ES2305099T3 - DNA SEQUENCING METHOD. - Google Patents

Abstract

The present invention provides a method of identifying a base at a target position in a sample nucleic acid sequence, said method comprising: subjecting a primer hybridised to said sample nucleic acid immediately adjacent to the target position, to a polymerase primer extension reaction in the presence of a nucleotide, whereby the nucleotide will only become incorporated if it is complementary to the base in the target position, and determining whether or not said nucleotide is incorporated by detecting whether PPi is released, the identity of the target base being determined from the identity of any nucleotide incorporated, wherein, where said nucleotide comprises an adenine base, an alpha-thio triphosphate analogue of said nucleotide is used, ant the Rp isomer of said analogue and/or the degradation products of said analogue are eliminated from the polymerase reaction step.

Description

DNA sequencing method.

The present invention relates to improvements in DNA sequencing methods, which are based on detection of the incorporation of bases by the release of pyrophosphate (PPi).

DNA sequencing constitutes a Essential tool in molecular genetic analysis. The capacity  to determine the nucleotide sequences of DNA has become increasingly important as efforts have been made to determine the sequences of the great genomes of man and of other organisms.

Techniques that allow rapid detection of a single change in a DNA base, or some changes in the bases are also important tools for the genetic analysis, for example, in clinical situations in the analysis of genetic diseases or certain cancers. Truly, the more and more diseases described are associated with changes to genetic level, more especially to single nucleotide polymorphisms (SNP), increases the need for methods, both to track SNP or other mutations or genetic changes (by sequencing of representative genomic samples), such as to classify SNPs (or other mutations / changes). In this way, the more they have developed new sequencing technologies to determine the sequence of longer stretches of DNA, the technique has experienced also a rapid increase in the development of technologies for detect unique (or some) changes in the bases. Such protocols to determine a more limited sequential information, which they refer only to one or a few bases, they are called of Mini Sequencing

The most commonly used method as a base for DNA sequencing, or to identify a target base of DNA, is Sanger's enzymatic method of ending the chain. Traditionally, such methods depended on the electrophoresis to solve, according to its size, the fragments of the DNA produced from a larger segment of the DNA. Without However, recently, various technologies of sequencing, which depend on a set of different strategies of detection, such as mass spectrometry and selection.

A type of sequencing methods that assumes importance in the art, are those that depend on the detection of the release of PPi as a detection strategy. It has been found that these methods lead admirably to projects Large-scale genomics or clinical sequencing or tracing, in that relatively profitable units with a high are necessary performance.

Methods of sequencing that are based on the concept of detection of inorganic pyrophosphate (PPi), which is released during a reaction polymeric, for example in WO93 / 23564, WO 89/09283, WO98 / 13523 and WO 98/28440). When each nucleotide is added to a growing chain of the nucleic acid during a polymerase reaction, it is released a pyrophosphate molecule. It has been found that pyrophosphate released under these conditions can be easily detected, by example, enzymatically, by generating light in the Luciferase-Luciferin reaction. These methods of DNA allow the identification of a base in a target position and carry out sequencing simply and quickly, while avoids the need for electrophoresis and the use of markers.

In its most basic form, a reaction of PPi-based sequencing simply involves carrying out a polymeric elongation reaction directed by a primer and the detection of whether the nucleotide has been incorporated or not, checking if PPi has been released or not. Conveniently, this detection of the PPi release can be obtained enzymatically, and very conveniently by a light detection reaction, based on luciferase, which is called ELIDA (see continuation).

It has been found that the dATP added as a nucleotide for incorporation, interferes with the reaction of the Luciferase that is used for the detection of PPi. In accordance with this, an important improvement in the basic sequencing method based on PPi has been to use, instead of dATP, an analogue of dATP (specifically, dATP?), which cannot act as a substrate for luciferase, but that, however, can be incorporated into a nucleotide chain by an enzyme Polymeric (WO98 / 13523).

Further improvements to the basic technique of PPi-based sequencing include the use of an enzyme which degrades nucleotides such as apyrase during the stage polymeric, so that the nucleotides that were incorporated are gradients, as described in WO98 / 28440, and the use of a protein that binds to the single stranded nucleic acid in the reaction mixture after hybridization of the primers to the matrix, has been found to have a beneficial effect on the reduction of the number of false signals, as described in WO00 / 43540.

However, even with the modified methods and enhanced sequencing based on PPI, previously mentioned, there is still room for improvement, for example, increase the efficiency and / or accuracy of the procedure, or, as it is considered then to increase the possible length of the sequence reading. The present invention seeks to address these needs

       \ newpage
    

In particular, the present invention relates to PPi-based sequencing methods that use a α-thio analog of deoxy ATP (dATP) (or dideoxy ATP (ddATP), particularly a (1-uncle) triphosphate (or? Thiophosphate) analog of deoxy or dideoxy ATP, preferably deoxyadenosine [1-uncle] triphosphate or deoxyadenosine α-thiotriphosphate (dAT-Pas as It is also known. dATP? (as with all analogs αthio nucleotides), is found as a mixture of isomers, the Rp isomer and the Sp isomer.

Yee et al , Biochemistry 1979, 18 (19), pages 4116-4210) is a mechanistic study of the "initiation" part of the E. coli RNA polymerase reaction, and concludes that the Sp isomer of ATP? It is a better primer than the Rp isomer.

Romaniuk et al ., J. Biol. Chem, 1982, 257 (13), p. 7684-7688 studies the mechanism of action of T4 DNA polymerase in the Rp and Sp isomers of dATPαS. The Rp isomer is found to be inactive (that is, it is not a substrate for T4 polymerase).

Armstrong et al ., Biochemistry 1979, 18 (19), pp. 4120-4123 is a mechanistic study of the elongation part of the E. coli RNA polymerase reaction. It is reported that the Rp isomer of dATPαS does not constitute a substrate for the RNA polymerase enzyme and is a weak inhibitor.

When dATP? (And / or others α-thio nucleotides) are used, it has been found that the efficiency of the sequencing method decreases when the number of cycles increases, and in particular that the length The reading that can be obtained is limited (for example, up to 40-50 bases). This is believed to be due to the accumulation of inhibitory substances in the reactive system. The The present invention particularly relates to the reduction or elimination of said inhibitory effects.

More particularly, it has been found so surprising that the removal or exclusion of the Rp isomer from the α-thio nucleotide analogues and / or of the degradation products of said analogue from the mixture of polymerization, improves the efficiency of sequencing methods based on PPi and, in particular, of said methods based on the PPi detection by an ELIDA reaction based on Luciferase

Without pretending to be linked to theory, it is believed that various reasons or effects can contribute to this effect beneficial of the Rp isomer and / or the elimination of the products of degradation of the α-thio analogs nucleotides in the sequencing reaction.

Some of these effects are explained to then, but in particular it is believed that the Rp isomer and / or the degradation methods of the α-thio analog Nucleotide can inhibit polymeric activity. Therefore, it believes that said tax effect may be due to the effect of Rp isomer and / or degradation products of the analogue of the α-thio nucleotide, not appreciated until date, to inhibit polymerase activity. Thus, excluding or eliminating the Rp isomer and / or the products of degradation of the α-thio analog nucleotide, the inhibitory effect can be avoided, which leads to a faster and more efficient polymerization reaction, and even more signals generated in the PPi detection reaction. Further, eliminating or excluding the Rp isomer and / or the products of degradation of the α-thio analog nucleotide, increases the fidelity of DNA synthesis, that is, the number of non-incorporation events decreases.

In one aspect, the present invention provides thus, a method to identify a base in a target position in a nucleic sequence of the sample, said said method:

submit a primer hybridized to said sample nucleic acid, immediately adjacent to the target position, to a reaction Polymeric primer elongation in the presence of a nucleotide, by means of which the nucleotide will be incorporated only if it is complementary to the base in the target position, and determining whether said nucleotide is incorporated or not, detecting whether PPi is released, determining the identity of the target base at from the identity of any incorporated nucleotide,

wherein, if said nucleotide comprises a adenine base, an α-trio analog is used triphosphate of said nucleotide, and the Rp isomer of said analog and / or degradation products of said analog are removed from the Polymerase reaction stage.

The use of the analog α-trio phosphate of a nucleotide comprising an adenine base and the removal of its Rp isomer and / or that of the degradation products of said analogue, constitute essential features of the present invention, which is not relate to, for example, mini-sequencing reactions, in that only nucleotides comprising guanine, thymine or Cytosine are added for incorporation.

Under the condition that when the nucleotide comprises an adenine base (A), an analogue is used α-trio triphosphate of said nucleotide, the nucleotide can be any that is able to incorporate by a polymeric enzyme in a nucleic acid chain or molecule. Thus, for example, the nucleotide can be a deoxynucleotide (dNTP, dexosinucleoside triphosphate) or dideoxynucleotide (ddNTP, dideoxynucleoside triphosphate).

Conveniently, for sequential purposes, guanine deoxy or dideoxynucleotides (G) can be used, cytosine (C), thymine (T) or adenine (A). So the nucleotide can be dGTP (deoxyguanosine triphosphate), dCTP (deoxycytidine triphosphate) or dTTP (deoxythymidine triphosphate) or instead of dATP (deoxyadenosine triphosphate) its analog α-trio-triphosphate dATP? (deoxyadenosine α-triotrifosphate or deoxyadenosine [1-uncle] triphosphate as also known). Similarly, the nucleotides can be ddGTP, ddCTP, or dTTP, or in instead of ddATP, ddATPαs.

