ES2530292B2 - Gene construction and methods to detect antifungal and antitumor compounds - Google Patents

Abstract

Gene construction and methods for detecting antifungal and antitumor compounds. # The present invention relates to a gene construct for amplifying the response to signals that activate the cellular integrity pathway (CWI) in Saccharomyces cerevisiae. It comprises a hyperactive allele of the MAPKK of this route, under the control of the promoter of a gene inducible by Rlm1, which involves the creation of a positive feedback circuit whose stimulation leads to cell death. The invention also relates to methods for detecting agents that alter the cell wall or the function of components of the route itself, which allows the detection of antifungal and / or antitumor drug compounds.

Description

Gene construction and methods to detect antifungal compounds and

antitumor

5

Technical Sector

The present invention falls within the pharmaceutical industry sector

biotechnology And, more specifically, in pharmacological screening programs

for the search of compounds with antifungal or modifying activity of the

MAPK-mediated signaling (Mitogen Activated Protein Kinases).

\OR

Eslado of the technique:

The epidemiology of invasive fungal infection (IFI) has changed in the

last 20 years, so today mycoses are considered diseases

emerging. Its incidence has increased significantly and the population of

1 S

risk has been extended including patients with different diseases of

base such as those suffering from hematological cancer, those admitted to

intensive care units, solid organ transplants or those

who receive high doses of corticosteroids or other immunosuppressants (Garcia

Vidal et al. , 2013. Pathogenesis of invasive fungal infections. Curr. Opin. Infec !.

twenty

Dis. 26, 270-276). In addition, this increase has also been observed in other

much more numerous patient populations such as those who suffer

chronic obstructive pulmonary disease. Also relevant is the fact

that the etiology of invasive mycoses is changing. In addition to Gandida

albicans and Aspergillus fumigatus, are being identified as causative agents

25

IFI other species such as Candida glabrata, Aspergillus terreus, Trichosporon

asahii, Fusarium spp, Scedosporium spp, Mucora / es and dematiaceae. All

these emerging species have the common characteristic of being much more

resistant to antifungals that C. albicans and A. fumigatus, which increases

mortality already high.

30

The current number of effective antifungals is relatively small and,

contrary to what could be expected by analogy with what happens in the

case of antibacterial drugs that act on the cell wall, only

a type of antifungal compounds has been marketed so far

acting on this target, inhibiting the synthesis of ~ -glucan:

Echinocandins (Drew el al., 2013. Recent advances in the treatment 01 life-

S

threatening, invasive lungal infections. Expert Opin. Pharmacother 14,2361

2374). One of the reasons for the shortage of f;, antifungal drugs of this type

probably the limited number of tracking procedures

specific targeting this target, compared to the classic strategy of searching

fungal growth inhibitors in a general way. They have proposed

10

some methodologies focused on the search for antifungals that

specifically act on the cell wall, such as the search for

fungal GTPase inhibitor compounds that regulate the process of

maintenance of cell wall integrity (EP0892854B1),

compounds that can inhibit hands H-transferases (N or O-glycosylations),

fifteen

which are absent enzymes in mammalian cells and essential for

maintenance of the fungal cell wall (US6153376A), or inhibitors

product-specific genes related to this structure and that are

essential for fungal viability such as CaKRE5, CaALR1 or CaCdc24

(W00068420A2). Strategies oriented to the

twenty

assessment of gene expression indicators of the pathway activity of the

gtuc;, n-synthase, such as the genes SKM1, YPS3, YKL 161C (MLP1), MET10,

etc. (W02004057033A1). Likewise, a methodology for

identify compounds that alter the cell wall by assessing the

expression of the promoter of one of these genes, MLP1, because its

25

expression is regulated by the path of cell wall integrity (CWI, Cell

Wall Integrily) in a manner dependent on the transcription factor Rlm1, of

so that when the route is induced, a consequence of an alteration

Significant cell wall, this is the gene whose expression is most induced.

The fusion of said promoter to the antibiotic resistance gene nurseotricin

30

allows to detect the induction of the route depending on the resistance of the

yeast to said antibiotic (ES2303452B 1).

Another reason that could explain the low number of fungal cell wall biogenesis inhibitors identified so far, could be precisely the existence of the effective induced rescue mechanism

by the CWI route under conditions that endanger this structure.

