EP4695384A2 - Zusammensetzungen und verfahren zur hochregulierung der reversen transkription und reduktion des sequenzbias in der rna-sequenzierung - Google Patents

Zusammensetzungen und verfahren zur hochregulierung der reversen transkription und reduktion des sequenzbias in der rna-sequenzierung

Info

Publication number
EP4695384A2
EP4695384A2 EP24789679.8A EP24789679A EP4695384A2 EP 4695384 A2 EP4695384 A2 EP 4695384A2 EP 24789679 A EP24789679 A EP 24789679A EP 4695384 A2 EP4695384 A2 EP 4695384A2
Authority
EP
European Patent Office
Prior art keywords
composition
concentration
reverse transcriptase
pcr
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24789679.8A
Other languages
English (en)
French (fr)
Inventor
Raj Chakrabarti
Anisha GHOSH
Xiangying GUAN
Gauthier ERRASTI
Thomas Delacroix
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
5prime Biosciences Inc
Original Assignee
5prime Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 5prime Biosciences Inc filed Critical 5prime Biosciences Inc
Publication of EP4695384A2 publication Critical patent/EP4695384A2/de
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions

Definitions

  • thermostable reverse transcriptase (RT) enzymes have been also been discovered.
  • RT reverse transcriptase
  • genes cannot be effectively replicated or amplified in water irrespective of temperature, resulting in significant biases in RNA and DNA sequencing that limit the potentially transformative applications of these methods.
  • (RT) ⁇ PCR amplification of GC ⁇ rich nucleotide sequences is often accompanied by inadequate yield of the target DNA sequence and amplification of nonspecific products.
  • a recent analysis of intragenic regions reveals 773 sequences with more than 65% GC in the human genome.
  • PCR ⁇ enhancing compounds have been used to improve GC ⁇ rich gene amplification or reduce GC bias in amplification without target modification, and are components of some of the most commonly used PCR commercial products, because organic cosolvents and temperature represent the two primary means of denaturing macromolecules.
  • PCR ⁇ enhancing organic solvents are very effective in improving amplification due to their favorable effects on duplex nucleic acid melting and 2 single ⁇ stranded nucleic acid secondary structure alleviation – thus complementing the effects of the increased temperatures used in PCR, which alone are insufficient to amplify many GC ⁇ rich genes – their application is limited by the fact that they generally deleteriously affect the polymerase stability and activity.
  • polymerases used in PCR have evolved naturally to be thermostable, they have not evolved naturally to be optimally solvent ⁇ tolerant.
  • organic cosolvents belonged specifically to four chemical classes that we defined as low molecular weight amides, sulfoxides, sulfones and polyols (particularly diols) (Chakrabarti, 2002, 2004; Chakrabarti et al., 2001 Nucleic Acids Res, 2001 Gene, 2002 Biotechniques; US Patent 6,949,368; US Patent 7,276,357 B2; and US Patent 7,772,358 B2). Earlier, DMF, DMSO and Glycerol were also reported to have some beneficial effects in PCR amplification of high GC targets (Sarker et al., 1990, Pomp et al., 1991, Henkel et al., 1997).
  • Figs. 1A to 1D A comprehensive list of the more useful members among these low molecular weight organic cosolvents is provided below and the chemical structures of some of them are shown in Figs. 1A to 1D.
  • the members are: formamide, N ⁇ methyl formamide, N,N ⁇ dimethyl formamide (DMF), acetamide, N ⁇ methylacetamide, N,N ⁇ dimethylacetamide, propionamide, isobutyramide, 2 ⁇ pyrrolidone, N ⁇ methylpyrrolidone (NMP), N ⁇ hydroxyethyl pyrrolidone (HEP), N ⁇ formyl pyrrolidine, N ⁇ Formyl morpholine; delta ⁇ valerolactam, epsilon ⁇ caprolactam, 2 ⁇ azacyclooctanone (16 compounds); 3
  • the members are: dimethyl sulfoxide (DMSO), n ⁇ propyl sulfoxide, n ⁇ butyl sul
  • the members are: dimethyl sulfone, 10 diethyl sulfone, di (n ⁇ propyl) sulfone, tetramethylene sulfone (sulfolane), and 2,4 ⁇ dimethylsulfolane and butadiene sulfone (sulfolene) ⁇ (6 compounds: Fig.
  • the members are: 1,2 ⁇ propanediol, 1,3 ⁇ propanediol, 1,2 ⁇ butanediol, 1,3 ⁇ butanediol, 1,4 ⁇ butanediol, 1,2 ⁇ pentanediol, 2,4 ⁇ pentanediol, 1,5 ⁇ pentanediol, 1,2 ⁇ cyclopentanediol, 1,2 ⁇ hexanediol, 1,6 ⁇ hexanediol,and 2 ⁇ methyl ⁇ 2,4 ⁇ pentanediol (13 compounds; Fig. 1D).
  • triol namely, glycerol
  • betaine When used as a part of the PCR buffer, these cosolvents provide an aqueous ⁇ organic reaction medium that is predominantly aqueous in nature (as opposed to the common use of predominantly organic reaction media for small molecule enzymatic reactions described earlier).
  • the properties of a cosolvent in terms of its overall impact on a PCR reaction can be expressed in terms of effective range, potency, and specificity of each cosolvent that are different for different compounds (Chakrabarti R., 2004).
  • the effective range of a cosolvent 4 is defined as the range of concentration starting at the concentration at which amplification of a given target improved PCR yield and ending at the concentration above which amplification began to be inhibited. Put in a different way, the effective range of a cosolvent is the range of concentration outside which it does not exhibit any beneficial effect. This range was different for different compounds but also for the same compound for different targets.
  • the potency of a cosolvent is defined as the maximum densitometric volume of the target band amplification that could be obtained for any target amplification within the effective range of that cosolvent. It is the maximum effectiveness of the cosolvent at the most effective concentration within its effective range.
  • the specificity of a cosolvent at a particular concentration is defined as the ratio of the volume of the target band amplification to the total volume of all bands, including the undesired non ⁇ specific bands, expressed as a percent. False positives and false negatives in PCR ⁇ based disease diagnosis, for instance, are the result of poor reaction specificity. Use of cosolvent ⁇ based PCR is of significant value in this area. There are, however, important limitations of these solvent systems that have thwarted their more widespread application.
  • thermostabilities of DNA polymerases between 92 °C and 95 °C ⁇ the range within which the denaturation step of the PCR reaction is usually carried out ⁇ were greatly lowered by addition of the most potent and most specific cosolvents. 5 Notwithstanding the above results on DNA ⁇ dependent DNA polymerization and PCR in aqueous ⁇ organic media, reverse transcription activity (RNA ⁇ dependent DNA polymerization) has never been demonstrated to be improved by or even compatible with the aforementioned polar organic cosolvents.
  • RT ⁇ PCR reverse transcription PCR
  • a composition for performing a reverse transcriptase reaction comprises a thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase (RT) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), and one or more of the low molecular weight polar organic solvents.
  • RT reverse transcriptase
  • dNTPs deoxyribonucleoside triphosphates
  • low molecular weight polar organic solvents in some embodiments, are selected from the group consisting of an amide, a sulfoxide, a sulfone, and a diol.
  • Low molecular weight polar organic solvents in some embodiments, can have a molecular weight less than or equal to 150 g/mol. Additionally, the low molecular weight polar organics can be present at a concentration ranging between 0.05 molar and 7.5 molar, in some embodiments.
  • the thermostable reverse transcriptase or a fragment thereof has an optimal reverse transcriptase (RT) above 37 o C and preferably above 48 o C. As shown and described further herein, the presence of the one or more of the organic cosolvents, in some embodiments, increases RT activity (rate of nucleotide incorporation) of the thermostable reverse transcriptase or the fragment thereof.
  • the RT activity rate can be increased by at least 5%, in some embodiments.
  • the reverse transcriptase of compositions described herein comprises one or more amino acids alterations conferring stability and/or activity in the one or more polar organic solvents.
  • the reverse transcriptase is a modified or mutant Taq polymerase bearing at least 90% sequence similarity to wild ⁇ type Taq polymerase (SEQ ID NO: 1), wherein the amino acid modifications confer stability and/or activity in the one or more polar organic solvents.
  • a composition comprises a thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase polymerase chain reaction (RT ⁇ PCR) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), DNA ⁇ dependent DNA polymerase enzyme of a fragment thereof, and one or more low molecular weight polar organic solvents.
  • the thermostable reverse transcriptase of the composition can be any thermostable reverse transcriptase described herein.
  • the one or more low molecular weight solvents can have any identity described herein.
  • a composition for performing a reverse transcriptase reaction comprises a thermostable reverse transcriptase, a reverse transcriptase (RT) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), and one or more low molecular weight polar organic solvents, wherein the thermostable reverse transcriptase is a mutant of Taq polymerase bearing at least 90% sequence similarity to wild ⁇ type Taq polymerase of SEQ ID NO:1 and comprises one or more amino acid alterations enhancing stability and/or activity of the reverse transcriptase in the one or more low molecular weight polar organic solvents.
  • modified Taq DNA polymerases are described herein.
  • a modified Taq DNA polymerase having an amino acid sequence that is at least 90% identical to an amino acid sequence comprised of the sequence of wild ⁇ type Taq DNA polymerase of SEQ ID NO:1, wherein the amino acid sequence comprises a first set of non ⁇ natural amino acid alterations stabilizing or improving the activity of the modified Taq DNA polymerase in an aqueous ⁇ organic medium, and a second set of non ⁇ natural amino acid alterations conferring reverse transcriptase activity to the modified Taq DNA polymerase. Any non ⁇ natural amino acid alterations consistent with the objectives of the first and second sets can be employed.
  • a composition comprises a modified Taq DNA polymerase suitable for RT or RT ⁇ PCR reactions in an aqueous ⁇ organic medium, wherein the aqueous ⁇ organic medium comprises one or more low molecular weight organic solvents selected from the group consisting of an amide, a sulfoxide, a sulfone, and a diol, and wherein the amino acid sequence of the modified Taq DNA polymerase is at least 90% identical to an amino acid sequence comprised of the sequence of wild ⁇ type Taq DNA polymerase of SEQ ID NO:1 with a first set of amino acid alterations selected to confer reverse transcriptase activity, and a second set of amino acid alterations selected from the group consisting of L30P, A54V, E434D, K206Q, S612R, V730I, and F749V of SEQ ID NO:1; P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R
  • the amino acid alterations conferring RT activity include one or more of E732N, E742K, E742R, M747K, M747R, E742N, E742N, E742Q, E742Y, E742M, E742A and M747N of SEQ ID NO:1.
  • the second set of amino acids above are paired with one of the E742 alterations and one of the E747 alterations of SEQ ID NO:1. Any desired pairing can be made. Non ⁇ limiting examples of such pairing are provided in Table 15 below.
  • kits are provided herein.
  • a kit comprises a composition for reverse transcription or a composition for reverse transcription ⁇ PCR described herein.
  • a kit comprises a composition for target enrichment for RNA sequencing by a reverse transcription or reverse transcription ⁇ PCR composition described herein.
  • Methods of reverse transcribing RNA into DNA and methods of administering reverse transcription ⁇ PCR are also described herein.
  • a method of reverse transcribing RNA into DNA comprises incubating a thermostable reverse transcriptase with a reverse transcriptase buffer, a RNA template, deoxyribonucleoside triphosphates (dNTPs), DNA primers, and at least one low molecular weight organic cosolvent.
  • the one or more low molecular weight organic cosolvents can have any identity described herein.
  • the reverse transcriptase is a modified Taq DNA polymerase bearing at least 90% sequence similarity to wild ⁇ type Taq polymerase of SEQ ID NO:1.
  • the temperature of reverse transcription is higher than its optimal value in the absence of the polar organic cosolvent, and less than or equal to the melting temperature of 9 the enzyme at that cosolvent concentration, minus 5 o C.
