FI107739B - In clacinomycin biosynthesis included gene clusters and its use in genetic engineering - Google Patents

Description

1 107739

Gene cleavage associated with aclasinomycin biosynthesis and its use in genetic engineering

FIELD OF THE INVENTION The present invention relates to a gene cluster of aclasinomycin biosynthesis derived from Streptomyces galilaeus and the use of genes contained therein to obtain hybrid antibiotics or to increase yields of aclasinomycin or related antibiotics.

Background of the Invention

Anthracyclines are commonly used anticancer drugs. Seven different anthracyclines are in clinical use worldwide: daunorubicin, doxorubicin, idarubicin, epirubicin, pirarubicin, zorubicin and aclarubicin. A typical compound is doxorubicin, which is most effective and affects a wide range of malignant conditions. Many toxic effects, such as cumulative cardiotoxicity sometimes seen with doxorubicin, have led to discontinuation of treatment in some cases. In addition, there are certain types of malignant conditions for which the available anthracyclines are ineffective. The mechanism of action of anthracyclines, in terms of their clinical efficacy, is not clear, although most researchers consider the inhibition of topoisomerase II to be a desirable effect. si. The formation of free radicals due to quinone structures is reported to be associated with side effects such as cardiotoxicity. Professor Strohl and his team have recently provided an overview of anthracyclines (1997).

Aclacinomycin A (aclarubicin), first described by Oki et al., (1975), is an anthracycline antibiotic produced by Streptomycesgalilaeus ATCC 31133 and S. gal- • · · width ATCC 31615. It is active against tumor cells and has less toxic properties than doxorubicin. However, its effect does not reach solid • • · ***; thigh, which limits its use in the treatment of leukemia. The structure of acarubicin differs from w · ♦ 1 30. The trisaccharide moiety, rhodosamine-2-deoxylose-kinerulose A, is linked to the · · · ··, position C-7 by a glycosidic linkage, while the corresponding position · · · · · of daunomycins. \ associated with only one sugar residue, daunosamine.

• • • • • • i · «2 107739

Despite the long history of anthracyclines, about three decades, their biosynthesis studies are still ongoing and there is new interest in developing new molecules for the development of anticancer drugs. The method currently used to find new molecules for drug selection is genetic engineering. Cloning of the anthracycline 5 biosynthetic genes facilitates the production of hybrid anthracyclines and their use in recombinant biosynthesis to generate new molecules. Regarding the chemical nature of the anthracyclines currently in clinical use, aclarubicin has unique properties that make its biosynthetic genes of interest in the development of new products.

10

Regarding the deoxyhexose pathway genes, Madduri et al. (1998) reported that a gene from an avermectin biosynthetic cluster, when introduced into a strain of S. peucetius, caused the production of hybrid anthracyclines by altering the sugar moiety. The product obtained was epi-rubicin, a commercially important anthracycline. In this case, the hydroxyl-15 moiety of the daunosamine moiety was stereochemically opposite due to the action of the avermectin biosynthesis gene.

S. galilaeus has been used as a host for the preparation of hybrid anthracyclines using S.

genes derived from the rhodomycin pathway of purpurascens (Niemi et al., 1994) and the nogalamycin biosynthetic cluster of S. nogalateri (Ylihonko et al., 1996a). Nogalamy-. genes in the sine pathway were used to effect the production of hybrid anthracycline in S. steffisbur- · · ** V gensis, which typically produces steffimycin (Kunnari et al., 1997). Actinorodine • · · ···, biosynthetic genes have previously been expressed in S. galilaeus, resulting in the formation of aloe-saponarin (Strohl et al., 1991). These hybrid compounds were modified for aglycone moieties. Recently, a Nogalamycin deoxyhexose pathway was used. *: *. related biosynthetic genes to provide hybrid compounds using S. galgaleus mutants as host (FI pat. application no. 982295).

· · · ***: As indicated above, S. galilaeus has been used as a cloning host for the development of new molecules, while its use for gene delivery has not been described. Recognized • · • ·. * · *. genes involved in aclasinomycin biosynthesis include the polyketide reductase gene (Tsu-? · Λ kamoto et al., 1994), aclanic acid methyl ester cyclase (GeneBank, storage AF-? 043550), and polyketide synthase genes (Hutchinson and Fuji, 1995) not available;

3, 107739

SUMMARY OF THE INVENTION This invention relates to a gene cluster, most of whose genes are derived from the deoxyhexose pathway of rhodos-5 amine, 2-deoxifucose and / or rhodosin. The gene cluster was cloned from S. galilaeus ATCC 31615 and is involved in the biosynthesis of aclasinomycins.

DETAILED DESCRIPTION OF THE INVENTION The experimental procedures of this invention include conventional biochemical and chemical methods. Detailed descriptions of techniques not described herein are provided by Hopwood et al. Genetic Manipulation of Streptomyces: a Laboratory Manual, The John Innes Foundation, Norwich (1985) and Sambrook et al.

15 (1989) 'Molecular Cloning: a laboratory manual'.

The publications, patents and patent applications used herein as a whole are incorporated by reference in their entirety.

The present invention relates in particular to the discovery of a gene cluster for aclasinomycin biosynthesis. When introduced into S. peucetius strains, the group produced a modified sugar moiety. ·. ·. yield of hybrid antibiotics.

It was possible to clone a group of the deoxyhexose pathway from a limited library of 4,107,739. To simplify the cloning strategy, the library was made in an E. coli replicating pUC-based plasmid (e.g. pBluescript or pWHM109).

The strategy for cloning genes involved in aclasinomycin biosynthesis according to the invention was summarized as follows: Total DNA was isolated from S. galilaeus (ATCC 31615) and digested with several restriction enzymes producing average 10 kb fragments. Restriction thiophages were analyzed by Southem hybridization using a homologous DNA fragment, Sg-dht, as a probe. BglII produced an 8.5 kb hybridized fragment, and double digestion with Ala and ILII produced a 7 kb hybridized fragment. DNA digestion 10 using (i) BglII and (ii) XhoI-NotI was performed and the fragments were inserted into the BamHI digested E. coli-Streptomyces transfer vector pWHM 1109 and the AT 50 I -od digested pBlue script. The ligation mixtures were introduced into an E. coli XL1BlueMRF strain with reduced restriction modification systems. Colonies were plated on agar plates at dilutions yielding 200 to 600 p.m. (colony forming unit) per plate.

Well-grown colonies were transferred to nylon membranes for hybridization performed using the Sg-dht probe. Six of the 786 Bg / II digested clones and seven of the 1523 clones carrying the AT 50 I-Akrtl fragments produced a hybridization signal. Hybridization and washes were performed at 65 ° C under stringent conditions with low salt content. Many probe labeling and hybridization techniques are possible but 20 Boehringer Mannheim's Guide to The DIG System User's Guide for Filter Hybridization ·. procedure is preferred. Colonies that give hybridization signals flash. for plasmid isolation. Plasmids were analyzed by Southem hybridization for colon • 1: 1; to ensure reliability of hybridization. Plasmids containing the desired DNA fragments (Sg4 and Sg5) ···: 1 · · · were named pSgc4 (Bg / II fragment) and pScg5 (XhoI-NotI- · 25 fragment) (see Figure 2).

• ·· • 1 · • · ·

Fragments Sg4 and Sg5 were subcloned for sequencing into E. coli vectors pUC19 '"1 · and pBluescript. A total of 30 subclones were used to obtain the nucleotide sequence ···' ... of Sg4 and Sg5. The sequenced cluster revealed thirteen aclasynomycetes *. 1 1 1: 30 related genes A comparison of the sequencer Aston sequences suggested that sga2 • ·: acts as an activator, sga3 dehydratase, sgaA oxidoreductase, sgaS dTDP-glucose-4,6-dehydratase, sga6 glycosylase, sga6 glycosylase, - • ·, sgaS as aclaviketone reductase, sga9 as a putative polyketide scavenger, sgalQ as otac- • 107739 as a cyclase, s maybe 1 aminomethylase, sga 12 glucose-1-phosphate-thymidyl-transferase, sga 13 aminotransferase: nga. suggested by similarity searches. Based on the inferred functions, nine genes are involved in the glycosylation pathway. These genes are sgaS, sga9, and 5 sgalO. Activation, Sga2, may regulate both the glycosylation moiety and the formation of aclavone via the polyketide pathway.

Sg4 from pSgc4 was cloned into the Streptomyces expression vector pIJE486 (Ylihonko et al., 1996b) in S. lividans TK24 to yield pSgs4. This vector is a high number 10 plasmid that replicates in several Streptomyces species (Ward et al., 1986) and contains the constitutively expressed promoter ermE (Bibb et al., 1985) upstream of the multiclonal site. Plasmid pSgs4 isolated from TK24 was introduced into S. galilaeus strains that inhibit the deoxyhexose pathway of aclasinomycin biosynthesis, and S.

peucetius mutants which produce ε-rhodomycinone based on the damage in glycosylation genes. Three S. galilaeus mutants, H063, H054 and H065, restored the ability to produce aclasinomycin. Mutant strain H063 accumulates aclavinone and is fully complemented by plasmid pSgs. Instead, H054 and H065, which produced aclavinoglycosides with the same neutral sugars but no rhodosamine, only partially complemented with pSgs4. Surprisingly, H063, which had pSgs4 (H063 / pSgs4), was able to produce twice as much aclasinomycins as wild-type S. galilaeus. S.

. 1j peucetius M18 and M90 producing ε-rhodomycinone were chosen as hosts for pSgs4. L- · 1 · «: V: rhamnosyl-s-rhodomycinone (El Khamed et al., 1977) was obtained when pSgs4 was expressed in M18 and M90 mutants, and additionally, M18 / pSgs4 produced L-daunosaminyl- s-rhodomycin • · · .1 · (Esery and Doyle, 1980). The constructs were not novel, but this demonstrates the ability of the gene groups according to the present invention to produce hybrid products in a heterologous host. To produce hybrid compounds, we favor the use of E1 medium to maintain a suitable antibiotic addition, in this case thiostrepton, to maintain the selection pressure of the plasmid containing carriers. The products were extracted with organic solvents and purified • ♦ *; 1 was subjected to chromatography to obtain compounds of high purity for structural analysis.

The following are examples to further illustrate the invention.

• · • · · · ·· • · 6 107739

Brief Description of the Drawings

Figure 1 shows the structures of aclasinomycin, daunomycin and ε-rhodoraysinone.

Figure 2 is a diagram of the gene cluster of aclasinomycin biosynthesis.

Figure 3 illustrates a suggested biosynthetic pathway for sugars in aclasinomycins.

Figure 4 shows the structures of hybrid compounds 10 produced by M18 / pSgs4 (1 and 2) and M90 / pSgs4 (2).

EXPERIMENTAL PART

Materials Used The restriction enzymes used were obtained from Promega (Madison, Wisconsin, USA), Fermentas (Lithuania) or Boehringer Mannheim (Germany), alkaline phosphatase from Boehringer Mannheim and used according to the manufacturer's instructions. Proteinase K was obtained from Promega and lysozyme Sigma. 20 Hybond ™ N-Nylon Films for Hybridization were purchased from Amersham (Buckinghamshire, England), DIG DNA Labeling Kit and DIG Luminescent Detection Kit from Boehringer Mannheim. Qia- * · · · quick Gel Extraction Kit from Qiagen (Hilden, Germany) was used to isolate DNA from * · agarose.

»LY: 25 Bacterial strains and their use t

Escherichia coli XL1BlueMRF (Stratagene, La Jolla, California) was used for cloning.

30 Streptomyces lividans TK24 was the first cloning host for gene expression.

* · · J ... ί Edited by prof. Sir David Hopwood, John Innes Center, UK. 1 · • · · • · · * 9 9 9 9 9 9 9 99 9 9 7 107739

Wild-type Streptomyces galilaeus ATCC 31615 produces aclasinomycins. It was used herein to deliver the genes of the invention.

Akv- (Rho) o-3- is produced by Streptomyces galilaeus H039 (Ylihonko et al., 1994) as an expression host for pSgs4 because it is more easily transformed than other wild-type mutants.

Streptomyces galilaeus H054 (Ylihonko et al., 1994) produces Akv-Rho-dF- (CinA) 0-1, Akv-dF-dF- (CinA) 0-i and Akv-dF-Rho-Rho. It was used as an expression host for pSgs4.

10

Streptomyces galilaeus H063 produces aclavinone. It is a mutant strain derived from wild-type S. galilaeus. H063 was used as an expression host for pSgs4.

Streptomyces galilaeus H065 produces aclavinone with neutral glycosides. It is a mutant strain derived from wild-type 15 S. galilaeus. H065 was used as an expression host for pSgs4.

Streptomycespeucetius M18 and M90, which produce ε-rhodomycinone, are S. peucetius var. mutants derived from caesius (ATCC 27952). They were used as an expression host for 20 pSgs4.

• ♦ ♦ · ♦ • ·· ·

Plasmids • · ··· • · • · «··: * ·. E. coli cloning vectors pBluescript SK (Stratagene) and pUC 19 (Pharmacia, Sweden) • ·: *: ': 25 were used to construct the subclones to be sequenced and pBluescript was also used as a vector of the gene gene.

pWHM1109 (edited by Prof. C.R. Hutchinson, Wisconsin, USA) is an E. coli

• M

. a replicating transfer vector in streptomycetes. It was used as a vector for the gene library.

: ·: 30 • · •: pIJ486 is an abundant plasmid vector provided by prof. Sir David Hopwood,

John Innes Center, UK (Ward et al., 1986).

PIJE486 (Ylihonko et al., 1996b) is an expression vector containing ermE (Bibb et al., 1985) to promote expression of cloned genes.

8 107739

Culture media and solutions TSB medium was used for culturing 5 S. galilaeusm for total DNA isolation. Lysozyme solution (0.3 M sucrose, 25 mM Tris, pH 8 and 25 mM EDTA, pH 8) was used for total DNA isolation. TE buffer (10 mM Tris, pH 8.0 and 1 mM EDTA) was used for DNA lysis.

10 TRYPTON SOYA SOYA (TSB)

Per liter: Oxoid Tryptone Soya Broth 30 g.

15 ISP4

Bacto ISP Tray 4, Difco; 37 g / l.

Per liter of tap water: glucose 20 g 20 soluble starch 20 g. Farmamedia 5g • · · • · · ·

Yeast extract 2.5 g; ···. Κ2ΗΡ04 · 3Η20 1.3g • · ·

MgSO 4 * 7H 2 O 1 g: T: 25 NaCl 3 g

CaC03 3g pH adjusted to 7.4 before autoclaving General Methods: • NMR measurements were performed on a JEOL JNM-GX 400 spectrometer. The internal standard for α and 13 C NMR samples was TMS.

• ♦ • ♦ ♦ · · • · · ♦ · 9 107739

Anthracycline metabolites were determined by (i) HPLC (LaChrom, Merck Hitachi, L-7100 pump, L-7400 detector and D-7500 integrator) using a LiChroCART RP-18 column. Acetonitrile: Potassium hydrogen phosphate buffer (60 mM, pH 3.0 adjusted with citric acid) was used as the mobile phase. A gradient system ranging from 65% to 30% potassium dihydrogen phosphate buffer was used to separate the compounds. The flow rate was 1 mL / min and detection was performed at 480 nm and (ii) by TLC using Kieselgel 60 F254 glass plates (Merck, Darmstadt, Germany) and eluent toluene: ethyl acetate: methanol: formic acid (50:50). 15: 3).

Thiostrepton (50 pg / ml) supplemented ISP4 plates were used to maintain plasmid containing cultures.

Example 1. Cloning of an Aclasinomycin Biosynthetic Gene Group 15 1.1 Selection of Clones by Hybridization

For total DNA isolation, Streptomyces galilaeus was grown for four days in 50 ml of TSB medium supplemented with 0.5% glycine. Cells were harvested by centrifugation for 15 min (3900 x g) in 12 ml Falcon tubes and stored at -20 ° C. Cells from 50 ml culture were used for DNA isolation. 5 cells were added to the cells of each Falcon tube. ml of lysozyme solution containing 5 mg / ml lysozyme and incubated for 20 min at 37 ° C.

· ♦ · ♦

500 μΐ of 10% SDS containing 0.7 mg of proteinase K was added to the cells and incubated. After 80 min at 62 ° C, an additional 500 μΐ of 10% SDS containing 0.7 mg proteinase was added.

K, and incubation was continued for 60 min. The sample was chilled on ice and 600 µl of 3 M NaAc, pH

V * 25 5.8 was added and the mixture was extracted with balanced phenol (Sigma). The phases were separated by centrifugation (1400 x g) for 10 min. The DNA was precipitated from the aqueous phase with an equal volume of isopropanol and collected by rotation on a glass rod and washed by immersion in 70% ethanol, air dried and dissolved in 500 µl of TE buffer.

Southem hybridization to determine restriction enzymes suitable for the preparation of restricted plasmid libraries was performed using Bg / II, Xhol, NotI and their · ·: V combinations. A ~ 9 kb fragment that hybridized with the Sg-dht probe was found to be good. For hybridization, 600 ng of digested S. galilaeus DNA 10 107739

was loaded on an agarose gel and after electrophoresis, the DNA was transferred from the gel to the nylon membrane by vacuum blotting. Hybridization was performed according to Boehringer Mannheim's 'The DIG System User's Guide for Filter Hybridization'. The hybridization probe, Sg-dht, which was also used for colony hybridization, was obtained by amplifying a gene fragment from S. Galila-5 eus DNA which is internal to the 4,6-dehydratase gene and corresponds to SEQ.

The fragment 6345-6861 shown in ID NO: 14. PCR was used for amplification, and the sequences of the degenerate oligonucleotide primers were 5'-CSGGSGSSGCSGGS-TTCATSGG-3 '(forward, SEQ. ID. NO: 15) and 5'-GGGWRCTGGYRSGGSCC. GTTG-3 '(reverse, SEQ. ID. NO: 16). Suitable fragments were the 9 kb BglII-10 fragment and the 7 kb BpII-TVoil fragment.

Ten micrograms of chromosomal DNA were digested with BglII. The DNA fragments were separated by agarose gel electrophoresis and the 8-9 kb band was cut from 0.6% low temperature solidified SeaPlaque® agarose. The DNA band was isolated from the gel using the Qiagen Extraction Kit. The isolated fragment was ligated into 5 amHI-digested pWHM1109 plasmid vector and dephosphorylated in relation to 3 moles of insert DNA per 1 mole of vector DNA. The inserted DNA was introduced into an E. coli XL1Blue-MRF strain by electroporation. Using the entire junction mixture, 786 colonies were obtained. Colonies were grown on agar plates for at least 12 h and transferred to nylon membranes. Hybridization of colonial-20 membranes was performed in southern form using Sg-dht as probe. Six clones gave signals in hybridization, and the corresponding colonies were plated on agar M and inoculated into 3 ml of LB medium to isolate plasmid DNA. Southern hybridis: * "· disassembly was used to examine whether plasmids derived from clones had the desired» · «: * \: insert. Four of these plasmids contained the 4,6-dehydratase gene fragment and gave an identical restriction fragment map, so they had the same fragment representing both orientations.

M · φϊ: The fragment was named Sg4 and the plasmid containing the fragment was named pSgc4.

Similarly, a plasmid library of 7 kb AT10I-AolI DNA fragment from S. galilaeus was constructed. pBluescript was digested with SuperTiI-TVol, and a gene library containing the 7 µg * · *: 30 kb fragments was constructed. A total of 1523 colonies were hybridized and seven turned out to be the desired clone. As described above, the clones were examined for the iTioI-Abil fragment. The insert fragment was named Sg5 and the plasmid · ·: * ·. · D was named pSgc5. The strain E. coli XLIBlue MRF '/ pSgc5 was deposited in accordance with the rules of the Budapest Treaty in the Deutsche Sammlung von Mikroorganismen und Zell-11 107739 Kulturen GmbH (DSMZ) on 12 August 1999 under accession number DSM 12999. The fragments Sg4 and Sg5 overlap. bp, corresponding to bases 6181-7016 in SEQ ED NO: 14.

5 1.2. Subcloning of fragments for sequencing

Suitable subclones were constructed to determine the nucleotide sequence of the whole group of Sg4 and Sg5. Appropriate restriction sites were used to subclone the 14806 bp region into pUC19 and pBluescript. Nineteen subclones were required for sequencing Sg4, and 11 subclones for Sg5.

E. coli XLIBlue MRF 'cells containing the subcloned plasmids were cultured overnight at 37 ° C in 5 ml of LB medium supplemented with 50 μg / ml ampicillin. Promegan Wizard Plus Minipreps 15 DNA Purification System Kit or Biometra Silica Spin Disc Plasmid DNA Miniprep Kit from Biomedizinische Analytik GmbH was used to isolate plasmids for sequencing reactions according to the manufacturer's instructions.

DNA sequencing was performed using an ABI automated DNA sequencer (Perkin-Elmer) according to the manufacturer's instructions.

20th ·. 1.3. Gene Sequence Analysis and Inferred Functions. 1 1 1. S equivalency analyzes were performed using the GCG Sequence Analysis Kit (Version ··· 8; Genetics Computer Group, Madison, Wis., USA). The translation table was modified • ·: '·': 25 so that GTG was also accepted as the start codon. Use of codons was analyzed using published data (Wright and Bibb 1992).

According to the CODONPREFERENCE program, the DNA fragment sequenced revealed 11 · · · complete open reading frames (ORFs) and two 5′-ends (sgal and: 1 · 1: 30 sga \ 3) of other ORFs. The functions of the genes were deduced by comparing • · • amino acid sequences translated from their base sequences with known sequences in the databases. Results. V. is shown in Table 1 with reference to the sequence information provided in the application.

* · · • ♦ ♦ • · · • · «• · 12 107739

The functions proposed for the genes fit well with the suggested biosynthetic pathway for aclasinomycin sugars (Figure 3). The last residue of the trisaccharide moiety of aclasinomycins is rhodinose, which is enzymatically converted to kinerulose. Aclacinomycin N, precursor of aclarubicin, contains rhodinose as the third sugar residue.

5

Table 1.

Gene Location Amino- Inferred Function Notes acids sgal -1986> 662 unknown imperfect croup. Seq.ID.NO:l sgal 2523-3341 272 activator Seq.ID.NO:2 sga3 3355-4659 434 dehydratase Seq.ID.NO:3 scab.

sga4 4821-5810 329 oxidoreductase Seq.ID.NO:4 sga5 5920-6891 323 dTDP-glucose 4.6- Seq.ED.NO:5 bundle. dehydratase sga6 6879-8210 443 glucosyltransferase Seq.ID.NO:6.

sgal 8287-9618 443 putative isomerase Seq.ID.NO:7 snail,:. ·: Sga8 9642-10445 267 aclaviketone reductase Seq.ID.NO:8: .V snail, (KRII) • M _ __ '··· * sga9 10471-10905 144 putative Seq.ID.NO:9 • · 4 polyketide assembler «· · ____________________________ __ ^^ *:!. * sgal® 11115-11894 259 putative cyclase Seq.ID.NO:10 • · · • · · - ----— -. ----- —.....

sgal 1 11956-12672 238 aminomethylase Seq.ID.NO:ll sgal 2 12685-13560 291 glucose-1-phosphate-Seq.ID.NO:12 • ·. * · *. crawled. thymidylyltransferase sgal3 13783-14805 341 aminotransferase Seq.ID.NO:13 • · • ♦ ..... * '"im ··' i— 1 l'i— .— .. il t ... ..... .- »i -" * · * · • · «· • · · • • 13 ♦ ♦ 13 13 13 13 13 13 13 13 13 13 10 13 107739 1.4 Expression Cloning in Streptomyces Strains 8 kb 5n. The / HI / ^ fragment of pSgc4 was ligated into pIJE486 to give pSgs4. Plasmid pSgs4 was introduced into the -S ', lividans TK24 strain by protoplast transformation.

The resulting strain S. lividans TK24 / pSgs4 was deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) on August 12, 1999 under the rules of the Budapest Treaty under accession number DSM 12998. The plasmid pSgs4 was isolated from the strain and further transferred to S. galilaeus mutant. The plasmid preparation isolated from H039 was subsequently introduced into mutants H063, H054, and H065, which lack aclasinomycin glycosylation systems. Use of H039 as a primary S. ga-lilaeus host. because its uptake of foreign DNA was more efficient.

The S. galilaeus mutants were examined for complementation by culturing clones containing pSgs4 in E1 medium supplemented with thiostrepton (10 pg / ml). The products were extracted from 15,500 μ1: η broth sample with toluene: methanol (1: 1) at pH 7. Metabolites from both transformed clones and mutants were analyzed by TLC and HPLC for differences in pSgs4. Endogenously producing aclavinone, H063 returned to producing aclasinomycin with pSgs4. Aclavinone was not found in the growth broth of H063 / pSgs4. However, complementation did not become complete when pSgs4 was expressed in H054 and H065. Each mutant produces aclavinone with neutral glycosides.

Incomplete complementation was probably due to the disappearance of the plasmid from some cells during culturing, or the low expression of the genes required as an activator in pSgs4.

PSgs4 isolated from 25 TK24 was similarly introduced into S. peuceiius mutants M1 8 and M90.

··· V * The characteristic product of these mutants is ε-rhodomycinone. Plasmid-containing strains M18 / pSgs4 and M90 / pSgs4 were cultured in E1 medium supplemented with thiostreptone (10 * pg / ml) and metabolites therein were analyzed by TLC and HPLC. Both • · ··· * clones exhibited a changed production profile compared to the products obtained from the mutants.

M90 / pSgs4 accumulates a glycosylated product, ε-rhodomycinone, as an aglycon.

• ·· 'The compound was identified in El Khamedin ali. (1977) previously synthesized (CAS = 63252-? Ί.ί, ί 11-9) to L-rhamnosyl-s-rhodomycinone.

14 107739 M18 / pSgs4 produced two compounds that differed from the parent strain. Based on HPLC and TLC results, one compound was the same as the L-rhamnosyl-s-rhodomycinone produced by M90 / pSgs4 and the other was the L-daunosaminyl-s-rhodomycinone previously characterized by Essery and Doyle (1980).

5

Table 2: TLC and HPLC data for hybrid products

Product Rf value Retention time ε-rhodomycinone 0.67 6.70 L-rhamnosyl-s-rhodomycinone 0.38 5.00 L-daunosaminyl-ε-rhodomycinone 0.04 4.06 1.5. Utility of pSgs4 for Strain Improvement Because of the complete complementation of H063 with pSgs4, the level of production of aminoglycosides was examined. To this end, H063 / pSgs4, H063 and wild-type S. galilaeus were cultured in E1 vessel in Erlenmeyer flasks for four days. Two 2 ml samples of each culture were first extracted with toluene: methanol (1: 1) under acidic conditions to remove neutral glycosides and aglycones. The extraction procedure was repeated until neutral glycosides and aglycones had disappeared from the aqueous phase. Amount of anthracycline metabolites toluene phase, ·. was determined and is shown in Table 3. Rhodosamine-containing aclasinomycins were extracted from the aqueous phase with chloroform. Both the toluene and chloroform extracts were analyzed for 1 h • ·. ···. By TLC, and the toluene phases mainly contained aclavinone and degradation products. The chloro ··· 'formifases mainly contained aminoglycosides, albeit with small amounts of aglyco • ·: 1 ·'; 20 were also observed. The extracts were evaporated to dryness and then dissolved in 1 ml: 1: methanol. Quantities of anthracycline metabolites were detected with a spectrophotometer at 430 nm. Amounts relative to absorbance were calculated using an extinction sugar *: 1 ·: factor of 13000. The results given in mg / 1 growth broth are shown in Table 3. The production of aclasino- · · · * ... J mycines by H063 / pSgs4 was at least twice as high as wild-type. - · 1 · 1; 25 types.

• »« · · · · · · · · · · · · · · · · · · · ··· ·

Table 3.

Chloroform Phase Toluene Phase Aglycon Fraction Aminoglycoside Fraction Sample Absorbance Concentration Absorbance Concentration (mg / l) (mg / l) H063 0.401 12 ^ 6 2.956 92 ^ 3 H063 / pSgs4 2.751 85 ^ 9 2.974 92 ^ 9 S. galilaeus 1.338 4 ^ 83.6 The ability of pSgs4 to increase the yield of aclasinomycins in mutant H063 suggests that the genes of this invention are useful for strain improvement.

5

Example 2. Compounds produced by pSgs4

A starter culture of 180 ml of the culture of M18 / pSgs4 or M90 / pSgs4 plasmid containing strains was obtained by growing each strain in three 250 ml Erlenmeyer flasks containing 50 ml of E1 medium supplemented with thiostrepton (5 μg / ml) for 30 days. At 330 rpm. Combined broths (180 mL) were used to inoculate 13 L of E1 medium in a fermenter (Biostat E). Fermentation was carried out for five days at 28 ° C (330 rpm, aeration: 4501 / min).

• • • • • • • • • •. · · ·, 15 S beer was collected by centrifugation. 2.61 methanol was used to disrupt bacterial cells.

• ·. ·. ; The anthracycline metabolites were extracted from methanolic solution at pH 8 using 21 ethyl acetate and the extract was evaporated to dryness. The viscous residue was applied to a 4 x 10 cm phanoic acid column and toluene: ethyl acetate: formic acid (50: 50: 3) was used as eluent with increasing methanol. The pure fractions were combined and extracted with 1 M phosphate ·: ··· 20 drops buffer (pH 8.0) and water. The organic phase was dried over anhydrous Na2SO4 and then treated with hexane to effect precipitation. The pure compounds were pu · · ·: ·. ·. women and powders dried in vacuo.

• · * • · · · ·. · · ···

Complete structural determination of the compounds was performed by NMR. Proton and carbon measurements were based on standard NOE resolution, pHSQC and HMBC measurements. In particular, the correlations were strongly dependent on the HMBC test.

16 107739

The structures deduced from the data in Table 4 were L-rhamnoyl-s-rhodomycinone (1) and L-daunosaminyl-s-rhodomycinone (2) shown in Figure 4.

Although these constructs were not novel, the production of hybrid products of the genes involved in the glycosylation moiety of aclasinomycin biosynthesis demonstrates well that the pSgs4 genes are functional and ready to be used in drug discovery to find new molecules.

10 Deposited Microbes

The following microbes were deposited according to the Budapest Treaty into the Deutsche Sammlung von Mikroorganism und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, D-38124 Braunschweig, Germany.

15

Microbe Deposit Number Record Date S. lividans TK24 / pSgs4 DSM 12998 August 12, 1999 E. coli XLlBlueMRF7pSgc5 DSM 12999 August 12, 1999 20 1 · · · · 1 • «· ♦ 1 ♦ ♦ 1 1 ♦ ♦ ♦ 1 • 1 • t t ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 17

Table 4. Ή and 13C Ceramic Transitions for Compounds 1 (DMSOd6) and 2 (small amount of TFA in DMSOd6) at 400 and 100 MHz measurements.

~ 1 2

Position 1H liC 1Η UC

~ T ..... 7.74, 1H, dd, 7.5, 0.9 118.9 (d) 7.74, 1H, dd, 7.5, 1.0 119.7 (d) 2 7.64, 1H, dd, 8.4,7.5 136.5 (d) 7.68, 1H, dd, 8.1,7.5 137.4 (d) 2__7.22, 1H, dd, 8.4, 0.9 124.1 (d) 7.24, 1H, dd, 8.1, 1.0 125.0 (d) 4__161.8 (s) 162 162.6 (s) 4-OH 12.00, 1H, s __-__ exchange widened _ 4a__115.2 (3) __ 115.9 (s) _5 __: __ 189.9 (s) 190.6 (s) 5a__110.4 (s) __ 11 l, 4 (s) _6 __ ^ __ 156.2 (s) __ 157 , 2 (s) δ-OH 13.41, 1H, s___extrapably broadened 6a__135, l (s) 135 135.7 (s) δ 5.14, 1H, d, 4.5__70.9 (d) 5.15, 1H, d, 3.6__71.3 (d) 8A 2.31, 1H, d, 15.1_28.9 (t) 2.33, 1H, d, 14.6__34.0 (t) 8B 2.14, 1H, dd, 15.1, 4.5 -__ 2.21, 1H, dd, 14.6, 3.8-_9 __-__ 70.0 (s) __ 70.9 (s) 10 4.16, 1H, s__51.2 (d) 4.23, 1H, s__51.8 (d) 10a__134.8 (s) __ 136.1 (s) 11 156.0 (s) __ 156.8 (s) 11-OH 12.77, 1 H, s widened by __-__ exchange _ 11a__110.8 (s) __ 11 l, l (s) 12 __185.4 (s) __ 186.0 (s) 12a__132.6 (s) __ 133.3 (s) 13A 1.73 , 1H, dg, 13.9, 7.4 31.7 (t) 1.83, 1H, dg, 14.1, 7.3 32.0 (t) 13B 1.38, 1H, dg, 13, 9, 7.4 -__ 1.47, 1H, dg, 14.1, 7.3-14 1.05, 3H, t, 7.4__6.09 ( g) 1.13, 3H, t, 7.3 - 6.90 (g) *: Y 15 - 170.4 (s) - 171; 1 (s) 16 3.63, 3H, s - 51.7 (g) 3, 70, 3H, s__52.3 (g) Γ 5.28, 1H, brs__103.7 (d) 5.52, 1H, d, 3.1__100.7 (d) Λ »! 2 '3.83, 1H, d, 5.2 70.9 (d) 2.18.2H, m_27.1 (t) 3' 3.44, 1H, dd, 9.0, 5.2 70 , Δ (d) 3.40, 1H, dd, 11.8, 5.1 55.5 (d) 4 ′ 3.41, 1H, dd, 9.1, 9.0 72.0 (d) 3 , 98, 1H, brs__67.0 (d) 5 '3.77, 1H, dg, 9.1, 6.2 68.9 (d) 4.21, 1H, g, 6.3 65.3 (d) ) 6 ′ 1.29.3H, d, 6.2 16.9 (g) 1.32.3H, t, 6.3 16.7 (g)? · · · • • ♦ • • · · · • 1 • «• ♦ · · · · • · • · • ·» · · • · 18 107 739

References

Bibb, M.J., Janssen, G.R. and Ward, J.M. 1985. Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE) of Streptomyces erythraeus, Gene 5 38: 215-226.

El Khamed, H.S., Swartz, D.L. and Cermak, R.C. 1977. Synthesis of ε-rhodomycinone glycosides. J Med Chem 20: 957–960.

10 Essery, J.M. and Doyle, T.W. 1980. The Synthesis of daunosaminyl-s-rhodomycinone, daunosaminyl-10-epi-s-rhodomycinone, daunosaminyl-e-pyrromycinone and 10-des-carbomethoxy-s-pyrromycin. Can J Chem 58: 1869-1874.

Hutchinson, C.R. and Fujii, I. 1995. Polyketide Synthase Gene Manipulation: A Struc-15 Ture-Function Approach in Engineering Novel Antibiotics. Annu Rev Microbiol 49: 201-238.

Kunnari, T., Tuikkanen, J., Hautala, A., Hakala, J., Ylihonko, K. and Mäntsälä, P.

1997. Isolation and characterization of 8-demethoxy steffimycins and generation of 2,8-20 demethoxy steffimycins in Streptomyces steffisburgensis by the nogalamycin biosynthesis genes. J Antibiot 50: 496–501.

Madduri, K., Kennedy, J., Rivola, G., Inventi-Solari, A., Filippini, S., Zanuso, G., Colombo, A.L., Gewain, K.M., Occi, J.L., MacNeil, D.J. and Hutchinson, C.R. 1998. 25 Production of the antitumor drug Epirubicin (4Q-epidoxorubicin) and its precursor by a genetically engineered strain of Streptomycespeucetius. Nature Biotech 16: 69-74.

Niemi, J., Ylihonko, K., Hakala, J., Kopio, A., Pärssinen, R. and Mäntsälä, P. 1994. Microbiol 140: 1351-1358.

• · · · ··· ·

Oki, T., Matsuzawa, Y., Yoshimoto, A., Numata, K., Kitamura, L, Hori, S., Taka-Matsu, A., Umezawa, H., Ishizuka, M., Naganawa, H. , Suda, H., Hamada, M. and Takeuchi, T. 1975. New Antitumor Antibiotics, Aclacinomycins A and B. J Antibiot 28: 35830-834.

Strohl, W. R., Dickens, M. L., Rajgarhia, V. B., W'oo, A. J. and Priestley, N. D. 1997

Anthracyclines in Biotechnology of Antibiotics, ed. Strohl, W. R. Marcel Dekker Inc., New York. pp. 577-657.

40 ”**! Strohl, W.R., Bartel, P.L. Li, Y., Connors, N.C. and Woodman, R.H. 1991. Express-

. * · *. ion of polyketide biosynthesis and regulatory genes in heterologous streptomycetes. J

Ind Microbiol 7: 3: 163-174.

• · · • · · · · '·· *. 45 Tsukamoto, N., Fujii, I., Ebizuka, Y. and Sankawa, U. 1994. Nucleotide sequence of

'· · ·' The aknk region of the aclavinone biosynthetic gene cluster of Streptomyces galilaeus. J

Bacteriol 176: 2473-2475.

• · · «·:. * ·· Ward, J. M., Janssen, G. R., Kieser, T., Bibb, M. J., Buttner, M. J. and Bibb, M. J..

50 1986. Construction and characterization of a series of multicopy promoter-probe plas- 19 107739 mid vectors for Streptomyces using the aminoglycoside phosphotransferase from Tn5 as indicator. Mol Gen Genet 203: 468–478.

Wright, F. and Bibb, M. J. 1992. Codon usage in the G + C-rich Streptomyces genome.

5 Gene 113: 55-65.

Ylihonko K., Hakala J., Kunnari T. and Mäntsälä P. 1996a. Production of hybrid anthracycline Antibiotics by heterologous expression of Streptomyces nogalater nogala-mycin biosynthesis genes. Microbiol 142: 1965-1972.

10

Ylihonko, K., Tuikkanen, J., Jussila, S., Cong, L. and Mäntsälä, P. 1996b. A gene cluster involved in nogalamycin biosynthesis from Streptomyces nogalater. sequence analysis and complementation of early-block mutations in the anthracycline pathway. Mol Gen Genet 251: 113-120.

15

Ylihonko, K., Hakala, J., Niemi, J., Lundell, J. and Mäntsälä, P. 1994. Isolation and characterization of aclacinomycin A-non-producing Streptomyces galilaeus (ATCC 31615) Mutant. Microbiol 140: 1359-1365.

• • • • • • • • • • • • • ••••••••••••••••••••••••••••••••••••••• a · • · · · ··· · · · · · · · · · · · · · · · · · · · · · · · · · ···

• B

• · B

• · · • · B ♦ ♦ ♦ • · · «· 107739 20

SEQUENCE LISTING

<110> Galilaeus Oy <120> The gene cluster involved in the biosynthesis of aclacinomycin and its use for Genetic Engineering <130> 31344 <140> <141> <160> 16 <170> Patent Ver. 2.2

<210> 1 <211> 662 <212> PRT

<213> Streptomyces galilaeus <400> 1

Met Thr Glu Asp Arg Val Thr Thu Leu Gly Gly Glu Gin lie Ala Leu 15 10 15

Leu Ala Pro Leu Leu Asp Gly Ser Arg Asp Leu Pro Gly lie Val Ala 20 25 30

Asp Area Area Pro Arg Leu Pro Area Gly Leu Area Glu Arg Leu Val Thr 35 40 45

Arg Leu Leu Asp Ala Gly Leu Leu Cys Ala Tyr Pro Gin Asp Gly Ala 50 55 60

Asp Arg Pro Glu Arg Ala Tyr Arg Ser Leu Thr Gly Leu Gin Ala Arg 65 70 75 80. Ser Ala Asp Ala Arg Asp Ala Val Leu Ala Val Ala Val Asp Leu Thr Gly 85 90 95 • · · »:: Asp Ala Glu Ser Pro Leu Pro Glu Ala Val Ser Ala Ala Gly Leu Arg ll 100 105 110 • · • · **. · Ala Ala Ala Pro Gly Glu His Ala Ala Leu Thr Leu Val Leu Cys His: ·: 115 120 125 • · ··· ϊ:: Asp Tyr Leu Asp Pro Arg Leu Ser Ala Leu Asp Ala Glu His Arg Ala ’. .. 130 135 140 ♦ ♦ · • · ·

Thr Gly Arg Gly Trp Leu Pro Val Arg Ala Asn Gly Thr His Leu Trp 145 150 155 160 • * ί ** ϊ Ile Gly Pro Phe Phe Ser Ala Gly Asp Gly Pro Cys Trp Ser Cys Leu ... 165 170 175 •.

* 1 * Ala Asp Arg Leu Arg Leu Arg Arg Arg Gly Glu Ala Tyr Val Gin His 180 185 190 ♦ · • ♦

Arg Leu Gly His Ser Gly Pro Ala Val His Arg Arg Ala Tyr Leu Pro * · * · * 195 200 205 • · ϊ:: Ala Gly Arg Ala Ala Leu Gin Leu Ala Leu Glu Ala Gly Lys'. *. 210 215 220 ...

...

Trp Leu Ser Gly His Arg Asp Thr Val Gin Asp Ser Leu Trp Arg Leu 225 230 235 240 107739 21

Asp Thr Arg Thr Leu Glu Ser Ser Arg His Pro Or Arg Arg Arg Pro 245 250 255

Gin Cys Ser Arg Cys Gly Asp Pro Leu Leu Vai Arg Asp Arg Vai Ser 260 265 270

Ala Pro Can Or Leu Ser Ser Arg Pro Or Ar Asp Glu Ser Gly Gly 275 280 285

Gly His Arg Thr Phe Gly Pro Gin Glu Met Leu Asp Arg Tyr Gly His 290 295 300

Leu Or Asp Pro Or Thr Gly Or Or Gly Glu lie Arg Arg Asp Pro 305 310 315 320

Arg Gly Pro Glu Phe Leu Asn Cys Phe Thr Arg Ser Arg Cys Arg Leu 325 330 335

Gly Pro Arg Area Lower Pro Pro Area Leu His Ser Pro Leu Arg Ser Pro 340 345 350

Gly Ser Gly Lys Gly Vai Thr Glu Leu His Ala Arg Vai Ser Ala Leu 355 360 365

Ala Glu Ala Leu Glu Arg Cys Ser Gly Tyr Phe Gin Gly Asp Glu Pro 370 375 380

Arg Arg Arg Gly Ser Tyr Arg Glu Leu Ala Gly Leu Ala Vai His Pro 385 390 395 400

Asp Ser Vai Gin Leu Phe Asp Arg Arg Gin Phe Glu Asp Arg Arg Ala 405 410 415

Trp Asn Arg Lower His Gly Pro Phe His Gin Vai Thr Glu Pro Phe Asp 420 425 430

Glu Asp Ala Pro Ile Asp Trp Thr Pro Vai Trp Ser Leu Thr Glu Arg 435 440 445. :: Arg Gin Arg Leu Ala Pro Thr Ser Leu Leu Tyr Tyr Asn Ala Pro Asp ~ Y 450 455 460 • · · • · ·

Ala Asp Thr Gly Phe Cys Arg Ala Thr Ser Asn Gly Ala Ala Ala Gly:: 465 470 475 480 • · ϊ *.! Thr Ser Leu Glu Asp Ala Vai Vai His Gly Cys Leu Glu Leu Vai Glu 485 490 495 • · ♦ • * ♦

Arg Asp Ala lie Ala Leu Trp Trp Tyr Asn Arg Thr Arg Gin Pro Gly: 500 505 510

Thr Leu Asp Area Arg Asp Pro Trp Ile Thr Arg Leu Arg Area Ar. 515 520 525 ♦ · ... Leu Arg Asp Leu Gly Arg Thr Vai Trp Ala Leu Asp Leu Thr Ser Asp 'ί 530 535 540 • · · ί *. *. Leu Gly Ile Pro Vai Vai Ala Ala Vai Ser Vai Arg Thr Gly Gly Thr • · '545 550 555 560 e · · • · * ···' Ala Glu Asp Ile Vai Leu Gly Phe Gly Ala His Phe Asp Pro Arg Ile 565 570 575 • · · • ♦ ♦! *. Ala Leu Arg Arg Ala Leu Thr Glu Leu Ser Gin Met Leu Pro Pro Leu: ·: 580 585 590 • · 107739 22

Ala Gin Glu Thr Ala Gly Asp Ala Ser Ala Tyr Thr Gly Thr Asp Pro 595 600 605

Glu Ala Met Arg Trp Phe Arg His Ala Thr Thr Ala Asn Gin Pro Tyr 610 615 620

Leu Leu Pro Area Area Arg Ser Ser Area Area Pro Pro Area Area Le Le Arg 625 630 635 640

Pro Pro Arg Asp Area Area Area Gin Area Area Gly Area Area Leu Area Area Area Leu Leu 645 650 655

Arg Arg His Gly Leu Glu 660

<210> 2 <211> 272 <212> PRT

<213> Streptomyces ga.llla.eus <400> 2

Will Asp Ile Trp Leu Leu Gly Pro Leu Thr Ala Glu Will Arg Gly Arg 15 10 15

Ser Ile Vai Pro Thr Bottom Lys Pro Arg Gin Ile Leu Bottom Leu Leu 20 25 30

Ala Ile His Ala Asn Arg Or Leu Pro Or Gly Thr Leu Met Glu Glu 35 40 45

Ile Trp Gly Thr Glu Pro Pro Gin Ser Ala Leu Ala Thr Leu His Thr 50 55 60

Tyr Ile Leu Gin Leu Arg Arg Arg Leu Thr Ala Ala Tyr Gly Asp Glu 65 70 75 80, Gly Gly Vai Ser Ala Lys Asp Vai Leu Vai Thr Gin Tyr Gly Gly Tyr. : 85 90 95 ··· · • · t ΐ: Cys Trp Gin Ala Pro Thr Asp Ser Vai Asp Vai Pro Arg Tyr Glu Arg I. * 100 105 110 • · • ·! **, - · Leu Vai Thr Ala Gly Arg Ile Ala Thr Ala Glu Asp Arg Gin Glu Glu: ns i2o 125 • · • · · • ii Ala Ser Ala His Phe Arg Glu Ala Leu Ala Leu Trp Arg Gly Ser Ala 130 135 140 • · · • · *

Leu Or Asp Or Arg Ile Gly Pro Or Leu Ser Ile Glu Or Ala Arg 145 150 155 160 • ”**! Leu Glu Glu Ser Arg Leu Gly Vai Leu Glu Arg Cys Leu Glu Ala Asp ... 165 170 175 • ·. Leu Arg Leu Gly Arg His Ala Glu Leu Leu Ala Glu Leu Thr Glu Leu: ·. ·, 180 185 190 • · • ·. ***. Thr Gly Arg His Pro Leu His Glu Gly Leu His Ala Gin Cys Met Thr * ··· '195 200 205 • ♦ ί! i Ala Leu Tyr Arg Ala Gly Arg Ser Trp Gin Ala Leu Asp Vai Tyr Gin. ' *. 210 215 220 * * * • · ·

Arg Leu Arg Arg Arg Leu Area Glu Glu Leu Gly Leu Ser Pro Ser Pro 225 230 235 240 107739 23

Arg Leu Gin Arg Leu Gin Gin Ala Val Leu Ser Ala Glu Pro Trp Leu 245 250 255

Asp Ala Pro Arg Tyr Gly Gly Asp Pro Val Phe Asp Arg Met lie Ser 260 265 270

<210> 3 <211> 434 <212> PRT

<213> Streptomyces galilaeus <400> 3

Met Thr Ser Asp Thr Lys Ala Leu Val Leu Glu Gin Val Arg Glu Tyr 1 5 10 15

His Arg Gin Gin Gin Pro Gly Asn Phe Gin Pro Gly Val Thr Pro lie 20 25 30

Leu Ser Ser Gly Ala Val Leu Asp Glu Glu Asp Arg Val Ala Leu Val 35 40 45

Glu Ala Ala Leu Asp Leu Arg lie Ala Ala Gly Ala His Ser Arg Arg 50 55 60

Phe Glu Ser Lys Phe Ala Arg His lie Gly Val Arg Lys Ala His Leu 65 70 75 80

Val Asn Ser Gly Ser Ser Ala Asn Leu Leu Ala Leu Ser Ala Leu Thr 85 90 95

Ser Pro Arg Leu Gly Glu Gin Arg Leu Arg Pro Gly Asp Glu Val lie 100 105 110. Thr Val Ala Gly Gly Phe Pro Thr Thr Val Asn Pro lie Leu Gin Asn. :: 115 120 125 • ΦΦ Φ • ·! ! ί Gly Leu Thr Pro Val Phe Val Asp Leu Glu Leu Gly Thr Tyr Asn Thr l.l 130 135 140 • Φ • Φ. .- Thr Val Glu His Val Arg Ala Ala lie Ser Asp Arg Thr Arg Ala lie V * i 145 150 155 160 • · · ·. * · Met lie Ala His Thr Leu Gly Asn Pro Tyr Gin Val Ala Glu lie Gin ... . 165 170 175 • · · • Φ ·

Gin Leu Ala Thr Glu His Glu Leu Phe Leu lie Glu Asp Asn Cys Asp 180 185 190 • * · ** · Ala Val Gly Ser Thr Tyr Gin Gly Arg Met Thr Gly Thr Phe Gly Asp ... 195 200 205 • Φ • Φ ·. * Leu Ala Thr Val Ser Phe Tyr Pro Ala His His lie Thr Thr Gly Glu ί *. *. 210 215 220 • · • Φ j * “j Gly Gly Cys Val Leu Thr Arg Asn Leu Glu Leu Ala Arg lie Val Glu - * ··· * 225 230 235 240 • · ·. ·! Ser Phe Arg Asp Trp Gly Arg Asp Cys Trp Cys Glu Pro Gly Glu Asp. . 245 250 255 • Φ Φ • Φ Φ Φ Φ

Asn Thr Cys Leu Lys Arg Phe Asp Tyr Gin Leu Gly Asn Leu Pro Lys 260 265 270 107739 24

Gly Tyr Asp His Lys Tyr lie Phe Ser His lie Gly Tyr Asn Leu Lys 275 280 285

Ala Thr Asp Leu Gin Gly Ala Leu Ala Leu Ser Gin Leu Asn Lys Leu 290 295 300

Pro Glu Phe Gly Ala Ala Arg Arg Arg Asn Trp Gin Arg Leu Arg Asp 305 310 315 320

Gly Leu Ala Asp Val Pro Gly Leu Leu Leu Pro Thr Pro Gly 325 330 335

Ser Asp Pro Ser Trp Phe Gly Phe Val lie Thr Val Leu Pro Asp Ala 340 345 350

Thr Tyr Thr Arg Arg Asp Leu Val Ala Phe Leu Glu Glu Arg Arg lie 355 360 365

Gly Thr Arg Arg Leu Phe Gly Gly Asn Leu Thr Arg His Pro Ala Tyr 370 375 380

Leu Gly Thr Pro His Arg Val Ala Gly Asp Leu Arg Asn Ser Asp lie 385 390 395 400 lie Thr Glu Gin Ser Phe Trp lie Gly Val Tyr Pro Gly lie Thr Glu 405 410 415

Glu Met Thr Asp Tyr Met Arg Glu Ser lie Val Glu Phe Val Thr Lys 420 425 430

Asn Gly

<210> 4 <211> 329 <212> PRT

. <213> Streptomyces galilaeus TV <400> 4 ϊ ί Ϊ Met Pro Lys Asp Thr Pro Arg Pro Val Leu Arg lie Gly Val Leu Gly V 1 5 10 15 • · «· I **. - Cys Ala Asp lie Ala Val Arg Arg lie Leu Pro Ala lie Val Glu His: \ ί 20 25 30% t ··· • ϊ i Pro Ser Val Arg Leu Val Ala Leu Ser Ser Asp Gly Ala Arg Ala 1.. 35 40 45 • · · · · ·

Glu Arg Leu Ala Ala Arg Phe Gly Cys Ala Ala Val Thr Gly Tyr Lys 50 55 60 • ***** Ala Leu Leu Asp Arg Glu Asp lie Asn Ala Val Val Pro Leu Pro ... 65 70 75 80 • · ^ ♦ »Pro Gly Met His His Glu Trp Val Thr Glu Ala Leu Thr Ala Gly Lys ί *. '. 85 90 95 • »• a ***** His Val Leu Val Glu Lys Pro Leu Ser Thr Thr Tyr Ala Gin Ser Val ··· * 100 105 110 •« V · Asp Leu Val Ala Met Ala Gly Arg Leu Gly Leu Ala Leu Thr Glu Asn. . 115 120 125 • · · * ♦ *

Phe Met Phe Leu His His Ser Gin His Glu Ala Val Arg Ala Met Thr 130 135 140 107739 25

Gly Glu Ile Gly Glu Leu Arg Vai Phe Thr Ser Ser Phe Gly Val Pro 145 150 155 160

Pro Pro His Pro Ser Ser Phe Arg His Asp Ala Arg Leu Gly Gly Gly 165 170 175

Ala Leu Leu Asp Val Gly Val Tyr Pro Leu Arg Ala Ala Gin Leu His 180 185 190

Leu Ala Gly Glu Leu Asp Val Leu Gly Ala Cys Leu Arg Val Asp Glu 195 200 205

Ala Thr Gly Val Asp Val Ala Gly Ser Ala Leu Leu Ser Thr Ala Thr 210 215 220

Gly Val Thr Ala Gin Leu Asp Phe Gly Phe Gin His Ala Tyr Arg Ser 225 230 235 240

Val Tyr Ala Leu Trp Gly Ser Arg Gly Arg Leu Ser Val Pro Arg Ala 245 250 255

Phe Thr Pro Pro Arg Glu His Arg Pro Val Val Arg lie Glu Gin Gin 260 265 270

Asp Arg Leu Thr Glu Val Thr Leu Pro Area Asp His Gin Val Gly Asn 275 280 285

Ala Leu Asp Ala Phe Ala Ser Ala Val His Ser Glu Thr Val Arg Ala 290 295 300

Ser Leu Gly Glu Ala Leu Leu Arg Gin Ala Leu Leu Val Glu Gin Val 305 310 315 320

Arg Lys Ala Ala Arg Val Val Ser Gly 325

<210> 5 <211> 323 <212> PRT

. <213> Streptomyces galllaeus ♦ 9 <400> 5; Met Arg Val Leu lie Thr Gly Gly Ala Gly Phe lie Gly Ser His Tyr I.! 15 10 15 »· •« ***. Val Arg Ser Leu Leu Ala Gly Thr Leu Pro Gly Pro Arg Pro Ser Arg: 20 25 30 • ·: ί: Val Thr Val Val Asp Leu Leu Thr Tyr Ala Gly Asp Thr Gly Asn Leu 35 40 45 • ♦ · • · ·

Pro Leu Ala Asp Pro Arg Leu Asp Phe Arg Arg Leu Asp lie Arg Asp 50 55 60 • - * i ** J Leu Asp Ala Leu Leu Thr Val Val Pro Gly His Asp Ala Val Val His ... 65 70 75 80 • · *: * Phe Ala Ala Glu Thr His Val Asp Arg Ser Leu Ser Glu Pro Ala Glu: *. ·. 85 90 95 • · • ·. * · *. Phe Val Arg Thr Asn Val Leu Gly Thr Gin Ser Leu Leu Glu Ala Ser * ... * 100 105 110 * III Leu Arg Gly Gly Val Gly Thr Phe Val His Val Ser Thr Asp Glu Val 115 120 125 • · · • · · • · 107739 26

Tyr Gly Ser lie Ala Gin Gly Thr Trp Thr Glu Glu Ala Pro Leu Leu 130 135 140

Pro Asn Ser Pro Tyr Ala Ala Ser Lys Ala Gly Ser Asp Leu Val Ala 145 150 155 160

Arg Ser Tyr Trp Arg Thr His Gly Leu Asp Val Arg Thr Thr Arg Cys 165 170 175

Ala Asn Asn Tyr Gly Pro Arg Gin His Pro Glu Lys Leu lie Pro Leu 180 185 190

Phe Val Thr Glu Leu Leu Ala Gly Arg Pro Val Pro Leu Tyr Gly Asp 195 200 205

Gly Gly Asn Val Arg Glu Trp Leu His Val Asp Asp His Cys Arg Ala 210 215 '220

Val His Ala Val Leu Thr Gly Gly Arg Pro Gly Glu lie Tyr Asn lie 225 230 235 240

Gly Gly Gly Thr His Leu Thr Asn Arg Glu Met Thr Ala Lys Leu Leu 245 250 255

Ala Leu Cys Gly Thr Asp Trp Ser Arg Val Arg Gin Val Pro Asp Arg 260 265 270

Lys Gly His Asp Leu Arg Tyr Ala Val Asp Asp Thr Lys lie Arg Glu 275 280 285

Glu Leu Gly Tyr Arg Pro Leu Arg Ser Leu Asp Asp Gly Leu Arg Glu 290 295 300

Val Val Asp Trp Tyr Arg Asp Arg Gin Thr His Arg Pro Glu Pro Ala 305 310 315 320

Glu Arg Val. <210> 6 · <211> 443

IV <212> PRT

V. * <213> Streptomyces galilaeus • · · V.: <400> 6 •. Met Arg Val Leu Leu Thr Ser Phe Ala Leu Asp Ala His Phe Asn Gly ·. * ·; 15 10 15 • · · ·. · · Ser Val Pro Leu Ala Trp Ala Leu Arg Ala Ala Gly His Glu Val Arg ... 20 25 30 • · ♦ • · ·

Val Ala Ser Gin Pro Ala Leu Thr Ala Ser lie Thr Ala Ala Gly Leu 35 40 45 • * · ** · Thr Ala Val Pro Val Gly Ala Asp Pro Arg Leu Asp Glu Met Val Lys ··· 50 55 60 • · • · · • Gly Val Gly Asp Ala Val Leu Ser His His Ala Asp Gin Ser Leu Asp 65 70 75 80 • ·

Ala Asp Thr Pro Gly Gin Leu Thr Pro Ala Phe Leu Gin Gly Trp Asp 85 90 95 • · ·. ·. * Thr Met Met Thr Ala Thr Phe Tyr Thr Leu lie Asn Asp Asp Pro Met •. 100 105 110 «· · • · * • · 107739 27

Will Asp Asp Leu Will Ala Phe Ala Arg Gly Trp Glu Pro Asp Leu Ile 115 120 125

Leu Trp Glu Pro Phe Thr Phe Ala Gly Ala Vai Ala Ala Lys Vai Thr 130 135 140

Gly Ala Ala His Ala Arg Leu Leu Ser Phe Pro Asp Leu Phe Met Ser 145 150 155 160

Met Arg Arg Ala Tyr Leu Ala Gin Leu Gla Ala Pro Ala Gly Pro 165 170 175

Ala Gly Gly Asn Gly Thr Thr His Pro Asp Asp Ser Leu Gly Gin Trp 180 185 190

Leu Glu Trp Thr Leu Gly Arg Tyr Gly Vai Pro Phe Asp Glu Glu Ala 195 200 205

Is Thr Gly Gin Trp Ser Or Asp Gin Is Pro Arg Ser Phe Arg Pro 210 215 220

Pro Ser Asp Arg Pro Or Or Gly Met Arg Tyr Or Pro Tyr Asn Gly 225 230 235 240

Pro Gly Pro Ala Vai Or Pro Asp Trp Leu Arg Or Pro Pro Thr Arg 245 250 255

Pro Arg Vai Cys Or Thr Leu Gly Met Thr Ala Arg Thr Ser Glu Phe 260 265 270

Pro Asn Area Or Pro Or Asp Leu Or Leu Lys Area Or Glu Gly Leu 275 280 285

Asp Ile Glu Is Is Ala Thr Leu Asp Ala Glu Glu Arg Ala Leu Leu 290 295 300

Thr His Vai Pro Asp Asn Is Arg Leu Is Asp His Vai Pro Leu His 305 310 315 320

Ala Leu Leu Pro Thr Cys Ala Ala Ile Vai His His Gly Gly Ala Gly 325 330 335 •;, · 1 Thr Trp Ser Thr Ala Leu Vai Glu Gly Vai Pro Gin Ile Ala Met Gly 340 345 350 • · «• · ·. .. Trp Ile Trp Asp Ala Ile Asp Arg Ala Gin Arg Gin Gin Ala Leu Gly 355 360 365 • · · .1 ·· Ala Gly Leu His Leu Pro Ser His Glu Vai Thr Vai Glu Gly Leu Arg 370 375 380 »» « • # 1j «Gly Arg Leu Vai Arg Leu Leu Asp Glu Pro Ser Phe Thr Ala Ala Ala: 385 390 395 400

Ala Arg Leu Arg Ala Glu Ala Glu Ser Glu Pro Thr Pro Ala Gin Vai 405 410 415 • ·, ···, Ara Arg Leu Thr Ala Gin His Arg Ala Arg Glu Pro ... 1,420,425,430: 1 · 1; Arg Arg Pro Gly Gly Thr Ser Pro Cys Vai Ser 435 440 • • • • • • • · · · · · · 107739 28

<210> 7 <211> 443 <212> PRT

<213> Streptomyces galllaeus <400> 7

Val Gin Thr Gin Asn Ala Pro Glu Thr Ala Glu Asn Gin Gin Thr Asp 15 10 15

Ser Glu Leu Gly Arg His Leu Leu Thr Ala Arg Gly Phe His Trp lie 20 25 30

Tyr Gly Thr Ser Gly Asp Pro Tyr Ala Leu Thr Leu Arg Ala Glu Ser 35 40 45

Asp Asp Pro Ala Leu Leu Thr Arg lie Arg Glu Ala Gly Thr Pro 50 55 60

Leu Trp Gin Ser Thr Thr Gly Lower Trp Val Thr Gly Arg His Gly Val 65 70 75 80

Area Area Glu Area Leu Area Asp Pro Arg Leu Area Leu Arg His Area Asp 85 90 95

Leu Pro Gly Pro Gin Arg His Val Phe Ser Asp Ala Trp Ser Asn Pro 100 105 110

Gin Leu Cys His lie lie Pro Leu Asp Arg Phe Leu His Ala Ser 115 120 125

Asp Ala Asp His Thr Arg Trp Ala Arg Ser Ala Ser Ala Val Leu Gly 130 135 140

Ser Ala Gly Gly Ala Pro Ala Glu Gly Val Arg Glu His Ala Gly Arg 145 150 155 160

Val His Arg Glu Ala Ala Asp Arg Thr Gly Asp Ser Phe Asp Leu Met 165 170 175

Ala Asp Tyr Ser Arg Pro Val Ala Thr Glu Ala Ala Ala Glu Leu Leu 180 185 190. :: Gly Val Pro Ala Ala Gin Arg Glu Arg Phe Ala Thr Cys Leu Ala 'I *. * 195 200 205 • # «• 0 ·

Leu Gly Val Ala Leu Asp Ala Ala Leu Cys Pro Gin Pro Leu Ala Val I: 210 215 220 • · ·: Thr Arg Arg Leu Thr Glu Ala Val Glu Asp Val Arg Ala Leu Val Gly I .. * 225 230 235 240 • · · • · «

Asp Leu Val Glu Ala Arg Arg Thr Gin Pro Gly Asp Asp Leu Leu Ser:.:: 245 250 255

Ala Val Leu His Ala Gly Ser Ser Ala Ala Ser Ala Gly Gin Asp Ala. 260 265 270 • · ... Leu Ala Val Gly Val Leu Thr Ala Val Val Gly Val Glu Val Thr Ala •: 275 280 285 «·· I *. *. Gly Leu lie Asn Asn Thr Leu Glu Ser Leu Leu Thr Arg Pro Val Gin I. * 290 295 300 • · · ♦ · *. ·· * Trp Ala Arg Leu Gly Glu Asn Pro Glu Leu Ala Gly Ala Val Glu 305 310 315 320 • · · · · · · · · 107739 29

Glu Ala Leu Arg Phe Ala Pro Pro Val Arg Leu Glu Ser Arg lie Ala 325 330 335

Ala Glu Asp Leu Thr Leu Gly Gly Gin Asp Leu Pro Ala Gly Ala Gin 340 345 350

Val Val Val His Val Gly Ala Ala Asn Arg Asp Pro Glu Ala Phe Leu 355 360 365

Ala Pro Asp His Phe Asp Leu Asp Arg Pro Ala Gly Gin Gly Gin Leu 370 375 380

Ser Leu Ser Gly Pro His Thr Ala Leu Phe Gly Ala Phe Ala Arg Leu 385 390 395 400

Gin Ala Glu Thr Ala Val Arg Thr Leu Arg Glu Arg Arg Pro Val Leu 405 410 415

Ala Pro Ala Gly Ala Val Leu Arg Ar Met Met Pro Ser Le Val Leu Gly 420 425 430

Ala Val Leu Arg Phe Pro Leu Thr Thr Ser Ala 435,440

<210> 8 <211> 267 <212> PRT

<213> Streptomyces ga.lila.eus <400> 8

Val Asn Arg Ala Ala Arg Pro Thr Val Arg Gly Met Ser Ala lie Ala 15 10 15

Glu Pro Thr Ala Pro Arg Gly Val He Val Thr Gly Gly Gly Thr Gly 20 25 30

He Gly Arg Ala Thr Ala His Ala Phe Ala Asp Arg Gly Asp Arg Val 35 40 45. Leu Val Val Gly Arg Thr Ala Ala Thr Leu Ala Gly Thr Ala Glu Gly. :: 50 55 60 ♦ ♦ · ♦ • ·::: - His Pro Gly He Ser Val Leu Thr Ala Asp Leu Thr Asp Pro Asp Gly 1 / . 65 70 75 80 • · • · I **. Pro Arg Ala He Thr Asp Ala Ala Leu Asp Ala Leu Gly Arg He Asp: 85 90 95 • «··· •:: Val Leu Val Asn Asla Ala Thr Gly Gly Phe Ala Gly Leu Ala Glu 1 .. 100 105 110 • · · • · ·

Thr Glu Pro Glu Ala Ala Ala Arg Glu Gin Phe Asp Ser Asn Leu Leu Ala 115 120 125 • · ****: Pro Leu Leu Leu Thr Arg Gin Thr Leu Asp Ala Leu Ser Ala Asp Gly ... 130 135 140 • ·

Gly Gly Thr Val Leu Asn lie Gly Ser Ala Gly Ala Leu Gly Arg Arg: *. *. 145 150 155 160 • · • ·. ***. Ala Trp Pro Gin Asn Gly Val Tyr Gly Ala Ala Lys Ala Gly Leu Asp * ·. «* 165 170 175 ♦«:::: Phe Leu Thr Arg Thr Trp Ala Val Glu Leu Ala Pro Arg Gly He Arg * \ 180 185 190 • * ♦ ♦ ·· • · 107739 30

Vai Leu Gly Leu Ala Pro Gly Vai Ile Asp Thr Gly Ile Gly Glu Arg 195 200 205

Ser Gly Met Ser Arg Glu Ala Tyr Ala Gly Phe Leu Gly Gin Ile Ala 210 215 220

Ala Arg Vai Pro Ala Gly Arg Vai Gly Arg Pro Glu Asp Ile Ala Trp 225 230 235 240

Trp Ala Will Gin Leu Ala Asp Pro Arg Ala Ala Tyr Ala Thr Gly Ala 245 250 255

Vai Leu Ala Vai Asp Gly Gly Leu Ser Leu Thr 260 265

<210> 9 <211> 144 <212> PRT

<213> Streptomyces galilaeus <400> 9

Met Thr Ala Gin Ala Pro Thr Ala Gla Ala Asp Vai Tyr Ala Glu Vai 15 10 15

Gin His Phe Tyr Ala Arg Gin Met Arg Tyr Leu Asp Ser Gly Glu Ala 20 25 30

Glu Thr Trp Ala Gly Thr Phe Thr Glu Asp Gly Ser Phe Ala Pro Pro 35 40 45

Ser Leu Pro Glu Pro Or Ar Gly Arg Pro Leu Leu Area Glu Gly Area 50 55 60

Arg Asn Area Area Area Gly Leu Area Area Area Arg Glu Thr His Arg His 65 70 75 80

Trp Vai Gly Met Leu Thr Vai Thr Pro Ala Asp Asp Gly Ser Leu Thr 85 90 95. Ala Glu Ser Leu Vai Ser Ile Vai Ala Vai Ala Gin Gly Gly Pro Ala. :: loo 105 no ··· · • · ii! · Arg Leu His Leu Vai Cys Thr Cys Arg Asp Vai Leu Vai Arg Glu Gly 115 120 125 • · • ·. . Gly Arg Leu Leu Do Arg Glu Arg Do Do Thr Arg Asp Asp Arg Pro Σ * .J 130 135 140 • · 107739 31

Ala Glu Leu Pro Glu Gly Glu Phe Leu Ser Leu Asp Arg Leu Gin Leu 50 55 60

Thr Thr His Thr Gly Thr His Vai Asp Ala Pro Ser His Tyr Gly Thr 65 70 75 80

Arg Ala Ala Tyr Arg Asp Gly Pro Pro Arg His Ile Asp Glu Met Pro 85 90 95

Leu Asp Trp Phe Phe Arg Pro Area Or Or Leu Asp Leu Ser Asp Gin 100 105 110

Gly Thr Gly Ala Vai Gly Ala Asp Vai Leu Arg Arg Glu Met Asp Arg 115 120. 125

Ile Gly His Thr Pro Ser Pro Met Asp Ile Vai Leu Leu Arg Thr Gly 130 135 140

Ala Asp Ala Trp Ala Gly Thr Pro Lys Tyr Phe Thr Asp Phe Thr Gly 145 150 155 160

Leu Asp Gly Ser Lower Or His Leu Leu Leu Asp Leu Gly Or Ar Ar 165 170 175

Ile Gly Thr Asp Ala Phe Ser Leu Asp Ala Pro Phe Gly Asp Ile Ile 180 185 190

Thr Arg Tyr Arg Ala Thr Gly Asp Pro Ser Vai Leu Trp Pro Ala His 195 200 205

Vai Ile Gly Arg Asp Arg Glu Tyr Cys Gin Vai Glu Arg Leu Ala Gly 210 215 220

Leu Asp Arg Leu Pro Area Area His Gly Phe Arg Area Area Cys Phe Pro 225 230 235 240

Vai Arg Ile Ala Gly Ala Gly Ala Gly Trp Thr Arg Ila Ala Ala Leu 245 250 255

Vai Asp Glu • ·:; γ <210> 11::: - <2ii> 238

<212> PRT

ί Ϊ <213> Streptomyces galilaeus <4oo> ii ϋ .. 'Met Tyr Gly Arg Glu Leu Ala Asp Or Tyr Glu Ala Ile Tyr Arg Ser::: 1 5 10 15 ··· ί ϊ Ϊ Arg Gly Lys Asp Trp Gly Gin Glu Ala Ala Asp Vai Ser Arg Ile Ile 20 25 30, Thr Glu Arg Arg Pro Gly Ala Gly Ser Leu Leu Asp Vai Ala Cys Gly »1: 2: 35 40 45 ··· ί Thr Gly Ala His Leu Ser Vai Phe Ser Thr Leu Phe Glu Vai Ala Glu T 50 55 60 • ·· · * ♦ · • · 1 Gly Leu Glu Ile Ala Glu Pro Met Arg Arg Leu Ala Glu Gin Arg Leu. ·· 1. 65 70 75 80 • ♦ • · ·

Pro Gly Thr Thr Vai His Ala Gly Asp Met Arg Asp Phe Arg Leu Pro: :: ss 90 95 • «♦ •« «e · 2 •» 107739 32

Arg Thr Tyr Asp Ala Val Ser Cys Met Phe Cys Ala lie Gly Tyr Leu 100 105 110

Glu 'Thr Leu Asp Asp Met Arg Area Ala Val Arg Ser Met Area Ala His 115 120 125

Leu Glu Pro Gly Gly Val Leu Val Val Glu Pro Trp Trp Phe Pro Glu 130 135 140

Asn Phe lie Glu Gly Tyr Val Ala Gly Asp Leu Ala Arg Glu Glu His 145 150 155 160

Arg Thr lie Ala Arg lie Ser His Thr Thr Arg Lys Gly Arg Ala Thr 165 170 175

Arg Met Glu Val Arg Phe Thr Val Gly Asp Ala Ala Gly lie Gin Gin 180 185 190

Phe Thr Glu lie Asp Val Leu Thr Leu Phe Thr Arg Asp Glu Tyr Thr 195 200 205

Ala Ala Phe Thr Asp Ala Gly Cys Ser Val Glu Phe Leu Glu Asp Gly 210 215 220

Pro Thr Gly Arg Gly Leu Phe Val Gly Val Arg Glu Gin Arg 225 230 235

<210> 12 <211> 291 <212> PRT

<213> Streptomyces galilaeus <400> 12

Met Lys Gly lie lie Leu Ala Gly Gly Ser Gly Thr Arg Leu His Pro 15 10 15 lie Thr Val Ser Val Ser Lys Gin Leu Leu Pro Val Gly Asp Lys Pro 20 25 30. Met lie Tyr Tyr Pro Leu Ser Val Leu Met Leu Ala Asp lie Arg Glu. :: 35 40 45 ··· · • ·

He Leu Leu lie Cys Thr Glu Arg Asp Leu Glu Gin Phe Arg Arg Leu 50 55 60 • · • · *** # Leu Gly Asp Gly Ser Gin Leu Gly Leu Arg lie Asp Tyr Ala Val Gin I ·: 65 70 75 80 • · «I»::! Asn Arg Pro Ala Gly Leu Ala Asp Ala Phe Val lie Gly Ala Asp His: .. 85 90 95 • · «• · ·

Val Gly Asp Asp Asp Val Ala Leu Val Leu Gly Asp Asn lie Phe His 100 105 110 *: **: Gly His His Phe Tyr Asp Leu Leu Gin Ser Asn Val His Asp Val Gin ... 115 120 125 «· * ' ! * Gly Cys Val Leu Phe Gly Tyr Pro Val Glu Asp Pro Glu Arg Tyr Gly 130 135 140 • »• ·, * ··, Val Gly Glu Thr Asp Ala Ser Gly Gin Leu Val Ser Leu Glu Glu Lys * .... * 145 150 155 160 • ·::: Pro Leu Arg Pro Arg Ser Asp Leu Ala lie Thr Gly Leu Tyr Leu Tyr; *. 165 170 175 • * · «·» • · 107739 33

Asp Asn Glu Is Or Asp Ile Area Lys Asn Leu Arg Pro Ser Pro Arg 180 185 190

Gly Glu Leu Glu Ile Thr Asp Or Asn Arg Asn Tyr Leu Ala Arg Gly 195 200 205

Arg Ala Arg Leu Is Asp Leu Gly Arg Gly Phe Ala Trp Leu Asp Ala 210 215 220

Gly Thr Pro Glu Ser Leu Leu Gin Lower Thr Gin Tyr Or Ar Thr Leu 225 230 235 240

Glu Glu Arg Gin Gly Or Arg Ile Ala Cys Or Glu Glu Or Ala Leu 245 250 255

Arg Met Gly Phe Ile Asp Ala Asp Met Cys His Arg Leu Gly Glu Gin 260 265 270

Met Ser Gin Ser Gly Tyr Gly Arg Tyr Or Met Ala Or Ala Arg Glu 275 280 285

Phe Ser Gly 290

<210> 13 <2U> 341 <212> PRT

<213> Streptomyces galilaeus <400> 13

Met Thr Thr Leu Or Trp Asp Tyr Leu Gin Glu Tyr Glu Asn Glu Arg 15 10 15

Ala Asp Ile Leu Asp Ala Vai Glu Thr Vai Phe Ser Ser Gly Arg Leu 20 25 30

Vai Leu Gly Asp Ser Vai Arg Gly Phe Glu Glu Glu Phe Ala Ala Tyr 35 40 45 107739 34

Asp Gly Gly Lower Or Do Thr Ser Arg Asp Asp Thr His Arg Lower Leu 195 200 205

Arg Arg Leu Arg Tyr Tyr Gly Met Glu Glu Arg Tyr Tyr Vai Vai Gly 210 215 220

Thr Pro Gly His Asn Ala Arg Leu Asp Glu Vai Gin Ala Glu Ile Leu 225 230 235 240

Arg Arg Lys Leu Arg Arg Leu Asp Thr Tyr Ile Glu Gly Arg Arg Ala 245 250 255

Vai Ala Arg Arg Tyr Glu Asp Gly Leu Gly Asp Thr Gly Leu Vai Leu 260 265 270

Pro His Thr Vai Pro Gly Asn Glu His Vai Tyr Tyr Vai Tyr Thr Vai 275 280 285

Arg His Pro Arg Arg Asp Asp Ile Ile Lys Ala Leu Lys Ala Tyr Asp 290 295 300

Ile Glu Leu Asn Ile Ser Tyr Pro Trp Pro Or His Thr Met Ser Gly 305 310 315 320

Phe Ala His Leu Gly Tyr Gly Lys Gly Ser Leu Pro Vai Thr Glu Asp 325 330 335

Leu Ala Gly Gin Ile 340

<210> 14 <211> 14806 <212> DNA

<213> Streptomyces galilaeus <400> 14 ctcgaggccg tgccggcgca gcagggcgac gagggccccg gcctgtgccg cggcgtcgcg 60 gggaggccgc agcgaggcag ggggccgggc ggaccggcgc gccgcgggca ggagatacgg 120 ctggtttgcc gtggtggcgt gccggaacca gcgcatggcc tcggggtccg tgccggtgta 180. ·. cgcggaggcg tcgccggccg tctcctgcgc caacggcggg agcatctggc tgagttcggt 240 ··· S gagagcccgg cgcagggcga tacgcggatc gaagtgcgcg ccgaagccca gcacgatgtc 300 ctcggcggtg ccgcccgtcc gcaccgacac ggcggcgacc acgggaatgc cgagatcgga 360 cgtgaggtcg agggcccaca ccgtcctgcc cagatcgcgc aggacggccc ggagccgcgt 420. * ··. gatccacgga tcccgcgcgt ccagggtcac gccgggctgg cgcgtgcggt tgtaccacca 480 cagggcgatc gcgtcccgtt ccacgagttc caggcagccg tgcacgacgg cgtcctccag 540 gctcgttccg gcggcggctc cgttggacgt ggcccggcag aagccagtgt ccgcgtccgg 600 * · * ί ggcgttgtag tagagcagac tcgtgggcgc gagccgctgc cgccgctcgg tcagtgacoa 660 gacgggggtc cagtcgatcg gggcgtcctc gtcgaagggc tcggtcacct ggtggaaggg 720 * · * * accgtgcgcg cggttccacg cccgccggtc ctcgaactgt ctgcggtcga agagctggac 780 gctgtccgga tgcacggcga gaccggccag ctcgcggtaa ctgccgcgcc ggcgcggttc 840 * · * 'gtcgccctgg aagtagccgc tgcaccgctc cagcgcctcg gccagcgcgc tgaccctggc 900 gtggagttcg gtgacgccct tgccggatcc cgggctgcgc agcggggagt ggagcgccgg 960 cggtgcagcg cggggtccca gacggcagcg cgaccgcgtg aagcagttga ggaactccgg 1020 tccgcgcgga tcccggcgga tctcgccgac aacgccggtg acggggtcca cgagatggcc 1080 gtagcggtcc agcatctcct gcggaccgaa cgtgcggtga ccaccgccgc tctcgtcccg 1140. ** *. caccggccgg gaggacagca ccacgggtgc cgagacccgg tcgcgtacca gcagcggatc 1200 · · · * gccgcagcgg gagcactgcg ggcggcgccg cacgggatgg cgactgctct ccagcgtgcg 1260 ggtgtccagg cgccagaggc tgtcctgcac cgtgtcgcgg tgtccggaga gccactttcc 1320 I * I ggcttccagc agggccagtt gcagggccgc ggcacgcccc gcgggcaggt aggcccgccg 1380 gtgcacggcc ggaccgctgt gccccagccg gtgctgcacg tacgcctcac cgcgccggcg 1440! 2 cagccggagc cggtccgcca gacagctcca gcaggggccg tcgccggcgg agaagaacgg 1500 * 1 * gccgatccac aggtgggtgc cgttggcccg gacgggcagc cagccgcgtc ccgtcgcgcg 1560 gtgctccgcg tccagggcac tcagccgcgg gtcgaggtag tcgtgacaga gcaccagggt 1620 *. ·. * Cagagcggcg tgctcgcccg gtgccgcggc gcgcagcccc gccgcggaca cggcctcggg 1680 2 cagcggggat tccgcgtcac cggtgaggtc gaccgcggcc aggaccgcgt cccgcgcgtc 1740 «♦ 107 739 35 ggcggaccgc gcctgaagac cggtgaggga ccggtaggcc cgttcggggc ggtcggcccc 1800 gtcctgggga taggcgcaca gcagtcccgc gtccagcagc cgggtcacga gccgctcggc 1860 gagtccggcc ggcagccggg gtgccgcgtc ggcgacgatg ccoggcagat cgcggctgcc 1920 gtcgagcagc ggggccagca gggcgatctg ctccccgccc agcgtggtca cccggtcctc 1980 ggtcatcagg tagacgggct ctcccggccg cgactcgacc cgcagatgcg gtgcgaaccc 2040 cagccggggg agcccgttgc caggggccgt acggctcatc gagacgcagg gccgccgacc 2100 gtggccgacg gggtgctgga aaggggagcc cagcagatac agatcgcgct gtccgcgtgc 2160 tccccgggac cgttgccgaa ctccgtgatg acgagatcgt cggcgaactc ggcggctgcc 2220 gcgtcacctt ccaggagggg cgtgatccgt gacatgtgtg c tccttgtcg ctgtcggccg 2280 gctgctgtga gtagtgctct ggccctggtt cgagctgtgc actgccgtca tccttacggc 2340 ccgtcagggc ggctgccagt gcgtctggca taccgtgcct atgaggttta cacatcttgc 2400 acatacgttc ctcatgtgcc tgttcgggtt cagggcactg gttgattgcc gaagtggcca 2460 gcaagactcc ctgagcatgg agctcttcgc ggtgctccgt cgaccagatg ggggagaaga 2520 acgtggacat atggttgctg ggaccgctga cggccgaggt gcggggcagg tcgatcgtgc 2580 ccaccgcggc gaaaccccga cagatcctcg ccctgctcgc catccacgcc aatcgcgtcc 2640 tgcccgtcgg gaccctgatg gaggagatct ggggcaccga gccgccccag agcgccctcg 2700 ccaccctgca cacgtacatc ctccagctgc gccgccggct gaccgctgcc tacggtgacg 2760 aggggggegt gtccgccaag gacgtcotcg tcacccagta cggcggctac tgctggcagg 2820 cgcccacgga ctccgtggac gtaccgogct acgaacggct cgtcaccgcc ggacggatcg 2880 ccaccgccga ggaccgccag gaggaggcgt cggcccactt. ccgtgaggca ctcgcgctct 2940 ggcgggggtc cgcgctggtg gacgtgcgga tcggaccggt cctgagcatc gaggtggcgc 3000 ggctggagga gagcaggctc ggcgtgctgg agcgctgcct ggaggcggac ctgaggctgg 3060 gacgccacgc ggagctgctg gccgaactca ccgaactcac cgggcgccat ccgctgcacg 3120 agggcctgca cgcccagtgc atgacggcgc tgtaccgggc gggcogctcc tggcaggcgc 3180 tggacgtcta ccagaggctg cgccgccggc tggcggagga actcggactc tccccgtcgc 3240 cgcgcctgca gcgtctgcag caggcggtgc tctcggcgga gccctggctg gacgcgccca 3300 ggtacggagg ggacccggtg ttcgaccgga tgatcagctg accgtcccgg cggctcagcc 3360 gttcttggtg acgaactcga cgatggactc ccgcatgtag tcggtcatct cctccgtgat 3420 gcccggatac accccgatcc agaagctctg ctcggtgatg atgtcggagt tgcgcagatc 3480 gcccgccacc cggtgcggcg tgccgaggta cgccggatgg cgggtgaggt tgccgccgaa 3540 cagccgccgt gtgccgatcc gccgttcctc caggaaggcg accaggtcac ggcgggtgta 3600 ggtggcgtcg ggcaggaccg tgatcacgaa cccgaaccag ctgggatcgc tgcccggtgt 3660 cgcgaccggc agcagcagac cggggacgtc ggcgagcccg tcccgcagcc gctgccagtt 3720 gcgccgccgg gccgcgccga actccggcag cttgttcaac tggctg agtg ccagcgcccc 3780 ttgcagatcg gtcgccttca ggttgtaacc gatgtgggag aagatgtact tgtggtcgta 3840 gcccttgggg agattaccca gctggtagtc gaaccgcttg aggcaggtgt tgtcctcgcc 3900 cggttcgcac cagcagtccc ggccccagtc gcggaacgac tcgacgatgc gggccagttc 3960 gaggttgcgg gtcagtacgc agcccccctc gcccgtggtg atgtggtggg caggatagaa 4020 actgaccgtt gccaggtccc cgaaggtccc cgtcatacgt ccctggtagg tcgagcccac 4080 cgcgtcgcag ttgtcctcga tcaggaacag ctcgtgctcg gtggccagtt gctggatctc 4140 cgccacctgg taggggttgc cgagggtgtg cgcgatcatg atggcccggg tccggtccga 4200 gatcgccgcc cgcacgtgct ccaccgttgt gttgtacgta ccgagttcca ggtccacgaa 4260 1.; ; cacgggcgtc agcccgttct ggaggatcgg gttcaccgtg gtggggaatc cgccggccac 4320 φ · · cgtgatcacc tcgtcacccg gacgcagccg ctgctcaccg agccggggag aggtcagcgc 4380 ·. ·. agagagcgcc agcaggttcg ccgaggaccc cgagttcacc aggtgcgcct tgcgtacgcc 4440. ··· gatgtggcgg gcgaatttgc tctcgaagcg ccgggagtgg gctccggccg cgatccgcag 4500 gccccggcc gaggatgggc gtcactccgg gctggaaatt ccctggctgc tgctgccggt gatactcgcg 4620 *. ·; aacctgctcc aggaccagag ccttggtgtc cgacgtcata gccgtccctc cgtaaggatt 4680, 'j ·, gcctcgccga ccatgctggc ccggatcggt cgaggagccg tggagtcccg gccgaaggcc 4740 · · · ctgctccagt gggcttcaag gggccttcga cctgccgtgg ctagcgtgtc cggcgacgca 4800 (·,.. · tcgaactggt gaggtggcag atgccgaagg acactccacg gcccgtactc cgcatcgggg 4860 * · * ttctgggctg tgccgatatc gcggtgcgcc ggatcctgcc cgcgatcgtg gagcatccgt 4920 cggtccggct ggtcgctctg gcgagccggg acggggcgcg cgccgaacgg ctcgcggccc 4980 gtttcggatg cgcggcggtg accggctaca aggcgctgct ggaccgtgag gacatcaacg 5040 ccgtctacgt tcccctgccg cccggcatgc accacgaatg ggtcaccgaa gcgctgacgg 5100 * · cgggcaagca cgtgctggtg gagaagccgc tcagcacgac gtacgcgcag agcgtcgacc 5160. ···. tggtggcgat ggccggccgg ctcggcctcg cgctcaccga gaacttcatg ttcctgcacc 5220 ... * actcgcagca cgaggcggtc cgggccatga ccggcgagat cggggaactg cgggtcttca 5280 ccagttcctt cggcgfcgccg ccgccccgg cctcgtcctt ccggcacgac gcgcggctcg 5340 · *; gcggcggcgc cggtgcccggccg ctg ggcgcctgtc tgcgcgtgga cgaggcgacc ggcgtcgacg 5460 :; tcgcgggaag cgcgctgctg tccacggcga cgggtgtgac cgcgcagctc gacttcggct 5520 * | * tccagcacgc gtaccggtcc gtgtacgcgc tgtggggcag ccgcggcagg ctgagcgtgc 5580 cgcgggcctt caccccgccc cgtgagcacc gcccggtggt ccgtatcgaa cagcaggacc 5640 * · · gtctcaccga agtgacgctg cccgccgatc accaggtggg caacgcgctc gacgcgttcg 5700 ·.... ; cctcggcggt gcactcggag accgtccgtg cctccctggg ggaggcgctg ctgcgtcagg 5760 • * · • * 107 739 36 cgctcctggt cgagcaggta cgcaaagccg cgcgggtcgt cagcggctga gccccccgga 5820 cgctttgcgg gcgcctgacg cccgcacgac gagagnnnnn nnnnnnnnnn nnnnngggct 5880 ctcctcacac tcctcgcggt cgcgccccgc cggggcggct cagacccgct cggccggttc 5940 cggccggtgg gtctgccggt cgcggtacca gtcgacgacc tcgcgcagac cgtcgtccag 6000 ggaccgcagc ggccggtagc cgagttcttc gcggatcttc gtgtcgtcca ccgcgtaccg 6060 caggtcgbgg cccttgcggt cgggcacctg gcggaccctg gaccagtcgg tgccgcacag 6120 cgcgagcagc ttggccgtca tctcacggtt cgtcagatgg gtaccgccgc cgatgttgta 6180 gatctcgccg ggccggccac cggtcagcac cgcgtggacg gcccggcagt ggtcgtccac 6240 gtgcagccat tccctgacgt tgcctccgtc gccgtacagc ggcaccggcc ggccggccag 6300 cagttcggtg acgaacagcg ggatgagctt ctccgggtgc tgacgggggc cgtagttgtt 6360 ggcgcagcgg gtcgtgcgca catcgaggcc gtgggtgcgc cagtaggacc gtgcgaccag 6420 gtcgcttccc gccttcgagg ccgcgtaggg ggagttgggg agcagcggcg cctcctccgt 6480 ccaggtgccc tgcgcgatcg atccgtagac ctcgtccgtg gagacgtg ca cgaacgtgcc 6540 gaccccgccg cgcaggctcg cctccagcag cgactgggtg cccagtacgt tggtgcggac 6600 gaactccgcc ggctcgctca gcgaacggtc gacatgggtc tcggccgcga agtgtacgac 6660 cgcgtcgtgg ccggggacca ccgtcagcag cgcgtccagg tcgcggatgt cgagccggcg 6720 gaagtccagc cggggatcgg ccaggggcag attgccggtg tctcccgcgt acgtgagcag 6780 gtcgacgacg gtgacccggc tcgggcgggg accgggcagg gtccccgcca gcagggaacg 6840 gacgtagtgg gatccgatga aaccggcgcc gccggtgatc aggacacgca tggcgacgta 6900 cctccggggc gtcggggttc acgggcgcgg tgctgggcgg tcagccgttc cagtacgggg 6960 acgacctgcg ccggggtcgg ttcggactcg gcctcggccc gcaggcgggc ggccgccgcg 7020 gtgaacgagg gctcgtcgag gagccggacg agcctgccgc gcagtccctc caccgtcacc 7080 tcgtgcgagg ggagatggag gcccgcgccg agtgcctgct gacgctgcgc gcggtcgatc 7140 gcgtcccaga tccagcccat ggcgatctgc ggcacaccct cgaccagcgc cgtcgaccag 7200 gtgccggcgc cgccgtggtg gacgatggcc gcgcaggtcg gcagcagcgc gtgcagcggc 7260 acatggtcca ccagacgcac attgtcgggg acatgggtca gcagtgcccg ttcctcggcg 7320 tcgagggtgg cgaccacctc gatgtccagc ccctcgaccg ccttgaggac gag gtcgacc 7380 gggacggcgt tggggaactc cgaggtccgg gccgtcatgc ccagggtgac gcagacgcgg 7440 gggcgggtcg gcgggacgcg cagccagtcg ggtacgacgg caggccccgg cccgttgtag 7500 gggacgtagc gcatgcccac gaccgggcgg tccgacggcg ggcggaagct gcgcggcacc 7560 tggtccaccg accactgtcc cgtcaccgcc tcctcgtcga aggggacgcc gtagcggccg 7620 agcgtccact ccagccactg gccgagtgag tcgtcggggt gcgtcgtccc gttccccccg 7680 gccgggcccg ccggggcggc gccgagctgg gcgaggtagg cccgccgcat ggacatgaag 7740 aggtccggaa aggacagcag ccgggcgtgg gccgcgccgg tcaccttcgc ggccaccgcg 7800 ccggcgaagg tgaacggctc ccacaggatc aggtccggtt cccagccgcg ggcgaacgcg 7860 acgaggtcgt cgaccatcgg atcgtcgttg atcagggtgt agaaggtggc ggtcatcatc 7920 gtgtcccagc cctggagaaa ggccggggtg agctgtccgg gggtgtcggc gtcgagcgac 7980 tggtcggcgt ggtgggacag cacagcgtcg cccacgccct tgaccatctc gtccagccgg 8040 gggtccgcgc ccaccggcac ggcggtcagc ccggccgccg tgatgctcgc cgtcagcgcg 8100 ggctggctcg ccacccgcac ctcgtgcccg gcggcccgca acgcccaggc cagcggcacg 8160 gacccgttga agtgagcgtc cagcgcgaag gatgtcagga gaacccgcat ggtcggtcc t 8220. ·. ttctctgcgg ctcggctttc ggcggctcgc aactcgggcc gcggcacgcc gggccccggc 8280 t gtgccgtcac gcggaggtgg tcagggggaa gcgcagcacc gcgcccagca cgggggaacg 8340 catccgccgc aggaccgcgc cggccggcgc gagcacgggc cggcgctccc gcagcgtgcg 8400 *. *. * gaccgcggtc tccgcctgga gccgggcgaa cgccccgaag agcgcggtgt gcgggccgga 8460. · **. gagcgacaac tgcccctgcc cggcgggacg gtcgaggtcg aagtggtccg gggccaggaa 8520 cgcctcgggg tcccggttcg ccgcaccgac atggacgacg acctgggcgccggg 8580: gtcctcgcgcg cgcgaagcgc agtgcctcct ccacggcgcc ggccgcgagt tcagggttct cgccgagccg 8700 cgcccactgc acgggacggg tgagcagcga ctccagggtg ttgttgatga gcccggcggt 8760 *. * * gacctcgacg ccgaccacgg cggtcagcac acccacggcg agcgcgtcct gcccggcgga 8820 ggcggcggag gagccggcgt gcagcaccgc gctgagcagg tcgtcacccg gctgcgtccg 8880 * ♦ * * ccgcgcctcg acgaggtcgc cgacgagggc ccgtacgtcc tcgacggcct cggtgagccg 8940 gcgggtcacg gcgagcggct gggggcagag cgcggcgtcg agggcgacac cgagggcgag 9000 gcacgtcgcc gcgaagcgtt cccgctgggc ggcggggaca ccgagcagct ccgcggcggc 9060 ctccgtggcc accgggcggcgggtgtcccccgcgcgcgccgccgccgccgccg cgcactgccc aggacggcgg aggcggaccg cgcccagcgc gtgtggtcgg cgtccgacgc 9240 ··· * gtggaggaag gcccggtcca gcgggatgat gtggcacagc tgcggattgc tccaggcgtc 9300 ggagaagacg tgccgctgcg ggcccggcag gtcggcgtgg cgcagggcga gccggggatc 9360 j * J ggccagggcc tcggcggcga cgccgtgccg gccggtgacc caggcgccgg tggtgctctg 9420 * .. * ccacagcggc gtcccggctt cccgtatccg gcgggtcagc agcgcggggt cgtcgctctc 9480 ί l ggcgcgcagg gtcagggcgt acgggtcgcc gctggtgccg tagatccagt ggaagccgcg 9540 *! 'ggcggtcagg agatgacggc ccagttcgct gtcggtctgc tggttctccg ccgtctccgg 9600 cgcgttctgt gtctgcacgg cagtctcctt cgggacgtgg ttcaggtgag ggacagaccg 9660 · *'. * ccgtcgaccg cgagcaccgc tccggtcgcg taagcggcgc gcgggtcggc cagctggacg 9720. ·. ; gcccaccagg cgatgtcctc gggccggccg acccggccgg ccgggacgcg ggcggcgatc 9780 • · · «· 107 739 37 tgcccgagga agcccgcgta ggcctcccgt gacatgcccg agcgttcacc gatgccggtg 9840 tcgatoacgc cgggcgccag gccgaggaca cggatgccgc ggggtgccag ttcgacggcc 9900 caggtccggg tgaggaagtc gagcccggcc ttggcggcgc cgtagacacc gttctgcggc 9960 caggcccggc ggcccagagc tccggccgag ccgatgttca gcacggttcc cccgccgtcg 10020 gccgacaggg cgtccagggt ctgccgggtg agcagcagcg gggccaggag gttgctgtcg 10080 aactgctcgc gggcggcctc cggctcggtc tccgccaggc cggcgaaccc accggtggcc 10140 gcgttgttca cgaggacgtc gatacggccc aacgcgtcca gcgccgcgtc ggtgatggcg 10200 cgcggaccgt ccggatcggt gagatcggcg gtcaggacac tgatgccggg gtggccctcg 10260 gcggtcccgg ccagggtcgc ggcggtgcgg cctacgacga gtacccggtc gccgcggtcg 10320 gcgaaggcgt gggccgtggc ccgcccgatc ccggtcccgc cgccggtgac gatcacgccc 10380 cgcggcgctg tcggttctgc tatggcgctc atgccccgga ccgtaggccg ggccgctcga 10440 ttcacggtcg actcccgctc ggccgcggcc tcagggccgg tcgtcacggg tcaccacgcg 10500 ttcccggacc aggagccggc cgccctcccg gaccaggac g tcccggcagg tgcagaccag 10560 gtgcagccgg gcggggccgc cctgcgcgac ggcgacgatc gagaccaggc tctcggcggt 10620 cagcgagccg tcgtccgcgg gggtgacggt gagcatgccg acccagtggc ggtgcgtctc 10680 gcgggcggcg gccagacccg ccgcggcgtt gcgggcaccc tcggcgagca gcgggcgtcc 10740 gcgtaccggc tccgggagcg agggcggtgc gaaggägccg tcctcggtga aggtgccggc 10800 ccaggtctcg gcctcgcccg agtccaggta ccgcatctgc cgtgcgtaga aatgctgtac 10860 ctcggcgtag acgtccgccg gggccgtcgg tgcctgtgct gtcatgccgt gtcacctttc 10920 gccgttcccg cgtcggggac gggtgcgtgc ccgggtcccc ggtgagtgtc acgacggtcg 10980 cagcgcgact ccaggatcgg tcgagcgggg ggcgggcgga tgcgctggcg gctgttcagt 11040 cagcctccaa cgcttctcaa gccgcgctgg tgagcatggg ctggctcgca ggaacccatc 11100 gccgggaggc gcgtgtgcgc atcatcgacc tgtcctcacc cgtggacgcg gcgggttttg 11160 aacctgatcc cgtcgtgcac gacgttctcg gtccgaagga ggccgccacg caoatgagcg 11220 aggagatgcg tgagcacttc ggcatcgact tcgatccggc ggaactgccg gagggcgaat 11280 tcctctcgct cgaccgtctc cagctgacca cccacaccgg aacccatgtc gacgcgccct 11340 cgcactacgg cacgcgcgcc gcgtaccggg acggtccgcc gcggcacatc gacgagatgc 11400 cgotcgactg gttcttccgg cccgccgtcg tcctcgacct cagcgaccag ggcacgggcg 11460 cggtcggcgc cgacgtgctg cggcgggaga tggaccggat cggccacact ccctcgccca 11520 tggacatcgt cctgctcagg accggtgccg acgcgtgggc gggaaccccg aagtacttca 11580 cggacttcac cgggctggac ggttcggccg tgcacctgct gctggacctg ggggtgcggg 11640 tgatcggcac ggacgcgttc agcctggacg cgccgttcgg cgacatcatc acccgctacc 11700 gggccacggg cgacccgtcg gtcctgtggc ccgcccatgt catcgggcgg gaccgggagt 11760 actgccaggt cgagcggctc gccgggctcg accggctgcc cgccgcgcac gggttccggg 11820 tcgcgtgctt cccggtgcgg atcgccggag cgggcgccgg ctggacgagg gcggtggccc 11880 tggtcgacga gtgaggagcg cacggcgggc cgagcggacg acgcgcccac cggggcgccg 11940 acggagggaa cagacatgta cggccgggaa ctcgcggacg tgtacgaggc catctaccgc 12000 agccgcggca aggactgggg acaggaggcg gcggacgtct cgcggatcat caccgaacgg 12060 cgtccgggag ccggctcgct gctcgacgtc gcctgtggca cgggcgccca tctgagcgtg 12120 ttcagcacgc tgttcgaggt cgccgagggc ctggagatcg cggagccgat gcggcggctc 12180 gccgagcagc ggctgcccgg cac caccgtg cacgccggcg acatgcgcga cttccggctc 12240. ·. ccgcgcacct acgacgcggt gagctgcatg ttctgcgcca tcggctatct ggagacgctg 12300:.:: gacgacatgc gggccgccgt ccggtcgatg gccgctcatc tggagcccgg cggcgtgctg 12360 gtcgtcgaac cctggtggtt ccccgagaac ttcatcgagg gctatgtcgc gggtgacctg 12420 gcccgcgagg agcaccggac catcgcccgg atctcgcaca ccacccggaa gggccgggcc 12480 acccgcatgg aggttcgctt caccgtgggg gacgccgccg gcatccagca gttcacggag 12540 * · ..1 atcgacgtgc tgaccctgtt caccagggac gaatacaccg ccgcgttcac cgacgccggc 12600: tgttccgttg aattcctgga ggacggaccc accggccgcg gtcttttcgt cggtgttcgc 12660 '· 1t gaacagcgct gagccggagg aaggtcagcc cgagaattct cgggcgaccg ccaitcacata 12720 gcgaccgtaa ccggactgcg acatctgctc accgagtcgg tggcacatgt ccgcgtcgat 12780 *** 1 gaatcccatg cgcagcgcca cttcttcgac gcaggcgatg cgcacgccct gccgttcttc 12840 gagcgtgcgc acgtactggg tggcctgaag cagcgattcc ggggttccgg cgtcgagcca 12900 *** 1 ggcgaaaccg cggccgagat cgaccagacg cgctcggccg cgggccaggt aattccggtt 12960 cacatcggtg atctccagtt cgccgcgcgg cgagggccgg aggttcttcg cgatgtccac 13020 cacttcgttg tcgtacagat agagc ccggt gatggcgagg tcggaacgcg gccggagcgg 13080 ....: cttctcctcc agggagacga gttgccccga cgcgtcggtc tcgcccacgc cgtagcgctc 13140 <1 1 cgggtcctcc acggggtagc cgaacagcac gcagccctgg acgtcgtgga cgttgctctg 13200 · "1« gagcaggtcg tagaagtggt gtccgtggaa gatgttgtcc ccgaggacca gtgccacgtc 13260 · · · 1 gtcgtcaccc acgtggtcgg cgccgatgac gaaggcgtcg gccagtccgg ccggccggtt 13320 ctgcaccgcg tagtcgatgc gcaggccgag ctgggagccg tcgcccagga gccggcggaa 13380 I 1 #: ctgttccaga tcgcgctcgg tgcagatgag caggatctcc ctgatgtccg ccagcatcag 13440 caccgagagc ggatagtaga tcatcggctt gtcgccgacc ggaagaagct gttttgatac 13500 • I ggagacggtt atcggatgga gccgtgttcc cgaaccgccg gcgagaataa tccccttcat 13560 • gggtatgccc ctgtcctcga tttcttctca tgctaacgac cggattcgct cggcagcaag 13620 ccggaaaatt tctggtccag ggaaaatcga gcggtaatag agggaatttc ggggttgtgg 13680 * · 1 · 1 accggagcga gaatgtgatg tgctgcgagg ggatggtgac gccctgtggc acggcatcgg 13740 .1 ·: cgtggcatcg gcaaggcatc ggcaagggga ggaaaagaat taatgacgac tctcgtctgg 13800 • · 107739 38 gactacct aatacga gaacgaacgc gccgacattc tggacgccgt ggagacggtc 13860 ttcagctcgg gtcggctcgt cctcggtgac agcgttcgcg gattcgagga ggagttcgcc 13920 gcgtaccacg gcgcggcgca ctgcgtcggt gtcgacaacg gcaccaacgc gatcaagctg 13980 gccctccagg cgctcggcgt cggccccggt gacgaggtcg tcacggtgtc caacaccgcg 14040 gcccccacgg tcgtggccat cgattcggtg ggcgocaccc cggtgttcgt cgacgtccac 14100 ccggacagct acctcatgga caccgagcag gtggaggccg cactcacgcc ccggacccga 14160 tgcctgctgc cggtccatct ctacgggcag tgcgtcgacc tggctccgct ggagcggctc 14220 gccgcggagc acgacctgtt cctcgtcgag gactgcgcac aggcccacgg tgcccgccgc 14280 gccggccggc tcgccggcac caccggcgac gccgccgcct tctccttcta ccccacgaag 14340 gtgctcggcg cctacggcga cggaggcgcc gtggtgacct cccgggacga cacccaccgc 14400 gcgctgcgcc gactgcgcta ctacggcatg gaggagcggt actacgtcgt cggcaccccg 14460 ggtcacaacg cccggctcga cgaggtccag gccgagatcc tgcggcgcaa gctgcgccgg 14520 ctcgacacct acatcgaggg gcggcgggcc gtcgcccggc gctacgagga cgggctcggc 14580 gacaccggcc tggtgctccc gcacaccgtc cccggcaacg agcacgtgta ctacgtctac 14640 acggtg cgcc acccgcggcg cgacgacatc atcaaggccc tcaaggcgta cgacatcgag 14700 ctgaacatca gctatccctg gcccgtgcac accatgtccg ggttcgccca cctcggctac 14760 ggcaagggc cgctgccccccccgcccta

<210> 15 <211> 22 <212> DNA

<213> Artificial Sequence <220> <223> Description of Artificial Sequence: degenerated Oligonucleotide primer <400> 15 csggsgssgc sggsttcats gg 22

<210> 16 <211> 24 <212> DNA

<213> Artificial Sequence <220> <223> Description of Artificial Sequence: degenerated Oligonucleotide primer <400> 16 ß · ß ϊ gggwrctggy rsggsccgta gttg 24 * · · »· • ·« · • ♦ · · • * * ♦ ♦ ♦ ♦ ♦ ♦ «« «« · • · »» · • · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Claims (13)

1. Isolated and purified DNA fragment, which is a gene grouping for the anthracycline biosynthesis pathway of the bacterium Streptomyces galilaeus, which grouping is included in a 7 kb; ThioI-TVori fragment and an adjacent 8.5 kb Egg / H fragment of S. galilaeus genome, · · ·. ·: ·. as shown in Fig. 2. • · »25 A DNA fragment according to claim 1, comprising a nucleotide sequence set forth in SEQ ID NO: 14 or a portion thereof, or a sequence having at least 84% homology to the sequence. ·· · • · · · · · · · · · ·. 30 A hybrid DNA comprising a DNA fragment according to claim 1 or 2, donate in a ·. a plasmid replicated in Streptomyces or in E. coli. m · · · · · · The hybrid DNA of claim 3, which is plasmid pSgs4, deposited in S. lividans strain TK24 / pSgs4 with the deposit number DSM 12998. 107739 The hybrid DNA of claim 3, which is plasmid pSgc5, deposited in the E. coli strain XL1BlueMRF7pSgc5 with the deposit number DSM 12999. Use of the genes derived from the DNA fragment of claim 1 or 2 to produce anthracycline metabolites. Use of the genes derived from the DNA fragment of claim 1 or 2 to increase aclacinomycin production. 10 Use according to claim 6 or 7, wherein the genes encode an activator, a dehydratase, an oxidoreductase, a dTDP-glucose-4,6-dehydratase, a glycosyl transferase, an isomerase, an aclaviketone reductase, a polyketide collector, a cyclase, an aminomethylase, a glucose-1-phosphate thymidylyl transferase and an amino transferase. 15 A method of increasing aclacinomycin production in a bacterial host, comprising transferring a DNA fragment according to claim 1 or 2 to a Streptomyces host, culturing the recombinant strain obtained, and isolating the produced aclacinomycins. 20 * * *. The method of claim 9, wherein the Streptomyces wood is a Streptomyces. galilaeus host. • · • · n · • · • · · • Il The method of claim 10, wherein Streptomyces galilaeus values are a mutant. ·; · # 25 strain derived from S. galilaeus ATCC 31615. A process for producing polyketide metabolites, including the transfer of a. · · ·. DNA fragments according to claim 1 or 2 in a Streptomyces-Growth, culture of the recombinant strain obtained, and isolation of the polyketide compounds produced. • I · 3o «· ♦« A method of producing anthracycline metabolites, including transferring a ··· • · · · ··· * DNA fragment according to claim 1 or 2 into a Streptomycespeucetius host, culturing the • · · • · * of the compounds produced.