ES2530292A1 - Gene construction and methods to detect antifungal and antitumor compounds (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

Gene construction and methods to detect antifungal and antitumor compounds. The present invention relates to a gene construct for the amplification of the response to signals that activate the cell integrity pathway (cwi) in saccharomyces cerevisiae. It comprises a hyperactive allele of the mapkk of this route, under the control of the promoter of a gene induced by rlm1, which implies the creation of a positive feedback loop whose stimulation leads to cell death. The invention also relates to methods for detecting agents that alter the cell wall or the function of components of the route itself, which allows the detection of antifungal and/or antitumor pharmacological compounds. (Machine-translation by Google Translate, not legally binding)

Description

Gene construction and methods to detect antifungal and antitumor compounds

Technical Sector The present invention falls within the pharmaceutical industry sector biotechnology and, more specifically, in pharmacological screening programs to search for compounds with antifungal or signal modifying activity mediated by MAPKs (Mitogen Activated Protein Kinases).

State of the art: The epidemiology of invasive fungal infection (IFI) has changed in the last 20 years, so mycoses are considered emerging diseases today. Its incidence has increased significantly and the population at risk has expanded to include patients with different underlying diseases such as those suffering from hematological cancer, those admitted to intensive care units, solid organ transplant recipients or those receiving high doses of corticosteroids or other immunosuppressants (GarcíaVidal et aL, 2013. Pathogenesis of invasive fungal infections. Curr. Opino Infect. Dis. 26, 270-276). Furthermore, this increase has also been observed in other much larger patient populations such as those with chronic obstructive pulmonary disease. Also relevant is the fact that the etiology of invasive fungal infections is changing. In addition to Gandida a / bicans and Aspergíllus fumigatus, other species such as Gandida g / abrata, Aspergíllus terreus, Tríchosporon asahíi, Fusarium spp, Scedosporium spp, Mucora / es and dematiaceos are being identified as causative agents of IFI. All these emerging species have the common characteristic of being much more resistant to antifungals than G. a / bicans and A. fumigatus, which increases already high mortality.

The current number of effective antifungals is relatively small and, contrary to what could be expected by analogy with what happens in the case of antibacterial drugs that act on the cell wall, only one type of antifungal compound has been marketed so far. that act on this target, inhibiting the synthesis of ~ -glucan: echinocandins (Drew et al., 2013. Recent advances in the treatment of lifethreatening, invasive fungal infections. Expert. Opino Pharmacother. 14, 23612374). One of the reasons for the shortage of antifungal drugs of this type is probably the limited number of specific screening procedures directed at this target, as opposed to the classic strategy of searching for inhibitors of fungal growth in a general way. Some methodologies focused on the search for antifungals that specifically act on the cell wall have been proposed, such as the search for compounds that inhibit fungal GTPases that regulate the process of maintaining the integrity of the cell wall (EP0892854B1), compounds that can inhibit mannosyl transferases (N or O-glycosylations), which are absent enzymes in mammalian cells and essential for the maintenance of the fungal cell wall (US6153376A), or specific inhibitors of the product of genes related to this structure and which are essential for fungal viability such as CaKRE5, CaALR1 or CaCdc24 (W00068420A2). Strategies aimed at evaluating the expression of genes that indicate activity of the glucan synthase pathway have also been proposed, such as the SKM1, YPS3, YKL 161C (MLP1), MET10 genes, etc. (W02004057033A1). Likewise, a methodology has been proposed to identify compounds that alter the cell wall by evaluating the expression of the promoter of one of these genes, MLP1, since its expression is regulated by the cell wall integrity pathway (CWI). , Cel / Wal / Integrity) dependent on the Rlm1 transcription factor, so that when the pathway is induced, as a consequence of a significant alteration of the cell wall, this is the gene whose expression is most induced. The fusion of said promoter to the antibiotic resistance gene nurseotricin allows to detect the induction of the route based on the resistance of the yeast to said antibiotic (ES2303452B1).

Another reason that could explain the low number of inhibitors of fungal cell wall biogenesis identified so far, could be precisely the existence of the effective rescue mechanism induced by the CWI pathway under conditions that endanger this structure.