The present invention therefore requires the use of an α-thiotriphosphate analog of an adenine nucleotide, but for the other bases (G, T or C), an original nucleotide can be used (or truly any another nucleotide, for example, it is desirable to use a derivative nucleotide, provided it can be incorporated by an enzyme Polymeric). Thus, according to the present invention, it is used at least one α-uncle analog of a adenine nucleotide

However, in certain cases it may be desirable. also use α-thio analogs of one or other nucleotides (i.e., guanine, cytosine or nucleotides thymine) In that case, where a α-thio analog of a nucleotide, according to the present invention, then, the Rp isomer of said analog is removed from the stage of the polymer reaction. In others words, in the method of the invention, where the nucleotide is an α-thio nucleotide, (for example, deoxy or dideoxy nucleoside α-thiotriphosphate (dNTPαS or ddNTPαS)), the Rp isomer of said α-thio nucleotide is removed from the stage of Polymeric reaction, and / or degradation products of NTP? S are deleted.

For convenience, the term "deoxynucleosic α-thiotriphosphate "(dNTP? S) such as is used herein, therefore includes the dexosiadenosine α-thiotriphosphate (dATPαS), deoxycytidine α-thiotriphosphate (dCTPαS), deoxyguanosine? -triotrifosphate (dGTPα) and deoxythymidine α-thiotriphosphate (dTTPαS). Similarly, the term "dideoxy nucleotide α-thio triphosphate "includes the equivalent dideoxy. The term "dideoxynucleotide" as used In the present invention, it includes all 2'-deoxy-nucleotides in which the 3'-hydroxyl group is absent or modified and by so long as it is able to be added to the primer in presence of polymerase, and can not enter a subsequent polymerization reaction, a dideoxy nucleotide is thus a "chain terminator", and as it is well known in the technique, certain sequencing methods can use such nucleotide chain terminators.

The term "NTP?" (Nucleoside α-thiotriphosphate), as used in the present report to refer to all analogues α-thiothiphosphate nucleotides (i.e. α-thionucleotides) that can be used according to the present invention includes nucleotides both deoxyribo and dideoxy). These include, most especially, dNTPαS and ddNTP?

When synthesized, analogs α-thio nucleotide triphosphates (i.e. dd- or dNTPαS) are typically produced in two isomeric forms, the isomers Sp and Rp. A nucleotide analog α-thiotriphosphate has a chiral center, and, therefore, the 2 species are enantiomers. The Sp isomer is the Levógiro isomer, also called L. isomer. The isomer. dextrógiro is the Rp isomer, also known as D-isomer (see for example, Eckstein (1985) Ann. Rev. Biochem., 54 (367-402).

The Rp isomer of NTP? Does not act as a substrate for a polymeric enzyme, as used in the primer elongation reaction. Surprisingly, without However, as mentioned above, it has been found that the use of the Rp isomer of NTPαS leads to inhibition of enzymes involved in sequencing reactions based on PPi. The precise nature of these various inhibitory effects it is not entirely clear, but it is believed that the Rp isomer thereof NTPαS (and possibly also the Rp isomer of NDPαS and the Rp isomer of NMPαs) are responsible for the effects observed inhibitors, including, as mentioned previously, polymerase inhibition. The products of NTPαS degradation are also responsible for the effects inhibitors appreciated. Degradation products include, but they are not limited to NDP?, NMP? and any of its degradation products. The effects have been investigated inhibitors of the Rp isomer of dATPαS on enzymes that degrade nucleotides and PPi detection enzymes (see Example 2 and Figures 8I, 8J 8K and 8L) and it has been shown that the Rp isomer and / or degradation products of dATPαs inhibit the enzymes involved in the degradation of nucleotides and the PPi release detection.

It will be appreciated that when the target base (which is find) immediately at the 3 'end of the primer, possess there an identical 3 'base and polymerization is carried out with a deoxynucleotide (preferably with a dideoxynucleotide), the elongation reaction will add two bases at the same time and, in true, any sequence of successive identical bases in the Sample will lead to the simultaneous incorporation of bases corresponding in the primer. However, the amount of released pyrophosphate will be clearly proportional to the number of bases incorporated, so that it is not difficult to detect these repetitions

Since the primer is propagated by a base unique by the procedure described above (or by a sequence of identical bases), the primer that propagates can serve in the same way exactly in a repeated procedure, to determine the next base in the sequence, allowing this so that the entire sample is sequenced.

The method of the invention can be used, by so, to determine the identity (that is, the sequence) of a single base. However, conveniently, repeating the stages of primer propagation in the presence of another nucleotide (successive), the sequence (or identity) of another base may be revealed in the nucleic acid sequence of the sample. In accordance with this, the method of the invention can be used to determine the identity of one or more bases in a sample nucleic acid (that is, to determine the sequence of one or more bases in a nucleic acid of the sample).

The method of the invention is therefore useful in different methods and sequencing formats, including mini-sequencing procedure, for example, the detection of single base changes (for example, to detect mutations punctual, or polymorphisms, or allelic variations, etc). Agree with this, the method of the invention can therefore be used, in a "complete" sequencing procedure, that is, the identification of the sequential order of the bases in a fragment of nucleotides, as well as in base detection procedures unique.

For example, to determine the information sequential in a target nucleotide sequence (i.e., of an acid nucleic of a sample of a sample or target), can be added different nucleotides to aliquots separated from a mixture primer-sample (for example, four aliquots, one for each of the four nucleotides A, T, G or C) or, successively to the same primer-sample mixture and subject it to polymerase reaction to indicate which nucleotide is incorporates

To sequence the sample nucleic acid, the procedure can be repeated one or more times, that is, cyclically, as is known in the art. This way, you can identify the identity of several or many bases in the acid nucleic of the sample, essentially in the same reaction.

When separate quotas are used, once it has been identified which base has been incorporated (that is, in what incorporation of the aliquot has taken place), the base "built-in" can be added to aliquots "that have not reacted ", to propagate the primer in all aliquots, before repeating the method (cyclization) to sequence the base next. In the "successive" embodiment, it can be added successively a different nucleotide, which until incorporation is indicates by the release of PPi, whereby the procedure can repeat.

From there, a sequencing protocol may involve hybridization of a primer as described above, adding a nucleotide, carrying out a reaction elongation of the polymerase catalyzed primer, detecting the presence or absence of the incorporation of said nucleotide, detecting any released PPi, and repeating the nucleotide addition and primer elongation steps, etc, one or more times. As previously considered, the single nucleotides (i.e. individual) can be added successively to the same matrix-primer mixture, or to separate aliquots of the matrix-primer mixture, etc, as selected, and the sequential information that is desired obtain.

To allow repeated or successive addition (iterative) nucleotide in a sequencing procedure of Multiple base, the previously added nucleotide must be removed. This can be done by washing, or more conveniently, using a nucleotide degrading enzyme, for example, as described in detail in WO98 / 28440.

According to this, in one embodiment main of the present invention, an enzyme is used degrading a nucleotide to degrade any nucleotide not incorporated or that is in excess. So, if you add a nucleotide that is not incorporated (because it is not complementary to the target base), or any added nucleotide remains after an incorporation event (i.e. excess nucleotides), then said unincorporated nucleotides can be easily removed using a degrading enzyme from nucleotides This is described in detail in the document. WP98 / 28440.

As will be considered in greater detail to then it has been observed that the inhibitory effects due to the use of an α-thio nucleotide they take place particularly (or are observed) when a nucleotide degrading enzyme, and that such effects can be repealed beneficially according to the present invention, by the methods which are described herein.

The term "degrading enzyme of nucleotides "as used in the present invention, includes any enzyme can degrade specific nucleotides or not specifically, including at least nucleoside triphosphates (NTP), but optionally, also di- and monophosphates, and any mixture or combination of said enzymes, provided it is present a nucleoside triphosphatase or other NTP- degrading activity. Though nucleotide degrading enzymes that have an activity phosphatic can be conveniently used according to the invention, any enzyme that has any activity can be used nucleotide or nucleoside degradant, for example, enzymes that they fragment nucleotides in different positions than groups phosphate, for example in sugar residues or in basic ones. Thus, a degrading enzyme of a nucleoside triphosphate is essential for the invention The degrading enzymes nucleoside di- and / or monophosphate are optional and can be used in combination with a nucleoside triphosphate degrading enzyme. A phosphatase that is used as a nucleotide degrading enzyme according to this aspect of the invention, it must comply with different criteria, such as that particularly, the inhibitory constant (Ki) for the phosphate product (Pi) of the phosphatase action should not be too low, so that the enzyme is not inhibited by the phosphate that accumulates. Second, the enzyme requires acting relatively fast and should not be too slow (certain enzymes phosphatics may act too slowly to be practical) and thirdly, they must degrade the totality of the four nucleotide substrates (i.e. substrates A, T, G and C), with an efficiency more or less equal. As considered more Further, the ATP generated in the ELIDA reactions is preferred for PPi detection, and a useful nucleotide degrading enzyme in the invention it must also degrade ATP efficiently. This leads to an "exit" of the signal. It will be considered that no all phosphatic enzymes (for example, phosphatases alkalines that are strongly inhibited by the phosphate product) meet these criteria, and not all of them may be appropriate for used as a nucleotide degrading enzyme according to the invention. However, said ability to be appropriate can easily be evaluated by routine experiments. Degrading enzyme Preferred nucleotide is apyrase, which is both a diphosphatase nucleoside as trinucleoside, which catalyzes reactions (NTP- - - -NDP + Pi and NDP- - -NMP + Pi (where NTP is a nucleotide triphosphate, NDP a nucleoside diphosphate,  NMP is a nucleoside monophosphate and Pi is inorganic phosphate). The apyrase can be obtained from the Sigma Chemical Company. Other possible nucleotide degrading enzymes include the Nucleoside triphosphate diphosphohydrolase from Porcine Pancreas (Le Bel et al., 1980, J. Biol. Chem, 255, 1227-1233). Other enzymes are described in the literature.