All types of cells, from the most elementary prokaryotic to the most complex eukaryotic, use signal transduction pathways to recognize the environment around them and adapt to it, as well as to communicate with other cells. Of particular relevance in eukaryotic organisms are the routes in which MAPKs (Mitogen Activafed Protein Kinases) are involved. These protein kinases regulate essential processes such as gene expression or protein translation, stability and localization.

It is not surprising, therefore, that MAPKs play an essential role in

processes such as embryogenesis, cell proliferation and differentiation, apoptosis, stress response, cell mobility, metabolic homeostasis, immunity or cardiac function, or that abnormalities in MAPK signaling are associated with human diseases such as obesity , diabetes, neurodegenerative disorders, rheumatoid arthritis or

cancer (Kim and Choi, 2010. Pathological roles of MAPK signaling pathways in human diseases. Biochim. Biophys. Acta. 1802,396 · 405).

These routes, evolutionarily conserved in eukaryotes, share a

Three protein kinase cascade: a MAPK kinase kinase (MKKK or MEKK), a MAPK kinase (MKK or MEK) and MAPK itself, which are phosphors and

activate successively under stimulation conditions. Once activated, MAPKs in turn phosphorylate effector proteins, for example,

transcription, thus regulating gene expression (Yang et al., 2013. MAP kinase signalling cascades and transcriptional regulation. Gene 513, 113).

In the yeast Saccharomyces cerevisiae, a single-celled eukaryotic organism,

5 MAPKs operate: Fus3, Kss1, Hog1, Smk1 and Slt2, which define 5 routes that

regulate mating, filamentous growth, response to osmotic stress conditions, spore formation and cell integrity, respectively (Chen and Thorner, 2007. Function and regulation in MAPK

signaling pathways: Lessons learned lrom the yeast Saccharomyces cerevisiae. Biochim Biophys Minutes. 1773, 1311-1340). In response to a

aggression to the cell wall of S. cerevisiae, an essential structure that the

protects and gives lorma, the stimulation of the route mediated by the MAPK Slt2, called the cell wall integrity route (CWI; reviewed by Levin in 2005 -Levin, DE, 2005) occurs. Cell wall integrity signaling in Saccharomyces cerevisiae. Mol. Biol. Rev. 69,262-291-). The activation of this route

triggers a compensatory mechanism aimed at maintaining the stability of the cell wall by remodeling it, fundamentally to

through a change in the pattern of gene expression, and thereby ensure the

cell viability against such aggression. MAPK 5112 is activated by the

Redundant MAPKKs Mkkl and Mkk2 which in turn are activated by the MAPKKK Bckl. Bckl receives the stimulation of protein kinase C Pkcl, in turn activated by GTPase Rhol in response to the signal detected by the membrane mechanosensors Mid2 and Wscl, 2,3. Once activated, SIt2 loslorila and activates the Rlml transcription lactor, which promotes an increase in the transcription of a series of genes, including YKL 161C (MLP1), CRH1, CWP1, SLT2 or RLM1. On the other hand, the cell wall is not present in

mammalian cells, while this route is also conserved in

pathogenic fungi, such as Candida albicans (Navarro-Garcia, F. el al., 2001.

Signal transduction pathways and cell-wall construction in Candida albicans.

Med. Mycol. 39 Suppl1, 87-100), Aspergitlus fumigalus (May, GS el al., 2005. Mitogen activated protein kinases 01 Aspergillus fumigalus. Med.Mycol. 43 Suppl 1, S83-S86) or Cryplococcus neofonnans (Kozubowski, L. el al ., 2009. Signaling pathways in the pathogenesis 01 Cryplococcus. Cell Microbiol. 11, 370-380).

In conclusion, it is necessary to develop new search systems and therapeutic strategies to solve these problems. In that line of

Actions include the invention presented here, which focuses on the use of hypersensitive strains for pharmacological screening of compounds that specifically damage the fungal cell wall, or inhibit the compensatory mechanism controlled by the CWI route.

Detailed description of the invention

Gene construction and methods to detect antifungal and antitumor compounds.

