ES2911490T3 - Immunogenic compositions for use in pneumococcal vaccines - Google Patents

Abstract

An immunogenic composition comprising at least one S. pneumoniae serotype 18C capsular polysaccharide glycoconjugate covalently linked to a carrier protein and further comprising serotype 1, 3, 4, 5, 6A, 6B, 7F capsular polysaccharide glycoconjugates, 9V, 14, 19A, 19F and 23F of S. pneumoniae covalently linked to a carrier protein, wherein said glycoconjugates are individually conjugated to CRM197, for use in a method of immunizing a subject against infection by serotypes 18A, 18B and/or 18F of S. pneumoniae, wherein said composition does not comprise a capsular saccharide of serotypes 18A, 18B and 18F of S. pneumoniae.

Description

DESCRIPTION

Immunogenic compositions for use in pneumococcal vaccines

field of invention

An object of the present invention is to provide immunogenic compositions for protection against S. pneumoniae serogroup 18. The immunogenic compositions of the present invention will typically comprise conjugated capsular saccharide antigens (glycoconjugates), where the saccharides are derived from serotypes of Streptococcus pneumoniae. The present invention relates to new immunogenic compositions for use in pneumococcal vaccines.

Background of the invention

Pneumococcal infections are a major cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia, and meningitis are the most common manifestations of invasive pneumococcal disease, while bacterial spread within the respiratory tract can lead to middle ear infection, sinusitis, or recurrent bronchitis. Compared with invasive disease, noninvasive manifestations are usually less severe but considerably more common.

The etiologic agent of pneumococcal diseases, Streptococcus pneumoniae (pneumococcus), is a Gram-positive encapsulated coccus, surrounded by a polysaccharide capsule. Differences in the composition of this capsule allow serological differentiation between some 91 capsular types, some of which are frequently associated with pneumococcal disease, while others are rarely. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; common noninvasive manifestations include otitis media, sinusitis, and bronchitis. Pneumococcal conjugate vaccines (PCVs) are pneumococcal vaccines used to protect against disease caused by S. pneumoniae (pneumococcus). There are currently three PCV vaccines available on the world market: PREVNAR® (called Prevenar in some countries) (7-valent vaccine), SYNFLORIX® (10-valent vaccine) and PREVNAR 13® (tri-decavalent vaccine).

Specific serotypes causing disease beyond PREVNAR 13® vary by region, population, and may change over time due to acquisition of antibiotic resistance, introduction of the pneumococcal vaccine, and secular trends of origin unknown.

WO 2006/110381 discloses a multivalent immunogenic composition, comprising: 13 different polysaccharide-protein conjugates, in which each of the conjugates comprises a capsular polysaccharide from a different serotype of Streptococcus pneumoniae conjugated to a carrier protein, and the Capsular polysaccharides are prepared from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 180, 19A, 19F, and 23F.

CN 102 068 690 discloses a polyvalent pneumococcal capsular polysaccharide vaccine comprising conjugates of capsular polysaccharides of 23 pneumococcal serotypes and a carrier protein, and the serotypes of the 23 pneumococcal serotypes are 1, 2, 3, 4, 5 , 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19F, 19A, 20, 22F, 23F and 33F.

WO 2007/071707 discloses a multivalent immunogenic composition of S. pneumoniae with various conjugated capsular saccharides of different serotypes of S. pneumoniae conjugated with 2 or more different carrier proteins, in which the composition comprises the capsular saccharide of serotype 19F conjugated with diphtheria toxoid (DT) or CRM197, optionally in which 19F is the only saccharide in the composition conjugated with diphtheria toxoid (DT) or ^CRM197 .

Document 2016/113644 discloses immunogenic compositions for protection against S. pneumoniae, in particular against serogroup 9 of S. pneumoniae, limiting the number of conjugates.

WO 2007/116028 discloses a multivalent S. pneumoniae immunogenic composition with 9 or more conjugated capsular saccharides from different S. pneumoniae serotypes, wherein the composition comprises the 18C conjugated capsular saccharide that is less than 80, 70, 60 , 50, 40, 30, 20, 15 or 10% O-acetylated.

The addition of conjugates to an immunogenic composition is not a straightforward process, as the combination of conjugates in a single multivalent injection may result in competition between the different components and may negatively affect the immunogenicity of any individual conjugate.

This interference phenomenon may limit the number of conjugates that can be included in a multivalent vaccine. Therefore, protection against a high number of serotypes, while limiting the number of conjugates in the composition, may be very difficult to obtain despite the significant value.

An object of the present invention is to provide immunogenic compositions for adequate protection against S. pneumoniae, in particular against S. pneumoniae serogroup 18, while limiting the number of conjugates.

Streptococcus pneumoniae serogroup 18 consists of four different serotypes, 18F, 18A, 18B, and 18C, each of which produces its own type-specific capsular polysaccharide.

It is an object of the present invention to provide immunogenic compositions for adequate protection against serotypes 18F, 18A, 18B and 18C of S. pneumoniae, with a limited number of conjugates.

Summary of the invention

The invention is set forth in the attached set of claims. Embodiments and/or examples in the following description that are not covered by the appended claims are not considered to be part of the present invention. Any reference in the description to methods of treatment refers to the compounds, pharmaceutical compositions and medicaments of the present invention for use in a method of treating the human (or animal) body by therapy (or for diagnosis).

The present invention relates to an immunogenic composition comprising at least one glycoconjugate of S. pneumoniae serotype 18C covalently linked to a carrier protein and also comprising glycoconjugates of capsular polysaccharides of S. pneumoniae serotypes 1, 3, 4, 5 , 6A, 6B, 7F, 9V, 14, 19A, 19F, and 23F covalently linked to a carrier protein, wherein said glycoconjugates are individually conjugated to CRM ¹⁹⁷ , for use in a method of immunizing a subject against infection by S. pneumoniae serotypes 18A, 18B and/or 18F, wherein said composition does not comprise a capsular saccharide from S. pneumoniae serotypes 18A, 18B and 18F.

In one aspect, the above immunogenic compositions further comprise at least one glycoconjugate of S. pneumoniae serotypes 15B, 22F, 33F, 12F, 10A, 11A and/or 8.

In another aspect, the above immunogenic compositions further comprise at least one glycoconjugate of S. pneumoniae serotypes 2, 15C, 17F and/or 20.

In one aspect, the above immunogenic compositions further comprise at least one S. pneumoniae serotype 9N glycoconjugate.

In another aspect, the immunogenic composition is a 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-, 21-, 22-, 23-, 24-, or 25-valent pneumococcal conjugate composition.

In another aspect, the glycoconjugates of the immunogenic compositions are individually conjugated to CRM ¹⁹⁷ .

In one aspect, the glycoconjugates are prepared using CDAP chemistry or by reductive amination chemistry.

The immunogenic composition may further comprise antigens from other pathogens and/or at least one adjuvant, such as aluminum phosphate, aluminum sulfate, or aluminum hydroxide.

In one aspect, the immunogenic compositions are capable of eliciting IgG antibodies in humans that are capable of binding to a S. pneumoniae serotypes 18A, 18B, and/or 18F polysaccharide at a concentration of at least 0.35 pg/mL. , as determined by an ELISA assay. In one aspect, the immunogenic compositions are capable of eliciting a titer of at least 1:8 against S. pneumoniae serotype 18A, 18B, and/or 18F in at least 50% of subjects, as determined by an assay. in vitro opsonophagocytic destruction (OPA).

In one aspect, the immunogenic compositions are capable of significantly increasing the proportion of responders against S. pneumoniae serotype 18A, 18B and/or 18F compared to the preimmunized population.

In one aspect, the immunogenic compositions are capable of significantly increasing the OPA titers of human subjects against S. pneumoniae serotype 18A, 18B and/or 18F compared to the preimmunized population.

In one aspect, the immunogenic compositions are for use in a method of immunizing a subject against infection by S. pneumoniae serotypes 18A, 18B, and/or 18F.

In one aspect, the immunogenic compositions are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotypes 18A, 18B, and/or 18F in a subject, for use to prevent infection by serotypes 18A, 18B and/or 18F of S. pneumoniae in a subject or for use in a method of protecting or treating a human susceptible to infection by serotypes 18A, 18B and/or 18F of S. pneumoniae, by administering said immunogenic compositions systemically or mucosally.

In one aspect, the present disclosure relates to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotypes 18A, 18B and/or 18F in a subject, for use to prevent infection by serotypes 18A, 18B and/or 18F of S. pneumoniae in a subject or for use in a method of protecting or treating a human susceptible to infection by serotypes 18A, 18B and/or 18F of S. pneumoniae, through the administration of said immunogenic compositions by the systemic or mucosal route.

In one aspect, the disclosure relates to a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae serotypes 18A, 18B, and/or 18F in a subject, comprising administering to the subject a immunologically effective amount of the immunogenic composition of the invention.

In one aspect, the disclosure relates to a method of preventing an infection by serotypes 18A, 18B and/or 18F of S. pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of the immunogenic composition of the invention.

The disclosure further relates to a kit comprising an immunogenic composition disclosed herein and an informational package insert, wherein said informational package insert mentions the ability of the composition to elicit functional antibodies against serotypes 18A, 18B and/or 18F of S. pneumoniae and the process for producing said kit.

It has surprisingly been found that the conjugate of a serotype 18C polysaccharide, in addition to raising functionally reactive antibodies against serogroup 18C, can also raise functional cross-reactive antibodies against the other serotypes of serogroup 18: 18A, 18B and/or 18F.

figures

Figure 1. Cross-functional responses in OPA. A subset of 59 sera from adults vaccinated with a 13-valent pneumococcal conjugate vaccine (US study 6115A1-004; ClinicalTrials.gov identifier: NCT00427895) was evaluated at OPA for the presence of functional antibodies against serotypes 18C, 18F, 18A, 18B . The percentage of samples with a positive OPA titer (ie, >1:8) is indicated on each group. The geometric mean of the titers (GMT) appears on the x-axis below each group.

Figure 2. Cross-functional responses in OPA of 66 paired sera before and after vaccination. A subset of 66 matched serum panels before and after vaccination of adults with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov ID: NCT00546572) were evaluated at OPA for the presence of functional antibodies against serotypes. 18C, 18F, 18A and 18B. The percentage of samples with a positive OPA titer (ie, >1:8) is indicated on each group. The geometric mean of the titers (GMT) appears on the x-axis below each group.

Figure 3. Reverse cumulative distribution curves (RCDC) before and after immunization - pneumococcal serotype 18C. Inverse cumulative distribution curves of OPA titers for serotype 18C from a pre- and post-vaccination matched serum panel (N = 66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov identifier : NCT00546572). The graphs represent the percentage of sera with a positive OPA titer (ie, >1:8).

Figure 4. Reverse cumulative distribution curves (RCDC) before and after immunization - pneumococcal serotype 18A. Inverse cumulative distribution curves of OPA titers for serotype 18A from a pre- and post-vaccination matched serum panel (N = 66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov identifier : NCT00546572). The graphs represent the percentage of sera with a positive OPA titer (ie, >1:8).

Figure 5. Reverse cumulative distribution curves (RCDC) before and after immunization - pneumococcal serotype 18B. Inverse cumulative distribution curves of OPA titers for serotype 18B from a pre- and post-vaccination matched serum panel (N = 66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov identifier : NCT00546572). The graphs represent the percentage of sera with a positive OPA titer (ie, >1:8).

Figure 6. Inverse cumulative distribution curves (RCDC) before and after immunization - pneumococcal serotype 18F. Inverse cumulative distribution curves of OPA titers for serotype 18F from a pre- and post-vaccination matched serum panel (N = 66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov identifier : NCT00546572). The graphs represent the percentage of sera with a positive OPA titer (ie, >1:8).

1. Immunogenic compositions of the invention

The immunogenic compositions of the present invention will typically comprise conjugated capsular saccharide antigens (also called glycoconjugates), where the saccharides are derived from serotypes of S. pneumoniae.

Preferably, the number of S. pneumoniae capsular saccharides may range from 13 serotypes (or "v", valences) to 25 different serotypes (25v). In one embodiment there are 13 different serotypes. In one embodiment there are 14 different serotypes. In one embodiment there are 15 different serotypes. In one embodiment there are 16 different serotypes. In one embodiment there are 17 different serotypes. In one embodiment there are 18 different serotypes. In one embodiment there are 19 different serotypes. In one embodiment there are 20 different serotypes. In one embodiment there are 21 different serotypes. In one embodiment there are 22 different serotypes. In one embodiment there are 23 different serotypes. In one embodiment there are 24 different serotypes. In one embodiment there are 25 different serotypes. Capsular saccharides are conjugated to a carrier protein to form glycoconjugates as described below.

If the protein carrier is the same for 2 or more saccharides in the composition, the saccharides could be conjugated to the same protein carrier molecule (carrier molecules that have 2 or more different saccharides conjugated to them) [see, for example, the WO 2004/083251].

However, in a preferred embodiment, the saccharides are individually conjugated to different protein carrier molecules (each protein carrier molecule only has one type of saccharide conjugated to it). In such an embodiment, the capsular saccharides are said to be individually conjugated to the carrier protein.

For purposes of the invention, the term "glycoconjugate" denotes a capsular saccharide covalently linked to a carrier protein. In one embodiment, a capsular saccharide is directly attached to a carrier protein. In a second embodiment, a bacterial saccharide is linked to a protein through a spacer/linker.

1.1 Carrier protein of the invention

One component of the glycoconjugate of the invention is a carrier protein to which the saccharide is conjugated. The terms "protein carrier" or "carrier protein" or the term "carrier" may be used interchangeably herein. The carrier proteins must be capable of being subjected to conventional conjugation procedures.

In a preferred embodiment, the glycoconjugate carrier protein is selected from the group consisting of: DT (diphtheria toxin), TT (tetanus toxin) or TT fragment C, CRM ¹⁹⁷ (a non-toxic but antigenically identical variant of diphtheria toxin), CRM197 mutant diphtheria toxin A chain (CN103495161), other DT mutants (such as CRM176, CRM228, CRM45 (Uchida et al. (1973), J. Biol. Chem. 218:3838-3844 , 1973); CRM9, CRM102, CRM 103 or CRM107; and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, ed. Frankel, Maecel Dekker Inc. (1992); deletion or mutation of Glu-148 to Asp, Gln or Ser and/or Ala 158 to Gly and other mutations disclosed in US Patent Nos. 4,709,017 and 4,950,740, the mutation of at least one or more residues Lys 516, Lys 526, Phe 530 and/or o Lys 534 and other mutations disclosed in US Patent ^Nos . 5,917,017 and 6,455,673 or a fragment disclosed in US Patent No. 5,843,711, neumolis pneumococcal ina (ply) (Kuo et al. (1995), Infect. Immun., 63:2706-2713) including ply detoxified in some way, for example dPLY-GMBS (WO 2004/081515 and WO 2006/032499) or dPLY-formaldehyde, PhtX, including PhtA, PhtB, PhtD, PhtE (PhtA, PhtB, PhtD or PhtE sequences are disclosed in WO 00/37105 and WO 00/39299) and Pht protein fusions, eg PhtDE fusions, PhtBE fusions, Pht AE (WO 01/98334, WO 03/054007, WO 2009/000826), OMPC (meningococcal outer membrane protein - generally extracted from Neisseria meningitidis serogroup B (EP0372501), PorB (from N. meningitidis), PD (protein D from Haemophilus influenzae ; see for example EP0594610 B), or their immunologically functional equivalents, synthetic peptides (EP0378881, EP0427347), heat shock proteins (W o 93/17712, WO 94/03208), cough proteins pertussis (WO 98/58668, EP0471177), cytokines, lymphokines, factor is growth or hormones (WO 91/01146), artificial proteins comprising multiple human CD4+ T cell epitopes of various pathogen-derived antigens (Falugi et al. (2001), Eur. J. Immunol., 31:3816-3824), such as the N19 protein (Baraldoi et al. (2004), Infect. Immun., 72:4884-4887), PspA pneumococcal surface protein (WO 02/091998), iron uptake proteins (WO 01/72337), Clostridium difficile toxin A or B (WO 00/61761), transferrin binding proteins, pneumococcal adhesion protein (PsaA) , recombinant Pseudomonas aeruginosa exotoxin A (in particular, non-toxic mutants thereof (such as exotoxin A with a 553 glutamic acid substitution) (Douglas et al. (1987), J. Bacteriol., 169(11):4967 -4971)) Other proteins, such as ovalbumin, limpet hemocyanin (KLH), bovine serum albumin (BSA), or tuberculin purified protein derivative (PPD), can also be used as carrier proteins. suitable include inactivated bacterial toxins, such as cholera toxoid (for example, as described in WO 2004/08 3251), Escherichia coli LT, E. coli ST and P. aeruginosa exotoxin A.

In a preferred embodiment, the carrier protein of the glycoconjugates is independently selected from the group consisting of TT, DT, DT mutants (such as CRM ¹⁹⁷ ), H. influenzae protein D, PhtX, PhtD, fusions. PhtDE (particularly those described in WO 01/98334 and WO 03/054007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, C. difficile toxin A or B, and PsaA.

In one embodiment, the carrier protein of the glycoconjugates of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugates of the invention is TT (tetanus toxoid).

In another embodiment, the carrier protein of the glycoconjugates of the invention is PD ( H. influenzae protein D; see, for example, EP0594610 B).

The CRM197 protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM ¹⁹⁷ is produced by Corynebacterium diphtheriae infected by the non-toxigenic phage p197 ^tox -created by nitrosoguanidine mutagenesis of the toxigenic corynephage beta (Uchida et al. (1971), Nature New Biology 233:8-11). The CRM ¹⁹⁷ protein has the same molecular weight as diphtheria toxin, but differs from it by a single base change (guanine to adenine) in the structural gene. This single base change causes an amino acid substitution (glutamic acid for glycine) in the mature protein and removes the toxic properties of diphtheria toxin. CRM ¹⁹⁷ protein is a safe and efficient T-cell dependent saccharide carrier. More details on CRM ¹⁹⁷ and its production can be found, for example, in US Patent No. 5,614,382. In one embodiment, the capsular saccharides of the invention are conjugated to CRM ¹⁹⁷ protein or CRM ¹⁹⁷ A chain (see CN103495161). In one embodiment, the capsular saccharides of the invention are conjugated with CRM ¹⁹⁷ A chain obtained by expression by genetically recombinant E. coli (see CN103495161). In one embodiment, the capsular saccharides of the invention are all conjugated with CRM ¹⁹⁷ . In one embodiment, the capsular saccharides of the invention are all conjugated to the A chain of CRM ¹⁹⁷ .

