RU2752840C1 - Method for barcoding amplicons in the preparation of targeted dna libraries for mass parallel sequencing - Google Patents
Method for barcoding amplicons in the preparation of targeted dna libraries for mass parallel sequencing Download PDFInfo
- Publication number
- RU2752840C1 RU2752840C1 RU2020141811A RU2020141811A RU2752840C1 RU 2752840 C1 RU2752840 C1 RU 2752840C1 RU 2020141811 A RU2020141811 A RU 2020141811A RU 2020141811 A RU2020141811 A RU 2020141811A RU 2752840 C1 RU2752840 C1 RU 2752840C1
- Authority
- RU
- Russia
- Prior art keywords
- targeted
- amplicons
- reaction mixture
- barcoding
- barcode
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Abstract
Description
Изобретение относится к области молекулярной биологии и генетической инженерии и может быть использовано для присоединения олигонуклеотидных штрихкодов к продуктам таргетной амплификации с целью их последующей идентификации в процессе исследования методами массового параллельного секвенирования.The invention relates to the field of molecular biology and genetic engineering and can be used to attach oligonucleotide barcodes to targeted amplification products for the purpose of their subsequent identification in the process of research by methods of massive parallel sequencing.
Таргетное секвенирование является одним из наиболее востребованных приложений массового параллельного секвенирования. Оно позволяет проводить одновременный анализ целевых (таргетных) участков большого количества образцов ДНК. Для идентификации образцов ДНК в ходе анализа требуется введение специальных олигонуклеотидов – штрихкодов. Штрихкоды присоединяют к продуктам амплификации целевых участков ДНК – ампликонам – в процессе подготовки таргетной библиотеки.Targeted sequencing is one of the most requested mass parallel sequencing applications. It allows the simultaneous analysis of target (target) areas of a large number of DNA samples. The identification of DNA samples during analysis requires the introduction of special oligonucleotides - barcodes. Barcodes are attached to the amplification products of the target DNA regions - amplicons - during the preparation of the target library.
Известен способ присоединения штрихкодов к продуктам таргетной амплификации ДНК путём проведения реакции лигирования по «тупым» концам. Способ имеет крайне низкую специфичность, в результате чего нарабатывается широкий спектр разнообразных побочных продуктов.A known method of attaching barcodes to products of targeted amplification of DNA by carrying out a ligation reaction at "blunt" ends. The method has extremely low specificity, resulting in a wide range of various by-products.
Известен способ кодирования продуктов ПЦР в реальном времени с помощью комбинаций замещающих зондов разного цвета для одной целевой последовательности, комплементарных одной общей последовательности с тушителем. При обнаружении в реакционной смеси детектируемой последовательности регистрируется комбинация цветового сигнала, по которой и определяется результат реакции [1] Однако недостатками этого способа являются невысокая мультиплексируемость (до 15 вариантов, по мнению авторов) и необходимость синтеза нескольких меченых олигонуклеотидов для одной детектируемой последовательности.A known method of encoding PCR products in real time using combinations of replacement probes of different colors for one target sequence, complementary to one common sequence with a quencher. When a detectable sequence is detected in the reaction mixture, a color signal combination is recorded, which determines the result of the reaction [1] However, the disadvantages of this method are low multiplexability (up to 15 variants, according to the authors) and the need to synthesize several labeled oligonucleotides for one detectable sequence.
Известен способ штрихкодирования ампликонов путем осуществления дополнительных циклов полимеразной цепной реакции (ПЦР) [2]. Штрихкодирование данным способом требует применения длинных олигонуклеотидов с последовательностями, частично гомологичными каждому ампликону. Использование длинных олигонуклеотидов создаёт риск побочных реакций, а проведение дополнительных циклов ПЦР повышает вероятность возникновения и/или накопления ошибок.The known method of barcoding amplicons by carrying out additional cycles of the polymerase chain reaction (PCR) [2]. Barcoding by this method requires the use of long oligonucleotides with sequences partially homologous to each amplicon. The use of long oligonucleotides creates the risk of side reactions, and additional PCR cycles increase the likelihood of errors occurring and / or accumulating.