All types of cells, from the most basic prokaryotes to the most complex eukaryotes, use signal transduction pathways to recognize and adapt to the environment around them, as well as to communicate with other cells. Of particular relevance in eukaryotic organisms are the routes in which MAPKs (Mitogen Activated Protein Kinases) intervene. These protein kinases regulate essential processes such as gene expression or protein translation, stability and localization. It is not surprising, therefore, that MAPKs play an essential role in processes such as embryogenesis, cell proliferation and differentiation, apoptosis, stress response, cell mobility, metabolic homeostasis, immunity or cardiac function, or that MAPK signaling abnormalities are associated with human diseases such as obesity, diabetes, neurodegenerative disorders, rheumatoid arthritis, or cancer (Kim and Choi, 2010. Pathological roles of MAPK signaling pathways in human diseases. Biochim. Biophys. Acta. 1802 , 396-405).

These pathways, evolutionarily conserved in eukaryotes, share a cascade of three protein kinases: a MAPK kinase kinase (MKKK or MEKK), a MAPK kinase (MKK or MEK), and MAPK itself, which are successively phosphorylated and activated under stimulating conditions. Once activated, MAPKs in turn phosphorylate effector proteins, eg, transcription factors, thereby regulating gene expression (Yang et al., 2013. MAP kinase signaling cascad es and transcriptional regulation. Gene 513, 113) .

In the yeast Saccharomyces cerevisiae, a eukaryotic unicellular organism, 5 MAPKs operate: Fus3, Kss1, Hog1, 8mk1 and 81t2, which define 5 routes that regulate mating, filamentous growth, the response to conditions of osmotic stress, the formation of spores and cellular integrity, respectively (Chen and Thorner, 2007. Function and regulation in MAPK signaling pathways: Lessons learned from the yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta. 1773, 1311-1340). In response to an attack on the S. cerevisiae cell wall, an essential structure that protects and shapes it, stimulation of the MAPK Slt2-mediated pathway occurs, called the cell wall integrity pathway (CWI; reviewed by Levin in 2005 -Levin, OE, 2005. Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 69, 262-291-). Activation of this pathway triggers a compensatory mechanism aimed at maintaining the stability of the cell wall by remodeling it, fundamentally through a change in the pattern of gene expression, and thereby ensure cell viability against such aggression. The SIK2 MAPK is activated by the redundant MAPKKs Mkk1 and Mkk2, which in turn are activated by the MAPKKK Bck1. Bck1 is stimulated by protein kinase C Pkc1, which in turn is activated by GTPase Rh01 in response to the signal detected by the Mid2 and Wsc1,2,3 membrane mechosensors. Once activated, SIt2 phosphorylates and activates the transcription factor Rlm1, which promotes an increase in transcription of a series of genes, including YKL 161G (MLP1), GRH1, GWP1, SL T2 or RLM1. On the other hand, the cell wall is not present in mammalian cells, while this pathway is also conserved in pathogenic fungi, such as Gandida albicans (Navarro-Garcia, F. et al., 2001. Signal transduction pathways and cell-wall construction in Gandida albicans. Med. Mycol. 39 Supp / 1, 87-100), Aspergillus fumigates tus (May, GS et al., 2005. Mitogen activated protein kinases of Aspergillus fumigates. Med.Mycol. 43 Suppl 1, S83- S86) or Gryptococcus neoformans (Kozubowski, L. et al., 2009. Signaling pathways in the pathogenesis of Gryptococcus. Cell Microbiol. 11, 370-380).

In conclusion, it is necessary to develop new search systems and therapeutic strategies to solve these problems. In this line of action is included the invention presented here, which is oriented to the use of hypersensitive strains for pharmacological screening of compounds that specifically damage the fungal cell wall, or inhibit the compensatory mechanism controlled by the CWI pathway.

Detailed description of the invention

Gene construction and methods to detect antifungal and antitumor compounds.

In order to obtain a system with which to screen new drugs with a potentially antifungal effect, in the present invention a gene construct has been made that includes the Saccharomyces cerevisiae MKK1 gene modified by a mutation that results in a change in amino acid 386 of the protein , so that the serine of the wild sequence is replaced by a proline, which gives rise to an overactive form of the gene (MKK1S386P); in the gene construction, furthermore, said gene is preceded by a promoter sequence inducible by the transcription factor Rlm1 of the CWI pathway and a transcription termination sequence is also included.