In order to obtain a system with which to track new drugs with a potentially antifungal effect, in the present invention a gene construction has been carried out that includes the modified MKK1 gene of Saccharomyces cerevisiae by means of a mutation that results in a change in amino acid 386 of the protein. , so that the serine of the wild sequence is replaced by a proline, which results in an overactive form of the gene (MKK1 S380P): in the gene construct, moreover, said gene is preceded by a promoter sequence inducible by the factor of Rlm1 transcription of the CWI route and also a transcription termination sequence is included.

In the present invention, "promoter sequence" means the region of a DNA molecule to which RNA polymerase binds to initiate transcription and "transcription termination sequence" means the DNA sequence located in the end of the transcribed portion, and that causes RNA polymerase to terminate transcription.

One aspect of the present invention relates to a gene construct comprising the following components, in the order indicated in the transcription direction from 5 'to 3': -the promoter sequence of a gene inducible by the transcription factor Rlm1 of the cellular integrity pathway (CWI) of Saccharomyces cerevisiae, - an ONA sequence whose expression gives rise to the Mkk1 protein of Saccharomyces cerevisiae with a mutation that produces the modification of the amino acid S386 by P386 in said protein, called Mkk1 s386P, according to It is described in SEO ID NO: 3, and

5 -a transcription termination sequence. In this gene construct the distance between the 3 'end of the promoter sequence and the 5' end of the ONA sequence whose expression gives rise to the Mkk1s386P protein is less than or equal to 18 nucleotides and the distance between the 3 'end of the ONA sequence whose expression gives rise to protein

10 Mkk1 s386P and the 5 'end of the termination sequence is less than or equal to 18 nucleotides. In fact, at the junction between two of the components of the construction, for example, nucleotides of restriction enzyme target sequences inserted in the sequence of one or more components may be left to facilitate the binding of the different components of the construction, or good

15 other nucleotide sequences, provided they do not alter the functionality of the construction.

In a preferred embodiment, the promoter sequence belongs to the YKL161C (MLP1) gene, which is described in SEO ID NO: 1. On the other hand, cemo 20 transcription termination sequence, a preferred embodiment includes the ADHt termination sequence, described in SEO ID NO: 4. The most preferred embodiment of the invention, characterized by SEO ID NO: 13, includes

pYKL161C and ADHt.

25 Overexpression of the MKK1s386P allele encoding an overactive version of this MAPKK is lethal to the cell. A gene construct has been developed that results in a positive feedback genetic circuit that leads to a high amplification of the signal that is transmitted through the CWI path of the S. cerevisiae yeast and results in cell loyalty.

The gene construct object of this invention leads to a continuous amplification of the signal transmitted by the MAPK SIt2 through the factor of

Rlm1 transcript. The scheme that includes a preferred embodiment of the

Invention is: pYKL161C-MKKls 386P-ADHt, and therefore comprises the

following components:

pYKL161C-promoter of the YKL161C (MLPI) gene, characterized by SEO

ID NO: 1, which has a high transcriptional induction in response to

damage to the wall and to stimuli that activate the CWI route.

MKKls 386P_ characterized by SEO ID NO: 2; MKKI allele that encodes a hyperactive version of this MAPKK, whose overexpression is lethal to the cell.

ADHt-region of transcriptional termination of the ADHI gene, characterized by SEO ID NO: 4.

Another aspect of the invention relates to vectors in which the possible constructions of the invention have been inserted. These vectors can subsequently be used to transform S. cerevisiae cells. In addition, the constructs of the invention can be integrated directly into the genome of a S. cerevisiae strain.

The invention also includes the S. cerevisiae strain deposited on September 26, 2014 in the Spanish Type Culture Collection (CECT), located in the Scientific Park of the University of Valencia, 46980 Paterna

(Valencia), with access number CECT13115 that, internally, receives the

reference yEA 1.

As indicated in Figure 1, in a cell that includes the gene construct of the invention, an amplification circuit is generated, with positive feedback, and the stimulation of the route involves the activation of the kinase cascade up to 51t2, phosphorylation and activation of Rlm1, the

YKL161C promoter induction and expression of the corresponding hyperactive allele. Its expression leads to a greater activation of Slt2, therefore of Rlm1, and therefore a greater expression of YKL 161C, generating a

activation loop that feeds positively and continuously while the stimulus is maintained. This entails a great amplification of the signal and, therefore, an excessive cellular response, which leads to the death of the cell at low concentrations of any agent that alters the wall of S. cerevisiae. Therefore, the gene construction of the invention gives the cells that carry it a hypersensitivity to the stimuli that activate the route

CWI

This invention has applications as a biosensor system of external stimuli. Strains that include gene construction can be used to more easily detect weak stimuli that naturally activate the route

CWI, due to its greater sensitivity.

