FI117974B - An improved vaccine for immunization against TBE virus infections and a method for its preparation - Google Patents

Abstract

Vaccine against flavivirus infections comprises nucleic acid encoding flavivirus proteins E and prM/M in full-length native form. Also claimed is a nucleic acid vector comprising the entire protein prM/M and E coding sequence of a flavivirus, provided that it is not an SV40-based plasmid vector.

Description

117974

Improved vaccine for immunization against TBE viral infections and method for its preparation - Förbättrat vaccin för immunisering mot TBE virusinfectioner und förfarande för dess framställning 5

The invention relates to an improved vaccine which immunizes against TBE viral infections and to a process for its preparation.

10 TBE (Tick-Borne-Encephalitis) virus is endemic in many European countries, the former Soviet Union and China.

The disease is a major public health problem in some Central European countries, such as Austria,

In the Czech Republic, Slovakia, Slovenia and Hungary, where 15 hundreds of hospital cases are registered every year (WHO: EURO Reports and Studies, 104, 1983).

The TBE virus, of which there is a Western, European, and Far East subtype, belongs to the genus Flaviviruses, which are spherical lipid envelope RNA viruses (Monath, TP: Flaviviruses. In: Fields, BN (ed.) Virology, Raven Press , NY 1990, pp. 763-814).

Flavivirus virion generally consists of a nucleocapsid containing the positive-stranded RNA genome linked to a viral capsid (C) protein. The nucleocapsid is surrounded by * · 1: a lipid envelope containing membrane-associated pro- · 1 · 1; teins E (50-60 kD) and M (7-8 kD) (Heinz and Roehrig in: · ·; van Regenmortel and Neurath (ed.) Immunochemistry of Viruses * 1 · 30 II. The Basis for Seradiagnosis and Vaccines . Elsevier • · 1

Sciences, Amsterdam (1990), 289-305).

♦ • · · 2 · “/ Mostly envelope protein E plays a key role * · 1 3

In Flavivirus biology, because it mediates important * 35 viral infiltration functions and triggers a host immune response. There is already a considerable amount of information about the structure of the TBE virus envelope protein E: nt 1 1 * 1 · and has been proposed. a structural model based on a wide range of biological and chemical and immunological data (Mandi 117974 2 et al., J. Virol. 63 (1989), 564-571).

The disease can be effectively prevented by vaccination with a high purity formalin inactivated whole virus vaccine 5 (Kunz et al., J. Med. Virol. 6 (1980) 103-109), which induces an immune response against the structural protein of the virus (Kunz, Ch. Acta leidensia 60 No.2). , 1-14, 1992). This vaccine has proved its worth, but large amounts of infectious and potentially dangerous virus suspensions must be handled during the manufacturing process. Thus, extensive and costly security measures are required.

The activity of virus neutralizing antibodies depends on their ability to recognize the native structures of the proteins on the surface of the virus. In the case of TBE viruses and other Flaviviruses, this is particularly the case with protein E (Heinz and Mandi, APMIS, 101 (1994), 735-745). Thus, in order to obtain the most potent antibodies induced by immunization, it is hoped that the vaccine will contain this protein in the same form as it is on the surface of the infecting virus. The disadvantage of whole virus dead vaccines is that the mandatory inactivation method may result in a partially altered protein structure compared to the native form.

: '' '25 • · · * Recombinant DNA technology offers the ability to replace · »·: whole-virus dead vaccines with recombinant proteins that contain essential components of immune response-inducing proteins. By genetic engineering of the individual viral proteins, it is not certain that the antigenic structure of the recombinant I proteins thus formed corresponds to each corresponding protein on the surface of the virus.

The expression of recombinant surface proteins of TBE viruses is known, for example, from Allison et al., Gemein-same Jahrestagung ÖBG-ÖGGT (1993) P114. This indicates that, when expressed under constant conditions, protein E and * · 117974 3 protein M are secreted in different forms, e.g. also as non-infectious subviral particles.

Such subviral particles are known in distant relatives of TBE-5 viruses, namely, Japanese Encephalitis virus (JEV), yellow fever virus, and Dengue virus (Konishi et al., Virology 188 (1992), 714-720 or WO 92/03545).

10 Konishi et al. however, it has been suggested that such subviral particles, emulsified in complete Freud's adjuvant and containing whole protein E, elicit a certain immune response in mice. On the other hand, it was shown that protein E partially truncated at the C-terminus can provide a much more effective protection against Flavivirus infection than protein E as a whole (WO 92/03161).

It is an object of the present invention to provide 20 improved vaccines against TBE infections.

This object is solved, in accordance with the invention, by a vaccine which immunizes against Tick-Borne-Encephalitis virus (TBE) virus, which comprises a non-infectious subviral particle that is substantially contains * · Protein E in complete, native form and: *. · possibly the prM / M protein, derived from TBE virus. What is essential here is that the protein: J E is in its full, native form, because only then can effective protection be obtained. The vaccine of the invention was able to amplify the native protein E · · · · · · ·. form by various assays, namely, · · · (a) analysis of antigen structure using mono * V * clonal antibodies, • * · · ... · 35 (b) ability to acid-induced conformational changes. : and • ·· • · c) haemagglutination activity '4 117974

The fact that the composition of the invention cannot be infectious due to its composition is an important consideration for the safety of the vaccine compared to known vaccines.

5

Protein E and optional protein prM / M are preferably recombinant proteins.

According to a particularly preferred embodiment, protein E is derived from the TBE virus, whereby, depending on the field of application, both the Western (European) and the Far East subtype are used. Preferably, the vaccine also comprises a lipid component, which is preferably in a vesicular form.

It has been shown, contrary to the understanding of the art, that TBE-derived recombinant protein E can provide sufficient immunization against infections only in the form of this non-infectious subviral particle. A partially truncated form of protein E from which, as described in WO 92/03161, the C-terminal membrane anchor has been removed, cannot be used to prepare an effective vaccine. The vaccine according to the invention preferably contains non-infectious particles which are substantially free of nucleic acids from the TBE virus detectable by PCR. This is for example · · · * demonstrable by the methods described by »· * i *. * Konishi et al.

»* * · · I» · »· t ·

In another aspect, the invention relates to a method of producing a TBE-30 vaccine, characterized by: - providing a cell culture system comprising t * · · coding sequences for prM and E proteins, * * · * · derived from TBE virus, ·. '·' - protein E is expressed in its complete, native ··· * ... · 35 form, whereby: - sub-viral, non-infectious particles are formed; nucleotides containing essentially recombinant N-protein 79 E in its complete native form and possibly recombinant protein prM / M and particles are harvested and used directly to prepare a composition for immunization.

The great advantage of the method according to the invention is that the viral inactivation step, for example formalin, is not necessary, which on the one hand greatly improves the quality of the vaccine (protein E is native and not at least partially denatured in the formalin treatment) can be used directly (i.e. without formalin treatment) to produce a pharmaceutical preparation.

Particularly advantageous in carrying out the method is the use of a cell culture system containing the coding sequences of the recombinant nant protein prM and E from the TBE virus in a chromosomal integrated form.

. However, there are also cell culture systems for the preparation of the particles of the invention, using viral vectors, or cell culture systems that work without the virus, for example by using the plasmid vector.

According to a preferred embodiment of the method, both protein expression and particle formation occur continuously.