  • reaction yield of reaction efficiency can be enhanced in the presence of the at least one low molecular weight solvents.
  • reverse transcription and/or DNA amplification in some embodiments, is administered for target enrichment in next ⁇ generation sequencing of RNA, including wherein the copy number of RNA sequences are determined by next ⁇ generation sequencing.
  • the RNA sequencing is carried out with incorporation of unique molecular identifiers (UMI) in the adapter sequences.
  • UMI unique molecular identifiers
  • a method comprises a) incubating a clinical sample containing a virus or bacteria with RT ⁇ PCR reagents including a thermostable or solvostable reverse transcriptase (RT), one or more low molecular weight polar organic cosolvents, optionally a thermostable or solvostable DNA ⁇ dependent DNA polymerase enzyme, RT ⁇ PCR buffer, and primers complementary to the nucleic acid sequence to be detected, at a temperature exceeding 70 o C and preferably below 80 o C, to lyse the virus or bacteria and release RNA without degrading the RNA; b) incubating the lysed clinical sample at or near the optimal temperature for reverse transcription of the RT enzyme; c) thermal cycling of the reaction mixture to PCR amplify the resulting complementary DNA (cDNA); and d) quantifying of the PCR product.
  • RT thermostable or solvostable reverse transcriptase
  • RT ⁇ PCR buffer optionally a thermostable or solvostable DNA ⁇ dependent DNA polymerase enzyme
  • FIG. 3(A) Comparison of RT activity for commercial RT enzyme (50U [62.5ng] of ProtoScript II RT) with mutants of interest (including 25ng of WT, N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT, L ⁇ 5 ⁇ 2 ⁇ F01 –RT1, L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT2) under extension temperatures 55 o C and 68 o C.
  • the Poly(A) template concentration is 0.5ng/ul (2.82 nM).
  • Fig. 3(B) The contribution of 5% BD to fluorescence readout was also assessed. The addition of 5% BD does not change the RFU.
  • RT ⁇ qPCR efficiency of these two mutants were evaluated along with the efficiency of SFM4 ⁇ 6 and a thermostable MMLV enzyme, ProtoScript II, in absence and presence of BD (7%) at 55°C (I) or 68°C (J).
  • RT ⁇ qPCR was carried out in 3 steps as described in Materials and Methods.
  • K,L represent the melt peak traces of the respective qPCR products from 55°C to 95°C.
  • *PSII ⁇ ProtoScript II Table 2 herein presents quantitative peak area and T M results for panels K,L since Cq values can be affected by nonspecific amplification.
  • RT activity inducing mutations identified in our study such as E742K, M747K are represented as purple spheres. The two images are rotated by 180 degrees to enable visualization of all mutations. Predicted effects of subset combinations of these mutations on polymerase folding free energy are reported in Table 7.
  • Figs. 7A ⁇ 7J Microfluidic preparation of double emulsions and FACS sorting: We prepared primary water ⁇ in ⁇ oil emulsions Fig. 7(A) followed by PCR. A fraction of primary emulsion was used to isolate DNA and ran on 1% Agarose gel Fig. 7(B). Panel B: Lane 1 DNA marker, Lane 2 negative control, and lane 3 is positive control.
  • FIG. 7H A total 1.6 million events were randomly captured; a threshold of 5000 was applied to gate the parental DE (Fig. 7H, and Fig. 7I), followed by sorting SYBR positive double emulsion (J).
  • Fig. 7I depicts the gated population from P1 that is identified for further analysis as P2;
  • Fig. 7J depicts the sorted SYBR positive DEs that were collected.
  • Figs. 7K ⁇ 7L (K) FACS sorting of the L5 library; (L) Direct fluorescence detection of reverse transcription products within emulsion droplets.
  • 5 ⁇ g of brain total RNA was mixed with a BEGAIN gene ⁇ specific primer and processed through a dolomite microfluidic device to generate ⁇ 3 million droplets.
  • Half of the droplets underwent RT ⁇ PCR amplification, then were stained with Picogreen and imaged under a fluorescence microscope (upper right). Pre ⁇ PCR droplets are shown for comparison (upper left). A negative control with no RNA added is also provided (lower).
  • Figs. 8A ⁇ 8C Fig.
  • E742K The mutation K742 (right) forms one hydrogen bond (cutoff – 2.7 to 3.3 angstroms; represented as dashed lines) with one ribonucleotide (G5 ⁇ 794) of the bound RNA, whereas E742 (left) does not form any hydrogen bond with RNA.
  • S515N The mutation N515 (right) forms two hydrogen bonds (one shown) between the amide side chain N and one nucleotide (DA840) of the bound DNA, whereas S515 (left) forms only one hydrogen bond, with one nucleotide (DA845).
  • the binding affinity difference calculated using MM ⁇ GBSA was determined to be ⁇ 22.71 kcal/mole for the S515N mutation.
  • the numbers depict the average distance between the donor ⁇ acceptor atom pairs forming the hydrogen bonds as observed in the production run of MD simulation. (Wild type binding affinity difference for RNA vs DNA in the same MM ⁇ GBSA units was determined to be +278.37 kcal/mol.) Figs.
  • Fig. 9B Melting curves and peak traces of four templates in the absence of BD with WT ⁇ Taq and presence of 5% BD with 5 selected clones N ⁇ 7 ⁇ 3 ⁇ B07, N ⁇ 7 ⁇ 3 ⁇ C08, N ⁇ 7 ⁇ 2 ⁇ E02, L3 ⁇ D04 ⁇ 26 and L ⁇ 5 ⁇ 2 ⁇ F01.
  • Figs. 10A ⁇ 10C GC bias in coverage of GC ⁇ rich and poor genes in target enrichment for next ⁇ generation sequencing with engineered polymerases.
  • GC ⁇ rich templates cloned in plasmids were PCR amplified together with either WT or L ⁇ 5 ⁇ 2 ⁇ F01 or N ⁇ 7 ⁇ 3 ⁇ B07 enzyme.
  • Gene ⁇ specific primers (one set of FWD and REV for each template) were added in the PCR reactions.
  • the PCR mix contained 7.25U of each enzyme and 5 ng of each template.
  • the reaction mixture contained 0.75 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of each 16 primer and BD as specified.
  • Fig. 10(B) The PCR mix contained 1.25U of each enzyme and 5 ng of each template.
  • FIG. 12(A) ⁇ Taq template in 5% BD
  • FIG. 12(B) ⁇ c ⁇ Jun template in 0 ⁇ 8% BD with select clones from early screening rounds
  • Fig. 12(C) ⁇ c ⁇ Jun template in 0 ⁇ 10% BD with select clones from later screening rounds (higher denaturation temperature was applied to the later round clones).
  • Fig. 12(A) ⁇ Taq template in 5% BD
  • FIG. 12(B) ⁇ c ⁇ Jun template in 0 ⁇ 8% BD with select clones from early screening rounds
  • Fig. 12(C) ⁇ c ⁇ Jun template in 0 ⁇ 10% BD with select clones from later screening rounds (higher denaturation temperature was applied to the later round clones).
  • Fig. 12(A) ⁇ Taq template in 5% BD
  • Fig. 12(B) ⁇ c ⁇ Jun template in 0 ⁇ 8% BD with select clones from early screening rounds
  • Figs. 13A ⁇ 13E Effect of 1,4 ⁇ butanediol (BD) on DNA melting, polymerase stability and PCR efficiency.
  • Fig. 13(A) GC content plot of c ⁇ Jun template flanked by primers J1/J3 (376 bp) 17 was generated by online tool (http://www.endmemo.com/bio/gcdraw.php),
  • Fig. 13(B) In triplicate reaction, 5 ⁇ g of purified c ⁇ Jun amplicon was used to assess the effect of 0 ⁇ 10% BD on T M of the template in a 1X PCR buffer and
  • Fig. 13(C) change in T M of DNA was plotted against BD concentration, Fig.
  • A,B Fluorescence ⁇ based detection of RT products from lysed cells with and without organic cosolvent, for enzymes SFM 4 ⁇ 6 and L5 ⁇ RT1.
  • C Gel analysis of RT ⁇ PCR products from lysed cells with varying amounts of organic cosolvent. Synthesized partial KRAS RNA (119 nucleotides) was mixed with the following components: a ⁇ SFM4 ⁇ 6 (40 ng, positive control), B, C, D ⁇ 5 million bacterial cells of b (WT Taq), c (SFM4 ⁇ 6), and d (L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1), respectively. Four sets of these mixtures were assigned different concentrations of BD (0%, 5%, 10%, 20%).
  • the reverse transcription (RT) reaction volume was 20 ⁇ L for each sample.
  • the RT reaction was performed at 80°C for 10 minutes followed by 55°C for 60 minutes.
  • PCR was carried out using the NEB LUNA PCR mix on 0.5 ⁇ L of the completed RT reaction mixture.
  • the PCR results were analyzed on a 2.5% agarose gel. Notice that the bands in WT lanes are non ⁇ specific as demonstrated by their wrong molecular weight.
  • compositions and methods for the upregulation of reverse transcription (RT) reactions and the reduction of sequence bias in RNA sequencing are presented.
  • a composition for performing a reverse transcriptase reaction comprises a thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase (RT) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), and one or more low molecular weight polar organic solvents.
  • a composition comprises a thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase polymerase chain reaction (RT ⁇ PCR) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), DNA dependent DNA polymerase enzyme of a fragment thereof, and one or more low molecular weight polar organic solvents.
  • RT ⁇ PCR reverse transcriptase polymerase chain reaction
  • dNTPs deoxyribonucleoside triphosphates
  • DNA dependent DNA polymerase enzyme of a fragment thereof and one or more low molecular weight polar organic solvents.
  • the low molecular weight polar organic solvents are employed as cosolvents with water or aqueous solvent.
  • low molecular weight polar organic solvents are selected from the group consisting of an amide, a sulfoxide, a sulfone, and a diol.
  • Low molecular weight polar organic solvents in some embodiments, can have a molecular weight less than or equal to 150 g/mol.
  • Embodiments herein are not limited to a particular organic co ⁇ solvent. Examples include but are not limited to, a low molecular weight amide, a low molecular weight sulfoxide, a low molecular weight sulfone, or low molecular weight diol.
  • the amide is selected from, for example, formamide, N ⁇ methyl formamide, N,N ⁇ dimethyl formamide (DMF), acetamide, N ⁇ methylacetamide, N,N ⁇ dimethylacetamide, propionamide, isobutyramide, 2 ⁇ pyrrolidone, N ⁇ methylpyrrolidone (NMP), N ⁇ hydroxyethyl pyrrolidone(HEP), N ⁇ formyl pyrrolidine, N ⁇ Formyl morpholine; delta ⁇ valerolactam, epsilon ⁇ caprolactam, or 2 ⁇ azacyclooctanone;
  • the sulfoxide is selected from, for example, dimethyl sulfoxide (DMSO), n ⁇ propyl sulfoxide, n ⁇ butyl sulfoxide, methyl sec ⁇ butyl sulfoxide, or tetramethylene sulfoxide;
  • the sulfone is selected from, for example, dimethyl sulf
  • the amide solvent for RT ⁇ PCR reactions is N,N ⁇ Dimethylformamide (DMF) at a concentration of about 0.5 to about 1.5 molar concentration; isobutyramide at a concentration of about 0.1 to about 1.0 molar concentration; 2 ⁇ pyrrolidone at a concentration of about 0.1 to about 1.0 molar concentration; or N ⁇ methylpyrrolidone at a concentration of about 0.1 to about 1.0 molar.
  • DMF N,N ⁇ Dimethylformamide
  • the organic solvent is N,N ⁇ Dimethylformamide (DMF) at a concentration of about 0.5 to about 7.0 molar concentration; isobutyramide at a concentration of about 0.1 to about 4.5 molar concentration; 2 ⁇ pyrrolidone at a concentration of about 0.1 to about 4.5 molar concentration; or N ⁇ methylpyrrolidone at a concentration of about 0.1 to about 4.5 molar.
  • the sulfoxide for RT ⁇ PCR reactions is dimethylsulfoxide (DMSO) at a concentration of about 0.5 to about 3.0 molar concentration or tetramethylenesulfoxide at a concentration of about 0.1 to about 1.0 molar.
  • the sulfone is tetramethylenesulfone (sulfolane) at a concentration of about 0.1 to about 1.0 molar.
  • the sulfoxide is dimethylsulfoxide (DMSO) at a concentration of about 0.5 to about 7.5 molar concentration or tetramethylenesulfoxide at a concentration of about 0.1 to about 4.0 molar.
  • the sulfone is tetramethylenesulfone (sulfolane) at a concentration of about 0.1 to about 3.0 molar.
  • the diol for RT ⁇ PCR reactions is 1,3 ⁇ propanediol at a concentration of about 0.5 to about 3.0 molar concentration; 1,4 ⁇ butanediol at a concentration of about 0.5 to about 2.0 molar concentration; or 1,5 ⁇ pentanediol at a concentration of about 0.5 to about 1.0 molar concentration.
  • the diol for RT reactions is 1,3 ⁇ propanediol at a concentration of about 0.5 to about 7.5 molar concentration; 1,4 ⁇ butanediol at a concentration of about 0.5 to about 5.0 molar 20 concentration; or 1,5 ⁇ pentanediol at a concentration of about 0.5 to about 2.5 molar concentration.
  • the one or more polar organic solvents display a rate of change of duplex DNA, DNA secondary structure, or RNA secondary structure melting temperature with respect to cosolvent concentration (dTm/d[solvent]) between ⁇ 1 K/M and ⁇ 15 K/M.