The biosensor capacity of fungal strains with the genetic construction that

gives rise to the signal amplifier circuit allows its use as a pharmacological screening tool for the identification of different types of drugs:

i) On the one hand, for the search of antifungals.

With a yeast strain that includes the gene construct of the invention,

which gives rise to the amplification circuit on the CWI route, we can track 2

types of compounds with antifungal activity in a very simple way and

sensitive:

(A) compounds that alter cell wall processes or damage

directly said structure. These compounds cause cell death by

stimulate the amplification circuit of the CWI route, which is detected by HTS (High throughput screening) tracking systems. The strain that contains the

Gene construction is hypersensitive to damage to the wall, due to the effect

signal amplifier, so you can discover compounds that, being active on that target, are in low concentration or have a

reduced potency in the sample to be tested (natural or synthetic products

chemistry), so they could not be directly detected as inhibitors

of fungal growth in a wild strain of S. cerevisiae.

(B) compounds that inhibit components of the CWI pathway and, therefore,

S

to the compensatory mechanism that trips under conditions of damage in the

cell wall and that allows to maintain the integrity of this essential structure.

This second type of compounds could enhance the action of others.

antifungals that act directly on the cell wall in therapies

combined. These compounds are identified by their ability to avoid

10

cell death of fungal strains that include gene constructs

of the invention under conditions of activation of the amplification circuit by

some known stimulus of the CWI route. The fact that his way of

identification in the tracking either by recovery of cell viability,

favors the isolation of compounds with little toxicity per se over the

fifteen

eukaryotic cell

ii) Moreover, this bioassay can be used in tracking

Pharmacological for the search of antitumor drugs.

twenty

Keep in mind that both the proteins that operate on the routes

MAPK-mediated yeast S. cerevisíae, as the mechanisms of

activation, the molecular interactions that determine recognition and

the specificity of substrates or the subcellular location of the components,

They are very similar to those of other eukaryotic organisms, including

25

of superior eukaryotes. In fact, this structural and functional conservation

has made possible the use of S. cerevísiae as an experimental cell model

eukaryotic for cloning or characterization of human genes that

encode signaling proteins. Therefore, the possible compounds that are

they would obtain in a screening with the second bioassay described above (B)

30

as inhibitors of the components of the CWI route are potentially

inhibitors of similar MAPK pathways in mammalian cells. Since, in

In this case, the target is not fungus specific, the compounds selected

they can have an antitumor effect since these MAPK routes are essential in the cell proliferation of higher eukaryotic cells, playing a fundamental role in some oncological processes.

The development of bioassays using this system, either through the use of gene construction or through the use of vectors and cells that contain it, has a number of notable advantages, such as its easy

Adaptability to high performance technology (HTS), since it supports high density formats, presents a very easy detection system (measurement of

growth by spectrometry, compared to other systems based on reporter genes that involve measurement of enzymatic activity), rapidity in obtaining results, low cost (allows the use of culture media

simple undefined, without specific nutritional requirements), etc. A

An important innovation of this system is the combination of a high sensitivity of the yeasts that carry the gene construct of the invention with a great selectivity of action.

Another aspect of the invention relates to a kit for the detection of compounds

antifungals and / or antitumor drugs that include the gene constructs, vectors and / or eukaryotic cells of the invention.

In conclusion, yeast strains that include this gene construct constitute a simple, easy to handle, sensitive, specific, safe system.

and very economical to search for compounds that alter the fungal wall as well as modify the signaling through MAPK routes, and

therefore with potential antifungal or antitumor activity.

Description of the figures

Figure 1: Illustrative scheme of the operation of the genetic amplification and feedback circuit of the CWI route mediated by the MAPK SIt2 in

the yeast S. cerevisiae. The different components are shown that

they participate in this stress response route on the cell wall and the composition of the gene construct of the invention.