In the present invention, "promoter sequence" means the region of a DNA molecule to which RNA polymerase binds to initiate transcription, and "transcription termination sequence" means the DNA sequence located in the end of the transcribed portion, and which causes RNA polymerase to terminate transcription.

One aspect of the present invention relates to a gene construct comprising the following components, in the order indicated in the 5 'to 3' direction of transcription: -the promoter sequence of a gene inducible by the transcription factor Rlm1 of the cellular integrity pathway (CWI) of Saccharomyces cerevisiae, -an ONA sequence whose expression gives rise to the Mkk1 protein of Saccharomyces cerevisiae with a mutation that produces the modification of amino acid S386 by P386 in said protein, named Mkk1s386P, according to described in SEQ ID NO: 3, and -a transcription termination sequence. In this gene construct the distance between the 3 'end of the promoter sequence and the 5' end of the ONA sequence whose expression gives rise to the Mkk1 S386P protein is less than or equal to 18 nucleotides and the distance between the 3 'end of the ONA sequence whose expression gives rise to the Mkk1s386P protein and the 5 'end of the termination sequence is less than or equal to 18 nucleotides. In fact, at the junction between two of the components of the construct, for example, nucleotides of target sequences of restriction enzymes can be inserted into the sequence of one or more components to facilitate the union of the different components of the construct, or or other nucleotide sequences, provided they do not alter the functionality of the construct.

In a preferred embodiment, the promoter sequence belongs to the YKL161C (MLP1) gene, which is described in SEQ ID NO: 1. On the other hand, as the transcription termination sequence, a preferred embodiment includes the ADHt termination sequence, described in SEQ ID NO: 4. The most preferred embodiment of the invention, characterized by SEQ ID NO: 13, includes pYKL161C and ADHt.

Overexpression of the MKK1s386P allele encoding an overactive version of this MAPKK is cell-lethal. A gene construct has been developed that results in a positive feedback loop that leads to high signal amplification that is transmitted through the CWI pathway of S. cerevisiae yeast and results in lethality for cells.

The gene construction object of this invention leads to a continuous amplification of the signal transmitted by MAPK SIt2 through the transcription factor Rlm1. The scheme that includes a preferred embodiment of the invention is: pYKL 161C-MKK1s386P-ADHt, and therefore comprises the following components:

pYKL 161C-promoter of the YKL 161C gene (MLP1), characterized by SEO ID NO: 1, which has a high transcriptional induction in response to wall damage and stimuli that activate the CWI pathway.

MKK1s386P_ characterized by SEO ID NO: 2; MKK1 allele encoding a hyperactive version of this MAPKK, whose overexpression is lethal to the cell.

ADHt-transcriptional termination region of the ADH1 gene, characterized by SEO ID NO: 4.

Another aspect of the invention relates to vectors into which the possible constructions of the invention have been inserted. These vectors can subsequently be used to transform S. cerevísíae cells. Furthermore, the constructs of the invention can be directly integrated into the genome of a strain of S. cerevísíae.

The invention also includes the S. cerevísíae strain deposited on September 26, 2014 in the Spanish Type Culture Collection (CECT), located in the Scientific Park of the University of Valencia, 46980 Paterna (Valencia), with number of access CECT13115 which, internally, receives the reference yEA 1.

As indicated in Figure 1, in a cell that includes the gene construct of the invention, an amplification circuit is generated, with positive feedback, and the stimulation of the path involves the activation of the kinase cascade to Slt2, Rlm1 phosphorylation and activation, induction of the YKL 161C promoter, and expression of the corresponding overactive allele. Its expression leads to a greater activation of Slt2, therefore of Rlm1, and therefore a greater expression of YKL 161C, generating an activation loop that is positively and continuously fed back while the stimulus is maintained. E "o con" eva a large signal amplification and, therefore, an excessive cellular response, which leads to the death of the cell at low concentrations of any agent that alters the wall of S. ce re vísía e. Therefore, the gene construction of the invention gives the cells that carry it a hypersensitivity to the stimuli that activate the CWI pathway.