Nucleotide degrading enzymes can conveniently included during the reaction stage Polymeric (ie propagation or elongation of the primer). Thus, for example, the polymeric reaction can be carried out. conveniently in the presence of a degrading enzyme of nucleotides Although less preferred, said enzyme may be added. also after the incorporation of nucleotides (or not incorporation) took place, that is, after the stage of The polymeric reaction.

Thus, the nucleotide degrading enzyme (for example, apyrase), can be added to the reaction mixture Polymeric (i.e. sample nucleic acid, primer and polymerase), in any convenient way, for example, before or simultaneously at the start of the reaction, or after the Polymeric reaction has taken place, for example before add nucleotides to the sample / primer / polymerase to start the reaction, or after polymerase and nucleotides are added to the sample / primer mixture.

Conveniently, the degrading enzymes of the nucleotides can simply be included in the reaction mixture for the polymeric reaction, which can be started by adding the nucleotide

Another amazing feature of the present invention is the observation that the use of the Rp isomer of the α-thio nucleotides and / or the products of degradation of said α-thio nucleotides, lead to the inhibition of a nucleotide degrading enzyme from the present invention, especially of apyrase. It is believed that the Rp isomer cannot act as a substrate for apyrase, and, which, according to this, is not degraded by the activity degrading nucleotides of apyrase. Alternatively, the NTP? S degradation products may be inhibitory. Thus, a situation of successive accumulation of the Rp inhibitory and inactive isomer (or inhibitory products degradation) during the sequencing procedure. By therefore, another benefit that can be derived from the elimination of Rp isomer and / or degradation products of said α-thio-nucleotides according to the present invention, is that the inhibition of apyrase can be reduced or avoided. This has very significant benefits and to date unpredictable about the efficiency and capacity of realization of the sequencing method, and represents an advantage significant and surprising of the present invention.

Degradation of nucleotides not incorporated by apyrase benefits even the production of well-defined PPi detection signals (eg sharp or narrow / defined) (see below). When such degradation is inefficient, due to the inhibition of the enzyme apyrase, this benefit is progressively lost. Thus, the inhibition of apyrase is directly or indirectly seen as a slower degradation rate of the nucleotide, and, consequently, as a signal of the well-defined detection of PPi "broader" or less, in the last cycles of sequencing. In particular, in the context of the ELIDA detection of the release of PPi, which is described below, the decrease observed in the signal (light) is "appreciated" as a degradation of the ATP (generated in the ELIDA reactions). Thus, a slower rate of ATP degradation is "appreciated." From this it can be deduced that the degradation rate of unincorporated nucleotides is also slower. In addition, non-synchronized elongation may occur. This takes place, since the presence of unincorporated and non-degraded nucleotides can lead to multiple elongation reactions that take place out of phase, and that lead to overlapping signals (signal overlapping or out of phase signals). Said non-synchronized elongation thus limits the number of nucleotides.
which can be sequenced in a given sequential processing, for example, the readable length readable.

The ability to sequence more fragments nucleic acid lengths constitutes a desirable target in the Scope of sequencing. The inhibitory effects that result from the use of α-thio nucleotides on the enzymes found in the sequencing methods that are based on PPI, leads to a decrease in fidelity and a non-synchronized extension, thereby limiting the scope of the reading length, that is, the length of the nucleic acid that It can be sequenced successfully. The reading length can be improved  according to the present invention by eliminating the Rp isomer of α? thionucleotide and / or degradation product of α-thio nucleotides.

The reachable reading length is, up to certain point, a parameter that depends on the criteria of acceptance to be adopted. The signal cleaning may be lost, but the sequence can still be readable to the expert and the Experienced professional. Therefore, the precise limits of the Reading length are not always understandable or cannot be applied generally, and may depend on the circumstances. But nevertheless, in some cases it has been found that 50 or more, or even 100 or more (for example 200 or more) bases, can be easily read according to the present invention The methods of the invention are thus, appropriate, for sequencing 100 bases or more. In In particular, the present invention can be used advantageously in sequencing of 50 or more, 60 or more, 70 or more or 80 or more bases.

The release of PPi can be detected according to the present invention in any desired or convenient way. PPi can be determined by many different methods, and various enzymatic methods have been described in the literature (Reeves et al ., (1969), Anal. Biochem., 28, 282-287, Guillory et al ., (1971), Anal Biochem, 39, 170-180; Johnson et al ., (1968), Anal Biochem., 15, 273, Cook et al (1978), Anal Biochem 91, 557-565; and Drake et al (1979), Anal Biochem , 94, 117-120).

The use of a reaction is preferred luciferase-based light generator (for example, a Luciferin based on luciferase), to detect the release of pyrophosphate, since the amount of light generated is substantially proportional to the amount of pyrophosphate released, which, at its Once, it is directly proportional to the number of bases that are incorporate. The amount of light can be easily estimated by an appropriate light sensitive device, such as a luminometer

Reactions that rely on luciferase to detect the release of PPi are well known in the art. In particular, a method has been developed by Nyren and Lundin (Anal. Biochem, 151, 504-509, 1985) to detect the release of PPi, based on the enzymes ATP sulfurilase and luciferase and called ELIDA (Enzymatic luminometric assay for the detection of inorganic pyrophosphate). The use of the ELIDA method to detect PPi is preferred according to the present invention. The method can, however, be modified, for example, using a more thermostable luciferase (Kaliyama et al , 1994, Biosci. Biotech. Biochem, 58, 1170-1171) and / or ATP sulfurilase (Onda et al ., 1996, Bioscience , Biotechnology and Biochemistry, 60: 10, 1740-42). This method is based on the following reactions:

one

Accordingly, it is preferred to detect enzymatically release PPi, and detection enzymes Preferred that are used in the PPi detection reaction are ATP sulfurylase and luciferase.

In a PPi detection reaction that is based in the enzymes ATP sulfurylase and luciferase, the signal (which corresponds to the released PPi) is seen as light. The generation of light can be seen as a curve that is known as a pyrogram The light is generated by the action of luciferase on the ATP product (produced by a reaction between PPi and APS (see a continued) mediated by ATP sulfurylase) and, when used a nucleotide degrading enzyme such as apyrase, the light generation "is produced" then by the action of the nucleotide degrading enzyme, degrading ATP which is the substrate for luciferase. The slope of the upward curve can be seen as indicative of DNA activities polymerase (release of PPi) and ATP sulfurylase (generating PPI ATP, then providing a substrate for the luciferase). The height of the signal depends on the activity of the luciferase, and the slope of the downward curve is indicative of, as explained above, the activity of the nucleotide degrading enzyme.

Advantageously, including the enzyme or enzymes PPi detection (i.e. the enzyme or enzymes needed to reach the detection of PPi according to the detection system selected enzyme, which in the case of ELIDA will be the ATP sulfurilase and luciferase) in the polymeric reaction stage, the method of the invention can be easily adapted to allow sequencing reactions are continuously monitored in real time, a signal being generated and detected when each nucleotide is incorporated. The benefits of these considerations are considered in more detail in WO9813523.

Thus, PPi detection enzymes (along with any enzyme substrates or other reagents necessary to PPi detection reaction), can simply be included in the polymeric reaction mixture.

More particularly, to carry out this embodiment of the method of the invention, the enzymes of detection are included in the polymeric reaction step, that is in the chain elongation reaction stage. In this way, the detection enzymes are added to the reaction mixture for Polymeric stage prior to, simultaneous with, or during the polymeric reaction. In the case of a detection reaction ELIDA, the reaction mixture for the polymer reaction can thus include at least one nucleotide, polymerase, luciferin, APS, ATP sulfurylase and luciferase. The polymeric reaction can start by adding the polymerase, or more preferably the nucleotide, and preferably detection enzymes are found already present at the moment when the reaction starts, or they can be added with the reagent that initiates the reaction. Whether uses a nucleotide degrading enzyme such as apyrase, it will understand, of course, that the addition of polymerase will not follow to apyrase, if nucleotides are present.

The present invention thus allows the PPi release is detected during the polymeric reaction, providing a real time signal. The reactions of Sequencing can be monitored continuously in real time.

The Rp isomer and / or degradation products of NTP? S can be removed, according to the present invention, from several ways, and the term "deleted" simply requires that the Rp isomer and / or degradation products are removed or excluded from the stage of the polymer reaction. This can Obtain in any convenient way. For example, the isomer Rp can be excluded, not being in the NTP? which is added or included in the polymer reaction mixture. Alternatively, the NTP? S preparation may initially include the Rp isomer, but can be removed before, during or afterwards, of the inclusion in or of the addition to the mixture of the Polymeric reaction, for example, by enzymatic degradation.  Media combinations can also be used to eliminate the Rp isomer (for example, removing and excluding). Thus, the isomer Rp can be removed or excluded from the reaction stage polymeric, from the stage after the polymerization has taken place (i.e. the stage of degradation of nucleotides), or the detection of the stage of incorporation nucleotide

The degradation products of NTP? -S can be removed during the stage of polymerization, the degradation stage of the nucleotides or of the detection of the stage of incorporation of nucleotides. By example, degradation products are eliminated by enzymatic degradation

In an embodiment of the invention, the Rp isomer can therefore. be removed using a preparation of NTP? S containing only the Sp isomer, for example, using only the Sp isomer of NTP? S, for example, pure Sp isomer. The individual Rp and Sp isomers of dATPαS are commercially available (eg, in Biolog Life Science, Bremen, DE). Alternatively, said isomers can be easily synthesized stereo-specifically, or purified (separated) from a racemic mixture using methods well known in the art and described in the literature (see for example, Eckstein, supra ). dATPαS, together with the α-thio analogs of dCTP, dGTP and dTTP, can be obtained from Amersham Pharmacia Biotech (Uppsala, SE).

The Rp isomer can be reduced in the stage reactive at less than 10% of total dATP? S, preferably less than 5%, more preferably less than 3% of the isomer Rp.