  • the duplex DNA corresponds to the c ⁇ jun DNA segment flanked by primers with SEQ ID NOS: 92 and 94, and where the DNA and RNA secondary structures correspond to the most stable secondary structures in the single ⁇ stranded BEGAIN DNA and RNA fragments flanked by primers with SEQ ID NOS: 126 and 127, respectively.
  • the one or more low molecular weight polar organic cosolvents may also display rates of change of wild ⁇ type Taq polymerase melting temperature with respect to cosolvent concentration (dT M /d[solvent]) between ⁇ 1 K/M and ⁇ 15 K/M.
  • Low molecular weight cosolvents of compositions and methods described herein can be of the formula , R 1 is C or S; and when R 1 is C, X is ⁇ O, R 3 is N and R 6 is absent; when R 1 is S, X is ⁇ O or and R 3 is C; R 2 is H or CH 3 only when one or more of R 4 , R 5 and R 6 is not H, and otherwise R 2 is an unsubstituted or halogen ⁇ , hydroxy ⁇ or alkoxy ⁇ substituted alkyl or cycloalkyl of length m, wherein m is selected such that the total number of carbons in the compound is between 3 and 8 when R 1 is C and between 2 and 8 when R 1 is S; wherein any two of 21 R 2 , R 3 , R 4 , R 5 and R 6 optionally form a cyclic structure in which cyclization is effected through a bond between them; and R 4 , R 5 and R 6 each is H, alkyl, cycloalkyl or
  • the one or more polar organic solvents comprises a cyclic compound, wherein the cyclization is effected through a bond between any two of R 2 , R 3 , R 4 , R 5 and R 6 .
  • the cyclic portion for example, can comprises five, six or seven members.
  • cyclic structure of the compound is a five, six, or seven ⁇ membered ring formed by a bond between R 2 and either R 4 , R 5 or R 6 .
  • R 1 can be S and remainder of the compound is unsubstituted.
  • the low molecular weight polar organic solvent comprises a compound in which R 1 is S, X is ⁇ O or , and R 3 is C.
  • the low molecular weight polar organic solvent is is selected from the group consisting of tetramethylene sulfone and tetramethylene sulfoxide.
  • the low molecular weight polar organic solvent is acyclic.
  • R 2 or R 3 of the compound is lower alkyl or substituted lower alkyl.
  • the polar organic solvent is selected from the group consisting of methyl sulfone, ethyl sulfone, n ⁇ propyl sulfone, n ⁇ propyl sulfoxide and methyl sec ⁇ butyl sulfoxide. As described herein, embodiments are not limited to a particular organic co ⁇ solvent.
  • the amide is is selected from the group consisting of formamide, N ⁇ methyl formamide, N,N ⁇ dimethyl formamide (DMF), acetamide, N ⁇ methylacetamide, N,N ⁇ dimethylacetamide, propionamide, isobutyramide, 2 ⁇ pyrrolidone, N ⁇ methylpyrrolidone (NMP), N ⁇ hydroxyethyl pyrrolidone (HEP), N ⁇ formyl pyrrolidine, and N ⁇ Formyl morpholine.
  • DMF N ⁇ methyl formamide
  • acetamide N ⁇ methylacetamide
  • N,N ⁇ dimethylacetamide propionamide
  • isobutyramide 2 ⁇ pyrrolidone, N ⁇ methylpyrrolidone (NMP), N ⁇ hydroxyethyl pyrrolidone (HEP), N ⁇ formyl pyrrolidine, and N ⁇ Formyl morpholine.
  • the organic solvent can be selected from the group consisting of N,N ⁇ Dimethylformamide (DMF) at a concentration of about 0.5 to about 1.5 molar concentration, isobutyramide at a concentration of about 0.1 to about 1.0 molar concentration, 2 ⁇ 22 pyrrolidone at a concentration of about 0.1 to about 1.0 molar concentration, and N ⁇ methylpyrrolidone at a concentration of about 0.1 to about 1.0 molar.
  • DMF Dimethylformamide
  • isobutyramide at a concentration of about 0.1 to about 1.0 molar concentration
  • 2 ⁇ 22 pyrrolidone at a concentration of about 0.1 to about 1.0 molar concentration
  • N ⁇ methylpyrrolidone at a concentration of about 0.1 to about 1.0 molar.
  • the amide solvent is N,N ⁇ Dimethylformamide (DMF) at a concentration of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of DMF; isobutyramide at a concentration of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of isobutyramide; 2 ⁇ pyrrolidone at a concentration of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 2 ⁇ pyrrolidone; or N ⁇ methylpyrrolidone at a concentration of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcript
  • DMF
  • sulfoxides are selected from the group consisting of dimethyl sulfoxide (DMSO), n ⁇ propyl sulfoxide, n ⁇ butyl sulfoxide, methyl sec ⁇ butyl sulfoxide, and tetramethylene sulfoxide;
  • the sulfone is selected from the group consisting of dimethyl sulfone, diethylsulfone, di(n ⁇ isopropyl) sulfone, tetramethylene sulfone (sulfolane), 2,4 ⁇ dimethylsulfolane, and butadienesulfone (sulfolene).
  • the organic solvent is selected from the group consisting of dimethylsulfoxide (DMSO) at a concentration of about 0.5 to about 3.0 molar concentration and tetramethylenesulfoxide at a concentration of about 0.1 to about 1.0 molar.
  • DMSO dimethylsulfoxide
  • the organic solvent is selected from the group consisting of dimethylsulfoxide (DMSO) at a concentration range of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 23 DMSO, and tetramethylene sulfoxide at a concentration range of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of tetramethylene sulfoxide.
  • DMSO dimethylsulfoxide
  • the organic solvent is tetramethylenesulfone (sulfolane) at a concentration of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of sulfolane.
  • sulfolane tetramethylenesulfone
  • Diols are selected from the group consisting of1,2 ⁇ propanediol, 1,3 ⁇ propanediol, 1,2 ⁇ butanediol, 1,3 ⁇ butanediol, 1,4 ⁇ butanediol, 1,2 ⁇ pentanediol, 2,4 ⁇ pentanediol, 1,5 ⁇ pentanediol, 1,2 ⁇ cyclopentanediol, 1,2 ⁇ hexanediol, 1,6 ⁇ hexanediol, and 2 ⁇ methyl ⁇ 2,4 ⁇ pentanediol.
  • the organic cosolvent is selected from the group consisting of 1,3 ⁇ propanediol at a concentration of about 0.5 to about 3.0 molar concentration, 1,4 ⁇ butanediol at a concentration of about 0.5 to about 2.0 molar concentration, and 1,5 ⁇ pentanediol at a concentration of about 0.5 to about 1.0 molar concentration.
  • the organic solvent is selected from the group consisting of 1,3 ⁇ propanediol at a concentration of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 1,3 ⁇ propanediol, 1,4 ⁇ butanediol at a concentration of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 1,4 ⁇ butanediol, and 1,5 ⁇ pentanediol at a concentration of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 1,5 ⁇ pentanediol.
  • thermostable reverse transcriptase or a fragment thereof. Any thermostable reverse transcriptase consistent with the technical 24 objectives described herein can be employed. In being thermostable, the reverse transcriptase can have an optimal RT temperature above 37 o C and preferably above 48 o C.
  • the thermostable reverse transcriptase in some embodiments, comprises one or more non ⁇ natural amino acid alterations conferring stability and/or activity in the one or more polar organic solvents.
  • the thermostable reverse transcriptase is a mutant or modified Taq polymerase bearing at least 90% sequence similarity to wild ⁇ type Taq polymerase (SEQ ID NO: 1).
  • the amino acid sequence comprises a first set of non ⁇ natural amino acid alterations stabilizing the modified Taq DNA polymerase in an aqueous ⁇ organic medium, and a second set of non ⁇ natural amino acid alterations conferring confer reverse transcriptase activity to the modified Taq DNA polymerase.
  • non ⁇ natural amino acid alterations of the first set stabilizing the modified Taq DNA polymerase in the low molecular weight polar organic solvents or aqueous ⁇ organic media comprising the low molecular weight polar organic solvents are selected from the group consisting of G3D, M4I, L5Q, F8L, E9V, P10S, V14A, L16P, H21R, A23P, L22M, F27S, A29T, G32D, G38D, K53N, A54V, L55P, A61V, D67G, P71L, R74L,R74H,R74C, K82N, G84D, A86V, P87Q, P89S, E90D, A97T, V103A, D104G, A109V, R110Q, P114S, G115D, E117D, A118V, A118T, K128R, V136A, L149P, L162P, K171T, A180V,
  • the solvostable first set of non ⁇ natural amino acid alterations are selected from the group consisting of L5Q, F8L, P10S, L16P, A23P, A29T, K31R, G38D,A61V, P89S, A97T, A118V, L162P, K171T, T186I, E201K, R205K, K206Q, G208S, K219E, N220D, I228V, M236T, D244E, D244V, R261H, D273G, L287Q, S290G, V310L, H333R, K346R, L351M, P382T, E388D, E434D, A454E, L461Q, L461R, V474I, F482I, I503T, E507K, S515N, A521V, Q534R, S543G, D551G, D551N, Q
  • the solvostable first set of non ⁇ natural amino acid alterations are selected from the group consisting of P10S, L16P, A29T, K31R, G38D, A61V, A118V, L162P, T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R, L351M, E388D, A454E, L461Q, L461R, F482I, I503T, S515N, A521V, Q534R, D551G, L606M, A608V, S612R, Q680R, E734G, S739G, F749V, F749I, L768M, and E832K of SEQ ID NO: 1.
  • the solvostable first set of non ⁇ natural amino acid alterations are selected from the group consisting of L5Q, P10S, A23P, A29T, T186I, L461R, E507K, A608V, S612R, E742K, F749L, F749I, K762R, K767R, and E832K of SEQ ID NO: 1.
  • the solvostable first set of non ⁇ natural amino acid alterations are selected from the group consisting of P10S, L16P, A29T, K31R, G38D, A61V, A118V, L162P, T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R, L351M, E388D, A454E, L461Q, L461R, F482I, I503T, S515N, A521V, Q534R, D551G, L606M, A608V, S612R, Q680R, E734G, S739G, F749V, F749I, L768M, and E832K of SEQ ID NO: 1.
  • quantifying the PCR product can be administered by qPCR.
  • the virus of the clinical sample for example, can be SARS ⁇ CoV virus or other respiratory virus.
  • kits for detection via RT ⁇ PCR of viral or bacterial pathogen RNA directly from clinical samples without sample preparation are provided.
  • such a kit comprises a thermostable or solvostable reverse transcriptase (RT) enzyme, one or more low molecular weight polar organic cosolvents, optionally a thermostable or solvostable DNA ⁇ dependent DNA polymerase enzyme, RT ⁇ PCR buffer, and primers complementary to the nucleic acid sequence to be detected.
  • RT thermostable or solvostable reverse transcriptase
  • kits including the solvostable reverse transcriptase (RT) enzyme and low molecular weight organic solvent can have any composition and/or properties described herein.
  • ddRT ⁇ PCR droplet digital reverse transcription PCR with enhanced RT and PCR efficiency are described herein.
  • a method for droplet digital reverse transcription PCR with enhanced RT and PCR efficiency, the method comprising: a) incubating RT ⁇ PCR reagents including a RT ⁇ PCR buffer, a thermostable or solvostable reverse transcriptase, a thermostable or solvostable DNA ⁇ dependent DNA polymerase, primers and/or probes for a sequence or mutation of interest, a polar organic cosolvent within emulsion droplets, and one or more RNA templates, at or near the optimal temperature for reverse transcription, such that the polar organic cosolvent at least doubles the reverse transcription yield compared to buffer lacking the cosolvent; b) thermal cycling of the reaction mixture to PCR amplify the resulting cDNA; and c) counting or sorting of the resulting positive droplets using a fluorescence ⁇ based counting or sorting device.
  • RT ⁇ PCR reagents including a RT ⁇ PCR buffer, a thermostable or solvostable reverse transcriptase, a thermostable or solv
  • a method for accelerating the in vitro evolution of reverse transcriptase (RT) enzymes comprising: a) preparation of a library of thermostable polymerase enzyme gene variants; 30 b) expression of the enzymes corresponding to these gene variants, for example through bacterial transformation and expression or in vitro transcription/translation of the library, in individual containers, the containers preferably being either droplets or microplate wells; c) incubation of the library of enzyme variants within individual containers, with one or more polar organic cosolvents at specified concentrations, RT ⁇ PCR buffer, primers and/or probes for an RNA sequence of interest, optionally a thermostable or solvostable DNA ⁇ dependent DNA polymerase enzyme, and the RNA template, at a temperature suitable for reverse transcription, the temperature preferably being between 48 o C and 80 o C; d) thermal cycling of the reaction mixtures to PCR amplify
  • the amino acid sequence comprises a first set of non ⁇ natural amino acid alterations stabilizing the modified Taq DNA polymerase in an aqueous ⁇ organic medium, and a second set of non ⁇ natural amino acid alterations conferring confer reverse transcriptase activity to the modified Taq DNA polymerase.
  • the temperature of reverse transcription is higher than its optimal value in the absence of the 31 polar organic cosolvent, and less than or equal to the melting temperature of the fully extended RNA:DNA heteroduplex at that cosolvent concentration, minus 5 o C.