Accordingly, in common embodiments, the glycoconjugates of the invention comprise CRM ¹⁹⁷ as the carrier protein, in which the capsular polysaccharide is covalently linked to CRM ¹⁹⁷ .

1.2 Capsular saccharide of the invention

The term "saccharide" throughout this specification may indicate a polysaccharide or an oligosaccharide and includes both. In common embodiments, the saccharide is a polysaccharide, in particular a capsular polysaccharide from S. pneumoniae.

The capsular polysaccharides are prepared by conventional techniques known to those of skill in the art.

In the present invention, capsular polysaccharides can be prepared, for example, from serotypes 1,2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F of S. pneumoniae. Typically, the capsular polysaccharides are produced by culturing each serotype of S. pneumoniae in a medium (eg soybean-based medium), and the polysaccharides are prepared from the culture of the bacteria. The bacterial strains of S. pneumoniae used to make the respective polysaccharides used in the glycoconjugates of the invention can be obtained from established culture collections or from clinical samples.

The population of the organism (each S. pneumoniae serotype) is often scaled up from a seed vial to seed bottles run through one or more increasing volume seed fermenters until production-scale fermentation volumes are reached . At the end of the growth cycle, the cells are lysed and the lysed broth is collected for further processing (purification) (see, eg, WO 2006/110381, WO 2008/118752, and US Pat. US Published Nos. ^2006/0228380 , 2006/0228381, 2008/0102498, and 2008/0286838).

The individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and/or column chromatography (see, for example, WO 2006/110352 and WO 2008/118752).

Purified polysaccharides can be activated (eg, chemically) to render them reactive (eg, directly with the carrier protein or through a linker such as an eTEC spacer) and then incorporated into the glycoconjugates of the invention, as described. later.

The capsular polysaccharides of S. pneumoniae comprise repeating oligosaccharide units that can contain up to 8 sugar moieties.

In one embodiment, the capsular saccharide of the invention may be an oligosaccharide unit, or a saccharide chain of shorter than native length of repeating oligosaccharide units. In one embodiment, the capsular saccharide of the invention is a repeating oligosaccharide unit of the corresponding serotype.

In one embodiment, the capsular saccharides of the invention may be oligosaccharides. Oligosaccharides have a low number of repeat units (usually between 5 and 15 repeat units) and are usually obtained synthetically or by hydrolysis of polysaccharides.

In one embodiment, all of the capsular saccharides of the present invention and in the immunogenic compositions of the present invention are polysaccharides. High molecular weight capsular polysaccharides are capable of inducing certain antibody immune responses due to epitopes present on the antigenic surface. Isolation and purification of high molecular weight capsular polysaccharides is preferably contemplated for use in the conjugates, compositions and methods of the present invention.

In some embodiments, the purified polysaccharides prior to conjugation have a molecular weight between 5 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 10 kDa and 4,000 kDa; between 50 kDa and 4,000 kDa; between 50 kDa and 3,000 kDa; between 50 kDa and 2,000 kDa; between 50 kDa and 1,500 kDa; between 50 kDa and 1,000 kDa; between 50kDa and 750kDa; between 50kDa and 500kDa; between 100 kDa and 4,000 kDa; between 100 kDa and 3,000 kDa; between 100 kDa and 2,000 kDa; between 100 kDa and 1,500 kDa; between 100 kDa and 1,000 kDa; between 100 kDa and 750 kDa; between 100kDa and 500kDa; between 100 and 400 kDa; between 200 kDa and 4,000 kDa; between 200 kDa and 3,000 kDa; between 200 kDa and 2,000 kDa; between 200 kDa and 1,500 kDa; between 200 kDa and 1,000 kDa; or between 200 kDa and 500 kDa.

In other embodiments, the capsular polysaccharide has a molecular weight between 70 kDa and 150 kDa; between 80 kDa and 160 kDa; between 90 kDa and 250 kDa; between 100 kDa and 1,000; between 100kDa and 500kDa; between 100 kDa and 400 kDa; between 100kDa and 160kDa; between 150kDa and 600kDa; between 200 kDa and 1,000 kDa; between 200 kDa and 600 kDa; between 200 kDa and 400 kDa; between 300 kDa and 1,000 kDa; between 300 kDa and 600 kDa; between 300 kDa and 500 kDa; or between 500 kDa and 600 kDa.

In other embodiments, the capsular polysaccharide has a molecular weight between 5 kDa and 100 kDa; between 7 kDa and 100 kDa; between 10 kDa and 100 kDa; between 20 kDa and 100 kDa; between 30 kDa and 100 kDa; between 40 kDa and 100 kDa; between 50kDa and 100kDa; between 60 kDa and 100 kDa; between 70 kDa and 100 kDa; between 80 kDa and 100 kDa; between 90 kDa and 100 kDa; between 5 kDa and 90 kDa; between 5 kDa and 80 kDa; between 5 kDa and 70 kDa; between 5 kDa and 60 kDa; between 5 kDa and 50 kDa; between 5 kDa and 40 kDa; between 5 kDa and 30 kDa; between 5 kDa and 20 kDa; or between 5 kDa and 10 kDa. Any integer within any of the above ranges is contemplated as an embodiment of the disclosure.

A polysaccharide can be slightly reduced in size during normal purification procedures. Additionally, as described herein, the polysaccharide may be subjected to sizing techniques prior to conjugation. Mechanical or chemical sizing can be used. Chemical hydrolysis can be done with acetic acid. For example, serotype 18C saccharides can be sized (and de-O-acetylated) by treatment with acetic acid (see eg WO2006/110381, p. 37, lines 1-4). Mechanical sizing can be done by high pressure homogenization shearing. The molecular weight ranges mentioned above refer to polysaccharides purified before conjugation (eg, before activation).

In a preferred embodiment, the purified polysaccharides are capsular polysaccharides of serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F, or 33F of S. pneumoniae, wherein the capsular polysaccharide has a molecular weight within one of the molecular weight ranges described above.

As used herein, the term "molecular weight" of the polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) combined with a multi-angle laser light scattering detector ( MALLS).

In some embodiments, the serotypes 9V, 18C, 11A, 15B, 22F and/or 33F pneumococcal saccharides of the invention are O-acetylated. In some embodiments, the serotypes 9V, 11A, 15B, 22F and/or 33F pneumococcal saccharides of the invention are O-acetylated. In a preferred embodiment, the serotype 18C pneumococcal saccharide of the invention is de-O-acetylated. For example, serotype 18C saccharides can be de-O-acetylated by acid treatment (see, eg, Wo2006/110381p.p. 37, lines 1-4).

The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, for example, by proton NMR (see, eg, Lemercinier et al. (1996), Carbohydrate Research, 296:83-96; Jones et al . ( 2002), J. Pharmaceutical and Biomedical Analysis, 30:1233-1247, WO 2005/033148 and WO 00/56357). Another commonly used method is described in Hestrin (1949), J. Biol. Chem.

180:249-261. Preferably, the presence of O-acetyl groups is determined by ion HPLC analysis.

The purified polysaccharides described herein are chemically activated so that the saccharides are capable of reacting with the carrier protein. These antipneumococcal conjugates are prepared by separate processes and are formulated in a single dosage formula as described below.

1.3 Glucoconjugates of the invention

The purified saccharides are chemically activated so that the saccharides (ie activated saccharides) are capable of reacting with the carrier protein, either directly or through a linker. Once activated, each capsular saccharide is separately conjugated to a carrier protein to form a glycoconjugate. In another embodiment, each capsular saccharide is conjugated to the same carrier protein. The chemical activation of saccharides and subsequent conjugation to the carrier protein can be achieved by the activation and conjugation methods disclosed herein.

1.3.1 Glucoconjugates of the invention

Capsular polysaccharides of serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F and/or 33F from S. pneumoniae are prepared as described above.

In one embodiment, the polysaccharides are activated with 1-cyano-4-dimethylamino-pyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated saccharide can be coupled directly or through a spacer (linker) group to an amino group of the carrier protein (preferably CRM ¹⁹⁷ ). For example, the spacer can be cystamine or cysteamine to give a thiolated polysaccharide that can be coupled to the carrier through a thioether bond obtained upon reaction with a maleimide-activated carrier protein (for example, by using the ester of N- [Y-maleimidobutyryloxy]succinimide (GMBS)) or a holoacetylated carrier protein (for example, by using iodoacetimide, N-succinimidyl bromoacetate (SBA; SIB), N-succinimidyl(4-iodoacetyl)aminobenzoate (SIAB), sulfosuccinimidyl (4-iodoacetyl)aminobenzoate (sulfo-SlAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamido]proprionate (SBAP)). Optionally, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexanediamine or adipic acid hydrazide (ADH) and the amino-derivatized saccharide is conjugated to the carrier protein (eg, CRM ¹⁹⁷ ) using by using carbodiimide chemistry (eg, EDAc or EDC) through a carboxyl group on the carrier protein. Such conjugates are described, for example, in WO 93/15760, WO 95/08348 and WO 96/129094.

In one embodiment of the present invention, glycoconjugates of serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C , 19A, 19F, 20, 22F, 23F and/or 33F from S. pneumoniae are prepared using CDAP chemistry. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1,4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7f, 9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are prepared using CDAP chemistry. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are prepared using CDAP chemistry. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1,3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are prepared using CDAP chemistry.

Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, pnitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many of these are described in International Patent Application Publication No. WO 98/42721. The conjugation may involve a carbonyl linker which can be formed by reaction of a free hydroxyl group on the saccharide with CDI (Bethell et al. (1979), J. Biol. Chem., 254:2572-2574; Hearn et al. (1981). ), J. Chromatogr., 218:509-518), followed by reaction with a protein to form a carbamate bond. This may involve reduction of the anomeric terminal to a primary hydroxyl group, optional protection/deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group in a protein.

In a preferred embodiment, at least one of the capsular polysaccharides of serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 15C, 17F , 18C, 19A, 19F, 20, 22F, 23F, and 33F from S. pneumoniae is conjugated to the carrier protein by reductive amination (as described in published US Patent Application ^Nos . 2006/0228380, 2007 /184072, 2007/0231340 and 2007/0184071, and WO 2006/110381, WO 2008/079653 and WO 2008/143709).

In one embodiment of the present invention, the S. pneumoniae serotype 18C glycoconjugate is prepared by reductive amination. In one embodiment of the present invention, the S. pneumoniae serotype 6A glycoconjugate is prepared by reductive amination. In one embodiment of the present invention, the S. pneumoniae serotype 19A glycoconjugate is prepared by reductive amination. In one embodiment of the present invention, the S. pneumoniae serotype 3 glycoconjugate is prepared by reductive amination. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 6A and 19a are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 3, 6A, and 19A are prepared by reductive amination.

In a preferred embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1, 4, 6B, 9V, 14, 18C, 19F, and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1,4, 5, 6B, 9V, 14, 18C, 19F, and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1,4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19F and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1,4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are prepared by reductive amination.

In another preferred embodiment, glycoconjugates of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F and 23F are prepared by reductive amination.

In another preferred embodiment, glycoconjugates of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F and 23F are prepared by reductive amination.

In another preferred embodiment, the glycoconjugates of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F and 23F of S. pneumoniae are prepared by reductive amination.

In another preferred embodiment, glycoconjugates of S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are prepared by reductive amination.

In another preferred embodiment, the glycoconjugates of serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 12F, 14, 15C, 18C, 19A, 19F, 22F, 23F and 33F of S. pneumoniae are prepared by reductive amination .

In another preferred embodiment, the glycoconjugates of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 14, 15B, 18C, 19A, 19F, 22F and 23F of S. pneumoniae are Prepared by reductive amination.

In another preferred embodiment, the glycoconjugates of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F and 23F of S. pneumoniae are prepared by reductive amination.

In another preferred embodiment, the glycoconjugates of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F of S. pneumoniae are prepared by reductive amination.

In another preferred embodiment, the glycoconjugates of serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23f and 33F of S. pneumoniae are prepared by reductive amination.

In another preferred embodiment, the glycoconjugates of serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F from S. pneumoniae are prepared by reductive amination.

Reductive amination involves two steps, (1) oxidation of the polysaccharide, (2) reduction of the activated polysaccharide and a carrier protein to form a conjugate. Before oxidation, the polysaccharide is optionally hydrolyzed. Mechanical or chemical hydrolysis may be employed. Chemical hydrolysis can be done with acetic acid. The oxidation step may involve reaction with periodate. For the purpose of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes both metaperiodate (IO ^4- ) and orthoperiodate (IO 6 ^5- ) and includes the various salts of periodate (eg, sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide is oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NaIO ⁴ ). In another embodiment, the capsular polysaccharide is oxidized in the presence of orthoperiodate, preferably in the presence of periodic acid.

In one embodiment, the oxidizing agent is a stable nitroxyl or nitroxide radical compound, such as piperidine-N-oxy or pyrrolidin-N-oxy compounds, in the presence of an oxidant to selectively oxidize primary hydroxyls (as described in the document w O 2014/097099). In said reaction, the actual oxidant is the N-oxoammonium salt, in a catalytic cycle. In one aspect, said stable nitroxyl or nitroxide radical compound are piperidine-N-oxy or pyrrolidine-N-oxy compounds. In one aspect, said stable nitroxyl or nitroxide radical compound bears a TEMPO (2,2,6,6-tetramethyl-1-piperidinylox) or PROXYL (2,2,5,5-tetramethyl-1-pyrrolidinyloxy) moiety. In one aspect, said stable nitroxyl radical compound is TEMPO or a derivative thereof. In one aspect, said oxidant is a molecule bearing an N-halo moiety. In one aspect, said oxidant is selected from the group consisting of N-chlorosuccinimide, N-bromosuccinimide, N-iodosuccinimide, dichloroisocyanuric acid, 1,3,5-trichloro-1,3,5-triazinan-2,4,6- trione, dibromoisocyanuric acid, 1,3,5-tribromo-1,3,5-triazinan-2,4,6-trione, diiodoisocyanuric acid and 1,3,5-triiodo-1,3,5-triazinan-2, 4,6-trione. Preferably, said oxidant is N-chlorosuccinimide.

In a preferred embodiment, the capsular polysaccharides of serotypes 12F of S. pneumoniae are conjugated with the carrier protein by reductive amination, in which the oxidizing agent is the free radical 2,2,6,6-tetramethyl-1-piperidinyloxy ( TEMPO) and N-chlorosuccinimide (NCS) as co-oxidant (as described in WO 2014/097099). Thus, in one aspect, S. pneumoniae serotype 12F glycoconjugates are obtained by a method comprising the steps of: a) reacting a 12F saccharide with 2,2,6,6-tetramethyl-1-piperidinyloxy ( TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce an activated saccharide; and b) reacting the activated saccharide with a carrier protein comprising one or more amine groups (said method hereinafter referred to as "TEMPO/NCS reductive amination").

Optionally, the oxidation reaction is quenched by the addition of a quenching agent. The quenching agent can be selected from vicinal diols, 1,2-aminoalcohols, amino acids, glutathione, sulfite, bisulfate, dithionite, metabisulfite, thiosulfate, phosphites, hypophosphites or phosphorous acid (such as glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol or butane-2,3-diol, ascorbic acid).

After the polysaccharide oxidation step, the polysaccharide is said to be activated and is referred to herein as "activated polysaccharide". The activated polysaccharide and carrier protein can be lyophilized, either independently (discrete lyophilization) or together (colyophilized). In one embodiment, the activated polysaccharide and carrier protein are freeze-dried. In another embodiment, the activated polysaccharide and carrier protein are lyophilized independently.

In one embodiment, lyophilization takes place in the presence of a non-reducing sugar, and possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinit.

The second stage of the conjugation process is the reduction of the activated polysaccharide and a carrier protein to form a conjugate (so-called reductive amination), using a reducing agent. Suitable reducing agents are cyanoborohydrides (such as sodium cyanoborohydride, sodium triacetoxyborohydride, or sodium or zinc borohydride in the presence of Bronsted or Lewis acids), amino-boranes, such as pyridineborane, 2-picoline- borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3, benzylamine-borane or 5-ethyl-2-methylpyridine-borane (PEMB) or the borohydride exchange resin. In one embodiment, the reducing agent is sodium cyanoborohydride.

In one embodiment, the reduction reaction is carried out in an aqueous solvent (eg, selected from PBS, MES, HEPES, Bis-tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bicina or HEPB, at a pH between 6.0 and 8.5, 7.0 and 8.0, or 7.0 and 7.5) and, in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in the solvent DMSO (dimethylsulfoxide) or DMF (dimethylformamide). The solvent DMSO or DMF can be used to reconstitute activated polysaccharide and carrier protein that has been lyophilized.

At the end of the reduction reaction, unreacted aldehyde groups may remain on the conjugates, which can be blocked using a suitable blocking agent. In one embodiment, this blocking agent is sodium borohydride (NaBH4). Following conjugation (the reduction reaction and, optionally, blocking), the glycoconjugates can be purified (enriched for the amount of polysaccharide-protein conjugate) by a variety of techniques known to those of skill in the art. These techniques include dialysis, concentration/diafiltration, tangential flow filtration elution/precipitation, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration. In one embodiment, the glycoconjugates are purified by diafiltration or ion exchange chromatography or size exclusion chromatography.

In one embodiment, the glycoconjugates are filter sterilized.

In one embodiment of the present invention, S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F glycoconjugates are prepared by CDAp chemistry and S. pneumoniae serotype 6A glycoconjugate. pneumoniae is prepared by reductive amination.

In one embodiment of the present invention, S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F glycoconjugates are prepared by CDAP chemistry and S. pneumoniae serotype 19A glycoconjugate. pneumoniae is prepared by reductive amination.

In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F are prepared by CDAP chemistry and glycoconjugates of serotypes 6A and 19A from S. pneumoniae are prepared by reductive amination.

In one embodiment of the present invention, glycoconjugates of serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F of S. pneumoniae are prepared by CDAP chemistry and glycoconjugates of serotypes 3, 6A and 19A from S. pneumoniae are prepared by reductive amination.

In one embodiment of the present invention, S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 22F and 23F glycoconjugates are prepared using CDAP chemistry and the serotype 6A glycoconjugate from S. pneumoniae is prepared by reductive amination.

In one embodiment of the present invention, S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 22F and 23F glycoconjugates are prepared using CDAP chemistry and serotype 19A glycoconjugate from S. pneumoniae is prepared by reductive amination.

In one embodiment of the present invention, S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 22F and 23F glycoconjugates are prepared by CDAP chemistry and serotypes 6A glycoconjugates and 19A from S. pneumoniae are prepared by reductive amination.

In one embodiment of the present invention, glycoconjugates of S. pneumoniae serotypes 1,4, 5, 6B, 7F, 8, 9V, 14, 18C, 19F, 22F and 23F are prepared by CDAP chemistry and glycoconjugates of S. pneumoniae serotypes 3, 6A and 19A are prepared by reductive amination.

In one embodiment, the glycoconjugates of the invention are prepared using eTEC conjugation, as described in WO 2014/027302. Said glycoconjugates comprise a saccharide covalently conjugated to a carrier protein through one or more eTEC spacers, wherein the saccharide is covalently conjugated to the eTEC spacer through a carbamate bond, and wherein the carrier protein is covalently conjugated to the spacer. eTEC through an amide bond. The eTEC-linked glycoconjugates of the invention may be represented by the general formula (I):

in which the atoms that make up the eTEC spacer are contained in the central box.

The eTEC spacer includes seven linear atoms (ie, -C(O)NH(CH ² ) ² SCH ² C(O)-) and provides stable thioether and amide bonds between the saccharide and the carrier protein. The synthesis of the unique glycoconjugate with eTEC involves the reaction of an activated hydroxyl group of the saccharide with the amino group of a thioalkylamine reagent, e.g., cystamine or cysteinamine or a salt thereof, forming a carbamate bond with the saccharide to provide a thiolated saccharide. The generation of one or more free sulfhydryl groups is accomplished by reaction with a reducing agent to provide an activated thiolated saccharide. Reaction of the free sulfhydryl groups of the activated thiolated saccharide with an activated carrier protein having one or more α-haloacetamide groups on amine-containing moieties generates a thioether bond to form the conjugate, in which the carrier protein is attached to the eTEC spacer. through an amide bond.

In said glycoconjugates of the invention, the saccharide may be a polysaccharide or an oligosaccharide. The carrier protein may be selected from any suitable carrier as described herein or known to those of skill in the art. In common embodiments, the saccharide is a polysaccharide. In some of these embodiments, the carrier protein is CRM ¹⁹⁷ . In some of these embodiments, the eTEC-linked glycoconjugate comprises a capsular polysaccharide of S. pneumoniae serotype 33F.

In particularly preferred embodiments, the eTEC-linked glycoconjugate comprises a pneumococcal serotype 33F (Pn33F) capsular polysaccharide, which is covalently conjugated to CRM ¹⁹⁷ via an eTEC spacer (serotype 33F eTEC-linked glycoconjugates).

In some embodiments, the S. pneumoniae serotypes 1, 7F, 9V, and/or 18C glycoconjugates of the invention are O-acetylated. In some embodiments, the S. pneumoniae serotypes 1, 7F, and 9V glycoconjugate is O-acetylated and the S. pneumoniae serotype 18C glycoconjugate is de-O-acetylated.

In some embodiments, the S. pneumoniae serotype 1 glycoconjugate comprises a saccharide having a degree of O-acetylation of between 10 and 100%, between 20 and 100%, between 30 and 100%, between 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 75 to 100%, 80 to 100%, 90 to 100% 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In other embodiments, the degree of O-acetylation is >10%, >20%, >30%, >40%, >50%, >60%, >70%, >80%, >90%, or about 100 %.

In some embodiments, the S. pneumoniae serotype 7F glycoconjugate comprises a saccharide having a degree of O-acetylation of between 10 and 100%, between 20 and 100%, between 30 and 100%, between 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 75 to 100%, 80 to 100%, 90 to 100% 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In other embodiments, the degree of O-acetylation is >10%, >20%, >30%, >40%, >50%, >60%, >70%, >80%, >90%, or about 100 %.

In some embodiments, the S. pneumoniae serotype 9V glycoconjugate comprises a saccharide having a degree of O-acetylation of between 10 and 100%, between 20 and 100%, between 30 and 100%, between 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 75 to 100%, 80 to 100%, 90 to 100% 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In other embodiments, the degree of O-acetylation is >10%, >20%, >30%, >40%, >50%, >60%, >70%, >80%, >90%, or about 100 %.

In some embodiments, the S. pneumoniae serotype 18C glycoconjugate comprises a saccharide having a degree of O-acetylation of between 10 and 100%, between 20 and 100%, between 30 and 100%, between 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 75 to 100%, 80 to 100%, 90 to 100% 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In other embodiments, the degree of O-acetylation is >10%, >20%, >30%, >40%, >50%, >60%, >70%, >80%, >90%, or about 100 %. However, it is preferable that the S. pneumoniae serotype 18C glycoconjugate is deacetylated. In some of said embodiments, the S. pneumoniae serotype 18C glycoconjugate comprises a saccharide having a degree of O-acetylation of between 0 and 50%, between 0 and 40%, between 0 and 30%, between 0 and 20%, between 0 to 10%, between 0 and 5%, or between 0 and 2%. In other embodiments, the degree of O-acetylation is <50%, <40%, <30%, <20%, <10%, <5%, <2%, or <1%.

Percent O-acetylation is the percentage of a given saccharide relative to 100% (where each repeat unit is fully acetylated relative to its acetylated backbone).

In some embodiments, the glycoconjugates of the present invention comprise a saccharide having a molecular weight between 5 kDa and 2,000 kDa. In other embodiments, the saccharide has a molecular weight between 50 kDa and 1,000 kDa. In other embodiments, the saccharide has a molecular weight between 70 kDa and 900 kDa. In other embodiments, the saccharide has a molecular weight between 100 kDa and 800 kDa. In other embodiments, the saccharide has a molecular weight between 200 kDa and 600 kDa. In other such embodiments, the saccharide has a molecular weight between 100 kDa and 1000 kDa; between 100 kDa and 900 kDa; between 100 kDa and 800 kDa; between 100kDa and 700kDa; between 100 kDa and 600 kDa; between 100kDa and 500kDa; between 100 kDa and 400 kDa; between 100 kDa and 300 kDa; between 150 kDa and 1,000 kDa; between 150kDa and 900kDa; between 150kDa and 800kDa; between 150kDa and 700kDa; between 150kDa and 600kDa; between 150kDa and 500kDa; between 150 kDa and 400 kDa; between 150kDa and 300kDa; between 200 kDa and 1,000 kDa; between 200 kDa and 900 kDa; between 200 kDa and 800 kDa; between 200 kDa and 700 kDa; between 200 kDa and 600 kDa; between 200 kDa and 500 kDa; between 200 kDa and 400 kDa; between 200 kDa and 300; between 250 kDa and 1,000 kDa; between 250kDa and 900kDa; between 250kDa and 800kDa; between 250kDa and 700kDa; between 250kDa and 600kDa; between 250kDa and 500kDa; between 250kDa and 400kDa; between 250kDa and 350kDa; between 300 kDa and 1,000 kDa; between 300 kDa and 900 kDa; between 300 kDa and 800 kDa; between 300 kDa and 700 kDa; between 300 kDa and 600 kDa; between 300 kDa and 500 kDa; between 300 kDa and 400 kDa; between 400 kDa and 1,000 kDa; between 400 kDa and 900 kDa; between 400kDa and 800kDa; between 400kDa and 700kDa; between 400kDa and 600kDa; between 500 kDa and 600 kDa. In other embodiments, the saccharide has a molecular weight between 5 kDa and 100 kDa; between 7 kDa and 100 kDa; between 10 kDa and 100 kDa; between 20 kDa and 100 kDa; between 30 kDa and 100 kDa; between 40 kDa and 100 kDa; between 50kDa and 100kDa; between 60 kDa and 100 kDa; between 70 kDa and 100 kDa; between 80 kDa and 100 kDa; between 90 kDa and 100 kDa; between 5 kDa and 90 kDa; between 5 kDa and 80 kDa; between 5 kDa and 70 kDa; between 5 kDa and 60 kDa; between 5 kDa and 50 kDa; between 5 kDa and 40 kDa; between 5 kDa and 30 kDa; between 5 kDa and 20 kDa; or between 5 kDa and 10 kDa. Any integer within any of the above ranges is contemplated as an embodiment of the disclosure. In some of these embodiments, the glycoconjugate is prepared by reductive amination.

In some embodiments, the glycoconjugate of the invention has a molecular weight between 100 kDa and 15,000 kDa; between 500 kDa and 10,000 kDa; between 2,000 kDa and 10,000 kDa; between 3,000 kDa and 8,000 kDa; or between 3,000 kDa and 5,000 kDa. In other embodiments, the glycoconjugate has a molecular weight between 500 kDa and 10,000 kDa. In other embodiments, the glycoconjugate has a molecular weight between 1,000 kDa and 8,000 kDa. In other embodiments, the glycoconjugate has a molecular weight of between 2,000 kDa and 8,000 kDa or between 3,000 kDa and 7,000 kDa. In other embodiments, the glycoconjugate of the invention has a molecular weight between 200 kDa and 20,000 kDa; between 200 kDa and 15,000 kDa; between 200 kDa and 10,000 kDa; between 200 kDa and 7,500 kDa; between 200 kDa and 5,000 kDa; between 200 kDa and 3,000 kDa; between 200 kDa and 1,000 kDa; between 500 kDa and 20,000 kDa; between 500 kDa and 15,000 kDa; between 500 kDa and 12,500 kDa; between 500 kDa and 10,000 kDa; between 500 kDa and 7,500 kDa; between 500 kDa and 6,000 kDa; between 500 kDa and 5,000 kDa; between 500 kDa and 4,000 kDa; between 500 kDa and 3,000 kDa; between 500 kDa and 2,000 kDa; between 500 kDa and 1,500 kDa; between 500 kDa and 1,000 kDa; between 750 kDa and 20,000 kDa; between 750 kDa and 15,000 kDa; between 750kDa and 12,500kDa; between 750 kDa and 10,000 kDa; between 750 kDa and 7,500 kDa; between 750 kDa and 6,000 kDa; between 750 kDa and 5,000 kDa; between 750 kDa and 4,000 kDa; between 750 kDa and 3,000 kDa; between 750 kDa and 2,000 kDa; between 750 kDa and 1,500 kDa; between 1,000 kDa and 15,000 kDa; between 1,000 kDa and 12,500 kDa; between 1,000 kDa and 10,000 kDa; between 1,000 kDa and 7,500 kDa; between 1,000 kDa and 6,000 kDa; between 1,000 kDa and 5,000 kDa; between 1,000 kDa and 4,000 kDa; between 1,000 kDa and 2,500 kDa; between 2,000 kDa and 15,000 kDa; between 2,000 kDa and 12,500 kDa; between 2,000 kDa and 10,000 kDa; between 2,000 kDa and 7,500 kDa; between 2,000 kDa and 6,000 kDa; between 2,000 kDa and 5,000 kDa; between 2,000 kDa and 4,000 kDa; or between 2,000 kDa and 3,000 kDa.

In other embodiments, the glycoconjugate of the invention has a molecular weight between 3,000 kDa and 20,000 kDa; between 3,000 kDa and 15,000 kDa; between 3,000 kDa and 10,000 kDa; between 3,000 kDa and 7,500 kDa; between 3,000 kDa and 5,000 kDa; between 4,000 kDa and 20,000 kDa; between 4,000 kDa and 15,000 kDa; between 4,000 kDa and 12,500 kDa; between 4,000 kDa and 10,000 kDa; between 4,000 kDa and 7,500 kDa; between 4,000 kDa and 6,000 kDa; or between 4,000 kDa and 5,000 kDa.

In other embodiments, the glycoconjugate of the invention has a molecular weight between 5,000 kDa and 20,000 kDa; between 5,000 kDa and 15,000 kDa; between 5,000 kDa and 10,000 kDa; between 5,000 kDa and 7,500 kDa; between 6,000 kDa and 20,000 kDa; between 6,000 kDa and 15,000 kDa; between 6,000 kDa and 12,500 kDa; between 6,000 kDa and 10,000 kDa or between 6,000 kDa and 7,500 kDa.

In other embodiments, the glycoconjugate of the invention has a molecular weight between 100 kDa and 250 kDa; between 100kDa and 500kDa; between 100 kDa and 750 kDa; between 100kDa and 1000kDa; between 100kDa and 1500kDa; between 100kDa and 2000kDa; between 100kDa and 2500kDa; between 100kDa and 3000kDa; between 250kDa and 500kDa; between 250kDa and 1000kDa; between 250kDa and 1500kDa; between 250 kDa and 2000 kDa or between 250 kDa and 2500 kDa.

The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any integer within any of the above ranges is contemplated as an embodiment of the disclosure.

In a preferred embodiment, the serotype 22F glycoconjugate of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 or 0.7 or about 0.8 mM of acetate per mM of polysaccharide of serotype 22F. In a preferred embodiment, the glycoconjugate comprises at least 0.5, 0.6 or 0.7 mM acetate per mM serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.6 mM acetate per mM serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.7 mM acetate per mM serotype 22F polysaccharide.

In a preferred embodiment, the serotype 33F glycoconjugate of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM acetate per mM of capsular polysaccharide of serotype 33F. In a preferred embodiment, the glycoconjugate comprises at least 0.5, 0.6 or 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.6 mM acetate per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the presence of O-acetyl groups is determined by ion HPLC analysis.

In a preferred embodiment, the serotype 15B glycoconjugate of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM acetate per mM of capsular polysaccharide of serotype 15B. In a preferred embodiment, the glycoconjugate comprises at least 0.5, 0.6 or 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.6 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the presence of O-acetyl groups is determined by ion HPLC analysis.

In a preferred embodiment, the serotype 15B glycoconjugate of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM of glycerol per mM of capsular polysaccharide of serotype 15B. In a preferred embodiment, the serotype 15B glycoconjugate of the invention comprises at least 0.5, 0.6 or 0.7 mM of glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the invention comprises at least 0.6 mM glycerol per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the invention comprises at least 0.7 mM glycerol per mM serotype 15B capsular polysaccharide.

In a preferred embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.3, 0.5, 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, 3, 0, 3.4, 3.8, 4.2, 4.6, or about 5.0 mM acetate per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate comprises at least 1.8, 2.2, or 2.6 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the glycoconjugate comprises at least 0.6 mM acetate per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, 3.0, 3.4, 3, 8, 4.2 or about 4.6 mM acetate per mM serotype 11A polysaccharide and less than about 5.0 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, or about 3.0 mM acetate per mM acetate. serotype 11A polysaccharide and less than about 3.4 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, or about 3.0 mM acetate per mM acetate. serotype 11A polysaccharide and less than about 3.3 mM acetate per mM serotype 11A polysaccharide. Any of the preceding numbers is contemplated as an embodiment of the disclosure.

In a preferred embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0, 9 or about 1.0 mM of glycerol per mM of serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate comprises at least 0.2, 0.3, or 0.4 mM glycerol per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or about 0 0.9 mM glycerol per mM serotype 11A polysaccharide and less than about 1.0 mM glycerol per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.3, 0.4, 0.5, 0.6, or about 0.7 mM of glycerol per mM of serotype 11A polysaccharide and less than about 0.8 mM glycerol per mM serotype 11A polysaccharide. Any of the preceding numbers is contemplated as an embodiment of the disclosure.

Another way to characterize the glycoconjugates of the invention is by the number of lysine residues in the carrier protein (eg CRM ¹⁹⁷ ) that are conjugated to the saccharide, which can be characterized as a range of conjugated lysines (degree of conjugation). Evidence of modification of carrier protein lysines due to covalent bonds to polysaccharides can be obtained by amino acid analysis using standard methods known to those skilled in the art. Conjugation results in a reduction in the number of lysine residues recovered, compared to the carrier protein starting material used to generate the conjugated materials. In a preferred embodiment, the degree of conjugation of the glycoconjugate of the invention is between 2 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15 or between 10 and 12. In one embodiment, the degree of conjugation of the glycoconjugate of the invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the degree conjugation of the glycoconjugate of the invention is between 4 and 7. In some of these embodiments, the carrier protein is CRM ¹⁹⁷ .

The glycoconjugates of the invention may also be characterized by the ratio (w/w) of saccharide to carrier protein. In some embodiments, the ratio of polysaccharide to carrier protein in the glycoconjugate (w/w) is between 0.5 and 3 (eg, about 0.5, about 0.6, about 0.7, about 0). .8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 17, about 1.8 , about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8 , about 2.9 or about 3.0). In other embodiments, the saccharide to carrier protein ratio (w/w) is between 0.5 and 2.0, between 0.5 and 1.5, between 0.8 and 1.2, between 0.5 and 1.0, between 1.0 and 1.5, or between 1.0 and 2.0. In other embodiments, the saccharide to carrier protein ratio (w/w) is between 0.8 and 1.2. In a preferred embodiment, the ratio of capsular polysaccharide to carrier protein in the conjugate is between 0.9 and 1.1. In some of these embodiments, the carrier protein is CRM ¹⁹⁷ .

The glycoconjugates and immunogenic compositions of the invention may contain a free saccharide that is not covalently conjugated to the carrier protein, but is nevertheless present in the glycoconjugate composition. The free saccharide may be non-covalently associated with the glycoconjugate (ie, non-covalently bound to it, adsorbed on it, or entrapped within or with it).

In a preferred embodiment, the glycoconjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment, the glycoconjugate comprises less than about 25% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment, the glycoconjugate comprises less than about 20% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment, the glycoconjugate comprises less than about 15% free polysaccharide compared to the total amount of polysaccharide.

Glycoconjugates can also be characterized by their molecular size distribution (K ^d ). A size exclusion chromatography medium (LC-4B) can be used to determine the relative molecular size distribution of the conjugate. Size exclusion chromatography (SEC) is used on gravity-loaded columns to profile the molecular size distribution of conjugates. Large molecules excluded from the pores of the medium elute faster than small molecules. Fraction collectors are used to collect the eluate from the column. The fractions are colorimetrically analyzed by a saccharide assay. For the determination of K ^d , the columns are calibrated to establish the fraction in which the molecules are totally excluded (V ⁰ ), (K ^d = 0), and the fraction that represents the maximum retention (V ⁱ ), (K ^d = 1). The fraction at which a certain attribute of the sample (V ^e ) is reached, is related to the K ^d through the expression K ^d = (V ^e - V ⁰ )/ (V ⁱ -V ⁰ ).

In a preferred embodiment, at least 30% of the glycoconjugate has a ^Kd of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, at least 40% of the glycoconjugate has a ^Kd of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the glycoconjugate has a ^Kd of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, at least 60% of the glycoconjugate has a ^Kd of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, between 50% and 80% of the glycoconjugate has a K ^d of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, between 65% and 80% of the glycoconjugate has a K ^d of less than or equal to 0.3 on a CL-4B column. The frequency of binding of the saccharide chain to a carrier protein lysine is another parameter to characterize the glycoconjugates of the invention. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 4 saccharide repeat units of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide occurs at least once for every 10 saccharide repeat units of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide occurs at least once for every 15 saccharide repeat units of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide occurs at least once for every 25 saccharide repeat units of the polysaccharide.

In common embodiments, the carrier protein is CRM ¹⁹⁷ , and the covalent bond through an eTEC spacer between the CRM ¹⁹⁷ and the polysaccharide occurs at least once per 4, 10, 15, or 25 saccharide repeat units of the polysaccharide. .

In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 5 to 10 saccharide repeat units; every 2 to 7 saccharide repeat units; every 3 to 8 saccharide repeat units; every 4 to 9 saccharide repeat units; each 6 to 11 saccharide repeat units; every 7 to 12 saccharide repeat units; every 8 to 13 repeat units saccharides; each 9 to 14 saccharide repeat units; every 10 to 15 saccharide repeat units; every 2 to 6 saccharide repeat units, every 3 to 7 saccharide repeat units; every 4 to 8 saccharide repeat units; every 6 to 10 saccharide repeat units; each 7 to 11 saccharide repeat units; every 8 to 12 saccharide repeat units; each 9 to 13 saccharide repeat units; every 10 to 14 saccharide repeat units; every 10 to 20 saccharide repeat units; every 4 to 25 saccharide repeat units or every 2 to 25 saccharide repeat units. In common embodiments, the carrier protein is CRM ¹⁹⁷ .

In another embodiment, at least one bond between the carrier protein and the saccharide occurs for every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24 or 25 saccharide repeat units of the polysaccharide. In one embodiment, the carrier protein is CRM ^197. Any integer within any of the above ranges is contemplated as an embodiment of the disclosure.

1.3.2 Glucoconjugates of serotype 18C of the invention

In one embodiment, the 18C glycoconjugates of the invention are as defined in this section.

S. pneumoniae serotype 18C capsular polysaccharides are prepared as described above.

In one embodiment, the polysaccharides are activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated saccharide is then coupled directly or through a spacer (linker) group to an amino group of the carrier protein (preferably CRM ¹⁹⁷ ). For example, the spacer can be cystamine or cysteamine to give a thiolated polysaccharide that can be coupled to the carrier through a thioether bond obtained upon reaction with a maleimide-activated carrier protein (for example, using the N-[ymaleimidobutyryloxy ester ]succinimide (GMBS)) or a haloacetylated carrier protein (for example, using iodoacetimide, N-succinimidyl bromoacetate (SBA; SIB), N-succinimidyl(4-iodoacetyl)aminobenzoate (SIAB), sulfosuccinimidyl(4-iodoacetyl)aminobenzoate ( sulfo-SIAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamido]proprionate (SBAP)). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexanediamine or adipic acid hydrazide (ADH) and the amino-derivatized saccharide is conjugated to the carrier protein (eg, CRM ¹⁹⁷ ) by using the carbodiimide chemistry (eg, EDAc or EDC) through a carboxyl group on the carrier protein. Such conjugates are described, for example, in WO 93/15760, WO 95/08348 and WO 96/129094.

In one embodiment of the present invention, the S. pneumoniae serotype 18C glycoconjugate is prepared using CDAP chemistry.

Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, pnitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many of these are described in International Patent Application Publication No. WO 98/42721. The conjugation may involve a carbonyl linker which can be formed by reaction of a free hydroxyl group on the saccharide with CDI (Bethell et al. (1979), J. Biol. Chem., 254:2572-2574; Hearn et al. (1981). ), J. Chromatogr., 218:509-518), followed by reaction with a protein to form a carbamate bond. This may involve reduction of the anomeric terminal to a primary hydroxyl group, optional protection/deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDl carbamate intermediate with an amino group in a protein.

In a preferred embodiment, the S. pneumoniae serotype 18C capsular polysaccharide is conjugated to the carrier protein by reductive amination (as described in published US Patent Application ^Nos . 2006/0228380, 2007/184072 , 2007/0231340 and 2007/0184071, WO 2006/110381, WO 2008/079653 and WO 2008/143709).

Reductive amination involves two steps, as described above.

In some embodiments, the S. pneumoniae serotype 18C glycoconjugate of the invention is O-acetylated. In some embodiments, the S. pneumoniae serotype 18C glycoconjugate of the invention is de-O-acetylated.

In some embodiments, the S. pneumoniae serotype 18C glycoconjugate comprises a saccharide having a degree of O-acetylation of between 10 and 100%, between 20 and 100%, between 30 and 100%, between 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 75 to 100%, 80 to 100%, 90 to 100% 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In other embodiments, the degree of O-acetylation is >10%, >20%, >30%, >40%, >50%, >60%, >70%, >80%, >90%, or about 100 %. However, it is preferable that the S. pneumoniae serotype 18C glycoconjugate is de-O-acetylated. In some of said embodiments, the S. pneumoniae serotype 18C glycoconjugate comprises a saccharide having a degree of O-acetylation of between 0 and 50%, between 0 and 40%, between 0 and 30%, between 0 and 20%. , between 0 and 10%, between 0 and 5%, or between 0 and 2%. In other embodiments, the degree of O-acetylation is <50%, <40%, <30%, <20%, <10%, <5%, <2%, or <1%.

Percent O-acetylation is the percentage of a given saccharide relative to 100 % (where each repeat unit is fully acetylated relative to its acetylated backbone).

In some embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention comprises a saccharide having a molecular weight between 5 kDa and 2,000 kDa. In other embodiments, the saccharide has a molecular weight between 10 kDa and 1,000 kDa. In other embodiments, the saccharide has a molecular weight between 15 kDa and 900 kDa. In other embodiments, the saccharide has a molecular weight between 20 kDa and 800 kDa. In other such embodiments, the saccharide has a molecular weight between 100 kDa and 1000 kDa; between 100 kDa and 900 kDa; between 100 kDa and 800 kDa; between 100kDa and 700kDa; between 100 kDa and 600 kDa; between 100kDa and 500kDa; between 100 kDa and 400 kDa; between 100 kDa and 300 kDa; between 150 kDa and 1,000 kDa; between 150kDa and 900kDa; between 150kDa and 800kDa; between 150kDa and 700kDa; between 150kDa and 600kDa; between 150kDa and 500kDa; between 150 kDa and 400 kDa; between 150kDa and 300kDa; between 200 kDa and 1,000 kDa; between 200 kDa and 900 kDa; between 200 kDa and 800 kDa; between 200 kDa and 700 kDa; between 200 kDa and 600 kDa; between 200 kDa and 500 kDa; between 200 kDa and 400 kDa; between 200 kDa and 300; between 250 kDa and 1,000 kDa; between 250kDa and 900kDa; between 250kDa and 800kDa; between 250kDa and 700kDa; between 250kDa and 600kDa; between 250kDa and 500kDa; between 250kDa and 400kDa; between 250kDa and 350kDa; between 300 kDa and 1,000 kDa; between 300 kDa and 900 kDa; between 300 kDa and 800 kDa; between 300 kDa and 700 kDa; between 300 kDa and 600 kDa; between 300 kDa and 500 kDa; between 300 kDa and 400 kDa; between 400 kDa and 1,000 kDa; between 400 kDa and 900 kDa; between 400kDa and 800kDa; between 400kDa and 700kDa; between 400kDa and 600kDa; between 500 kDa and 600 kDa. In other preferred embodiments, the saccharide has a molecular weight between 5 kDa and 100 kDa; between 7 kDa and 100 kDa; between 10 kDa and 100 kDa; between 20 kDa and 100 kDa; between 30 kDa and 100 kDa; between 40 kDa and 100 kDa; between 50kDa and 100kDa; between 60 kDa and 100 kDa; between 70 kDa and 100 kDa; between 80 kDa and 100 kDa; or between 90 kDa and 100 kDa. In other preferred embodiments, the saccharide has a molecular weight between 5 kDa and 90 kDa; between 5 kDa and 80 kDa; between 5 kDa and 70 kDa; between 5 kDa and 60 kDa; between 5 kDa and 50 kDa; between 5 kDa and 40 kDa; between 5 kDa and 30 kDa; between 5 kDa and 20 kDa; between 5 kDa and 10 kDa; between 10 kDa and 90 kDa; between 10 kDa and 80 kDa; between 10 kDa and 70 kDa; between 10 kDa and 60 kDa; between 10 kDa and 50 kDa; between 10 kDa and 40 kDa; between 10 kDa and 30 kDa; between 10 kDa and 20 kDa, 20 kDa and 90 kDa; between 20 kDa and 80 kDa; between 20 kDa and 70 kDa; between 20 kDa and 60 kDa; between 20 kDa and 50 kDa; between 20 kDa and 40 kDa; or between 20 kDa and 30 kDa. In other preferred embodiments, the saccharide has a molecular weight between 30 kDa and 90 kDa; between 30 kDa and 80 kDa; between 30 kDa and 70 kDa; between 30 kDa and 60 kDa; between 30 kDa and 50 kDa; between 30 kDa and 40 kDa; between 40 kDa and 90 kDa; between 40 kDa and 80 kDa; between 40kDa and 70kDa; between 40 kDa and 60 kDa; between 40kDa and 50kDa; between 50kDa and 90kDa; between 50kDa and 80kDa; between 50kDa and 70kDa; or between 50 kDa and 60 kDa. Any integer within any of the above ranges is contemplated as an embodiment of the disclosure. In some of these embodiments, the glycoconjugate is prepared by reductive amination.

In some embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight between 100 kDa and 20,000 kDa; between 200 kDa and 10,000 kDa; or between 300 kDa and 5,000 kDa. In other embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight of between 100 kDa and 5,000 kDa; between 150 kDa and 4,000 kDa; between 200 kDa and 3,000 kDa; or between 250 kDa and 2,000 kDa. In other embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight of between 100 kDa and 2,000 kDa; between 150 kDa and 2,000 kDa; between 200 kDa and 2,000 kDa; between 250 kDa and 2,000 kDa; between 300 kDa and 2,000 kDa; between 350 kDa and 2,000 kDa; between 400 kDa and 2,000 kDa; between 450 kDa and 2,000 kDa; between 500 kDa and 2,000 kDa; between 550 kDa and 2,000 kDa; between 600 kDa and 2,000 kDa; between 700 kDa and 2,000 kDa; between 800 kDa and 2,000 kDa; between 900 kDa and 2,000 kDa; between 1,000 kDa and 2,000 kDa; between 1,250 kDa and 2,000 kDa; between 1,500 kDa and 2,000 kDa or between 1,750 kDa and 2,000 kDa. In other embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight of between 150 kDa and 2,000 kDa; between 150 kDa and 1,900 kDa; between 150 kDa and 1,800 kDa; between 150 kDa and 1,700 kDa; between 150 kDa and 1,600 kDa; between 150 kDa and 1,500 kDa; between 150 kDa and 1,400 kDa; between 150 kDa and 1,300 kDa; between 150 kDa and 1,200 kDa; between 150 kDa and 1,100 kDa; between 150 kDa and 1,000 kDa; between 150kDa and 900kDa; between 150kDa and 800kDa; between 150kDa and 700kDa; between 150kDa and 600kDa; between 150kDa and 500kDa; between 150 kDa and 400 kDa; between 150kDa and 300kDa; or between 150 kDa and 200 kDa. In other embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight of between 200 kDa and 2,000 kDa; between 200 kDa and 1,900 kDa; between 200 kDa and 1,800 kDa; between 200 kDa and 1,700 kDa; between 200 kDa and 1,600 kDa; between 200 kDa and 1,500 kDa; between 200 kDa and 1,400 kDa; between 200 kDa and 1,300 kDa; between 200 kDa and 1,200 kDa; between 200 kDa and 1,100 kDa; between 200 kDa and 1,000 kDa; between 200 kDa and 900 kDa; between 200 kDa and 800 kDa; between 200 kDa and 700 kDa; between 200 kDa and 600 kDa; between 200 kDa and 500 kDa; between 200 kDa and 400 kDa; or between 200 kDa and 300 kDa. In other embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight of between 250 kDa and 2,000 kDa; between 250 kDa and 1,900 kDa; between 250 kDa and 1,800 kDa; between 250 kDa and 1,700 kDa; between 250 kDa and 1,600 kDa; between 250 kDa and 1,500 kDa; between 250 kDa and 1,400 kDa; between 250 kDa and 1,300 kDa; between 250 kDa and 1,200 kDa; between 250 kDa and 1,100 kDa; between 250 kDa and 1,000 kDa; between 250kDa and 900kDa; between 250kDa and 800kDa; between 250kDa and 700kDa; between 250kDa and 600kDa; between 250kDa and 500kDa; between 250kDa and 400kDa; or between 250 kDa and 300 kDa. In other embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight of between 300 kDa and 2,000 kDa; between 300 kDa and 1,900 kDa; between 300 kDa and 1,800 kDa; between 300 kDa and 1,700 kDa; between 300 kDa and 1,600 kDa; between 300 kDa and 1,500 kDa; between 300 kDa and 1,400 kDa; between 300 kDa and 1,300 kDa; between 300 kDa and 1,200 kDa; between 300 kDa and 1,100 kDa; between 300 kDa and 1,000 kDa; between 300 kDa and 900 kDa; between 300 kDa and 800 kDa; between 300 kDa and 700 kDa; between 300 kDa and 600 kDa; between 300 kDa and 500 kDa; or between 300 kDa and 400 kDa. In other embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight of between 400 kDa and 2,000 kDa; between 400 kDa and 1,900 kDa; between 400 kDa and 1,800 kDa; between 400 kDa and 1,700 kDa; between 400 kDa and 1,600 kDa; between 400 kDa and 1,500 kDa; between 400 kDa and 1,400 kDa; between 400 kDa and 1,300 kDa; between 400 kDa and 1,200 kDa; between 400 kDa and 1,100 kDa; between 400 kDa and 1,000 kDa; between 400 kDa and 900 kDa; between 400kDa and 800kDa; between 400kDa and 700kDa; between 400kDa and 600kDa; or between 400 kDa and 500 kDa. In other embodiments, the S. pneumoniae serotype 18C glycoconjugate of the present invention has a molecular weight of between 500 kDa and 2,000 kDa; between 500 kDa and 1,900 kDa; between 500 kDa and 1,800 kDa; between 500 kDa and 1,700 kDa; between 500 kDa and 1,600 kDa; between 500 kDa and 1,500 kDa; between 500 kDa and 1,400 kDa; between 500 kDa and 1,300 kDa; between 500 kDa and 1,200 kDa; between 500 kDa and 1,100 kDa; between 500 kDa and 1,000 kDa; between 500kDa and 900kDa; between 500kDa and 800kDa; between 500kDa and 700kDa; or between 500 kDa and 600 kDa.

The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any integer within any of the above ranges is contemplated as an embodiment of the disclosure.

Another way to characterize the glycoconjugates of the invention is by the number of lysine residues in the carrier protein (eg CRM ¹⁹⁷ ) that are conjugated to the saccharide, which can be characterized as a range of conjugated lysines (degree of conjugation). Evidence of modification of carrier protein lysines due to covalent bonds to polysaccharides can be obtained by amino acid analysis using standard methods known to those skilled in the art. Conjugation results in a reduction in the number of lysine residues recovered, compared to the carrier protein starting material used to generate the conjugated materials. In a preferred embodiment, the conjugation degree of the S. pneumoniae serotype 18C glycoconjugate of the invention is between 2 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15, or between 10 and 12. In one embodiment, the degree of conjugation of the S. pneumoniae serotype 18C glycoconjugate of the invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the degree of conjugation of the serotype 18C glycoconjugate of S. pneumoniae of the invention is between 4 and 7. In some of these embodiments, the carrier protein is CRM ¹⁹⁷ .

The S. pneumoniae serotype 18C glycoconjugate of the invention can also be characterized by the ratio (w/w) of saccharide to carrier protein. In some embodiments, the ratio of polysaccharide to carrier protein in the S. pneumoniae serotype 18C glycoconjugate of the invention (on a w/w basis) is between 0.5 and 3 (eg, about 0.5, about 0 .6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1 .6, about 17, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6 , about 2.7, about 2.8, about 2.9, or about 3.0). In other embodiments, the saccharide to carrier protein ratio (w/w) is between 0.5 and 2.0, between 0.5 and 1.5, between 0.8 and 1.2, between 0.5 and 1.0, between 1.0 and 1.5, or between 1.0 and 2.0. In other embodiments, the saccharide to carrier protein ratio (w/w) is between 0.8 and 1.2. In a preferred embodiment, the ratio of capsular polysaccharide to carrier protein in the conjugate is between 0.9 and 1.1. In some of these embodiments, the carrier protein is CRM ¹⁹⁷ .

In a preferred embodiment, the S. pneumoniae serotype 18C glycoconjugate of the invention comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free polysaccharide compared to with the total amount of polysaccharide. In a preferred embodiment, the glycoconjugate comprises less than about 25% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment, the glycoconjugate comprises less than about 20% free polysaccharide compared to the total amount of polysaccharide. In a preferred embodiment, the glycoconjugate comprises less than about 15% free polysaccharide compared to the total amount of polysaccharide.

Glycoconjugates can also be characterized by their molecular size distribution (K ^d ). A size exclusion chromatography medium (LC-4B) can be used to determine the relative molecular size distribution of the conjugate. Size exclusion chromatography (SEC) is used on gravity-loaded columns to profile the molecular size distribution of conjugates. Large molecules excluded from the pores of the medium elute faster than small molecules. Fraction collectors are used to collect the eluate from the column. The fractions are colorimetrically analyzed by a saccharide assay. For the determination of K ^d , the columns are calibrated to establish the fraction in which the molecules are totally excluded (V ⁰ ), (K ^d = 0), and the fraction that represents the maximum retention (V ⁱ ), (K ^d = 1). The fraction at which a certain attribute of the sample (V ^e ) is reached, is related to the K ^d through the expression K ^d = (V ^e - V ⁰ )/ (V ⁱ -V ⁰ ).

In a preferred embodiment, at least 30% of the S. pneumoniae serotype 18C glycoconjugate of the invention has a ^Kd of less than or equal to 0.3 on a CL-4b column. In a preferred embodiment, at least 40% of the glycoconjugate has a ^Kd of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the glycoconjugate has a lower K ^d or equal to 0.3 on a CL-4B column. In a preferred embodiment, at least 60 % of the glycoconjugate has a K of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, between 50% and 80% of the glycoconjugate has a K ^d of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, between 65% and 80% of the glycoconjugate has a K ^d of less than or equal to 0.3 on a CL-4B column.

The frequency of binding of the saccharide chain to a lysine on the carrier protein is another parameter to characterize the S. pneumoniae serotype 18C glycoconjugate. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 4 saccharide repeat units of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide occurs at least once for every 10 saccharide repeat units of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide occurs at least once for every 15 saccharide repeat units of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide occurs at least once for every 25 saccharide repeat units of the polysaccharide.

In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 5 to 10 saccharide repeat units; every 2 to 7 saccharide repeat units; every 3 to 8 saccharide repeat units; every 4 to 9 saccharide repeat units; each 6 to 11 saccharide repeat units; every 7 to 12 saccharide repeat units; each 8 to 13 saccharide repeat units; each 9 to 14 saccharide repeat units; every 10 to 15 saccharide repeat units; every 2 to 6 saccharide repeat units, every 3 to 7 saccharide repeat units; every 4 to 8 saccharide repeat units; every 6 to 10 saccharide repeat units; each 7 to 11 saccharide repeat units; every 8 to 12 saccharide repeat units; each 9 to 13 saccharide repeat units; every 10 to 14 saccharide repeat units; every 10 to 20 saccharide repeat units; every 4 to 25 saccharide repeat units; or every 2 to 25 saccharide repeat units. In common embodiments, the carrier protein is CRM ¹⁹⁷ .

In another embodiment, at least one bond between the carrier protein and the saccharide occurs for every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24 or 25 saccharide repeat units of the polysaccharide. In one embodiment, the carrier protein is CRM ^197. Any integer within any of the above ranges is contemplated as an embodiment of the disclosure.

1.4 Combination of glycoconjugates of the invention

In one embodiment, the immunogenic composition of the invention comprises any of the glycoconjugates disclosed herein.

1.4.1 Combinations of glycoconjugates

The immunogenic composition of the invention comprises at least one glycoconjugate of each of the following thirteen serotypes of S. pneumoniae : 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F.

1.4.2 Other combinations of glycoconjugates

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one S. pneumoniae serotype 15B glycoconjugate.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one S. pneumoniae serotype 22F glycoconjugate.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one S. pneumoniae serotype 33F glycoconjugate.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one S. pneumoniae serotype 8 glycoconjugate.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one S. pneumoniae serotype 10A glycoconjugate.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one S. pneumoniae serotype 11A glycoconjugate.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one S. pneumoniae serotype 12F glycoconjugate.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprises at least one glycoconjugate of each of the following two serotypes of S. pneumoniae :

15B and 22F,

15B and 33F,

15B and 12F,

15B and 10A,

15B and 11A,

15B and 8,

22F and 33F,

22F and 12F,

22F and 10A,

22F and 11A,

22F and 8,

33F and 12F,

33F and 10A,

33F and 11A,

33F and 8,

12F and 10A,

12F and 11A,

12F and 8,

10A and 11A,

10A and 8, or

11A and 8.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one glycoconjugate from each of the following three serotypes of S. pneumoniae :

15B and 22F and 33F,

15B and 22F and 12F,

15B and 22F and 10A,

15B and 22F and 11A,

15B and 22F and 8,

15B and 33F and 12F,

15B and 33F and 10A,

15B and 33F and 11A,

15B and 33F and 8,

15B and 12F and 10A,

15B and 12F and 11A,

15B and 12F and 8,

15B and 10A and 11A,

15B and 10A and 8,

15B and 11A and 8,

22F and 33F and 12F,

22F and 33F and 10A,

22F and 33F and 11A,

22F and 33F and 8,

22F and 12F and 10A,

22F and 12F and 11A,

22F and 12F and 8,

22F and 10A and 11A,

22F and 10A and 8,

22F and 11A and 8,

33F and 12F and 10A,

33F and 12F and 11A,

33F and 12F and 8,

33F and 10A and 11A,

33F and 10A and 8,

33F and 11A and 8,

12F and 10A and 11A,

12F and 10A and 8,

12F and 11A and 8, or

10A and 11A and 8.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one glycoconjugate from each of the following four serotypes of S. pneumoniae :

15B and 22F and 33F and 12F,

15B and 22F and 33F and 10A,

15B and 22F and 33F and 11A,

15B and 22F and 33F and 8,

15B and 22F and 12F and 10A,

15B and 22F and 12F and 11A,

15B and 22F and 12F and 8,

15B and 22F and 10A and 11A,

15B and 22F and 10A and 8,

15B and 22F and 11A and 8,

15B and 33F and 12F and 10A,

15B and 33F and 12F and 11A,

15B and 33F and 12F and 8,

15B and 33F and 10A and 11A,

15B and 33F and 10A and 8,

15B and 33F and 11A and 8,

15B and 12F and 10A and 11A,

15B and 12F and 10A and 8,

15B and 12F and 11A and 8,

15B and 10A and 11A and 8,

22F and 33F and 12F and 10A,

22F and 33F and 12F and 11A,

22F and 33F and 12F and 8,

22F and 33F and 10A and 11A,

22F and 33F and 10A and 8,

22F and 33F and 11A and 8,

22F and 12F and 10A and 11A,

22F and 12F and 10A and 8,

22F and 12F and 11A and 8,

22F and 10A and 11A and 8,

33F and 12F and 10A and 11A,

33F and 12F and 10A and 8,

33F and 12F and 11A and 8,

33F and 10A and 11A and 8 or

12F and 10A and 11A and 8.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one glycoconjugate from each of the following five S. pneumoniae serotypes:

15B and 22F and 33F and 12F and 10A,

15B and 22F and 33F and 12F and 11A,

15B and 22F and 33F and 12F and 8,

15B and 22F and 33F and 10A and 11A,

15B and 22F and 33F and 10A and 8,

15B and 22F and 33F and 11A and 8,

15B and 22F and 12F and 10A and 11A,

15B and 22F and 12F and 10A and 8,

15B and 22F and 12F and 11A and 8,

15B and 22F and 10A and 11A and 8,

15B and 33F and 12F and 10A and 11A,

15B and 33F and 12F and 10A and 8,

15B and 33F and 12F and 11A and 8,

15B and 33F and 10A and 11A and 8,

15B and 12F and 10A and 11A and 8,

22F and 33F and 12F and 10A and 11A,

22F and 33F and 12F and 10A and 8,

22F and 33F and 12F and 11A and 8,

22F and 33F and 10A and 11A and 8,

22F and 12F and 10A and 11A and 8 or

33F and 12F and 10A and 11A and 8.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprise at least one glycoconjugate from each of the following six serotypes of S. pneumoniae :

15B and 22F and 33F and 12F and 10A and 11A,

15B and 22F and 33F and 12F and 10A and 8,

15B and 22F and 33F and 12F and 11A and 8,

15B and 22F and 33F and 10A and 11A and 8,

15B and 22F and 12F and 10A and 11A and 8,

15B and 33F and 12F and 10A and 11A and 8 or

22F and 33F and 12F and 10A and 11A and 8.

In one embodiment, any of the immunogenic compositions defined in 1.4.1 above further comprises at least one glycoconjugate of each of the following seven serotypes of S. pneumoniae : 15B and 22F and 33F and 12F and 10A and 11A and 8.

In one embodiment, any of the above immunogenic compositions further comprise S. pneumoniae serotype 2 glycoconjugates.

In one embodiment, any of the above immunogenic compositions further comprise S. pneumoniae serotype 17F glycoconjugates.

In one embodiment, any of the above immunogenic compositions further comprise S. pneumoniae serotype 20 glycoconjugates.

In one embodiment, any of the above immunogenic compositions further comprise S. pneumoniae serotype 15C glycoconjugates.

Preferably, all of the glycoconjugates of the above immunogenic compositions are individually conjugated to the carrier protein.

In any of the above immunogenic compositions, S. pneumoniae serotype 18C glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 22F glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 33F glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 15B glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 33F glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 10A glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 10A glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 8 glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, glycoconjugates of S. pneumoniae serotypes 4, 6B, 9V, 14, 19F and 23F are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, glycoconjugates of S. pneumoniae serotypes 1, 5 and 7F are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotypes 6A and 19A glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 3 glycoconjugates are conjugated to CRM ¹⁹⁷ . In one embodiment of any of the above immunogenic compositions, S. pneumoniae serotype 2 glycoconjugates are conjugated to CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 17F glycoconjugates are conjugated to CRM ¹⁹⁷ . In one embodiment of any of the above immunogenic compositions, S. pneumoniae serotype 20 glycoconjugates are conjugate with CRM ¹⁹⁷ . In any of the above immunogenic compositions, S. pneumoniae serotype 15C glycoconjugates are conjugated to CRM ¹⁹⁷ .

In one embodiment, the glycoconjugates of the above immunogenic compositions are all individually conjugated to CRM ¹⁹⁷ .

In one embodiment, the above immunogenic composition comprises glycoconjugates from 16 or 20 different serotypes.

In one embodiment, the above immunogenic composition is a 14-, 15-, 16-, 17-, 18-, or 19-valent pneumococcal conjugate composition. In one embodiment, the above immunogenic composition is a 16-valent pneumococcal conjugate composition. In one embodiment, the above immunogenic composition is a 19-valent pneumococcal conjugate composition. In one embodiment, the above immunogenic composition is a 20-valent pneumococcal conjugate composition.

In one embodiment, the immunogenic composition of the invention comprises glycoconjugates of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F of S. pneumoniae .

In one embodiment, the immunogenic composition of the invention comprises glycoconjugates of serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F of S. pneumoniae.

In one embodiment, the immunogenic composition of the invention comprises conjugated saccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

In one embodiment, the immunogenic composition of the invention comprises conjugated saccharides from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F of S. pneumoniae. In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates of serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A , 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates of 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F , 23F and 33F.

Preferably, all of the glycoconjugates of the immunogenic composition of the invention are individually conjugated to the carrier protein. In one embodiment, the glycoconjugates of the above immunogenic composition are individually conjugated to CRM ¹⁹⁷ .

1.4.3 Other combinations of glycoconjugates

Any of the immunogenic compositions defined in sections 1.4.1 or 1.4.2 above do not comprise a capsular saccharide of serotypes 18F, 18A and 18B of S. pneumoniae.

2 Dosage of immunogenic compositions

2.1 Amount of polysaccharides

The amount of glycoconjugates in each dose is selected as an amount that induces an immunoprotective response without significant and adverse side effects in typical vaccinees. This amount will vary depending on the specific immunogen used and the form in which it is presented.

The amount of a particular glycoconjugate in an immunogenic composition can be calculated based on the total polysaccharides for that conjugate (conjugated and unconjugated). For example, a glycoconjugate with 20% free polysaccharide will contain about 80 μg of conjugated polysaccharide and about 20 μg of unconjugated polysaccharide in a 100 μg dose of polysaccharide. The amount of glycoconjugate can vary depending on the streptococcal serotype. Saccharide concentration can be determined by the uronic acid assay.

The "immunogenic amount" of the different polysaccharide components in the immunogenic composition may diverge and each may comprise about 1.0 μg, about 2.0 μg, about 3.0 μg, about 4.0 μg, about 5.0 jg, about 6.0 jg, about 7.0 jg, about 8.0 jg, about 9.0 jg, about 10.0 jg, about 15.0 jg, about 20.0 jg, about 30.0 jg, about 40.0 μg, about 50.0 μg, about 60.0 μg, about 70.0 μg, about 80.0 μg, about 90.0 μg, or about 100.0 μg of any particular polysaccharide antigen.

Generally, each dose will comprise from 0.1 µg to 100 µg of polysaccharide for a given serotype, particularly from 0.5 µg to 20 µg, more particularly from 1 µg to 10 µg, and even more particularly from 2 µg. jg to 5 jg. Any integer within any of the above ranges is contemplated as an embodiment of the disclosure.

In one embodiment, each dose will comprise 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 15 μg, or 20 μg of polysaccharide for a given serotype.

2.2 Carrier Quantity

Generally, each dose will comprise from 5 µg to 150 µg of carrier protein, in particular from 10 µg to 100 µg of carrier protein, more in particular from 15 µg to 100 µg of carrier protein, more in particular from 25 to 75 µg of protein. carrier protein, more particularly 30 μg to 70 μg carrier protein, more particularly 30 μg to 60 μg carrier protein, more particularly 30 μg to 50 μg carrier protein, and even more particularly 40 μg to 60 μg carrier protein. carrier protein. In one embodiment, said carrier protein is CRM197.

In one embodiment, each dose will comprise about 25 pg, about 26 pg, about 27 pg, about 28 pg, about 29 pg, about 30 pg, about 31 pg, about 32 pg, about 33 pg, about 34 pg, about 35 pg , about 36 jg , about 37 jg , about 38 jg , about 39 jg , about 40 jg , about 41 jg , about 42 jg , about 43 jg , about 44 jg , about 45 jg , about 46 jg , about 47 jg , about 48 jg about 49 jg , about 50 jg , about 51 jg , about 52 jg , about 53 jg , about 54 jg , about 55 jg , about 56 jg , about 57 jg , about 58 jg , about 59 jg , about 60 jg , about 61 jg, about 62 jg, about 63 jg, about 64 jg, a about 65 pg, about 66 pg, about 67 pg, 68 pg, about 69 pg, about 70 pg, about 71 pg, about 72 pg, about 73 pg, about 74 pg, or about 75 pg of carrier protein. In one embodiment, said carrier protein is CRM197.

3 Other antigens

The immunogenic compositions of the invention comprise conjugated saccharide antigens from S. pneumoniae (glycoconjugates). They may also include antigens from other pathogens, in particular bacteria and/or viruses. Preferred additional antigens are selected from: a diphtheria toxoid (D), a tetanus toxoid (T), a pertussis antigen (P), which is usually acellular (Pa), a hepatitis B virus surface antigen (HBV) (HBsAg), a hepatitis A virus (HAV) antigen, a conjugated Haemophilus influenzae type b capsular saccharide (Hib), an inactivated poliovirus vaccine (IPV).

In one embodiment, the immunogenic compositions of the invention comprise DT-Pa. In one embodiment, the immunogenic compositions of the invention comprise DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HBsAg. In one embodiment, the immunogenic compositions of the invention comprise DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, the immunogenic compositions of the invention comprise DT-Pa-HBsAg-IPV-Hib. Whooping cough antigens: Bordetella pertussis causes whooping cough. Pertussis antigens in vaccines are cellular (whole cell, in the form of inactivated B. pertussis cells) or acellular. The preparation of cellular pertussis antigens is well documented (for example, they can be obtained by heat inactivation of a phase I culture of B. pertussis). However, the invention preferably uses cell-free antigens. When acellular antigens are used, it is preferred to use one, two, or (preferably) three of the following antigens: (1) detoxified pertussis toxin (pertussis toxoid, or PT); (2) filamentous hemagglutinin (FHA); (3) pertactin (also known as the 69 kiloDalton outer membrane protein). FHA and pertactin can be treated with formaldehyde before use according to the invention. PT is preferably detoxified by treatment with formaldehyde and/or glutaraldehyde. Acellular pertussis antigens are preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, they can be added in the non-adsorbed state. If pertactin is added, it is preferable that it is already adsorbed on an aluminum hydroxide adjuvant. PT and FHA can be adsorbed on an aluminum hydroxide or aluminum phosphate adjuvant. Adsorption of all PTs, FHAs and pertactin to aluminum hydroxide is most preferred.

Inactivated poliovirus vaccine: Poliovirus causes poliomyelitis. Instead of using the oral poliovirus vaccine, preferred embodiments of the invention use IPV. Before administration to patients, polioviruses must be inactivated, which can be achieved by treatment with formaldehyde. Poliomyelitis can be caused by one of three types of poliovirus. The three types are similar and cause identical symptoms, but they are antigenically different, and infection with one type does not protect against infection with the other. Therefore, it is preferred to use three poliovirus antigens in the invention: poliovirus type 1 (for example, the Mahoney strain), poliovirus type 2 (for example, the MEF-1 strain), and poliovirus type 3 (for example, the MEF-1 strain). , the Saukett strain). Viruses are preferably grown, purified and inactivated individually, and then combined to obtain a bulk trivalent mixture for use with the invention.

Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. Diphtheria toxin can be treated (eg with formalin or formaldehyde) to remove its toxicity, but retain the ability to induce toxin-specific antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those prepared by treatment with formaldehyde. Diphtheria toxoid can be obtained by culturing C. diphtheriae in growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The toxoid material may then be treated by a process comprising sterile filtration and/or dialysis. Diphtheria toxoid is preferably adsorbed onto an aluminum hydroxide adjuvant.

Tetanus toxoid: Clostridium tetani causes tetanus. Tetanus toxin can be treated to give a protective toxoid. Toxoids are used in tetanus vaccines. Preferred tetanus toxoids are those prepared by treatment with formaldehyde. Tetanus toxoid can be obtained by culturing C. tetani in growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The material may then be treated by a process comprising sterile filtration and/or dialysis.

Hepatitis A virus antigens: Hepatitis A virus (HAV) is one of the known agents that causes viral hepatitis. A preferred component of HAV is based on inactivated virus, and inactivation can be achieved by formalin treatment.

Hepatitis B virus (HBV) is one of the known agents that causes viral hepatitis. The main component of the capsid is a protein known as HBV surface antigen or, more commonly, HBsAg, which is usually a 226 amino acid polypeptide with a molecular weight of approximately 24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to a normal vaccinee, it stimulates the production of anti-HBsAg antibodies that protect against HBV infection.

For the manufacture of vaccines, HBsAg has been manufactured in two ways: purification of the antigen in particulate form from the plasma of carriers of chronic hepatitis B or expression of the protein by recombinant DNA methods (for example, recombinant expression in cells). of yeast). Unlike native 1HBsAg (ie, as in the product purified from plasma), HBsAg expressed by yeast is generally not glycosylated, and this is the most preferred form of HBsAg for use with the invention.

Haemophilus influenzae type b conjugated antigens: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are usually based on the capsular saccharide antigen, the preparation of which is well documented. Hib saccharide can be conjugated to a carrier protein to improve its immunogenicity, especially in children. Typical carrier proteins are tetanus toxoid, diphtheria toxoid, CRM197, H. influenzae protein D, and a complex of serogroup B meningococcal outer membrane proteins. The saccharide moiety of the conjugate may comprise polyribosylribitol phosphate (PRP ) full-length, as prepared from Hib bacteria and/or full-length PRP fragments. Hib conjugates may or may not be adsorbed onto an aluminum salt adjuvant.

In one embodiment, the immunogenic compositions of the invention further include a conjugated capsular saccharide from N. meningitidis serogroup Y (MenY) and/or a conjugated capsular saccharide from N. meningitidis serogroup C (MenC).

In one embodiment, the immunogenic compositions of the invention further include a conjugated capsular saccharide from N. meningitidis serogroup A (MenA), a conjugated capsular saccharide from N. meningitidis serogroup W135 (MenW135), a conjugated capsular saccharide from N. meningitidis from serogroup Y (MenY) and/or a conjugated capsular saccharide from N. meningitidis serogroup C (MenC).

In one embodiment, the immunogenic compositions of the invention further include a conjugated capsular saccharide from N. meningitidis serogroup W135 (MenW135), a conjugated capsular saccharide from N. meningitidis serogroup Y (MenY), and/or a conjugated capsular saccharide from N. meningitidis serogroup C (MenC).

4 Adjuvants

In some embodiments, the immunogenic compositions disclosed herein may further comprise at least one adjuvant (eg, one, two, or three adjuvants). The term "adjuvant" refers to a compound or mixture that enhances the immune response against an antigen. Antigens may act primarily as a transport system, primarily as an immune modulator, or have strong characteristics of both. Suitable adjuvants include those that can be used in mammals, including humans.

Examples of known suitable transport system type adjuvants that can be used in humans include, but are not limited to, alum (eg, aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes , oil-in-water emulsions such as MF59 (4.3% w/v squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% sorbitan trioleate (Span 85) w/v), water-in-oil emulsions, such as Montanide, and microparticles or nanoparticles of poly(D,L-lactide-co-glycolide) (PLG).

In one embodiment, the immunogenic compositions disclosed herein comprise aluminum salts (alum) as an adjuvant (eg, aluminum phosphate, aluminum sulfate, or aluminum hydroxide). In a preferred embodiment, the immunogenic compositions disclosed herein comprise aluminum phosphate or aluminum hydroxide as an adjuvant. In one embodiment, the immunogenic compositions disclosed herein comprise from 0.1 mg/mL to 1 mg/mL or from 0.2 mg/mL to 0.3 mg/mL of elemental aluminum in the form of aluminum phosphate. In one embodiment, the immunogenic compositions disclosed herein comprise about 0.25 mg/mL of elemental aluminum in the form of aluminum phosphate. Examples of known immunomodulatory-type adjuvants that can be used in humans include, but are not limited to Aquilla tree bark saponin extracts (QS21, Quil A), TLR4 agonists such as MPL (monophosphoryl lipid A) , 3DMPL (3-O-deacylated MPL) or GLA-a Q, lT/CT mutants, cytokines, such as the various interleukins (eg, IL-2, IL-12) or GM-CSF, and the like.

Examples of known suitable immunomodulatory-type adjuvants with both transport and immune-modulating characteristics that can be used in humans include, but are not limited to, ISCOMS (see, eg, Sjolander et al. (1998), J. Leukocyte Biol., 64:713; WO 90/03184, WO 96/11711, WO 00/48630, WO 98/36772, WO 00/41720, WO 2006/134423 and WO 2007/026190) or GLA-EM, which is a combination of a TLR4 agonist and an oil-in-water emulsion.

For veterinary applications, including but not limited to animal testing, Complete Freund's Adjuvant (CFA), Incomplete Freund's Adjuvant (IFA), Emulsigen, N-acetyl-muramyl-L-threonyl-D-isoglutamine can be used. (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-( 1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate, and the skeleton of the cell wall (MPL+t Dm CWS) in a 2% squalene/Tween 80 emulsion.

Other examples of adjuvants to enhance the efficacy of the pneumococcal vaccines disclosed herein include, but are not limited to: (1) oil-in-water emulsion formulations (with or without other specific immunostimulatory agents, such as muramil peptides ( see below) or bacterial cell wall components), such as (a) SAF, containing 10% squalene, 0.4% Tween 80, 5% blocked pluronic polymer L121, and thr-MDP, either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (b) RIBI™ Adjuvant System (RAS) (Ribi Immunochem, Hamilton, MT) containing 2% squalene, Tween 80 0.2%, and one or more bacterial cell wall components, such as monophosphoryl lipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL CWS (DEToX™); (2) saponin adjuvants, such as QS21, STlMULON™ (Cambridge Bioscience, Worcester, MA), Abisco® (Isconova, Sweden), or Iscomatrix® (Commonwealth Serum Laboratories, Australia), or particles generated from them can be used such as ISCOMs (immunostimulating complexes), and said ISCOMs may be free of additional detergent (eg WO 00/07621); (3) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) cytokines, such as interleukins (eg, IL-1, IL-2, iL-4, IL-5, IL-6, IL-7, IL-12 (WO 99/44636)), interferons ( eg interferon gamma), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL) (see, for example, GB-2220221, EP0689454), optionally in the substantial absence of alum when used with pneumococcal saccharides (see, for example, example, WO 00/56358); (6) combinations of 3dMPL, eg with QS21 and/or oil-in-water emulsions (see eg EP0835318, EP0735898, EP0761231); (7) a polyoxyethylene ether or a polyoxyethylene ester (see, eg, WO99/52549); (8) a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (WO 01/21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional nonionic surfactant, such as an octoxynol (WO 01 /21152); (9) a saponin and an immunostimulatory oligonucleotide (eg, a CpG oligonucleotide) (WO 00/62800); (10) an immunostimulant and a metal salt particle (see eg WO00/23105); (11) a saponin and an oil-in-water emulsion, eg WO 99/11241(12) a saponin (eg QS21) 3dMPL IM2 (optionally a sterol), eg WO 98/57659( 13) other substances that act as immunostimulating agents to increase the effectiveness of the composition. Muramyl peptides include N-acetylmuramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L-alanyl- D-isoglutarninyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), etc.

In one embodiment of the present invention, the immunogenic compositions as disclosed herein comprise a CpG oligonucleotide as an adjuvant. A CpG oligonucleotide, as used herein, refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), so these terms are used interchangeably unless otherwise indicated. Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs that are unmethylated cytosine-guanine dinucleotides, optionally within certain preferred base contexts. The methylation status of the CpG immunostimulatory motif generally refers to the cytosine residue on the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide containing a 5' unmethylated cytosine linked by a phosphate bond to a 3' guanine, and which activates the immune system by binding to the Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system via TLR9, but not as strongly as if the CpG motif(s) were unmethylated. CpG immunostimulatory oligonucleotides may comprise one or more palindromes which may in turn encompass the CpG dinucleotide. CpG oligonucleotides have been described in a number of issued patents, published patent applications, and other publications, including US Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239. 116 and 6,339,068.

In one embodiment of the present invention, the immunogenic compositions as disclosed herein comprise any of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO 2010/125480.

Different classes of CpG immunostimulatory oligonucleotides have been identified. They are called class A, B, C and P, and are described in more detail on page 3 line 22 to page 12 line 36 of WO 2010/125480. The methods of the invention include the use of these different classes of CpG immunostimulatory oligonucleotides. In one embodiment of the present invention, the immunogenic compositions as disclosed herein comprise a class A CpG oligonucleotide. In one embodiment of the present invention, the immunogenic compositions as disclosed herein comprise a class A CpG oligonucleotide b.

The class B CpG oligonucleotide sequences of the invention are those generally described above, as well as those disclosed in published WO 96/02555, WO 98/18810, and US Patent Nos. 6,194,388. , 6,207,646, 6,214,806, 6,218,371, 6,239,116 and 6,339,068. Examples of sequences include, but are not limited to those disclosed in these latest applications and patents.

In one embodiment, the "class B" CpG oligonucleotide of the invention has the following nucleic acid sequence:

5' TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO:1), or

5' TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO:2), or

5' TCGTCGTTTTGTCGTTTTGTCGTT 3' (SEQ ID NO:3), or

5' TCGTCGTTTCGTCGTTTTGTCGTT 3' (SEQ ID NO:4), or

5' TCGTCGTTTTGTCGTTTTTTTCGA 3' (SEQ ID NO:5).

In any of these sequences, all linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more of the linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif, forming a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or a halogen can be substituted for the 5' T; examples of halogen substitutions include, but are not limited to bromo-uridine or iodo-uridine substitutions.

Some non-limiting examples of class B oligonucleotides include:

5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3' (SEQ ID NO: 6), or

5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3' (SEQ ID NO: 7), or

5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3 ' (SEQ ID NO:8), or

5' T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3 ' (SEQ ID NO:9), or

5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*T*C*G*A 3 ' (SEQ ID NO:10).

where "*" refers to a phosphorothioate bond.

In one embodiment of the present invention, the immunogenic compositions as disclosed herein comprise a class C CpG oligonucleotide.

In one embodiment of the present invention, the immunogenic compositions as disclosed herein comprise a P-class CpG oligonucleotide.

In one embodiment, the oligonucleotide includes at least one phosphorothioate bond. In another embodiment, all internucleotide linkages in the oligonucleotide are phosphorothioate linkages. In another embodiment, the oligonucleotide includes at least one phosphodiester bond. In another embodiment, the phosphodiester bond is a phosphodiester bond. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment the lipophilic group is cholesterol. In one embodiment, all internucleotide linkages of the CpG oligonucleotides disclosed herein are phosphodiester linkages ("soft" oligonucleotides, as described in WO 2007/026190). In another embodiment, the CpG oligonucleotides of the invention are rendered resistant to degradation (eg, stabilized). A "stabilized oligonucleotide" refers to an oligonucleotide that is relatively resistant to degradation in vivo (eg, via an exo- or endonuclease). Nucleic acid stabilization can be achieved by backbone modifications. Oligonucleotides with phosphorothioate linkages provide maximum activity and protect the oligonucleotide from degradation by exo- and intracellular endonucleases.

Immunostimulatory oligonucleotides may have a chimeric backbone, having combinations of phosphodiester and phosphorothioate linkages. For the purposes of the present invention, a chimeric backbone refers to a partially stabilized backbone, in which at least one internucleotide bond is phosphodiester or phosphodiester-like, and in which at least one other internucleotide bond is a stabilized internucleotide bond, in wherein said at least one phosphodiester or phosphodiester-type bond and said at least one stabilized bond are different. When the phosphodiester bond is preferentially located within the CpG motif, such molecules are called "semi-soft", as described in WO 2007/026190.

Other modified oligonucleotides include combinations of phosphodiester, phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, and/or p-ethoxy linkages.

Mixed-backbone modified ODNs can be synthesized as described in WO 2007/026190. The size of the CpG oligonucleotide (ie, the number of nucleotide residues along the oligonucleotide) may also contribute to the stimulatory activity of the oligonucleotide. To facilitate uptake into cells, the CpG oligonucleotide of the invention is preferably at least 6 nucleotide residues in length. Oligonucleotides of any size greater than 6 nucleotides (even many kb in length) are capable of inducing an immune response if sufficient immunostimulatory motifs are present, because larger oligonucleotides are degraded within cells. In certain embodiments, the CpG oligonucleotides are 6 to 100 nucleotides in length, preferably 8 to 30 nucleotides in length. In important embodiments, the nucleic acids and oligonucleotides of the invention are not plasmids or expression vectors.

In one embodiment, the CpG oligonucleotide disclosed herein comprises substitutions or modifications, such as at bases and/or sugars as described in paragraphs 134 to 147 of WO 2007/026190.

In one embodiment, the CpG oligonucleotide of the present invention is chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann et al. (1990), Chem. Rev., 90:543; S. Agrawal, ed., Humana Press, Totowa, ^{E e .} USA, 1993; Crooke et al. (1996), Ann. Rev Pharmacol. Toxicol., 36:107-129; and Hunziker et al. (1995), Mod. Synth. Methods, 7:331-417. An oligonucleotide according to the invention may have one or more modifications, where each modification is located at a particular phosphodiester internucleoside bridge and/or at a particular pD-ribose unit and/or at a particular natural nucleoside base position compared to an oligonucleotide with the same sequence that is composed of natural DNA or RNA.

In some embodiments of the invention, CpG-containing nucleic acids may simply be mixed with immunogenic carriers according to methods known to those of skill in the art (see, eg, WO 03/024480 ).

In a particular embodiment of the present invention, any of the immunogenic compositions disclosed herein comprise from 2 µg to 100 mg of CpG oligonucleotide, preferably from 0.1 mg to 50 mg of CpG oligonucleotide, preferably from 0.2 mg to 10 mg of CpG oligonucleotide, preferably from 0.3 mg to 5 mg of CpG oligonucleotide, preferably from 0.3 mg to 5 mg of CpG oligonucleotide, more preferably from 0.5 mg to 2 mg of CpG oligonucleotide, more preferably from 0.75 mg to 1.5 mg of CpG oligonucleotide. In a preferred embodiment, any of the immunogenic compositions disclosed herein comprise about 1 mg of CpG oligonucleotide.

5 Formulation

The immunogenic compositions of the invention may be formulated in liquid form (ie, solutions or suspensions) or in lyophilized form. Liquid formulations can advantageously be administered directly from their packaged form and are therefore ideal for injection without the need for reconstitution in an aqueous medium, as is required for the lyophilized compositions of the invention.

Formulation of the immunogenic composition of the present invention can be carried out using art-recognized methods. For example, the individual pneumococcal conjugates can be formulated with a physiologically acceptable carrier to prepare the composition. Examples of such carriers include, but are not limited to water, buffered saline, polyols (eg, glycerol, propylene glycol, liquid polyethylene glycol), and dextrose solutions.

The present disclosure provides an immunogenic composition comprising any of the combinations of glycoconjugates disclosed herein and a pharmaceutically acceptable excipient, carrier, or diluent.

In one embodiment, the immunogenic composition of the invention is in liquid form, preferably in aqueous liquid form.

The immunogenic compositions of the disclosure may comprise one or more of a buffer, a salt, a divalent cation, a nonionic detergent, a cryoprotectant, such as a sugar, and an antioxidant, such as a free radical scavenger or chelating agent. , or any multiple combination thereof.

In one embodiment, the immunogenic composition of the invention comprises a buffer. In one embodiment, said buffer has a pKa of from about 3.5 to about 7.5. In some embodiments, the buffer is phosphate, succinate, histidine, or citrate. In certain embodiments, the buffer is succinate at a final concentration of 1 mM to 10 mM. In a particular embodiment, the final concentration of the succinate buffer is approximately 5 mM.

In one embodiment, the immunogenic composition of the invention comprises a salt. In some embodiments, the salt is selected from the groups consisting of magnesium chloride, potassium chloride, sodium chloride, and a combination thereof. In a particular embodiment, the salt is sodium chloride. In a particular embodiment, the immunogenic composition of the invention comprises sodium chloride at 150 mM.

In one embodiment, the immunogenic compositions of the invention comprise a surfactant. In one embodiment, the surfactant is selected from the group consisting of polysorbate 20 (TWEEN™20), polysorbate 40 (TWEEN™40), polysorbate 60 (TWEEN™60), polysorbate 65 (TWEEN™65), polysorbate 80 (TWEEN™80 ), Polysorbate 85 (TWEEN™85), TRITON™ N-1 01, TRITON™ X-100, Oxtoxinol 40, Nonoxynol-9, Triethanolamine, Triethanolamine Polypeptide Oleate, Polyoxyethylene-660 Hydroxystearate (PEG-15, Solutol H 15), polyoxyethylene-35-ricinoleate (CREMOPHOR® EL), soy lecithin, and a poloxamer. In a particular embodiment, the surfactant is polysorbate 80. In some of said embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% polysorbate 80 by weight (w/w) . In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% polysorbate 80 by weight (w/w). In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.01% to 1% polysorbate 80 by weight (w/w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09% or 0.1% polysorbate 80 (w/w). In another embodiment, the final concentration of polysorbate 80 in the formulation is 1% polysorbate 80 (w/w).

In certain embodiments, the immunogenic composition of the invention has a pH of 5.5 to 7.5, more preferably a pH of 5.6 to 7.0, even more preferably a pH of 5.8 to 6.0.

In one embodiment, the invention provides a container containing any of the immunogenic compositions described herein. In one embodiment, the container is selected from the group consisting of a vial, a syringe, a flask, a fermenter, a bioreactor, a bag, a bottle, an ampoule, a cartridge, and a disposable pen. In certain embodiments, the container is siliconized.

In one embodiment, the container of the present invention is made of glass, metals (eg, steel, stainless steel, aluminum, etc.), and/or polymers (eg, thermoplastics, elastomers, thermoplastic-elastomers). In one embodiment, the container of the present invention is made of glass.

In one embodiment, the invention provides a syringe containing any of the immunogenic compositions described herein. In certain embodiments, the syringe is siliconized and/or glass.

A typical dose of the immunogenic composition of the invention for injection has a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, even more preferably a volume of about 0.5 mL.

Therefore, the container or syringe as defined above is filled with a volume of from 0.1 mL to 2 mL, more preferably from 0.2 mL to 1 mL, even more preferably a volume of about 0.5 mL of either of the immunogenic compositions defined herein.

6 Ability of the immunogenic compositions of the invention to elicit cross-reactive antibodies

In one embodiment, the immunogenic composition of the invention is capable of eliciting IgG antibodies in humans that are capable of binding to S. pneumoniae serotypes 18A, 18B, and/or 18F polysaccharide, as determined by ELISA. .

In the ELISA method (Enzyme-linked Immunosorbent Assay), antibodies from the serum of vaccinated subjects are incubated with polysaccharides that have been adsorbed on a solid support. Bound antibodies are detected using enzyme-conjugated secondary detection antibodies.

In one embodiment, said ELISA assay is the standard ELISA assay defined by the WHO in the "Training Manual For Enzyme Linked Immunosorbent Assay For The Quantitation Of Streptococcus Pneumoniae Serotype Specific IgG (Pn PS ELISA)" (available at http://www. vaccine.uab.edu/ELISA protocol.pdf, accessed 31 March 2014).

The ELISA measures IgG type-specific antibodies against the capsular polysaccharide (PS) of S. pneumoniae present in human serum. When dilutions of human sera are added to type-specific capsular PS coated microtiter plates, antibodies specific for that capsular PS bind to the microtiter plates. Plate-bound antibodies are detected using an alkaline phosphatase-labeled goat anti-human IgG antibody, followed by p-nitrophenyl phosphate substrate. The optical density of the final colored product is proportional to the amount of anti-capsular PS antibody present in the serum.

In one embodiment, the immunogenic composition of the invention is capable of eliciting IgG antibodies in humans that are capable of binding to S. pneumoniae serotype 18A polysaccharide at a concentration of at least 0.05 pg/ml, 0.1 pg /mL, 0.2 pg/mL, 0.3 pg/mL, 0.35 pg/mL, 0.4 pg/mL, or 0.5 pg/mL, as determined by ELISA assay.

In one embodiment, the immunogenic composition of the invention is capable of eliciting IgG antibodies in humans that are capable of binding to S. pneumoniae serotype 18B polysaccharide at a concentration of at least 0.05 pg/ml, 0.1 pg /mL, 0.2 pg/mL, 0.3 pg/mL, 0.35 pg/mL, 0.4 pg/mL, or 0.5 pg/mL, as determined by ELISA assay.

In one embodiment, the immunogenic composition of the invention is capable of eliciting IgG antibodies in humans that are capable of binding to S. pneumoniae serotype 18F polysaccharide at a concentration of at least 0.05 pg/ml, 0.1 pg /mL, 0.2 pg/mL, 0.3 pg/mL, 0.35 pg/mL, 0.4 pg/mL, or 0.5 pg/mL, as determined by ELISA assay.

In one embodiment, the immunogenic composition of the invention is capable of eliciting functional antibodies in humans that are capable of killing S. pneumoniae serotypes 18A, 18B, and/or 18F, as determined by an in vitro opsonophagocytic assay (OPA). ) (see example 1). In one embodiment, the immunogenic composition of the invention is capable of eliciting functional antibodies in humans that are capable of killing S. pneumoniae serotype 18A, as determined by an in vitro opsonophagocytic assay (OPA). In one embodiment, the immunogenic composition of the invention is capable of eliciting functional antibodies in humans that are capable of killing S. pneumoniae serotype 18B, as determined by an in vitro opsonophagocytic assay (OPA). In one embodiment, the immunogenic composition of the invention is capable of eliciting functional antibodies in humans that are capable of killing S. pneumoniae serotype 18F, as determined by an in vitro opsonophagocytic assay (OPA). In one embodiment, the immunogenic composition of the invention is capable of eliciting functional antibodies in humans that are capable of killing S. pneumoniae serotypes 18A and 18B, as determined by an in vitro opsonophagocytic assay (OPA). In one embodiment, the immunogenic composition of the invention is capable of eliciting functional antibodies in humans that are capable of killing S. pneumoniae serotypes 18A and 18F, as determined by an in vitro opsonophagocytic assay (OPA). In one embodiment, the immunogenic composition of the invention is capable of eliciting functional antibodies in humans that are capable of killing S. pneumoniae serotypes 18B and 18F, as determined by an in vitro opsonophagocytic assay (OPA).

The pneumococcal opsonophagocytic assay (OPA), which measures the killing of S. pneumoniae cells by phagocytic effector cells in the presence of functional antibodies and complement, is considered an important surrogate for evaluating the efficacy of pneumococcal vaccines.

The in vitro opsonophagocytic assay (OPA) can be carried out by incubating together a mixture of Streptococcus pneumoniae cells, a heat-inactivated human serum to be tested, differentiated HL-60 cells (phagocytes), and an exogenous complement source (e.g. example, rabbit breeding complement). Opsonophagocytosis occurs during incubation, and bacterial cells that are coated with antibodies and complement are killed by opsonophagocytosis. Colony-forming units (cfu) of surviving bacteria that escape opsonophagocytosis are determined by plating the assay mixture. OPA titer is defined as the reciprocal dilution that results in a 50% reduction in bacterial count relative to control wells without test serum. The OPA titer is interpolated from the two dilutions that span this 50% kill cutoff value.

An endpoint titer of 1:8 or greater is considered a positive result in these destructive-type OPAs.

In one embodiment, the immunogenic composition of the invention is capable of eliciting a titer of at least 1:8 against S. pneumoniae serotype 18A in at least 50% of subjects, as determined by an in vitro opsonophagocytic killing assay. vitro (OPA). In one embodiment, the immunogenic composition of the invention is capable of eliciting a titer of at least 1:8 against serotype 18A of S. pneumoniae in at least 60%, 70%, 80%, 90%, 95%, 98 % or at least 99% of subjects, as determined by an in vitro opsonophagocytic killing assay (OPA).

In one embodiment, the immunogenic composition of the invention is capable of eliciting a titer of at least 1:8 against S. pneumoniae serotype 18B in at least 50% of subjects, as determined by an in vitro opsonophagocytic killing assay. vitro (OPA). In one embodiment, the immunogenic composition of the invention is capable of eliciting a titer of at least 1:8 against serotype 18B of S. pneumoniae in at least 60%, 70%, 80%, 90%, 95%, 98 % or at least 99% of subjects, as determined by an in vitro opsonophagocytic killing assay (OPA).

In one embodiment, the immunogenic composition of the invention is capable of eliciting a titer of at least 1:8 against S. pneumoniae serotype 18F in at least 50% of subjects, as determined by an in vitro opsonophagocytic killing assay. vitro (OPA). In one embodiment, the immunogenic composition of the invention is capable of eliciting a titer of at least 1:8 against serotype 18F of S. pneumoniae in at least 60%, 70%, 80%, 90%, 95%, 98 % or at least 99% of subjects, as determined by an in vitro opsonophagocytic killing assay (OPA).

In some embodiment, subjects may have serotype-specific OPA titers prior to pneumococcal vaccination due to, for example, natural exposures to S. pneumoniae (eg, in the case of adult subjects).

Therefore, a comparison of the OPA activity of the serum before and after immunization with the immunogenic composition of the invention can be made and compared for its response to serotypes 18A, 18B and 18F to assess the potential increase in responders (see Table 1). Example 1).

In one embodiment, the immunogenic composition of the invention significantly increases the proportion of responders (ie, the individual with a serum having a titer of at least 1:8 as determined by in vitro OPA) compared to the preimmunized population. .

Therefore, in one embodiment, the immunogenic composition of the invention is capable of significantly increasing the proportion of responders against S. pneumoniae serotype 18A (i.e., the individual with a serum having a titer of at least 1:8 as determined by an in vitro OPA) compared to the preimmunized population.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the proportion of responders against S. pneumoniae serotype 18B (i.e., the individual with a serum having a titer of at least 1:8 as determined by an in vitro OPA) compared to the preimmunized population.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the proportion of responders against S. pneumoniae serotype 18F (i.e., the individual with a serum having a titer of at least 1:8 as determined by an in vitro OPA) compared to the preimmunized population.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the proportion of responders against serotypes 18A and 18B of S. pneumoniae (i.e., individuals with a serum having a titer of at least 1:8 as determined by an in vitro OPA) compared to the preimmunized population.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the proportion of responders against serotypes 18A and 18F of S. pneumoniae (i.e., individuals with a serum having a titer of at least 1:8 as determined by an in vitro OPA) compared to the preimmunized population.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the proportion of responders against serotypes 18B and 18F of S. pneumoniae (i.e., individuals with a serum having a titer of at least 1:8 as determined by by an in vitro OPA) compared to the preimmunized population.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the proportion of responders against serotypes 18A, 18B, and 18F of S. pneumoniae (i.e., individuals with a serum that has a titer of at least 1:8 according to determined by an in vitro OPA) compared to the preimmunized population.

Comparison of the OPA activity of serum before and after immunization with the immunogenic composition of the invention can also be done by comparing the potential increase in OPA titers.

Therefore, a comparison of the OPA activity of serum before and after immunization with the immunogenic composition of the invention can be made and compared for its response to serotypes 18A, 18B and 18F to assess the potential for increased titers. takeover bid (see example 1).

In one embodiment, the immunogenic compositions of the invention are capable of significantly increasing the OPA titer of human subjects compared to the preimmunized population.

Therefore, in one embodiment, the immunogenic composition of the invention is capable of significantly increasing OPA titers of human subjects against S. pneumoniae serotype 18A compared to the preimmunized population. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18A is at least 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0 , 7.5, 8.0 or 8.4.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the OPA titers of human subjects against S. pneumoniae serotype 18B compared to the preimmunized population. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18B is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0 , 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 15.5 or 16.0.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the OPA titers of human subjects against S. pneumoniae serotype 18F compared to the preimmunized population. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18F is at least 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 5.7 or 5.9.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing OPA titers of human subjects against serotypes 18A and 18B of S. pneumoniae compared to the preimmunized population. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18A is at least 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, 8.0, or 8.4 and the OPA titer rise against S. pneumoniae serotype 18B is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 15.5 or 16.0. In one embodiment, the OPA titer rise against S. pneumoniae serotype 18A is at least 8.4 and the OPA titer rise against S. pneumoniae serotype 18B is at least 16.0.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing OPA titers of human subjects against serotypes 18A and 18F of S. pneumoniae compared to the preimmunized population. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18A is at least 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0 7 .5, 8.0, or 8.4 and the rise in OPA titer against S. pneumoniae serotype 18F is at least 2.0, 3.0, 3.5, 4.0, 4.5, 5 .0, 5.5, 5.7 or 5.9. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18A is at least 8.4 and the increase in OPA titer against S. pneumoniae serotype 18F is at least 5.9.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing OPA titers of human subjects against serotypes 18B and 18F of S. pneumoniae compared to the preimmunized population. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18B is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 15.5, or 16.0 and rising OPA titer against S. pneumoniae serotype 18F is at least 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 5.7, or 5.9. In one embodiment, the OPA titer rise against S. pneumoniae serotype 18B is at least 16.0 and the OPA titer rise against S. pneumoniae serotype 18F is at least 5.9.

In one embodiment, the immunogenic composition of the invention is capable of significantly increasing the OPA titers of human subjects against serotypes 18A, 18B and 18F of S. pneumoniae compared to the preimmunized population. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18A is at least 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, 8.0 or 8.4, the increase in OPA titer against S. pneumoniae serotype 18B is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 15.5 or 16.0 and OPA title increase against S. pneumoniae serotype 18F is at least 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 5.7, or 5.9. In one embodiment, the increase in OPA titer against S. pneumoniae serotype 18A is at least 8.4, the increase in OPA titer against S. pneumoniae serotype 18B is at least 16.0, and the increase of the OPA titer against serotype 18F of S. pneumoniae is at least 5.9.

7 Uses of the immunogenic compositions of the invention

In one aspect, the immunogenic compositions of the present invention are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotypes 18A, 18B, and/or 18F in a subject. .

In one aspect, the immunogenic compositions of the present invention are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotype 18A in a subject. In one aspect, the immunogenic compositions of the present invention are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotype 18B in a subject. In one aspect, the immunogenic compositions of the present invention are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotype 18F in a subject.

In one aspect, the immunogenic compositions of the present invention are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition caused by serotypes 18A and 18B of S. pneumoniae in a subject. In one aspect, the immunogenic compositions of the present invention are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition caused by serotypes 18A and 18F of S. pneumoniae in a subject. In one aspect, the immunogenic compositions of the present invention are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition caused by serotypes 18B and 18F of S. pneumoniae in a subject.

In one embodiment, any of the immunogenic compositions disclosed herein is for use in a method of immunizing a subject against infection by S. pneumoniae serotypes 18A, 18B, and/or 18F.

In one embodiment, any of the immunogenic compositions disclosed herein is for use in a method of immunizing a subject against S. pneumoniae serotype 18A infection. In one embodiment, any of the immunogenic compositions disclosed herein is for use in a method of immunizing a subject against S. pneumoniae serotype 18B infection. In one embodiment, any of the immunogenic compositions disclosed herein is for use in a method of immunizing a subject against S. pneumoniae serotype 18F infection.

In one embodiment, any of the immunogenic compositions disclosed herein is for use in a method of immunizing a subject against infection by S. pneumoniae serotypes 18A and 18B. In one embodiment, any of the immunogenic compositions disclosed herein is for use in a method of immunizing a subject against infection by S. pneumoniae serotypes 18a and 18F. In one embodiment, any of the immunogenic compositions disclosed herein is for use in a method of immunizing a subject against infection by S. pneumoniae serotypes 18B and 18F.

In one aspect, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition caused by serotypes 18A, 18B, and/or 18F of S. pneumoniae in one subject.

In one aspect, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition caused by serotypes 18A and 18B of S. pneumoniae in one subject. In one aspect, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition caused by serotypes 18A and 18F of S. pneumoniae in one subject. In one aspect, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition caused by serotypes 18B and 18F of S. pneumoniae in one subject.

In one embodiment, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for immunizing a subject against infection by S. pneumoniae serotypes 18A, 18B, and/or 18F.

In one embodiment, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for immunizing a subject against S. pneumoniae serotype 18A infection. In one embodiment, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for immunizing a subject against S. pneumoniae serotype 18B infection. In one embodiment, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for immunizing a subject against S. pneumoniae serotype 18F infection.

In one embodiment, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for immunizing a subject against infection by serotypes 18A and 18B of S. pneumoniae. In one embodiment, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for immunizing a subject against infection by serotypes 18A and 18F of S. pneumoniae. In one embodiment, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for immunizing a subject against infection by S. pneumoniae serotypes 18B and 18F.

In one aspect, the present disclosure provides a method of inducing an immune response to S. pneumoniae serotypes 18A, 18B, and/or 18F in a subject. In one aspect, the present disclosure provides a method of inducing an immune response to S. pneumoniae serotype 18A in a subject. In one aspect, the present disclosure provides a method of inducing an immune response to S. pneumoniae serotype 18B in a subject. In one aspect, the present disclosure provides a method of inducing an immune response to S. pneumoniae serotype 18F in a subject. In one embodiment, the immunogenic compositions disclosed in the herein are for use as a vaccine. More specifically, the immunogenic compositions described herein can be used to prevent S. pneumoniae serotypes 18A, 18B and/or 18F infections in a subject. Thus, in one aspect, the disclosure provides a method of preventing an infection by S. pneumoniae serotypes 18A, 18B and/or 18F in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention. In some of these embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, bovine, or dog.

In one aspect, the immunogenic compositions disclosed herein are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae serotypes 18A, 18B, and/or 18F in a subject. In some of these embodiments, the infection, disease, or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess.

In one aspect, the immunogenic composition disclosed herein is for use in a method of preventing an infection by S. pneumoniae serotypes 18A, 18B and/or 18F in a subject. In some of these embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, bovine, or dog.

In one aspect, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae serotypes 18A, 18B and/or 18F in one subject. In some of these embodiments, the infection, disease, or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess.

In one aspect, the present disclosure is directed to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for preventing an infection by S. pneumoniae serotypes 18A, 18B and/or 18F in a subject. In some of these embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, bovine, or dog.

The immunogenic compositions of the present disclosure can be used to protect or treat a human susceptible to infection by serotypes 18A, 18B and/or 18F of S. pneumoniae, by administering the immunogenic compositions systemically or mucosally. In one embodiment, the immunogenic compositions disclosed herein are administered intramuscularly, intraperitoneally, intradermally, or subcutaneously. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular, intraperitoneal, intradermal, or subcutaneous injection. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular or subcutaneous injection.

In one embodiment, the immunogenic compositions of the present disclosure comprise at least one S. pneumoniae 9V glycoconjugate (such as the glycoconjugates of paragraph 1.3 above).

8 Subject to be treated with the immunogenic compositions of the invention

As described herein, the immunogenic compositions described herein can be used in various therapeutic or prophylactic methods to prevent, treat, or ameliorate a bacterial infection, disease, or condition in a subject.

In a preferred embodiment, said subject is a human. In a more preferred embodiment, said subject is a newborn (ie less than three months), an infant (ie 3 months to one year) or a toddler (ie one year to four years). .

In one embodiment, the immunogenic compositions disclosed herein are for use as a vaccine.

In said embodiment, the subject to be vaccinated may be less than 1 year old. For example, the subject to be vaccinated may be approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months old. In one embodiment, the subject to be vaccinated is about 2, 4 or 6 months old. In another embodiment, the subject to be vaccinated is less than 2 years old. For example, the subject to be vaccinated may be between 12 and 15 months old. In some cases, only one dose of the immunogenic composition is needed depending on the invention, but in some circumstances, a second, third or fourth dose may be administered (see section 9 below).

In one embodiment of the present invention, the subject to be vaccinated is a human adult aged 50 years or older, more preferably a human adult aged 55 years or older. In one embodiment, the subject to be vaccinated is a human adult age 65 or older, age 70 or older, age 75 or older, or age 80 or older.

In one embodiment, the subject to be vaccinated is an immunocompromised individual, in particular a human. An immunocompromised individual is generally defined as a person who exhibits an attenuated or reduced ability to mount a normal humoral or cellular defense upon exposure to infectious agents.

In one embodiment of the present invention, the immunocompromised subject to be vaccinated suffers from a disease or condition that impairs the immune system and elicits an antibody response that is insufficient for protection against or treatment of pneumococcal disease.

In one embodiment, said disease is a primary immunodeficiency disorder. Preferably, said primary immunodeficiency disorder is selected from the group consisting of: combined T-cell and B-cell immunodeficiencies, antibody deficiencies, well-defined syndromes, immune dysregulation diseases, phagocyte disorders, innate immunity deficiencies, autoinflammatory disorders, and immune deficiencies. complement. In one embodiment, said primary immunodeficiency disorder is selected from that disclosed on page 24, line 11, to page 25, line 19, of WO 2010/125480.

In a particular embodiment of the present invention, the immunocompromised subject to be vaccinated suffers from a disease selected from the groups consisting of: HIV infection, acquired immunodeficiency syndrome (AIDS), cancer, chronic heart or lung disorders, heart failure congestive heart disease, diabetes mellitus, chronic liver disease, alcoholism, cirrhosis, cerebrospinal fluid leaks, cardiomyopathy, chronic bronchitis, emphysema, chronic obstructive pulmonary disease (COPD), dysfunction of the spleen (such as sickle cell anemia), underactivity of the spleen (asplenia), blood malignancy, leukemia, multiple myeloma, Hodgkin's disease, lymphoma, kidney failure, nephrotic syndrome, and asthma.

In one embodiment of the present invention, the immunocompromised subject to be vaccinated is suffering from malnutrition.

In a particular embodiment of the present invention, the immunocompromised subject to be vaccinated is taking a drug or is undergoing a treatment that lowers the body's resistance to infection. In one embodiment, said drug is selected from the one disclosed on page 26 line 33 to page 26 line 4 of WO 2010/125480.

In a particular embodiment of the present invention, the immunocompromised subject to be vaccinated is a smoker.

In a particular embodiment of the present invention, the immunocompromised subject to be vaccinated has a white blood cell count (leukocyte count) of less than 5 x 109 cells per liter, or less than 4 x 109 cells per liter, or less than 3 x 109 cells per liter, or less than 2 x 109 cells per liter, or less than 1 x 109 cells per liter, or less than 0.5 x 109 cells per liter, or less than 0.3 x 109 cells per liter , or less than 0.1 x 109 cells per liter.

White blood cell count (WBC count): The number of white blood cells (WBC) in the blood. White blood cells are usually measured as part of a complete blood count (CBC). White blood cells are the infection-fighting cells in the blood and are distinct from red blood cells (which carry oxygen), known as erythrocytes. There are different types of white blood cells, such as neutrophils (polymorphonuclear leukocytes; PMNs), band cells (slightly immature neutrophils), T-type lymphocytes (T-cells), B-type lymphocytes (B-cells), monocytes, eosinophils and basophils. All types of white blood cells are reflected in the white blood cell count. The normal range for white blood cell count is usually between 4,300 and 10,800 cells per cubic millimeter of blood. It may also be referred to as the white blood cell count and can be expressed in international units as 4.3-0.8 x 109 cells per liter.

In a particular embodiment of the present invention, the immunocompromised subject to be vaccinated suffers from neutropenia. In a particular embodiment of the present invention, the immunocompromised subject to be vaccinated has a neutrophil count of less than 2 x 109 cells per liter, or less than 1 x 109 cells per liter, or less than 0.5 x 109 cells. per litre, or less than 0.1 x 109 cells per litre, or less than 0.05 x 109 cells per litre.

A low white blood cell count or "neutropenia" is a condition characterized by abnormally low levels of neutrophils in the circulating blood. Neutrophils are a specific type of white blood cell that help prevent and fight infection. The most common reason cancer patients experience neutropenia is as a side effect of chemotherapy. Chemotherapy-induced neutropenia increases the patient's risk of infection and alters cancer treatment.

In a particular embodiment of the present invention, the immunocompromised subject to be vaccinated has a CD4+ cell count of less than 500/mm3, or a CD4+ cell count of less than 300/mm3, or a CD4+ cell count of less than 200 /mm3, a CD4+ cell count less than 100/mm3, a CD4+ cell count less than 75/mm3, or a CD4+ cell count less than 50/mm3.

CD4 cell tests are normally reported as the number of cells in mm3. Normal CD4 counts are between 500 and 1,600 and CD8 counts between 375 and 1,100. CD4 counts drop dramatically in people with HIV.

In one embodiment of the invention, any of the immunocompromised subjects disclosed herein is a human male or female.

9 Regime

In some cases, only one dose of the immunogenic composition according to the invention is needed, but in some circumstances, such as in conditions of increased immunodeficiency, a second, third or fourth dose may be administered. Following the initial vaccination, subjects may receive one or more booster vaccinations separated by an appropriate time interval.

In one embodiment, the vaccination scheme of the immunogenic composition according to the invention is a single dose. In a particular embodiment, said single dose scheme is for healthy people of at least 2 years of age.

In one embodiment, the vaccination schedule of the immunogenic composition according to the invention is a multiple dose schedule. In a particular embodiment, said multiple dose schedule consists of a series of 2 doses separated by an interval of about 1 month to about 2 months. In a particular embodiment, said multiple dose schedule consists of a series of 2 doses separated by an interval of approximately 1 month, or a series of 2 doses separated by an interval of approximately 2 months.

In another embodiment, said multiple dose schedule consists of a series of 3 doses separated by an interval of about 1 month to about 2 months. In another embodiment, said multiple dose schedule consists of a series of 3 doses separated by an interval of approximately 1 month, or a series of 3 doses separated by an interval of approximately 2 months.

In another embodiment, said multiple dose schedule consists of a series of 3 doses spaced about 1 month to about 2 months apart, followed by a fourth dose about 10 months to about 13 months after the first dose. In another embodiment, said multiple dose schedule consists of a series of 3 doses separated by an interval of about 1 month, followed by a fourth dose from about 10 months to about 13 months after the first dose, or a series of 3 doses about 2 months apart, followed by a fourth dose from about 10 months to about 13 months after the first dose.

In one embodiment, the multiple dose schedule consists of at least one dose (eg, 1, 2, or 3 doses) in the first year of age, followed by at least one dose for toddlers.

In one embodiment, the multiple-dose schedule consists of a series of 2 or 3 doses spaced about 1 month to about 2 months apart (eg, 28-56 days between doses), beginning at 2 months of age, and followed by a toddler dose at 12-18 months of age. In one embodiment, such a multiple-dose schedule consists of a series of 3 doses spaced approximately 1 to 2 months apart (eg, 28-56 days between doses), beginning at 2 months of age, and followed by one dose for toddlers at 12-15 months of age. In another embodiment, such a multiple-dose schedule consists of a series of 2 doses approximately 2 months apart, beginning at 2 months of age, and followed by a toddler dose at 12-18 months of age.

In one embodiment, the multiple dose schedule consists of a series of 4 doses of vaccine at 2, 4, 6, and 12-15 months of age.

In one embodiment, an initial dose is administered on day 0 and then one or more boosters at intervals ranging from about 2 to about 24 weeks, preferably with a dosing interval of 4 to 8 weeks.

In one embodiment, a priming dose is given on day 0 and a booster is given approximately 3 months later.

10 Kit and process

In one embodiment, the disclosure is directed to a kit comprising an immunogenic composition disclosed herein and an informational insert.

In one embodiment, said information leaflet mentions the ability of the composition to elicit functional antibodies against serotypes 18B, 18F and/or 18A of S. pneumoniae.

In one embodiment, said information leaflet mentions the ability of the composition to elicit functional antibodies against serotype 18A of S. pneumoniae.

In one embodiment, said information leaflet mentions the ability of the composition to elicit anticapsular antibodies against serotypes 18B, 18F and/or 18A of S. pneumoniae at a concentration > 0.35 pg/mL in a human population.

In one embodiment, said information leaflet mentions the ability of the composition to elicit anticapsular antibodies against serotype 18A of S. pneumoniae at a concentration > 0.35 pg/mL in a human population. In one embodiment, said information leaflet mentions the ability of the composition to elicit OPA titers against serotypes 18B, 18F and/or 18A of S. pneumoniae in a human population.

In one embodiment, said informational insert mentions the ability of the composition to elicit OPA titers against S. pneumoniae serotype 18A in a human population.

In one embodiment, the disclosure is directed to a process for producing a kit comprising an immunogenic composition and an informational insert, said process comprising the step of:

• producing an immunogenic composition of the present disclosure, and

• combining in the same kit said immunogenic composition and the information leaflet, wherein said information leaflet mentions the ability of said composition to elicit functional antibodies against serotypes 18B, 18F and/or 18A of S. pneumoniae.

In one embodiment, the disclosure is directed to a process for producing a kit comprising an immunogenic composition and an informational insert, said process comprising the step of:

• producing an immunogenic composition of the present disclosure, and

• combining in the same kit said immunogenic composition and the information leaflet, in which said information leaflet mentions the ability of the composition to elicit anti-capsular antibodies against serotypes 18B, 18F and/or 18A of S. pneumoniae at a concentration > 0, 35 pg/mL in a human population.

In one embodiment, the disclosure is directed to a process for producing a kit comprising an immunogenic composition and an informational insert, said process comprising the step of:

• producing an immunogenic composition of the present disclosure, and

• combining in the same kit said immunogenic composition and the information leaflet, wherein said information leaflet mentions the ability of the composition to elicit OPA against serotypes 18B, 18F and/or 18A of S. pneumoniae in a human population.

In one embodiment, the disclosure is directed to a process for producing a kit comprising an immunogenic composition and an informational insert, said process comprising the step of:

• producing an immunogenic composition of the present disclosure;

• print an information leaflet mentioning the ability of said composition to elicit functional antibodies against serotypes 18B, 18F and/or 18A of S. pneumoniae;

• combining in the same kit said immunogenic composition and said information leaflet.

In one embodiment, the disclosure is directed to a process for producing a kit comprising an immunogenic composition and an informational insert, said process comprising the step of:

• producing an immunogenic composition of the present disclosure;

• print an information leaflet in which said information leaflet mentions the ability of the composition to elicit anti-capsular antibodies against serotypes 18B, 18F and/or 18A of S. pneumoniae at a concentration > 0.35 pg/mL in a human population;

• combining in the same kit said immunogenic composition and said package insert.

In one embodiment, the disclosure is directed to a process for producing a kit comprising an immunogenic composition and an informational insert, said process comprising the step of:

• producing an immunogenic composition of the present disclosure;

• printing an informational package insert wherein said informational package insert mentions the ability of the composition to raise OPA titers against serotypes 18B, 18F and/or 18A of S. pneumoniae in a human population;

• combining in the same kit said immunogenic composition and said information leaflet.

11 Methods

In one embodiment, the disclosure is directed to a method comprising the step of:

• injecting a subject with an immunologically effective amount of any of the immunogenic compositions defined herein;

• collecting a serum sample from said subject;

• analyze the opsonophagocytic killing activity of said serum sample against serotype 18A of S.

pneumoniae by an in vitro opsonophagocytic kill assay (OPA).

In one embodiment, the disclosure is directed to a method comprising the step of:

• injecting a subject with an immunologically effective amount of any of the immunogenic compositions defined herein;

• collecting a serum sample from said subject;

• analyze the opsonophagocytic killing activity of said serum sample against serotype 18B of S.

pneumoniae by an in vitro opsonophagocytic kill assay (OPA).

In one embodiment, the disclosure is directed to a method comprising the step of:

• injecting a subject with an immunologically effective amount of any of the immunogenic compositions defined herein;

• collecting a serum sample from said subject;

• analyze the opsonophagocytic killing activity of said serum sample against serotype 18F of S.

pneumoniae by an in vitro opsonophagocytic kill assay (OPA).

In one embodiment, the disclosure is directed to a method comprising the step of:

• injecting a subject with an immunologically effective amount of any of the immunogenic compositions defined herein;

• collecting a serum sample from said subject;

• analyzing the opsonophagocytic killing activity of said serum sample against serotypes 18A, 18B and/or 18F of S. pneumoniae by means of an in vitro opsonophagocytic killing assay (OPA).

As used herein, the term "approximately" means within a statistically significant range of a value, such as a stated concentration range, time frame, molecular weight, temperature, or pH. Said range may be within an order of magnitude, typically within 20%, more typically within 10%, and even more typically within 5% or within 1% of a given value or range. Sometimes said range may be within the typical experimental error of conventional methods used for the measurement and/or determination of a given value or range. The permissible variation encompassed by the term "approximately" will depend on the particular system being studied, and can be readily appreciated by those skilled in the art. Whenever a range is indicated within this application, each integer within the range is also contemplated as an embodiment of the disclosure.

The inventors intend that the expression and terms "comprising", "comprise" and "comprise" are optionally substitutable for the expressions "consisting of", "consist of" and "consists of", respectively, in all cases.

The invention is illustrated in the accompanying examples. The examples presented below are carried out by means of standard techniques, which are well known and routine to those skilled in the art, unless otherwise described in detail. The examples are illustrative, but do not limit the invention.

examples

Example 1: Evaluation of cross opsonophagocytic immune responses within serogroup 18 of Streptococcus pneumoniae

Host protection against S. pneumoniae is primarily mediated by anticapsular antibody-dependent opsonophagocytosis. The pneumococcal opsonophagocytic assay (OPA), which measures the killing of S. pneumoniae cells by phagocytic effector cells in the presence of functional antibodies and complement, is considered an important surrogate for evaluating the efficacy of pneumococcal vaccines.

Materials and methods

sera

Two randomly selected subsets of immunosera from adults vaccinated with a 13-valent pneumococcal conjugate vaccine (13vPnC) were tested in OPA assays for serotypes 18F, 18A, 18B, and 18C. Sera were collected from US clinical trials 6115A1-004 (N = 59, post-vaccination) and 6115A1-3005 (N = 66, matched before and after vaccination), respectively.

Study 6115A1-3005 (ClinicalTrials.gov identifier: NCT00546572) was a modified phase 3, randomized, actively controlled, double-blind trial that evaluated the safety, tolerability, and immunogenicity of PREVNAR 13® compared to a polysaccharide vaccine. 23-valent pneumococcal (23vPS) in ambulatory elderly aged 70 years or older who received 1 dose of 23vPS at least 5 years prior to study enrollment (see http://clinicaltrials.gov/ct2/show/NCT00546572, accessed on October 4, 2016).

Study 6115A1-004 (ClinicalTrials.gov identifier: NCT00427895) was a modified phase 3, randomized, actively controlled, double-blind trial that evaluated the safety, tolerability, and immunogenicity of a pneumococcal conjugate 13 (13vPnC) vaccine compared with a pneumococcal polysaccharide 23 (23vPS) vaccine in adults aged 60 to 64 years who had not received 23vPS, and the safety, tolerability, and immunogenicity of 13vPnC in adults aged 18 to 59 years who had not received 23vPS ( see: http://clinicaltrials.gov/show/NCT00427895, accessed 4 October 2016).

The 13-valent pneumococcal conjugate (13vPnC) vaccine tested in these studies contained conjugates of pneumococcal serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F, individually conjugated to the diphtheria cross-reactive material carrier protein 197 (CRM197) (Prevenar 13 ®).

Microcolony opsonophagocytic assay ( mcOPA) procedure

Opsonophagocytic assays (OPA) are used to measure functional antibodies in human sera against serotypes 18F, 18A, 18B, and/or 18C of S. pneumoniae. Test serum is prepared in assay reactions that measure the ability of capsular polysaccharide-specific immunoglobulin to opsonize bacteria, trigger complement deposition, thus facilitating phagocytosis and killing of bacteria by phagocytes. OPA titer is defined as the reciprocal dilution that results in a 50% reduction in bacterial count relative to control wells without test serum. The OPA titer is interpolated from the two dilutions that span this 50% kill cutoff value.

OPA procedures were based on the methods described in Hu et al. (2005), Cline. Diag. Lab. Immunol., 12:287-295.

The microcolony opsonophagocytic assay quantitatively assesses functional anti-S. pneumoniae antibodies by measuring bacterial survival in microcolony OPA (mcOPA) reactions containing test serum. Serial dilutions (2.5-fold) of heat-inactivated serum were added to the target bacteria in assay plates and incubated for 30 minutes with shaking. Next, baby rabbit complement (3-4 weeks old, 12.5% final concentration) and differentiated HL-60 cells were added to each well, in an approximate effector-to-target ratio of 200: 1, and incubated at 37 °C with shaking. To terminate the reaction, 80 μl of 0.9% NaCl was added to all wells, the reaction solution was mixed, and a 10 μl aliquot was transferred to the wells of Millipore, MultiScreenHTS HV filter plates containing 200 ml of water. Liquid was filtered through the plates under vacuum, and 150 μl of HySoy medium was added to each well and filtered.

After filtration, filter plates were incubated overnight in a 5% CO2 incubator at 37°C and then fixed with Destain Solution (Bio-Rad). Plates were then stained with Coomassie blue and destained once. Colonies were visualized and counted on a Cellular Technology Limited (CTL) ImmunoSpot Analyzer®. The OPA antibody titer was determined as the reciprocal of the lowest serum dilution that

Claims (15)

1. - An immunogenic composition comprising at least one glycoconjugate of the capsular polysaccharide of serotype 18C of S. pneumoniae covalently linked to a carrier protein and further comprising glycoconjugates of capsular polysaccharides of serotypes 1, 3, 4, 5, 6A, 6B , 7F, 9V, 14, 19A, 19F and 23F from S. pneumoniae covalently linked to a carrier protein, wherein said glycoconjugates are individually conjugated to CRM197, for use in a method of immunizing a subject against infection by the serotypes 18A, 18B and/or 18F of S. pneumoniae, wherein said composition does not comprise a capsular saccharide of serotypes 18A, 18B and 18F of S. pneumoniae . 2. - The immunogenic composition for use according to claim 1, further comprising glycoconjugates of serotypes 22F and 33F of S. pneumoniae . 3. - The immunogenic composition for use according to claim 1, further comprising glycoconjugates of serotypes 15B, 22F and 33F of S. pneumoniae. 4. - The immunogenic composition for use according to any one of claims 1 to 3, further comprising glycoconjugates of serotypes 12F, 10A, 11A and 8 of S. pneumoniae. 5. - The immunogenic composition for use according to any one of claims 1-4, which is a pneumococcal conjugate composition 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25-valent. 6. - The immunogenic composition for use according to any one of claims 1-5, wherein said glycoconjugate of serotype 18C of S. pneumoniae is prepared by reductive amination. 7. - The immunogenic composition for use according to any one of claims 1-6, wherein said glycoconjugate of serotype 18C of S. pneumoniae comprises a saccharide that has a degree of O-acetylation <10%. 8. - The immunogenic composition for use according to any one of claims 1-7, wherein said immunogenic composition further comprises at least one adjuvant. 9. - The immunogenic composition for use according to any one of claims 1 to 8, which is capable of raising IgG antibodies in humans that are capable of binding to the polysaccharide of serotypes 18A, 18B and/or 18F of S. pneumoniae at a concentration of at least 0.35 pg/mL, as determined by ELISA. 10. - The immunogenic composition for use according to any one of claims 1-9, which is capable of raising functional antibodies in humans that are capable of destroying serotypes 18A, 18b and/or 18F of S. pneumoniae, as described determined by an in vitro opsonophagocytic assay (OPA). 11. - The immunogenic composition for use according to any one of claims 1-10, which is capable of eliciting a titer of at least 1:8 against serotypes 18A, 18B and/or 18F of S. pneumoniae in at least the 50% of subjects, as determined by an in vitro opsonophagocytic killing assay (OPA). 12. - The immunogenic composition for use according to any one of claims 1-11, which is capable of significantly increasing the proportion of responders against serotypes 18A, 18B and/or 18F of S. pneumoniae, compared to the preimmunized population . 13. - The immunogenic composition for use according to any one of claims 1-12, which is capable of significantly increasing the OPA titers of human subjects against serotypes 18A, 18B and/or 18F of S. pneumoniae , compared to the preimmunized population. 14. - The immunogenic composition of any one of claims 1-13, for use in a method to prevent, treat or improve an infection, disease or condition caused by serotypes 18A, 18B and/or 18F of S. pneumoniae in one subject. 15. - The immunogenic composition of any one of claims 1-13, for use in preventing infection by serotypes 18A, 18B and/or 18F of S. pneumoniae in a subject.