FI95146B - A method for producing the anti-rejection protein PP15 or an immunogenic portion thereof - Google Patents

Abstract

The cDNA coding for PP15 is described. This cDNA can be used to prepare PP15 in pro- or eukaryotic cells. <IMAGE>

Description

95146 *

A method for producing the anti-rejection protein PP15 or an immunogenic portion thereof

The invention relates to a method for producing the anti-rejection protein PP15 or an immunogenic part thereof. The immunosuppressive protein PP15 is described by the following parameters in DE-A 2 952 792 (US-A 4 348 316): a) a carbohydrate content of 3.35 ± 0.9% consisting of 10 hexoses of 2.8 ± 0.5 %, 0,3 ± 0,2% for hexose amines, 0,05 ± 0,05% for fucose and 0,20 ± 0,15% for neuraminic acid, b) sedimentation factor SMw0 2,9 ± 0,2 S, c) molecular weight determined in an ultracentrifuge 30 15 700 ± 3 200 (dimer), d) extinction coefficient E ,, »1 * (280 nm) 14.2 ± 1.0 and e) electrophoretic mobility in the albumin region as well as f) isoelectric point 4.4 ± 0.1 , C t f.

20 g) with amino acid composition Residues 100 Variation residue factor

Per amino acid (mol%) (%) _. Lysine 4.74 3.30 • 25 Histidine 3.81 5.43

Arginine 1.62 3.43

Aspartic acid 13.39 5.08

Threonine 3.85 5.35

Serine 6.38 2.81. 30 Glutamic acid 13.43 5.32

Proline 4.35 14.25

Glycine 6.87 2.13

Alanine 6.51 8.26

Cystine 1/2 2.48 4.55 35 Intermediate 2.29 15.67 2 95146

Methionine 2.87 10.86

Isoleucine 8.39 8.18

Leucine 8.18 6.72

Tyrosine 2.09 8.49 5 Phenylalanine 6.27 2.27

Tryptophan 2.51 6.81

Determination of molecular weight by SDS-polyacrylamide gel electrophoresis gave a molecular weight of about 10 to 15,000 d (monomer).

Genetic engineering of this protein is highly desirable as it has become of therapeutic and diagnostic interest due to its anti-rejection properties. The invention thus relates to a method for the genetic engineering of PP15. Also described are the mRNA required therein, cDNA derived therefrom, DNA structures and vectors containing all or part of this cDNA, cells transformed with such DNA, a polypeptide expressed from these cells, and its use as a drug. In addition, the amino acid sequence of PP15 as well as the amino acid sequence subsequence, specific antibodies obtained therefrom, diagnostic reagents prepared from antibodies and antibody columns as well as the polypeptide obtained by the columns are shown. A further embodiment of the invention relates to diagnostic reagents comprising, in whole or in part, DNA or RNA encoding or complementary to PP15, and to diagnostic methods for examining body fluids and tissues with these diagnostic reagents. Other aspects of the invention . 30 are further specified in the following or defined in the claims.

First, specific antibodies against PP15 were attempted in a commercially available cDNA expression library of human 35 mature placental mRNA (Genofit, Heidelberg).

II

95146 3 clones expressing PP15. Since PP15 was known to be anti-rejection, thus specific antibodies were poorly, if at all, specific antibodies against subpeptides were prepared.

Therefore, the protein PP15 was digested into specific fragments by cleavage with bromocyanin, trypsin or proteinase V8, which fragments were subsequently sequenced. The following fragments were obtained:

10 (A) MVVGQLKADEDPIMGFHQMF

(B) FRLALHNFG

(C) VSVYAEAAER

(D) L S S L P F Q K I Q (H)

(E) FDNDRTQLGAIYIDAS-LT-E

15 (F) LLKNINDAWT

Peptides A, B and C were synthesized by well-known methods and specific antibodies were produced in rabbits according to standard methods. The above-mentioned cDNA expression bank containing> 1 x 10 6 recombinant Lambda gt11 clones failed to locate positive clones. Antibodies directed against Peptide A and B then precipitated PP15 in the control experiment, whereas antibodies against Peptide C did not react. As it later emerged, peptide • 25 C is also not subsequently included in the PP15 protein sequence derived from the cDNA sequence, so it is likely to need to be assimilated to the PP15 companion protein.