  • RNA ⁇ seq next ⁇ generation RNA sequencing
  • reverse transcriptases especially those enzymes whose optimal temperatures for RNA ⁇ dependent DNA polymerization are significantly above 37 o C, preferably above 48 o C, which is not the case for the vast majority of RTs
  • reverse transcriptases can be solvophilic – with polar organic cosolvents increasing rather than decreasing their catalytic activity, and often increasing the activity of engineered solvostable reverse transcriptases over 5 ⁇ fold and in some cases over 15 ⁇ fold under conditions conducive to the elimination of secondary structure while maintaining the chemical integrity of RNA.
  • organic solvent ⁇ resistant reverse transcriptases thus expanding the repertoire of RTs to include those that are resistant to both high temperature and organic media.
  • compositions containing both RT enzyme(s) and certain polar organic cosolvent(s) within certain preferred ranges have never been anticipated nor reported to result in upregulation of the RT enzyme(s), and as such they constitute novel compositions.
  • RT reactions we conducted both RT and PCR steps of RT ⁇ PCR reactions in mixed aqueous ⁇ organic media using either a thermostable or engineered solvostable RT 33 enzyme and either a thermostable of engineered solvostable DNA ⁇ dependent DNA polymerase enzyme.
  • Engineered solvophilic reverse transcriptases are introduced that display activity at temperatures approaching 80 o C and over 400% upregulation of activity in the presence of organic cosolvents (up to 2000%), and overcome sequence ⁇ dependent RNA secondary structure more effectively than any other tested enzyme.
  • Preferred engineered solvophilic reverse transcriptase compositions display optimal temperatures for activity between 48 o C 34 and 76 o C and at least 100% upregulation of activity in the presence of appropriate concentrations of at least one polar organic cosolvent.
  • some of these enzymes are also solvostable DNA ⁇ dependent DNA polymerases, enabling their use in one enzyme, one pot RT ⁇ PCR reactions in mixed aqueous ⁇ organic media comprising certain polar organic solvents within specific concentration ranges.
  • RNA ⁇ Seq next ⁇ generation sequencing
  • solvophilic RT technology includes: a) infectious disease detection without sample preparation steps by RT ⁇ PCR using thermostable and/or solvostable RT enzymes in the presence of organic cosolvents, due to the ability to lyse bacteria and viruses at lower temperatures conducive to the chemical stability of RNA through the destabilizing effects of organic cosolvents on these microorganisms; b) droplet digital RT ⁇ PCR (ddRT ⁇ PCR) with improved detection of rare RNA mutations using thermostable and/or solvostable RT enzymes within droplets in the presence of organic cosolvents (exploiting the greatly enhanced RT enzyme activity in these cosolvents) and 36 droplet sorting/counting by methods such as FACS; and c) ultrahigh ⁇ throughput RT enzyme engineering with greatly enhance signal enhancement from rare active library variants due to the ability of organic cosolvents to multiply RT activity
  • thermostable reverse transcriptases i.e., reverse transcriptases whose optimal temperature for RNA ⁇ dependent DNA polymerization is above 37 o C and preferably significantly above that temperature – preferably above 48 o C
  • thermostable reverse transcriptases i.e., reverse transcriptases whose optimal temperature for RNA ⁇ dependent DNA polymerization is above 37 o C and preferably significantly above that temperature – preferably above 48 o C
  • RT activity assay DNA sequence conversion assay
  • SFM 4 ⁇ 6, SFM 4 ⁇ 3 DNA sequence conversion assay
  • Reverse transcriptase activities of highly thermostable RTs of interest were tested at different extension temperatures conducive to the reduction of RNA secondary structure (55 o C, 68 o C, 72 o C and 76 o C).
  • RT activity was observed in SFM 4 ⁇ 6, SFM 4 ⁇ 3 and Taq polymerase RT variants engineered for solvent tolerance [N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT (SEQ ID NO: 4), L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 (SEQ ID NO: 2), and L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT2 (SEQ ID NO: 3)], and it was found that RT activities of tested mutants were dramatically enhanced in the presence of cosolvents up to over 20% v/v (Fig. 2).
  • Polar organic cosolvents from all the major aforementioned families – including 1,4 ⁇ butanediol for the diol family, sulfolane for the sulfone family, tetramethylene sulfoxide for 37 the sulfoxide family, and 2 ⁇ pyrrolidone for the amide family ⁇ were applied in reverse transcriptase activity assays (Fig. 2, Tables 1,2).
  • the RT activity decreased with increasing temperature (Fig. 2 (B,D)).
  • SFM4 ⁇ 6 lost its RT activity whereas L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 was still RT active.
  • the RT activity of SFM4 ⁇ 6 was limited or undetectable on this template, while the RT activities of L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 and N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT were enhanced in 7% BD (Cq ⁇ 15; Fig. 5I, lanes 4&6) compared to 0% BD (Cq ⁇ 20; Fig. 5I, lanes 3&5). Since the expected PCR product contains 75% GC, the T M is around 90°C (Fig. 5K, peaks 4&6), while the non ⁇ specific bands generated by SFM4 ⁇ 6 led to lower temperature melt peaks in both 0% BD and 7% BD (Fig. 5K, peaks 1&2).
  • thermostable reverse transcriptases L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1, L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT2, SFM4 ⁇ 6, SFM4 ⁇ 3
  • thermostable Taq polymerase based on variants of the thermostable Taq polymerase that these enzymes not only display resistance in their RT activity to organic cosolvents (including in the context of RT ⁇ PCR), but also show for the first time that the activity of highly thermostable RTs can be improved by the presence of organic cosolvents, with the RT activity of L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 increasing almost 2000% in the presence of 20% BD (Fig.
  • thermostable RT enzyme activity upregulation by the aforementioned polar organic cosolvents motivated the engineering of such enzymes for further enhanced function in mixed aqueous ⁇ organic media.
  • thermostable polymerase mutant libraries wherein both RT and DNA ⁇ dependent DNA polymerase activity in organic cosolvents could be introduced and/or improved, through ultrahigh ⁇ throughput droplet ⁇ based selection, computational modeling and experimental screening and characterization.
  • the thermostable polymerase was chosen to be Taq polymerase, but other thermostable polymerases may be used as well.
  • Selections were typically carried out using DNA ⁇ dependent DNA polymerase activity in droplet ⁇ based PCR reactions because of the comparative simplicity of the protocol compared to direct selection for RT activity – including the ability to apply compartmentalized self ⁇ replication (CSR) of the polymerase gene – based on the underlying observations that a) polymerase stability in mixed aqueous ⁇ organic media is the same irrespective of whether the activity in question is DNA ⁇ dependent or RNA ⁇ dependent DNA polymerase activity; and b) the native DNA ⁇ dependent DNA polymerase catalytic activity in the presence of organic solvents and at elevated is a prerequisite (though not sufficient) for RT activity in organic media as well.
  • CSR compartmentalized self ⁇ replication
  • the Taq epPCR library was subjected to CSR selection in the presence of 5% BD.
  • NGS ⁇ guided CSR enrichment We followed genotype redundancy as a function of CSR round by NGS. We performed seven consecutive rounds of CSR on the epPCR library (generation 1) and five rounds on the shuffled library (generation 2).
  • mutants with improved stability contained mutations to lysine (e.g., E832K); such mutations have been reported to often improve protein stability through entropic stabilization.
  • the mutants that are present in the polymerase domain tend to cluster in and around the substrate binding site ⁇ e.g., V586 may be implicated in DNA binding in association with E742 and A743.
  • the residue S612 belongs to Motif A (605 ⁇ 617) of the polymerase domain. In general Motif A residues are mutatable, except for residue D610 which is part of the catalytic triad.
  • Residue F667 can tolerate only tyrosine substitution and has been implicated in nucleotide substrate discrimination enabling the polymerase to incorporate dNTPs.
  • mutants of F749 which 46 reside near the O and O1 helices of the fingers subdomain and indirectly affect the function of the enzyme.
  • Those in category 1) such as P10, L30, A54, A61, F73, T186 etc. (Table 3) primarily affect the stability, as deletion of the N ⁇ terminal 1 ⁇ 288 amino acids (as in the Stoffel fragment) leads to a more thermostable polymerase domain.
  • Protein purification and primer extension activity We added N ⁇ terminal His ⁇ tag to the screening positive mutants and purified the proteins to homogeneity. We determined the polymerase activities of the WT and its mutant derivatives using self ⁇ annealing template ⁇ primer (SATP) at 72 o C. We found that the specific activities of the mutants in aqueous buffer ranged from 12 ⁇ 210 mU/ng (Table 12). The wild ⁇ type specific activity in aqueous buffer was 119 mU/ng.
  • thermostability assay Although the thermostability assay described above is well ⁇ established and widely accepted to assess the thermal tolerance of polymerases, it is a kinetic denaturation assay that depends on the primer extension ability of the enzyme.
  • thermostability assays we conclude that evolved polymerases have improved thermostability especially in cosolvents.
  • protein melting temperatures of four thermostable and solvostable reverse transcriptases were also measured by nanoDSF (Table 6A).
  • the data demonstrate that the enzymes not specifically engineered for solvostability and activity in organic cosolvents display significantly lower melting temperatures — especially in the presence of organic cosolvents — than those that were engineered for function in mixed aqueous ⁇ organic media.
  • the introduction of RT activity ⁇ inducing mutations is also observed in some cases to result in a small reduction in protein T m as well (Table 6A).
  • the lysine (K) residue was observed to be involved in forming five hydrogen bonds (hydrogen bond cut ⁇ off: 2.7 ⁇ 3.3 ⁇ ) and one salt bridge with the bound RNA ligand (Fig. 8B).
  • the mutation Lysine (K) was observed to form one hydrogen bond with the bound RNA, compared to no hydrogen bond for the native E. 51 M742K is located near the active site and forms a salt bridge with the nucleic acid backbone.
  • the binding affinity energy evaluation for DNA was performed on E507K and S515N mutant complexes along with reference complex for relative comparison.
  • the binding affinity difference calculated using MM ⁇ GBSA was determined to be ⁇ 62.80 kcal/mol for the E507K mutation.
  • the binding affinity difference calculated using MM ⁇ GBSA was determined to be ⁇ 22.71 kcal/mole for the S515N mutation.
  • GC bias evaluation using NGS We applied the Illumina target enrichment protocol to genes of widely varying GC content from genomic DNA. As shown in Fig. 9, without BD, there was no effect of the engineered enzymes N ⁇ 7 ⁇ 3 ⁇ B07 and N ⁇ 7 ⁇ 3 ⁇ C08 on increasing the mean coverage of GC ⁇ rich genes B3GT6 and CDN1C relative to the lower GC content genes EGFR and KRAS (Fig. 9A), with the bias being consistent with the T m s depicted in Fig. 9C.
  • a concentration of 4% BD was added in the PCR pool when WT enzyme was used since there was no template amplification with WT over 5% BD under high denaturation temperature conditions.
  • a concentration of 10% BD was added in the PCR reactions 53 when L ⁇ 5 ⁇ 2 ⁇ F01 or N ⁇ 7 ⁇ 3 ⁇ B07 were used since as demonstrated in Fig. 5, L ⁇ 5 ⁇ 2 ⁇ F01 could amplify a number of GC ⁇ rich genes under these conditions.
  • Solvostable DNA polymerases reduce copy number estimation errors by orders of magnitude (Fig. 9, Table 8), and hence are expected to largely eliminate sequence bias when applied in conjunction with UMIs in genome sequencing applications.
  • Highly solvophilic RNA ⁇ dependent DNA polymerases L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 and N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT which can be combined with solvostable DNA ⁇ dependent DNA polymerases L ⁇ 5 ⁇ 2 ⁇ F01 and N ⁇ 7 ⁇ 3 ⁇ B07, display the ability to enrich targets for NGS sequencing / RNA ⁇ Seq with dramatically reduced bias and to amplify hitherto intractable genes. For example, their ability to synthesize and amplify cDNA from GC ⁇ rich RNA like BEGAIN with much higher efficiency (Fig.