This invention has applications as a biosensor system for external stimuli. Strains that include the gene construct can be used to more easily detect weak stimuli that naturally activate the CWI pathway, due to their increased sensitivity.

The biosensing capacity of fungal strains with the gene construction that gives rise to the signal amplifier circuit allows their use as a pharmacological screening tool for the identification of different types of drugs:

i) On the one hand, for the search for antifungals. With a yeast strain that includes the gene construct of the invention, which gives rise to the amplification circuit in the CWI pathway, we can trace 2 types of compounds with antifungal activity in a very simple and sensitive way:

(A) compounds that alter cell wall processes or directly damage said structure. These compounds cause cell death by stimulating the amplification circuit of the CWI path, which is detected by HTS (Hígh fhroughpuf screening) systems. The strain that contains the gene construct is hypersensitive to damage to the wall, due to the amplifying effect of the signal, so it can allow the discovery of compounds that, being active on that target, are in low concentration or have a reduced potency in the sample to be tested (natural or synthetic products

chemistry), so they could not be directly detected as inhibitors

of fungal growth in a wild strain of S. cerevisiae.

(B) compounds that inhibit components of the CWI pathway and, therefore, the compensatory mechanism that is triggered under conditions of damage to the cell wall and that allows the integrity of this essential structure to be maintained. This second type of compound could enhance the action of other antifungals that act directly on the cell wall in combined therapies. These compounds are identified by their ability to prevent cell death of fungal strains that include the gene constructs of the invention under conditions of activation of the amplification circuit by some known stimulus of the CWI pathway. The fact that its identification form in the screening is by recovery of cell viability, favors the isolation of compounds with little toxicity per se on the eukaryotic cell.

ii) On the other hand, this bioassay can be used in pharmacological screening to search for antitumor drugs.

It should be borne in mind that both the proteins that operate on the MAPKs-mediated pathways in S. cerevisiae yeast, as well as the activation mechanisms, the molecular interactions that determine the recognition and specificity of substrates, or the subcellular location of the components, they are very similar to those of other eukaryotic organisms, including those of higher eukaryotes. In fact, this structural and functional conservation has made possible the use of S. cerevisiae as an eukaryotic cell experimental model for the cloning or characterization of human genes that encode signaling proteins. Therefore, the possible compounds that would be obtained in a screening with the second bioassay previously described (B) as inhibitors of the components of the CWI pathway are, potentially, inhibitors of similar MAPKs pathways in mammalian cells. Given that, in this case, the target is not fungus-specific, the selected compounds may have an antitumor effect since these MAPKs routes are essential in the cellular proliferation of higher eukaryotic cells, playing a fundamental role in some logical ancal processes.

The development of bioassays using this system, either by using the gene construct or by using the vectors and / or cells that contain it, has a number of notable advantages, such as its easy adaptability to high-performance technology. (HTS), since it supports high-density formats, presents a very easy detection system (growth measurement by spectrometry, compared to other systems based on reporter genes that involve measurement of enzyme activity), speed in obtaining results, low cost (allows the use of simple undefined culture media, without specific nutritional requirements), etc. An important innovation of this system is the combination of a high sensitivity of the yeasts that carry the gene construction of the invention with a high selectivity of action.

Another aspect of the invention relates to a kit for the detection of antifungal and / or antitumor compounds that includes the gene constructs, the vectors and / or the eukaryotic cells of the invention.

In conclusion, the yeast strains that include this gene construct constitute a simple, easy to manipulate, sensitive, specific, safe and very economical system for searching for compounds that both alter the fungal wall and modify the signaling through MAPK pathways. , and therefore with potential antifungal or antitumor activity.

Description of the figures

Figure 1: Illustrative diagram of the way of operating the genetic amplification and feedback circuit of the CWI pathway mediated by MAPK SIt2 in the yeast S. cerevisiae. The different components that

participate in this stress response pathway on the cell wall and the

composition of the gene construct of the invention.

Figure 2: Liquid medium sensitivity assays of the yEA 1 strain and the wild-type isogenic BY4741 and mutant Y00993 (sIt211), against Congo red (represented as "RC"), a cell wall disrupting compound, using a method of microdilution.