Таким образом, разработка новых способов раздельного определения множества нуклеотидных последовательностей в одном образце является актуальной для молекулярной биологии. Особенно важно это для генотипирования, когда требуется в одном образце выявить наличие множества мутаций в виде однонуклеотидных замен, делеций, инсерций и т.д.Thus, the development of new methods for the separate determination of multiple nucleotide sequences in one sample is relevant for molecular biology. This is especially important for genotyping, when it is required to identify the presence of multiple mutations in one sample in the form of single nucleotide substitutions, deletions, insertions, etc.
Известен способ одновременной детекции множества последовательностей нуклеотидов при проведении одной полимеразной цепной реакции, заключающийся в том, что готовят реакционную смесь, добавляют в нее специфичные для каждой детектируемой последовательности прямые праймеры нескольких видов с разными метками, кодирующие соотношением их количества вид детектируемой последовательности, и один вид обратного праймера для каждой детектируемой последовательности, проводят амплификацию, гибридизацию полученных ампликонов с закрепленными на разных участках поверхности олигонуклеотидами, где каждый отдельный участок поверхности содержит олигонуклеотиды, комплементарные только ампликонам с одной детектируемой последовательности, считывание сигнала с меток на ампликонах, расположенных на одном участке поверхности, и идентификацию разных детектируемых последовательностей нуклеотидов по соотношению сигналов различных меток, которое повторяет соотношение количеств меченных разными метками прямых праймеров в исходной реакционной смеси [3]There is a known method for the simultaneous detection of multiple nucleotide sequences when carrying out one polymerase chain reaction, which consists in preparing a reaction mixture, adding to it direct primers of several types specific for each detected sequence with different labels, encoding the ratio of their number, the type of detected sequence, and one type reverse primer for each detectable sequence, amplification, hybridization of the obtained amplicons with oligonucleotides attached to different areas of the surface, where each separate area of the surface contains oligonucleotides complementary only to amplicons from one detectable sequence, reading the signal from the tags on the amplicons located on the same area of the surface, and identification of different detectable nucleotide sequences by the ratio of signals of different labels, which repeats the ratio of the amounts of labeled with different labels of direct primer ov in the initial reaction mixture [3]
Недостатками известного способа являются трудоемкость и недостаточная эффективность.The disadvantages of this method are laboriousness and insufficient efficiency.
Наиболее близким к заявленному способу – прототипом, является способ штрихкодирования ампликонов, который заключается в амплификации целевых участков ДНК, создании выступающих («липких») T-A-концов и дальнейшем лигировании олигонуклеотидных штрихкодов по выступающим T-A-концам [4].The closest to the claimed method - the prototype, is a method for barcoding amplicons, which consists in amplifying the target DNA regions, creating protruding ("sticky") T-A-ends and further ligation of oligonucleotide barcodes at protruding T-A-ends [4].
Недостатком прототипа является зависимость процесса аденилирования (формирования A-конца) от структуры праймеров, используемых для таргетной амплификации, что может привести к существенному снижению выхода продукта лигирования [5]. Кроме того, данный способ не позволяет одновременно со штрихкодами ввести необходимые для последующего секвенирования адаптеры, что требует проведения дополнительной операции.The disadvantage of the prototype is the dependence of the process of adenylation (formation of the A-end) on the structure of primers used for targeted amplification, which can lead to a significant decrease in the yield of the ligation product [5]. In addition, this method does not allow simultaneously with the barcodes to enter the adapters necessary for subsequent sequencing, which requires an additional operation.
Задачей настоящего изобретения является создание нового способа штрихкодирования ампликонов при подготовке таргетных библиотек ДНК к массовому параллельному секвенированию.The objective of the present invention is to provide a new method for barcoding amplicons when preparing targeted DNA libraries for massive parallel sequencing.
Техническим результатом настоящего изобретения является расширение функциональных возможностей способа, повышение эффективности введения штрихкодов и снижение вероятности формирования побочных продуктов при подготовке таргетных ДНК-библиотек к массовому параллельному секвенированию.The technical result of the present invention is to expand the functionality of the method, increase the efficiency of the introduction of barcodes and reduce the likelihood of the formation of by-products when preparing targeted DNA libraries for massive parallel sequencing.
Поставленная задача достигается способом, который заключается в следующем.The task is achieved in the following way.
На первом этапе проводят дизайн праймеров для таргетной амплификации таким образом, чтобы 5'-конец каждого праймера содержал заданную последовательность из пяти нуклеотидов: 5'-TTCAG. Эта последовательность необходима для формирования «липких» концов и последующего лигирования штрихкодов и адаптеров.At the first stage, primers for targeted amplification are designed so that the 5'-end of each primer contains a given sequence of five nucleotides: 5'-TTCAG. This sequence is required for the formation of sticky ends and subsequent ligation of barcodes and adapters.
Далее, после проведения таргетной амплификации, полученные ампликоны обрабатывают Pfu ДНК-полимеразой в присутствии соответствующих дезоксирибонуклеозид-трифосфатов (дНТФ). Pfu-полимераза обладает 3'-экзонуклеазной активностью, с помощью которой она отщепляет несколько 3'-концевых нуклеотидов у каждого ампликона. Если в реакционной смеси присутствуют соответствующие дНТФ, то фермент за счёт своей полимеразной активности начинает снова включать нуклеотиды в цепь взамен отщеплённых, так, что в системе устанавливается равновесие между процессами отщепления и обратного включения нуклеотидов в цепь (при условии избытка соответствующих дНТФ в реакционной смеси). Further, after carrying out targeted amplification, the resulting amplicons are treated with Pfu DNA polymerase in the presence of the corresponding deoxyribonucleoside triphosphates (dNTPs). Pfu polymerase has a 3'-exonuclease activity by which it cleaves several 3'-terminal nucleotides from each amplicon. If the corresponding dNTPs are present in the reaction mixture, the enzyme, due to its polymerase activity, begins to re-incorporate nucleotides into the chain instead of the cleaved ones, so that an equilibrium is established in the system between the processes of cleavage and re-inclusion of nucleotides into the chain (provided there is an excess of the corresponding dNTPs in the reaction mixture) ...
В данном случае реакционная смесь содержит dTTP и dCTP. Как только происходит отщепление dC (или dT) в ходе последовательного 3'-экзонуклеазного расщепления цепи, полимераза немедленно включает dC (или dT) обратно в исходное положение. Таким образом, 3'-экзонуклеазное расщепление прекращается в заданном положении, что приводит к формированию «липкого» конца, имеющего структуру 5'-TTC. Подобный подход был описан ранее для лигазно-независимого клонирования [4].In this case, the reaction mixture contains dTTP and dCTP. As soon as dC (or dT) is cleaved by sequential 3'-exonuclease strand cleavage, the polymerase immediately turns dC (or dT) back to its original position. Thus, 3'-exonuclease cleavage is terminated at a given position, resulting in the formation of a sticky end having a 5'-TTC structure. A similar approach was previously described for ligase-independent cloning [4].
Затем по сформированным «липким» концам ампликона проводят лигирование штрихкода и одного из адаптеров. Лигирование второго адаптера к штрихкоду происходит в той же реакционной смеси с использованием выступающего конца, имеющего иную нуклеотидную последовательность.Then, the barcode and one of the adapters are ligated along the formed "sticky" ends of the amplicon. Ligation of the second adapter to the barcode occurs in the same reaction mixture using a protruding end having a different nucleotide sequence.
На заключительном этапе с помощью праймеров, комплементарных адаптерам, в ходе ПЦР проводят обогащение реакционной смеси целевыми последовательностями.At the final stage, using primers complementary to the adapters, in the course of PCR, the reaction mixture is enriched with the target sequences.
На фиг. 1 представлена схема штрихкодирования ампликонов при подготовке таргетных библиотек ДНК к массовому параллельному секвенированию.FIG. 1 shows a scheme for barcoding amplicons when preparing targeted DNA libraries for massive parallel sequencing.
Предлагаемый способ штрихкодирования имеет ряд преимуществ. Во-первых, связывание штрихкода с ампликоном с использованием «липких» концов является весьма эффективным. Во-вторых, представленный способ требует минимального молярного избытка штрихкодов и адаптеров в реакционной смеси, что снижает вероятность протекания побочных реакций. В-третьих, универсальный набор коротких штрихкодирующих нуклеотидных последовательностей может быть создан один раз и использован для штрихкодирования большого количества таргетных библиотек, что существенно снижает стоимость процедуры подготовки библиотек. Изобретение иллюстрируется следующими примерами конкретного выполнения. The proposed method for barcoding has a number of advantages. First, the sticky-end binding of the barcode to the amplicon is very efficient. Secondly, the presented method requires a minimum molar excess of barcodes and adapters in the reaction mixture, which reduces the likelihood of side reactions. Third, a universal set of short bar-coding nucleotide sequences can be created once and used for bar-coding a large number of targeted libraries, which significantly reduces the cost of the library preparation procedure. The invention is illustrated by the following specific examples.
Пример 1.Example 1.
Выполняли дизайн праймеров для таргетной амплификации участков генов человека BRCA1 (5'-TTCAGCAATTCCTTGTCACTCAGACCAACT-3' и 5'-TTCAGAAATGTTCTGCTAGCTTGTTTTCTTCAC-3'), Performed the design of primers for targeted amplification of regions of human genes BRCA1 (5'-TTCAGCAATTCCTTGTCACTCAGACCAACT-3 'and 5'-TTCAGAAATGTTCTGCTAGCTTGTTTTCTTCAC-3'),
BRCA2 (5'-TTCAGCCCTATTGCATATTTCTTCATGTGACCA-3' и 5'-TTCAGCTTTACTGCAAGAATGCAGTCTGTA-3') и CFTR (5'-TTCAGACATGCAACTTATTGGTCCCACT-3' и 5'-TTCAGTGTTTGGAGTTGGATTCATCCT-3'). BRCA2 (5'-TTCAGCCCTATTGCATATTTCTTCATGTGACCA-3 'and 5'-TTCAGCTTTACTGCAAGAATGCAGTCTGTA-3') and CFTR (5'-TTCAGACATGCAACTTATTGGTCCCACT-3 'and 5'-TTCCCCACT-3' and 5'-TTCCCCACT-3 'and 5'-TTCCCCACT-3' and 5'-TTCCCCACT-3 'and 5'-TTCGTCT-TAG
Осуществляли ПЦР с использованием указанных праймеров в термоциклере БИС-Н, модель М111-02 (Россия) при следующих условиях: начальная денатурация – 3 мин. при 95°C, далее 30 циклов: денатурация – 10 с при 95°C, гибридизация праймеров – 20 с при 60°C, элонгация цепей – 40 с при 72°C. Реакционная смесь объёмом 25 мкл содержала 10 нг геномной ДНК человека; 400 нМ каждого праймера; 320 мкМ каждого дезоксирибонуклеозидтрифосфата; 3 мМ MgCl2; 16 мМ (NH4)2SO4; 67 мМ Tris-HCl (pH = 8,8); 1 единицу активности Taq ДНК-полимеразы.PCR was carried out using the indicated primers in a BIS-N thermal cycler, model M111-02 (Russia) under the following conditions: initial denaturation - 3 min. at 95 ° C, then 30 cycles: denaturation - 10 s at 95 ° C, hybridization of primers - 20 s at 60 ° C, chain elongation - 40 s at 72 ° C. The reaction mixture with a volume of 25 μl contained 10 ng of human genomic DNA; 400 nM of each primer; 320 μM each deoxyribonucleoside triphosphate; 3 mM MgCl 2 ; 16 mM (NH 4 ) 2 SO 4 ; 67 mM Tris-HCl (pH = 8.8); 1 unit of Taq DNA polymerase activity.
Реакционную смесь после проведения ПЦР очищали с помощью магнитных частиц Agencourt AMPure XP (Beckman Coulter, США) согласно рекомендациям производителя. Очищенные продукты таргетной амплификации растворяли в воде объёмом 22,5 мкл.After PCR, the reaction mixture was purified using Agencourt AMPure XP magnetic particles (Beckman Coulter, USA) according to the manufacturer's recommendations. The purified targeted amplification products were dissolved in water in a volume of 22.5 μL.
Полученные ампликоны обрабатывали Pfu-полимеразой. К 22,5 мкл смеси ампликонов добавляли 0,5 мкл Pfu-полимеразы, содержащей 2 единицы активности в 1 мкл, 6 мкл 5х буфера для Pfu-полимеразы, и 1 мкл смеси dTTP и dCTP (25 мМ каждого). Полученную смесь объёмом 30 мкл инкубировали при 70°C в течение 10 мин.The resulting amplicons were treated with Pfu polymerase. To 22.5 μl of the amplicon mixture, 0.5 μl of Pfu polymerase containing 2 activity units in 1 μl, 6 μl of 5x Pfu polymerase buffer, and 1 μl of a mixture of dTTP and dCTP (25 mM each) were added. The resulting mixture in a volume of 30 μL was incubated at 70 ° C for 10 min.
Структуры использованных адаптеров и штрихкода приведены в таблице 1.The structures of the used adapters and barcode are shown in Table 1.
Таблица 1. Table 1.
3’-TTGGTAGAGTAGGGACGCACAGAGGC-5’5'- CCATCTCATCCCTGCGTGTCT -3 '
3'-TTGGTAGAGTAGGGACGCACAGAGGC-5 '
3’- TGAGTCTTCTCCTAAGAAG-5’5'-CCGACTCAGAAGAGGATTC -3 '
3'- TGAGTCTTCTCCTAAGAAG-5 '
3’- TAGTCCGTGACGGGTATCTCTCCTTTCGCCTCCGCATCACC -5’5'-GAAATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT-3 '
3'- TAGTCCGTGACGGGTATCTCTCCTTTCGCCTCCGCATCACC -5 '
Реакционную смесь очищали с помощью магнитных частиц Agencourt AMPure XP (Beckman Coulter, США) согласно рекомендациям производителя. Очищенные продукты растворяли в 15 мкл воды.The reaction mixture was purified using Agencourt AMPure XP magnetic particles (Beckman Coulter, USA) according to the manufacturer's recommendations. The purified products were dissolved in 15 μl of water.
Лигирование штрихкода и адаптеров к полученным ампликонам с «липкими» концами осуществляли следующим образом. К 15 мкл раствора ампликонов добавляли 2 мкл ДНК-лигазы T4 (250 единиц активности в мкл), 1 мкл полинуклеотидкиназы T4 (2 единицы активности в мкл), 3 мкл 10х буфера для ДНК-лигазы, 3 мкл 0,2 мкМ раствора штрихкода, 3 мкл 0,2 мкМ раствора адаптера A и 3 мкл 0,2 мкМ раствора адаптера P1. Полученную смесь объёмом 30 мкл инкубировали при 37°C в течение 20 мин.Ligation of the barcode and adapters to the obtained amplicons with sticky ends was carried out as follows. To 15 μl of the amplicon solution were added 2 μl of T4 DNA ligase (250 activity units in μl), 1 μl of T4 polynucleotide kinase (2 activity units in μl), 3 μl of 10x DNA ligase buffer, 3 μl of 0.2 μM barcode solution, 3 μl 0.2 μM adapter A solution and 3 μl 0.2 μM adapter solution P1. The resulting mixture in a volume of 30 μL was incubated at 37 ° C for 20 min.
Реакционную смесь очищали с помощью магнитных частиц Agencourt AMPure XP (Beckman Coulter, США) согласно рекомендациям производителя. Очищенные продукты растворяли в 50 мкл воды.The reaction mixture was purified using Agencourt AMPure XP magnetic particles (Beckman Coulter, USA) according to the manufacturer's recommendations. The purified products were dissolved in 50 μl of water.
Для повышения концентрации целевых последовательностей проводили обогащение с использованием праймеров A (5'-CCATCTCATCCCTGCGTGTC-3') и P1 (5'-CCACTACGCCTCCGCTTTCCTCTCTATG-3') в термоциклере БИС-Н, модель М111-02 (Россия) при следующих условиях: начальная денатурация – 3 мин. при 95°C, далее 15 циклов: денатурация – 10 с при 95°C, гибридизация праймеров – 20 с при 58°C, элонгация цепей – 40 с при 72°C. Реакционная смесь объёмом 25 мкл содержала 2 мкл очищенного продукта лигирования; 400 нМ каждого праймера; 320 мкМ каждого дезоксирибонуклеозидтрифосфата; 3 мМ MgCl2; 16 мМ (NH4)2SO4; 67 мМ Tris-HCl (pH = 8,8); 1 единицу активности Taq ДНК-полимеразы.To increase the concentration of the target sequences, enrichment was performed using primers A (5'-CCATCTCATCCCTGCGTGTC-3 ') and P1 (5'-CCACTACGCCTCCGCTTTCCTCTCTATG-3') in a BIS-N thermal cycler, model M111-02 (Russia) under the following conditions: initial denaturation - 3 min. at 95 ° C, then 15 cycles: denaturation - 10 s at 95 ° C, hybridization of primers - 20 s at 58 ° C, chain elongation - 40 s at 72 ° C. The reaction mixture with a volume of 25 μl contained 2 μl of the purified ligation product; 400 nM of each primer; 320 μM each deoxyribonucleoside triphosphate; 3 mM MgCl 2 ; 16 mM (NH 4 ) 2 SO 4 ; 67 mM Tris-HCl (pH = 8.8); 1 unit of Taq DNA polymerase activity.
В завершение полученную ДНК-библиотеку очищали с помощью магнитных частиц Agencourt AMPure XP (Beckman Coulter, США) согласно рекомендациям производителя. Очищенные продукты растворяли в 25 мкл воды.Finally, the resulting DNA library was purified using Agencourt AMPure XP magnetic particles (Beckman Coulter, USA) according to the manufacturer's recommendations. The purified products were dissolved in 25 μl of water.
Результаты электрофоретического разделения продуктов таргетной амплификации в 2%-ном агарозном геле до и после штрихкодирования показаны на фиг. 2. Номером 1 обозначены продукты таргетной амплификации до штрихкодирования, номером 2 – после введения штрихкода. Длина продуктов в результате штрихкодирования изменилась на величину, соответствующую суммарной длине штрихкода и адаптеров.The results of electrophoretic separation of targeted amplification products in 2% agarose gel before and after barcoding are shown in FIG. 2.
Пример 2.Example 2.
Процесс штрихкодирования, описанный в примере 1, повторяли с ампликоном, полученным в результате таргетной амплификации участка гена CFTR человека с помощью праймеров 5'-TTCAGCCTTTTGTAGGAAGTCACCAAAGCA-3' и 5'-TTCAGTACCAGCTCACTACCTAATTTATGACATT-3'.The barcoding process described in Example 1 was repeated with an amplicon obtained as a result of targeted amplification of the human CFTR gene region using primers 5'-TTCAGCCTTTTGTAGGAAGTCACCAAAGCA-3 'and 5'-TTCAGTACCAGCTCACTACCTAATTTATGACATT-3.
Результаты электрофоретического разделения продуктов таргетной амплификации в 2%-ном агарозном геле до и после штрихкодирования представлены на фиг. 2, где под номерами 3 (до штрихкодирования) и 4 (после штрихкодирования).The results of electrophoretic separation of targeted amplification products in 2% agarose gel before and after barcoding are shown in FIG. 2, where numbers 3 (before barcoding) and 4 (after barcoding).
Пример 3.Example 3.
Процесс штрихкодирования, описанный в примере 1, повторяли с ампликонами, полученными в результате таргетной амплификации двух участков гена BRCA2 человека. Для амплификации использовали пары праймеров: The barcoding process described in example 1 was repeated with amplicons obtained as a result of targeted amplification of two regions of the human BRCA2 gene. For amplification, pairs of primers were used:
5'-TTCAGTGTCCCAGTTGGTACTGGAAATC-3' и 5'-TTCAGCTGGTGATTTCACTAGTACCTTGCTC-3'; 5'-TTCAGACGCTGATGAATGTGAAAAATCTAAAAACC-3' и 5'-TTCAGTTCTCTGTGTCTAATAGGTCTTTTTCTGA-3'.5'-TTCAGTGTCCCAGTTGGTACTGGAAATC-3 'and 5'-TTCAGCTGGTGATTTCACTAGTACCTTGCTC-3'; 5'-TTCAGACGCTGATGAATGTGAAAAATCTAAAAACC-3 'and 5'-TTCAGTTCTCTGTGTCTAATAGGTCTTTTTCTGA-3'.
Результат представлен на фиг. 2 под номерами 5 (до штрихкодирования) и 6 (после штрихкодирования).The result is shown in FIG. 2 numbered 5 (before barcoding) and 6 (after barcoding).
Таким образом, заявляемый способ является универсальным и может быть использован для подготовки таргетных библиотек для любой платформы для проведения массового параллельного секвенирования (IonTorrent, Illumina и др.), а также может быть легко модифицирован для использования в роботизированных системах. Использование данного способа позволит существенно снизить вероятность формирования побочных продуктов в ходе штрихкодирования и повысить эффективность процесса.Thus, the claimed method is universal and can be used to prepare targeted libraries for any platform for massive parallel sequencing (IonTorrent, Illumina, etc.), and can also be easily modified for use in robotic systems. The use of this method will significantly reduce the likelihood of the formation of by-products during barcoding and increase the efficiency of the process.
Источники информацииSources of information
1. Huang Q, Zheng L, Zhu Y, Zhang J, Wen H, et al. (2011) Multicolor Combinatorial Probe Coding for Real-Time PCR. PLoS ONE 6(1): e16033. doi:10.1371/journal.pone.0016033.1. Huang Q, Zheng L, Zhu Y, Zhang J, Wen H, et al. (2011) Multicolor Combinatorial Probe Coding for Real-Time PCR. PLoS ONE 6 (1): e16033. doi: 10.1371 / journal.pone.0016033.
2. Parameswaran P, Jalili R, Tao L, Shokralla S, Gharizadeh B, Ronaghi M, Fire AZ. A pyrosequencing-tailored nucleotide barcode design unveils opportunities for large-scale sample multiplexing. Nucleic Acids Res. 2007;35:e130.2. Parameswaran P, Jalili R, Tao L, Shokralla S, Gharizadeh B, Ronaghi M, Fire AZ. A pyrosequencing-tailored nucleotide barcode design unveils opportunities for large-scale sample multiplexing. Nucleic Acids Res. 2007; 35: e130.
3. Патент RU 2644262C1, опубл. 08.02.2018.3. Patent RU 2644262C1, publ. 02/08/2018.
4. Vigneault F, Sismour AM, Church GM. Efficient microRNA capture and bar-coding via enzymatic oligonucleotide adenylation. Nat Methods 2008;5:777–779.4. Vigneault F, Sismour AM, Church GM. Efficient microRNA capture and bar-coding via enzymatic oligonucleotide adenylation. Nat Methods 2008; 5: 777-779.
5. Brownstein MJ, Carpten JD, Smith JR. Modulation of Non-Templated Nucleotide Addition by Taq DNA Polymerase: Primer Modifications that Facilitate Genotyping. Biotechnique 1995;20:1004–1010.5. Brownstein MJ, Carpten JD, Smith JR. Modulation of Non-Templated Nucleotide Addition by Taq DNA Polymerase: Primer Modifications that Facilitate Genotyping. Biotechnique 1995; 20: 1004-1010.
6. Aslanidis C, De Jong PJ. Ligation independent cloning of PCR products (LIC-PCR). Nucleic Acids Res. 1990;18: 6069–6074.6. Aslanidis C, De Jong PJ. Ligation independent cloning of PCR products (LIC-PCR). Nucleic Acids Res. 1990; 18: 6069-6074.
