités relatives de fluorescence.
La Figure 7 illustre la quantité d'ampücons produits par amplification TMA, après lyse de différentes concentrations initiales de bactéries par chocs mécaniques, et migration de leur matériel nucléique pendant 15 minutes sous champ électrique, selon l'exemple 2. En abscisse 30 est représenté le nombre de bactéries initiales pour 200 ,ul de lysat, et en ordonnée est représenté le signal obtenu après TMA, exprimé en DO x 1000.
La Figure 8 indique le pourcentage de protéines du sang récupéré dans le compartiment Cf en fonction du temps de migration d'un 35 échantillon clinique sanguin lysé par chocs mécaniques, selon l'exemple 3.
En abscisse est représenté le temps de migration (minutes), et en ordonnée est représenté le pourcentage de protéines récupéré dans le compartiment Cf, exprimé en DO à 595 nm.
La Figure 9 indique le pourcentage de proteines d'un crachat récupéré dans le compartiment Cf en fonction du temps de migration d'un 5 échantillon clinique de type respiratoire lysé par chocs mécaniques, selon l'exemple 2. En abscisse est représenté le temps de migration (minutes), et en ordonnée est représenté le pourcentage de protéines récupéré dans le compartiment Cf, exprimé en DO à 595 nm.
La Figure 10 montre l'élimination des inhibiteurs de la PCR
t0 initialement présent dans l'échantillon clinique de type respiratoire. Elle indique la quantité d'amplicons ADN produits par PCR à partir de différentes quantités initiales d'ADN de S, epidermidis; selon l'exemple 5.
En abscisse est représenté le nombre de copies d'ADN initiales pour 10 NI
d'échantillon, et en ordonnées est représenté le signal obtenu après PCR, exprimé en unités relatives de fluorescence.
La Figure 11 indique la quantité d'amplicons produits à partir de différentes quantités initiales de bactéries lysées et déposées dans le compartiment C1. Ghaque point représenté sur le graphe représente une valeur moyenne obtenue à partir de 13 crachats et aspirations bronchiques différents, selon l'exemple 5. En abscisse est représenté le nombre de copies d'ADN initiales pour 200 ,ul d'échantillon, et en ordonnées est représenté le signal obtenu après PCR, exprimé en unités relatives de fluorescence.
La Figure 12 indique ia quantité d'amplicons produits à partir de différentes quantités initiales de bactéries lysées par chocs mécaniques, et déposées dans le compartiment C1, selon l'exemple 5. L'ëtude a été
réalisée en parallèle sur 4 crachats différents. En abscisse est représenté le nombre de copies d'ADN initiales pour 200 ,ul d'échantillon, et en ordonnées est représenté le signal obtenu après TMA, exprimé en DO x 1000.
La figure 13 représente un dispositif à usage unique selon l'invention, vu en perspective.
La figure 14 représente une vue de dessous du dispositif représenté à la figure 13.
La figure 15 représente représente une vue de dessus du dispositif représenté à la figure 13.

La figure 1 F représente représente une vue en. coupe, selon le trait de coupe représenté à la figure 15, du dispositif selon la figure 13.
Exemple 1 : Mode opératoire général pour mettre en oeuvre le procédé selon l'invention.
Le mode opératoire est basé sur l'utilisation d'un appareil d'éléctroéfution d'acides nucléiques selon la figure 1. Un volume d'échantillon biologique est déposé soigneusement au fond du compartiment C1. Les deux électrodes du circuit sont reliées à un générateur électrique. Une tension constante de 150 V est appliquée aux bornes du générateur. L'intensité du circuit varie de 15 à 20 mA et la température du tampon dans le compartiment C varie de 23 à 30°C. Les molécules biologiques initialement déposées au fond du compartiment C1 migrent dans le champ électrique ainsi créé, à vitesse définie en fonction de leur charge et de leur taille. Après différents temps de migration, la tension aux bornes du générateur est arrêtée et les molécules ayant migré vers fa cathode et de poids moléculaire apparent inférieur ou égal à 10 kDa sont recueillies dans le compartiment Cf, dans un volume final de 200 ,ul.
L'échantillon ainsi récupéré est conservé dans la glace avant analyse.
L'échantillon biologique déposé dans ie compartiment C1 peut étre un matériel nucléique et/ou protéique purifié ou non, un lysat cellulaire, provenant d'un échantillon biologique tei que le sang, l'urine et un crachat de type respiratoire. Les lysats cellulaires étudiés ont été obtenus à partir de S. epidermidis, bactérie à paroi Gram+ (A054). Ces bactéries sont cultivées en milieu liquide BCC (Bouillon Coeur Cervelle, bioMerieux 410191. Avant lyse, elles sont mises en suspension, soit dans un prélèvement clinique (crachat liquéfié et décontaminé, sang, plasma, sérum, ....), soit en tampon de lyse (30 mM Tris-HCI, 5 mM EDTA, 100 mM NaCI pH 7.2). 300 ,ul de cette suspension cellulaire ont été lysés en suivant essentiellement deux protocoles - Protocole de Ivse oar chocs mécaniaues : 90 ,ul de billes de verre de diamètre compris entre 90 et 150 Nm, 3 billes de fer de diamètre 2 mm et 5 billes de verre de diamètre 3 mm sont placés dans un tube Faicon en présence de 300Ni de la suspension cellulaire, comme décrit dans le brevet (FR-A-2 768 7431. 6 mg /ml final de protéinase K (PK) (E.C.
3.4.21.14 Boehringer-Mannheim, ref. 10927661 peut être ajoutée à la suspension cellulaire. Le tube fermé est vortexé pendant deux minutes, à

W0 99/53304 PCTlFR99/00830 puissance maximale de l'appareil (Reax 2000, Heidolph). La suspension bacterienne ainsi traitée et récupérée est déposée immédiatement dans le compartiment C1 du dispositif décrit dans la Figure 1. Si la PK est présente dans la solution cellulaire, une incubation supplémentaire de 15 minutes à
37°C est réalisée.
Protocole de I~se par choc électrique : 300 ,ul de la suspension cellulaire sont déposés dans une cuve d'électroporation caractérisée par une distance entre les deux électrodes de 2 mm, en présence de 0.01 à 6 mg /ml final de PK: La cuve est placée dans un circuit ~ 0 électrique dont les paramètres sont choisis comme suit : tension 500 V, résistance 186 Ohms, capacité de 500 ou 1500 ,uFD. Après lancement d'une impulsion électrique, la décharge électrique se réalise en quelques millisecondes entre les deux électrodes. Le lysat ainsi récupéré est déposé
immédiatement dans le compartiment A du dispositif décrit dans la Figure 1 ~ 5 (FR-A-2 763 957).
Le pourcentage d'acides nucléiques recueilli du côté de la cathode, après migration dans le compartiment Cf, est déterminé par mesure de DO (densité optique) de l'échantillon récupéré à 260 nm. Le pourcentage recueilli est égal au rapport de fa valeur de DO à 260 nm après 20 migration, sur la valeur de DO à 260 nm avant migration. De méme, la quantité de protéines recueillies à la cathode après migration est déterminée par dosage Bradford et lecture de DO à 595 nm. Le pourcentage de protéines recueillies est égal au rapport de la quantité
protéique récupérée sur la quantité initiale.
25 La quantité des acides nucléiques récupérés du côté de la ' cathode après migration est vérifiée sur gel d'agarose 0.8% ; 10 NI de l'échantillon sont déposés par puits, la migration électrophorétique est réalisée sous voltage constant (150 V) et le gel est coloré au bromure d'ethidium (BET) avant observation sous rayonnement - ultra-violet. En 30 parallèle, les protéines récupérées à 1a cathode après migration peuvent être observées sur gel de polyacrylamide en présence de SDS (SDS-PAGE
10%); - 5 à 10 NI de l'échantillon sont déposés par puits, la migration électrophorétique est réalisée sous intensité constante (25 mA), et le gel est coloré au bleu de Coomassie.
35 La quantité d'acides nucléiques récupérés du côté de la cathode est déterminée par détection spécifique selon une technique d'hybridation dite sandwich, en utilisant l'appareil Vidas commercialisé par bioMérieux (France). Des sondes oligonucléotidiques de capture et de détection spécifiques des acides nucléiques de S. epidermidis (EP-A-0 632 269) ont été choisies. Les oligonucléotides de capture et de détection ont respectivement pour séquence : 5'-GACCACCTGTCACTCTGTCCC-3' (SEQ
ID N° :1 ) et 5'-GGAAGGGGAAAACTCTATCTC-3' (SEQ ID N° :2).
La sonde de détection est marquée par couplage avec la phosphatase alcaline (AKP). L'hybridation spécifique de ces sondes avec les acides nucléiques libérés dans le lysat est fonction de la quantité d'acides nucléiques prësents, mais aussi de leur accessibilité pour les sondes utilisées.
Deux protocoles d'amplification spécifique des molécules d'ADN
et d'ARN de S. epidermidis ont été réalisés à partir des échantillons recueillis après migration : un protocole PCR pour l'amplification de /'ADN
et un protocole NASBA pour l'amplification de l'ARNr16S et un protocole TMA pour l'amplification de l'ARNr 16S.
-Protocole PCR : la technique de PCR suivie est celle décrite par Goodman dans PCR Strategies, Ed : Innis, Gelford et Sninsky Academic press 1995, pp 17-31. Deux amorces d'amplification ont été utilisées, elles présentent les séquences suivantes Amorce 1 : 5'-ATCTTGACATCCTCTGACC-3' (SEQ ID N ° :3) Amorce 2 : 5'-TCGACGGCTAGCTCCAAAT-3' (SEQ ID N° :4) Les cycles de température suivants ont été utilisés 1 fois 3 minutes à 94°C
2 minutes à 65 ° C
35 fois 1 minute à 72°C
1 minute à 94°C
2 minutes à 65°C
1 fois 5 minutes à 72°C
-Protocole TMA : la technique de TMA suivie est celle décrite par US-A-5 554 516. Deux amorces d'amplification ont été utilisées, elfes présentent les séquences suivantes Amorce 1 . 5'-TCGAAGCAACGCGAAGAACCTTACCA -3' (SEQ
ID N° :5) Amorce 2 : 5'-AATTCTAATACGACTCACTATAGGGAGGTT
TGTCACCGGCAGTCAACTTAGA -3' (SEQ ID N ° :6) ,ul ou 50 NI d'échantillon recueilli sont utilisés pour chaque essai PCR et TMA, respectivement. Les amplicons produits par PCR sont observés sur gel d'agarose 0.8% et quantifiés sur Vidas selon le protocole décrit ci-dessus. Les amplicons produits par TMA sont détectés et 5 quantifés sur microplaque par hybridation avec une sonde de capture et une sonde de détection, spécifiques de S. epidermidis, selon ia méthode décrite par P. Cros et al., Lancet 1992, 240 :870. La sonde de détection est couplée à la " Horse Radish Peroxidase " (HRP). Les deux ~ sondes présentent les séquences suivantes 10 Sonde de capture : 5'-GATAGAGTTTTCCCCTTC-3' (SEQ ID
N° :7) Sonde de détection : 5'-GACATCCTCTGACCCCTCTA -3' tSEQ
ID N° :8) Exemple 2 : Cinétique de récupération d'acides nucléiques à
partir de lysat cellulaire.
Une suspension de Staphylococcus epidermidis (1-5.109 b./300,u1) est lysée par choc mécanique ou par choc électrique, comme décrit dans le protocole général ci-dessus. 200 cul de chaque lysat sont déposés au fond du compartiment C1. Le champ électrique est appliqué
2o pendant différents temps entre les deux électrodes. Les quantités d'acides nucléiques ou de protéines présentes dans l'échantillon recueilli dans le compartiment Cf sont déterminées par analyse avec un appareil Vidas ou dosage Bradford, respectivement. La qualité des molécules récupérées a été appréciée sur gel d'agarose ou d'acrylamide, en présence de SDS.
- LYsat cellulaire obtenu par choc mécaniaue Les acides nucléiques du lysat ont migré dans le compartiment Cf progressivement au cours du temps, comme montré à la figure 2. Après 60 minutes, la totalité du matériel nucléique du lysat est récupéré, quelque soit la présence ou non de protéinase K pendant l'étape de lyse. Ce résultat 3o est en faveur d'une bonne libération et accessibilité des acides nucléiques dans le lysat. Les molécules d'ADN récupérées ont le même profil de migration sur gel d'agarose 0:8% qu'avant migration dans le lysat. En présence de protéinase K pendant l'étape de lyse, comme montré à la figure 3, seul un pourcentage négligeable de protéines est récupéré aprës 60 minutes, tandis qu'en l'absence de protéase, environ 50% de protéines sont récupérées.