  • RNA ⁇ seq RNA sequencing
  • qPCR traces are shown in Fig. 12A.
  • the synthesized polymerase clones SPC3, 4, 5 and 9 were able to tolerate up to 7% BD and were among the best performing mutants from the early rounds.
  • a GC ⁇ rich template, c ⁇ Jun qPCR was carried out for early round mutants with increasing concentrations of BD (Fig. 12), since both qPCR and the desired property of reverse transcription in such media benefit from solvent resistance.
  • the WT enzyme and the mutants were not able to amplify c ⁇ Jun template at 0% BD (Cq values were close to the end of the 55 total number of cycles).
  • the protein melting T M s of the WT and mutant polymerases respond to BD concentration negatively (Table 6) with a linear relationship and the % enzyme denatured is displayed for several mutants in 5% BD in Fig. 13D.
  • the melting temperature of the WT ⁇ Taq polymerase decreases more per unit 57 BD concentration, compared to the mutants, consistent with the fact that the engineered polymerases resist the denaturation effect of BD.
  • Enzyme activity data at 0 and 5% BD demonstrate differential rates of activity loss.
  • Fig. 13E depicts the net effect of these properties on Cq values as a function of BD concentration and the concentrations at which maximal PCR efficiency is achieved for each.
  • top hit clones mutants from N series 7 th round, mutants from L series 5 th round and synthetic sequences
  • properties of the top hit clones with the best performance in terms of specific activity, thermostability, and/or PCR efficiency in the presence of 1,4 ⁇ butanediol are summarized in Table 1. Due to their improved butanediol organic solvent ⁇ tolerance and high thermal stability, the top hit clones were next systematically evaluated for their ability to improve GC ⁇ rich template amplification and to reduce GC bias in next ⁇ generation sequencing.
  • Nonlinear (RT ⁇ )PCR amplification dynamical models relate polymerase activity and thermostability as well as nucleic acid secondary structure and duplex melting temperatures to (RT ⁇ )PCR product yield and Cq value.
  • the proposed model can be used to predict the Cq value as a function of cosolvent concentration, given the effects of cosolvent on each of these three properties, and thus to identify the optimal cosolvent concentration for amplification of a given template with a characterized polymerase enzyme.
  • activity decline of DNA ⁇ dependent DNA polymerases
  • thermal denaturation by cosolvent, increase the minimum extension time which in turn decreases product yield.
  • the cosolvent concentration at which activity is extinguished or half ⁇ life becomes negligible determines the effective range of cosolvent concentrations because of the greater effect of the cosolvent on the enzyme activity at those concentrations.
  • GC ⁇ rich template amplification with engineered polymerases In addition to c ⁇ Jun, a broad set of GC ⁇ rich templates from genomic DNA (Table 13) was PCR ⁇ amplified with WT and one engineered polymerase (L ⁇ 5 ⁇ 2 ⁇ F01; Table 3), in the presence of BD. Two types of PCR cycling conditions (high and moderate denaturation temperature) were employed, with several BD concentrations. Fig. 5B shows that even under high denaturation temperature, WT is incapable of amplifying the seven GC ⁇ rich templates even in the presence of 7% BD. Interestingly, by increasing the BD concentration to 10% (Fig.
  • the engineered polymerase variant is capable of amplifying all seven of the GC ⁇ rich templates (with some degree of nonspecificity for CD5R2 and DACT3, which have among the highest GC contents at 64% average/88% max and 79% average/ ⁇ 100% max, respectively, Table 13 and Fig. 11).
  • the BAIP3 template (GC%: 64% average/80% max) showed strong amplification, with only one nonspecific band, while KLF14 (GC%:72% average/90% max) showed significantly lower specificity (Table 13 and Fig. 11).
  • KLF14 GC%:72% average/90% max
  • Solvostabilizing mutations can broaden the window for effective high temperature catalytic activity of reverse transcriptases at these cosolvent concentrations (compare SFM4 ⁇ 3, 4 ⁇ 6 with L5 ⁇ 2 ⁇ F01 ⁇ RT1 and ⁇ RT2 in Fig. 2 as well as Table 6A). Protein stabilizing adjuvants like glycerol can also be helpful.
  • the protein melting temperatures of four thermostable reverse transcriptases measured by nanoDSF (Table 6A) demonstrate that the enzymes not specifically engineered for solvostability and activity in organic cosolvents display significantly lower melting temperatures — especially in the presence of organic cosolvents — than those that were engineered for function in mixed 61 aqueous ⁇ organic media.
  • RNA:DNA heteroduplex reverse transcriptase enzymes
  • T m of the RNA:DNA heteroduplex is reduced by cosolvents.
  • Such effects may play a role in limiting the effective range of RT activity ⁇ enhancing polar organic cosolvents.
  • RTs generally have lower fidelity than DNA ⁇ dependent DNA polymerases and Taq variant RTs have been engineered to achieve fidelities close to several of the highest fidelity RTs reported to date without the need for a proofreading domain.
  • Fidelity data on the engineered solvostable RTs show that they do not generally have lower fidelities than other Taq variants.
  • Fidelity of the mutants Polymerases with high normalized peak area at 5% and/or 7% BD, including those which ranked most highly in the above computational and experimental activity and stability analyses, were selected for further characterization. As shown in Table 11, the fidelity of the engineered polymerases is similar to that of the wild type enzyme with the exception of SPC9, a synthetic variant which has slightly lower fidelity.
  • Reverse transcription within droplets, and reverse transcription and RT ⁇ PCR assays from cells enhanced by organic cosolvents For illustration of reverse transcription within emulsion droplets, direct detection of pico ⁇ green fluorescence from emulsion droplets was applied. Droplets were generated after mixing EnzChek RT buffer with brain total mRNA and the BEGAIN primer. As shown in the upper panel of Fig. 7(L), a clear fluorescence signal could be detected by microscopy when the droplets were processed after PCR. Prior to the PCR reaction, all droplets appeared uniform, and no bright droplets were observed. As a negative control, both pre ⁇ PCR and post ⁇ PCR images of the droplets lacking brain total mRNA did not show any bright droplets, indicating the absence of DNA formation.
  • FACS fluorescence ⁇ activated cell sorting
  • the purified SFM4 ⁇ 6 RT generated the expected DNA band across all BD conditions. However, its activity decreased at high BD concentrations, as anticipated. While a non ⁇ specific band was observed in the negative control lanes containing the wild ⁇ type Taq cells, no KRAS ⁇ specific band was detected, confirming the validity of the negative control. The cells expressing the SFM4 ⁇ 6 RT produced faint bands, indicating that its RT activity was weaker than that of the L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 enzyme under these experimental conditions.
  • thermostable reverse transcriptases are generally solvophilic, i.e. upregulated by polar organic cosolvents
  • droplet ⁇ based directed evolution to engineer solvostable polymerases even more suitable for RNA ⁇ dependent DNA polymerization (RT) and RT ⁇ PCR applications.
  • RT RNA ⁇ dependent DNA polymerization
  • cosolvent ⁇ resistant engineered polymerases ideally solve the longstanding sequence bias problem of nucleic acid polymerization.
  • compositions and methods, including cosolvents and polymerases are expected to work not only in standard RT and RT ⁇ PCR but in any related protocols such as NGS/RNA ⁇ seq, droplet digital RT ⁇ PCR (ddRT ⁇ PCR), and infectious pathogen RNA detection without sample preparation.
  • thermostable reverse transcriptases having properties described herein is provided in Table 15 below.
  • the codon ⁇ optimized WT ⁇ Taq gene was synthesized at Genscript (NJ, USA). The gene was cloned in pASK ⁇ IBA5C vector (IBA Lifesciences, Germany) between XbaI and SalI restriction sites to create the plasmid pASK ⁇ Taq. Restriction enzymes, Q5, Vent polymerase, T4 DNA ligase, Calf Intestinal Phosphatase (CIP), and M13 single stranded DNA were procured from New England Biolabs Inc (MA, USA). Diversify PCR random mutagenesis kits were purchased from Takara Bio USA Inc. (CA, USA). All primers were synthesized at Integrated DNA Technologies (Iowa, USA).
  • RT Reverse Transcriptase activity
  • a Stoffel fragment mutant of Taq polymerase (SFM 4 ⁇ 6) reported previously to have RT activity and ProtoScript II RT were used as positive controls. Equal activities of the enzymes were applied in the master mixture (total volume 30 ⁇ l) and the mixture was incubated at 55°C, and the same quantities of each enzyme were also incubated at 68°C and 76°C, for 30 min. The reactions were terminated by addition of 2 ⁇ l of 200mM EDTA. 68 ⁇ l of the PicoGreen solution (as recommended by the kit for solution preparation) was added into the solution and incubated for 5 min at room temperature.
  • the RT activity was measured as intensity of fluorescence using TeCan (Infinite 200Pro) microplate reader with excitation / emission wavelengths 480nm and 520 nm respectively.
  • the standard curve was measured at 37 o C using a commercially available reverse transcriptase (ProtoScript II RT, NEB) to calculate the relative activity.
  • the data were collected and analyzed using GraphPad Prism 7.
  • RT ⁇ qPCR assay RT ⁇ qPCR efficiencies of our two best mutants L ⁇ 5 ⁇ 2 ⁇ F01+E742K+M747K (L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1) and N ⁇ 7 ⁇ 3 ⁇ B07+E742K+M747K (N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT) were tested in absence and presence of BD (7%) and compared with the SFM4 ⁇ 6.
  • step 1 0.2 ⁇ g of a synthesized RNA of human BEGAIN gene fragment (100 base) with 75% GC content (CCUGCGGGCCAAGCCGGGGACCGCCCGGCUCCCCGGGGAGGACAUGAGGGGCCAGUGGCGUCC CCUGAGCGUGGAGGACAUCGGCGCCUACUCCUACCCC) (SEQ ID NO: 146) was incubated with 0.5 ⁇ g of BEGAIN RT ⁇ REV at 80°C for 10 min in 100 uL H 2 O (RNase and Dnase free).
  • RT reaction mixture (a total volume of 20 ⁇ l) was prepared using 1X Taq buffer ( ⁇ Mg), 0.25 mM dNTP, 3.5 mM MgCl 2 , RNase inhibitor (NEB), 1X SYBR safe, BD (0% or 7%), template RNA ⁇ primer mix (10 ⁇ l) from step 1 and 30 ng of each enzyme.
  • RT reaction was carried out at 55 o C or 68°C for an hour followed by deactivation of the above enzymes at 98.3°C for 1 min + 95°C for 6 min.
  • step 3 qPCR reaction mixture (20 ⁇ l) was prepared using 1X Taq 65 buffer ( ⁇ Mg), 0.25 mM dNTP, 3.5 mM MgCl 2 , 1X SYBR safe, RT reaction mixture from step 2 (1 ⁇ l), BEGAIN RT ⁇ FWD, BD (7%) and L ⁇ 5 ⁇ 2 ⁇ F01 enzyme (3.55 ng/0.625U).
  • the Bio ⁇ Rad CFX96 TM Real ⁇ Time PCR Detection System was used to carry out the qPCRs using 1 min at 95 o C followed by 40 cycles of 30s at 95°C, 30 sec at 57°C, and 40 sec at 72 o C. The Cq values were determined to assess the efficiency of RT ⁇ qPCR.
  • the purified products were digested by XbaI and SalI and introduced into the pASK ⁇ IBA5C vector.
  • the ligated products were electroporated into E. coli TG1 cells. After an hour of recovery, 5 ⁇ L cells were serially diluted to spread on the LB ⁇ chloramphenicol (50 ⁇ g/ml) plates to assess the library size.
  • the remaining cultures were re ⁇ inoculated into 20 ml LB media supplemented with chloramphenicol in 50 ml conical flask overnight at 37 o C and shaking at 250 RPM to generate N ⁇ epPCR expresser cells.
  • N ⁇ epPCR expresser cells (1%) were inoculated into 50 ml of LB ⁇ chloramphenicol. The cells were induced by anhydrotetracycline (300 ng/ml) to express the Taq polymerase once the OD 600 reached between 0.4 ⁇ 0.5. After four hours, the cells were harvested by centrifugation, washed, and resuspended in 1X Taq buffer (10 mM Tris ⁇ HCl pH 8.5, 50 mM KCl, 1.5 mM MgCl 2 , and 0.1% Triton X ⁇ 100). The CSR was performed as described by to select for thermostable and BD resistant mutants in 5% BD.
  • the emulsions were pre ⁇ incubated at 95 o C for 6 min, followed by CSR PCR, 25 cycles at 94 o C for 1 min, 55 o C for 1 min, and 72 o C for 5 min.
  • the top hit clones were randomly recombined by StEP PCR.
  • the resulting library (generation 2, pre ⁇ 1 st CSR round) was subjected to higher selection pressure.
  • the CSR ⁇ PCR was performed in the presence of 7% BD.