»1» J

4 '1 · - »1 * · · * 1 ·

In another aspect, the invention encompasses the use of non-infectious 2 4 · 4 4 · · * subviral particles for the preparation of a vaccine for active immunization against TBE virus infections, which contain substantially complete. and * · 117974 6 possibly protein prM / M, which proteins are derived from TBE virus.

Thus, Protein E and any PrM / M protein are preferably recombinant proteins.

The invention further encompasses the medical use of non-infectious subviral particles, in particular for the preparation of preparations containing anti-TBE viral immunoglobulin, which particles substantially contain Protein E in complete, native form, and which proteins are derived from TBE. virus. Again, it is preferred that Protein E and any PrM / M protein are recombinant-15 proteins.

It was surprisingly found that the nucleic acid comprising said coding sequences can be used as such for immunization against TBE virus infections.

20

It is known in the art that introducing naked DNA into mice can elicit an immune response. For example. mice were able to produce antibodies against human growth hormone (hGH) when injected with a plasmid, "·" '* 25 containing a genomic copy of hGH (Nature 356 (1992), 152 - V 154). * ·· I m «* i ♦ * * t *!. · J Some successful" genetic li l immunizations "with bare DNA are still described. In this genetic immunization, DNA encoding one or more viral antigens was given, whereby the corresponding viral antigens (»·« were synthesized in vivo, each of which viral antigens »· · individually elicited an immune response and thus could> i * · ^ * * f Achieving successful • s * 35 protective immunity in mice by injection of *, *. * intramuscularly influenza virus DNA has been described.

f M

in PNAS 91 (1994), pp. 9519-9523 (Raz et al.).

P f.

117974 7

Vaccine 12 (16), (1994), pp. 1503-1509 (Davis et al.) Also describes successful immunization of rats and mice against hepatitis B virus (HBV) surface antigen by intramuscular injection of plasmid DNA, which contains the HBV surface antigen coding sequence. However, many attempts to immunize with naked DNA encoding the pathogenic antigen failed. For example, immunization experiments against HIV by direct DNA transfer into body cells have been described (WO 93/17706); however, a successful vaccine has not yet been obtained by this method. In particular, in order to achieve a successful immunizing effect of a pure DNA vaccine, it is particularly advantageous - in addition to introducing DNA into a cell - that the antigen conferring an immune response is present in the immune system in its native form. The exact structure of the native form or the biosynthetic form required to form the native form and structure is known only to a few pathogens, so effective immunization with naked nucleic acid will in many cases prove extremely difficult, unless due to the lack of precise information on the antigen structure.

In the context of the present invention, it was found that immunization by means of a nucleic acid sequence that encodes only a substantial immune response to TBE infections produces protein E: not enough protective immune response • ·::; against disease.

30 Unexpectedly, a successful immune response was obtained; . ·. only by providing a nucleic acid sequence which, in addition to the coding sequence for protein E in its complete, native form, the coding sequence for protein · · · ·. * * prM / M. In addition, it turned out that no successful immunization could be achieved with the nucleic acid containing the coding sequence for the protein E * * *, in which the anchor region of the protein E has been deleted.

• • M

• «8 117974

The present invention thus further relates to a vaccine for immunization against tick-borne encephalitis virus (TBE virus) infections comprising a nucleic acid encoding protein E and protein prM / M derived from TBE virus and having at least are in their most complete, native form.

The present invention enabled, for the first time, to demonstrate nucleic acid immunization against Flaviviruses in general. Thus, the immunization system of the invention is in principle useful not only for immunization against TBE virus, but, owing to the high homology of all Flaviviruses to Protein Et and prM / M (Chambers et al., Annual Review of Microbiology, Vol. 44, ( 1990), pp. 649-688: Flavivirus Genome Organization, Expression and Replication) for general immunization against Flavivirus infections.

For nucleic acid vaccine immunizing against TBE, it is essential that protein E encodes in substantially complete, native form from the nucleic acid. Naturally, the present invention also encompasses nucleic acid vaccines which exhibit degeneracy of the genetic code, which exchange non-structurally important amino acid codons, and which contain natural or laboratory mutations, provided that the pro - ·· · Nucleic acid modifications in the coding sequence of ttein E: are capable of eliciting a successful immune response. I invent- ""· · ;*·*; vaccines containing nucleic acids with deletions or insertions in the coding sequence for protein j, · E, which retain the antigenic epi- · * * structure required for immunization of protein E, · · · are also contemplated. the upstream region is substantially unchanged, as long as these I (t V * modifications can be considered derived from the TBE virus 35 sequence. The same applies, of course, to the coding sequence of pro-f * i protein prM / M. in terms of reliable particle formation and secretion, whereby sequence deviations for protein prM / M are not as critical as for protein E, as long as successful particle assembly can be guaranteed .The nature of the nucleic acid is not essential to the invention. that DNA can be used as well in many applications, whereby DNA is more expensive than RNA because of its greater stability. Nucleic acid can be prepared either biologically or by chemical synthesis.

10

The nucleic acid encoding protein E is preferably derived from the European or Far East subtype of TBE virus, since these are particularly widespread subtypes.

15

Particularly preferred nucleic acid vaccines are those wherein the nucleic acid is a plasmid vector.

In particular, plasmid vectors carrying efficient promoters, such as the HSV, RSV, EBV, β-actin, Adeno, MMTV, hsp, and hGH promoters, have proven to be suitable. Effective promoters allow efficient gene expression.

Most suitable vectors or promoters are plasmids derived from the plasmid • * 't # 25 pCMVB (MacGregor et al.) With the * *' CMV-Immediate Early promoter.

Naturally, the nucleic acids of the nucleic acid vaccines of the invention may also comprise other coding or non-coding sequences, especially if the nucleic acid vector is used as the nucleic acid t · * ·.

* ··· • · * * * · • As examples of other sequences - in addition to promoters • * · * · * * - also mentions the marker gene, other transcripts, • · · ^.

35 regulators of translation and post-translational modification.

However, with these more complex nucleic acid constructs * ·, it should always be borne in mind that, when introduced into the target cell, the infectious virus cannot be formed by translation of the nucleic acid, i.e., the vaccine is a "dead vaccine" and remains so.

The nucleic acid vaccine of the invention may, in its simplest form, contain "naked" nucleic acid, optionally in a suitable buffer, and, of course, other ingredients, such as drug additives, carriers or specific agents for administration, may also be present.

10

The nucleic acid vaccines of the invention are preferably administered by injection, particularly intramuscularly, intradermally or subcutaneously, but may also be administered orally.

15

The amount of nucleic acid vaccine according to the invention given depends on the form of administration and the adjuvant used. Generally, a higher dose intramuscularly than subcutaneously is required to achieve the same protective immune response. A preferred amount is from 0.01 ng to 10 mg / dose, generally preferably from 1 ng to 1 mg / dose.

. The nucleic acid vaccine according to the invention has the essential advantage that a cell culture system is not required to produce sub- • viral particles, but that the particles are formed in vivo and can thus directly produce. · Get an immune response.