- L~at cellulaire obtenu par choc electrique.
En présence de PK pendant l'étape de lyse, comme montré à la figure 4, les acides nucléiques du lysat migrent progressivement jusqu'à la cathode. Après 60 minutes, un pourcentage important d'acides nucléiques 5 est récupéré. La récupération du matériel nucléique présent initialement dans ce lysat est similaire à celle du matériel nucléique présent initialement dans un lysat obtenu par choc mécanique (cf. ci-dessus). Par contre, en absence de PK pendant l'étape de lyse, aucun acide nucléique ne peut être détecté dans le compartiment Cf, même après 60 minutes de migration 10 (analyse Vidas et gel d'agarose 0.8%). Sur ge! d'agarose, les molécules d'ADN et d'ARN du lysat récupérées sont observables séparément après migration, alors qu'elles ne le sont pas initialement dans le lysat.
- Amplification des acides nucléiques purifiés à partir de Ivsat cellulaire 15 Les bactéries S. epidermidis diluées dans 300 NI de tampon de lyse sont lysées par choc mécanique en l'absence de PK, comme décrit dans ie protocole général de l'exemple 1. 200,u1 du lysat sont déposés au fond du compartiment C1. Un champ électrique est appliqué entre les deux électrodes pendant différents temps. I_e matériel nucléique qui a migré dans le compartiment Cf est amplifié par PCR (10 NI par essai) ou TMA (50 NI
par essai). La quantité d'amplicons produite est analysée par hybridation spécifique sur Vidas ou microplaque, respectivement.
- Amplification PCR des molécules d'ADN récupérées après migration Pour 104 bactéries initiales lycées, déposées dans le compartiment C1, différentes quantités d'amplicons sont produites, en fonction du temps de migration. Pour 15 minutes de migration, comme représenté à la figure 5, les molécules d'ADN récupérées permettent une production optimale d'amplicons par PCR. Avant 15 minutes, une quantité
3o inférieure de molécules d'ADN sont récupérées. Pour 20 minutes et après, une quantité supérieure de molécules d'ADN sont récupérées, mais de qualité moins adaptée à une amplification PCR optimale. Plus la migration dure, plus la structure de l'acide nucléique peut être altérëe. Afin d'obtenir une amplification PCR optimale, un compromis entre quantité et qualité des molécules d'ADN récupérées à la cathode doit être respecté. Ce résultat a été confirmé en utilisant des suspensions initiales de S. epidermidis plus concentrées (105-106 bactéries initiales /200,u1).
Comme représenté à le figure 6, l'ADN d'un nombre supérieur ou égal à 1.103 bactéries initiales (/200NI) peut être amplifié et détecté, après lyse mécanique des cellules et migration des constituants du lysat sous champ électrique; soit 102 molécules d'ADN ou bactéries par essai PCR, étant donné que le matëriel migré est récupéré dans 200 ,ul et que 10 ,ul de ce matériel est utilisé pour chaque essai PCR. 102 molécules d'ADN
correspondent à la limite de sensibilité du protocole PCR, de façon générale. Ce résultat démontre une grande sensibilité de rëcupération des molécules d'ADN bactérien après lyse cellulaire par choc mécanique et purification des molécules d'ADN intracellulaire par champ électrique en solution.
- Amplification TMA des molécules d'ARN rëcur~érées après migration Comme représenté à la figure 7, l'ARN de au moins 40 bactéries initiales (1200~r1) peut être détecté après lyse des bactéries, migration des constituants cellulaires sous champ électrique et amplification spécifique des ARNr16S de S epidermidis ; soit 10 bactéries initiales par essai TMA, compte tenu que le matériel nucléique migré est récupéré dans 200 NI final, et que 50 NI sont ajoutés par essai TMA. Ce résultat témoigne d'une grande sensibilité de récupération des molécules d'ARNr 16S
bactérien, après lyse par choc mécanique et purification des acides nucléiques du lysat par champ électrique.
Exemple 3 : Cinétique de récupération d'acides nucléiques à
partir d' un échantillon sanguin.
L'échantillon sanguin est utilisé sans pré-traitement préalable.
200 ~I de cet échantillon clinique est déposé au fond du compartiment C1.
Un voltage de 150 V est appliqué entre les deux électrodes pendant différents temps, puis le matériel récupérë du côté de la cathode dans le compartiment Cf est analysé par dosage de protéines selon la méthode de Bradford, et sur gel de polyacrylamide en présence de SDS iSDS-PAGE
10%).
Dans cet exemple, le pH du tampon TBE utilisé pour la migration a été fixé à pIH 7.0, ie point isoélectrique de l'hémoglobine étant égal à
7Ø
Des membranes de 50 ou 100 kDa ont été placées à l'interface des compartiments Cf et B. Comme cela est représenté à la figure 8, après 60 minutes de migration, un pourcentage négligeable de protéines est récupéré
avec la membrane de 100 kDa, et 10% des protéines sont récupérées avec la membrane de 50 kDa. A pH 7.0, seulement 10% des protéines sanguines chargées négativement à pH 7.0 ont un poids moléculaire apparent supérieur à 50 kDa et inférieur à 100 kDa. Un pourcentage négligeable de protéines sont récupérées après 15 minutes de migration, en utilisant indifféremment une membrane de 50 ou 100 kDa. Ces conclusions ont été vérifiées sur gel de polyacrylamide en présence de SDS-PAGE 10%.
La porosité de la membrane sera préférentielement supérieure à 10 kDa, afin de ne pas obtenir un pourcentage trop élevé de protéines.
Exemple 4 : Cinétique de récupération d'acides nuclëiques à
partir d'un échantillon de type respiratoire.
Avant utilisation, l'échantillon respiratoire est fluidifié, décontaminé selon le protocole standard au N-acetyl-L-cysteine et à la soude (NALC/NaOH); puis il est inactivé 20 minutes à 95°C.
Dans cet exempte, le tampon TBE utilisê pour la migration a un pH égal à 8.3 ou 7.0, et des membranes de différentes tailles de pores ont été placées à l'interface des compartiments Cf et B: 10, 50 ou 100 kDa.
Comme cela est représenté à la figure 9, à pH 8.3, 10% des protéines sont récupérées après 30 minutes, et 70-80% après 60 minutes avec des membranes de 50 ou 10 kDa, ce qui suggère que 70-80% des protéines du crachat sont chargées négativement à ces pH et ont un poids moléculaire apparent supérieur à 50 kDa. A pH 7.0, environ 0% des protéines sont récupérées après 30 ou fi0 minutes de migration, quelque soit la taille des pores de la membrane utilisée (dans la limite de sensibilité des techniques de détection utilisées). A ce pH, les 55-60% des protéines préalablement récupérées à pH 8.0 ne sont plus chargées négativement. Avec les membranes de 10 ou 50 kDa, un pourcentage négligeable des protéines du crachat est récupéré après 15 minutes de migration. On a vérifié ce point sur gel de polycrylamide en présence de SDS-PAGE 10%.
Exemple 5 : Levée d'inhibition de protocoles d'amplification par les échantillons de type respiratoire après migration.
Les échantillons de type respiratoire sont inhibiteurs des réactions PCR et TMA. 200 ,ul de ces échantillons ont été déposés au fond du compartiment C1 du système décrit Figure 1. Un voltage de 150 V