The oligonucleotides encoding PP15 oligopeptide A were then selected from PP15 oligonucleotide 103.

5'ATGGTGGTGG GCCAGCTGAA GGCTGATGAG GACCCC, respectively oligopeptide E from PP15 oligonucleotide-140 35 5'TTTGACAATG ACCGGACCCA GCTGGGCGCC ATCTACATTG ATGC

4,95146 and 64-fold degenerate PP15 oligonucleotide-139 from oligopeptide F.

5'AAAAATATTAATGATGCCTGGAC 5 G C C C C

A

R. Lathen [J. Mol. Biol. (1985) 183, 1-12] on the basis of statistical data.

These oligonucleotide probes were screened onto a cDNA library prepared from mature human placental mRNA. First, mRNA was isolated from the placenta and cDNA was prepared. This was provided with EcoRI ends and ligated into the EcoRI cleavage site of the phage vector Lambda gt10. 2 clones (PP15-24 and PP15-28) with the entire cDNA of PP15 were identified. DNA sequencing was performed by methods known per se; The complete cDNA sequence (coding strand) of PP15 is shown in Table 1. The cDNA is 894 bp in length, has a 99 bp untranslated sequence at the 5 'end, has an open reading frame of 381 bp, and leaves At the 3 'end, 414 base pairs, including eight base poly (A), without translation.

Table 1 lists the nucleotide probe sites below. dashed, in addition, the amino acid sequence is marked.

According to the invention, the encoding cDNA can be used to express PP15 by a suitable expression system. The choice of host can further influence the modification of PP15. Thus, there is no glycosylation in bacteria and different glycosylation occurs in yeast cells than in higher eukaryotic cells.

Knowing the amino acid sequence of PP15, it is possible to prepare amino acid subsequences that can function by conventional or genetic engineering methods. 5 95146 TABLE 1 10 30 50 GGAAGGGACAGTCGGCCGCAGACCGCGCTGGGTTGCCGCTGCCGCTGCCGCCGCTGCCGCCGC

5 AGCCCCTCGGGTCTCCGTGAGGCCGGGTGACGCTCCAGAATGGGAGACAAGCCAATTTGG

M G D K P I W

130 150 170

GAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAATGATAGAACC

EQIGSSFIQHYYQLFDNDRT

10 190 210 230

CAACTAGGCGCAATTTACATTGACGCGTCATGCCTTACGTGGGAAGGACAACAGTTCCAG

QLGAIYIDASCLTWEGQQFQ

250 270 290 GGGAAAGCTGCCATTGTGGAGAAGTTGTCTAGCCTTCCGTTCCAGAAAATTCAGCACAGC 15

GKAAIVEKLSSLPFQKIQHS

310 330 350

ATCACCGCGCAGGACCATCAGCCCACTCCAGATAGCTGCATCATCAGCATGGTTGTGGGC

I TAQDHQPTPDSCI I SMVVG

20,370,390,410

CAGCTTAAGGCGGATGAAGACCCCATCATGGGGTTCCACCAGATGTTCCTATTAAAGAAC

QLKADEDPIMGFHQMFL'LKN

430 450 470

ATCAACGATGCTTGGGTTTGCACCAATGACATGTTCAGGCTCGCCCTGCACAACTTTGGC

25 INDAWVCTNDMFRLALHNFG

TGACCTCCTCTCAGCTAGGCACTCACGCTGTTTCCTCCTCCCTCCTCTTCCCAATACTAT 490 510 530 550 570 590 610 630 650 TCCCACTCCTCCAGATGCTCCAAATATCATGCACAAATGAGCAGGGCCGCGGTGGGAGTG is GGCGCAGTGCGCTGCTGCCACTGAGGTGTTGTGCATGATGTTTGGATGCTAGACTAGTTG CATCTGACGGGAGAAGTTTGTGTTGTACCAGCGCATGCCTTGGAAAGACTTAAGTAATGC 670 690 710 730 750 770 790 810 830 AAAAGGTTGTCCTTTTTTTTTTTTTTTTTTTTTTAATCTACTGACAAGTTGCTCTAGTAA C C CAAAGAAGTGAAGGAGAAAGCAGCTGC CAC CGC CT CCAGACATTGATTTGTTCAGATG 850 870 890

35 TTTCAATGCCTCATGATACAATAAAACCACAAAAATTTTCTTAACAAAAAAAAA

95146 6 as antigens in the manufacture of polyclonal or monoclonal antibodies. Such antibodies are useful both for diagnostic purposes and for the preparation of antibody columns that allow PP15 to be separated from solutions containing it alongside other proteins.

The cDNA or portions thereof can also be used to isolate a genomic clone encoding PP15 from a gene bank in a simple manner, which not only facilitates expression in eukaryotic cells, but also allows other diagnostic statements to be made.

The invention is further defined in the claims and further illustrated in the following examples.

If not explained in the text, the following abbreviations are used.

EDTA = sodium methylenediamine tetraacetate SDS = sodium dodecyl sulfate DTT - dithiothreitol BSA - bovine serum albumin 20 Example 1 Isolation of RNA from human placenta RNA was obtained from mature human placenta [Chirgwin et al. according to Biochemistry 18 (1979) 5294-5299]. About 10 g. the placental tissue was crushed in liquid nitrogen, suspended in 80 ml of 4 M guanidinium thiocyanate with 0.1 M mercaptan ethanol and treated for 90 sec. 20,000 rpm in a homogenizer (Ultraturrax). The lysate was centrifuged for 15 min. 7,000 rpm (Sorvall-GSA rotor) and supernatant were precipitated with 2 ml of 1 M acetic acid and 60 with 30 ml of abs. ethanol at -20 ° C overnight. After the nucleic acid was sedimented at 6,000 rpm and -10 ° C for 10 min, it was completely dissolved in 40 ml of 7.5 M guanidinium hydrochloride (pH 7.0) and precipitated with a mixture of 1 μM. 1 M acetic acid and 20 ml abs. ethanol. To separate the DNA, the doping was repeated a second time

II

With 7 95146 volumes. RNA was dissolved in 12 mL of H 2 O, precipitated with a mixture of 1.2 mL of 4 M potassium acetate and 24 mL of abs. ethanol, was sedimented and finally dissolved in 10 H2O (1 ml per gram of tissue).

5 Example 2

Preparation of PolWAI-Contained Placental MRNA Placental RNA was separated to prepare poly (A) -containing mRNA by oligo (dT) -cellulose chromatography [Aviv and Leder, Proc. Natl. Acad. Sci. USA 69 (1973) 1408-1412] 10 in a 2 ml Pasteur pipette in LiCl. Approximately 5 mg of placental RNA was separated on a buffer 1 (500 mM LiCl, 20 mM Tris, pH 7.5, 1 mM EDTA, 0.1% SDS) column. Poly (A) + RNA bound to oligo (dT) cellulose, and poly (A) 'RNA could again be eluted. After a washing step with buffer 2 (100 15 mM LiCl, 20 mM Tris, pH 7.5, 1 mM EDTA, 0.1% SDS), poly (A) + RNA (placental mRNA) was eluted with buffer 3 (5 mM Tris, pH 7.5, 1 mM EDTA, 0.05% SDS) column.

For further purification, poly (A) + RNA was placed in buffer 1 and rechromatographed with oligo (dT) -selulose.

The yield of placental poly (A) + RNA after this second purification step was about 4% of the starting amount of RNA. Example 3 Synthesis of i cDNA from human placenta (placenta cDNAI and 25 double solution cDNA fdsDNA)

The integrity of the poly (A) -containing placental mRNA was examined before cDNA synthesis on a 1.5% agarose gel.

Thereafter, 4 μg of placental mRNA was dissolved in 65.5 ml of H 2 O, denatured for 10 min. At 70 ° C and cooled on ice.

cDNA synthesis was performed at a dose of 100 μl with the addition of 20 μΐ RT, buffer (250 mM Tris, pH 8.2, at 42 ° C, 250 mM KCl, 30 mM MgCl 2), 2.5 μΐ 20 mM dNTP (this means all four deoxynucleoside triphosphates), 35 1 μΐ oligo (dT) per 1 μg / ml, 1 μΐ 1 M DTT, 2 μΐ RNA- 8 95146 t case (Boehringer Mannheim) and 8 μΐ reverse transcriptase (24 U / μΙ, Boehringer Mannheim) 90 min. At 42 ° C. Double-stranded cDNA (dsDNA) was synthesized according to Gubler and Hoffmann [Gene 25 (1983) 263-269]. The synthesis took place immediately after cDNA synthesis by adding 305.5 μΐ H 2 O, 80 μΐ RT2 buffer (100 mM Tr is, pH 7.5, 25 mM MgCl 2, 500 mM KCl, 50 mM DTT, 250 μg / ml BSA ), 2 μΐ RNase H (2 U / ml), 2.5 μΐ E. coli DNA ligase (5 ϋ / μΐ), 5 μΐ 15 mM B-NAD and 5 μΐ DNA polymerase I (5 ϋ / μΐ) and incubating for 5 h at 10 ° C. The reaction was quenched by heat inactivation (70 eC, 30 min).

The reaction mixture was incubated for another 30 min. At 37 ° C after addition of 55 μΐ of 250 μM dNTP, 55 μΐ of 10 mM Tris (pH 7.5), 10 mM MgCl 2, 10 μg / ml BSA, 3 μΐ of T4 DNA polymerase I ( l ϋ / μΐ), 2 μΐ RNase H (2 ϋ / μΐ) and 2 μΐ RNase A (2 μg / ml) to ensure the completeness of the synthesis for the second strand of DNA ("Repair Reaction").

Example 4

Ligation of EcoRI linkers with dsDNA and opening of linkers

To establish a placental cDNA library, dsDNAs were provided with EcoRI ends to be ligated to the EcoRI cleavage sites of the phage vector λ gt10 [T. Maniatis et al. (1982), Molecular Cloning, A Laboratory Manual, Cold 25 Spring Harbor]. In addition to this, dsDNA

a) treated with EcoRI methylase to protect the internal EcoRI cleavage sites of the dsDNA, b) provided with an EcoRI linker, which c) were then cleaved with EcoRI.

30 a): The methylase reaction of dsDNA occurred directly in the "Repair Reaction" with the addition of 25 μΐ 500 mM EDTA (pH 8.0), 60 μΐ methylase buffer (100 mM NaOAc, pH 5.2, 2 mg S-adenosyl). L-methionine) and 2 μΐ EcoRI methylase 35 (20 U / μΙ) by incubation at 37 ° C for 30 min.

il 9 95146 4

The reaction mixture was extracted with phenol and the dsDNA was mixed with 60 Ml of 4 M NaOAc and 1300 μΐ ethanol. The dsDNA was washed twice with 70% ethanol, shaken once with ether and dried.

5 b):

EcoRI-methylated dsDNA was dissolved in 88 μΐ H 2 O and after the addition of 10 μΐ ligase buffer (500 mM Tris, pH 7.4, 100 mM MgCl 2, 100 mM DTT, 10 mM spermidine, 10 mM

ATP, 1 mg / ml BSA), 1 μΐ T4 DNA ligase (10 U / μΙ) with 1 μl η 10 of EcoRI linker (0.5 μg / μl, pGGAATTCC or pAGAATTCT) was ligated overnight at 15 eC.

c):

The volume of the ligation mixture was made of 120 μΐ ^ εί 6 μ1: 11β H 2 O, 12 μ1: 1ΐ3 10 x EcoRI buffer and 2 μ1: 1ΐΆ 15 EcoRI (120 U / μΙ). EcoRI digestion occurred for 2 h at 37 ° C.

Example 5

Separation of unbound linker by potassium acetate gradient and size selection of dsDNA To separate all unbound EcoRI linker from dsDNA, the entire EcoRI reaction mixture was placed in a potassium acetate gradient (5-20% KOAc, 1 mM EDTA, 1 μ mM / ml ethidium). centrifuged for 3 h at 50,000 rpm and 20 ° C (Beckman SW 65 rotor).

: * 25 The gradient was fractionated from below so that the first five fractions were 500 μΐ and all the remaining 100 μΐ. Fractions were precipitated with 0.01 volume of acrylamide (2 mg / ml) and 2.5 volumes of ethanol, washed once with 70% ethanol, dried and dissolved in 5 μΐ -30 H 2 O.

• To determine the size of dsDNA, 1 μΐ of each fraction was analyzed on a 1.5% agarose gel. In addition, the amount of dsDNA from 1 μl of each fraction was determined.

ίο 95146

Fractions with a dsDNA of 500 bp were pooled and the sample was concentrated to a final concentration of 27 pg / ml.

Example 6 Transfer of dsDNA to phage vector λ atlO 1a "in vitro packaging" reaction Transfer of dsDNA to the EcoRI junction of the phage vector λ gtlO (Vector Cloning Systems, San Diego, CA) occurred in a 4 μl: η ligation mixture: 2 μΐ dsDNA, 1 μΐ gt10 x 10 EcoRI (1 pg / ml), 0.4 μΐ ligase buffer, 0.5 μΐ H 2 O, 0.1 μΐ T4 DNA ligase. The mixture was incubated for 4 h at 15 ° C.

The establishment of a placental cDNA library in the phage vector λ gt10 was accomplished by in vitro packaging of the ligase mixture with E. coli NS 428 and NS 433 λ-lysogenic cell extract at 15 h at room temperature (Vector Cloning Systems, San Diego, CA; Enquist and Sternberg, Methods in Enzymology 68, (1979), 281-298). The reaction was quenched with 500 of suspension medium (SM: 0.1 M NaCl, 8 mM MgSO 4, 50 mM Tris, pH 7.5, 0.1% gelatin) and 2 drops of chloroform.

20 Example 7

Determination and analysis of placental cDNA library titer

The number of colony-forming units (PFUs) in the placental cDNA library was determined using E. coli K 12 strain '25 C600 HFL competent cells: a value of 1 x 106 PFU.

Example 8

Oligonucleotide Probes for Placental CDNA Bank Screening Oligonucleotide probes (PP15 oligonucleotide 103: and -140) and an oligonucleotide pool (PP15 oligonucleotide pool 139) were synthesized for analysis of a placental cDNA library. Their sequences were derived from the amino acid sequence of the three bromocyanine fragments of PP15.

li il 95146

The construction and use of probes essentially followed R. Lathen, above the rules.

Oligonucleotide sequences were labeled with T4 polynucleotide kinase (γ-32Ρ) in the presence of ΑΤΡ: η at the 5 'end (60 μ0ΐ / 40 μ1: η reaction mixture was used). The probes had a specific activity of 1 x 10 * Bq / μΐ or 1.5 x 106 Bq / pmol.

Example 9

Screening for placental cDNA with specific oligonucleotides 10 l of 106 PFU of placental cDNA libraries were examined in conjunction with oligonucleotide probes 103, 140 and 139.

To this end, 3 x 10 4 PFU of E. coli K 12 strain C 600 HFL were plated on soft agar in 13.5 cm petri dishes and incubated for 6 h at 37 ° C. By this time, 15 had no confluent lysis. The plates were incubated overnight in a refrigerator and the phages were transferred to nitrocellulose filters (Schleicher & Schiill, BA 85, Ref.-No.

401 124) (duplicates). The nitrocellulose filter and petri dishes were labeled with an injection cannula to allow subsequent alignment of positive plaques. Petri dishes were stored in a cold room during nitrocellulose filter processing. DNA on nitrocellulose filters was denatured by placing the filter on filter paper (Whatman-M3) dipped in 1.5 M NaCl, 0.5 M NaOH for 5 minutes. The filters were then similarly renatured with 1.5 M NaCl, 0.5 M Tris, pH 8.0, and washed with 2x SSPE (0.36 M NaCl, 16 mM NaOH, 20 mM NaH 2 PO 4, 2 mM EDTA). . The filters were then dried at 80 ° C under vacuum for 2 h. The filters were washed for 4 h at 65 ° C in 3 X SSC, 0.1% SDS (20 X SSC - 3 M NaCl, 0.3 M Na citrate) and prehybridized for 4 h at 65 ° C [ prehybridization solution: 0.6 M NaCl, 0.06 M Tris, pH 8.3, 6 mM EDTA, 0.2% non-ionic synthetic sucrose polymer (Ficoll), 0.2% polyvinylpyrrolidone 40, 0.2% 35 BSA, 0.1% SDS, 50 μg / ml denatured herring semen DNA].

12 95146

Filters were incubated overnight in beakers or fired polyethylene foils with gentle shaking in hybridization solution supplemented with 100,000 to 200,000 Bq of labeled oligonucleotide / ml of hybridization-5 solution (like prehybridization solution, but without herring sperm DNA). The hybridization temperature was 46 ° C for the oligonucleotide probe 139 and 52 ° C for the other probes. The nitrocellulose filters were washed 6 x SCC, 0.05 M sodium pyrophosphate for one hour at room temperature and an additional 10 hours at each hybridization temperature. The filters were dried and autoradiographed overnight. The signals on the X-ray film that appeared in both duplicates were localized in petri dishes and the area (ca. 50 plaques) was spread through a Pasteur pipette with water on top and the phages resuspended in 1 ml SM buffer. Positive phages were separated by three rounds until there was only one positive clone.

1 x 106 PFU placental cDNA libraries were examined three to 20 times. Only the third search identified 2 signals with a duplicate filter. Both clones PP15-24 and PP15-28 had the entire cDNA for PP15.

A comparison of oligonucleotide sequences 103, 139 and 140 with the reported PP15 sequence is summarized in Table 2.

· »- · 11 13 95146 TABLE 2 PP15 Sequence versus PP15 Oligonucleotide 103 5 301 ATCACCGCGCAGGACCATCAGCCCACTCCAGATAGCTGCATCATCAGCAT 350 1 ............................ .................... AT 2 • · · · · 351 GGTTGTGGGCCAGCTTAAGGCGGATGAAGACCCCATCATGGGGTTCCACC ^ 00 3 GGTGGTGGGCCAGCTGAAGGCTGATGAGGACCCC ................ 36 10 PP15 Sequence versus PP15 Oligonucleotide 139 • ♦ · · «401 AGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGAC 450 15 1 .............. AAGAACATCAACGATGCCTGGAC ............. 23 PP15- sequence versus PP15 oligonucleotide 140 • · · · ♦ 151 TACTACCAGTTATTTGATAATGATAGAACCCAACTAGGCGCAATTTACAT 200 20 1 ............ TTTGACAATGACCGGACCCAGCTGGGCGCCATCTACAT 38 • · · · · 201G TGACGCGTGGGGGGGGGGGGGGGGGGGGG .................................. 44: 25 Example 10 DNA sequence analysis

Phage clones PP15-24 and PP15-18 were amplified and their DNA extracted in each case. The corresponding EcoRI fragment was isolated and ligated into the EcoRI site of the Bluescript M13 30 vector (Stratagene, San Diego, CA, USA) by the enzymatic dideoxy method according to Sanger for restriction analysis and sequence analysis. The sequence indicates an open reading frame, and encodes a protein of up to 127 amino acids. PP15 has a calculated molecular weight of 14,475,146 (including methionine), which is in line with the value of DE-A 2,952,729 mentioned at the beginning.

Example 11 Expression of anti-rejection protein PP15

Vector pTrc99A [E. Amann et al. (1988) Gene 69, 301-315] was used to express non-fused, mature PP15 protein in E. coli. The DNA-10 sequence of the PP15 cDNA at the start codon is:

Met Gly Asp 5 '... CGCTCCAGA ATG GGA GAC ... 3' 15 Because there is no NcoI site in ATG, DNA cannot be cloned directly into the pTrc99A expression vector. However, the NcoI site is obtained by two base exchanges in the PP15 sequence: 5 'GAATGG 3' through mutagenesis 5 'CCATGG 3'. The second amino acid (Gly) was not damaged during this change, because the second codon of the structural sequence of PP15 begins with G. For mutagenesis, a 902 bp EcoRI fragment of clone PP15-28 of the PP15 cDNA was isolated and similarly ligated into the EcoRI digested and dephosphorylated mutagenesis vector pMa5-8 (Figure). For the resulting plasmid • · :: 25 pMa5-8-PP15 (with the correct orientation of the PP15 EcoRI insert

Relative to the F1 start site) was then subjected to gapped duplex mutagenesis [Kramer et al. (1984) Nucl. Acids. Res. 12, 9441-9456] using the following oligodeoxynucleotide: 30: 1 5 'GGCTTGTCTCCCATGGTGGAGCGTCAC 3'

A clone containing the desired mutation was identified by restriction analysis and labeled pMc5-8-NcoI.

35 A 798 bp large NcoI was isolated from this plasmid.

II

is 95146 4

EcoRI fragment and ligated into the digested pTrc99A vector, respectively. The resulting plasmid pTrc99A-PP15 comprises 4918 base pairs and expresses a non-fused, approximately 15 kD large PP15 protein after induction of the trc promoter.

Claims (1)

16 95146 Patenttivaatimus Menetelmä hylkimistä vastustavan proteini PP15 tai sen immunogenes osan valmistamiseksi, t u n -5 n e t u siitä, et taulukon 1 mukaista PP15: tä koodaa-va cDNA, if it is not expressed in the prokaryotic system. Process for the preparation of the immunosuppressive protein PP15 or an immunogenic portion thereof, characterized in that cDNA encoding PP15 of Table 1 is inserted into a prokaryotic expression system and expressed there by conventional methods. «II 95146 Xbal — I Hindlll — ι Pst I — I Sail — ι BamHI-i .... Smaln ^ -3803 3500 Xmir Λ (- 3000 ~ - #;: ί / Λ W -ί ':; 1 Pmac 5 -8 r - ™ 3803 \ —1000 2500 ^ | ^> ^ ____ ^ // 1500 2000 Plasmidine pMAC5-8 (= pMA5-8 yes pMC5-8) mapped Fl-ORI: Faagi fl: n replication aloitus cohta, ORI: ColEl -Type: n Replication aloituskohta, CAT: Chloramphenicoliasetyylitransferaasia koodaava alue AMP: β-lactamaasia koodava alue pMA5-8: lla on amber mutatio CAT: ssa (A ash mass 3409) and pMCT-8: llä amber-mutaatio AMP breathing mass 2238).