• · f * * • · · • * *

The nucleic acid vaccine of the invention also has the advantage of being highly stable compared to protein-based vaccines, especially if the nucleic acid is DNA. Thus, it is possible to store the vaccine «i» for long periods of time without high cooling costs, whereby a substantial reduction in activity is not expected. Nucleic acid, especially when lyophilized; form can be stored without spoiling, even at room temperature · · · practically unlimited * «'11 117974. The reconstitution of the lyophilized nucleic acid vaccine of the invention is much easier to perform than the reconstitution of the lyophilized protein solution, which, in the experience, can often prove problematic due to the nature of the protein.

The nucleic acid vaccine of the invention still has the advantage, compared to traditional dead vaccines, that the immunizing antigen is synthesized in vivo and leads to the development of an effective cellular immune response (Science vol. 258, March 19, 1993, p. 1591-1692, Research News: Naked DNA Points Way to Vaccines) .

In yet another aspect, the invention relates to 15 nucleic acid sequences, in particular nucleic acid vectors, comprising the entire coding sequence of the TBE virus-derived proteins E and prM / M as a drug. So far, there is no mention in the art of any successful nucleic acid immunization with 20 Flaviviral DNA. The medical use of these nucleic acids (nucleic acid vectors) thus constitutes. surprisingly new usability. In the invention, the vector '' is understood to mean any nucleic acid vehicle, in particular plasmids, viruses or transposons.

To date, only the SV40-derived plasmid divider containing the protein sequence of prM / M and E proteins derived from TBE virus has been described (Allison et al. , 30 Virus-Genes 8 (3), (1994), pp. 187-198). These SV40 Plasma ···. However, there was no discussion of the possibility of an immunization effect.

The plasmid vectors of the invention differ from the plasmid vectors described earlier in particular in that they are suitable for immunization. Thus, the plasmid vectors of the invention particularly exist as ready-to-use solutions or lyophilisates in syringes or ampoules.

According to the invention, effective promoters selected from the group consisting of CMV, HSV, RSV, EBV, β-actin, Adeno, MMTV, hsp and hGH promoters serve as plasmid vectors, in particular the CMV "Immediate Early" promoter has proven to be effective.

In yet another aspect, the present invention relates to the use of a nucleic acid comprising the entire coding sequence of TBE virus-derived proteins E and prM / M for the preparation of a vaccine.

The invention will be illustrated by the following Examples 15, with reference to the figures:

Figure 1 is a schematic representation of inserts used in expression plasmids. Figure 2 is a schematic representation of the plasmid pSVB used to express the structures shown in Figure 1. Figure 3a, b and c are the complete nucleotide and amino acid sequences of SV-PEwt of the structure shown in Figure 1.

Figure 4 shows the immunoprecipitation of cellular lysates transfected with the structures shown in Figure 1 and infected with TBE virus (COS / TBE) by Triton X-100. Figure 5 is a graph showing the presence of? · * '* 25 protein E as determined by 4-layer EL1SA in the culture medium of COS? · · *. * Cells transfected with the structures of Figure 1. Figure 6 shows SV-PEwt and SV- · ·

Immunoprecipitation from culture medium of Cil cells transfected with Jil PEst. Figure 7 is a sedimentation analysis curve of COS cell culture-30 medium, whereby COS-, ·, cells are transfected with SV-PEwt or SV-PEst or • · t-f infected with TBE virus. The sedimentation direction is left; • * * Malta to the right. Figure 8 is a thio-analysis of rSP (SV-PEwt) sedimentation without Triton treatment and with 0.5% Triton X-100 ··· 35 treatment. The sedimentation direction is from left to X: right. Fig. 9 is a view showing SDS-PAGE analysis of purified TBE virus and * * # # X purified rSPr; Coomassie- «13 117974

Blue-dyeing. Figure 10 is a comparison between rSPs of COS cells and rSPs of a stable transfected CHO cell line. Figure 11 shows the reactivity of 19 protein E-specific monoclonal antibodies by 4-layer-5 ELISA with TBE virus, formalin-inactivated TBE virus, rSP and rE *. Figure 12 shows the reactivity of TBE virus and rSP with 4-layer ELISA with monoclonal antibodies B3, i2, IC3 and C6 without treatment (pH 8.0) and after treatment at pH 10.0 6.0. Figure 13 shows the reactivity of pE * with 4-layer ELISA with monoclonal antibodies B3, i2, IC3 and C6 without treatment (pH 8.0) and after treatment at pH 6.0.

The invention will be further illustrated by the following examples.

1. Preparation of particles

Four expression plasmids were prepared containing either the protein E or the membrane anchor-free form of protein E alone or in combination with prM (Figure 1).

. An example of the preparation of these plasmids has been described

Allison et al., Virus Genes 8 (3) (1994) pp. 187-198.

S ···· 25 • * • ♦ · * The starting plasmid pSV8 described therein is shown in Figure 2.

········································································································· · · · Vector expressions were used as pSV46. This vector is a derivative of SV40 based eukaryotic expression vector pSV0 (Clontech) comprising: /. insert inserted containing the β-galactosidase gene. (MacGregor G. R. and Caskey C. T., Nucleic Acids Res. 17, 235, 1989) by digestion with the restriction enzyme Notl. A portion of the · «· *. * * Polylinker located downstream of the translational termination site was also removed by restriction enzymes Xba I. : and HindIII, with Klenow supplementation and ligated again.

• * 1 1 7974 14 PCR products were included in this vector, obtained as follows:

Synthetic oligonucleotide primers were used to amplify cDNA, which corresponds to either the prM + E region of the TBE virus or the E region only. Mandi et al. (Mandi C.

W., Heinz FX and Kunz C., Virology 166, 197-205, 1988) have examined the nucleotide coordinates used and contain the first 20 nucleotides of the TBE genome (Mandi CW, 10 Heinz F. X, Stockl E and Kunz C). ., Virology 173). The 5 'primers for the prM + E and E-only constructs were 27-mers having the sequences AAGCGGCCGCCATGGTTGGCTTGCAAA and AAGCGGCCGCCATGGTTACCGTTGTGT. The first 11 nucleotides of each sequence are artificial and contain the 15 restriction enzyme NotI recognition site (GCGGCCGC), followed by a 16 nucleotide long sequence corresponding to either nucleotides 388-403 (SV-PE chain) or 883-898 (SV-E chain). . In both cases, the naturally occurring ATG codon was used as the start codon positioned upstream of the corresponding 20 genes, and the primer was designed so that the ATG was positioned in an appropriate environment (GCCGCCATGG) for efficient translational initiation in COS cells. (Kozak M., Cell 44, 283-292, 1986; Kozak M., J Mol Biol. *, 196, 947-950, 1987). Both structures used * ·

25 same 28 nucleotides long oligonucleotide (ATGCGGCCGC

'1 TAGTCATACC ATTCTGAG) 3' primer. This primer was 3'-; complementary to nucleotides 2535-2550 and; at its 5 'end contained the NotI site and the TAG termination codon • * ·! t:! complement (CTA) in the same reading frame.

30 h PCR amplification was performed under essentially standard conditions according to the Cetus protocol (Saiki R. K., f · ·

Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, V * G. T., Mullis, K. B., and Erlich, H. A., Science 239, 487-491 (1988). Reaction mixtures contained 50 mM KCl, 10 mM Tris-HCl, * J pH 8.3, 1.5 mM MgCl 2, sometimes 200 μΜ dNTP, 10 ng of each primer, 10 μΐ of 1000-fold dilution of cDNA matrix. and 3E AmpliTaq polymerase (Perkin Elmer Cetus) in a total volume of 100 μΐ. The samples were covered with 100 µl of paraffin oil in a Perkin Elmer thermal recycler.

The samples were held for 6.5 min at 94 ° C, then cooled to an annealing temperature of 40 ° C before Taq polymerase was added. In total, 35 cycles of amplification were performed.

Each cycle consisted of 1.5 minutes at 94 ° C, 3 minutes at 40 ° C, and 7 minutes at 68 ° C. The samples were purified by extraction with phenol and chloroform, mixed with ethanol and redissolved in sterile double distilled water. The quality and amount of PCR products were determined by agarose gel electrophoresis and samples were stored at -20 ° C until used for the next 15 cloning steps.

The polymerase chain reaction was used to generate a mini-library of cDNA plasmid clones containing inserts corresponding to either the prM + E-20 region (SV-PE chain), nucleotides 388-2550, or the E region (SV-E chain) of the TBE virus genome ), nucleotides 883-2550 (Figure 1).

Normally, structural proteins of the TBE virus are produced by co-translation of major polyprotein precursors; now • «* # * '. However, translation initiation and termination sites * 'at the ends of the PCR product were introduced by including these sites in the oligonucleotide primers. • *:,! Was added to each structure. a natural ATG codon placed in a suitable environment to serve as the initiation codon, upstream of the internal signal sequence, to allow natural processing by the host signaling and to provide the correct secretion pathway. Similarly, f · a TAG termination codon was placed downstream of each of the constructs' · '' at the signaling cleavage site, which cleaves to the carboxy terminus of protein E. To ends *. \ 4 | the restriction enzyme NotI recognition sites were also included to facilitate subsequent cloning of the PCR products • f 117974 16.

The PCR DNAs were cleaved with NotI and ligated to the NotI cloning site of plasmid vector pSV46, allowing for proper insertion of the inserted genes under the control of the early SV40 promoter (MacGregor GR and Caskey CT, Nucleic Acids Res 17, 2365, 1989). ). The vector also provided a polyadenylation signal for efficient expression and to allow replication of the SV40 replication source in recombinant 10 plasmids, which constitutively express the large SV40 T antigen (Gluzman Y., Cell 23, 175-182, 1981).

The ligation mixture was used to transform E. coli HB101 and single ampicillin-resistant colonies corresponding to individual clones were isolated. Orientation of insert pathways in each plasmid was determined by digestion with restriction enzymes and agarose gel electrophoresis. Clones containing properly oriented inserts were retained for further analysis.

Plasmids containing properly oriented inserts were identified by restriction analysis and purified by? · 25% CsCl gradient centrifugation.

f (* "" "* *!! *) Double-stranded plasmid DNA purified from a single * i: preparation was used from each plasmid construct for DNA sequencing. The sequencing reactions were performed in a Perkin-Elmer thermal recycler. - «. *« Using TBE-specific primers, ArnpliTaq polymerase · «, j * (Perkin Elmer Cetus) and fluorescent dye-labeled dideoxy terminators according to the manufacturer's instructions * *" · V (Applied Biosystems) The products of the sequencing reaction ι «· 35 were analyzed on an Applied Biosystems automated DNA 9, ·.: 373A sequencer.

t · ι ·· * # «}.

117974 17 Analysis of PCR-generated Mutations

Thirteen individual E. coli clones containing SV-PE series plasmids and 9 containing SV-E series 5 plasmids were selected for accurate analysis of the cloned inserts and to evaluate the efficiency of Taq polymerase mutation. Plasmid DNA from each clone was purified and both strands of the cloned inserts were analyzed by complete sequencing.

The cDNA sequences were then compared to the Neudorfl RNA sequences of the parent wild-type TBE strain (Mandi C.W., Heinz F.X. and Kunz C.

Virology 166, 197-205, 1988).

Expectedly, there were several differences in the nucleotide sequence of each plasmid clone compared to the wild-type TBE virus sequence. These changes were, with a few exceptions (see below), generally single mutations that appeared to be generated during PCR amplification and could be found only in single clones.

• * • · • · • ··.

••••••••••••••••••••••••••••••••••••••••••••••••••• · * • · * * • ♦ ♦ · · · · · · ·........ t • · • * · • · »··· · * ··· 117974 18

Table 1. Summary of mutations produced by PCR

Nucleotide-Amino acid changes13 Clone changes3 prM E

5

SV-PE

01 945 G-> A, 1122 G-> C Gin 50-> His

1395 C-> T

10 2027 T-> C Or 352-> Ala

2480 A ·> GC

02 551 T-> A Or 24-> Glu

1080 G -> A 1153 T-> C

15 1168 T> C Ser 66-> Pro 1690 A-> G Arg 240-> Gly 2458 G-> del Ala 495-> Reading Frame 03 952 T-> C Cysl58-> Arg Offset 976 C-> T Arg 2-> Cys 20 1163 A-> G Lys 64-> Arg 1679 A-> G Asn 236-> Ser 1889 T-> A Met 306-> Lys

04d 1434 C-> T

2275 A-> T Lys 435-> quit

25 2364 G-> A

05c 701 T> C Leu 74-> Pro

1488 C-> A 1492 T> C

1893 T-> A Cys 307-> Quit 30 06 782 T-> C Leul01-> Pro 865 A-> G Lysl29-> Glu

1002 C-> T

. 1972 G-> A Gly 334-> Arg • * · 07c 1327 G-> del Ala 119-> Chapter.ir.

: *. 35 2248 G -> A Ala 426-> Thr <: ** 08 701 T-> A Leu 74-> Gln 2092 A-> G Met 374-> Val

2124 T-> C

ί V 0 9 4 52 T-> Cc

t ·. 40,960 A-> T

1746 A-> G

2086 A-> G Ile 372-> Val

2142 T> C

2290 G-> A Vai 440-> Ile

I. *. 45 2361 A-> G

: · * · / · SV-PE

10c 1625 A-> G Asp 218-> Gly

2475 T> C

1 ϊ · ϋ 50 12c 1203 G -> A Met 77-> Ile · ... * 13c 1366 T-> C Tyr 132-> His 1381 A-> G Ile 137-> Val 1728 G-> A Met 252 · > IJ e

2134 C_> T

• t 19 5 117974

Nucleotide Amino Acid Changesb Clone Changes3 prM E

SV-E

01d 1239 C-> T

02 1093 A-> T Met 41-> Leu

2301 C-> T

10 03 1321 G-> A Vai 117-> Ile 1688 A-> G Glu 239-> Gly 1717 G-> A Ala 249-> Thr 2053 A-> G Asn 361-> Asp 2092 A-> G Met 374- > Val

15 04 2073 T-> C

2438 C-> T Ala 489-> Val 05 938 T-> C (Leul53-> Pro) £ 973 T-> C Ser l-> Pro 2401 T-> G Ser 477-> Ala.

20 06 891 C-> T

1151 G-> A. Cys 6 0 -> Tyr 1364 T-> C Vai 131-> Ala 1567 A-> G Ile 199-> Val 2045 T -> C Ile 358-> Thr

25 07 1257 T-> C

1694 T-> C Leu 241-> Pro

1794 A-> G

2159 G-> T Gly 396-> Val

08 1806 A-> G

30 2205 A-> G

09 2491 A-> delc i · 1 Nucleotide coordinates for the entire TBE genome

.. 35 b Amino acid coordinates for prM or E

: '·· c Amino acid changes in NS1 or C gene V. d SV-PE04 renamed "SV-PEst" and SV-E01 "SV- · 1 Ewt" je No mutations other than PCR induced \ \ m 40 shown (cf. text): f Only the C-terminal portion of prM was present in this construct * 11. ^ 45! .I ί As shown in Table 1, there were 71 single nucleotide changes in the 22 sequenced insert • (43549 base pairs in total), which could be counted as Taq polymerase errors.

Of these changes, 42 (59%) resulted in substitutions in the predicted amino acid sequence and 3 resulted in deletions that caused a reading frame shift (Table 2).

· 117974 20

Table 2. Prevalence of PCR mutations

Occurrence * Prevalence

Base pair changes (%) (per base pair) 5 G / C-> A / T 20 (28%) 4.59 x 10-4 G / C-> T / A 2 (2.8%) 4.59 x 10'5 G / C-> C / G 1 (1.4%) 2.30 x 10'5 A / T-> G / C 37 (52%) 8.50 x 10'4 10 A / T- > C / G 1 (1.4%) 2.30 x 10'5 A / T-> T / A 7 (9.9%) 1.61 x 10'4 G / C deletion 2 (2.8%) ) 4.59 x 10'5 A / T Deletion 1 (1.4%) 2.30 x 10'5

Transitions 57 (80%) 1.31 x 10 "3 15 Transversions 11 (15%) 2.53 x 10'4

All Mutations 71 (100%) 1.63 x 10'3

Aminohapposubstituut. 42 (59%) 9.64 x 10-4

Silent mutations 24 (34%) 5.51 x 10 -4

Reading frame transitions 3 (4.2%) 6.89 x 10 5 5 20 stop codons 2 (2.8%) 4.59 x 10-5 * 43549 base pairs were sequenced 25 The distribution of mutations was strongly inverted A / T-> G / C and G / C → A / T transition mutations, as previously noted (Dunning AM, Talmudd P. and Humphries SE, Nucleic Acids Res 16, 10393, 1988; Chen J., Sahota A., Stambrook PJ and Tischfield, JA, Mutat Res 249,: * 4i 30 169-176, 1991; Cadwell RC and Joyce GF, PCR Methods (1992, Applic 2, 28-33) The prevalence of total mutations was 1.63 x 10 '. 3 per base pair in a 35-cycle amplification (4.7 x · ***: 10'5 per base pair per cycle), which corresponds to the values reported for the frequency of Taq polymerase • · I errors (15.32). The 35 amino acid substitution rate was 0.46 per gene for tM prM (164 amino acids long) and 1.59 E (496 amino acids long).

* The silent mutation at nucleotide 930 occurred in 40 of all clones and is thought to have been formed t ''; as a natural mutation during virus culture. In addition, • * ·. it was found that the five clones of the SV-PE series, SV-PE05, SV-PE07, SV-PE11, SV-PE12 and SV-PE13, had seven common identical mutations in nucleotides 849, 1285, 117974. 1346, 1404, 1909, 2247, and 2255. The clone SV-PE10 had three of these mutations (1909, 2247, and 2255), but the other SV-PE clones had no mutations at these sites or any SV-E clone. One of these changes, the 5 nucleotide deletion at 1346, results in a shift of the reading frame at codon 125 of the E gene, and it is thus expected that the resulting E protein will not function. Because a clone with one of these seven mutations was obtained regardless of which separate cDNA and PCR-10 preparations it was made from (no results shown), it appears that these variants were already present in the viral RNA population prior to amplification. These peculiar mutations are thus not included in the analysis of the mutations obtained by PCR.

15

Structures encoding wild-type and deleted E-proteins

In addition to clones encoding single amino acid changes, we were also interested in the production of prM + E and E-only constructs encoding wild-type and deleted proteins. However, since all of the SV-PE series clones obtained by ···· PCR had mutations,! *. which would result in amino acid changes, direct V, 25 subcloning was used to prepare the wild type construct encoding the unmodified prM and E proteins and * * * * I only the deleted form of the E construct.

In addition to two silent 30 mutations, the DNA sequence of plasmid SV-PE04 had an A / T substitution at nucleotide 2275, whereby the AAC codon corresponding to protein E lysine 435, * · · :: · became the TAG termination codon (Table 1). Thus, SV-PE04 is predicted to encode wild-type prM protein and * * * deleted E protein lacking the 61 amino acid I ("* 35 residues of the carboxy-terminal, which contains a putative membrane-attached region (Mandi)"). CW, Gulrakhoo F., *! * '! Holzmann H., Heinz FX and Kunz C., J Virol 63, 564-571, 117974 22 1989), was shown to lack plasmid SV-E01, which lacks most of the prM gene , is only a silent mutation in the E gene, whereby it encodes the wild-type E protein.

To create the full-length prM + E construct of the wild-type amino acid sequence and the stop-codon-only E-construct without the prM at nucleotide position 2275, restriction fragments were transferred from SV-PE04 and SV-E01 (hereinafter referred to as SV-PEst). and SV-Ewt).

For this purpose, two restriction sites on the restriction enzyme Cfr101 were used, one between nucleotides 960 and 961, near the border of the prM and E genes, and the other in the ampicillin resistance gene of the vector. One of the resulting plasmid constructs, SV-PEwt, contains the wild-type pi-prM gene from SV-PEst and the wild-type E gene from SV-Ewt, while the other, SV-Est, lacking the prM gene, contains a stop codon containing E-gene from SV-PEst.

These changes were confirmed by sequencing the inserts of both plasmids. These constructs yielded four expression plasmids to compare the modification of the expressed E proteins and the structures obtained by the reference protein from the wild-type construct: * ·; (SV-PEwt) and the proteins being compared are! * ·,. proteins lacking prM (SV-Ewt), E anchor region *., 25 (SV-PEst), or both (SV-Est).

The complete sequence of the PEwt insert is shown in Figure 3a, b and t *.

“* * C.

COS cells were transfected with appropriate plasmids and the expression of recombinant proteins was analyzed by DNA transfection. -: * 35,

COS-1 cells (Gluzman Y., Cell 23, 175-182, 1981) were maintained in a · · · · COS medium consisting of Dulbecco's MEM

117974 23 (Gibco-BRL) supplemented with 10% fetal bovine serum, penicillin (100 U / ml) and streptomycin (100 pg / ml) at 37 ° C and 5% CO 2.

Plasmids containing cloned TBE genes were introduced into C0S-1 cells by liposome-mediated transfection using a modification of the method of Feigner et al (Feigner PL, Gadek TR, Holm M., Roman R., Chan H. VJ., VJenz M., Northrop JP). , Ringold GM and Danielsen M., Proc Natl 10 Acad Sci USA 84, 7413-7417, 1987) BioRad Gene Pulser-

device. Lipofectin reagent (Gibco-BRL) was diluted to 20 pg / ml in Opti-MEM-X-deficient serum medium (Gibco-BRL) and mixed with an equivalent volume of OptiMEM-I containing 8 pg / ml of the plasmid DNA in question: ta. For transfection, 5 pg Lipofectin and 2 pg plasmid DNA were used. The mixture was allowed to stand for 15 min at room temperature to form DNA-Lipofectin complexes and 0.5 ml of this mixture was added to each of 24 wells of a cell culture plate (Nunc) containing 20 cells washed twice with 1 ml OptiMEM

to remove serum trace media. Cells were incubated with DNA-Lipofectin for 5 h at 37 ° C, 5% CO 2, followed by addition of 1 ml of complete COS-medium, and incubation overnight. 24 h after trans-25 infection, the medium was removed and replaced with a new * V COS medium, and incubation was continued for approximately 46 h after trans-I infection, whereby cells were either prepared by immuno-labeling. * for fluorescence analysis or solubilized for analysis of intracellular antigens by ELISA.

The method for infecting COS cells with TBE virus to generate a control sample for immunofluorescence was performed in substantially the same manner as transfection, · · ···. however, with the difference that TBE virus was used in place of plasmid DNA and Lipofectin 1 · 35 in the form of a suspension in the mammalian brain • · *. * ·: 100-fold diluted in Opti-MEM-1 medium.

117974 24

Analysis of the Expressed Proteins a. Immunoprecipitation of Cell Lysates Transfected cells were labeled with 35S-cysteine, solubilized with Triton X-100, and immunoprecipitated with polyclonal rabbit serum specific for TBE virus E and prM. As shown in Figure 4, expression of the SV-PEwt and SV-Ewt constructs resulted in the synthesis of 10 authentic sized protein E. The proteins synthesized from SV-PEst and SV-Est were, as expected, slightly smaller than wild-type E due to their truncated C-terminal.

15 b. Analysis of secretion of recombinant protein from cell culture medium

The presence of protein Ein in the culture medium of transfected cells was quantitatively analyzed on days 0-4 post-transfection using a four-layer ELISA such as Heinz et al., J. Biol. Stand. (1986), 14: 133-141. The results in Figure 5 show that only the · · * constructs, which also express the prM protein, resulted in the secretion of protein E. Medium immunoprecipitation V, 25 (Figure 6) confirmed that the isolated proteins were of the same size as the corresponding intracellular proteins (cf. Figure 4).

The secretion of recombinant proteins is of immense benefit for 30 production, since it can avoid cellular breakdown and removal of contaminating cellular material to obtain the desired protein. Under appropriate conditions, this, ··, ·, also allows for the continuous supply of recombinant protein without breaking the cells.

*: · '35 ♦ · ♦ f »» • · ··· ♦ · «· 117974 25 c. Characterization of isolated recombinant proteins

The media shown in Figure 5 were centrifuged in sucrose density gradient band using a 5-30% w / w sucrose gradient and a Beckman SW-40 rotor. Centrifugation was performed at 38000 U / min and 4

At 100 ° C for 100 min. The gradients were fractionated and protein E

was quantified from each fraction by a four-layer ELISA (see Heinz et al., J. Biol.

10 Stand. (1986) 14: 133-141). The culture medium of virus-infected cells was used as a control giving two protein E-containing peaks (Figure 7), one corresponding to the whole virus and the other corresponding to the so-called non-infectious "slow-sedimenting hemagglutinin (SHA)". (see Russel et al.

(1980), Chemical and antigenic structure of Flaviviruses.

In: Schlesinger, R. W. (ed.), The Togaviruses, 503-529,

Academic Press). The culture medium of cells transfected with SV-PEwt contained a particulate form of E with a sedimentation rate similar to that of viral SHA, whereas the C-terminal truncated protein E obtained from SV-PEst did not form a stable particle and remained ** ϊ above the gradient.

· \ ♦ · V. 25 particulate forms derived from SV-PEwt were called! ·, *, "Recombinant subviral particle" (rSP), and "i soluble form derived from SV-PEst" was called "recombinant E *" * (rE *).

By treating rSP with 0.5% Triton X-100 particles * · 9 * ♦ UI: dissociated as indicated by the sedimentation * · V · analysis of Figure 8, which indicates the presence of a lipid membrane.

Preparation of rSP and rE: · 35 * · V *: a. Purification of rSPt • · · · · · 117974 26 on SV-PEwt the culture medium of transfected COS cells was clarified by centrifugation for 30 min at 10,000 U / min at 4 ° C in a Sorval high speed centrifuge and the particles were then centrifuged for 120 min at 44,000 U / min at 4 ° C using a Beckman Ti45 rotor. The rSP-containing pellet fraction was resuspended in TAN buffer, pH 8.0 and loaded with a 5-20% sucrose gradient in the same buffer. After centrifugation, in a Beckman SW40 rotor (90 min, 38000 U / min and 4 ° C), samples were fractionated and peak-forming fractions were identified by assaying HA activity (Clarke and Casals, 1958, Aver.

J. Trop. Med. Hyg. 7: 561-573). The peak fractions from the zone gradient were further purified by equilibrium centrifugation (35,000 U / min, 4 ° C, overnight), and fractions were again identified by HA. Total protein E was quantitated by 4-layer ELISA and purity was determined by SDS-PAGE using Coomassie-Blue staining (Figure 9).

20 b. Preparation of rE * in serum-free COS cells transfected with SV-PEst; medium was clarified as described above and V. was concentrated to approximately 15 fold by ultrafiltration.

25 *. «Β ·, Preparation of cell lines containing the chromosomal integrated prM-la E gene $ · t · *» »♦ ·

To prepare stable transfected rSP-producing cells, a dihydrofolate reductase ς (DHFR) selection system (Current Protocols in Molecular vt · V · Biology, John Wiley & Sons, Inc.) and each construct containing the prM proteins were used. and E whole genes (Fig. 1) and leading to the synthesis and secretion of rSPs. DHFR

»M

/, 35 genes were transferred by the plasmid pSV2-dhfr (Subramani et al., Mol. Cell. Biol. 1, 854-864, 1981), prM and E-C4 * * genes. transfer was by plasmid CMV-PEwt 27'117974 prepared by recloning an insert from plasmid SV-PEwt in pCMVB (Clontech).

DHFR-deficient hamster cell line CH0-DG44 (Som. Cell.

5 Mol. Get. 12, 555-666, 1986) was grown in HAM Fl2 substrate supplemented with 10% fetal calf serum (FVS) and transfected with pCMV-PEwt and pSV2-dhfr in a 20: 1 electroporation using BioRad Gene Pulser device. The transfected cells were then grown for further 2 days in HAM Fl2 medium + 10% FVS, trypsinized, diluted extensively, and transferred to selection medium (ΜΕΜ-α in the absence of ribo- and deoxyribonucleotides + 10% dialyzed FVS) in Petri dishes with single DHFR and prM + E to isolate expressing cell clones. After about 15 to 10 days, single cell colonies visible under the microscope were transferred to small cell culture dishes and further grown. Cell clones producing FSME-specific antigen were identified by analysis of the cell culture medium by ELISA.

20

One of these cell clones (CHO-37) was used to isolate and characterize the rSPs they produced. In addition, the cells were grown in the above selection medium and the rSPs were purified from it in the same manner as the * * · · ·. 25 RSPs isolated from COS cells have been described.