constant a été appliqué entre les deux électrodes pendant 15 minutes. Une membrane de séparation entre Cf et B de 10 kDa a été choisie. Après migration, l'échantillon récupéré dans le compartiment Cf (200 ,u!) a été
supplémenté avec différentes quantités d'acides nucléiques purifiés de S.
epidermidis. 10 NI ou 50 ,ul de cette solution ont été utilisés pour chaque essai PCR ou TMA, respectivement. Comme représenté à la figure 10, jusqu'à 102-103 copies initiales d'ADN peuvent être amplifiées dans 10 NI
d'échantillon migré. Ce résultat démontre que le crachat migré a perdu son caractère inhibiteur de la PCR. Des résultats similaires ont été obtenus avec l'amplification TMA.
1-5.109 S. epidermidis ont été ensemencés dans 300 ,ui de crachat fluidifié, décontaminés et inactivés comme décrit dans l'exemple 4 ci-dessus. Ces cellules en suspension ont été lysées par choc mécanique en absence de PK, et le lysat a migré pendant 15 minutes sous 150 V avec ~ 5 une membrane de 10 kDa entre les compartiments Cf et B, selon le schéma présenté à la Figure 1. La quantité d'acides nucléiques bactériens récupérés dans le compartiment Cf après migration a été quantifiée par analyse Vidas spécifique de l'espèce bactérienne étudiée. L'expérience a été réalisée à
partir de différents crachats. En moyenne, 80% d'acides nucléiques S.
2o epidermidis sont récupérés. Ce résultat indique que les molécules de la matrice du crachat ne gênent pas la migration des molécules d'ADN et d'ARN du lysat bactérien dans le champ électrique, dans ces conditions. Au contraire, il semble que l'environnement soit propice à une meilleure récupération et/ou migration de ces molécules.
25 Amplification PCR:
Les bactéries S. epidermidis ont été ensemencées dans 300 ul de crachat fluidifié, dëcontaminé, inactivé, puis lysées par choc mécanique en absence de PK comme décrit dans !'exempte 1. 200 ,ui du lysat a migrë
pendant 15 minutes sous 150V avec une membrane de 10 kDa entre les 3o compartiments Cf et B. Le matériel nucléique présent dans l'échantillon a été amplifié par PCR t10 ,ul par essai), et les ampücons produits ont été
quantifiés par analyse Vidas: Comme représenté à la figure 11, jusqu'à
104-103 bactéries initiales lysées (i200,u1 de lysat? peuvent être détectées après migration et amplification des molécules d'ADN (soit 100-10 35 molécules d'ADN /10,u1 d'essai PCR). Ce résultat, d'une part confirme un très bon rendement de récupération des molécules d'ADN bactérien du lysat dans le crachat, et d'autre part démontre une très bonne élimination des inhibiteurs de la PCR initialement présents dans les crachats.
Amplification TMA:
De même que pour l'étude de l'amplification PCR décrite ci avant, les bactéries S. epidermidis ont été ensemencés dans 300 ,ul de crachat fluidifié, décontaminé, inactivé puis lysées par choc mécanique en absence de PK. 200 pl du lysat a migré pendant 15 minutes sous 150V
avec une membrane de 10 kDa entre les compartiments Cf et A. Les molécules d'ARNr présentes dans l'ëchantillon récupéré ont été amplifiées 90 par TMA (50 ,ul par essai), et les amplicons produits ont été quantifiés par hybridation spécifique sandwich sur microplaque. Comme représenté à la figure 12, au moins 106-105 bactéries initiales lysées (i200p1 de lysat) peuvent être détectées après migration et amplification des molécules d'ARN (soit au moins 5.104-5.103 bactéries initiales /50 ,ul d'essai TMA).
Ce résultat démontre l'élimination des inhibiteurs de la TMA initialement présents dans les crachats.
Exemple 6: Electro-séparation après lyse par chocs électriques.
1-5.1 O9 S. epidermidis ont été ensemencés dans 300 ,ul de crachat fluidifié, décontaminé et inactivé comme décrit dans l'exemple 4.
Ces cellules en suspension ont été lysées par choc électrique en présence de 102 mgiml final de PK et 2% final de LLS (Lithium Lauryl Sulfate, Sigma). 200 pl de lysat a migré pendant 15 minutes sous 150 V avec une membrane de 10 kDa entre les compartiments Cf et B, selon le shéma présenté à la figure 1. Le matériel nucléique récupéré après migration (200 ,ul ) a été amplifié par PCR spécifique de S. epidermidis ( 10 pl/essai), et les amplicons produits ont été quantifiés par analyse Vidas. Jusqu'à 104-105 bactéries initiales lysées (Iml) peuvent être détectées après migration et amplification des molécules d'ADN (soit 100-10 molécules d'ADN/10 NI
d'essai PCR, ce qui représente la limite de sensibilité de la technique PCR
utilisée).
Conformément aux figures 13 à 16, on décrit ci-après un dispositif à usage unique, c'est-à-dire consommable, ou jetable après emploi, permettant de mettre en oeuvre le procédé d'électro-séparation décrit et exemplifié précédemment.
Un tel dispositif comprend un support 1, ou base, ayant généralement une forme parallèlépipédique, comprenant notamment une WU 99/53304 PCT/F'R99/00830 face supérieure 1 b, une face inférieure 1 c et un flanc latéral 1 a, montrés sur les Figures 13 et 14:
De manière générale dans ce support 1, sont rassemblés et intégrés, ainsi qu'agencés entre eux, les différents moyens, notamment 5 électrodes requis pour l'électro-séparation, ainsi que des moyens d'interfaçage correspondant au flanc 1a du support 1 avec l'extérieur, d'une part pour le transfert des différents fluides ou liquides vers et/ou hors du support 1, dont l'échantillon biologique traité, ie milieu liquide aqueux (tampons) et la fraction enrichie en matière nucléique, et d'autre part pour 10 l'alimentation et la commande des moyens électriques requis au moins pour 1'électro-séparation, dont celle du champ électrique.
De manière non représentée, à titre d'exemple, les deux faces 1 a et 1 b du dispositif, ou carte, sont revêtues d'un film transparent, étanche; adhérant au support, et fermant ies différents conduits et cavités ~ 5 représentés en surface aux figures 13 et 14.
Ce dispositif comprend encore - un moyen de réception 2 de l'échantillon biologique traité
- un premier réservoir 3 pour un premier milieu liquide àqueux (tampons TBE dilué à 10 fois), comportant lui-même un compartiment 31 20 fermé par une membrane 4 perméable, ayant par exemple une capacité de l'ordre de 100 Nl, ainsi qu'un autre compartiment 32, ayant une capacité
de 1 ml, pour la réception d'au moins une fraction obtenue à partir d'un échantillon biologique ; cet autre compartiment est disposé en amont du compartiment 31 selon le sens de circulation du matériel nucléique, sous l'effet du champ électrique, et communique lui-même avec le moyen de réception 2 de L'échantillon biologique - un second réservoir 5 pour un second milieu liquide aqueux (par exemple tampon TBE, une fois concentré), identique ou différent du premier liquide aqueux, séparé du premier réservoir 3, uniquement par la membrane 4 - deux électrodes 61 et 62 pour générer un champ électrique, communiquant avec deux plots 63 et 64 de contact électrique sur le flanc 1a ; l'une des électrodes, à savoir 61, ou cathode, est au contact du premier milieu liquide aqueux dans le premier réservoir 3, et l'autre électrode 62, ou anode, est au contact du second milieu aqueux dans le second réservoir 5 WO 99/53304 PCT/FR99/00$30 - un moyen d'extraction 9 de la fraction enrichie en matériel nucléique du compartiment 31 fermé par la membrane 4 Les deux réservoirs 3 et 5 communiquent respectivement avec des évents d'aération 33 et 53, et avec au moins un canai de remplissage 34 communiquant en ce qui le concerne avec ie second réservoir 5.
Un puits intermédiaire 7 est disposé et communique entre le moyen de réception 2 de l'ëchantillon biologique et le premier réservoir 3.
Ce puits n'est pas obligatoire, puisque le lysat peut être déposé
directement dans le compartiment 32. Ce puits 7 est pourvu de moyens permettant de lyser un échantillon cellulaire pour obtenir une fraction soumise ensuite à électra-séparation ; ces moyens sont des électrodes 81 et 82, permettant d'exposer l'échantillon à une ou plusieurs impulsions électriques, conformément au procédé décrit par ailleurs dans la demande de brevet frarfçais FR-A-2 7fi3 au nom de la Demanderesse. Ces électrodes 81 et 82 communiquent respectivement avec des plots de contact électrique 83 et 84 prévus sur le flanc 1 a. II existe donc deux circuits électriques, l'un associé aux électrodes 81 et 82, et l'autre associé aux électrodes 61 et 62.
I - Prénaratian du dispositif Avant de démarrer toute réaction, on remplit les réservoirs 3 et 5 de tampon. Ce dernier peut étre constitué par un tampon TBE (Tris-Borate-EDTA1 dont la concentration varie d'un réservoir à l'autre. On remplit le premier réservoir 3, supérieur, par le moyen de réception 2, avec du tampon dilué dix fois, et le second réservoir 5, inférieur, par le canal 34 avec du tampon une fois concentré. On perce les évents d'aération 33 et 53 au niveau des films étanches recouvrant les faces 1 a et 1 b, afin de permettre à l'air de s'échapper lors du remplissage des réservoirs.
1 ) Lyse L'échantillon est introduit dans le moyen de réception 2 à !'aide d'une pipette, manuellement ou par un automate. Le volume de l'échantillon est compris entre 0 et 1 ml. II arrive alors dans le puits intermédiaire 7 de lyse. La lyse est réalisée grâce à une décharge électrique de 500 V pendant environ 1 seconde, entre les électrodes 81 et 82.
Dans le cas où le volume d'échantillon est supérieur à 50 cul, plusieurs étapes de lyse sont réalisées les unes après les autres, les fractions lysées étant transférées au fur et à mesure dans le compartiment 32 de réception.
2) Electro-séparation Une fois l'échantillon lysé et transfëré en totalité dans le compartiment 32 de départ de I'électro-séparation, le premier circuit électrique des électrodes 81 et 82 est ouvert, le deuxième des électrodes 61 et 62 est fermé. Les constituants du iysat chargés négativement vont alors migrer jusqu'à l'anode 62. Les acides nucléiques étant fortement négatifs migreront plus vite. On pourra donc les récupérer sélectivement au-dessus de la membrane 4, au niveau du compartiment de réception 31 par le canal de prélèvement 9.
Le courant imposé pour cette migration est compris entre 0 et 30 mA, sous une tension de 150 V. La durée optimale de migration est d'environ 15 minutes.
Afin de récupérer ies acides nucléiques, on vide le réservoir 3 supérieur jusqu'à ce qu'il n'y ait plus de liaison fluidique entre le compartiment 32 et le compartiment de réception 31. On prélève alors avec une pipette, par le canal 9, les 100 ,ul de tampon contenus dans le compartiment 31. Le prélèvement peut se faire manuellement ou par l'intermédiaire de l'automate.
On peut prévoir de récupérer aussi les protéines purifiées. Pour cela, il faut effectuer deux passes successives d'électro-purification, la première permettant de récupérer la fraction enrichie en acides nucléiques et la deuxième la fraction enrichie en protéines. Dans ce cas précis, les acides nucléiques doivent être récupérés entre ies deux passes, et sans vider le réservoir 3 supérieur du tampon qui contient les protéines qui n'ont pas fini de migrer.
Un dispositif tel que précédemment décrit peut ne comprendre que trois électrodes. En effet, les deux cathodes 61 et 81, respectivement affectées au circuit d'électro-séparation et au circuit de lyse, deviennent la cathode commune aux deux circuits. Dans ce cas, la lyse de l'échantillon biologique s'effectue dans le compartiment 32. Un tel dispositif peut étre utilisé sur la tranche. II sera alors facile de l'intégrer dans un automate grâce à ce gain de place. 5 in contact with the buffer solution.
In a preferred embodiment according to the invention, the time electric field application is at most 30 minutes, and preferably between 5 and 30 minutes.
In a very preferred embodiment according to the invention, the duration of migration of the nucleic fraction is 10 to 20 minutes, from preferably another 15 minutes.
In a preferred embodiment according to the invention, the value the molarity of the buffer solution is at least equal to 0.1 mol / l, and preferably between 0.1 and 5 mol / I.
The molarity of the buffer solution is between 0.1 and 5 mol / I, we can actually either put only the same buffer solution in the two compartments, either put two buffer solutions different in the two compartments.
The molarity of the buffer solution can be the same in two compartments and will be between 0.1 and 1 mol / I, preferably still 0.1 mol / I:
The molarity of the buffer solution may be different in the two compartments and will preferably be 0.1 mol respectively in the first compartment and 1 mol / I in the second compartment.
In a preferred embodiment according to the invention, the field electric has a value between 100 and 250 V, and preferably equal to 150 V.
In another very preferred embodiment according to the invention, the distance between the biological sample and the permeable membrane, along the lines of force of the electric field, is at least equal to 30 mm, and preferably 75 mm.
The cell lysate from which the process is carried out according to the invention can be a cell lysate from a single culture or complex, i.e. comprising different cells, or can be also a biological sample, such as in particular blood, urine and a respiratory type sputum.