  • the CSR ⁇ PCR cycle used was as follows: 98.3 o C for 1 min then 95 o C for 6 min, followed by 25 cycles at 94 o C for 1 min, 55 o C for 1 min, and 72 o C for 5 min.
  • the library series generated via error ⁇ prone PCR are referred to as the N ⁇ series (or epPCR libraries) for short.
  • the initial error ⁇ prone PCR ⁇ generated library is labeled N ⁇ epPCR.
  • Downstream CSR ⁇ treated libraries are labeled referring to the number of CSR rounds applied to this library.
  • CSR ⁇ treated libraries are referred to N ⁇ 1 st , N ⁇ 2 nd , N ⁇ 3 rd , N ⁇ 4 th , N ⁇ 5 th , N ⁇ 6 th , and N ⁇ 7 th corresponding to the total 7 rounds of CSR treatment applied to this library.
  • the initial StEP shuffling ⁇ generated library is labeled L ⁇ StEP.
  • Downstream CSR ⁇ treated libraries are labeled referring to the number of CSR rounds applied to this library.
  • CSR treated libraries are referred to L ⁇ 1 st , L ⁇ 2 nd , L ⁇ 3 rd , L ⁇ 4 th , and L ⁇ 5 th corresponding to the total 5 rounds of CSR treatment applied to this library series.
  • Library enrichment and next ⁇ generation sequencing To enrich and identify best ⁇ performing clones, we subjected the epPCR library series to seven consecutive rounds of CSR in the presence of 5% BD. After each cycle of the CSR enrichment rounds, the PCR product was re ⁇ amplified, cloned and then transformed in E.
  • the Taq gene ( ⁇ 2.5 kbp) was arbitrarily divided into six fragments (Fragments 1 ⁇ 6 and the amplicon size ranged from 450 bp ⁇ 468 bp) to make it compatible with Illumina sequencing platform.
  • PCR products were gel purified and then subjected to the Illumina NGS protocol at GENEWIZ. Forward and reverse sequence reads were merged and filtered with a sequence quality score cutoff of 33, using the PEAR assembler. Filtered and assembled sequences were then aligned to the reference gene sequence (WT ⁇ Taq gene) using sequence matcher and pairwise2 modules of the Biopython software suite. We used alignment parameters 2, ⁇ 1, ⁇ 35, ⁇ 0.1, for identical, non ⁇ identical, gap opening, and gap extending, respectively, for both alignment tools. Resulting unique merged sequences and alignment scores were recorded.
  • Non ⁇ target, large frameshifted, and truncated data were removed based on an alignment score as a sequence length cutoff of amplicon length ( ⁇ 6 to +1bp).
  • Final sequences were translated to their corresponding in ⁇ frame amino acid sequences by the Biopython translate module; sequence changes were recorded and logged in a tabular format.
  • SPC1 ⁇ 9 A total of nine clones (Synthesized polymerase clones; SPC1 ⁇ 9) were synthesized at Genscript. SPC1 ⁇ 9 were based on mutations identified from wet lab screening after one round of CSR. Microfluidic droplet preparation for CSR and polymerase screening by FACS: We noted one of the challenges with manual droplet emulsion preparation is the polydispersity.
  • PE water ⁇ in ⁇ oil
  • DE double emulsion
  • Dolomite ⁇ Encapsulator system and 30 ⁇ m fluorophilic chip to generate a 20 ⁇ m, monodispersed, primary emulsion (PE) following the manufacturer’s protocol.
  • PE monodispersed, primary emulsion
  • For double emulsion preparation we loaded one channel of the reservoir chip with PE, while the 70 other channel was loaded with FluoSurf as spacer fluid. All the three P ⁇ pumps were loaded with outer carrier phase driving the PE and spacer fluid into the 30 ⁇ m hydrophilic chip.
  • Typical flow rates for double emulsion preparation were as follows: 0.8 ul/min for P1 and P2 ⁇ pumps whereas 8 ul/min for P3 ⁇ pump, generating 30 ⁇ m DE. Droplet generation was monitored by an in ⁇ built, high ⁇ speed camera.
  • the primary emulsions were subjected to PCR. We employed the following PCR cycles ⁇ 95 o C for 6 minutes followed by 25 cycles of 95 o C for 1 min, 55 o C for 1 min, 72 o C for 5 min.
  • PCR cycles 100 o C for 6 minutes followed by 25 cycles of 95 o C for 1 min, 55 o C for 1 min, 72 o C for 5 min.
  • To prepare the double emulsion we used a 30 ⁇ m hydrophilic chip.
  • the samples were collected as SYBR HIGH , SYBR MEDIUM and SYBR LOW for downstream processing.
  • SYBR HIGH population 71 represents most of the droplets
  • SYBR MEDIUM contributes to the sorted population possibly because SYBR Green I binds to bacterial chromosomal DNA.
  • the excess sheath fluid was removed from SYBR HIGH sample then mixed with 2X volume of 1H, 1H, 2H, 2H ⁇ Perfluoro ⁇ 1 ⁇ octanol (PFO) to break the droplets, followed by Sanger sequencing to quantify enrichment of each clone.
  • Real ⁇ time qPCR screening assay A SYBR Green I assay based on real ⁇ time qPCR was used to screen the transformants obtained following CSR selection. Transformed colonies were picked and inoculated into a 96 ⁇ deep well culture plate containing 500 ⁇ L LB ⁇ chloramphenicol medium. Cells were grown and induced by anhydrotetracycline (300 ng/ml) once the OD 600 reached between 0.4 ⁇ 0.5. Then the cells were harvested and resuspended in 200 ⁇ L of 1X Taq buffer (10 mM Tris ⁇ HCl, pH 8.0, 50 mM KCl, 1.5 mM MgCl 2 , 0.1% Triton X ⁇ 100).
  • 1X Taq buffer 10 mM Tris ⁇ HCl, pH 8.0, 50 mM KCl, 1.5 mM MgCl 2 , 0.1% Triton X ⁇ 100).
  • the PCR mix contained 10 ⁇ L of cell suspension and 40 ⁇ L master mix 1,4 ⁇ Butanediol (5% (v/v), 0.25 mm dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of primers ⁇ Taq Q1, Taq Q2 (Table 14), and 0.5X SYBR Green I.
  • Bio ⁇ Rad CFX96 TM Real ⁇ Time PCR Detection System to carryout PCR using the following program – 6 min at 95 o C followed by 16 cycles of 30 sec at 94°C, 30 sec at 57.8°C, and 30 sec at 72 o C.
  • N ⁇ 7 ⁇ 1 ⁇ E10 refers to a clone isolated from the epPCR library (N) after 7 CSR rounds on plate 1 in well E10; whereas L ⁇ 1 ⁇ 14 ⁇ H10 refers to a clone isolated from the shuffling library (L) after 1 CSR round on plate 14 in well H10.
  • Protein purification We introduced His ⁇ tag to the top ranked clones by PCR using Q5 site ⁇ directed mutagenesis kit (NEB). The primer (His ⁇ F and His ⁇ R) sequences are listed in Table 14. 72 Following transformation, we confirmed the His ⁇ tag by DNA sequencing. Single colonies expressing either WT polymerase or mutant derivatives were grown overnight at 37 o C in 5 ml LB ⁇ chloramphenicol.
  • the overnight grown cultures were re ⁇ inoculated into 200 ml of LB ⁇ chloramphenicol.
  • the protein expression was induced by anhydrotetracycline (300 ng/ml) once the OD 600 reached between 0.4 ⁇ 0.5.
  • the cells were harvested by centrifugation after 4 hours, washed once, and resuspended in 2.5 ml wash buffer (50 mM Tris ⁇ HCl, pH 7.9, 50 mM dextrose, 1 mM EDTA, 1 mM PMSF).
  • the cell suspensions were subjected to two cycles of freeze ⁇ thaw.
  • the partially lysed cells were incubated with 1 mg/ml lysozyme at room temperature for 15 min.
  • lysis buffer (10 mM Tris ⁇ HCl, pH 7.9, 50 mM KCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.5% Tween ⁇ 20, 0.5% Nonidet P40) was added; the sample was kept on ice for 30 min. The crude lysates were then incubated at 75 o C for 30 min followed by centrifugation to collect the supernatant. The nucleic acids were precipitated by streptomycin sulfate. The solution was centrifuged, and the supernatant was loaded onto an IMAC column.
  • the column was washed with equilibration buffer (10 mM Tris ⁇ HCl, pH 7.9, 50 mM KCl, 20 mM imidazole), and eluted with 10 mM Tris ⁇ HCl, pH 7.9, 50 mM KCl, 300 mM imidazole.
  • the proteins were dialyzed against dialysis buffer containing 20 mM Tris ⁇ HCl, pH 8.0, 1 mM DTT, 0.1 mM EDTA, 100 mM KCl, 0.5 % NP40, 0.5% Tween ⁇ 20 and 50% glycerol.
  • the polymerases were quantified using Bio ⁇ Rad’s DC protein assay.
  • 0.2 ng purified WT and its mutant derivatives were incubated with 100 nM SATP, 3 mM MgCl 2 , 250 ⁇ M dNTPs, 1x EvaGreen, and 0.5 ⁇ g/ ⁇ L BSA in 1x Taq buffer.
  • the primer extension reactions were carried out at 72 o C.
  • Half ⁇ lives of the enzymes were determined as described previously, except that we used EvaGreen based assay and utilized SATP to measure the remaining activity as described above.
  • Thermal unfolding analysis The thermal unfolding experiments of wild type polymerases as well as the variants (5 ⁇ M, in 20 mM Tris ⁇ HCl pH 8.0, 1 mM DTT, 0.1 mM EDTA, 100 mM KCl, and 5% glycerol) were performed using nano ⁇ scale Differential Scanning Fluorimetry (nanoDSF) on a Prometheus NT.48 instrument, with a high ⁇ temperature package and back ⁇ scatter optics, which allowed analysis of thermal unfolding and aggregation up to 110°C.
  • nanoDSF Nano ⁇ scale Differential Scanning Fluorimetry
  • Thermal denaturation of each protein was determined in triplicate by measuring changes in fluorescence at 330 and 350 nm over varying temperature, from 30°C to 110°C, with a heating speed of 1°C/min and with a 10% sensitivity setting (fluorescence excitation power). These measurements were completed in the presence of 5% BD. Experiments were performed, in triplicate, at 2Bind GmbH (https://2bind.com, Regensburg, Germany). The ratio of 350/330 nm and scattering data were analyzed using the PR. Stability Analysis software (v. 1.1, Nanotemper Technologies, Kunststoff Germany).
  • the minimization was performed for a total of 20,000 steps with the first 1000 steps of steepest descent followed by conjugate gradient algorithm for the remaining steps, within which the total energy of the complex was observed to become stable.
  • Two different DNA inputs were used in the NGS library preparation: a) using plasmid DNA ⁇ five high GC templates (c ⁇ Jun 63%, BEGAIN 71.3%, DACT3 79.2%, PO3F3 77.7%, and BAIP3 64.4%) were cloned into PUC18 plasmid and 5 ng of each prepared construct were pooled.
  • the five templates were coamplified with 7.25U of either WT, L ⁇ 5 ⁇ 2 ⁇ F01 or N ⁇ 7 ⁇ 3 ⁇ B07 mutant under the same conditions. 4% BD was used for WT enzyme and 10% BD was used for the mutants.
  • the reaction mixture contained 0.75 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , and 0.5 ⁇ M of each primer.
  • the following PCR programs were used: 98.3 o C for 1 min and 95 o C for 6 min, 25 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 50 sec.
  • the PCR products were run on 1% agarose gel and purified using Qiagen DNA Gel Extraction and purification Kit. Purified PCR products were sent to GENEWIZ for sequencing and library preparation as described above.
  • the Fastq raw sequencing data from GENEWIZ on Illumina platform were aligned to the targeted templates and read frequencies were determined for each template; b) using genomic DNA ⁇
  • the mutant enzymes N ⁇ 7 ⁇ 3 ⁇ B07 and N ⁇ 7 ⁇ 3 ⁇ C08 and WT were tested in NGS library preparation using 150 ng genomic DNA in absence and presence of 5% BD.
  • Three high GC templates (B3GT6 72%, CDN1C 78%, EGFR 60% and one low GC template (KRAS 40 %) were coamplified using gene ⁇ specific PCR primers under the same conditions. The following PCR cycles were used: 98°C for 3 min followed by 30 cycles of 30 sec at 95°C, 30 sec at 58.5°C, and 30 sec at 72°C.
  • the PCR products were purified with Monarch DNA Gel Extraction Kit (New England BioLabs) and eluted with 10 ⁇ L elution buffer.
  • the purified products were mixed and prepared with the Nextera XT library 77 prep kit (Illumina) according to manufacturer’s instructions.
  • the indexed libraries were subsequently purified with Illumina Purification Beads included in Nextera XT library prep kit (Illumina), and quantified using the Qubit High Sensitivity dsDNA Assay (Thermo Fisher Scientific, Waltham, MA). The average fragment size, defined as insert length plus adapter length, for each sample was calculated prior to pooling.
  • the pooled libraries were sequenced on an Illumina iSeq100 using a 2 x 150 bp paired ⁇ end sequencing protocol.
  • the raw sequencing data were demultiplexed and converted to Fastq files by iSeq100 Local Run Manager DNA Enrichment Analysis Module v2.0.1.5.
  • the reads were then aligned to human genome assembly 37/hg19 reference sequence by BWA ⁇ MEM.
  • qPCR efficiency and amplification of GC ⁇ rich templates To confirm the screening rank obtained from library screening and characterize the ability of engineered polymerases to amplify GC ⁇ rich templates, we used purified enzymes and performed the qPCR assay.
  • the PCR mix contained 1.25U of each enzyme in the presence of different concentrations of cosolvents (1,4 ⁇ Butanediol, or Pyrrolidone or Sulfolane), and 5 ng of Taq or GC ⁇ rich template.
  • the reaction mixture contained, 0.25 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of each primer ⁇ (Q1 and Q2 for Taq template; primers listed in Table 14 for GC ⁇ rich templates), and 0.5X SYBR Green I.
  • PCR cycles were used: 95 o C for 6 min followed by 30 cycles of 30 sec at 94°C, 30 sec at 59°C, and 30 sec at 72 o C.