S

Figure 2: Sensitivity tests in liquid medium of strain YEA 1 and the isogenic wild BY4741 and mutant Y00993 (sIt2lJ), against Congo red (represented as "RC"), a cell wall altering compound, using a method of microdilution

10

Figure 3: Viability recovery tests in liquid medium in the presence of Congo red of strain YEA1 and wild isogenic BY4741 and mutant slt2lJ, after the addition of cercosporamide (represented as "C"), an agent that inhibits signaling to through the CWI route, using a microdilution method.

fifteen

EMBODIMENT OF THE INVENTION The present invention is further illustrated by the examples, which are not intended to limit its scope. following

20 25

Example 1: Construction of the plasmid pEAl that includes the signal amplification cassette of the CWI route. In order to construct the plasmid pEA1 with the signal amplification cassette of the CWI route, the three modules that include the gene construction of the invention (the cutting sites) were amplified separately and by polymerase chain reaction (PCR). of the corresponding restriction enzymes are indicated by underlining):

30

Promoter region of the YKL161C gene, using the oligonucleotide primers MLP1PR5 (CCCCGGAATTCGGGCCCACAACAAGAACGT GGGCGATAC), characterized by SEQ ID NO: 5, which introduces EcoRI and PspOMI cut-off points; and MLP1PR3 (CCCCCTCGAGCATTTAATTG TGAATCTTTCTTCG), characterized by SEQ ID NO: 6, which introduces

a point Xhol. As a template, genomic DNA of strain S288C was used

of S. cerevisiae. Amplification of the hyperactive version of the MKK1s386P gene. They were used

MKKI-5 oligonucleotide primers (CCCGTCGACTCGAGATGG CTICACTGTICAGACC), characterized by SEO ID NO: 7, which

introduces Sall-Xho cutting sites / at the beginning of the sequence

amplified and oligonucleotide MKKI-3 (CCCGTCGACTIAATCTTIC CAGCACTICC), characterized by SEO ID NO: 8, which introduces a site

Sall at the end of the amplified sequence. The mold was used as

plasmid pNV7W_MKK1s386P (Watanabe, Y. al. 1995. Yeast RLMl

encades a serum response factor-like protein that may function

downstream of the Mpkl (Slt2) mitogen-activated protein kinase pathway. Mol. Cell Biol. 15, 5740-5749).

Amplification of the terminator region of the ADH1 gene, with

oligonucleotides ADHT5 (CCCCGGATCCGTCGACCCTGAGTAAATAA GCG), characterized by SEO ID NO: 9, which introduces BamHI-Sall cutting sites, and ADHT3B (CCCCCGGATCCCGGTGGTGGTCAATAAG), characterized by SEO ID NO: 10, which introduces a BamHI cutting site. As a template, genomic DNA of the S288C strain of S. was used.

cerevisiae

Next, the gene construct was assembled by tandem subcloning the three modules indicated above, following the EcoRI sequence

pYKL161C-Xhol-MKK1S386P-San-ADHI-BamHI, and were introduced as a gene fragment into the integration vector M4366 HO-hisG-URA3-hisG-polyHO (Voth el al. 2001. Yeast vectors for integration at the HO locus. Nucleic Acids Res. 29, E59) (accession number AF324729) between the EcoRI and BamHl sites, generating the plasmid pEAl.

Example 2: Construction of the recombinant strain yEA1 of S. cerevisiae

To construct the recombinant strain yEA1 of S. cerevisiae, the

pYKL 161C-MKK1S386P-ADHI gene construct in the genome of the wild strain BY4741 (EUROSCARF collection) by transforming it with the Notl-Notl fragment from plasmid pEA 1, thus addressing the

integration to the HO locus of said strain. For the transformation, the lithium acetate method was followed by selecting the transformants in medium lacking uracil. Its integration into the HO locus was confirmed by PCR amplification assays, using 5 'oligonucleotides

CTGATATGTCTGAGG-3 ', characterized by SEO ID NO: 11, which hybridizes in the HO gene, and 5' -CATIGGAAATIAGGGC '-3, characterized by SEO ID NO: 12, which hybridizes in the sequence of the promoter region of the YKL 161C gene . Behind the

10 verification of its correct integration, the loss of the URA3 selection marker, present in the integration cassette, was forced by culturing in the presence of 5-fluoroorotic acid, which is toxic to those cells

carriers of the URA3 gene, obtaining strain yEA 1.

15 Example 3: Test of strain yEA1 against altering wall agents

mobile.