s The cell lysate from which the nucleic fraction is obtained, then subjected to the process according to the invention, can be obtained by different lysis techniques, including lysis by mechanical shock, by electric shock and others.
In a preferred embodiment according to the invention, the biological sample results directly from the lysis of a sample cellular, in particular by mechanical or electrical means. This mode of realization is carried out in the same device, as described below.
In another preferred embodiment according to the invention, the cell lysate is obtained from a sample of a body fluid, for example blood or respiratory sputum.
When the biological sample is blood, it is preferred that the pH of the buffer solution is 7.
~ 5 The membrane recovering the fraction enriched in material nucleic acid has a predetermined cutoff threshold, preferably less than 100 kDa.
When the biological sample is blood, the porosity of the membrane at the cathode will preferably be greater than 10 kDa.
In a preferred embodiment according to the invention, a proteinase to the biological sample.
In yet another preferred embodiment according to the invention, the fraction enriched in nucleic material is directly subject to a subsequent amplification step.
The cell lysis will preferably still be carried out, by lysis electric in the presence of proteinase K and a detergent.
A second object according to the invention is a device for use unique for implementing a method according to the invention, comprising a support or base, in which are gathered and integrated, as well 3o that arranged together, the different means, in particular electrodes, required for electro-separation, as well as means for interfacing said support with the outside, on the one hand for the transfer of the various fluids or liquids to and / or out of the carrier, including the biological sample, the solution buffer, and the fraction enriched in nucleic material, and secondly for supply and control of electrical means required at least for electro-separation, of which connects from the electric field.

In a preferred embodiment according to the invention, the device comprises means for receiving the biological sample; a reservoir for the buffer solution, comprising a compartment closed by the permeable membrane, communicating at an end opposite to said compartment with the means for receiving the biological sample, said tank being intended to receive a first buffer solution; and one second tank for a second buffer solution, identical or different of the first buffer solution, separated from the first tank only by said membrane; two electric field generation electrodes, one in contact with the first buffer solution, upstream of the membrane according to the direction of circulation of the nucleic material, and the other in contact with the second buffer solution; and a means of extracting the enriched fraction in nucleic material from the compartment closed by the membrane.
In a very preferred embodiment according to the invention, the T5 tank includes another compartment, for receiving at least a fraction obtained from the biological sample, arranged upstream of said compartment according to the direction of circulation of the nucleic material, communicating with the means for receiving the biological sample.
In another preferred embodiment according to the invention, the two tanks communicate respectively with ventilation vents, and with at least one cana! filling.
In yet another preferred embodiment according to the invention, an intermediate well is arranged and communicates between the means for receiving the biological sample and the first reservoir.
In yet another preferred embodiment according to the invention, the intermediate well is provided with means making it possible to lyse a cell sample.
In yet another preferred embodiment according to the invention, the intermediate well is provided with electrodes ensuring lysis of said cell sample.
In yet another preferred embodiment according to the invention, the device comprises, communicating with each other, a lysate receiving compartment, an intermediate lysis well, and a compartment for receiving the fraction enriched in nucleic material.
In yet another preferred embodiment according to the invention, the volume of the iysat receiving compartment is greater the volume of the receiving compartment of the fraction enriched in material nucleic acid.
In yet another preferred embodiment according to ('invention, the proportion between the volumes of the receiving compartments of the lysate and receiving the nucleic fraction is between% 2 and 1/50, especially between 1/5 and 1/20.
A third object according to the invention is the use of the device described above for electro-separating a fraction of nucleic acids to from a cell lysate.
A fourth object according to the invention is the use of the electro-separated fraction by implementing the method according to the invention to detect and / or identify nucleic acids directly after amplification.
Figure 1 shows schematically a device ~ 5 electroelution of nucleic acids and proteins from a gel, and of electraphoretic concentration of macromolecules (Isco, Nebraska, USA), that we use in a different process, namely electro-separation according to the invention. Compartments A and B, in which two are immersed negative and positive electrodes respectively, are filled with buffer 20 TBE 1x; compartment C, comprising a part C1 and a part C2, and compartment Cf are filled with 0.1 x TBE buffer. A membrane of dialysis is placed at the interface of compartments Cf and B (porosity 100 kDa), and compartments C1 and A (porosity 10 kDa).
Figure 2 shows the percentage of nucleic acids in S.
25 epidermidis recovered in compartment Cf, after migration from a cell lysate obtained by mechanical shock, determined by analysis with a Vidas device (BioMerieux, France), according to example 2. On the abscissa the migration time (minutes) is represented, and on the ordinate is represented the percentage of nucleic acids recovered in the 30 compartment Cf, expressed in relative fluorescence units.
Figure 3 presents the protein recovery kinetics of a cell lysate. The percentage of proteins in the bacterial fysate is recovered in compartment Cf, after migration from a lysate cell obtained by mechanical shock, determined by Bradford assay, 35 according to Example 2. On the abscissa is shown the migration time (minutes), and on the ordinate is represented the percentage of acids nucleic acids recovered in compartment Cf, expressed in optical density (DO) at 595 nm.
Figure 4 shows the kinetics of acid recovery nucleic acids from cell lysate. The percentage of nucleic acids of Staphycoccus epidermidis, recovered in compartment Cf after migration from a cell lysate obtained by electric shock, is determined by analysis with a Vidas device, according to example 2. In abscissa is represented the migration time (minutes ?, and on the ordinate is represented the percentage of nucleic acids recovered in the compartment Cf, expressed in relative fluorescence units.
Figure 5 shows the amplification of nucleic acids purified from a cell lysate. The amount of amplicons produced by PCR from 10 NI of DNA molecules is recovered in the compartment Cf, from a cell lysate obtained by impact ~ 5 mechanical, after different migration times, according to Example 2. In abscissa is represented ie migration time (minutes), and on the ordinate is represented the percentage of nucleic acids recovered in ie compartment Cf, expressed in relative fluorescence units.
Figure 6 shows the amount of amplicons produced by 2o PCR amplification, after lysis of different initial concentrations of bacteria by mechanical shock, and migration of their nucleic material for 15 minutes under an electric field, according to example 2. In abscissa is represented the number of initial bacteria per 200 ass of lysate, and on the ordinate is represented the signal obtained after PCR, expressed in 25 relative fluorescence units.
Figure 7 illustrates the quantity of ampücons produced by amplification TMA, after lysis of different initial concentrations of bacteria by mechanical shock, and migration of their nucleic material for 15 minutes under an electric field, according to example 2. On the abscissa 30 is represented the number of initial bacteria per 200 μl of lysate, and in ordinate is represented the signal obtained after TMA, expressed in DO x 1000.
Figure 8 shows the percentage of protein in the blood recovered in compartment Cf depending on the migration time of a 35 clinical blood sample lysed by mechanical shock, according to Example 3.
On the abscissa is represented the migration time (minutes), and on the ordinate the percentage of proteins recovered in the compartment is shown Cf, expressed in OD at 595 nm.
Figure 9 shows the percentage of proteins in a sputum recovered in compartment Cf depending on the migration time of a 5 clinical sample of respiratory type lysed by mechanical shock, according to Example 2. On the abscissa is shown the migration time (minutes), and on the ordinate is represented the percentage of proteins recovered in the compartment Cf, expressed as OD at 595 nm.
Figure 10 shows the elimination of PCR inhibitors t0 initially present in the clinical respiratory type sample. She indicates the quantity of DNA amplicons produced by PCR from different initial amounts of S DNA, epidermidis; according to example 5.
The abscissa shows the number of initial DNA copies for 10 NI
sample, and on the ordinate is represented the signal obtained after PCR, expressed in relative fluorescence units.
Figure 11 shows the amount of amplicons produced from different initial amounts of bacteria lysed and deposited in the compartment C1. Each point represented on the graph represents a average value obtained from 13 sputum and bronchial aspirations different, according to example 5. On the abscissa is shown the number of initial DNA copies for 200 µl of sample, and on the ordinate is represented the signal obtained after PCR, expressed in relative units of fluorescence.
Figure 12 shows the amount of amplicons produced from different initial quantities of bacteria lysed by mechanical shock, and deposited in compartment C1, according to example 5. The study was performed in parallel on 4 different sputum. The abscissa shows the number of copies of initial DNA for 200 μl of sample, and in ordinates is represented the signal obtained after TMA, expressed in DO x 1000.
FIG. 13 represents a disposable device according to the invention, seen in perspective.
Figure 14 shows a bottom view of the device shown in Figure 13.
Figure 15 shows a top view of the device shown in Figure 13.