Claims (1)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2020141811A RU2752840C1 (en) | 2020-12-17 | 2020-12-17 | Method for barcoding amplicons in the preparation of targeted dna libraries for mass parallel sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2020141811A RU2752840C1 (en) | 2020-12-17 | 2020-12-17 | Method for barcoding amplicons in the preparation of targeted dna libraries for mass parallel sequencing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2752840C1 true RU2752840C1 (en) | 2021-08-09 |
Family
ID=77226155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2020141811A RU2752840C1 (en) | 2020-12-17 | 2020-12-17 | Method for barcoding amplicons in the preparation of targeted dna libraries for mass parallel sequencing |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2752840C1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018039969A1 (en) * | 2016-08-31 | 2018-03-08 | President And Fellows Of Harvard College | Methods of whole genome digital amplification |
| EA023190B9 (en) * | 2009-04-02 | 2018-03-30 | Флуидигм Корпорейшн | Multi-primer amplification method for barcoding of target nucleic acids |
| RU2018105835A (en) * | 2015-07-17 | 2019-08-19 | Президент Энд Фэллоуз Оф Харвард Коллидж | METHODS OF AMPLIFICATION OF NUCLEIC ACID SEQUENCES |
| RU2018115247A (en) * | 2015-09-24 | 2019-10-24 | АБВИТРО ЭлЭлСи | CONJUGATES AFFINE MOLECULE-OLIGONUCLEOTID AND THEIR APPLICATION |
-
2020
- 2020-12-17 RU RU2020141811A patent/RU2752840C1/en active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EA023190B9 (en) * | 2009-04-02 | 2018-03-30 | Флуидигм Корпорейшн | Multi-primer amplification method for barcoding of target nucleic acids |
| RU2018105835A (en) * | 2015-07-17 | 2019-08-19 | Президент Энд Фэллоуз Оф Харвард Коллидж | METHODS OF AMPLIFICATION OF NUCLEIC ACID SEQUENCES |
| RU2018115247A (en) * | 2015-09-24 | 2019-10-24 | АБВИТРО ЭлЭлСи | CONJUGATES AFFINE MOLECULE-OLIGONUCLEOTID AND THEIR APPLICATION |
| WO2018039969A1 (en) * | 2016-08-31 | 2018-03-08 | President And Fellows Of Harvard College | Methods of whole genome digital amplification |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210355537A1 (en) | Compositions and methods for identification of a duplicate sequencing read | |
| US10704091B2 (en) | Genotyping by next-generation sequencing | |
| KR102628035B1 (en) | Single cell whole genome library for methylation sequencing | |
| US10364464B2 (en) | Compositions and methods for co-amplifying subsequences of a nucleic acid fragment sequence | |
| US8053192B2 (en) | Methods for indexing samples and sequencing multiple polynucleotide templates | |
| EP3036359B1 (en) | Next-generation sequencing libraries | |
| CN107257862B (en) | Sequencing from multiple primers to increase data rate and density | |
| GB2533882A (en) | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation | |
| KR102398479B1 (en) | Copy number preserving rna analysis method | |
| US10011866B2 (en) | Nucleic acid ligation systems and methods | |
| US20220364169A1 (en) | Sequencing method for genomic rearrangement detection | |
| US20220267848A1 (en) | Detection and quantification of rare variants with low-depth sequencing via selective allele enrichment or depletion | |
| WO2009036119A1 (en) | Method for identifying the sequence of one or more variant nucleotides in a nucleic acid molecule | |
| RU2752840C1 (en) | Method for barcoding amplicons in the preparation of targeted dna libraries for mass parallel sequencing | |
| EP3601611B1 (en) | Polynucleotide adapters and methods of use thereof | |
| CN110446791B (en) | Polynucleotide adaptors and methods of use thereof | |
| WO2006003638A2 (en) | Novel method for labeling nucleic acid in a sequence-specific manner, and method for detecting nucleic acid using the same | |
| JP2008502352A (en) | Methods, reaction mixtures and kits for ligating polynucleotides |