As an example of the applicability of this system in the search for fungal cell wall altering antifungals, inhibition of

growth that causes red Congo, a substance that binds to chitin

20 of the cell wall and interferes with the stability of the cell wall of the

yeast. The tests were performed on strain yEA 1, compared to the

wild strain BY4741 and with an isogenic slt2Ll mutant strain (EUROSCARF strain Y00993). The test was performed by culturing a pre-circle of each yeast strain in YPD medium (Yeast Extraet-Peptone-Dextrose, medium

25 common fungal growth) to a concentration of 2 x 107 cells (equivalent to a 00600 between 0.8 and 1.2), from which the culture was diluted to an estimated OD 0.01, inoculating 75 ~ I of this suspension in each well of a multiwell plate (96 wells), containing 75 ~ I of fresh medium YPD in each well, to which Congo red was added in a concentration

30 between 0.0029 and 1.5 g / ml, as indicated in Figure 2. The multiwell plates were incubated at 24 ° C for 24 hours, assessing the growth of the three strains used in a reader plates like

absorbance at 600nM. In the graph of Figure 2, the

behavior in this trial of the three strains, with the growth represented in ordinates and the concentrations of Congo red used in the abscissa axis. You can see how the Minimum Concentration

Inhibitory (MIC) of this compound on strain yEA 1 that includes the

Gene construct of the invention is smaller than over the wild strain

BY4741 and even that on the strain deleted in the SLT2 gene. This indicates the high sensitivity of strain yEA 1, which carries the gene construct here

described.

Example 4: Test of strain yEA 1 against agents that inhibit signaling through the CWI route. As an example of the applicability of this system in the search for compounds that inhibit the CWI path of

fungi, a growth recovery test by cercosporamide is shown. Cercosporamide is a commercial Pkc1 protein kinase inhibitor, an essential component in signaling through the CWI pathway. The test was performed as in Example 3, with the exception that

aMixed a fixed concentration of 0, 025 ~ g / ml of Congo red to all wells to induce the positive feedback genetic circuit to which the

gene construct of the invention and varying concentrations of cercosporamide, in a range that is not toxic to the wild strain (between 2.5 and 40 ~ g / ml); In addition, the same three strains were used as in the example

3. The graph in Figure 3 shows, in ordinates, the growth in these conditions of the three strains tested, after 24 hours of incubation at 24 ° C, compared to the cercosporamide concentrations used, in the abscissa axis. The recovery of the growth that caused the

Cercosporamide in strain YEA1 from a concentration of 20 ~ g / ml,

while the isogenic s1t2L'l mutant strain did not grow at any of the concentrations tested.

Free text from the sequence list

The free text used in the sequence list corresponds in Spanish to the following characteristics:

SEO ID NO: 5 AON artificial sequence; YKL 161C based primer from Saccharomyces

cerevisiae Nucleotides 6 to 11: restriction enzyme recognition site

EcoRI

Nucle6tides from 12 to 17: PspOMI restriction enzyme recognition site.

SEO ID NO: 6 Artificial DNA sequence; YKL 161C based primer from Saccharomyces

cerevisiae

Nucle6tidos del5 a110: Xhol restriction enzyme recognition site

SEO ID NO: 7 Artificial DNA sequence; MKK1 based primer from Saccharomyces

cerevisiae Nucle6tidos from 4 to 9: Sallo restriction enzyme recognition site

Nucle6tidos del9 a114: Xhol restriction enzyme recognition site

SEO ID NO: 8 Artificial DNA sequence; MKK1 based primer from Saccharomyces

cerevisiae Nucleotides 4-9: Safl restriction enzyme recognition site.

SEO ID NO: 9 AON artificial sequence; ADH1 based primer of Saccharomyces cerevisiae.

Nucle6tides 5 to 10: restriction enzyme recognition site

BamHI

Nucle6tides 11 to 16: restriction enzyme recognition site

Salt.

SEQ ID NO: 10 Artificial DNA sequence: Saccharcmyces ADHI based primer

cerevisiae

Nucle61ids 6 to 11: restriction enzyme recognition site

BamHI

SEQ ID NO: 11 Primer based on the HO gene of Saccharomyces cerevisiae.

SEQ ID NO: 12 Primer based on the promoter region of the YKL 161C gene of Saccharomyces cerevisiae.