Figure 1 F shows a view in. cut, according to cutting line shown in FIG. 15, of the device according to FIG. 13.
Example 1: General procedure for implementing the method according to the invention.
The operating mode is based on the use of a device electroefution of nucleic acids according to Figure 1. One volume of biological sample is carefully placed at the bottom of the compartment C1. The two circuit electrodes are connected to a electric generator. A constant voltage of 150 V is applied to generator terminals. The circuit intensity varies from 15 to 20 mA and the buffer temperature in compartment C varies from 23 to 30 ° C. The biological molecules initially deposited at the bottom of compartment C1 migrate in the electric field thus created, at a speed defined as a function of their charge and their size. After different migration times, the voltage at the generator terminals is stopped and the molecules having migrated to fa cathode and of apparent molecular weight less than or equal to 10 kDa are collected in compartment Cf, in a final volume of 200, ul.
The sample thus recovered is kept in ice before analysis.
The biological sample deposited in compartment C1 can be a purified or not purified nucleic and / or protein material, a lysate cellular, from a biological sample such as blood, urine and sputum respiratory type. The cell lysates studied were obtained from of S. epidermidis, Gram + walled bacteria (A054). These bacteria are grown in liquid medium BCC (Bouillon Coeur Cervelle, bioMerieux 410191. Before lysis, they are suspended, either in a clinical specimen (liquefied and decontaminated sputum, blood, plasma, serum, ....), either in lysis buffer (30 mM Tris-HCI, 5 mM EDTA, 100 mM NaCI pH 7.2). 300 μl of this cell suspension were lysed in basically following two protocols - Protocol of Ivse oar mechanical shocks: 90, ul of beads glass diameter between 90 and 150 Nm, 3 iron balls of diameter 2 mm and 5 glass beads of 3 mm diameter are placed in a tube Faicon in the presence of 300Ni of the cell suspension, as described in the patent (FR-A-2 768 7431. 6 mg / ml final proteinase K (PK) (EC
3.4.21.14 Boehringer-Mannheim, ref. 10927661 can be added to the cell suspension. The closed tube is vortexed for two minutes, at W0 99/53304 PCTlFR99 / 00830 maximum power of the device (Reax 2000, Heidolph). Suspension bacterial thus treated and recovered is immediately deposited in the compartment C1 of the device described in Figure 1. If the PK is present in the cell solution, an additional incubation of 15 minutes at 37 ° C is achieved.
I ~ se protocol by electric shock: 300, ul of the cell suspension are deposited in an electroporation tank characterized by a distance between the two electrodes of 2 mm, in presence of 0.01 to 6 mg / ml final PK: The tank is placed in a circuit ~ 0 electrical, the parameters of which are chosen as follows: voltage 500 V, resistance 186 Ohms, capacity of 500 or 1500, uFD. After launch of an electrical impulse, the electrical discharge takes place in a few milliseconds between the two electrodes. The lysate thus recovered is deposited immediately in compartment A of the device described in Figure 1 ~ 5 (FR-A-2 763 957).
The percentage of nucleic acids collected from the cathode, after migration into compartment Cf, is determined by OD measurement (optical density) of the sample recovered at 260 nm. The percentage collected is equal to the ratio of the OD value at 260 nm after 20 migration, on the OD value at 260 nm before migration. Likewise, the amount of protein collected at the cathode after migration is determined by Bradford assay and OD reading at 595 nm. The percentage of protein collected is equal to the ratio of the amount protein recovered from the initial quantity.
25 The amount of nucleic acids recovered from the cathode after migration is checked on 0.8% agarose gel; 10 NI from the sample are deposited by well, the electrophoretic migration is performed under constant voltage (150 V) and the gel is colored with bromide of ethidium (BET) before observation under radiation - ultraviolet. In In parallel, the proteins recovered at the cathode after migration can be observed on polyacrylamide gel in the presence of SDS (SDS-PAGE
10%); - 5 to 10 NI of the sample are deposited per well, migration electrophoretic is carried out under constant intensity (25 mA), and the gel is colored with Coomassie blue.
35 The quantity of nucleic acids recovered from the cathode side is determined by specific detection using a hybridization technique called sandwich, using the Vidas device marketed by bioMérieux (France). Oligonucleotide capture and detection probes specific for S. epidermidis nucleic acids (EP-A-0 632 269) have been chosen. The capture and detection oligonucleotides have respectively for sequence: 5'-GACCACCTGTCACTCTGTCCC-3 '(SEQ
ID No: 1) and 5'-GGAAGGGGAAAACTCTATCTC-3 '(SEQ ID No: 2).
The detection probe is labeled by coupling with alkaline phosphatase (AKP). The specific hybridization of these probes with nucleic acids released into the lysate is a function of the amount of nucleic acids present, but also their accessibility for the probes used.
Two specific amplification protocols for DNA molecules and RNA of S. epidermidis were produced from the samples collected after migration: a PCR protocol for amplification of DNA
and a NASBA protocol for amplification of rR16S and a protocol TMA for amplification of 16S rRNA.
- PCR protocol: the PCR technique followed is that described by Goodman in PCR Strategies, Ed: Innis, Gelford and Sninsky Academic press 1995, pp 17-31. Two amplification primers were used, they show the following sequences Primer 1: 5'-ATCTTGACATCCTCTGACC-3 '(SEQ ID N °: 3) Primer 2: 5'-TCGACGGCTAGCTCCAAAT-3 '(SEQ ID N °: 4) The following temperature cycles were used 1 time 3 minutes at 94 ° C
2 minutes at 65 ° C
35 times 1 minute at 72 ° C
1 minute at 94 ° C
2 minutes at 65 ° C
1 time 5 minutes at 72 ° C
- TMA protocol: the TMA technique followed is that described by US-A-5,554,516. Two amplification primers were used, elves show the following sequences Primer 1. 5'-TCGAAGCAACGCGAAGAACCTTACCA -3 '(SEQ
ID No: 5) Primer 2: 5'-AATTCTAATACGACTCACTATAGGGAGGTT
TGTCACCGGCAGTCAACTTAGA -3 '(SEQ ID N °: 6) , ul or 50 NI of collected sample are used for each PCR and TMA test, respectively. The amplicons produced by PCR are observed on 0.8% agarose gel and quantified on Vidas according to the protocol described above. The amplicons produced by TMA are detected and 5 quantified on microplate by hybridization with a capture probe and a detection probe, specific for S. epidermidis, according to the method described by P. Cros et al., Lancet 1992, 240: 870. The detection probe is coupled with "Horse Radish Peroxidase" (HRP). Both ~ probes show the following sequences 10 Capture probe: 5'-GATAGAGTTTTCCCCTTC-3 '(SEQ ID
N °: 7) Detection probe: 5'-GACATCCTCTGACCCCTCTA -3 'tSEQ
ID No: 8) EXAMPLE 2 Kinetics of Recovery of Nucleic Acids from cell lysate.
A suspension of Staphylococcus epidermidis (1-5.109 b./300,u1) is lysed by mechanical shock or by electric shock, as described in the general protocol above. 200 ass of each lysate are deposited at the bottom of compartment C1. Electric field is applied 2o for different times between the two electrodes. Amounts of acids nucleic or protein present in the sample collected in the compartment Cf are determined by analysis with a Vidas device or Bradford assay, respectively. The quality of the molecules recovered has was assessed on agarose or acrylamide gel, in the presence of SDS.
- Cell LYsat obtained by mechanical shock Lysate nucleic acids have migrated into the compartment See gradually over time, as shown in Figure 2. After 60 minutes, all of the lysate nucleic material is recovered, some either the presence or not of proteinase K during the lysis step. This result 3o is in favor of good release and accessibility of nucleic acids in the lysate. The DNA molecules recovered have the same profile migration on agarose gel 0: 8% than before migration into the lysate. In presence of proteinase K during the lysis step, as shown in Figure 3, only a negligible percentage of protein is recovered after 60 minutes, while in the absence of protease, about 50% protein are recovered.

- The cell at ~ obtained by electric shock.
In the presence of PK during the lysis step, as shown in Figure 4, the nucleic acids of the lysate gradually migrate to the cathode. After 60 minutes, a large percentage of nucleic acids 5 is recovered. Recovery of the nucleic material initially present in this lysate is similar to that of the nucleic material initially present in a lysate obtained by mechanical shock (see above). However, in absence of PK during the lysis step, no nucleic acid can be detected in compartment Cf, even after 60 minutes of migration 10 (Vidas analysis and 0.8% agarose gel). On ge! of agarose, the molecules of DNA and RNA from the lysate recovered can be observed separately after migration, when they are not initially in the lysate.
- Amplification of purified nucleic acids from Ivsat cellular 15 S. epidermidis bacteria diluted in 300 NI of buffer lysis are lysed by mechanical shock in the absence of PK, as described in the general protocol of Example 1. 200, u1 of the lysate are deposited at bottom of compartment C1. An electric field is applied between the two electrodes for different times. The nucleic material that has migrated into the compartment Cf is amplified by PCR (10 NI per test) or TMA (50 NI
per test). The amount of amplicons produced is analyzed by hybridization specific on Vidas or microplate, respectively.
- PCR amplification of DNA molecules recovered after migration For 104 initial high school bacteria, deposited in the compartment C1, different quantities of amplicons are produced, as a function of migration time. For 15 minutes of migration, like shown in Figure 5, the DNA molecules recovered allow a optimal production of amplicons by PCR. Before 15 minutes, a quantity 3o lower DNA molecules are recovered. For 20 minutes and after, more DNA molecules are recovered, but from quality less suitable for optimal PCR amplification. Plus migration the longer the structure of the nucleic acid can be altered. In order to get optimal PCR amplification, a compromise between quantity and quality of DNA molecules recovered at the cathode must be observed. This result has been confirmed using initial suspensions of S. epidermidis plus concentrated (105-106 initial bacteria / 200, u1).
As shown in Figure 6, the DNA of a higher number or equal to 1.103 initial bacteria (/ 200NI) can be amplified and detected, after mechanical lysis of the cells and migration of the lysate constituents under electric field; or 102 DNA molecules or bacteria per test PCR, since the migrated material is recovered in 200, ul and 10 , ul of this material is used for each PCR assay. 102 DNA molecules correspond to the sensitivity limit of the PCR protocol, so general. This result demonstrates a high sensitivity of recovery of bacterial DNA molecules after cell lysis by mechanical shock and purification of intracellular DNA molecules by electric field in solution.
- Amplification TMA of RNA molecules recur ~ ered after migration As shown in Figure 7, the RNA of at least 40 bacteria initials (1200 ~ r1) can be detected after lysis of bacteria, migration of cell constituents under electric field and amplification specific for Rs16S of S epidermidis; or 10 initial bacteria per TMA test, given that the migrated nucleic material is recovered in 200 final NI, and 50 NI are added per TMA test. This result testifies high sensitivity for recovery of 16S rRNA molecules bacterial, after lysis by mechanical shock and purification of acids nucleic acid of the lysate by electric field.
EXAMPLE 3 Kinetics of Recovery of Nucleic Acids from a blood sample.
The blood sample is used without pre-treatment.
200 ~ I of this clinical sample is deposited at the bottom of compartment C1.
A voltage of 150 V is applied between the two electrodes for different times, then the material recovered from the cathode side in the compartment Cf is analyzed by assaying proteins according to the Bradford, and on polyacrylamide gel in the presence of SDS iSDS-PAGE
10%).
In this example, the pH of the TBE buffer used for migration was set at pIH 7.0, ie the isoelectric point of hemoglobin being equal to 7Ø
50 or 100 kDa membranes were placed at the interface of the compartments Cf and B. As shown in Figure 8, after 60 minutes of migration, a negligible percentage of protein is recovered with the 100 kDa membrane, and 10% of the proteins are recovered with the 50 kDa membrane. At pH 7.0, only 10% of the proteins negatively charged blood cells at pH 7.0 have molecular weight apparent greater than 50 kDa and less than 100 kDa. A percentage negligible protein is recovered after 15 minutes of migration, in using either a 50 or 100 kDa membrane. These conclusions were verified on polyacrylamide gel in the presence of 10% SDS-PAGE.
The porosity of the membrane will preferably be greater than 10 kDa, so as not to get too high a percentage of protein.
EXAMPLE 4 Kinetics of Recovery of Nuclear Acids from a respiratory type sample.
Before use, the respiratory sample is fluidized, decontaminated according to the standard protocol with N-acetyl-L-cysteine and soda (NALC / NaOH); then it is inactivated for 20 minutes at 95 ° C.
In this example, the TBE buffer used for migration has a pH equal to 8.3 or 7.0, and membranes of different pore sizes have have been placed at the interface of compartments Cf and B: 10, 50 or 100 kDa.
As shown in Figure 9, at pH 8.3, 10% of the proteins are recovered after 30 minutes, and 70-80% after 60 minutes with 50 or 10 kDa membranes, suggesting that 70-80% of the proteins in sputum are negatively charged at these pHs and have molecular weight apparent greater than 50 kDa. At pH 7.0, approximately 0% of the proteins are recovered after 30 or fi0 minutes of migration, whatever the size of the pores of the membrane used (within the limit of sensitivity of the techniques used). At this pH, 55-60% of proteins previously recovered at pH 8.0 are no longer negatively charged. With the membranes of 10 or 50 kDa, a negligible percentage of the proteins of the sputum is recovered after 15 minutes of migration. We checked this point on polycrylamide gel in the presence of 10% SDS-PAGE.
Example 5 Lifting of Inhibition of Amplification Protocols by respiratory-type samples after migration.
Respiratory-type samples are inhibitors of PCR and TMA reactions. 200, ul of these samples were deposited at the bottom of compartment C1 of the system described in Figure 1. A voltage of 150 V

constant was applied between the two electrodes for 15 minutes. A
10 kDa separation membrane between Cf and B was chosen. After migration, the sample recovered in compartment Cf (200, u!) was supplemented with different amounts of purified nucleic acids from S.
epidermidis. 10 NI or 50 µl of this solution was used for each PCR or TMA test, respectively. As shown in Figure 10, up to 102-103 initial copies of DNA can be amplified in 10 NI
migrated sample. This result shows that the migrated sputum has lost its inhibitory character of PCR. Similar results have been obtained with TMA amplification.
1-5.109 S. epidermidis were seeded in 300, ui of fluidized sputum, decontaminated and inactivated as described in Example 4 above. These suspended cells were lysed by mechanical shock in absence of PK, and the lysate migrated for 15 minutes at 150 V with ~ 5 a 10 kDa membrane between compartments Cf and B, according to the diagram presented in Figure 1. The amount of bacterial nucleic acids recovered in compartment Cf after migration was quantified by Vidas analysis specific to the bacterial species studied. The experiment was carried out at from different sputum. On average, 80% of nucleic acids S.
2o epidermidis are recovered. This result indicates that the molecules of the sputum matrix do not interfere with the migration of DNA molecules and of RNA from the bacterial lysate in the electric field, under these conditions. At on the contrary, it seems that the environment is conducive to better recovery and / or migration of these molecules.
25 PCR amplification:
S. epidermidis bacteria were seeded in 300 µl sputum fluidized, decontaminated, inactivated, then lysed by mechanical shock in the absence of PK as described in! ex. 1.200, ui of the lysate has migrated for 15 minutes at 150V with a 10 kDa membrane between the 3o compartments Cf and B. The nucleic material present in the sample has was amplified by PCR t10, ul per test), and the ampoules produced were quantified by Vidas analysis: As shown in Figure 11, up to 104-103 initial lysed bacteria (i200, u1 lysate? Can be detected after migration and amplification of DNA molecules (i.e. 100-10 35 DNA molecules / 10, u1 PCR test). This result, on the one hand confirms a very good recovery performance of bacterial DNA molecules from lysate in the sputum, and on the other hand demonstrates very good elimination PCR inhibitors initially present in sputum.
TMA amplification:
As for the PCR amplification study described here before, S. epidermidis bacteria were seeded in 300 μl of fluidized, decontaminated, inactivated sputum then lysed by mechanical shock in absence of PK. 200 µl of lysate migrated for 15 minutes at 150V
with a 10 kDa membrane between compartments Cf and A. The rRNA molecules present in the recovered sample were amplified 90 by TMA (50, ul per test), and the amplicons produced were quantified through specific sandwich hybridization on microplate. As shown in the Figure 12, at least 106-105 initial lysed bacteria (lysate i200p1) can be detected after migration and amplification of molecules of RNA (i.e. at least 5.104-5.103 initial bacteria / 50, μl of TMA test).
This result demonstrates the elimination of TMA inhibitors initially present in sputum.
Example 6: Electro-separation after lysis by electric shock.
1-5.1 O9 S. epidermidis were seeded in 300 µl of fluidized, decontaminated and inactivated sputum as described in Example 4.
These suspended cells were lysed by electric shock in the presence 102 mgiml final PK and 2% final LLS (Lithium Lauryl Sulfate, Sigma). 200 μl of lysate migrated for 15 minutes at 150 V with a 10 kDa membrane between compartments Cf and B, according to the diagram presented in Figure 1. The nucleic material recovered after migration (200 , ul) was amplified by PCR specific for S. epidermidis (10 μl / test), and the amplicons produced were quantified by Vidas analysis. Up to 104-105 initial lysed bacteria (Iml) can be detected after migration and amplification of DNA molecules (i.e. 100-10 DNA molecules / 10 NI
PCR test, which represents the sensitivity limit of the PCR technique used).
In accordance with FIGS. 13 to 16, below is described a disposable device, i.e. consumable, or disposable after use, allowing to implement the electro-separation process described and exemplified previously.
Such a device comprises a support 1, or base, having generally a parallelepiped shape, including in particular a WU 99/53304 PCT / F'R99 / 00830 upper face 1 b, a lower face 1 c and a lateral flank 1 a, shown in Figures 13 and 14:
Generally in this support 1, are collected and integrated, as well as arranged between them, the different means, in particular 5 electrodes required for electro-separation, as well as means interfacing corresponding to the side 1a of the support 1 with the outside, on the one hand for the transfer of different fluids or liquids to and / or out support 1, including the treated biological sample, ie aqueous liquid medium (buffers) and the fraction enriched in nucleic matter, and on the other hand for 10 supply and control of the electrical means required at least for Electro-separation, including that of the electric field.
Not shown, by way of example, the two faces 1 a and 1 b of the device, or card, are coated with a transparent film, waterproof; adhering to the support, and closing the various conduits and cavities ~ 5 shown on the surface in Figures 13 and 14.
This device also includes a means 2 for receiving the treated biological sample a first reservoir 3 for a first liquid medium with (TBE buffers diluted 10 times), itself comprising a compartment 31 20 closed by a permeable membrane 4, for example having a capacity of around 100 Nl, as well as another compartment 32, with a capacity 1 ml, for the reception of at least a fraction obtained from a biological sample; this other compartment is arranged upstream of the compartment 31 according to the direction of circulation of the nucleic material, under the effect of the electric field, and communicates itself with the means of reception 2 of biological sample - a second reservoir 5 for a second aqueous liquid medium (for example TBE buffer, once concentrated), identical or different from first aqueous liquid, separated from the first reservoir 3, only by the membrane 4 - two electrodes 61 and 62 for generating an electric field, communicating with two electrical contact pads 63 and 64 on the side 1a; one of the electrodes, namely 61, or cathode, is in contact with the first aqueous liquid medium in the first tank 3, and the other electrode 62, or anode, is in contact with the second aqueous medium in the second tank 5 WO 99/53304 PCT / FR99 / 00 $ 30 - a means of extraction 9 of the fraction enriched in material nucleic acid of compartment 31 closed by membrane 4 The two tanks 3 and 5 communicate respectively with ventilation vents 33 and 53, and with at least one filling channel 34 communicating as far as it is concerned with the second reservoir 5.
An intermediate well 7 is arranged and communicates between the means 2 for receiving the biological sample and the first reservoir 3.
This well is not compulsory, since the lysate can be deposited directly in compartment 32. This well 7 is provided with means allowing to lyse a cell sample to obtain a fraction then subjected to electro-separation; these means are electrodes 81 and 82, allowing the sample to be exposed to one or more pulses electrical, in accordance with the process described elsewhere in the application FR-A-2 7fi3 patent application in the name of the Applicant. These electrodes 81 and 82 communicate with contact pads respectively electrical 83 and 84 provided on the side 1 a. There are therefore two circuits electrical, one associated with electrodes 81 and 82, and the other associated with electrodes 61 and 62.
I - Prenaratian of the device Before starting any reaction, fill tanks 3 and 5 of buffer. The latter can be constituted by a TBE buffer (Tris-Borate-EDTA1 whose concentration varies from one reservoir to another. We fills the first tank 3, upper, by the receiving means 2, with of buffer diluted ten times, and the second reservoir 5, lower, through channel 34 with buffer once concentrated. The air vents 33 are drilled and 53 at the level of the waterproof films covering the faces 1 a and 1 b, in order to allow air to escape when filling the tanks.
1) Lyse The sample is introduced into the receiving means 2 with the aid with a pipette, manually or by an automated device. The volume of the sample is between 0 and 1 ml. He then arrives in the well lysis intermediate 7. Lysis is carried out thanks to an electric discharge of 500 V for approximately 1 second, between electrodes 81 and 82.
In case the sample volume is more than 50 ass, several lysis steps are carried out one after the other, the lysed fractions being transferred progressively to the compartment 32 reception.
2) Electro-separation Once the sample has been lysed and completely transferred to the compartment 32 for starting the electro-separation, the first circuit the electrodes 81 and 82 is open, the second of the electrodes 61 and 62 is closed. The constituents of the negatively charged iysat will then migrate to the anode 62. The nucleic acids being strongly negatives will migrate faster. We can therefore recover them selectively above the membrane 4, at the receiving compartment 31 via the sampling channel 9.
The current imposed for this migration is between 0 and 30 mA, at a voltage of 150 V. The optimal duration of migration is about 15 minutes.
In order to recover the nucleic acids, the tank 3 is emptied higher until there is no longer a fluidic connection between the compartment 32 and the receiving compartment 31. This is then taken with a pipette, via channel 9, the 100 μl of buffer contained in the compartment 31. Sampling can be done manually or by through the automaton.
We can also plan to recover the purified proteins. For This requires two successive passes of electro-purification, the first to recover the fraction enriched in nucleic acids and the second the protein-enriched fraction. In this specific case, the nucleic acids must be recovered between two passes, and without empty the upper reservoir 3 of the buffer which contains the proteins which have not not finished migrating.
A device as previously described may not include than three electrodes. Indeed, the two cathodes 61 and 81, respectively assigned to the electro-separation circuit and to the lysis circuit, become the cathode common to the two circuits. In this case, lysis of the sample biological is carried out in compartment 32. Such a device can be used on the edge. It will then be easy to integrate it into an automaton thanks to this space saving.

Claims (21)

REVENDICATIONS 1/ Utilisation d'un procédé de traitement d'un échantillon sous l'action d'un champ électrique en milieu liquide, ledit échantillon étant libre et mobile dans ledit milieu liquide sous l'action du champ électrique, procédé selon lequel a) on dispose d'une solution tampon, b) on dispose d'une membrane perméable, en contact d'un côté
avec la solution tampon, et ayant un seuil de coupure prédéterminé pour arrêter ledit échantillon, du côté de ladite solution tampon, lors de sa migration sous l'action du champ électrique, c) on établit ledit champ électrique, en sorte que ses lignes de force passent au sein de la solution tampon, et traversent la membrane perméable, d) on dispose l'échantillon dans la solution tampon, en amont de la membrane, selon le sens de circulation du matériel nucléique sous l'action du champ électrique, caractérisée en ce que pour séparer un matériel nucléique d'un échantillon biologique comprenant à la fois ledit matériel nucléique, et un matériel non nucléique, par exemple un protéique, - on applique le champ électrique directement à l'échantillon biologique dans la solution tampon, pendant une durée limitée et définie, d'une part par le temps suffisant pour l'arrivée sur la membrane et la présence de matériel nucléique du côté de la solution tampon, et d'autre part par le fait qu'au terme de ladite durée le matériel non nucléique n'a pas migré et/ou demeure en cours de migration vers ladite membrane, - on prélève le matériel nucléique au terme de ladite durée, moyennant quoi on électro-sépare au moins le matériel nucléique de l'échantillon biologique. 1/ Use of a process for processing a sample under the action of an electric field in a liquid medium, said sample being free and mobile in said liquid medium under the action of the electric field, process by which a) a buffer solution is available, b) we have a permeable membrane, in contact on one side with the buffer solution, and having a predetermined cut-off threshold for stop said sample, on the side of said buffer solution, during its migration under the action of the electric field, c) said electric field is established, so that its lines of force pass within the buffer solution, and cross the membrane permeable, d) the sample is placed in the buffer solution, upstream of the membrane, depending on the direction of circulation of the nucleic material under the action of the electric field, characterized in that to separate a nucleic material from a biological sample comprising both said nucleic material, and a non-nucleic material, for example a protein, - the electric field is applied directly to the sample biological solution in the buffer solution, for a limited and defined period, on the one hand by the sufficient time for the arrival on the membrane and the presence of nucleic material on the side of the buffer solution, and on the other part by the fact that at the end of the said period the non-nucleic material has not migrated and/or remains in the process of migrating towards said membrane, - the nucleic material is collected at the end of the said period, whereby at least the nucleic material of the biological sample. 2/ Utilisation selon la revendication 1, caractérisée en ce que l'échantillon biologique comprend un lysat cellulaire. 2 / Use according to claim 1, characterized in that the biological sample comprises a cell lysate. 3/ Utilisation selon la revendication 1 ou 2, caractérisée en ce que l'échantillon biologique est disposé sur une autre membrane, du côté
de cette dernière en contact avec la solution tampon. 3 / Use according to claim 1 or 2, characterized in that that the biological sample is placed on another membrane, on the side of the latter in contact with the buffer solution. 4/ Utilisation selon la revendication 1 ou 2, caractérisée en ce que le temps d'application du champ électrique est au plus de 30 minutes, et préférentiellement compris entre 5 et 30 minutes. 4 / Use according to claim 1 or 2, characterized in that that the application time of the electric field is at most 30 minutes, and preferably between 5 and 30 minutes. 5/ Utilisation selon la revendication 1 ou 2, caractérisée en ce que la valeur de la molarité de la solution tampon est au moins égale à 0,1 mol/l, et préférentiellement comprise entre 0,1 et 5 mol/l. 5 / Use according to claim 1 or 2, characterized in that that the value of the molarity of the buffer solution is at least equal to 0.1 mol/l, and preferably between 0.1 and 5 mol/l. 6/ Utilisation selon la revendication 1 ou 2, caractérisée en ce que le champ électrique a une valeur comprise entre 100 et 250 V, et préférentiellement égale à 150 V. 6 / Use according to claim 1 or 2, characterized in that that the electric field has a value between 100 and 250 V, and preferably equal to 150 V. 7/ Utilisation selon la revendication 1 ou 2, caractérisée en ce que la distance séparant l'échantillon biologique de la membrane perméable, est au moins égale à 30 mm, et préférentiellement à 75 mm. 7 / Use according to claim 1 or 2, characterized in that that the distance separating the biological sample from the membrane permeable, is at least equal to 30 mm, and preferably to 75 mm. 8/ Utilisation selon la revendication 7, caractérisée en ce que l'échantillon biologique est obtenu à partir d'un prélèvement d'un liquide corporel, par exemple sang ou crachat respiratoire. 8 / Use according to claim 7, characterized in that the biological sample is obtained from a sample of a liquid bodily, e.g. blood or respiratory sputum. 9/ Utilisation selon la revendication 1 ou 2, caractérisée en ce que l'on ajoute une protéinase à l'échantillon biologique. 9 / Use according to claim 1 or 2, characterized in that that a proteinase is added to the biological sample. 10/ Utilisation selon la revendication 1 ou 2, caractérisée en ce que la fraction enrichie en matériel nucléique est directement soumise à
une étape subséquente d'amplification. 10 / Use according to claim 1 or 2, characterized in that that the fraction enriched in nucleic material is directly subjected to a subsequent amplification step. 11/ Utilisation d'un dispositif de traitement d'un échantillon, ledit dispositif comprenant un moyen de réception (2) dudit échantillon ;
un réservoir (3) pour une solution tampon, comportant un compartiment (31) fermé par une membrane (4) perméable, communiquant à une extrémité opposée audit compartiment (31) avec le moyen de réception (2) de l'échantillon biologique, ledit réservoir étant destiné à recevoir une première solution tampon; et un second réservoir (5) pour une seconde solution tampon, identique ou différente de la première solution tampon, séparé du premier réservoir uniquement par ladite membrane; deux électrodes (61, 62) de génération du champ électrique, l'une (61) au contact de la première solution tampon, en amont de la membrane selon le sens de circulation de l'échantillon, et l'autre (62) au contact de la seconde solution tampon; et un moyen d'extraction (9) d'une fraction du compartiment fermé (31) par la membrane, caractérisé en ce que, pour séparer un matériel nucléique d'un échantillon biologique, comprenant à la fois ledit matériel nucléique, et un matériel non nucléique, par exemple protéique:
- on applique le champ électrique, pendant une durée limitée et définie, d'une part par le temps suffisant pour l'arrivée sur la membrane et la présence de matériel nucléique du côté de la première solution tampon, et d'autre part par le fait qu'au terme de ladite durée le matériel non nucléique n'a pas migré et/ou demeure en cours de migration vers ladite membrane, - on prélève le matériel nucléique au terme de ladite durée, moyennant quoi on électro-sépare au moins le matériel nucléique de l'échantillon biologique. 11/ Use of a sample processing device, said device comprising means for receiving (2) said sample;
a reservoir (3) for a buffer solution, comprising a compartment (31) closed by a permeable membrane (4), communicating to a end opposite said compartment (31) with the receiving means (2) of the biological sample, said reservoir being intended to receive a first buffer solution; and a second tank (5) for a second buffer solution, identical to or different from the first buffer solution, separated from the first tank only by said membrane; of them electrodes (61, 62) for generating the electric field, one (61) at contact of the first buffer solution, upstream of the membrane according to the direction of circulation of the sample, and the other (62) in contact with the second buffer solution; and a means for extracting (9) a fraction of the compartment closed (31) by the membrane, characterized in that, for separating a nucleic material from a biological sample, comprising at the both said nucleic material, and a non-nucleic material, for example protein:
- the electric field is applied, for a limited duration and defined, on the one hand by the sufficient time for the arrival on the membrane and the presence of nucleic material on the side of the first buffer solution, and on the other hand by the fact that at the end of the said period the material not nucleic acid has not migrated and/or remains in the process of migration towards said membrane, - the nucleic material is collected at the end of the said period, whereby at least the nucleic material of the biological sample. 12/ Utilisation selon la revendication 11, caractérisée en ce que le réservoir (3) du dispositif de traitement comprend un autre compartiment (32), pour la réception d'au moins une fraction obtenue à partir de l'échantillon biologique, disposé en amont dudit compartiment (31) selon le sens de circulation du matériel nucléique, communiquant avec le moyen de réception de l'échantillon biologique. 12 / Use according to claim 11, characterized in that the tank (3) of the treatment device comprises another compartment (32), for receiving at least one fraction obtained from the biological sample, arranged upstream of said compartment (31) according to the direction of circulation of the nucleic material, communicating with the means of receipt of the biological sample. 13/ Utilisation selon la revendication 11, caractérisée en ce que les deux réservoirs (3,5) du dispositif de traitement communiquent respectivement avec des évents d'aération (33, 53), et avec au moins un canal de remplissage (34). 13 / Use according to claim 11, characterized in that the two reservoirs (3,5) of the treatment device communicate respectively with ventilation vents (33, 53), and with at least one filling channel (34). 14/ Utilisation selon la revendication 11, caractérisée en ce que un puits intermédiaire (7) du dispositif de traitement est disposé et communique entre le moyen de réception (2) de l'échantillon biologique et le premier réservoir (3). 14 / Use according to claim 11, characterized in that an intermediate well (7) of the treatment device is arranged and communicates between the means (2) for receiving the biological sample and the first tank (3). 15/ Utilisation selon la revendication 14, caractérisée en ce que le puits intermédiaire (7) est pourvu de moyens permettant de lyser un échantillon cellulaire. 15 / Use according to claim 14, characterized in that the intermediate well (7) is provided with means making it possible to lyse a cell sample. 16/ Utilisation selon la revendication 15, caractérisée en ce que le puits intermédiaire (7) est pourvu d'électrodes (81,82) assurant une lyse dudit échantillon cellulaire. 16 / Use according to claim 15, characterized in that the intermediate well (7) is provided with electrodes (81,82) providing lysis of said cell sample. 17/ Utilisation selon la revendication 11, caractérisée en ce que le dispositif de traitement comprend, communiquant les uns avec les autres, un compartiment (32) de réception du lysat, un puits intermédiaire de lyse (7), et un compartiment de réception (31) de la fraction enrichie en matériel nucléique. 17 / Use according to claim 11, characterized in that the processing device comprises, communicating with each other others, a compartment (32) for receiving the lysate, an intermediate well lysis (7), and a receiving compartment (31) of the fraction enriched in nucleic material. 18/ Utilisation selon la revendication 17, caractérisée en ce que, dans le dispositif de traitement, le volume du compartiment de réception (32) du lysat est supérieur au volume du compartiment de réception (31) de la fraction enrichie en matériel nucléique. 18 / Use according to claim 17, characterized in that, in the processing device, the volume of the receiving compartment (32) of the lysate is greater than the volume of the reception compartment (31) of the fraction enriched in nucleic material. 19/ Utilisation selon la revendication 18, caractérisée en ce que la proportion entre les volumes des compartiments de réception du lysat et de réception de la fraction nucléique est comprise entre 1/2 et 1/50, notamment entre 1/5 et 1/20. 19 / Use according to claim 18, characterized in that the proportion between the volumes of the lysate receiving compartments and reception of the nucleic fraction is between 1/2 and 1/50, especially between 1/5 and 1/20. 20/ Utilisation selon la revendication 11, pour électro-séparer une fraction ou la totalité des acides nucléiques, à partir d'un lysat cellulaire. 20 / Use according to claim 11, for electro-separating a fraction or all of the nucleic acids, from a lysate cellular. 21/ Utilisation selon la revendication 11, caractérisée en ce que la fraction étectro-séparée est utilisée pour détecter et/ou identifier des acides nucléiques directement après amplification. 21 / Use according to claim 11, characterized in that the electro-separated fraction is used to detect and/or identify nucleic acids directly after amplification.
CA002328298A 1998-04-10 1999-04-09 Method for electroelution of a biological sample and implementing device Abandoned CA2328298A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR98/04878 1998-04-10
FR9804878A FR2777293B1 (en) 1998-04-10 1998-04-10 ELECTRO-SEPARATION PROCESS OF A BIOLOGICAL SAMPLE AND IMPLEMENTATION DEVICE
PCT/FR1999/000830 WO1999053304A1 (en) 1998-04-10 1999-04-09 Method for electroelution of a biological sample and implementing device