In an alternative embodiment, the Rp isomer and / or analog degradation products α-thio nucleotide, can be removed using an enzyme that degrades it, particularly phosphatase alkaline In particular, preliminary experimental results we lead to think that alkaline phosphatase can degrade both NTP? S isomers, including the Rp isomer and the products of degradation of NTPαS. The Rp isomer and the products of degradation of NTPαS found in the mixture of reaction, or in the preparation of NTP? S, can be eliminated easily (degrade) by adding an alkaline phosphatase enzyme.

In a more particular embodiment, a combination of the Sp isomer can be used together with an enzyme alkaline phosphatase.

Conveniently, alkaline phosphatase can simply be included during the reaction stage Polymeric This can be obtained by adding the enzyme to the mixture of polymeric reaction before, or simultaneously with, the onset of the polymerase reaction, or after the reaction Polymeric has taken place, for example, before adding the nucleotides to the sample / primer / polymerase mixture to initiate the reaction, or after the polymerase and nucleotide are added to The sample / primer mixture.

Alternatively, alkaline phosphatase can immobilize on a solid support, for example, a support particular solid (e.g., magnetic beads) or a filter, or a rod, etc., and can be added to the reaction mixture Polymeric at a convenient time. When the Rp isomer has degraded, the immobilized enzyme can be removed from the mixture of reaction (for example, can be removed or captured, for example, magnetically, in the case of magnetic beads), before it add to the next nucleotide. The procedure can then Repeat to sequence more bases.

Alkaline phosphatase catalyzes the extraction of 5'-phosphate residues from nucleosides tri-, di- and monophosphates (including ribo-NTP and dNTP, and, as mentioned above, the two isomers of NTP? In this way, not only nucleotides are degraded (nucleoside triphosphates), but also NDP and NMP. Phosphatases alkaline prawns, bacteria and / or intestinal calves, are preferred enzymes, but any enzyme can be used appropriate alkaline phosphatase in the method of the invention, of Any convenient origin. The preferred enzyme is that of shrimp. There are many commercial sources of phosphatase enzymes alkaline, or may, if desired, be isolated from an organism producer.

The amount of alkaline phosphatase that is use, will depend on the precise reactive system used, of the reaction conditions, etc., and can be easily determined through routine experiments. It has been found that, for example, concentrations of 50 mU at 10 U can be used.

As mentioned above, the alkaline phosphatase possesses a degrading activity of NDP and NMP, as well as of NTP. It also benefits from acting on modified α-thio substrates, including, by therefore, not only to NTPαs, but also to NDPαs and NMP? This activity provides a further benefit to the present invention Thus, it has been observed that the enzyme apirasa, and also the luciferase enzyme used in the preferred method of PPi detection according to the present invention, are inhibited when an NTP? is used for nucleotide incorporation. The exact nature of the inhibitory effects observed is not clear, but it may be due to the NTP? or S product substrate inhibition. Thus, NTP \ alphaS can itself be inhibitory, or more likely a degradation product of NTP? (For example, resulting from the action of apyrase), It is inhibitory. For example, it is postulated that the products of degradation of NDP? and NMP? (in particular dADPαS and dAMPαS) produced by the action of the apirasa on NTPαS, and they are added to the mixture of the Polymeric reaction for incorporation, may be inhibitory. More particularly, it is believed that both Sp and Rp isomers of NDP? And / or NMP? S inhibit luciferase, and also the apyrase enzyme (see later in the Examples). These inhibitory substances can be eliminated (or reduced) by action of alkaline phosphatase.

As mentioned above, the apyrase inhibition is indicated by a degradation rate slower nucleotides, and therefore, by an increase in signal width There may also be an elongation not synchronized, and this limits the reachable reading length. The Luciferase inhibition is indicated by a decrease in signal strength Thus, as also indicated in The Examples below, luciferase inhibition can can be seen as a balanced decrease in peak height of the signal, since nucleotides are incorporated into the last sequencing cycles

The effect of the decrease in intensity of the signal (luciferase inhibition) can be combined with the loss of signal definition effect (for example, increase of the width of the signal or signals that are outside of phase) (inhibition of apyrase) to reduce the efficiency of sequencing method and therefore the ability to Provide longer reading lengths. The use of the alkaline phosphatase in conjunction with apyrase and dATPαS (and optionally other dNTP?) has the additional benefit unexpected to repeal these significant additional sources of the inhibition (particularly inhibition from use of NTP? in conjunction with apyrase, by example due to NDP? and / or NMP? produced by the action of apirasa).

Other benefits of using the alkaline phosphatase may also be available. So, in certain  conditions or circumstances, for example, the sequencing of long reading (for example, above 50 cycles), other NTP not thio-modified, added for incorporation, may also constitute a source of inhibition, although to a degree less than its modified α-thio analogs. By For example, preliminary results suggest that dATP may constitute a source of inhibition for the enzyme luciferase (see Examples below). The apirasa action on the NTP does not incorporated leads to the accumulation of degradation products, particularly NDP and NMP (for example, dADP, dAMP, dCTP, dCMP, dGDP, dGMP, dTDP, dTMP). In the last sequencing cycles, such products can inhibit enzymes used in PPi sequencing and / or detection reactions, for example the apirasa and / or luciferase. Although any of these effects inhibitors can be obtained with other nucleotides, they will be lower than those from the use of NTP?, and can still contribute, however, to a decrease in system efficiency As mentioned before, any potential problem caused by such inhibitory substances, can be eliminated or reduced by the action of phosphatase alkaline

ATP is generated in the first stage of the ELIDA reaction (catalyzed by the enzyme ATP sulfurylase), which is used as the preferred method for the detection of PPi. Saying ATP product (in particular any such ATP that is not use in the subsequent luciferic reaction), you can also act as a substrate for apyrase (or other degrading enzyme of nucleotides), and therefore, can also lead to generation of inhibitory products (for example, ADP and AMP), which they can inhibit luciferase, and to a lesser extent, also the apirasa. Again, any of said inhibitory products can be reduced or eliminated by the action of phosphatase alkaline

Finally, the use of alkaline phosphatase it can also have a benefit to reduce any problems caused by the quinasic contamination. The kinases can be Contaminants of enzymatic preparations used in PPi sequencing and detection reactions described In the present memory. The action of kinases on degradation products of apyrase (ie, NDP or NMP), and the ATP resulting from the reaction of ATP sulfurylase in the ELIDA procedure, can generate NTP that can deform the primary sequencing reaction (i.e. it can be incorporated by polymerase) and lead to elongation not synchronized Alkaline phosphatase exerts a beneficial effect degrading potential kinetic substrates.

The nucleic acid in the sample (that is, the target nucleic acid to be sequenced) can be any polynucleotide sequence of which it is desirable to obtain information sequential. That is, it can be any polynucleotide sequence, or truly oligonucleotide. The nucleic acid can be DNA or RNA, and can be natural or synthetic. Thus, the target nucleic acid it can be genomic DNA or cDNA, or a PCR product, or other amplicon etc. The target nucleic acid (sample) can be used in any conveniently, according to methods known in the art, by example, isolated, cloned, amplified, etc., and can be prepared for the sequencing reaction, as desired, according to methods known in the art. The nucleic acid in the sample acts as matrix for possible primer extension based on polymerase and to which reference can be made, conveniently as "matrix" or "nucleic acid matrix". DNA can also be single or double stranded, although in the reactions of sequencing has traditionally used a DNA matrix single-stranded, or truly, in any reaction of primer elongation, it is possible to use a matrix double-stranded, a chain shift, or a localized opening of the two strands of DNA, to allow the primer hybridization and the action of the polymerase

In the polymeric reaction, it can be used any convenient polymeric enzyme, as selected, such as will be described in more detail below. In the case of an RNA matrix, said polymeric enzyme may consist of a reverse transcriptase enzyme.

To cyclically repeat the method and of that sequence the sample DNA and also help the separation of a single-stranded DNA from the sample, from its chain complementary, the sample DNA can be immobilized optionally or provide means to attach it to a support solid.

In addition, the amount of DNA found in a sample to be analyzed may be small, and may, by therefore, wishing to amplify the DNA before sequencing As mentioned above, the DNA of the Sample can then be an amplicon.

Any desired in vitro or in vivo amplification method can be used, for example PCR (or a variant or modification thereof), or the Self-Sustained Sequence Replication (3SR), or the ligase chain reaction (CSF), etc. Whatever the method used, it may be convenient to immobilize the amplified DNA, or provide it with means to attach it to a solid support. For example, a PCR primer can be immobilized, or provided with means to attach it to a solid support.

Immobilization of amplified DNA can be carried out as part of the PCR amplification itself, if one or more primers are attached to a support, or alternatively, one or more of the PCR primers can carry a functional group that allow subsequent immobilization, for example, biotin or thiol group. Immobilization by the 5 'end of a primer, allows the DNA chain emanating from that primer to join a solid support and keep the 3 'end away from the support and arranged for subsequent hybridization with the primer of the lengthening and prolongation of the chain through polymerase

The solid support can conveniently take the shape of microtiter wells. However any solid support can be conveniently used, including any of the abundant number described in the art, by example, for separation / immobilization reactions, or tests of solid phase In this way, the support can also comprise particles (eg, pearls), fibers or capillaries manufactured with agarose, cellulose, alginate, teflon or polystyrene. They can also Magnetic particles are used as support, for example superparamagnetic pearls manufactured by Dynal AS (Oslo, Norway).

The solid support can carry groups functional such as hydroxyl, carboxyl, aldehyde or groups amino, or other fractions such as avidin or streptavidin, to the binding of nucleic acid molecules, for example, primers. These can be provided, in general, by treating support for get a surface coating of a polymer that transports one of said functional groups, for example, polyurethane in conjunction with a polyglycol to provide hydroxyl groups, or a cellulose derivative to provide hydroxyl groups, a polymer or copolymer of acrylic acid or methacrylic acid for providing carboxyl groups, or an aminoalkyl polymer for provide amino groups. US Patent No. 4654267 describes the introduction of many of said surface coatings.

If desired, the sample can be washed after certain number of reactive cycles, for example, 15-25, according to methods well known in the technique. Washing can be facilitated by immobilizing the sample. on a solid surface. Using a degrading enzyme nucleotides, combined with the removal of the Rp isomer (using alkaline phosphatase in particular), however, the Means for washing are not absolutely necessary.

The test technique is very simple and fast, thus becoming easy to automate using a robotic device, in which large number of samples can analyze quickly. Since the detection and quantification preferred are based on a luminometric reaction, this can easily follow spectrophotometrically. The use of luminometers is well known in the art and is described in the literature.

The method of the present invention fits particularly for use in a deployment format, in the that the samples are distributed on a surface, for example, a microfabricated chip, and by means of which an ordered set of Samples can be immobilized in a 2-dimensional format. They can Many samples are analyzed, therefore, in parallel. Using the method of the invention, many immobilized matrices can analyzed in this way to allow the solution containing the enzymes and a nucleotide that flows over the surface, and detect then the signal produced by said sample. This procedure It can then be repeated. Alternatively, several different matrix complementary oligonucleotides can be distributed above the surface, followed by hybridization of the matrix. Nucleotide incorporation can be controlled for each oligonucleotide by the signal produced using the various oligonucleotides as primer. Combining the signals of the different surface areas, analyzes can be carried out based on the sequence, through four reaction cycles Polymeric using the various nucleotides.

The length of the elongation primer is not critical, and can be as selected. It will be clear to experts in the field, that the size of the elongation primer and hybridization stability will depend to some extent on the ratio of base pairings A-T / C-G, since in a pairing  C-G, more hydrogen bond is available. Also, the subject matter expert will consider the degree of identity  sequential between the elongation primer with other parts of the matrix sequence and will make a selection according to the degree of restriction. The guide for such routine experimentation can found in the literature, for example, Molecular Cloning, to laboratory manual, by Sambrook, J., Fritsch E.F. and Maniatis, T. (1989). It can be advantageous to ensure that the sequencing primer hybridizes at least one internal base from the 3 'end of the matrix, to eliminate the polymeric activity of end DNA blunt If separate aliquots are used (i.e. 4 aliquots, one for each base), the elongation primer is added preferably before the sample is divided into four aliquots, although it can be added separately to each aliquot.

Alternatively, a primer can be used. that contains a loop, is retrohybridized on itself, has a 5 'phosphorylated end and 3' end of the matrix, single stranded. If the 3 'end of the matrix has the sequence region called T (matrix), the primer has the following sequence, which begins at starting at the 5 'end; P-L-P-T ', where P is a specific primer (5 to 30 nucleosides), L is a loop (preferably 4 to 10 nucleotides), P 'is complementary to P (preferably 5 and 30 nucleotides) and T 'is complementary to the matrix sequence at the 3 '(T) end (at least 4 nucleotides) This primer can then bind to the matrix single chain using a T4 DNA ligase or a similar enzyme. This provides a covalent bond between the matrix and the primer. thus avoiding the possibility that the hybridized primer is ejected during the protocol.

In the polymeric reaction, it can be used any convenient enzyme as selected, for example, the T7 polymerase, Klenow or Sequanasa Ver 2.0 (USB USA). Any Appropriate polymerase can be used conveniently and many se They know in the art and they are informed in the literature. Without However, it is known that many polymerases show a "correction of evidence "(or error tracking capability) and that 3 'ends that are available for chain extension, They are sometimes digested by one or more nucleotides. If said digestion takes place in the method according to the invention, the level of noise that precedes, increases. To avoid this problem, a polymerase "without proofreading", for example, a Klenow polymerase deficient in exonuclease (exo -) and this is preferred according to the present invention. Alternatively, they can be used substances that suppress the digestion of the 3 'end by polymerase, such as fluorine ions or nucleotide monophosphate. The exact conditions of the reaction, the concentrations of reagents, etc., can be easily determined for each system, as selected However, it may be favorable to use a excess polymerase with respect to the primer / matrix, to ensure that all 3 'free ends are prolonged.

In the method of the invention, it is preferred use a DNA polymerase with high efficiency at each stage of the prolongation, due to the rapid increase of the signal that precedent that can take place if the matrices that have not been prolonged completely, they accumulate. It is also desirable a high fidelity at each stage, which can be achieved using polymerases with exonucleic activity. However, this has the aforementioned disadvantage that the degradation of the chain that is prolonging. Although the Klenow polymerase exonuclease activity is low, the extreme 3 'of the primer can be degraded with longer incubations in absence of nucleotides A suitable binding mechanism, induced in the polymerization stage, select very efficiently the union of the correct dNTP with a net contribution towards the fidelity of 10 5 -10 6.

Deficient exonucleic polymerases, such as (exo -) Klenow or Sequenasa 2.0, catalyzed the incorporation of a nucleotide that was only observed when dNTP complementary was present, confirming fidelity high of these enzymes, even in the absence of activity Exonucleic "proofreading". The main advantage to use (exo -) Klenow DNA polymerase, with respect to the Sequanasa 2.0, is its lowest Km for nucleotides, allowing a high rate of nucleotide incorporation, even at low concentrations of these. As mentioned previously, it is also possible to replace all dNTPs with nucleotide analogs or with unnatural nucleotides such as dNTP? S, such analogs may be preferred for use with a DNA polymerase with exonucleic activity.

In certain circumstances, for example with longer matrices of the samples, it can be advantageous used a polymerase that has a lower K_ {M} for incorporation of the correct nucleotide (paired), which stops the nucleotide incorrect (unpaired). This can improve accuracy and method efficiency Said appropriate polymeric enzymes include Drosophila? polymerase.

In many diagnostic applications, for example, the genetic test for disease carriers inherited, the sample will contain heterozygous material, that is, that half of the DNA will have a nucleotide in the target position and the another half will have another nucleotide, so, if four aliquots (it's say, four parallel reactions of the same sample) are used in an embodiment according to the invention, two will show a negative signal and two will show half of the positive signal. Be you will appreciate, therefore, that it is desirable to determine quantitatively the amount of signal detected in each sample. It also you will appreciate that if two or more of the same bases are found adjacent to the 3 'end of the primer, a signal will be produced powerful. In the case of a homologous sample, it will be clear that there will be three negative and one positive signals, when the sample is divided in four parallel reactions.

In carrying out the method of the invention, any possible contamination of the reagents, for example, of NTP solutions, by PPi, are undesirable, and can be avoided easily including a pyrophosphatase, preferably in small amounts, in the reactive solutions. Truly, it is desirable to avoid contamination of any kind and it turns out preferred the use of high purity reagents or carefully purified, for example, to avoid Kinase contamination.

The efficiency of the reaction can be improved including Mg2 + ions in reagent solutions (NTP and / or polymerase).

A potential problem that has been observed previously with the method of sequencing based on PPi, arises when the DNA to be sequenced has a number of bases identical adjacent, especially three or more thereof. In addition, false signals may occur due to failure in the priming, that is, the primer hybridization has not been made with its target complement inside the sequence of the target DNA, but with another region, which will lead to the generation of "signs of incorporation", which do not reflect the identity of the target sequence As described in WO00 / 43540, this can be avoided by using proteins that bind acid single stranded nucleic in the reaction mixture after primer hybridization to the matrix.

Thus, another preferred feature of the invention is the use of a protein bound to the nucleic acid single chain, which is included during the reaction stage Polymeric after primer hybridization.

As mentioned above, the benefits of the present invention arise from elimination (by example, the elimination and / or exclusion) of the substances of inhibition of the reaction mixture.

Thus, contemplated from a point of different view, the present invention provides a method for decrease polymerase inhibition in a procedure of PPi-based sequencing, which uses at least one NTP? S, said method comprising removing the isomer Rp of NTP? And / or degradation products of said NTP? S from the sequencing reaction mixture (is that is, the matrix, the primer, the polymerase and / or the mixture nucleotide)

In addition, since a similar inhibition effect It has been observed for the enzyme apyrase, which can be used to degrading unincorporated nucleotides, the present invention it also provides a method to decrease the inhibition of apirasa when used in a sequencing procedure based on PPi, which uses at least one NTP?, said method comprising the removal of the Rp isomer of NTPαSy / or degradation products of said NTPαS from the sequencing reaction.

As mentioned above, the Luciferase enzyme that is preferably used in the detection of PPi, can be inhibited by various inhibitory substances (by example, the Rp isomer and / or degradation products) and these they can be advantageously removed by the action of phosphatase alkaline According to this, in another aspect, this invention provides a method to decrease the inhibition of Luciferase when used as a detection enzyme in a sequencing procedure based on PPi, said said method the inclusion of alkaline phosphatase in the mixture of sequencing and / or in the PPi detection reaction.

Typically, in certain embodiments of the invention, NTPαS will be ATPαS (for example, dATPαS or ddATPαS).

The invention also includes equipment for its use in methods of the invention, which will normally include, at least, the following components:

(to)

a polymerase

(b)

some means for detecting pyrophosphate release (preferably enzymatic means, and more preferably luciferase and ATP sulfurylase, for example, the reactive components of an assay ELIDA (see above)

(C)

optionally, a degrading enzyme of nucleotides (preferably apyrase)

(d)

alkaline phosphatase

(and)

one or more nucleotides, preferably deoxynucleotides, which include, instead of an adenine nucleotide (for example, dATP), an analog α-thiototriphosphate of said nucleotide (by example, dATPαS);

(F)

optionally, a specific primer test, which hybridizes to the nucleic acid in the sample, so that the position of the target is very close to the 3 'end of the primer.

       \ vskip1.000000 \ baselineskip
    

Another embodiment of the team of the invention will normally include at least the components following:

(to)

a polymerase

(b)

some means for detecting pyrophosphate release (preferably enzymatic means, and most preferably luciferase and ATP sulfurylase, for example, the reactive components of an assay ELIDA (see above)

(C)

optionally, a degrading enzyme of nucleotides (preferably apyrase)

(d)

he Sp isomer of an α-thiotriphosphate analog of an adenine nucleotide (preferably dATPαS) and optionally one or more Sp isomers of thymine nucleotides, cytosine or guanine (preferably dGTPαS, dCTPαS or dGTPα); Y

(F)

optionally, a specific primer test, which hybridizes to the DNA of the sample nucleic acid, so that the position of the target is very close to the 3 'end of the primer.

(g)

optionally, one or more nucleotides unmodified thymine, cytosine or guanine (preferably dTTP, dCTP, dGTP);

(h)

optionally phosphatase alkaline

       \ vskip1.000000 \ baselineskip
    

The benefits of the present invention for reduce the effects of inhibitory substances on PPi-based sequencing, improve efficiency and reliability of the method and expand the applications in which it can be used the method. Thus, the techniques that require further reading long such as genome re-sequencing, EST comparative sequencing, microbiological typing and sequential confirmation, can all be carried out by PPi based sequencing, according to the present invention.

The primer, if found on equipment, is design so that it binds to the nucleic acid matrix with its end 3 ', close to the target nucleotide. "Coming soon" means 1 to 30 nucleotides, preferably 1 to 20 nucleotides, more preferably 1 to 10, most preferably 1 at 5 nucleotides, from the target nucleotide.

The invention will be described below. by non-limiting examples referring to the figures, in which:

Figure 1 shows a stroke (intensity of the light with respect to nucleotide addition), which is obtained from the simulation of the effect of dATP on luciferase and apyrase, using 2 µM of ATP in the nucleotide solution. In this experiment, 100 ng of luciferase, 50 mU of apyrase, were used, 0.1 M Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM magnesium acetate, 0.1% bovine serum albumin, 1 mM of dithiothreitol. 0.4 mg / ml polyvinylpyrrolidone, (360000) and 100 \ mug / ml of D-luciferin (Bio-Thema). 200 µL of 0.7 mM nucleotide (dATP) containing 2 µM ATP, were administered to the reaction mixture, as described in Example 1. The height of the curve ascending demonstrates luciferase activity and the slope of the downward curve demonstrates apyrase activity. The PPi is Detected in real time.

Figure 2 shows a stroke (intensity of the light with respect to nucleotide addition), which is obtained from simulation of the effect of dATPαS on luciferase and the apyrase, using 2 µM of ATP in the nucleotide solution. In this experiment, 100 ng of luciferase, 50 mU of apyrase, 0.1 M Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM magnesium acetate, 0.1% bovine serum albumin, 1 mM dithiothreitol. 0.4 mg / ml polyvinylpyrrolidone, (360000) and 100 \ mug / ml of D-luciferin (Bio-Thema). 200 µL of 0.7 mM nucleotide (dATPαS) containing 2 µM ATP, were administered to the reaction mixture, as described in Example 1. Height of the upward curve demonstrates the activity of luciferase and the slope of the downward curve demonstrates the activity apirasa.

Figure 3 shows a stroke (intensity of the light with respect to nucleotide addition), which is obtained from the simulation of the effect of dCTP on luciferase and apyrase, using 2 µM of ATP in the nucleotide solution. In this experiment, 100 ng of luciferase, 50 mU of apyrase, were used, 0.1 M Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM magnesium acetate, 0.1% bovine serum albumin, 1 mM of dithiothreitol. 0.4 mg / ml polyvinylpyrrolidone, (360000) and 100 \ mug / ml of D-luciferin (Bio-Thema). 200 µL of 0.2 mM nucleotide (dCTP) containing 2 µM ATP, were administered to the reaction mixture, as described in Example 1. The height of the curve ascending demonstrates luciferase activity and the slope of the downward curve demonstrates apyrase activity.

Figure 4 shows a stroke (intensity of the light with respect to nucleotide addition), which is obtained from the simulation of the effect of dGTP on luciferase and apyrase, using 2 µM of ATP in the nucleotide solution. In this experiment, 100 ng of luciferase, 50 mU of apyrase, were used, 0.1 M Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM magnesium acetate, 0.1% bovine serum albumin, 1 mM of dithiothreitol. 0.4 mg / ml polyvinylpyrrolidone, (360000) and 100 \ mug / ml of D-luciferin (Bio-Thema). 200 µL of 0.16 mM nucleotide (dGTP) containing 2 µM ATP, were administered to the reaction mixture, as described in Example 1. The height of the curve ascending demonstrates luciferase activity and the slope of the downward curve demonstrates apyrase activity.

Figure 5 shows a stroke (intensity of the light with respect to nucleotide addition), which is obtained from the simulation of the effect of dTTP on luciferase and apyrase, using 2 µM of ATP in the nucleotide solution. In this experiment, 100 ng of luciferase, 50 mU of apyrase, were used, 0.1 M Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM magnesium acetate, 0.1% bovine serum albumin, 1 mM of dithiothreitol. 0.4 mg / ml polyvinylpyrrolidone, (360000) and 100 \ mug / ml of D-luciferin (Bio-Thema). 200 µL of 0.8 mM nucleotide (dTTP) containing 2 µM ATP, were administered to the reaction mixture, as described in Example 1. The height of the curve ascending demonstrates luciferase activity and the slope of the downward curve demonstrates apyrase activity.

Figure 6 shows a stroke (intensity of the light with respect to nucleotide addition), which is obtained from simulation of the effect of dATPαS on luciferase and the apyrase, using 2 µM of ATP in the nucleotide solution, in presence of alkaline phosphatase. In this experiment, they were used 100 ng of luciferase, 50 mU of apyrase, 0.1 M Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM acetate magnesium, 0.1% bovine serum albumin, 1 mM dithiothreitol. 0.4 mg / ml polyvinylpyrrolidone, (360000) and 100 µg / ml of D-Luciferin (Bio-Thema), and 1U of alkaline phosphatase. 200 µL of 0.7 mM nucleotide (dATPαS) containing 2 µM ATP, were administered to the reaction mixture, as described in Example 1. The height of the curve ascending demonstrates luciferase activity and the slope of the downward curve demonstrates apyrase activity.

Figure 7 shows three strokes (intensity of light with respect to nucleotide addition) obtained in reactions DNA sequencing using 1 pmol matrix primer oligonucleotide; the reactive system contained 10 U Klenow DNA polymerase, 25 mU ATP sulfurylase and 0.1 M Tris-acetate (pH 7.75) 0.5 mM EDTA, 5 mM acetate magnesium, 0.1% bovine serum albumin, 1 mM dithiothreitol. 0.4 mg / ml polyvinylpyrrolidone, (360000) and 100 µg / ml of D-Luciferin (Bio-Thema); and A) 100 ng of luciferase and 50 mU of apirasa; B) 100 ng luciferase, 50 mU of apyrase and 2 mU nucleoside diphosphate kinase; C) 100 ng of Luciferase, 50 mU of apyrase, 2 mU of nucleoside diphosphate kinase and 2 U alkaline phosphatase. The arrows in B indicate the signals false that appear as a result of the kinetic activity in the system, which are removed by adding alkaline phosphatase in the experiment shown in C.

Figure 8 shows lines (intensity of the light with respect to nucleotide addition) showing the effects of the preincubation of a sequencing reaction mixture PP-i (in the absence of the matrix), with quantities "normal" (ie, racemic) dATP? s variables, which contained both Sp and Rp isomers) ((A) 0 µl; (B) 5 µl; (C) 10 \ mul; (D) 20 µ) of the pure Sp isomer of dATP? S ((E) 0 \ mul; (F) 5 µ, (G) 10 µ; (H) 20 µ)), or the isomer Pure Rp of dATP? ((I) 0?; (J) 5?; (K) 10 µl; (L) 20 µ)). After preincubation, the matrix was added and the sequencing reaction was carried out based on PPi, as described in Example 2.

Figure 9 is a stroke (intensity of light with respect to nucleotide addition) which shows the results of a DNA sequencing reaction on a matrix derived from pUC19, in which the four different nucleotides are added step to passed to the matrix hybridized to a primer. A mixture of the Rp and Sp isomers of dATPαS. The matrix / primer was incubated with 10U (exo -) Klenow and 40 mU apirasa, and the others PPi tal sequencing / detection reaction components as described in example 3. The reaction began by adding the first nucleotide, adding the (other) nucleotides step by step. The released PPi was detected in real time by Luciferase

Figure 10 is a stroke (intensity of light with respect to nucleotide addition) which shows the results of a DNA sequencing reaction on a matrix derived from pUC19, in which the four different nucleotides are added step to passed to the matrix hybridized to the primer. Only the Sp isomer was used of d-ATPαS. The matrix / primer was incubated with 10U (exo -) Klenow and 40 mU apirasa, and the other components of the sequencing / detection reaction of PPi as described in example 3. The reaction began by adding the first nucleotide, then adding the (other) nucleotides step to He passed. The released PPi was detected in real time by Luciferase

Example 1 Investigation of the inhibitory effects of different nucleotides in PPi-based sequencing using a ELIDA detection reaction-the effects of alkaline phosphatase

In this example a series of 5 was carried out experiments to examine the inhibitory effect of each of 5 nucleotides (dATP, dATPαS, dCTP, dGTP and dTTP on the enzymes apyrase and luciferase. A model system was used that simulated the effects of these enzymes in a reaction of PPi based sequencing. Each nucleotide was added to the mixture luciferase / apyrase / substrate, together with ATP (to provide a substrate for luciferase), and the effect of each addition nucleotide on enzymes was monitored by observing the signals lights generated from the luciferase reaction. Two more experiments showed, first, that the effects inhibitors resulting from the use of dATPαS may be repealed in the model system using alkaline phosphatase, and, secondly, that alkaline phosphatase also has a additional benefit by offsetting the interference effects of the quinasic enzymes on the reactive system (as it is demonstrates in a sequencing reaction).

The reactions were carried out at temperature environment in a volume of 50 µl in an instrument prototype automated sequencing (Pyrosequencer) (kindly assigned by Pyrosequencing AB, Uppsala, Sweden). Reaction mixture contained: 50 mU of apyrase (Sigma Chemical Co., USA), 100 ng of purified luciferase (Biothema, Dalarö, Sweden), 0.1M Tris-acetate pH 7.75), 0.5 mM EDTA, 5 mM acetate magnesium, 0.1% bovine serum albumin, 1 mM dithiothreitol, 0.4 mg / ml polyvinylpyrrolidone (360000) and 100 µg / ml of D-Luciferin (Biothema). Added one 2 µM concentration to the different nucleotides (dATP, dATPαS, dCTP, dGTP and dTTP), as shown in the Figures 1 to 5 to follow the activity of luciferase and the apirasa. For the investigation of the effect of alkaline phosphatase of prawns (Amersham Pharmacia Biotech, Uppsala, Sweden), two units of this enzyme were added to the reaction mixture (see below). In total, 50 additions of nucleotides and the mixture of ATP in 50 minutes. The production of light resulting from the incorporation of nucleotides, was detected through a CCD camera. The data was obtained in format Excel

Seven experiments were carried out. Experiments 1 to 5 investigated the effects of each dATP, dATPαS, dCTP, dGTP and dTTP. Experiment 1 was performed using a mixture of 0.7 mM nucleotide dATP and 2 µM ATP supplied to the reaction mixture. The trace obtained from experiment 1 is presented in Figure 1. The height of the ascending curve demonstrates the luciferase activity and the descending curve indicates or demonstrates the activity of apyrase. Note the relatively linear decrease in signal strength, which is due to the inhibition of luciferase, which is believed to be due to the accumulation of the degradation products of dATP (for example, dAMP). It has been previously reported that dAMP inhibits luciferase (Ford et al ., 1998, Methods in Mol. Biol. 102: 3-20) or accordingly, it follows that the inhibitory substance may be dAMP. Thus, luciferase inhibition is shown when dATP is used, and this is believed due to the degradation products of dAMP (dATP and / or dADP).

Experiment 2 was carried out using a mixture of 0.7 mM nucleotide dATPαS and 2 µM ATP, provided to the reaction mixture. The results are shown. in Figure 2. The height of the ascending curve demonstrates the Luciferase activity, and the slope of the curve demonstrates the apirasa activity. Note the relatively linear decrease in signal strength, which is due to the inhibition of Luciferase, which is believed to be caused by the accumulation of inhibitory products (for example, dAMPαS). The reduction in signal strength after 50 cycles it is 50% lower that the data obtained from the degradation of dATP in Figure 1. According to this, it follows that it is inhibitory just a dATPαS isomer, believing that this is due to the Sp isomer (or rather, that the products of the Sp isomer are inhibitory for Luciferase). Apyrase is drastically inhibited in recent cycles, as seen by the widest peaks that are get. It is believed that the inhibitory effect after each addition it is due to the accumulation of the Rp isomer of dATPαS and also, to degradation products of the Sp isomer. It is believed that the apirasa degrades only the Sp isomer and not the Rp isomer. It is speculated with which the inactive isomer of dATPαS (Rp) is not recognized by luciferase, since it is not degraded to form the product inhibitory.

Experiment 3 was carried out using a mixture of 0.2 mM nucleotide dCTP and 2 µM ATP supplied to the reaction. The results are shown in Figure 3. The height of the ascending curve demonstrates the activity of luciferase and the slope of the downward curve demonstrates the activity of the apirasa. The relatively constant intensity of the signal, even after 50 cycles, indicating that the products of this nucleotide do not inhibit luciferase or apirasa under the conditions used, and within the number of cycles shown.

Experiment 4 was carried out using a mixture of 0.16 mM nucleotide dGTP and 2 µM ATP supplied to the reaction. The results obtained from experiment 4 are shown in Figure 4. The height of the ascending curve demonstrates the Luciferase activity and the slope of the downward curve It demonstrates the activity of apirasa. Notice the intensity relatively constant signal, even after 50 cycles, which indicates that the products of this nucleotide do not inhibit the luciferase or apirasa under the conditions used, and within of the number of cycles shown.

Experiment 5 was carried out using a mixture of 0.8 mM nucleotide dTTP and 2 µM ATP supplied to the reaction. The results are shown in Figure 5. The height of the ascending curve demonstrates the activity of luciferase and the slope of the downward curve demonstrates the activity of the apirasa. Note the relatively constant signal intensity, even after 50 cycles, which indicates that the products of this nucleotide does not inhibit luciferase or apyrase under the conditions used, and within the number of cycles that are show.

Experiment 6 investigated the reduction in inhibition carried out by the addition of alkaline phosphatase to the reaction mixture. This experiment was performed similarly. to Experiment 2, using a mixture of 0.7 mM nucleotide dATPαS and 2 µM ATP supplied to the reaction mixture. The results are shown in Figure 6. The height of the peak generated demonstrates luciferase activity and the slope of the downward curve demonstrates the apyrase activity. May appreciate the efficiency of nucleotide degradation when compare with Figure 2. It can be seen that the width of the signal remains constant even after 50 cycles, indicating the lack of apriasic inhibition, and therefore, the high efficiency of alkaline phosphatase in preventing this inhibition (which believed due to its action in the degradation of both isomers (it is ie, the Rp and Sp) isomers of dATPαS. The decrease in signal strength, indicating the absence of Luciferase inhibition. It is believed to be due to the effect of the alkaline phosphatase in the degradation of the products of dATP? (thus eliminating the inhibitory elements). The experimental conditions for Figures 2 and 6 are the same, except for the addition of 2 U AP in the reaction mixture in Experiment 6. Thus, the results of Experiment 6 show that alkaline phosphatase can eliminate substances Inhibitory of the reactive system, thereby improving the performance of the enzymes luciferase and apirasa.

Experiment 7 investigated the inhibitory effects of nucleotides and kinases on a sequencing reaction, and the reduction of these effects using alkaline phosphatase. For the investigation of the quinasic effect, 2 mU of kinase (Sigma Chemicals) was added to the sequencing reaction mixture containing 0.5 pmol of the synthetic primer matrix E3PN / NUSPT (Ronaghi et al ., Science, 1998), 10 U of Klenow exonuclease-deficient DNA polymerase (Amersham Pharmacia Biotech, Uppsala, Sweden), 40 mU of apyrase (Sigma Chemical Co., USA), 100 ng of purified luciferase (BioThema, Dalarö, Sweden), 15 mU of ATP sulfurilase produced recombinant, 0.1M Tris-acetate pH 7.75), 0.5mM EDTA, 5mM magnesium acetate, 0.1% bovine serum albumin, 1mM dithiothreitol, 5µM adenosine 5-phosphosulfate (APS) , 0.4 mg / ml polyvinylpyrrolidone (360000) and 100 µg / ml D-luciferin (BioThema). The sequencing procedure was carried out by step-by-step extension of the primer-chain after sequential addition of Sp-dATPαS (Biolog LIfe Science, Bremen, DE), dCTP, dGTP, and dTTP (Amersahm Pharmacia Biotecb) and the simultaneous degradation of nucleotides by apyrase. To study the effect of alkaline phosphatase on the kinetic activity, 2 mU of the enzyme kinase and 2 U of alkaline phosphatase were added to the mixture mentioned above. The light production resulting from nucleotide incorporation was detected by a CCD camera. The data was obtained in Excel format. Figure 7a shows the results of the sequencing reaction in the absence of the added alkaline kinase or phosphatase. Figure 7b shows a plot of the results of the sequencing reaction in the presence of 2 mU nucleoside diphosphate kinase. The arrow indicates the false signals that are generated.

Thus, it can be seen that the addition of alkaline phosphatase to the polymerization reaction mixture, Eliminates false signals generated by the kinetic contamination, removing the substrates for the kinases from the solution.

Example 2 Inhibitory effects of dATPαS on sequencing PPi based

In this example, the inhibitory effect of dATPαS on a sequencing reaction based on PPi, with ELIDA detection (known as Pyrosequencing?), investigated by preincubating the reaction mixture in the absence of matrix, with varying amounts of normal dATP? (ie, racemic) (containing both Rp and Sp isomers), or of the Sp isomer dATPαS pure. After preincubation, the matrix and a normal reaction of "Pyrosequencing."

Materials and methods

The "normal" dATP? S was obtained from PSQ 96 SNP Reagents equipment supplied by Pyrosequencing AB (Uppsala, Sweden). The pure Rp and Sp isomers were obtained from Biolog Life Sciences (Bremen, Germany). Reaction mixture It also included the enzyme mixture (DNA polymerase, ATP-sulfurylase, apyrase and luciferase) and the mixture of substrates (luciferin and APS), from the Reagents team PSQ 96 SNP supplied by Pyrosequencing AB. The matrix was a oligonucleotide (Interactive, Ulm, Germany), from which the following sequence could be read, after hybridization of a sequencing primer: CTAAAGGTGCACCATGACTGGGGTTACAGTCATC.

Pure isomeric samples were diluted to same concentration as dATPαS in the PSQ Reagents kit 96 SNP. For preincubation, 0, 5, 10, or 20 µl of each sample A (normal dATPαS or the Rp or Sp isomer), was added to a mixture containing 5 µl of the enzyme mixture, 5 µl of the mixture of substrates in a total volume of 45 µl. The reaction it was carried out in the 96-well plate that had been supplied with the PSQ 96 SNP Reagents kit. The reaction is incubated at room temperature, in the dark, for 10 minutes. After this, 1.5 pmol in 5 µl of the matrix was added hybridized oligonucleotide, to each well and the plate was transferred from the PSQ 96 instrument, where a reaction `` Normal pyrosequencing? Was carried out (omitting the addition of enzyme mixtures and substrate.

The results are shown in Figure 8. Using normal (ie, racemic) dATP?, You can it should be noted that preincubation with 5 µl (Fig 8B), 10 µl (Fig 8C) or 20 µl (Fig 8D), results in an inhibition progressively severe sequencing reaction (when compare with 0 µl of dATPαS added (Fig 8A). May appreciate some loss of signal strength (height of the peak) and, more significantly, the loss of the definition of signal (for example, broader, less defined and less signals clear). Thus, it can be seen that particularly the inhibition of apyrase. Even one more inhibition is seen pronounced when the Rp isomer is used (see Figure 8J). This effect was significantly reduced when the pure Sp isomer instead of racemic αS dATP or Rp isomer of dATPαS, as seen in Figure 8F (5 µl), Fig 8G (10 µl) and Fig 8H (20 µl), (compared to 0 µl (Fig 8E)). The pure Rp isomer has an important effect on all Enzymes involved in ELIDA detection (Figures 8I and 8J). The apyrase inhibition is indicated by an increase in width Of the signal. This can be clearly seen in Figures 8J a 8L, very clearly shown in Figure 8K. Inhibition of Luciferase is indicated by a decrease in the intensity of the signal. As can be seen in Figure 8K, the intensity of the signal decreases, compared to figure 8I, which indicates that the Luciferase is being inhibited.

A similar experiment was also carried out. in which preincubation was carried out by comparing dATP? "normal" with dCTP, dGTP or dTTP, all coming from a prototype for the PSQ 96 SNP Reagents team. As a control, only IxTE (dilution buffer for dNTP) was added. The matrix was the same as before, but 2 pmol were added to each well.

The results obtained (not represented) clearly showed that there was no negative effect on the preincubation with dCTP, dGTP or dTTP, but confirmed a severe negative effect of dATPαS, mainly on the apirasa.

Example 3 DNA sequencing based on PPi with and without Rp-dATPαS.

In this example, the experiments of sequencing were carried out using the same matrix (a PCR product of the standard cloning plasmid pUC19), with and without the Rp isomer of dATPαS (i.e., using first place a racemic mixture of dATPαS, and second, Sp-dATP? Pure).

Single chain matrix preparation

The standard plasmid pUC19 was used to generate the matrix by PCR. Briefly, the PCR primers GGGATCATGTAACTCGCCTTGA (upper primer, biotinylated position 1345) and CGGGAGGGCTTACCATCTGG (lower primer, position 1648) (where positions 1648-1345 = 303 base pairs) were used in a PCR reaction on pUC19 to generate a fragment of 303 base pairs of length. 50 microliters of the biotinylated PCR product were immobilized on 20 µl of superparamagnetic beads wrapped with streptoavidin (Dynabeads M-280-streptavidin, Dynal AS, Oslo, Norway) by incubation at 43 ° C for 30 minutes. Single stranded DNA was obtained by incubating the immobilized PCR product in 5 µL of 0.1 M NaOH for 4 minutes. The immobilized chain was resolved in 8 µL of H 2 O plus 1 µl of hybridization buffer (100 mM Tris-Ac 2 (pH 7.75) 20 mM MgAc2). Single stranded DNA corresponding to 50 µl of PCR product was hybridized to 10 pmol of the sequencing primer (TCAG-CAATAAACCAGCCAGCC) at 70 ° C for 3 minutes, followed by incubation at room temperature for 5 minutes. (After hybridization of the sequencing primer, the length of the remaining single strand matrix is 211 base pairs). The initiated PCR product was added to the "PyrosequencingTM" reaction mixture containing: 0.1 M Tris-Ac2 (pH 7.75), 0.05% Tween 20, 0 U of Klenow DNA polymerase deficient in exonuclease (exo -), 40 mU of apyrase (Sigma Chemical Co., Saint Louis, Mo, USA), 0.8 µg of purified luciferase (BioThema, Dalarö, Sweden), 15 mU of recombinant-produced ATP sulfurylase (Karamohamed et al ., 1999), 0.5 µg of single stranded DNA-bound protein (Amersham Pharmacia Biotech, Uppsala, Sweden), 0.5 mM EDTA, 5 mM MgAc2, 0.1 bovine serum albumin % (BioThema), 1 mM dithiothreitol, 5 µM adenosine 5'-phosphosulfate (Sigma Chem, Co), 0.4 mg / ml polyvinylpyrrolidone (360000) and 100 µg / ml D-luciferin (BioThema), in a total volume of 50 µl.

Pyrosequencing?

The pyrosequencing? Was carried out at ambient temperature in an automated prototype model Pyrosequencer (Pyrosequencing AB, Uppsala, Sweden; www.pyrosequencing.com), with a supply pressure of 600 mbar, with an open time of 8 milliseconds and a cycle time of 60 seconds. The sequencing procedure was carried out. by step-by-step prolongation of the primer-chain after cyclic delivery of the different deoxynucleotides triphosphates (Amersham Pharmacia Biotech) In an experiment (shown in Figure 9), it is uses a racemic mixture of dATP? (dATP? "normal"), (together with dCTP, dGTP and dTTP), and in the second experiment was used the pure Sp isomer of dATPαS. The light production, resulting from nucleotide incorporation, is detected by a photomultiplier. The data were obtained in Microsoft Excel and are shown in Figures 9 and 10.

Looking at Figure 9, it can be seen that the signal quality gradually deteriorates with repeated nucleotide addition, eventually leading to loss of the signal that can be read (parts 4-6 of Fig 9). In Figure 10, it will be appreciated that with the pure Sp isomer, the quality of the signal is maintained longer, and a longer readable length is obtained before the signal quality deteriorates to levels lower than reading.

Claims (12)

1. Method of identifying a base in a target position in a nucleic acid sequence of a sample, said method comprising:

submit to a primer hybridized to said sample nucleic acid immediately adjacent to the target position, to a reaction of extension of the DNA polymerase primer in the presence of a nucleotide, resulting in the nucleotide thus only incorporated if it is complementary to the base in the target position, and determine whether said nucleotide is incorporated or not detecting if the PPi is released, determining the identity of the target base from the identity of any nucleotide that is incorporated,

in which a nucleotide degrading enzyme, which is apirasa, is present during or after the stage of DNA polymerase reaction; and in which, if said nucleotide comprises an adenine base, an analogue is used α-thio triphosphate of said nucleotide, and the Rp isomer of said analog and / or degradation products of said analog are removed from the DNA reaction stage polymerase 2. Method according to claim 1, wherein the Rp isomer is removed using an analog preparation α-thio triphosphate of an adenine nucleotide which contains only its Sp isomer. 3. Method according to claim 2, wherein the Rp isomer is removed using a preparation of dATPαS or ddATPαS containing only its isomer Sp. 4. Method according to any of the claims 1 to 3, wherein the Rp isomer and / or the products of degradation of said analog are eliminated by degradation enzymatic 5. Method according to claim 4, wherein alkaline phosphatase is included in or added to the mixture of DNA polymerase reaction. 6, Method according to claim 2 or 3, in the that the alkaline phosphatase is included in or added to the mixture of DNA polymerase reaction. 7. Method according to any of the claims 1 to 6, wherein the extension reaction of the primer is repeated in the presence of other nucleotides. 8. Method of decreasing the inhibition of apyrase, when used in a sequencing method based on PPi, which uses at least one NTP?, Comprising said method of eliminating the Rp isomer of NTP? and / or the degradation products of said reaction analog of sequencing 9. Method of decreasing the inhibition of Luciferase, when used in a sequencing method based in PPi, which uses at least one NTP?, comprising said method the removal of the Rp isomer of NTPαS and / or the degradation products of said reaction analog of sequencing 10. Method according to any of the claims 1 to 9, wherein said pyrophosphate release (PPi) is detected using the enzymes luciferase and ATP sulfurylase 11. Kit for use in a method of identification of a base in a target position in an acid nucleic, comprising:

(to)

a DNA polymerase

(b)

some means for detecting pyrophosphate release;

(C)

a degrading enzyme of a nucleotide, which is apyrase;

(d)

alkaline phosphatase

(and)

one or more nucleotides, preferably deoxynucleotides, which include, instead of an adenine nucleotide, an analog α-thiototriphosphate of said nucleotide;

(F)

optionally a specific primer of assay that hybridizes with the nucleic acid in the sample, so that the target position is very close to the 3 'end of the primer.

12. Kit for use in a method of identification of a base in a target position in an acid nucleic, comprising:

(to)

a DNA polymerase;

(b)

some means for detecting pyrophosphate release;

(C)

a degrading enzyme of a nucleotide, which is apyrase;

(d)

he Sp isomer of an α-thiotriphosphate analog of an adenine nucleotide, and optionally, one or more Sp isomers of thymine, cytosine or guanine nucleotides; Y

(F)

optionally, an assay primer specific that hybridizes with the nucleic acid DNA of the sample, so that the target position is very close to the 3 'end of the primer;

(g)

optionally, one or more nucleotides of unmodified thymine, cytosine or guanine;

(h)

optionally phosphatase alkaline

13. Kit according to claim 11 or 12, in the that said means for detecting pyrophosphate release they comprise luciferase and ATP sulfurylase.