Figure 3: Viability recovery tests in liquid medium in the presence of Congo red from the yEA1 strain and the wild isogenic BY4741 and mutant sIt211, after the addition of cercosporamide (represented as "C"), an agent that inhibits signaling to through the CWI route, using a microdilution method.

EMBODIMENT OF THE INVENTION

The present invention is further illustrated by the following examples, which are not intended to be limiting in scope.

Example 1: Construction of the plasmid pEA1 including the CWI pathway signal amplification cassette.

To construct the plasmid pEA 1 with the CWI pathway signal amplification cassette, the three modules that include the gene construction of the invention (the sites of the invention) were separately amplified by means of the polymerase chain reaction (PCR). section of the corresponding restriction enzymes are indicated by underlining):

Promoter region of the YKL 161e gene, using the primer oligonucleotides MLP1 PR5 (CCCCGGAATTCGGGCCCACAACAAGAACGT GGGCGATAC), characterized by SEO ID NO: 5, which introduces EcoRI and PspOMI cutpoints; AND MLP1PR3 (CCCCCTCGAGCATTTAATTG TGAATCTTTCTTCG), characterized by SEO ID NO: 6, which introduces

a point Xhol. Genomic DNA from strain S288C was used as template

S. cerevisiae.

-

Amplification of the hyperactive version of the MKK1s386P gene. Primer oligonucleotides MKK1-5 (CCCGTCGACTCGAGATGG CTTCACTGTTCAGACC), characterized by SEO ID NO: 7, introducing Sall-Xhol cleavage sites at the beginning of the amplified sequence, and MKK1-3 oligonucleotide (CCCGTCGACTT AATCTTTC CAGCACTTCC), characterized by ID NO: 8, which introduces a Sall site at the end of the amplified sequence. The plasmid pNV7W-MKK1s386P (Watanabe, Y. et al. 1995. Yeast RLM1 encodes a serum response factor-like protein that may function downstream of the Mpk1 (Slt2) mitogen-activated protein kinase pathway was used as a template. Mol. Cell Biol .15,5740-5749).

-

Amplification of the terminator region of the ADH1 gene, with the oligonucleotides ADHT5 (CCCCGGATCCGTCGACCCTGAGT AAA T AA GCG), characterized by SEO ID NO: 9, which introduces BamHI-Sall cleavage sites, and ADHT3B (CCCCCGGATCCCGGTGGTGGTCAA T AAG), characterized NO: 10, which introduces a BamHI cut site. Genomic DNA from S strain S288C was used as template.

cerevisiae.

Next, the gene construct was assembled by tandem subcloning the three modules indicated above, following the sequence EcoRIpYKL161 C-Xhol-MKK1s386P-Sa / l-ADHt-BamHI, and introduced as a gene fragment into the integration vector M4366 HO- hisG-URA3-hisG-polyHO (Voth et al. 2001. Yeast vectors for integration at the HO locus. Nucleic Acids Res. 29, E59) (accession number AF324729) between the EcoRI and BamH1 sites, generating the plasmid pEA1.

Example 2: Construction of the recombinant S. cerevisiae strain yEA1 To construct the recombinant S. cerevisiae strain yEA 1, the gene construct pYKL161C-MKK1s386P-ADHt was integrated into the genome of the wild BY4741 strain (EUROSCARF collection) by transformation with the Notl-Notl fragment from the plasmid pEA 1, thus directing the integration to the HO locus of said strain. For transformation, the lithium acetate method was followed by selecting transformants in uracil-free medium. Its integration in the HO locus was confirmed by means of PCR amplification assays, using the 5'CTGATATGTCTGAGG-3 'oligonucleotides, characterized by SEQ ID NO: 11, which hybridizes in the HO gene, and 5'-CATTGGAAATTAGGG''3, characterized by SEO ID NO: 12, which hybridizes in the sequence of the promoter region of the YKL 161C gene. After verifying its correct integration, the loss of the URA3 selection marker, present in the integration cassette, was forced by cultivation in the presence of 5-fluoroorotic acid, which is toxic to those cells carrying the URA3 gene, obtaining the strain yEA 1.

Example 3: Assay of the yEA1 strain against cell wall disrupting agents.