The result of sucrose density gradient centrifugation is shown in Fig. 10, which compares rSPs obtained from COS cells J with rSPs obtained from a stably transfected cell line • · V * CHO-37. The centrifugation conditions used were as follows: 20-50% sucrose, Beckman TI-40-; *: rotor, 35000 UM overnight. After centrifugation, · · * * gradients were graded and individual fractions analyzed-4 *. was detected by a hemagglutination assay and an ELISA with FSME virus specific antigen. As shown in the figure, the sedimentation reactions of the preparations differed neither in specific density nor in specific haemagglutination activity • · .. ···.

1 17974 28 2. Characterization versus Native Protein Structure Preparations prepared in this manner were analyzed as follows: a. Analysis of antigen structure using monoclonal antibodies, b. Ability to acid-induced conformational changes 10 c. haemagglutination activity a. Antigen structure

The formalin-inactivated whole virus antigen structure was compared with that of the native infecting virus using 19 specific antibodies against protein E (Mandi et al. 1989, J. Virol. 63: 564-571; own experiments). The reactivity of each individual monoclonal antibody was analyzed by the above preparations with a 4-layer ELISA as described by Heinz et al. J. Biol. Stand. (1986), 14: 133-141. A pre-determined constant concentration of 1 pg / ml of protein E was used for each antigen preparation and an * * * # 'dilution of antibody containing • · ·: · * 25 each monoclonal antibody was used, that * * * II ·: has an extinction * *; * value with a native infectious virus in the range of 0.5-1.6.

• · · • · · · ·

As shown in Figure 11, the monoclonal antibodies · * ·,. The reaction patterns with rSP and the infecting virus are virtually identical, so it is to be expected that * * · protein E exists in the same native form * * *: · 'rSP as the infecting virus.

* · · T * • · • »· · '· *; In contrast, formalin inactivation significantly affects the structure of the antigen, which also contains epitopes that bind neutralizing antibodies. This applies to 117974 29, as well as to the neutralizing monoclonal antibody 12 (Mandi et al., 1989, J. Virol. 63: 564-571), whose epitope is destroyed by formalin treatment, as well as the epitopes in doraene A and domain B (Mandi et al., 1989, J.

5 Virol. 63: 564-571), whose reactivity is at least reduced. This analysis also shows that the structure of E * does not correspond at all to the native protein E on the viral surface.

10b. Acid-Induced Conformation Changes TBE virus invades cells via receptor-mediated endocytosis, thereby reaching endosomes whose acidic pH (<6.4) induces the specific conformation change required to fuse the viral membrane and endosomal membrane. These structural changes may be due to alterations in the reactivity of individual monoclonal antibodies (Heinz et al., 1994, Virology 198: 109-20 117) and affect e.g. to epitopes i2 and IC3 (reactive severe decrease) and C6 (enhanced reactivity) but not to epitope B3.

···· • ·: *. These changes are essential for the function of protein E.

• ·· ·. ·, 25 The ability to react as shown at acidic pH is thus ..! also a sign that protein E is in its native form, which corresponds to an infectious virus. preparations containing rSP, rE, and infectious virus * in triethanolamine • ♦ * V buffer pH 8.0 were mixed with 0.05 m 30 mES, 0.1 m NaCl and 0.1% bovine albumin to give a pH of 6.0, incubated for 10 min at 37 ° C and then adjusted again with tri: ethanolamine, 0. The reactivity of these preparations was then analyzed before and after incubation with acidic · · * ·· 35 mass at pH pH with monoclonal antibodies B3, i2, IC3 and • · ϊ * · C6. by ELISA as described in • · *: ··: "Antigen Structure". The results are shown in Figures 12 and 13 of 117974 30 and show that acidic pH causes similar structural changes in protein E of rSPs as in infectious virus protein E (see Figure 12), but that similar analysis for rE * does not indicate 5 any reference to a similar variant (see Figure 13).

c. Specific Heme Olutination Activity A characteristic feature of an infectious FSME virus is the ability under certain conditions to agglutinate goose hematocytes (haemagglutination activity). Protein E transmits this property to the virus and is thus another indicator of the presence of the native functional structure of the protein. Hemagglutination tests were performed as in Clarke and Casals (1958), Amer. J. Trop. Med.

Hyg. 7: 561-573 using goose hormone nitrocytes at pH 6.4.

Antigen concentrations determined by ELISA for infectious virus, formalin-inactivated virus, rSP and rE * were adjusted to 5 pg / ml and analyzed by the haemagglutinin assay. The result is shown in Table 3 below.

• *. • t It appears that rSP has the corresponding specific heme,

l M

*. . 25 agglutination activity other than infectious virus, and

* S

* m that this protein E-mediated activity is almost completely lost due to formalin inactivation. There is no measurable amount of HA activity in the * Ϊ.Ι I control rE *.

30: Table 3. HA Activity ·· * · ---- • · «* *

Preparation HA Titer • · ♦ • · · ·, ···, 35 Infectious Virus 512 * ··· * formalin-inact. virus 4. rSP 512 »» »* *. ·: RE <2 * »· ·» • * 31 117974 3. Immunoenzymes in mice

Immunization in mice analyzed the immunogenicity of the following antigen preparations: 5 - formalin-inactivated purified virus

- rSP

- rE

The protein E concentration was detected by the enzyme immunoassay 10 (Heinz et al., 1986, J. Biol. Stand. 14: 133-141) and the antigen concentration in all preparations was adjusted to the same value of 5 pg / ml. As with the TBE vaccine already in use (FSME-ImmunR), PBS pH 7.4 containing 0.1% human albumin was used as a dilution buffer and 0.2% Al (0H) 3 was added as an adjuvant.

The immunogenicity of rSP and rE1 was also tested without the addition of adjuvant.

20 Immunization Protocol:

Groups of 10 Swiss Albino mice (5 females and 5: ··· male) weighing 15 g were immunized subcutaneously twice every 14 days with each preparation, with 0.2 ml of antigen per mouse and * · · · 25 immunizations. One week after the second immunization, a blood sample was taken and all • · 1 I mice were infected intraperitoneally with 500 LD50 mice · · ***, 'the pathogenic TBE virus strain Hypr (Challenge test).

• ♦ · * · 1 The presence of fatal encephalitis in mice was monitored for 14 days.

· 1 · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · of ten mice, all of which were · · immunized with the same immunogen and analyzed for TBE- * 1 * 11 35 virus-specific antibody levels by an enzyme-linked immunoassay (ELISA), a haemagglutination inhibition test (HHT) and 5 **! neutralointitestillä.

117974 32 The ELISA was performed using purified TBE virus as antigen as described by Heinz et al. described by J. Gen. Virol. (1984) 65: 1921-1929. HHT was performed as in Clark and Casals (1958), Amer. J. Trop. Med. Hyg. 7: 561-573, using goose henocytes at a final pH of 6.4. For neutralization tests, BHK-21 cells were used and the virus concentration used was 500 infecting units.

The results of the immunization experiment are shown in Table 4. It shows that rSP, both without and with adjuvant as well as formalin-inactivated whole virus, protected all mice against the lethal dose against TBE virus. In contrast, when immunized with rE *, no protective effect was observed (without adjuvant) or no protective effect (with adjuvant).

When comparing antibody induction, rSPs were even superior to formalin-inactivated virus, with A1 (0H) 3 as adjuvant being particularly clear. This applies to both the virus binding antibodies detected by the ELISA and, more importantly to the protective immune response, the antibodies measured in HHT and NT,; thus blocking specific functions of the virus (haemagglutination and infectivity).