Publications (1)

Publication Number Publication Date
CA2328298A1 true CA2328298A1 (en) 1999-10-21

Family

ID=9525403

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002328298A Abandoned CA2328298A1 (en) 1998-04-10 1999-04-09 Method for electroelution of a biological sample and implementing device

Country Status (6)

Country Link
EP (1) EP1070246A1 (en)
JP (1) JP2002511583A (en)
AU (1) AU745247B2 (en)
CA (1) CA2328298A1 (en)
FR (1) FR2777293B1 (en)
WO (1) WO1999053304A1 (en)

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7338805B2 (en) 2001-05-04 2008-03-04 Bio Merieux Labeling reagents, methods for synthesizing such reagents and methods for detecting biological molecules
FR2855832B1 (en) 2003-06-03 2007-09-14 Biomerieux Sa DIAGNOSTIC AND / OR PROGNOSTIC METHOD OF SEPTIC SYNDROME
FR2857375B1 (en) 2003-07-10 2007-11-09 Biomerieux Sa PROCESS FOR THE DETECTION AND / OR IDENTIFICATION OF STAPHYLOCOCCUS GENE BACTERIA
JP2005110503A (en) * 2003-10-02 2005-04-28 Arkray Inc Method for purifying nucleic acid and device therefor
FR2868071B1 (en) 2004-03-26 2006-06-09 Biomerieux Sa MARKING REAGENTS, METHODS FOR SYNTHESIZING SUCH REAGENTS AND METHODS FOR DETECTING BIOLOGICAL MOLECULES
FR2868433B1 (en) 2004-04-06 2008-01-18 Biomerieux Sa METHOD FOR THE PROGNOSIS AND / OR DIAGNOSIS OF CANCER
JP4735119B2 (en) * 2004-08-09 2011-07-27 日本精工株式会社 Reactor and production method thereof
FR2881437B1 (en) 2005-01-31 2010-11-19 Biomerieux Sa METHOD FOR THE DIAGNOSIS / PROGNOSIS OF A SEPTIC SYNDROME
FR2886735B1 (en) 2005-06-01 2015-09-11 Biomerieux Sa PROCESS FOR MARKING OR PROCESSING A BIOLOGICAL SAMPLE CONTAINING BIOLOGICAL MOLECULES OF INTEREST, IN PARTICULAR NUCLEIC ACIDS
FR2902430B1 (en) 2005-11-25 2012-11-02 Biomerieux Sa OLIGONUCLEOTIDES, USE, DETECTION METHOD AND KIT FOR DIAGNOSING THE PRESENCE OF INFLUENZA VIRUS H5 AND N1 GENES
FR2900158A1 (en) 2006-04-25 2007-10-26 Biomerieux Sa Probe for detecting a target sequence comprises a first nucleotide segment with a sterically hindering structure at its 5' end and a second nucleotide segment complementary to the target sequence
FR2906537A1 (en) 2006-09-28 2008-04-04 Biomerieux Sa METHOD FOR IN VITRO DIAGNOSIS OF BRONCHO-PULMONARY CANCER BY DETECTION OF ALTERNATIVE MAJORITY TRANSCRIPTS OF KLK8 GENE ENCODING KALLICREIN 8 AND USE THEREOF FOR THE PROGNOSIS OF SURVIVAL
FR2917090B1 (en) 2007-06-11 2012-06-15 Biomerieux Sa MARKING REAGENTS HAVING DIAZO AND NITRO FUNCTIONS, METHODS FOR SYNTHESIZING SUCH REAGENTS AND METHODS FOR DETECTING BIOLOGICAL MOLECULES
FR2934595B1 (en) 2008-07-29 2013-04-05 Biomerieux Sa MARKING REAGENTS HAVING A PYRIDINE CORE HAVING DIAZOMETHYL FUNCTION, METHODS FOR SYNTHESIZING SUCH REAGENTS AND METHODS FOR DETECTING BIOLOGICAL MOLECULES
WO2010082004A1 (en) 2009-01-19 2010-07-22 Biomerieux Methods for determining the likelihood of a patient contracting a nosocomial infection and for determining the prognosis of the course of a septic syndrome
EP2576815B1 (en) 2010-06-04 2018-02-14 Biomérieux Method for the prognosis of colorectal cancer
EP2588860A4 (en) * 2010-06-30 2017-01-25 ANPAC Bio-Medical Science Co., Ltd. Apparatus for disease detection
WO2012129758A1 (en) 2011-03-25 2012-10-04 Biomerieux Method and kit for determining in vitro probability for individual to suffer from colorectal cancer
US9333463B2 (en) * 2013-07-26 2016-05-10 General Electric Company Devices and systems for elution of biomolecules

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4164464A (en) * 1977-03-25 1979-08-14 Instrumentation Specialties Company Sample concentrator
US4750982A (en) * 1985-03-21 1988-06-14 Lifecodes Corp. Process and apparatus for purifying and concentrating DNA from crude mixtures containing DNA
US5415758A (en) * 1993-11-19 1995-05-16 Theobald Smith Research Institute, Inc. Method and apparatus for electro-elution of biological molecules
DE19610354C1 (en) * 1996-03-15 1997-11-20 Innova Gmbh Device, method and device for isolating nucleic acids
GB9608644D0 (en) * 1996-04-26 1996-07-03 Scient Genarics Ltd Nucleic acid manipulation

Also Published As

Publication number Publication date
JP2002511583A (en) 2002-04-16
AU3151899A (en) 1999-11-01
EP1070246A1 (en) 2001-01-24
WO1999053304A1 (en) 1999-10-21
FR2777293B1 (en) 2000-05-19
FR2777293A1 (en) 1999-10-15
AU745247B2 (en) 2002-03-14

Similar Documents

Publication Publication Date Title
CA2328298A1 (en) Method for electroelution of a biological sample and implementing device
JP6212488B2 (en) Methods and devices for electrical sample preparation
KR102458490B1 (en) Nucleic acid purification cartridge
US5340449A (en) Apparatus for electroelution
US7217513B2 (en) Apparatus and method for isolating a nucleic acid from a sample
EP1056758B1 (en) Electrophoretic nucleic acid purification method
US20080131949A1 (en) Apparatus and method for isolating a nucleic acid from a sample
EP0187586B1 (en) Process and apparatus for preparative electrophoresis
EP3629000B1 (en) Method for preparing a biological sample
US9333463B2 (en) Devices and systems for elution of biomolecules
EP3222989A1 (en) Device for analysing a biological sample
EP3024931B1 (en) Methods for electroelution of biomolecules
US20150191717A1 (en) Simultaneous extraction and separation of rna and dna from single cells using electrophoretic techniques
JP2005110503A (en) Method for purifying nucleic acid and device therefor
US11584926B2 (en) Method and system for magnetic extraction of components in a liquid sample
US7338796B1 (en) Vesicle-based method and apparatus for collecting, manipulating, and chemically processing trace macromolecular species
US20200047093A1 (en) Systems, devices, and methods for point-of-use testing for fluid contamination
EP0348275B1 (en) Method and apparatus for obtaining plasmids and cosmids
US6713299B1 (en) Apparatus for separating biological materials
EP3654011B1 (en) Method for preparing a sample to be analysed obtained from a food matrix
JP2005218332A (en) Method for detecting virus gene
KR20060058523A (en) Purification method of nucleic acids using silver nanoparticles

Legal Events

Date Code Title Description
FZDE Dead