As an example of the applicability of this system in the search for antifungals in the fungal cell wall, the inhibition of growth caused by Congo red, a substance that binds to chitin in the cell wall and interferes with yeast cell wall stability. The tests were performed on the yEA 1 strain, compared to the wild BY 47 41 strain and to an isogenic slt2fJ mutant strain (EUROSCARF strain Y00993). The assay was performed by cultivating a preinoculum of each yeast strain in YPO medium (Yeast Extract-Peptone-Dextrose, common fungal growth medium) to a concentration of 2 x 107 cells (equivalent to 00600 between 0.8 and 1,2), from which the culture was diluted to an estimated OD 0.01, 75 1-11 of this suspension being inoculated in each well of a multi-well plate (96 wells), containing 75 1-11 of fresh medium YPO in each well, to which Congo red was added in a concentration between 0.0029 and 1.5 I-Ig / ml, as indicated in Figure 2. The multi-well plates were incubated at 24 ° C for 24 hours, assessing the growth of the three strains used in a plate reader as absorbance at 600nM. The graph in Figure 2 shows the behavior in this test of the three strains, with the growth represented in ordinates and the concentrations of Congo red used in the abscissa axis. It can be seen how the Minimum Inhibitory Concentration (MIC) of this compound on the yEA 1 strain that includes the gene construct of the invention is lower than on the wild BY 4741 strain and, even, on the SL T2 gene-deleted strain . This indicates the high sensitivity of the yEA 1 strain, which carries the gene construct described here.

Example 4: Assay of the yEA1 strain against signaling inhibiting agents through the CWI pathway. As an example of the applicability of this system in the search for fungal CWI pathway inhibitor compounds, a cercosporamide growth recovery assay is shown. Cercosporamide is a commercial inhibitor of protein kinase Pkc1, an essential component in signaling through the CWI pathway. The assay was performed the same as in Example 3, with the exception that a fixed concentration of 0.025 µg / ml Congo red was added to all wells to induce the positive feedback loop resulting in Gene construction of the invention and variable concentrations of cercosporamide, in a range that is not toxic to the wild strain (between 2.5 and 40 µg / ml); In addition, the same three strains were used as in the example

3. The graph of Figure 3 shows, in ordinates, the growth under these conditions of the three strains tested, after 24 hours of incubation at 24 ° C, against the concentrations of cercosporamide used, on the abscissa axis. Recovery of the growth caused by cercosporamide in the yEA 1 strain is observed from a concentration of 20 µJg / ml, while the isogenic slt2LJ mutant strain did not grow at any of the concentrations tested.

Free text of the sequence list

The free text used in the sequence list corresponds in Spanish to

the following characteristics:

SEQ ID NO: 5

AON artificial sequence; primer based on YKL 161C from Saccharomyces cerevisiae.

Nucleotides 6-11: restriction enzyme recognition site

EcoRI.

Nucleotides 12-17: restriction enzyme recognition site

PspOMI.

SEQ ID NO: 6

AON artificial sequence; primer based on YKL 161C from Saccharomyces cerevisiae. Nucleotides from 5 to 1 O: Xhol restriction enzyme recognition site

SEQ ID NO: 7

AON artificial sequence; Saccharomyces cerevisiae MKK1-based primer Nucleotides 4-9: restriction enzyme recognition site Sall. Nucleotides del9 to114: Xhol restriction enzyme recognition site

SEQ ID NO: 8

AON artificial sequence; Saccharomyces MKK1-based primer cerevisiae. Nucleotides 4-9: Sall restriction enzyme recognition site.

SEQ ID NO: 9

AON artificial sequence; Saccharomyces cerevisiae ADH1-based primer.

Nucleotides 5-10: restriction enzyme recognition site

BamHI.

Nucleotides 11-16: restriction enzyme recognition site

Sall.

SEQ ID NO: 10

Artificial DNA sequence; Saccharomyces cerevisiae AOH1-based primer.

Nucleotides 6-11: restriction enzyme recognition site

BamHI.

SEQ ID NO: 11

Primer based on the HO gene of Saccharomyces cerevisiae.

SEQ ID NO: 12

Primer based on the promoter region of the YKL 161 C gene of Saccharomyces cerevisiae.

SEQ ID NO: 13

Artificial DNA sequences; Gene construct comprising the promoter region of the YKL161C gene, the MKK1s386P gene and the termination region of the AOH1 gene from Saccharomyces cerevisiae. Nucleotides 1-6: restriction enzyme recognition site

EcoRI.

Nucleotides 7-12: restriction enzyme recognition site

PspOMI. Nucleotides 13 to 1204: promoter of the YKL 161C gene from S. cerevisiae. Nucleotides 1205 to 1210: recognition site of the enzyme Xhol constraint. Nucleotides 1211 to 2737: MKK1s386P gene from S. cerevisiae. Nucleotides 2738 to 2743: recognition site of the enzyme Sall constraint. Nucleotides 2744 to 2938: termination region of the AOH1 gene of S. cerevisiae.

Claims (13)

one.

Gene construct comprising the following components, in the order indicated in the 5 'to 3' direction of transcription: -the promoter sequence of a gene inducible by the transcription factor Rlm1 of the cellular integrity pathway (CWI) of Saeeharomyees eerevisiae, -a sequence of ONA whose expression gives rise to the Mkk1 protein of Saeeharomyees eerevisiae with a mutation that produces the modification of amino acid S386 by P386 in said protein, as described in SEO ID NO: 3 and called Mkk1s386P, and - a transcription termination sequence; in which the distance between the 3 'end of the promoter sequence and the 5' end of the ONA sequence whose expression gives rise to the Mkk1 S386P protein is less than or equal to 18 nucleotides and the distance between the 3 'end of the ONA sequence whose expression gives rise to the Mkk1 S386P protein and the 5 'end of the termination sequence is less than or equal to 18 nucleotides.

2.

A gene construct in which the ONA sequence whose expression gives rise to the Mkk1s386P protein is the polynucleotide described in SEO ID NO: 2, called MKK1s386P.

3. Gene construction according to any of claims 1-2, in which the promoter sequence is the promoter region of the YKL 161e gene, characterized by SEO ID NO: 1.

Four.

Gene construct according to any of claims 1-3 in which the transcription termination sequence is the Saeeharomyees eerevisiae ADH1 gene termination sequence, characterized by SEO ID NO: 4.

5.

Gene construct characterized by SEO ID NO: 13.

6.

Vector that contains any of the constructions defined in the

Claims 1-5.

7.

S. cerevisiae cell containing the vector defined in claim 6.

8.

Recombinant S. cerevisiae cell that includes in its genome any of the constructions defined in claims 1-5.

9.

S. cerevisiae strain deposited in the Type Culture Collection (CECT) with the accession number CECT13115.

10.

Method to detect antifungal compounds that alter the cell wall fungal that includes the following steps: a) inoculate a sufficient amount of a S. cerevisiae strain as defined in any of claims 7-9 in culture medium that contains, in successive tubes, microtubes or wells, concentrations crescents of the products to be evaluated; b) incubating the inoculated culture medium from step a); c) determining the growth of the strain inoculated in step a); d) select the products included in the culture medium from step a) in the one that detects less growth of the S. cerevisiae strain defined in the Claims 7-9 with respect to a wild strain used as a control.

eleven.

Method for detecting inhibitory antitumor or antifungal compounds signaling through the CWI route that includes the following steps: a) inoculate a sufficient amount of a S. cerevisiae strain as defined in any of claims 7-9 in culture medium that contains a compound that stimulates the CWI path and, in successive tubes, microtubes or wells, increasing concentrations of the products being you want to evaluate; b) incubating the inoculated culture medium from step a); c) determining the growth of the strain inoculated in step a);

d) selecting the product (s) included in the culture medium of step a) in which the greatest growth of the S. cerevísíae strain defined in claims 7-9 is detected with respect to a wild strain used as control. 12. The method of claim 11 wherein the CWI pathway stimulating compound of step a) is Congo Red. 13. Use of the gene construct, the vectors and / or the cells defined in the Claims 1-9 in the detection of antifungal compounds and / or 10 antitumor compounds. 14. Kit for the detection of antifungal and / or antitumor compounds that includes the gene constructs, the vectors and / or the eukaryotic cells defined in claims 1-9.