·· · ♦ · · • '* Lack of protective action or no effect | The existence of * * ··· · is well compatible with the fact that the induction of antibody * * * * *. * * To rE was very small or not detectable.

• · • * * I I »J» · ·

Thus, rSPs have been shown to be excellent immuno-. genes that protect against otherwise lethal encephalitis • · · and are even superior to formalin-inactivated size «·; · '35 virus when compared to the induction of functional virus neutralizing antibodies.

• · 1 * MMI f ♦ 33 117974

Table 4. Immunization of mice

Challenge Antibody Titer Test 5 alive via total ELISA HHT NT (# 10/10) formalin-inact.

10 virus + adjuv. 10/10 10000 40 20-40 rSP without adjuv. 10/10 12000 80-160 40-80 rSP + adjuv. 10/10 30000 160 160 15 rE * without adjuv. 0/10 100 <10 <10 rE * + adjuv. 1/10 4000 <10 <10-10 20 buffer control 0/10 neg <10 <10 4. Immunization with naked DNA 25 Plasmids containing the inserts shown in Figure 1 were used for immunization with naked DNA. under the control of the promoter. These plasmids (CMV-PEwt, CMV-PEst, CMV-Ewt, CMV-Est) were prepared by insertion of the plasmids SV-PEwt, ··, 30 SV-PEst, SV-Ewt and SV-Est in the plasmid by recloning. pCMVfi • ··

(Clontech) (Mac Gergor et al., Nucleic Acids Research, IRL

'Press, Vol. 17, No. 6, 1989, p. 2365: "Construction of plasmids that express E. coli β-galactosidase in mammalian (j) cells") and purified by CsCl density gradient centrifugation. (Maniatis et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 1982).

«T ♦ * t * j · · * ···· ', ···, CMV-PEwt contains wild-type sequences of the prM and E proteins.

The CMV-PEst contains the wild-type sequence of protein prM and the deletion sequence of protein E which lacks the 3479 amino acid codons of 61 carboxyl terminus, which form the membrane anchor region of protein E.

In CMV-Ewt most of the prM sequence is not present but the entire sequence of the 5 wild-type protein E is.

CMV-Est does not contain the prM sequence but contains the deleted protein E sequence from CMV-PEst.

Two concentrations (60 pg / ml and 300 pg / ml in PBS) of each of these four plasmids were used to immunize mice (Swiss Albino) using 10 mice (5 females and 5 males) for each plasmid preparation. Each mouse was injected intradermally with two 15 times 100 μΐ of the DNA preparation in question every two weeks. Plasma CMV3 at 300 pg / ml and PBS were used as controls. For comparison, groups of 10 mice were also immunized conventionally with formalin-inactivated virus at concentrations of 1 pg / ml and 5 pg / ml also twice every two weeks by 0.2 ml subcutaneous injection per mouse and using 0.2% Al (0H). 3 as adjuvant. One week after the second innervation, a blood sample was taken from the mice to detect specific antibodies by ELISA and simultaneously challenged with an intraperitoneal Challenge infection using 500 LD50 TBE-S virus. The follow-up time was 3 weeks, and Table 5 summarizes the results of the antibody assays and protection tests, as shown by DNA immunization 30 to provide protection against the lethal TBE virus infection. ***; only with a plasmid containing the genes encoding the complete proteins prM and E.

This is probably interpreted to mean that the presence of the protein 'l »* ·' 'prM / Μ is necessary for the assembly of the subviral particles M · 35, in which protein E is in an immunogenic form.

• · • ι · «· ι t« 35 117974

Table 5; Results of mouse protection experiments

Immunoqene Protection Antibody Positive

Plasmidlt 5 PE-wt 60 pg / ml 6a / 10b l ° / 10d PE-wt 300 µg / ml 9/10 5/10 E-wt 60 µg / ml 0/10 0/10 10 E-wt 300 µg / ml 0/10 0/10 60 pg / ml 0/10 0/10 300 gg / ml 0/10 0/10 15 E 60 pg / ml 0/10 0/10 E 300 pg / ml 0/10 0/10 CMV-β 300 pg / ml 0/10 0/10 20 Comparison HCOH Virus 1 gg / ml 4/10 4/10 HCOH Virus 5 yg / ml 10/10 10/10 25 PBS 0/10 0/10 a Number of protected mice b Number of mice tested 30 c Number of ELISA positive mice d Number of mice tested • 1 1 * · • t • · * 1 · * · 1 • 1 · · • «· • · · 1 · · · · · 1 ···· 1 1! * · · • 1 • · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · to end · · · 1

Claims (15)

Vaccine for immunization against Tick-Borne-Encephalit virus (TBE virus) infections, characterized by including non-infectious, subviral particles containing protein E in its complete native form and optionally the protein prM / M, which proteins are derived from the TBE virus. 2. Vaccine according to claim 1, characterized in that protein E and possibly protein prM / M are recombinant proteins. 3. Vaccine according to claim 2, characterized in that the recombinant protein E is derived from the European or Far Eastern subtype of the TBE virus. Vaccine according to any one of claims 1 to 3, characterized in that the non-infectious particles further comprise a lipid component which is preferably in vesicular form. * · J *. 5. Vaccine according to any one of claims 1 to 4, characterized in that the non-infectious particles are free of nucleic acids derived from PCR detectable by PCR. 6. Procedure for the preparation of a TBE vaccine, characterized in that ♦ · • * ·· 30 - a cell culture system is made available, sora • · Contains the coding sequences for the proteins prM and E, which proteins are derived from the TBE virus, • * • * *; * - protein E is expressed in its complete native * * • * ·· 35 form, wherein: **: - Subviral, non-infectious particles are formed which contain recombinant protein E in its complete, native form and optionally the recombinant protein prM / M and - the particles are collected and processed directly into a composition suitable for immunization. 5 7. A method according to claim 6, characterized in that a cell culture system is provided which contains the coding sequences for the proteins prM and E, which proteins are derived from the TBE virus, in chromosomally integrated form. Method according to claim 6, characterized in that viral vectors come into use in the cell culture system. 15 Method according to claim 6, characterized in that the cell culture system is virus-free. Method according to claim 9, characterized in that a plasmid vector is used. 11. A process according to any of claims 6 to 10, characterized in that the expression of the proteins and the formation of the particles is continuous. ♦ · ·: V 25 i j Use of non-infectious, subviral particles containing protein E in its complete native form and possibly protein prM / M, which proteins are derived from the TBE virus, for the preparation of an active vaccine. ···. Immunization against TBE virus infections. Use according to claim 12, characterized in: ... · that protein E and possibly protein prM / Μ are recombinant. proteins. 35 • * · · »* * Use of non-infectious, subviral particles containing protein E in its complete native form and possibly protein prM / M, which proteins originate from the TBE virus, for the preparation of anti-TBE virus immunoglobulin preparations. Use according to claim 14, characterized in that protein E and possibly protein prM / M are recombinant proteins. ····· • · ♦ * • · • * · * * · * · * · * • · · # * • · «* ·. • · * * · * • * · • · · * # · • · • ·· ** · • · • · · · · · ''. ·· • * * · · • · * · * • · • ♦ • · · • · • · · ·· * ·· * · j