  • Fig. 5 High denaturation temperature (98.3 o C for 1 min + 95 o C for 6 min followed by 25 cycles of 94 o C for 30 sec, 57 o C for 30 sec, 72 o C for 50 sec).
  • Moderate denaturation temperature (94 o C for 2 min followed by 30 cycles of 95 o C for 30 sec, 57 o C for 30 sec, 72 o C for 50 sec).
  • a final extension was done at 72 o C for 2 min before holding at 4 o C.
  • the PCR mix included 1X PCR buffer (Invitrogen), 1.5 mM MgCl 2 , 0.25 mM dNTPs, 25 ng human gDNA (Promega #G1471), 0.5 ⁇ M each forward and reverse primers, and 2.5 U of the polymerase.
  • the PCR products were resolved on 1% agarose gel.
  • Reverse transcription within droplets Total RNA from brain tissue (ThermoFisher AM7962) 5 ⁇ g was mixed with forward and reverse primers targeting the BEGAIN gene in Enzchek RT buffer. The RNA ⁇ primer mixture was then subjected to a dolomite microfluidic device to generate water ⁇ in ⁇ oil emulsion droplets.
  • the device produced approximately 3 million droplets with an average diameter of 20 ⁇ m and a total input volume of 100 ⁇ L.
  • Half of the generated droplets (50 ⁇ L) were transferred to a thermocycler and underwent reverse transcription and PCR amplification using the following protocol: 55°C for 30 minutes, followed by 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 40 seconds.
  • 2 ⁇ L of the post ⁇ PCR droplets were mixed with 2 ⁇ L of 2X concentrated Picogreen dye on a microscope slide. Following a 10 ⁇ minute incubation at room temperature, the sample was examined under a fluorescence microscope.
  • a 119 ⁇ nucleotide partial KRAS RNA (sequence: AGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAAUAGAGGAUUCCUACAGGAAG 79 CAAGUAGUAAUUGAUGGAGAAACCUGUCUCUUGGAUAUUCUCGACACAGCAGGUCAA) was synthesized by Genscript. Fifty picomoles of the KRAS RNA were mixed with 50 pmol of forward and reverse primers, and 0.5 mM dNTPs in EnzChek RT buffer. Different reverse transcriptases, either purified enzymes or unpurified preparations, were then added to the reaction mixture.
  • a ⁇ SFM4 ⁇ 6 40 ng, positive control
  • B, C D ⁇ 5 million bacterial cells expressing wild ⁇ type Taq
  • SFM4 ⁇ 6, and L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 were assigned different concentrations of 1,4 ⁇ butanediol (BD) (0%, 5%, 10%, 20%).
  • BD 1,4 ⁇ butanediol
  • the RT reaction mixture (final volume 20 ⁇ L) was then transferred to a PCR thermocycler and incubated at 80°C for 10 minutes followed by 55°C for 60 minutes. After the RT reaction, the samples were centrifuged before being used for the subsequent PCR step. PCR was carried out using the NEB LUNA PCR mix (Cat.
  • PCR was run in 5% BD ⁇ 95 o C for 6 min, followed by 16 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 30 sec, or in 7% BD ⁇ 98.3 o C for 1 min, 95 o C for 6 min, followed by 16 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 30 sec. In both cases, final extension was done at 72 o C for 2 min before holding at 4 o C.
  • Frequency of each unique mutation species within a region was calculated by dividing the number of reads of specific mutation by the total number of detected reads of sequences within that region and multiplying by 100 to yield percentage.
  • GC bias of GC ⁇ rich templates with engineered polymerases were PCR amplified together with either WT or L ⁇ 5 ⁇ 2 ⁇ F01 or N ⁇ 7 ⁇ 3 ⁇ B07 mutants under the same conditions.
  • Gene ⁇ specific primers (one set of FWD and REV for one template) were added in the PCR reactions.
  • A) The PCR mix contained 7.25U of each enzyme in the presence of BD and 5 ng of each template.
  • the reaction mixture contained 0.75 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of each primer.
  • B) The PCR mix contained 1.25U of each enzyme in the presence of BD and 5 ng of each template.
  • the reaction mixture contained 0.25 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of each primer.
  • the following PCR program were used for both Tables A and B: 98.3 o C for 1 min and 95 o C for 6 min, 25 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 50 sec.
  • PCR products were isolated from 1% agarose gel electrophoresis and subjected to NGS analysis. Percent frequency of each gene in the PCR pool was calculated from the total number of read sequences. More details of GC content (%) is presented in Fig. 11.
  • the Cq values for the WT and the top clones selected from generation 1 library (one clone from 1 st enrichment and three clones from 7 th enrichment round), two clones from generation 2 after the 5 th enrichment, and a synthetic clone SPC9 (Table 3).
  • the following PCR programs were used to amplify (A) WT ⁇ Taq template: 95 o C for 6 min, 16 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 60 sec, using Q1 and Q2 primers.
  • BD 1,4 ⁇ butanediol
  • Table 15 Reverse Transcriptases Developed Herein Table 15 provided non ⁇ limiting examples of reverse transcriptases having properties described herein. Sequence Listing Amino acid alterations/mutations SEQ ID NO: 1 WT ⁇ Taq DNA polymerase SEQ ID NO: 2 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations A97T, A608V, K702R, K762R, E742K, M747K SEQ ID NO: 3 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations A97T, A608V, K702R, K762R, and D732N SEQ ID NO: 4 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations A23P, L162P, 228V, L461R, A521V, E734G, F749I, L768M, E742K, and M747K SEQ ID NO: 5 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30
  • SEQ ID NO: 7 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742R, and M747R.
  • SEQ ID NO: 8 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742N, and M747N.
  • SEQ ID NO: 9 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742K, and M747R.
  • SEQ ID NO: 10 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742K, and M747N.
  • SEQ ID NO: 11 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742R, and M747K.
  • SEQ ID NO: 12 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742R, and M747N.
  • SEQ ID NO: 13 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742N, and M747K.
  • SEQ ID NO: 14 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742N, and E747R.
  • SEQ ID NO: 15 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, and D732N.
  • SEQ ID NO: 16 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742K, and M747K.
  • SEQ ID NO: 17 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742R, and M747R.
  • SEQ ID NO: 18 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742N, and M747N.
  • SEQ ID NO: 19 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742K, and M747R.
  • SEQ ID NO: 20 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742K, and M747N.
  • SEQ ID NO: 21 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742R, and M747K.
  • SEQ ID NO: 22 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742R, and M747N.
  • SEQ ID NO: 23 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742N, and M747K.
  • SEQ ID NO: 24 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, M742M, and E747R.
  • SEQ ID NO: 25 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, and D732N.
  • SEQ ID NO: 26 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742K, and M747K.
  • SEQ ID NO: 27 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742R, and M747R.
  • SEQ ID NO: 28 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742N, and M747N.
  • SEQ ID NO: 29 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742K, and M747R.
  • SEQ ID NO: 30 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742K, and M747N.
  • SEQ ID NO: 31 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E712R, and M747K.
  • SEQ ID NO: 32 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742R, and M747N.
  • SEQ ID NO: 33 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742N, and M747K.
  • SEQ ID NO: 34 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742N, and E747R.
  • SEQ ID NO: 35 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, and D732N.
  • SEQ ID NO: 36 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742K and M747K.
  • SEQ ID NO: 37 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742R, and M747R.
  • SEQ ID NO: 38 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, and E742N, and M747N.
  • SEQ ID NO: 39 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742K, and M747R.
  • SEQ ID NO: 40 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742K, and M747N.
  • SEQ ID NO: 41 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742R, and M747K.
  • SEQ ID NO: 42 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742R, and M747N.
  • SEQ ID NO: 43 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742N, and M747K.
  • SEQ ID NO: 45 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742N and E747R.
  • SEQ ID NO: 46 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, and D732.
  • SEQ ID NO: 47 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747K.
  • SEQ ID NO: 48 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747R.
  • SEQ ID NO: 49 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742N, and M747N.
  • SEQ ID NO: 50 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747R.
  • SEQ ID NO: 51 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747N.
  • SEQ ID NO: 52 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747K.
  • SEQ ID NO: 53 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747N.
  • SEQ ID NO: 54 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742N, and M747K.
  • SEQ ID NO: 55 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742N, and E747R.
  • SEQ ID NO: 56 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, and D732N.
  • SEQ ID NO: 57 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742K, and M747K.
  • SEQ ID NO: 58 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, M742R, and M747R.
  • SEQ ID NO: 59 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742N, and M747N.
  • SEQ ID NO: 60 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742K, and M747R.
  • SEQ ID NO: 61 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742K, and M747N.
  • SEQ ID NO: 62 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742R, and M747K.
  • SEQ ID NO: 63 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742R, and M747N.
  • SEQ ID NO: 64 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742N, and M747K.
  • SEQ ID NO: 65 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742N, and E747R.
  • SEQ ID NO: 66 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, and D732N.
  • SEQ ID NO: 67 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742K, and M747K.
  • SEQ ID NO: 68 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742R, and M747R.
  • SEQ ID NO: 69 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742N, and M747N.
  • SEQ ID NO: 70 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742K, and M747R.
  • SEQ ID NO: 71 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742K, and M747N.
  • SEQ ID NO: 72 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742R, and M747K.
  • SEQ ID NO: 73 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742R and M747N.
  • SEQ ID NO: 74 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742N, and M747K.
  • SEQ ID NO: 75 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742N, and E747R.
  • SEQ ID NO: 76 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, and D732N.
  • SEQ ID NO: 77 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742K, and M747K.
  • SEQ ID NO: 78 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742R, and M747R.
  • SEQ ID NO: 79 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742N, and M747N.
  • SEQ ID NO: 80 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742K, and M747R.
  • SEQ ID NO: 81 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742K, and M747N.
  • SEQ ID NO: 82 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742R, and M747K.
  • SEQ ID NO: 83 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742R, and M747N.
  • SEQ ID NO: 84 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742N, and M747K.
  • SEQ ID NO: 85 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742N, and E747R.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP24789679.8A 2023-04-13 2024-04-15 Zusammensetzungen und verfahren zur hochregulierung der reversen transkription und reduktion des sequenzbias in der rna-sequenzierung Pending EP4695384A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363459012P 2023-04-13 2023-04-13
PCT/US2024/024649 WO2024216275A2 (en) 2023-04-13 2024-04-15 Compositions and methods for upregulation of reverse transcription and reduction of sequence bias in rna sequencing

