FI124926B - Adenovirus vectors and related methods and uses - Google Patents

Description

Adenovirus vectors and related methods and uses

Field of the Invention

The present invention relates to the fields of life sciences and medicine. In particular, the invention relates to cancer treatments. More particularly, the present invention relates to oncolytic adenoviral vectors and in vitro cells and pharmaceutical compositions comprising said vectors. The present invention also relates to said vectors and a pharmaceutical composition for use in treating cancer in a subject. Furthermore, the present invention relates to an in vitro method for producing CD40L in a cell and an oncolytic adenoviral vector for use in enhancing a tumor-specific immune response and apoptosis in a subject, and for use of oncolytic adenoviral vectors for producing CD40L in a cell.

Background of the Invention

Cancer can be treated with surgery, hormonal treatments, chemotherapies, radiation treatments and / or other treatments, but in many cases, cancers, often characterized by their advanced stage, cannot be cured by current treatments. Therefore, new approaches to cancer cells, such as gene therapy, are needed.

Over the past twenty years, gene transfer technology has been the subject of much research. The purpose of gene therapy for cancer is to introduce a therapeutic gene into a tumor cell. These therapeutic genes introduced into the target cell may, for example, repair mutated genes, suppress active oncogenes, or create additional cellular properties. Suitable exogenous therapeutic genes include, but are not limited to, immunotherapeutic, anti-angiogenic and chemoprotective genes, and "suicide genes" and may be introduced into the cell utilizing modified viral vectors or non-viral methods, such as electroporation, gene terminals or lipid inserts.

Requirements for optimal viral vectors include an effective ability to locate specific target cells and to express the viral genome in the target cells. In addition, optimal vectors must remain active in the target tissues or cells. All these properties of viral vectors have been developed over the past decades, and retroviral and adenoviral vectors and adeno-associated viral vectors, for example, have been extensively studied in biomedicine.

To further improve local penetration of tumor penetration and antitumor activity, selectively oncolytic agents, e.g., conditionally replicating adenoviruses, have been formed. Are-lytic adenoviruses are a promising tool for the treatment of cancers and have proven to be very safe and somewhat effective in clinical trials. Are-lytic adenoviruses kill tumor cells because the virus replicates in the tumor cell, whereby the final stage of replication leads to the release of thousands of virions into the surrounding tumor tissues for efficient tumor penetration and vascular reinfection. Tumor cells allow viral replication, whereas normal cells are spared because modifications are made to the viral genome that prevent replication in non-tumor cells.

Replication can be limited to tumor tissue either by partial deletions in the E1 region of the adenovirus or by the use of tissue or tumor specific promoters (TSPs). Insertion of such a promoter may enhance the effects of the vectors on target cells, and the use of exogenous tissue or tumor-specific promoters is common in recombinant adeno-viral vectors.

Previous studies have shown that the human telomerase reverse transcriptase (hTERT) promoter is highly active in most tumors and immortal cell lines but inactive in normal somatic cell types. hTERT is a catalytic subunit of telomerase and its function stabilizes telomeric length during chromosomal replication. Oncolytic adenoviruses using the hTERT promoter to control genes in the adenovirus early region have been previously described (see, e.g., Huang, TG, et al., Gene Therapy 2003; 10, 1241-1247; Ryan, PC. Et al., Cancer Gene Therapy 2004). ; 11, 555-559; Irving et al., Cancer Gene Therapy 2004; 11, 174-185; Bauerschmitz GJ, et al., Cancer Res 2008; 68: 5533-9). However, telomerase is expressed not only in tumor cells but also in other human cells with unlimited proliferative capacity, such as stem cells.

Most clinical trials have been performed on early-generation ade-viruses based on adenovirus 5 (Ad5). The antitumor activity of oncolytic adenoviruses depends on their gene transfer ability. Unfortunately, most tumors poorly express the most important Ad5 receptor, which is why modifications have been introduced into the Ad5 capsid. For example, capsid modification with the serotype 3 protrusion has improved infectivity and efficacy in ovarian cancer (Kanerva A, et al., Clin Cancer Res 2002; 8: 275-80; Kanerva A, et al., Mol Ther 2002; 5: 695-704; Kanerva A , et al., Mol Ther 2003; 8: 449-58). Further, since the Ad vectors strand and the penton base unit are key mediators of cell entry, targeting of recombinant Ad vectors can be achieved through genetic modifications of these capsid proteins (Dmitry I., et al. 1998, Journal of Virology, 72, 9706-9713 ). Most of the currently used oncolytic viruses are severely attenuated in replication due to many deletions in the critical viral genes. These viruses have excellent safety data, but their antitumor efficacy has been limited.

However, clinical and preclinical results indicate that treatment with unarmed oncolytic viruses is not sufficiently immunostimulatory to result in longer-term antitumor therapeutic immune responses. In this regard, oncolytic viruses have been armed to be more immuno-stimulatory. In addition, viral replication and expression of immunomodulatory proteins within the tumor enhance the immune system by inducing cytokine production and release of tumor antigens (Ries SJ, et al., Nat Med 2000; 6: 1128-33).

Arming oncolytic viruses combines the benefits of traditional gene transfer with the efficacy of replicating agents. One purpose of viral armamentation is to induce an immune response against cells that allow viral replication. As mentioned above, viral replication, although immunogenic, is normally not sufficient alone to induce effective anti-tumor immunity. To enhance the induction of therapeutic immunity, viruses are armed with stimulatory proteins, such as cytokines, to facilitate the delivery of tumor antigens to antigen presenting cells, such as dendritic cells, and their stimulation and / or maturation. The introduction of immunotherapeutic genes into tumor cells and furthermore the translation of their proteins results in activation of the immune response and more efficient destruction of the tumor cells. The most important immune cells in this regard are natural killer cells (NKs) and cytotoxic CD8 + T cells.

CD40 Ligand (CD40L) is a type II transmembrane protein belonging to the family of tumor necrosis factor. CD40L is also known as CD154 or gp39 and is predominantly expressed on CD4 + T cells and binds to the CD40 receptor on the membrane of antigen presenting cells (APCs) (Grevval IS and Flavell RA., Ann Rev Immunol 1998; 16: 111-35 Roy M, et al., J Immunol 1993; 151: 2497-510). CD40 is expressed on the surface of macrophages and dendritic cells (DCs), whereby its activation by CD40L leads to antigen presentation and cytokine production, followed by T cell excitation and a strong innate immune response (van Kooten C and Banchereau J, J Leukoc Biol 2000 ; 67: 2-17). Interactions between CD40L and its receptor, CD40, produce critical costimulatory signals that trigger the proliferation of T lymphocytes (Grevval IS and Flavell RA, 1998, Annu Rev Immunol 1998; 16: 111-35), and increase IL-12 production required for binding of cytotoxic T lymphocytes (CTL) to the anti-tumor immune response (Loskog AS, et al., Clin Can Res 2005; 11: 8816-21; Mackey MF, et al., J Immunol 1998; 161: 2094). -8). Previous findings indicate that recombinant soluble protein, CD40L, (rsCD40L) has direct effects on suppressing tumor cell proliferation in vitro (Eliopoulos AG, et al., Oncogene 1996; 13: 2243-54; Tong AW, et al., Clin Cancer Res 2001; 7: 691-703) and in vivo (Eliopoulos AG, et al., Mol Cell Biol 2000; 20: 5503-15; Hirano A, et al., Blood 1999; 93: 2999-3007). Other direct effects of rsCD40L include stimulation of survival signaling pathways (including PI-3 kinase and ERK / MAPK) and induction of apoptosis in carcinoma cells (Eliopoulos, AG., Et al., Mol Cell Biol 2000; 20: 5503-15; Davies). CC, et al., J Biol Chem 2004; 279: 1010-921).

Some recent reports have shown that adenoviruses armed with CD40L can provide inhibition of tumor growth along with an increase in apoptotic events at the tumor site (Loskog AS, et al., Clin Cancer Res 2005; 11: 8816-21; Fernandes MS, et al., Clin Cancer Res 2009; 15: 4847-56; Loskog AS, et al., J Immunol 2004; 172: 7200-5). There is also some evidence regarding an antitumor immune response through increased lymphocyte infiltration and cytotoxic CD8 + T cells (Hanyu K, et al., Anticancer Res 2008; 28: 2785-9; Iida T, et al., Cancer Sci 2008; 99). : 2097-10324, 25).

Adenoviruses are medium-sized (90-100 nm), non-enveloped icosahedral viruses with approximately 36,000 base pairs of double-stranded linear DNA in a protein capsid. The viral capsid has filamentous structures that are involved in attaching the virus to the target cell. First, the protruding domain of the fiber protein binds to the target cell receptor [e.g., CD46 or coxsackievivirus adenovirus receptor (CAR)], second, the virus interacts with the integrin molecule, and third, the virus is endocytosed to the target cell. Next, the viral genome is transported from the endosomes to the nucleus, and the replication machinery of the target cell is also utilized for viral purposes (Russell W. C., J General Virol 2000; 81,2573-2604).

The adenovirus genome contains early (E1-E4), intermediate (IX and IVa2), and late (G1-L5) genes, which are transcribed sequentially. Early gene products affect the host cell defense mechanisms, the cell cycle and cell metabolism. Mid- and late-stage genes encode structural proteins of viruses to produce new virions (Wu and Nemerov, Trends Microbiol 2004; 12: 162-168; Russell WC, J General Virol 2000; 81, 2573-2604; Volpers C. and Kochanek S., J Gene). Med 2004; 6 suppl 1, S164-71; Kootstra NA and Verma IM, Annu Rev Pharmacol Toxicol 2003; 43, 413-439).

More than 50 different serotypes of adenoviruses have been found in humans. The serotypes are classified into six subgroups A-F, and the different serotypes are known to be associated with various diseases such as respiratory, conjunctivitis and gastrointestinal inflammation. Adenovirus serotype 5 (Ad5) is known to cause respiratory disease and is the most common serotype studied in the field of gene therapy. E1 and / or E3 regions were deleted from the first Ad5 vectors, allowing foreign DNA to be introduced into the vectors (Danthinne X, Imperiale, MJ. Gene Therapy. 2000; 7: 1707-1714). In addition, deletions and further mutations in other regions have provided additional features for viral vectors. Thus, various modifications of the adenoviruses have been proposed to provide effective antitumor effects.

U.S. Patent Application No. 2010047208 A1 discloses proto-modified adenoviral vectors in which tumor targeting is achieved by a modified hTERT promoter and which may be armed with an immunostimulatory protein such as GM-CSF.

However, more efficient and accurate gene transfer and increased specificity of gene therapies and sufficient tumor-killing capacity are needed. The safety data of therapeutic vectors must also be excellent. The present invention provides a cancer treatment with these above-mentioned properties by utilizing both the oncolytic and immunotherapeutic properties of adenoviruses in a novel and inventive manner.

Brief Description of the Invention

It is an object of the invention to provide new methods and means for providing the above-mentioned properties of adenoviruses and thus also for solving the problems of conventional cancer treatments. More particularly, the invention provides novel methods and tools for gene therapy.

The present application describes the construction of recombinant viral vectors, methods for using these vectors and their use in tumor cell lines, animal models and cancer patients.

The present invention relates to an oncolytic adenoviral vector comprising 1) a nucleic acid backbone of adenovirus serotype 5 (Ad5) comprising a capsid modification, preferably a capsid modification with the adenovirus serotype 3 (Ad3) extension (codon for transcription of human Ad5 / 3), ) a promoter upstream of the E1 region; and 3) a deleted gp19k / 6.7K site in the E3 region of the nucleic acid sequence encoding human CD40L.

The present invention further relates to an in vitro cell comprising an oncolytic adenoviral vector of the invention.

The present invention also relates to a pharmaceutical composition comprising an adenoviral vector of the invention.

The present invention also relates to an adenoviral vector of the invention for use in treating cancer in a subject.

The present invention also relates to a pharmaceutical composition of the invention for use in treating cancer in a subject.

The present invention also relates to a method of treating a subject's cancer, the method comprising administering a vector or pharmaceutical composition of the invention to a subject suffering from cancer, in particular a cancer that is poorly responsive to conventional chemotherapeutic and / or radiation therapies.

Furthermore, the present invention relates to an in vitro method for producing CD40L in a cell, the method comprising delivering a vehicle comprising the oncolytic adenoviral vector of the invention to a cell and expressing the CD40L of that vector in a cell.

The present invention further relates to a method of enhancing a tumor-specific immune response of a subject, comprising delivering a vehicle comprising an oncolytic adenovirus vector of the invention to a target cell or tissue expressing CD40L of said vector in a cell increasing the amount of cytotoxic T cells and / or natural killer cells. and inducing Th2 → Th1 exchange to enhance cytotoxic antitumor activity in the tumor microenvironment.

The present invention further relates to the use of the oncolytic adenoviral vector of the invention for the production of CD40L in a cell in vitro.

The present invention further relates to an oncolytic adenoviral vector of the invention for the production of CD40L in a cell.

The present invention further relates to the use of the oncolytic adenoviral vector of the invention to enhance the tumor-specific immune response of the subject.

The present invention further relates to an oncolytic adenoviral vector of the invention for enhancing the tumor-specific immune response of a subject.

The present invention further relates to an oncolytic adenoviral vector of the invention for use in increasing the tumor-specific immune response and apoptosis, in altering Th2 → Th1, or in reducing immune suppression! in.

The present invention relates to a novel device for the treatment of cancers, in particular for the treatment of poorly responsive or incurable cancers. In addition, there are few limitations regarding the types of tumors that can be treated compared to many other treatments. In fact, all solid tumors can be treated with the present invention. The treatment can be administered intravenously, intravitreally, intravenously and in combination. The method of treatment can provide systemic efficacy despite local injection. The treatment may also kill cells that are thought to be cancerous ("cancer stem cells").

Not only does the vector of the invention allow delivery of the vector to the target region, it also ensures expression and stability of the transgene. The present invention solves the problem of treatment resistance to conventional therapies. Furthermore, the present invention provides means and methods for selective treatment without causing toxicity or damage to healthy tissues. The present invention also has the advantages of different and reduced side effects compared to other treatments. Importantly, the treatment is synergistic with many other therapies, including chemotherapy and radiation, and can thus be used in combination regimens.

Induction of an immune response against cells that allow replication of unarmed adenoviruses is normally not potent enough to induce the development of therapeutic tumor immunity. To overcome this weakness, the present invention provides armed adeno viruses with a potent antitumor immunity inducer, CD40L, which additionally induces local apoptosis in tumor tissue.

More specifically, CD40L, together with non-replicating viral vectors, has been shown to be synergistic in its ability to increase the activity of effector cells (CD8 + T cells) by altering Th2 chemokine models of T cells to Th1 (Loskog et al. 2004, J Immunol 172: 7200 -5; Bendiss-Vermare et al. 2005, J Leucocyte Biol 78: 954-66). Th2 promotes antibody production, while Th1 promotes cytotoxicity, and the latter may be more beneficial in targeting T cells to kill tumor cells. This patent application demonstrates that this phenomenon is particularly potent with oncolytic adenovirus, as evidenced by preclinical and human data.

The production of oncolytic adenovirus CD40L is also important because it can recruit natural killer cells to the tumor and increase their anti-tumor activity (Nakajima et al. 1998 J Immunol 161: 1901-7). In addition, CD40L can increase the function of antigen presenting cells (Nakajima et al. 1998 J Immunol 161: 1901-7). Finally, the CD40 / CD40L interaction produces potent inhibitory signals to suppressive cells, such as regulatory T cells, which may lead to strong stimulation of anti-tumor immune responses (Guiducci et al. 2005 Eur J Immunol 35: 557-67).

In addition, viral replication is limited to target cells by the use of the powerful transcriptionally targeting promoter, hTERT. The tumor-specific promoter hTERT is active in virtually all advanced solid tumors, but it can also mediate targeting of oncolytic adenoviruses to potential cancer-initiating cells, as demonstrated in pancreatic fluid samples from cancer patients (Bau-erschmitz et al. 2008: 55). . The clinical results presented here demonstrate non-toxicity to normal tissue stem cells as no life-threatening adverse events occurred.

The present invention provides cancer therapy in which virion-induced oncolysis kills tumor cells, combined with a variety of human immune response activating mechanisms such as proliferation and activation of T cells, macrophages, and dendritic cells (DCs), followed by cytokines, type of immune response, whereby the attack of cytotoxic T cells on the tumor is further stimulated. In addition, CD40L-induced apoptosis contributes to the reduction of tumor burden.

Compared to prior art adenoviral devices, the present invention provides a simpler, more effective, less expensive, non-toxic and / or safer means for the treatment of cancer. In addition, helper viruses or co-administration of a recombinant molecule are not required.

The present invention provides a new generation of improved and highly effective adenoviruses with high infectivity, which retains good safety but prevents higher levels of efficacy. Importantly, the present invention describes oncolytic adenoviruses that produce immunological factors critical for the efficacy of oncolytic viruses.

The novel products of the invention allow for further improvements in the treatment of cancer.

Brief description of the figures

Figure 1 shows schematically the Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-CMV-hCD40L and Ad5 / 3-CMV-mCD40L viruses. The replication-capable Ad5 / 3-hTERT-E1A-hCD40L has the nucleic acid sequence (SEQ ID. NO: 1) encoding the tumor-specific human telomerase reverse transcriptase (hTERT) promoter upstream of the E1 region and gp19k / 6. region has been replaced by the human CD40L cDNA sequence (SEQ ID NO: 2) (Figure 1a). In replication-deficient Ad5 / 3-CMV-hCD40L (Figure 1b) and Ad5 / 3-CMV-mCD40L (Figure 1c), hCD40L and mCD40L, respectively, are in place of the E1A region and the native E1A promoter has been replaced by the CMV promoter. ADP refers to the adenovirus death protein.

Figure 2a shows the results of a flow cytometric assay for expression of hCD40L in the 293 cell line 24 hours after infection at 10 VP / cell. Figure 2b shows in vivo expression of CD40L protein in mouse serum. To analyze hCD40L, blood from mice treated with Ad5 / 3-CMV-hCD40L was harvested only twice (days 4 and 8) due to rapid tumor growth and animals had to be sacrificed on day 8. Figure 2c shows Ad5 / 3-hTERT replicative adenovirus. Functionality of hCD40L expressed by E1A-hCD40L. The luciferase-encoding plasmid containing the Nf-KB5-ELAM promoter was transfected into EJ cells and supernatant from Ad5 / 3-hTERT-hCD40L-infected A549 cells was added. Mock values (uninfected) were subtracted and Nf-κB activity is expressed as the order of magnification of luciferase expression (relative light units, RLU). Supernatants from cells infected with CD40L-free oncolytic virus (Ad5 / 3-hTERT-E1A) and recombinant human CD40L (hCD40L) were used as controls. The assay was performed three times and each time in triplicate. Results are presented as mean ± SEM; ***, P <0.001. Figure 2d also shows the functionality of hCD40L. The human B lymphocyte cell line (Ramos-Blue) stably expresses the NF-κB / AP-1 inducible SEAP reporter gene. Supernatants collected from virus-infected cells were used to stimulate Ramos-Blue cells and SEAP production with QUANTI-Blue assay reagent (InvivoGen, San Diego, CA, USA) was measured as a substitute for cell activation. Results are presented as mean ± SEM; ***, P <0.001.

Figure 3 shows the oncolytic potency of Ad5 / 3-hTERT-E1A-hCD40L in CD40-positive (EJ) or CD40-negative (A549) cell lines. To determine the oncolytic efficacy of the adenovirus of the invention, the A549- (CD40-) (Figure 3a) and EJ- (CD40 +) (Figure 3b) cell lines were infected with Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-hTERT-E1A: IIa, Ad5 / 3-CMV-hCD40L and Ad5 / 3Luc1 at doses of 0.1, 1, 10, 100 and 1000 VP / cell, and cell viability was measured by MTS assay. The monolayers of EJ and A549 cells were infected with either Ad5 / 3-hTE RT-E1A-hCD40L (Figure 3c) or Ad5 / 3-hTE RT-E1A (Figure 3d).

The assay was stopped 7 days after infection and cell viability was measured by __ *** MTS assay. , P <0.001.

Figure 4 shows the antitumor activity of the vectors Ad5 / 3-CMV-hCD40L and Ad5 / 3-hTERT-E1A-hCD40L in mice. Mice bearing A549 (CD40-) (Fig. 4a) or EJ- (CD40 +) (Fig. 4b) subcutaneous tumors were injected intravenously with non-replicating adenovirus Ad5 / 3-CMV-hCD40L at a dose of 108 VP / tumor for three days (0, 2 and 4, n = 5 mice / group), and tumor growth was monitored. This experiment shows that CD40L has antitumor activity in CD40 + cells. Tumors were induced in mice with either A549 (Figure 4c) or EJ (Figure 4d) cell lines and injected with replication-capable adenovirus Ad5 / 3-hTERT-E1A-hCD40L and control virus Ad5 / 3-hTERT-E1A at a dose of 108VP / tumor for three days (0). , 2 and 4, n = 5 mice / group), and tumor volumes were compared relative to the original size. This experiment demonstrates the oncolytic activity of Ad5 / 3-hTERT-E1A-hCD40L, but does not take into account the immunological activity of CD40L because hCD40 is not active in mice. Results are presented as mean ± SEM. *, P <0.05; ", P <0.01;", P <0.001.

Figure 5 shows expression of caspase-3 in CD40 + tumors. Mice bearing EJ (CD40 +) tumors were injected intravenously with Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-hTERT-E1A, Ad5 / 3-CMV-hCD40L and Ad5 / 3-Luc1 ( False) three times. After 26 days, the animals were sacrificed and the tumors were harvested and embedded in paraffin blocks (n = 5 mice / group). Immunohistochemistry for caspase-3 was performed to study the induction of apoptosis. Positive staining appears brown.

Figure 6 shows that Ad5 / 3-CMV-mCD40L inhibits tumor growth in an immunocompetent animal model. To investigate the immunologic effect of CD40L without mixing the oncolysis effect, C57Black mice bearing MB49 (murine bladder cancer cell line) tumors were injected intravenously as ad5 / 3-CMV-mx40 / , 2 and 4 (n = 6 mice / group). Tumor size was monitored and compared with size at day 0. Results are presented as mean ± SEM, ***, P <0.001 (Figure 6a). Figure 6b shows immunohistochemical analysis of apoptosis (active caspase-3) in tumors treated with Ad5 / 3-CMV-mCD40L or Ad5 / 3-Luc1. The expression of active caspase-3 is shown in brown.

Figure 7 depicts the host immune responses in a syngeneic mouse model. Figure 7a shows a cytokine assay for IL-12, IFN-γ, TNF-α and Rantes in spleen cells of mice treated with Ad5 / 3Luc1 (black) or Ad5 / 3-CMV-mCD40L (white). Spleen cells were cultured for 24, 48 or 72 hours. IL-12 indicates activation of antigen-presenting cells, while others are indicative of a Th1-type immune response. For immunohistological analysis, MB49 tumors were harvested on day 16 after infection with the virus. Four pm tumor sections were stained with immunohistochemistry for various markers. Figure 7b shows macrophage (F4 / 80), leukocyte (CD45) and B lymphocyte (CD19) staining. In Figure 7c, tumor sections were stained for helper (CD4 +) and cytotoxic (CD8 +) T cells (brown).

Figure 8 shows a pretreatment analysis of tumor samples for predicting treatment efficacy. The cell killing assay (MTS assay) was performed on fresh, pre-treated, malignant lung fluid from a patient with breast cancer (R73) using an oncolytic adenovirus with Ad5 capsid and Ad5 / 3-hTERT-E1A chimeric capsid), and non-oncolytic adenovirus.

Figure 9 shows the induction of adenovirus recognizing T cells following treatment with oncolytic adenovirus Ad5 / 3-hTERT-E1A-hCD40L. Total PBMCs were isolated and pulsed with an adenovirus 5-penton derived peptide pool to determine the activation of adenovirus-specific cytotoxic T lymphocytes by interferon-gamma ELISPOT.

Figure 10 shows the results of patient sample analysis for either Th1-induced cytokines: interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α) and interleukin-2 (IL-2) or Th2-cytokines: interleukin-4 (IL-4). ), interleukin-5 (IL-5) and interleukin 10 (IL-10) using the Becton-Dickinson Cytokine Multiplex Bead Array System (BD FACSArray; BD Biosciences, San Jose, CA) according to the manufacturer's instructions. Figure 10 shows Th1-induced cytokines on the left and Th2-induced cytokines on the right. Before = serum sample taken before virus administration; 1 month = serum sample taken 1 month after virus treatment; 2 months = Serum samples taken 2 months after virus treatment.

Figure 11 shows the results of analysis of patient serum samples for Th1 cytokines: interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α) and interleukin-2 (IL-2), and Th2 cytokines: interleukin-4 (IL-4), interleukin-5 (IL-5) and interleukin-10 (IL-10) using the Becton-Dickinson Cytokine Multiplex Bead Array System (BD FACSArray; BD Biosciences, San Jose, CA) according to the manufacturer's instructions. Cytokine concentrations are reported relative to their baseline set to 1 and the Th1 / Th2 ratio calculated for each time point. 1 month = serum sample taken 1 month after virus treatment; 2 months = Serum samples taken 2 months after virus treatment.

DETAILED DESCRIPTION OF THE INVENTION Adenoviral vector

In Ad5, as in other adenoviruses, the icosahedral capsid is composed of three major proteins: hexone (II), penton base protein (III), and protruding strand (IV), in addition to small proteins; VI

Vili, IX, purple and IVa2 (Russel W. C., J General Virol 2000; 81, 2573-2604). Proteins VII, small peptide mu and terminal protein (TP) are linked to DNA. Protein V provides a structural link to the capsid via protein VI. A virus-encoded protease is required for processing some structural proteins.

The oncolytic adenoviral vector of the present invention is based on an adenovirus serotype 5 (Ad5) nucleic acid backbone comprising a capsid modification, such as an adenovirus serotype 3 (Ad3) extension (Ad5 / 3 capsid chimerism), a nucleic acid sequence encoding a human NO: 1), upstream of the E1 region, and the nucleic acid sequence encoding human CD40L (SEQ ID NO: 2), in place of the deleted gp19k / 6.7K sequences (965 bp) in the E3 region (Figure 1a). In a preferred embodiment of the invention, the adenoviral vector is based on the human adenovirus. The CD40L sequence used herein differs from the human genomic sequence (NG_007280.1) to facilitate detection in human samples. Thus, the present invention describes a unique CD40L variant.

The Ad5 genome contains early (E1-4), intermediate (IX and IVa2) and late (G1-5) genes with inverted terminal repeats (LITR and RITR, respectively) containing DNA: n sequences required for replication. The genome also contains the packaging signal (Ψ) and MLP (major late promoter).

Transcription of the early stage gene E1A initiates a replication cycle, followed by expression of E1B, E2A, E2B, E3 and E4 proteins. E1 proteins modulate cell metabolism in a way that renders the cell more susceptible to viral replication. For example, they interfere with NF-κΒ, p53 and pRb proteins. E1A and E1B together inhibit apoptosis. The E2 (E2A and E2B) and E4 gene products mediate DNA replication, and the E4 products also affect viral RNA metabolism and inhibit host protein synthesis. E3 gene products are responsible for defense against the host immune system, promote cell lysis and release of virus progeny (Russel W. C., J General Virol 2000; 81, 2573-2604).

The intermediate genes IX and IVa2 encode the small proteins of the viral capsid. MLP affects the expression of late-stage genes L1-5, which results in the production of viral structural components, encapsulation and maturation of viral particles (Russel W. C., J General Virol 2000; 81, 2573-2604).

Compared to the wild-type adenovirus genome, the adeovirus vector of the invention comprises the hTERT promoter in the E1 region, more particularly upstream of the E1A region, lacks gp19k and 6.7K in the E3 region, and comprises a capsid modification in the viral strand. In addition to the modified / partial E1 and E3 regions modified in a preferred embodiment of the invention, the oncolytic adenoviral vector of the invention further comprises one or more regions selected from the group consisting of E2, E4 and late stage regions. In a preferred embodiment of the invention, the oncolytic adenoviral vector comprises the following regions: left ITR, partial E1, pIX, p1-Va2, E2, VA1, VA2, L1, L2, L3, L4, partial E3, L5, E4 and right ITR. The regions may be in the vector in any order, but in a preferred embodiment of the invention, the regions are in a sequential order in the 5-3 'direction. Open reading frames (ORFs) may be on the same DNA strand or on different DNA strands. In a preferred embodiment of the invention, the E1 region comprises a virus compression signal.

As used herein, the term "adenovirus serotype 5 (Ad5) nucleic acid backbone" means an Ad5 genome or osagenome comprising one or more regions selected from the group consisting of partial E1, p1x, p1Va2, E2, VA1 derived from Ad5 , VA2, L1, L2, L3, L4, partial E3, L5 and E4 In a preferred embodiment, the vector of the invention comprises the backbone of Ad5 together with part of Ad3 (e.g., part of the capsid structure).

As used herein, the term "partial" region refers to an area lacking any portion relative to the corresponding wild-type region. For example, "partial E3" refers to an E3 region lacking gp19k / 6.7K.

In this context, the terms "VA1" and "VA2" refer to virus-associated RNAs 1 and 2, which are transcribed by the adenovirus but not translated. VA1 and VA2: Ma play a role in the fight against cellular defense mechanisms.

As used herein, the term "viral packaging signal" refers to a portion of viral DNA consisting of a series of AT-rich sequences that direct the process of encapsidation.

The E3 region is not essential for viral replication in vitro, but the E3 proteins play an important role in the regulation of the host immune response, that is, in the suppression of both natural and specific immune responses. The gp19k / 6.7K deletion in E3 means a deletion of 965 bp in the E3A region of the adenovirus. In the resulting adenovirus construct, both the gp19k and the 6.7K gene have been deleted (Kanerva A. et al., Gene Therapy 2005; 12, 87-94). The product of the gp19k gene is known to bind and isolate major histocompatibility complex I (MHC1) molecules in the mucosa and prevent cytotoxic T lymphocytes from recognizing infected cells. Because many tumors lack MHC1, deletion of gp19k increases viral tumor selectivity (virus is cleared faster than wild-type virus from normal cells, but no difference in tumor cells). 6.7K proteins are expressed on cell surfaces and are involved in the downregulation of TNF-like apoptosis-inducing ligand (TRAIL) receptor 2.

In the present invention, the CD40L transgene is inserted into the gp19k / 6.7k-6e \ eio \ 6u \ ee region under the E3 promoter. This limits expression of the transgene to tumor cells that allow viral replication and subsequent activation of the E3 promoter. The E3 promoter may be any exogenous or endogenous promoter known in the art, preferably an endogenous promoter. In a preferred embodiment of the invention, the nucleic acid sequence encoding CD40L is under the control of the viral E3 promoter.

The gp79 / c deletion is particularly useful for expression of CD40L because it can increase MHC1 presentation of tumor epitopes in tumors that retain this ability. In this context, stimulation of APC and T cells by CD40L may result in optimal benefit.

CD40L enhances the immune response through a variety of mechanisms including the recruitment of cytotoxic T cells, natural killer cell (NK) cells, stimulation of antigen-presenting cells (APCs) and reduction of suppressive cells such as regulatory T cells. The APC can then recruit, activate and target T cells to the tumor. The nucleotide sequence encoding CD40L may be derived from any animal, e.g., human, monkey, rat, mouse, hamster, dog, or cat, depending on the subject being treated, but preferably the human sequence is encoded by CD40L. The nucleotide sequence encoding CD40L may be modified to enhance the effects of CD40L, or be unmodified, i.e., wild-type. In a preferred embodiment of the invention, the nucleic acid sequence encoding CD40L is modified with respect to one nucleotide from the wild-type sequence to allow specific detection in human samples.

The addition of exogenous elements can enhance the effects of vectors on target cells. The use of exogenous tissue or tumor specific promoters is common in recombinant adenoviral vectors. Virus replication is restricted to target cells using hTERT or hTERT variants to control the E1A region. In a preferred embodiment of the invention, hTERT is located upstream of the E1A region, but in addition or alternatively other genes such as E1B or E4 can also be regulated. Exogenous insulators, i.e., inhibitors of non-specific enhancers, left ITR, native E1A promoter, or chromatin proteins, may also be included in recombinant adenoviral vectors of the invention. additional components or modifications, but are not required.

The oncolytic adenoviral vector of the invention comprises a Kap linkage modification. Most adults are exposed to the most widely used ade-novovirus serotype Ad5, and therefore the immune system is able to rapidly produce neutralizing antibodies (NAb) against it. In fact, the incidence of anti-Ad5 NAb can be up to 50%. It has been shown that NAb can be induced against most immunogenic proteins of the adenovirus capsid, and on the other hand, it has been shown that even small changes in the Ad5 filament protrusion can allow escape from the capsid-specific NAb. Thus, modification of the protrusion is important to maintain or increase gene transfer when using adenovirus contact in humans.

In addition, Ad5 is known to bind to a receptor called a CAR through a fiber protrusion, and modifications of this protrusion or fiber may improve target cell entry and result in enhanced oncolysis in many or some cancers (Ranki T. et al., Int J Cancer 2007; 121, 165- 174). Indeed, capsid-modified adenoviruses are preferred tools for improved gene transfer to cancer cells.

As used herein, "capsid" means a viral protein coat containing hexon, strand and penton base proteins. Any capsid modulation, i.e., modification of the hexon, strand and / or penton base proteins known in the art to enhance viral export Modifications may be genetic and / or physical modifications and include, but are not limited to, modifications that add ligands that recognize specific cellular receptors and / or inhibit native receptors for binding, and substitute for adenoviral or non-adenoviral vector. adenovirus protrusion (chimerism), and specific molecules (e.g., fibroblast growth factor 2, FGF2) are added to adeno viruses. Thus, capsid modifications include, but are not limited to, small peptide motif (s), peptide (s), chimerism (s) or mutation (s). adding p the yoke (e.g., cantilevered, arm or tail portion), hexon and / or penton base unit. In a preferred embodiment of the invention, the capsid modification is Ad5 / 3 chimerism, insertion of an integrin binding region (RGD), and / or modification of a heparin sulfate binding polylysine into a strand. In a particular embodiment of the invention, the capsid modification is Ad5 / 3-Kime.

In this context, "Ad5 / 3 chimerism" of the capsid means chimerism in which the protrusion of the strand is Ad serotype 3 and the end strand is Ad serotype 5.

The vector of the invention may also contain other modifications, such as modifications of the E1B region.

In this context, "RGD" refers to the arginine-glycine-aspartic acid-po (RGD) motif revealed on the surface of the penton base unit and interacts with cellular α-ν-β integrins that support adenovirus internalization. In a preferred embodiment of the invention, the capsid modification is an RGD-4C modification. "RGD-4C modification" refers to the insertion of the heterologous integrin-binding RGD-4C motif into the H1 loop of the filament region. 4C refers to the four cysteines that form sulfur bridges in RGD-4C. The construction of a recombinant Ad5 filament gene encoding a strand containing a RGD-4C peptide is described in detail, for example, in an article by Dmitry I. et al. (Journal of Virology 1998; 72, 9706-9713).

In this context, "heparan sulfate binding polylysine modification" means the addition of seven cycles of lysine to the C-terminus of a filament.

Expression cassettes are used to express transgenes in a subject, e.g., a cell, using vectors. As used herein, the term "expression cassette" means a DNA vector or portion thereof comprising nucleotide sequences encoding cDNAs or genes or nucleotide sequences that direct and / or regulate expression of said cDNAs or genes. The same or different expression cassettes may be inserted into one or more vectors The Ad5 vectors of the present invention may comprise either multiple expression cassettes or a single expression cassette.

However, only one expression cassette is sufficient. In a preferred embodiment of the invention, the oncolytic adenoviral vector comprises at least one expression cassette. In a preferred embodiment of the invention, the oncolytic adenoviral vector comprises only one expression cassette.

The cell comprising the adenoviral vector of the invention may be any cell, for example a eukaryotic cell, a bacterial cell, an animal cell, a human cell, a mouse cell and so on. The cell may be an in vitro, ex vivo or in vivo cell. For example, the cell may be used to produce an adenoviral vector in vitro, ex vivo or in vivo, or the cell may be a target, e.g., a tumor cell infected with the adenoviral vector.

In a method for producing CD40L in a cell, a vehicle comprising the vector of the invention is delivered to a cell, and the CD40L gene is expressed and the protein is translated and secreted paracrine. A "vehicle" can be any viral vector, plasmid or other medium, such as a particle, capable of delivering a vector of the invention to a target cell. Any conventional method known in the art can be used to deliver a vector to a cell.

A tumor-specific immune response may be increased in a subject using the present invention. Cytotoxic T cells and / or natural killer cells are stimulated and recruited to the tumor area as a result of CD40L expression. In a preferred embodiment of the invention, the amount of natural killer cells and / or cytotoxic T cells is increased in the target cell or tissue. Various signs of an immune response (e.g., inflammatory signs) can be determined to monitor or investigate the effects of the invention. The most common signs include, but are not limited to, proliferation of proinflammatory cytokines and tumor or adenovirus specific cytotoxic T cells, recruitment and activation of antigen presenting cells, or enlargement of local lymph nodes. The levels of these markers can be assayed according to any conventional method known in the art, including, but not limited to, methods utilizing antibodies, probes, primers, and the like, e.g., ELIS-POT assay, tetramer assay, pentamer assay, and blood or tumor cell types.

Cancer

The oncolytic vectors of the invention are engineered to be capable of replication in cells expressing human telomerase reverse transcriptase (hTERT), a catalytic subdomain of human telomerase. These include more than 85% of human tumors that are found to increase expression of the hTERT gene and its promoter, while most adult somatic cells lack or transiently express very low levels of enzymes. (Shay and Bacchetti 1997, Eur J Cancer 33: 787-791).

Any cancer or tumor, including malignant and benign tumors, as well as primary tumors and metastases, may be subject to gene therapy as long as they express hTERT. In a particular embodiment of the invention, the cancer is any solid tumor. In one advantageous embodiment, the cancer is selected from the group consisting of nasopharyngeal cancer, synovial carcinoma, hepatocellular carcinoma, kidney cancer, connective tissue cancer, melanoma, lung cancer, intestinal cancer, colon cancer, rectal cancer, colorectal cancer, brain cancer, throat cancer, oral cancer, liver cancer, bone cancer, pancreatic cancer, placental cancer, gastrinoma, pheochromocytoma, prolactinoma, T-cell leukemia / lymphoma, neuroma, von Hippel-Lindau's disease, zollinger-ellison syndrome, adrenal carcinoma, anal cancer, viral cancer, , oligodendroglioma, neuroblastoma, meningioma, spinal tumor, osteochondroma, chondrosarcoma, Evving's sarcoma, cancer of unknown primary location, carcinoid, gastrointestinal carcinoid, fibro-sarcoma, breast cancer, Paget's disease, cervical cancer, cancer of the cervix, silmäsy cancer, neck cancer, kidney cancer, Wilm's tumor, Kaposi's sarcoma, prostate cancer, testicular cancer, Hodgkin's disease, non-Hodgkin's lymphoma, skin cancer, mesothelioma, multiple myeloma, ovarian cancer, endocrine pancreatic cancer, endocrine pancreatic cancer, , soft tissue sarcoma, Retino-blastoma, small intestine cancer, stomach cancer, thymic carcinoma, thyroid cancer, trofoblastisyöpä, hydatidiform mole, uterine cancer, endometrial cancer, vulval, ulkosynnytinsyöpä, auditory nerve tumors, mucosis fungoides, in-sulinooma, carcinoid syndrome, somatostatinoma, iensyöpä, heart cancer, lip cancer, film cancer , oral cancer, nerve cancer, palatine cancer, salivary gland cancer, peritoneal cancer, pharyngeal cancer, pleural cancer, salivary gland cancer, tongue cancer and tonsillectomy.

Pharmaceutical composition

The pharmaceutical composition of the invention comprises at least one type of vector of the invention. In addition, the composition may comprise at least two, three or four different vectors of the invention. In addition to the vector of the invention, the pharmaceutical composition may also comprise other vectors such as other adenoviral vectors such as those described in US2010166799 A1, other therapeutically effective agents, other agents such as pharmaceutically acceptable carriers, buffers, adjuvants, adjuvants, antiseptics, and / or any components normally present in similar products.

The pharmaceutical composition may be in any form suitable for administration, for example solid, semi-solid, or liquid. The formulation may be selected from the group consisting of, but not limited to solutions, emulsions, suspensions, tablets, pellets, and capsules.

In a preferred embodiment of the invention, the oncolytic adenoviral vector or pharmaceutical composition acts as an in situ cancer vaccine. In this context, "in situ cancer vaccine" refers to a cancer vaccine that both kills tumor cells and enhances the immune response against tumor cells. Viral replication is a potent signal of danger to the immune system (necessary for a TH1-type response) and thus serves as a potent costimulatory factor for CD40L-mediated maturation and activation of APCs and NK cell recruitment. Suppression of regulatory cells also helps in this regard. Tumor cell lysis also helps to present tumor fragments and epitopes to APCs, and inflammation produces more costimulation. Thus, an epitope-independent (i.e., non-HLA-restricted) response is produced in each tumor and thus occurs in situ. The tumor-specific immune response is activated in the target cell, subsequently allowing antitumor effects to occur at the entire target level, e.g., distant metastases. The effective dose of vectors depends on many factors, such as the subject to be treated, the type of tumor, the location of the tumor, and the category of the tumor. For example, the dose may vary from about 108 viral particles (VP) to about 1014 VP, preferably from about 5x109 VP to about 1013 VP, and more preferably from about 8x109 VP to about 1012 VP. In one particular embodiment of the invention, the dosage is about 5x101 ° -5x1011 VP.

The pharmaceutical compositions can be produced by any of the conventional methods known in the art, for example, using one of the following: batch, batch feed and perfusion culturing modes, column chromatography purification, CsCl gradient purification and perfusion modes at low shear cell retention.

Allocation

The vector or pharmaceutical composition of the invention may be administered to any eukaryotic subject selected from the group consisting of plants, living and humans. In a preferred embodiment of the invention, the subject is a human or animal. The animal may be selected from the group consisting of pet animals, domestic animals, and farm animals.

Any conventional method of administering a vector or composition to a subject can be used. The route of administration will depend on the formulation or form of the composition, the disease, the location of the tumors, the patient, the comorbidities, and other factors. In a preferred embodiment of the invention, administration is by intravenous, intramuscular, intra-arterial, intravenous, pleural, intracellular, intrathecal or peritoneal injection or oral administration.

Even one administration of the oncolytic adenoviral vector of the invention can provide therapeutic effects. However, in a preferred embodiment of the invention, the oncolytic adenoviral vectors or pharmaceutical compositions are administered several times during a treatment period. Oncolytic adenoviral vectors or pharmaceutical compositions may be administered, for example, 1 to 10 times during the first two weeks, during the first four weeks, monthly or during a treatment period. In one embodiment of the invention, they are administered 3 to 7 times in the first two weeks, then in the fourth week and then monthly. In one particular embodiment of the invention, they are administered four times in the first two weeks, then in the fourth week and then monthly. The length of the treatment period can vary, for example from 2 to 12 months or longer.

In addition, administration of the oncolytic adenoviral vectors of the invention may advantageously be combined with administration of other oncolytic adenoviral vectors, such as those described in US201066799 A1. The administration may be simultaneous or sequential.

To avoid neutralizing antibodies in a subject, the vectors of the invention may vary between treatments. In a preferred embodiment of the invention, the subject is provided with an oncolytic adenovirus vector having a different capsular filament protector compared to the prior treatment vector. In this context, the "capsid filament protrusion" refers to the protrusion portion of the filament protein (Figure 1a).

The gene therapy of the invention is effective on its own, but combining ade-noviral gene therapy with another treatment, such as conventional therapy, may be more effective than either alone. For example, each agent of the combination therapy may function autonomously in tumor tissue, adenoviral vectors may sensitize cells to chemotherapy or radiation therapy, and / or chemotherapeutic agents may enhance viral replication levels or affect target cell receptor status. Alternatively, the combination may modify the immune system of the subject so as to be beneficial to the efficacy of the treatment. For example, chemotherapy could be used to reduce suppressive cells, such as regulatory T cells. The combination therapy agents may be administered simultaneously or sequentially. In a preferred embodiment of the present invention, patients are simultaneously receiving cyclophosphamide to enhance the immunological effect of the treatment.

In a preferred embodiment of the invention, the method or use further comprises administering concurrent radiation therapy to the subject. In another preferred embodiment of the invention, the method or use further comprises the administration of concurrent chemotherapy to the subject. In another preferred embodiment, the method or use further comprises administering to the subject other oncolytic adenovirus or vaccinia virus vectors. The vectors may be administered simultaneously or sequentially.

As used herein, "concurrent" refers to treatment given before, after or concurrently with the gene therapy of the invention. The period of concurrent treatment may vary from minutes to several weeks. Preferably, the concurrent treatment lasts several hours. In one embodiment, cyclophosphamide is administered both intravenously.

Suitable agents for combination therapy include, but are not limited to, all-trans-retinoic acid, azacitidine, azathioprine, bleomycin, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, dau-norubicin, docetaxel, doxiflubidine, , gemcitabine, hydroxyurea, idarubicin, imatinib, michlorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, temozolomide, teniposide, thioguanine, valrubicin, vin-blastin, vincristine

In a preferred embodiment of the invention, the method or use further comprises administering verapamil or another calcium channel blocker to the subject. "Calcium channel blocker" refers to a class of drugs and natural substances that interfere with calcium channel conduction and may be selected from the group consisting of verapamil, dihydropyridines, gallopamil, diltiazem, mibefradiil, bepridil, fluspirilene, and fendilin.

In a preferred embodiment of the invention, the method or use further comprises administering agents to induce autophagy. Autophagy refers to a catabolic process in which the cellular components are broken down by lysosomal machinery. "Autophagy-inducing agents" means substances which are capable of inducing autophagy, and may be selected from the group consisting of, but not limited to, mTOR inhibitors, PI3K inhibitors, lithium, tamoxifen, chloroquine, bafilomycin, temozirolimus, temozirolimus, and temsirolimus. further comprises administering temozolomide to a subject Temozolomide may be either oral or intravenous temotolomomide Autophagy inducing agents may be combined with immunomodulatory agents In one embodiment, the oncolytic adenovirus encoding CD40L is combined with both temozolomide and cyclophosphamide.

In one embodiment of the invention, the method or use further comprises administering chemotherapy or anti-CD20 treatment or other treatment that inhibits neutralizing antibodies. "Anti-CD20 treatment" refers to agents capable of killing CD20 positive cells and which may be selected from the group consisting of rituximab and other anti-CD20 monoclonal antibodies. "Neutralizing Antibody Therapy" refers to agents that are capable of inhibiting the development of antiviral antibodies normally produced as a result of infection, and which may be selected from the group consisting of various chemotherapeutic agents, immunomodulatory agents, corticoids, and other drugs. a group consisting of, but not limited to, cyclophosphamide, cyclosporine, azathioprine, methyl-prenizolone, etoposide, CD40L, CTLA4Ig4, FK506 (tacrolimus black), IL-12, IFN-gamma, interleukin , anti-CD8, anti-CD4 antibodies, myeloablation, and oral adenoviral proteins.

The approach described in this application may also be combined with molecules capable of defeating neutralizing antibodies. Such agents include liposomes, lipoplexes and polyethylene glycol, which can be mixed with the virus. Alternatively, neutralizing antibodies may be removed by an immunopheresis column consisting of adenovirus capsid proteins.

The oncolytic adenoviral vector of the invention initiates virion-mediated oncolysis of tumor cells and activates the human immune response against tumor cells. In a preferred embodiment of the invention, the method or use further comprises administering agents which are capable of reducing regulatory T cells in the subject. "Regulatory T Cell Reduction Agents" refers to agents that reduce the number of cells identified as suppressor T cells or regulatory T cells. These cells have been identified to contain one or more of the following immunophenotype characters: CD4 +, CD25 +, FoxP3 +, CD127 and GITR + Such suppressor T cell or regulatory T cell depressants may be selected from the group consisting of anti-CD25 antibodies or chemotherapeutic agents.

In a preferred embodiment of the invention, the method or use further comprises administering cyclophosphamide to the subject. Cyclophosphamide is a common chemotherapy agent that has also been used in some autoimmune diseases. In the present invention, cyclophosphamide can be used to enhance viral replication and the effects of CD40L-induced stimulation of NK cells and cytotoxic T cells to elicit an improved immune response to a tumor. It can be used as intravenous bolus doses or orally in small doses metronomically or in combination.

Any method or use of the invention may be either an in vivo, an ex vixo or an in vitro method or use.

One observed limitation of the use of adenoviral vectors in the treatment of cancer is their immunogenicity. However, because the immune system of a cancer patient has failed to remove the tumor due to the immunosuppressive nature of the tumor environment, the immunogenicity of the adenoviruses becomes an advantage. In the present invention, this effect is enhanced by maintaining the replication ability and arming with an immunostimulatory molecule, CD40L. The adenoviral vectors of the present invention exhibit four important features. Tumor transduction has been enhanced by capsid modification, such as serotype chimerism at the Ad3 protrusion otherwise in the Ad5 capsid. Tumor selectivity is achieved by inserting the hTERT promoter in front of E1A. Recruitment and stimulation of antigen presenting cells to induce a Th1-type cytotoxic T cell response has been accomplished by arming CD40L virus. Finally, CD40L can also induce apoptosis of CD40 + tumors.

The adenoviruses of the present invention have been found to be effective in inducing CD40L expression in both CD40 + and CD40 cells. In an oncolytic model that ensures that oncolysis ultimately kills transduced tumor cells, the secretion or release of CD40L from lysing cells produces an apoptotic bystander effect on nearby tumor cells. However, it is believed that the major benefit of using CD40L is the immunostimulatory effect.

The oncolytic adenovirus Ad5 / 3-hTERT-E1A has been shown to have significantly higher oncolytic activity compared to wild-type Ad5. (Bauerschmitz GJ, et al., Cancer Res 2008; 68: 5533-9). In the same study, when comparing the selectivity of hTERT to a panel of oncolytic adeoviruses displaying various tumor-specific promoters such as α-lactalbumin, cyclooxygenase or multidrug resistance protein, Ad5 / 3-hTERT-E1A showed the best results in vitro in vivo. Thus, Ad5 / 3-hTERT-E1A is an ambitious control virus for the adenoviruses of the present invention.

When comparing the oncolytic adenoviruses of the present invention, exemplified by Ad5 / 3-hTERT-E1A-hCD40L, with non-armed oncolytic adenovirus, Ad5 / 3-hTERT-E1A, it was found that both viruses were equally effective in terms of oncolytic activity in vivo. (Figures 4c, 4d). This was an important finding because transgene expression may sometimes inhibit viral potency and Ad5 / 3-hTERT-E1A-hCD40L was slower than Ad5 / 3-hTE RT-E1A A549 cells in vitro. In vitro, Ad5 / 3-hTE RT-E1A-hCD40L had more antitumor activity on CD40 + AJ49 cells than CD40-A549 cells, whereas the opposite was true for Ad5 / 3-hTERT-E1A (Figures 3c, 3d ).

Although the greatest use of the oncolytic adenoviruses of the invention, such as Ad5 / 3-hTERT-E1A-hCD40L, could be in the presence of CD40 + tumors, where all three antitumor activities (oncolysis, apoptosis, immune stimulation) could be affected, it is believed potential use is not limited to CD40 + tumors. There are reports showing that CD40L activates antigen-presenting cells even when the tumor is CD40- (Noguchi M, et al., Cancer Gene Ther 2001; 8: 421-9; Sun Y, et al., Gene Ther 2000). ; 7: 1467- 76. Since even non-armed oncolytic adenoviruses have been shown to be of use in humans, whether or not lytic adenoviruses containing hCD40L could represent an improvement regardless of tumor CD40 status.

Clinical and preclinical work in the field of tumor immunology and vaccine development over the past two decades has shown that several approaches can be used to induce an anti-tumor immune response. Unfortunately, approaches aimed at inducing immune responses have not been very effective in patients with advanced and highly immunosuppressive tumors. In contrast, the first successful immunotherapeutic agents contain either trained and stimulating T cells (to overcome tumor-mediated immunosuppression) or antibodies capable of reducing immunosuppression (Motohashi et al. 2006 Clin Cancer Res 12: 6079-86; Hodi et al. 2008 Nature Clinical Practice Oncology 5: 557-561). Many researchers also use pretreatment to "make room" for activated T cells and to reduce immunosuppressive cells. Thus, the critical teaching is that successful immuno-therapy may require breaking the immunological tolerance acquired by tumors.

However, the adenoviral vectors of the present invention exhibited antitumor responses in patients with poorly responsive and immunosuppressive disease, and these effects were associated with induction of immunity and a change in Th2 → Th1.

In conclusion, the oncolytic CD40L-expressing adenoviral vectors of the invention, such as, for example, Ad5 / 3-hTERT-E1A-hCD40L, exhibit significant antitumor activity. An important part of the effect is the induction of a Th1-type immune response, which results in the accumulation of cytotoxic T cells at the tumor site and their activation.

The following, for example, illustrate the present invention, but are not intended to be limiting in any way.

eXAMPLES

Animals

All animal protocols were reviewed and approved by the Experimental Animal Committee of the University of Helsinki and the Provincial Office of Southern Finland. C57Black mice and NMRI nude mice were obtained from Taconic (Ejby, Denmark) at 4-5 weeks of age and were quarantined for at least one week prior to study. The mice were frequently monitored for their health, and as soon as any sign of pain or pain appeared, they were killed.

cell lines

106 A549 cells (human lung adenocarcinoma cell line available from American Type Culture Collection, ATCC, 10801 University Boulevard, Manassas, Virginia 20110-2209, USA) or EJ cells (human bladder carcinoma cell line, kindly provided by Angel) Loskog, Uppsala University, Sweden). The Ramos-Blue ™ cell line was from InvivoGen (San Diego, CA, USA)

In an immunocompetent model, 5x105 MB49 cells (mouse bladder carcinoma cell line kindly provided by Dr. Angelina Loskog, University of Uppsala, Sweden) were injected subcutaneously into the shaved flanks of C57Black mice (n = 7 mice / group). The virus was injected three times intravenously at a dose of 3 x 10 8 VP / tumor on days 0, 2 and 4 when the tumors reached a size of about 5 x 5 mm.

Statistical analysis

A two sample Student's t test was used and a p value <0.05 was considered significant. Survival data were processed by Kaplan-Meier analysis.

Example 1. Cloning of Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-CMV-hCD40L and Ad5 / 3-CMV-mCD40L

Ad5 / 3-hTERT-E1A-hCD40L (SEQ ID NO: 5) was constructed and amplified using standard adenovirus production techniques (Kanerva A, et al., Mol Ther 2002; 5: 695-704; Bauerschmitz GJ, et al., Mol Ther 2006; 14: 164-74; Kanerva A and Hemminki A, Int J Cancer 2004; 110: 475-80; VolkAL et al., Cancer Biol Ther 2003; 2: 511-5). Briefly, human CD40L cDNA (a friendly gift from Prof. Eliopoulos Bridge, University of Crete, Heraklion, Greece) was amplified by polymerase chain reaction (PCR) using specific primers (forward primer: TTTAACATCTCTCCCTCTGTGATT; SEQ ID NO: 3G; ID N0: 4) containing the specific restriction sites Sun \ IMun \ insertion. The PCR amplification product was then subcloned into pTHSN (Kanerva A., et al., Gene Ther 2005; 12: 87-94) and then recombined with pAd5 / 3-hTERT-E1A (Bauerschmitz GJ, et al., Cancer Res 2008; 68: 5533-9) to form pAd5 / 3-hTERT-E1A-hCD40L. This plasmid was linearized with Pacl and transfected into A549 cells for amplification and recovery.

All cloning steps were confirmed by PCR and several restriction di gestions. The pTHSN-hCD40L shuttle plasmid was sequenced. The absence of wild-type E1 was confirmed by PCR. The E1 region, the transgene and the strand were checked for final virus by sequencing and PCR. All steps of virus production, including transfection, were performed on A549 cells to avoid the risk of wild-type recombination as previously described (Kanerva A. et al. 2003, Mol Ther 8, 449-58; Baeurschmitz GJ et al. 2006, Mol Ther 14, 164 -74). hCD40L is under the control of the E3 promoter (particularly under the control of endogenous viral E3A gene expression control elements), leading to the expression of replication-associated transgenes that begin about 8 h after infection. E3 is intact except for the 6.7K / gp19K \ n deletion. Figure 1a shows the structure of pAd5 / 3-hTERT-E1A-hCD40L.

To generate non-replicating adenoviruses Ad5 / 3-CMV-hCD40L and Ad5 / 3-CMV-mCD40L, expression cassettes containing either hCD40L or mCD40L were inserted into the pShuttle-CMV plasmid (Stratagene, La Jolla, CA, USA). Shuttle plasmids were recombined with the pAdeasy-1.5 / 3 plasmid (Krasnykh VN, et al., J Virol 1996; 70: 6839-46), which contains the entire adenovirus genome, and the resulting Rescue plasmids were transfected into 293 cells (human transformed embryonic kidney cell line). , available from Microbix, Toronto, Ontario, Canada) to form Ad5 / 3-CMV-hCD40L and Ad5 / 3-CMV-mCD40L. Figures 1b and 1c show the structures and cloning of Ad5 / 3-CMV-hCD40L and Ad5 / 3-CMV-mCD40L, respectively.

The control vector Ad5 / 3-Luc1 (Kanerva A, et al., Clin Cancer Res 2002; 8: 275-80) and Ad5 / 3-hTERT-E1A (Bauerschmitz GJ, et al., Cancer Res 2008; 68: 5533-9 ) has been reported previously. Ratios of VP to plaque forming units for Ad5 / 3-Luc1, Ad5 / 3-hTERT-E1A, Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-CMV-hCD40L and Ad5 / The 3-CMV-mCD40L had 25, 31,200, 138 and 86, respectively.

Example 2. Expression and Functionality of Generated Adenoviruses: In Vitro and In Vivo

Flow cytometry and an enzyme-linked immunosorbent assay (ELISA) were used to examine the expression of hCD40L. For flow cytometric analysis, human embryonic kidney 293 cells were infected with Ad5 / 3-hTERT-E1A-hCD40L or Ad5 / 3-CMV-hCD40L using 10 VP / cell in medium containing 2% fetal calf serum (FCS). Control cells (mock) were treated with 2% Dulbecco's modified Eagle's medium alone. Twenty-four hours later, cells were stained with either hCD40L-FITC (555699, BD Biosciences Pharmacy Franklin Lakes, NJ) for 30 minutes or isotype control (IC) to measure background fluorescence from cellular autofluorescence and non-antigen specific binding. Flow cytometry analysis was performed on a BDLSR (BD Biosciences, Franklin Lakes, NJ).

For ELISA analysis, A549 xenografts and MB49 syngeneic tumors were induced and treated with either Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-CMV-hCD40L or Ad5 / 3-CMV-mCD40L as above. Blood samples were taken on days 4, 8 and 12 after the first viral injection. For analysis of hCD40L, blood from Ad5 / 3-CMV-hCD40L-treated mice was harvested only twice (day 4 and 8) for rapid tumor growth and animals had to be sacrificed on day 8. Serum levels of hCD40L and mCD40L were determined in human CD40. ligand ELISA kit (ELH-CD40L-001, RayBiotech Inc, Nor-cross GA, USA) and mouse sCD40L ELISA kit (BMS6010, Bender Medsytems, Austria) according to the manufacturer's protocol.

The flow cytometry results shown in Fig. 2a show that both replication-capable Ad5 / 3-hTERT-E1A-hCD40L and replication-deficient Ad5 / 3-CMV-hCD40L resulted in high expression of CD40L in vitro.

The expression of hCD40L and mCD40L was also confirmed by in vivo ELISA (Figure 2b). Ad5 / 3-CMV-hCD40L resulted in higher serum concentrations than Ad5 / 3-hTERT-E1A-hCD40L because the transduced A549 cells are CD40 and are not expected to be killed by CD40L. Thus, transduced cells continue to produce CD40L ad inifinitum, whereas Ad5 / 3-hTERT-E1A-hCD40L induces oncolysis of A549 cells, which limits the time they have to produce CD40L. This might be advantageous from a safety point of view, as CD40L can cause side effects when present in high concentrations. A maximum human tolerated dose of rhCD40L was reported to correspond to a serum concentration of 2900 pg / ml, which is 100 times higher than that seen with Ad5 / 3-hTERT-E1A-hCD40L. Ad5 / 3-CMV-mCD40L resulted in lower serum mCD40L concentrations than Ad5 / 3-CMV-hCD40L, presumably because mCD40L is metabolized by mouse tissues and cells, whereas hCD40L is probably not because it is inactive in mice.

The functionality of CD40L expressed by Ad5 / 3-hTERT-E1A-hCD40L was examined in lung cancer cells (A549). Monolayers of cell line A549 (5x106 cells / T25 flask) were infected with 1000 VP / cell Ad5 / 3-hTERT-E1A-hCD40L and Ad5 / 3-hTERT-E1A, and one flask was not infected (mock). The supernatant was collected 48 hours after infection and filtered with 0.02 µm filters (Whatman 6809-1002, Maidstone England, England). The supernatant was used for two functional assays.

In the first functionality assay, monolayers of the EJ cell line were transfected with pNiFty-Luc (InvivoGen) and cultured overnight. pNiFty-Luc is a genetically engineered endothelial cell leukocyte adhesion molecule (ELAM) promoter that combines five NF-κB sites and encodes luciferase. Induction of NF-κΒ Activates the promoter leading to luciferase expression.

Supernatant recovered from A549 monolayers was added to EJ cells and cultured for 12 hours. One pg / ml recombinant hCD40L protein (Abcam, Cambridge, MA) was used as a positive control in the assay. Cells were lysed and luciferase activity was measured (Luciferase Assay System, Pro-mega, Madison, WI). Mock values were subtracted and Nf-κB activity is expressed as a multiple of luciferase expression (relative light units, RLU). The assay was performed five times and each time as a triple assay. Results are presented as mean ± SEM; ***, P <0.001 (Figure 2c).

The second functionality assay was performed on RAMOS-Blue cells. The Ramos-Blue cell line is a human B-lymphocyte cell line that stably expresses the SEF reporter gene inducible by NF-KB / AP-1. When stimulated, these cells produce SEAP in the supernatant, which can be measured using the QUANTI-Blue assay reagent (InvivoGen, San Diego, CA, USA) (Figure 2d).

These functionality assays indicate that the virus produces biologically active hCD40L. A 2.3-fold increase is observed in NF-κB activation by hCD40L, which is expressed by the replication-capable Ad5 / 3-hTERT-E1A-hCD40L adenovirus in EJ cells transfected with the ELAM plasmid (Figure 2c), and 4, 5-fold increase in NF-kB / AP-1 in Ramos-Blue cells (Fig. 2d). Taken together, these results confirm that the viruses generated express fully functional CD40L both in vitro and in vivo at all concentrations predicted to be safe in humans based on the use of recombinant hCD40L.

Example 3. In vitro assay for oncolytic efficacy of formed adenoviruses

EJ- (CD40 +) and A549- (CD40-) cell lines were used to determine the oncolytic efficacy of the formed adenoviruses. In the cell viability assay, cells in 96-well plates were infected with various concentrations (0.1, 10, 100, 1000 VP / cell) of Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-CMV-hCD40L and their control viruses Ad5 / 3-hTERT-E1A and Ad5 / 3-Luc1 suspended in 2% DMEM. After one hour, the cells were washed and incubated for 7 days in medium containing 5% FCS. Cell viability was then analyzed using an MTS assay (Cell Titer 96 AQueous One Solution Proliferation Assay, Promega).

With Ad5 / 3-hTERT-E1A-hCD40L, complete killing is seen at 1000 viral particles / cell (VP / cell) in the EJ (CD40 +) cell line (Figure 3b). In the A549 (CD40-) cell line, the oncolytic activity of Ad5 / 3-hTERT-E1A-hCD40L is slower compared to the control virus Ad5 / 3-hTERT-E1A (Figure 3a). Comparison of A549 and EJ cell lines infected with the same doses of Ad5 / 3-hTERT-E1A-hCD40L shows a significant increase in the cell killing of EJ (CD40 +) cells (Figure 3c). The same cell lines when infected with the replicated control adenovirus Ad5 / 3-hTERT-E1A replicate: A549 is more sensitive to the virus (Fig. 3d). These experiments show that Ad5 / 3-hTERT-E1A-hCD40L has an oncolytic activity that is proportional to the control virus and kills CD40 + cells more effectively than the positive control virus.

Example 4. Efficacy of adenoviruses expressing hCD40L in vivo in mice

The lack of productive replication of human adenovirus in mouse cells and the inactivity of hCD40L in mouse tissues complicate the preclinical evaluation of Ad5 / 3-hTERT-E1A-hCD40L. Therefore, it was decided to isolate the three antitumor mechanisms into three different mouse models.

For immune-deficient models, 106 A549 cells were injected subcutaneously into the flanks of nude mice (n = 5 mice / group). When the tumors reached a size of about 5x5 mm, mice bearing subcutaneous A549 (CD40-) (Figure 4a) or EJ (CD40 +) (Figure 4b) were injected intravenously with an ad5 / 3-CMV-hCD40L non-replicating adenovirus. 108 VP / tumor for three days (0, 2 and 4), and tumor growth was monitored. Mock animals received PBS only. This experiment shows that CD40L has antitumor activity in CD40 + cells (Figure 4b), whereas antitumor activity cannot be seen in CD40 cells (Figure 4a).

For replicable models, tumors were injected intravenously with Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-hTERT-E1A, and mockel-la at a dose of 108 VP / tumor for three days (0, 2 and 4), and tumor volumes were compared. in relation to the original size. Ad5 / 3-hTERT-E1A-hCD40L was found to be as effective as the positive control virus Ad5 / 3-hTERT-E1A in both CD40-negative (Figure 4c) and CD40-positive tumors (Figure 4d). This experiment demonstrates the oncolytic activity of Ad5 / 3-hTERT-E1A-hCD40L, but disregards the immunological activity of CD40L because hCD40L is not active in mice. This experiment further demonstrates that transgene expression does not impair the oncolytic effect of Ad5 / 3-hTERT-E1A-hCD40L (Figures 4c, 4d).

For the immunocompetent model, 5x105 MB49 cells were injected subcutaneously into the shaved flanks of C57Black mice (n = 7 mice / group). Ad5 / 3-CMV mCD40L was injected three times intravenously at a dose of 3x108VP / tumor on days 0, 2 and 4 when tumors reached a size of approximately 5x5 mm. Tumor growth was monitored and organs / tumors harvested at the end of the experiments. Tissues were immersed in paraffin and histology and immunohistochemistry (see Example 5 below) were performed.

A CD40 + xenograft model (nude mice without T cells) was used to investigate the effect of oncolysis with induction of CD40L-induced apoptosis without distortion due to immunological effects. CD40L expression itself had antitumor activity (Figure 4b), and Ad5 / 3-hTERT-E1A-hCD40L was as effective as a positive control virus, indicating that the oncolytic effect of Ad5 / 3-hTERT-E1A-hCD40L is not impaired. (Figure 4d).

In addition, to demonstrate that CD40L promotes apoptosis in CD40 + tumors in nude mice, mice bearing EJ (CD40 +) tumors were injected with Ad5 / 3-Luc1 (mock), Ad5 / 3-hTERT-E1A, Ad5 / 3-hTERT-E1A. -hCD40L and Ad5 / 3-CMV-hCD40L three times. After 26 days, the animals were sacrificed and the tumors were harvested and embedded in paraffin blocks (n = 5 mice / group). Immunohistochemistry (for details, see Example 5 below) on caspase-3 was performed to investigate the possible induction of apoptosis. Although Ad5 / 3-hTERT-E1A, as reported for oncolytic adenoviruses, and although Ad5 / 3-CMV-hCD40L, due to its hCD40L expression and its apoptotic effect, somewhat induces apoptosis, Ad5 / 3-hTERT-E1A- Much more apoptosis was seen with hCD40L (Fig. 5).

Example 5. Antitumor activity of mCD40L in syngeneic immunocompetent animals

The immunohistochemistry used in the analysis of mCD40L in a syngeneic immunocompetent animal model was performed as follows. Tissues were fixed in 4% formalin and paraffin blocks were prepared. Four µm thick tissue sections were prepared and incubated with the primary antibody at the dilutions listed in Table 1. Sections were incubated with the challenge kit either in rabbits using the LSAB2 + Dako System kit (DakoCytomation, Carpinteria, CA, USA (K0673)) or in rat raised antibodies using the IHC Select kit (DAB150-RT, Millipore, MA, U.S). Sections were counterstained with hematoxylin and water removed with ethanol, clarified with xylene, and sealed with Canadian balsam. Photographs were taken with an Axio-plan2 microscope (Carl Zeiss) equipped with Axiocarrr (Zeiss).

Table 1. Antibodies used in the study

To investigate the immunological activity of CD40L without distortion due to oncolysis, C57Black mice bearing subcutaneous MB49 tumors were injected intravenously with adenovirus replication-defective Ad5 / 3-CMV-mCD40L or control Ad5 / 3-lx10 ann and 4 (n = 6 mice / group). Tumor size was monitored and plotted against day 0. The results are shown in Figure 6a. The Ad5 / 3-CMV-mCD40L treated group shows a significant increase in antitumor activity (p = 0.001).

For immunohistochemical determination of apoptosis (active caspase-3) in Ad5 / 3-CMV-mCD40L and Ad5 / 3-Luc1 treated tumors, the tumors were harvested 16 days after the first treatment and analyzed for caspase-3 activity. The results are shown in Figure 6b. Positive staining, i.e., brown active caspase-3 expression, suggests that the antitumor activity was due in part to apoptosis induced by the binding of mCD40L to CD40 + MB49 cells (Figure 6b).

To analyze the host immune responses in a syngeneic mouse model, 4 µm tumor sections were stained with immunohistochemistry for various markers: macrophage (F4 / 80), leukocytes (CD45) and B lymphocytes (CD19) (Figure 7a). Tumor sections were also stained for helper (CD4 +) and cytotoxic (CD8 +) T cells (brown) (Figure 7c).

Example 6. Effect on Antigen-Presenting Cells An important part of the potential antitumor activity of CD40L-encoding viruses is their effect on antigen-presenting cells. Cyto-Chinese analysis for IL-12, TNF-α, INF-γ and RANTES was performed in serum and in cultured spleen cells supernatant mice treated with Ad5 / 3Luc1 or Ad5 / 3-CMV-mCD40L. , using the BD FACSArray kit according to the manufacturer's protocol (BD Cytometric Bead Array Mouse Flex Sets, BD Biosciences). Spleens were minced and spleen cells were cultured in 10% DMEM supplemented with 1% L-glutamine and penicillin / streptomycin. Supernatants were collected at 24, 48 and 72 hours and analyzed for cytokines by the FACSArray kit.

FACSArray analysis shows increased production of INF-γ, TNF-α, RAN-TES and IL-12 in the group treated with Ad5 / 3-CMV-mCD40L (Figure 7A). Induction of IL-12 refers to the activation of macrophages, an important class of antigen presenting cells. INF-γ, TNF-α and RANTES are indicators of Th1-type immunity and suggest the induction of a cytotoxic T cell response.

To correlate this at the cellular level, histological sections were analyzed for tumors collected 16 days after injection of Ad5 / 3-CMV-mCD40L. Increased recruitment of macrophages (F4 / 80) and leukocytes (CD45) was seen, but only a small increase in B lymphocytes (CD19), suggesting that the infiltrate was predominantly T cells (Figure 7b). Analysis of T cell subgroups showed that most of these cells were CD8 + cytotoxic T cells, although a smaller increase was also seen in CD4 + helper T cells (Fig. 7c). These findings indicate that production of mCD40L in syngeneic MB49 tumors in an immunocompetent animal model elicited a potent anti-tumor immune response mediated by Th1 response elements and cytotoxic T cell infiltration (Figure 7).

Example 7. Pre-treatment analysis of tumor samples to predict treatment efficacy in a human patient

One patient (R73) had fresh, malignant pleural fluid collected prior to treatment for MTS assay. Oncolytic adenoviruses with the chimeric Ad5 / 3 capsid (a capsid identical to Ad5 / 3-hTERT-E1A-hCD40L) were more effective in killing the patient's pleural cells than the oncolytic adenoviruses with the serotype 5 capsid. Interestingly, in this patient, the tumor marker Ca15-3 gradually decreased following treatment with Ad5 / 3-hTERT-E1A-hCD40L, and a 44% decrease was seen 74 days after treatment (Table 3). The results suggest that adenoviruses with Ad5 / 3 chimeric capsid are effective in killing human tumor cells, and an ex vivo cell killing assay could be of interest in testing for clinical utility.

Example 8. Safety and efficacy of Ad5 / 3-hTERT-E1A-hCD40L in human cancer patients /. patients

Patients with advanced and poorly responsive solid tumors were asked to participate in the Advanced Therapy Access Prog-ram program controlled by the Finnish Agency for Safety and Development of Medicines (FIMEA). Doses and previous treatments for patients receiving Ad5 / 3-hTERT-E1A-hCD40L are listed in Tables 2 and 3.

Nine patients, three female (R73, N235, R8) and six male (T181, C239, C229, I244, P251, C220) with advanced solid tumors that responded poorly to standard treatments (Table 2) were treated with a single Ad5 / 3-hTERT-E1A-hCD40L (R73) or Ad5 / 3-hTERT-E1A-hCD40L-Serial (T181, C239, I244, P251, N235, C220) intravenously, intravenously or intraperitoneally (Table 2). Patient C229 received serial treatment with Ad5-RGD-D24-GMCSF (PCT / FI2009 / 051025) and Ad5 / 3-hTERT-E1A-hCD40L, and patient R8 received serial treatment with Ad5-D24-GMCSF, Ad5 / 3 hTERT-E1A-hCD40L and Ad3-hTERT-E1 (WO2010 / 086838). Inclusion criteria were solid tumors that responded poorly to conventional treatments, a WFIO score of 3 or less, and no major organ dysfunction. The criteria for rejection were transplantation, HIV, severe cardiovascular, metabolic or pulmonary disease, or other symptoms, findings, or diseases that prevented oncolytic viral therapy. Written informed consent was obtained and treatments were administered in accordance with good clinical practice and the Helsinki Declaration.

II. Treatments with the adenoviral vector encoding hCD40L a) Ad5-D24-GM-CSF-Ad5 / 3-D24-GM-CSF or Ad5-RGD-D24-GM-CSF

Ad5 / 3-hTERT-E1A-hCD40L and Ad5-RGD-D24-GM-CSF were produced according to clinical grade and patient treatment was initiated.

Two different administration schedules were used. In the first round of serial therapy, 4 patients (C229, I244, P251, R8) received four-fifths of the dose intravenously (or intraperitoneally in R8 patient with peritoneal disease) and one-fifth intravenously, while the other 4 patients (C189, C2 intravenous injections. In subsequent cycles, all patients were treated intravenously. Patient R73 received one cycle of treatment and half of the dose was administered intravenously and half was administered intraperitoneally.

The doses of the virus are shown in Table 2. The doses were selected on the basis of previous data obtained by the inventors with other oncolytic viruses.

The virus was diluted with sterile saline at the time of administration under appropriate conditions. After administration of the virus, all patients were monitored overnight in hospital and then for the next 4 weeks as an outpatient. Physical examination and medical report were performed at each visit and clinically relevant laboratory values were monitored.

Treatment side effects were recorded and scored according to CTCAE Version 3.0 Common Criteria for Adverse Events. Because many cancer patients have symptoms due to the disease, previous symptoms were not numbered unless they worsened. However, if the symptom became more severe, for example, if pre-treatment grade 1 changed to grade 2 after treatment, it will be numbered as grade 2.

Tumor size was determined by contrast-enhanced computed tomography (CT) scan. Maximum tumor diameters were obtained. The RECIST1.1 (Response Evaluation Criteria in Solid Tumors) criteria were applied to the entire disease, including injected and non-injected lesions. These criteria are: partial response PR (> 30% reduction in the sum of tumor diameters), stable disease SD (no reduction / increase), progressive disease PD (> 20% increase). The number of non-PR tumor growth reductions was assigned a low response (MR). Serum tumor marks were also determined as they increased from baseline, and the same percentages were used.

Patient serum samples were analyzed for both Th1-type cytokines: interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α) and interleukin-2 (IL-2) and Th2 cytokines: interleukin-4 (IL- 4) using interleukin-5 (IL-5) and interleukin-10 (IL-10)

Becton-Dickinson Cytokine Multiplex Bead Array System (BD FACSArray; BD Biosciences, San Jose, CA) according to manufacturer's instructions. Samples included baseline, 1 month after viral therapy or 2 months after viral therapy.

III Safety of Ad5 / 3-hTERT-E1A-hCD40L in Cancer Patients Table 4 summarizes the adverse reactions reported during and after viral therapy. Adverse reactions were scored according to Common Terminology Criteria for Adverse Events (CTCAE) version 3.0.

Ad5 / 3-hTERT-E1A-hCD40L was well tolerated up to the highest dose used: 5x1011 VP / patient. No Grade 4-5 adverse reactions were observed. A patient receiving a single treatment with Ad5 / 3-hTERT-E1A-hCD40L had only Grade 1 symptoms, whereas serial treatment patients experienced Grade 1-3 symptoms such as weakness, nausea and transient elevation of liver enzymes.

IV. Titers of neutralizing antibodies

Neutralizing antibodies (NAb) against Ad5 / 3 capsid were measured from patient T181 and C239 (Table 5). 293 cells were plated in 96-well plates at a concentration of 1 x 10 4 cells / well and cultured overnight. The next day, the cells were washed with DMEM without FCS. To inactivate complement, human serum samples were incubated at 56 ° C for 90 min. A four-fold dilution series (1: 1-1: 16,384) was prepared in serum-free DMEM (Sarkioja M et al. 2008, Gene Ther 15 (12): 921-9). Ad5 / 3luc1 was mixed with serum dilutions and incubated at room temperature for 30 min. Next, cells in triplicate were inoculated at 100 VP / cell in 50 µl of the above mixture, and after 1 hour, 100 μΙ medium containing 10% FCS was added. 24 hours after infection, cells were lysed and luciferase activity was measured with a Luciferase Assay System kit (Promega, Madison, WI) using a TopCount-Lumino meter (PerkinElmer, Waltham, MA). Luciferase counts were presented relative to gene transfer obtained to evaluate the effect of Ad5 / 3luc1 neutralizing antibodies alone in the serum of patients treated with the virus.

The results are shown in Table 5 as a serum dilution factor that causes 80% inhibition of gene transfer by Ad5 / 3-luc1 (a capsid identical to Ad5 / 3-hTERT-E1A-hCD40L) to 293 cells. Patient T181 had a high NAb titer even before treatment and no changes were observed during treatment. Patient C239 initially had a low NAb titer. The first treatment induced high NAb production, which dropped to moderate levels during treatment. This is not usually seen in patients treated with oncolytic viruses (usually the titer is constantly rising) and may be an indicator of Th2 → Th1 activity transfer.

V. Performance evaluation

Table 5 also shows the evaluation of the efficacy of Ad5 / 3-hTERT-E1A-hCD40L by RECIST criteria for Computed Tomography (CT) (Theasse P et al. 2000, J Natl Cancer Inst 92, 205-16) or PERCIST criteria. (Wahl et al. 2009 J Nucl Med 50 Suppl 1: 122S-50S) for positron emission tomography computed tomography (PET-CT). All patients had progressive tumors before treatment. T181 had stable disease (SD), C239 had stable metabolic disease (SMD), C229 had progressive disease (PD), I244 had SMD, P251 had PD, and R8 had SD. Patients with elevated baseline markers showed baseline tumor responses in R73, CR-56% and -58% in T181 and N235, -16% in R8, -16% in R8, and C229 in R8, respectively. had stable disease, while patients C239, P251 and C220 had progressive disease according to tumor grade (Table 5). The overall survival of patients is also shown in Table 5.

Overall, signs of anti-tumor efficacy were seen in 7/9 patients.

In addition to objective measurements of antitumor activity, we also saw clinical and / or subjective benefit in a number of cases. Patient C229 showed improvement in performance status (WHO 2 before viral treatments and WHO 1 after serial treatment with CGTG-401) and patient I244 benefited from common symptoms.

VI. Th1 and Th2 immune responses to oncolytic adenovirus after treatment with Ad5 / 3-hTERT-E1 A-hCD40L

Patient serum samples were analyzed for either Th1-induced cytokines: interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α) and interleukin-2 (IL-2) or Th2-cytokines: interleukin-4 ( IL-4), interleukin-5 (IL-5), and interleukin 10 (IL-10) using the Becton-Dickinson Cytokine Multiplex Bead Array System (BD FACSArray; BD Biosciences, San Jose, CA) according to the manufacturer's instructions. Figure 10 shows Th1-induced cytokines on the left and Th2-induced cytokines on the right. Before = serum sample taken before virus administration; 1 month = serum sample taken 1 month after virus treatment; 2 months = Serum samples taken 2 months after virus treatment.

Figure 11 reports cytokine concentrations relative to their baseline set to 1 and Th1 / Th2 ratio calculated for each time point. 1 month = serum sample taken 1 month after virus treatment; 2 months = Serum samples taken 2 months after virus treatment. A ratio greater than 1 indicates the predominance of a Th1-type immune response, while a ratio less than 1 indicates a predominance of a Th2-type immune response.

VII. Induction of adenovirus-recognizing T cells by oncolytic adenovirus after treatment with Ad5 / 3-hTERT-E1A-hCD40L

Oncolytic cell death allows the immune system to gain the ability to recognize and kill tumor cells. This is potentially beneficial for tumor removal and may facilitate healing. The adenovirus is purified from the body within a relatively short time after administration; therefore, it is very important to stimulate the immune system so that it is able to recognize specific tumor antigens so that treatment can result in a lasting beneficial effect in the patient. In addition, when antibodies are generated or present, the virus may be partially or completely neutralized so that it may lose its ability to infect and kill metastases. However, anti-tumor induced effector T or NK cells are free to circulate and potentially kill metastases far from the injected tumor.

To demonstrate that the oncolytic adenovirus Ad5 / 3-hTERT-E1A-hCD40L is capable of inducing adenovirus-recognizing T cells, total PBMCs were isolated and pulsed with a peptide pool of adenovirus 5 penton specific adenovirus-specific interferon-gamma ELISPOT (Figure 9). Patient T181 had a reduced number of adenovirus-recognizing T cells after treatment, whereas patient C239 had an increased number after treatment. It has been suggested that the antiviral immune response may play an important role in the overall antitumor activity of oncytic lymphomas (Alemany 2008, Lancet Oncol 9: 507-8; Prestvvich et al. 2008, Lancet Oncol 9: 610-2; Tuve et al. 2009, Vaccine 27 : 4225-39).

Claims (32)

An oncolytic adenoviral vector, characterized in that it comprises an adenovirus serotype 5 (Ad5) nucleic acid backbone comprising a capsid modification, a second nucleic acid sequence encoding a tumor specific human telomerase reverse transcriptase (hTERT) promoter; and 3. a nucleic acid sequence encoding human CD40L in place of the deleted gp19k / 6.7K in the E3 region. The oncolytic adenoviral vector of claim 1, further comprising one or more regions selected from the group consisting of E2, E4 and late regions. The oncolytic adenoviral vector according to claim 1 or 2, characterized in that it comprises the following regions: left ITR, partial E1, p1x, p1Va2, E2, VA1, VA2, L1, L2, L3, L4, partial E3, L5, E4 and right ITR. The oncolytic adenoviral vector according to claim 3, characterized in that the regions are in a sequential order in the 5'-3'-direction. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that a wild-type region is located upstream of the E1 region. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that the E1 region comprises a viral packaging signal. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that the nucleic acid sequence encoding CD40L is under the control of the viral E3 promoter. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that the nucleic acid sequence encoding CD40L differs by a single nucleotide from the wild-type human sequence. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that the E4 region is of the wild type. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that the capsid modification is Ad5 / 3-Chimerism, insertion of the integrin binding region (RGD) and / or modification of the heparin sulfate binding polylysine into the strand. The oncolytic adenoviral vector according to claim 10, characterized in that the capsid modification is Ad5 / 3 chimerism. An oncolytic adenovirus vector according to claim 10, characterized in that the capsid modification is an RGD-4C modification. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that it comprises at least one Expression cassette. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that it comprises only one expression cassette. The oncolytic adenoviral vector according to any one of the preceding claims, characterized in that the vector is capable of selectively replicating in cells expressing telomerase. In vitro cell, characterized in that it comprises an adenoviral vector according to any one of claims 1 to 15. Pharmaceutical composition, characterized in that it comprises an adenoviral vector according to any one of claims 1 to 15. The oncolytic adenoviral vector or pharmaceutical composition according to any one of the preceding claims, characterized in that it functions as an in situ cancer vaccine. An adenoviral vector according to any one of claims 1 to 15 for use in treating cancer in a subject. A pharmaceutical composition according to claim 17 for use in treating cancer in a subject. The adenoviral vector of any one of claims 1 to 15 or the pharmaceutical composition of claim 17 for use in treating cancer in a subject, wherein the cancer is selected from the group consisting of nasopharyngeal cancer, synovial cancer, hepatocellular cancer, kidney cancer, connective tissue cancer, lung cancer, , colon cancer, rectal cancer, colorectal cancer, al-vosyöpä, throat cancer, oral cancer, liver cancer, bone cancer, pancreatic cancer, choriocarcinoma, gastrinoma, pheochromocytoma, prolactinoma, T-cell leukemia / lymphoma, neuroma, von Hippel-Lindau disease, Zollinger Ellison's syndrome, lymphoma adrenal gland, anal cancer, biliary cancer, bladder cancer, ureteral cancer, oligodendroglioma, neuroblastoma, meningioma, spinal cord tumor, osteochondroma, chondrosarcoma, cystic carcinoma, Evving's sarcoma, sinusoid, fibro-rosarcoma, breast cancer, Paget's disease, cervical cancer, esophageal cancer, gallbladder cancer, head cancer, eye cancer, neck cancer, kidney cancer, Wilms tumor, Kaposi's sarcoma, prostate cancer, testicular cancer, Hodgkin's lymphoma, Hodgkin's , multiple myeloma, ovarian cancer, endocrine pancreatic cancer, glucagonoma, paratyroidinen cancer, penile cancer, aivolisäkesyöpä, soft tissue sarcoma, retinoblastoma, small intestine cancer, stomach cancer, thymic carcinoma, thyroid cancer, tro-foblastisyöpä, hydatidiform mole, uterine cancer, endometrial cancer, vaginal cancer, ulkosynnytinsyöpä, auditory nerve tumor, mycosis fungoides, insulinoma, carcinoid syndrome, somatostatinoma, gingival cancer, heart cancer, lip cancer, membrane cancer, oral cancer, nerve cancer, palatine cancer, parathyroid cancer, glandular cancer, pleural cancer, pleural cancer . The adenoviral vector or pharmaceutical composition of claim 21 for use in treating cancer in a subject, characterized in that the subject is a human or animal. The adenoviral vector or pharmaceutical composition for use in the treatment of cancer according to claim 21 or 22, characterized in that the adenoviral vectors or pharmaceutical compositions are administered intravenously, intramuscularly, intravenously, intravenously, intraperitoneally or intracellularly, intracellularly or intracellularly. An adenoviral vector or pharmaceutical composition for use in the treatment of cancer according to any one of claims 21 to 23, characterized in that the oncolytic adenoviral vectors or pharmaceutical compositions are administered several times during a treatment period. The adenoviral vector or pharmaceutical composition according to any one of claims 21 to 24 for use in treating cancer in a subject, characterized in that the subject is administered an oncolytic adenoviral vector having a different capsular filament protrusion than the vector used in previous treatment. The adenoviral vector or pharmaceutical composition for use in the treatment of cancer according to any one of claims 21 to 25, characterized in that the adenoviral vectors or pharmaceutical compositions are administered to the subject in parallel with radiation therapy or chemotherapy. An adenoviral vector or pharmaceutical composition for use in the treatment of cancer according to any one of claims 21 to 26, wherein the adenoviral vectors or pharmaceutical compositions are administered to a subject with an adjuvant selected from the group consisting of verapamil or another calcium channel blocker; an autophagy inducing agent; temozolomide; agents capable of reducing regulatory T cells; cyclophosphamide and any combination thereof in the subject. Adenoviral vector or pharmaceutical composition for use in the treatment of cancer according to any one of claims 21 to 27, characterized in that the adenoviral vectors or pharmaceutical compositions are administered in combination with chemotherapy or anti-CD20 treatment or other neutralizing antibody blocking treatment. An in vitro method for producing CD40L in a cell, characterized in that the method comprises: a) delivering a vehicle comprising an oncolytic adenovirus vector according to any one of claims 1 to 15, and b) expressing the CD40L of said vector in a cell. Use of an adenoviral vector according to any one of claims 1 to 15 for the production of CD40L in a cell in vitro. An oncolytic adenoviral vector according to any one of claims 1 to 15 for use in enhancing a tumor-specific immune response and apoptosis, in altering Th2 → Th1, or in decreasing immune suppression in a subject. An oncolytic adenoviral vector according to any one of claims 1 to 15 for use according to claim 31, characterized in that the number of natural killer cells and / or cytotoxic T cells in the target cell or tissue is increased or the number of suppressor cells (such as regulatory T cells) decreases.