SEQ ID NO: 13 Artificial sequences of AON; gene construct comprising the promoter region of the YKL161C gene, the MKKI5386P gene and the termination region of the ADHI gene of Saccharcmyces cerevisiae. Nucleotides 1 to 6: restriction enzyme recognition site

EcoRI

Nucle6tides 7 to 12: restriction enzyme recognition site

PspOMI. Nucleotides from 13 to 1204: promoter of the YKL 161C gene of S. cerevisiae. Nucleotides from 1205 to 1210: enzyme recognition site of Xhol restriction. Nucle6tids from 1211 to 2737: S. cerevlsiae MKKI5386P gene. Nucleotides from 2738 to 2743: enzyme recognition site of Sa / l restriction. Nucleotides from 2744 to 2938: termination region of the ADHI gene of S. cerevisiae

Nucleatides from 2939 to 2944: BamHI restriction enzyme recognition site.

.

Claims (13)

one.

Gene construction comprising the following components, in the order indicated in the 5 'to 3' transcription direction: -the promoter sequence of a gene inducible by the transcription factor Rlm1 of the cellular integrity pathway (CWI) of Saccharomyces cerevisiae, -a DNA sequence whose expression gives rise to the Mkk1 protein of Saccharomyces cerevisiae with a mutation that produces the modification of amino acid S386 by P386 in said protein, as described in SEO ID NO: 3 and called Mkk1 SJ86P, and -a sequence of transcription termination; wherein the distance between the 3 'end of the promoter sequence and the 5' end of the DNA sequence whose expression gives rise to the prolein Mkk1 s386P is less than or equal to 18 nucleotides and the distance between the 3 'end of the DNA sequence whose expression gives rise to the Mkk1 s386P protein and the 5 'end of the termination sequence is less than or equal to 18 nucleotides.

2.

Gene construction in which the DNA sequence whose expression gives rise to prolein Mkk1 5386P is the polynucleotide described in SEO ID NO: 2, called MKK1s386P.

3. Gene construction according to any of claims 1-2 in which the promoter sequence is the promoter region of the YKL 161c gene, characterized by SEO ID NO: 1.

Four.

Gene construct according to any one of claims 1-3 wherein the transcription termination sequence is the ADHI gene termination sequence of Saccharomyces cerevisiae, characterized by SEO ID NO: 4.

5.

Gene construction characterized by SEO ID NO: 13.

6.

Vector containing any of the constructions defined in claims 1-5.

7.

S. cerevisiae cell containing the vector defined in claim 6.

8.

Recombinant S. cerevisiae cell that includes in its genome any of the constructs defined in claims 1-5.

9. S. cerevisiae strain deposited in the Type Crop Collection (CECT) 10 with the accession number CECT13115. 10. Method for detecting antifungal compounds that alter the fungal cell wall that includes the following steps: a) inoculate a sufficient amount of a S. cerevisiae strain as 15 defines in any of claims 7-9 in culture medium containing, in successive tubes, microtubes or wells, increasing concentrations of the products to be evaluated; b) incubate the inoculated culture medium from step a); c) determine the growth of the inoculated strain in step a); D) select the product (s) included in the culture medium of step a) in which less growth of the S. cerevisiae strain defined in claims 7-9 is detected with respect to a wild strain used as control eleven . Method for detecting inhibitory antitumor or antifungal compounds 25 of the signaling through the CWI route that includes the following steps: a) inoculate a sufficient amount of a S. cerevisiae strain as defined in any of claims 7-9 in culture medium containing a compound that stimulates the CWI route and, in successive tubes, microtubes or wells, increasing concentrations of the products that are 30 want to evaluate; b) incubate the inoculated culture medium from step a); c) determine the growth of the inoculated strain in step a); d) selecting the product (s) included in the culture medium of step a) in which greater growth of the S. cerevisiae strain defined in claims 7-9 is detected with respect to a wild strain used as control. 12. A method according to claim 11 wherein the stimulating compound of the CWI route from step a) is Congo Red. 13. Use of gene construction, vectors and cells defined in claims 1-9 in the detection of antifungal compounds and 10 antitumor compounds. 14. Kit for the detection of antifungal and antitumor compounds that includes gene constructs, vectors and eukaryotic cells defined in claims 1-9.