Publications (1)

Publication Number Publication Date
EP4695384A2 true EP4695384A2 (de) 2026-02-18

Family

ID=93060190

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24789679.8A Pending EP4695384A2 (de) 2023-04-13 2024-04-15 Zusammensetzungen und verfahren zur hochregulierung der reversen transkription und reduktion des sequenzbias in der rna-sequenzierung

Country Status (3)

Country Link
EP (1) EP4695384A2 (de)
CN (1) CN121693563A (de)
WO (1) WO2024216275A2 (de)

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003507072A (ja) * 1999-08-21 2003-02-25 アマシャム・バイオサイエンス・コーポレイション 耐塩性を改善した、E681にアミノ酸置換を有するTaqDNAポリメラーゼおよびその同族体
GB0022458D0 (en) * 2000-09-13 2000-11-01 Medical Res Council Directed evolution method
US20080171318A1 (en) * 2004-09-30 2008-07-17 Epigenomics Ag Epigenetic Methods and Nucleic Acids for the Detection of Lung Cell Proliferative Disorders
BRPI0613593A2 (pt) * 2005-07-08 2011-01-18 Univ Zuerich método de teste "phage display" filamentoso, vetor de fago ou de fagomìdeo e biblioteca de vetores de fago ou fagomìdeo
WO2009003211A1 (en) * 2007-06-29 2009-01-08 Newsouth Innovations Pty Limited Treatment of rheumatoid arthritis
CN103608467B (zh) * 2011-04-20 2017-07-21 美飒生物技术公司 用于核酸的振荡扩增反应
JP7067737B2 (ja) * 2015-11-27 2022-05-16 国立大学法人九州大学 Dnaポリメラーゼ変異体
IL268417B2 (en) * 2017-02-10 2025-05-01 Univ Rockefeller Methods for cell-type specific profiling to identify drug targets
US10768173B1 (en) * 2019-09-06 2020-09-08 Element Biosciences, Inc. Multivalent binding composition for nucleic acid analysis
CN113728115A (zh) * 2019-01-25 2021-11-30 格里尔公司 侦测癌症、癌症来源组织及/或癌症细胞类型
US20250388878A1 (en) * 2021-10-06 2025-12-25 5Prime Biosciences, Inc. Polymerases for mixed aqueous-organic media and uses thereof
CN116814584A (zh) * 2022-06-29 2023-09-29 武汉爱博泰克生物科技有限公司 一种Taq DNA聚合酶突变体及其应用

Also Published As

Publication number Publication date
WO2024216275A2 (en) 2024-10-17
WO2024216275A3 (en) 2025-04-10
CN121693563A (zh) 2026-03-17

Similar Documents

Publication Publication Date Title
JP7112456B2 (ja) バリアント検出のための方法
US9796965B2 (en) Use of Taq polymerase mutant enzymes for nucleic acid amplification in the presence of PCR inhibitors
JP2008511327A (ja) 単一プライマー核酸増幅法
US11118206B2 (en) Multiple stage isothermal enzymatic amplification
EP3167060B1 (de) Dna-amplifikationstechnologie
KR20120101278A (ko) C형 간염 바이러스 핵산을 증폭시키는 방법
US20220333183A1 (en) Assay methods and kits for detecting rare sequence variants
Nguyen et al. CRISPR-ENHANCE: An enhanced nucleic acid detection platform using Cas12a
Yang et al. A novel buffer system, AnyDirect, can improve polymerase chain reaction from whole blood without DNA isolation
US20250388878A1 (en) Polymerases for mixed aqueous-organic media and uses thereof
JP5239853B2 (ja) 変異遺伝子の検出方法
US7074558B2 (en) Nucleic acid amplification using an RNA polymerase and DNA/RNA mixed polymer intermediate products
JP2024538743A5 (de)
EP4695384A2 (de) Zusammensetzungen und verfahren zur hochregulierung der reversen transkription und reduktion des sequenzbias in der rna-sequenzierung
AU2020299621B2 (en) Oligonucleotides for use in determining the presence of Trichomonas vaginalis in a sample.
Song et al. Rapid and sensitive detection of fungicide-resistant crop fungal pathogens using an isothermal amplification refractory mutation system
Jothikumar et al. Development and evaluation of a ligation-free sequence-independent, single-primer amplification (LF-SISPA) assay for whole genome characterization of viruses
Kawai et al. Sensitive detection of EGFR mutations using a competitive probe to suppress background in the SMart Amplification Process
AU2025256175B2 (en) Oligonucleotides for use in determining the presence of trichomonas vaginalis in a sample
WO2021262013A1 (en) Bst-nec dna fusion polymerase for use in isothermal replication of specific sars cov-2 virus sequences
US20250034659A1 (en) Detection of multidrug-resistant mycobacterium tuberculosis using superselective primer-based real-time pcr assays
Lezhava et al. Detection of SNP by the isothermal smart amplification method
JP2013042732A (ja) 齧歯類コロナウイルスの検出方法
Low et al. Development of an in-house, one-step RT-qPCR mix and optimized MS2 detection primers for hepatitis A virus and norovirus detection in berries
Schoenike et al. Quantitative sense-specific determination of murine coronavirus RNA by reverse transcription polymerase chain reaction

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20251111

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR