EP4689058A1 - Bacteries clostridium modifiees produisant du propan-2-ol, preparation et utilisations de celles-ci - Google Patents

Bacteries clostridium modifiees produisant du propan-2-ol, preparation et utilisations de celles-ci

Info

Publication number
EP4689058A1
EP4689058A1 EP24722061.9A EP24722061A EP4689058A1 EP 4689058 A1 EP4689058 A1 EP 4689058A1 EP 24722061 A EP24722061 A EP 24722061A EP 4689058 A1 EP4689058 A1 EP 4689058A1
Authority
EP
European Patent Office
Prior art keywords
bacterium
propan
sequence
seq
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24722061.9A
Other languages
German (de)
English (en)
Inventor
Gwladys DA COSTA
Nicolas Lopes Ferreira
François WASELS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
IFP Energies Nouvelles IFPEN
Original Assignee
IFP Energies Nouvelles IFPEN
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by IFP Energies Nouvelles IFPEN filed Critical IFP Energies Nouvelles IFPEN
Publication of EP4689058A1 publication Critical patent/EP4689058A1/fr
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0095—Oxidoreductases (1.) acting on iron-sulfur proteins as donor (1.18)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/065—Ethanol, i.e. non-beverage with microorganisms other than yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/16—Butanols
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26—Ketones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/145—Clostridium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01002—Alcohol dehydrogenase (NADP+) (1.1.1.2), i.e. aldehyde reductase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01157—3-Hydroxybutyryl-CoA dehydrogenase (1.1.1.157)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y118/00—Oxidoreductases acting on iron-sulfur proteins as donors (1.18)
    • C12Y118/01—Oxidoreductases acting on iron-sulfur proteins as donors (1.18) with NAD+ or NADP+ as acceptor (1.18.1)
    • C12Y118/01003—Ferredoxin--NAD+ reductase (1.18.1.3)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to the genetic modification of bacteria of the genus Clostridium, typically solvent-producing bacteria of the genus Clostridium.
  • the inventors describe in particular methods, tools and kits allowing the elimination or modification of sequence(s) coding for, or controlling the transcription of sequence(s) coding for, an enzyme with 3-hydroxybutyryl-CoA dehydrogenase activity (Hbd), an NADPH-dependent alcohol dehydrogenase (BdhB) and/or a pyruvate NADP ferredoxin oxidoreductase, or allowing the addition of a sequence coding for a secondary alcohol dehydrogenase (Adh).
  • Hbd 3-hydroxybutyryl-CoA dehydrogenase activity
  • BdhB NADPH-dependent alcohol dehydrogenase
  • Adh pyruvate NADP ferredoxin oxidoreductase
  • the genetically modified bacteria thus obtained are also described as well as their uses, in particular for producing propan-2-ol or a mixture comprising propan-2-ol and ethanol.
  • Clostridium Gram-positive strict anaerobic bacilli, capable of forming endospores and belonging to the phylum Firmicutes. This genus contains many species studied because of their pathogenic nature or their industrial and medical interest.
  • the Clostridium species said to be of industrial interest, non-pathogenic, are capable of producing compounds of interest such as acids and solvents from a wide variety of sugars and substrates ranging from glucose to cellulose.
  • solvent-producing Clostridium bacteria (called "solventogenic” or “acidogenic”) is said to be biphasic. Acids are produced during the acidogenesis phase, which corresponds to the exponential growth phase.
  • Clostridium acetobutylicum is naturally capable of producing a mixture of ethanol, acetone and n-butanol during a fermentation called ABE ( Figure 1). Some strains of Clostridium beijerinckii are also capable of reducing all or part of the acetone to propan-2-ol. This is the case of strain DSM 6423 which has in its genome a gene (adh) (Ismail AA et al., 1993) encoding a secondary alcohol dehydrogenase catalyzing the reduction of acetone to propan-2-ol. C.
  • acetobutylicum is considered a model organism for the study of solventogenic microorganisms, because of the relatively high titres obtained during fermentations.
  • Many genetic tools have been specifically developed to perform metabolic engineering to reorient metabolic pathways. Lehmann and Lütke-Eversloh described in 2011 the construction of a ⁇ hbd mutant that no longer produces butyrate or butanol as final fermentation products, due to the absence of an enzyme with 3-hydroxybutyryl-CoA dehydrogenase activity in this mutant. The resulting mutant produces mainly ethanol, as well as a small amount of acetone.
  • Collas et al, Dusséaux et al, Lee et al described the heterologous expression of the adh gene of C.
  • the inventors describe, in the context of the present invention, bacteria of the genus Clostridium, typically solvent-forming bacteria, in particular mutants of C. acetobutylicum no longer producing butanol or butyrate and producing propan-2-ol or a mixture comprising propan-2-ol and ethanol with a C3/C2 ratio largely improved compared to the mutant ⁇ hbd described in the literature.
  • the inventors describe in particular a genetically modified bacterium, belonging to the genus Clostridium, in particular a solventogenic bacterium, whose hbd and bdhB genes have been inactivated.
  • This genetically modified bacterium is a bacterium not expressing the products of the hbd and bdhB genes, in particular the products of the genes of sequences SEQ ID NO: 39 and SEQ ID NO: 36, or expressing non-functional versions of said products.
  • These bacterial mutants are identified respectively in the present text as mutant ⁇ hbd and mutant ⁇ bdhB.
  • a particular bacterium described by the inventors in the present text further does not express the gene CA_C0764 of sequence SEQ ID NO: 37 or expresses a non-functional version thereof.
  • the bacterium not expressing the products of the hbd and bdhB genes, or expressing non-functional versions of said products can be advantageously used to obtain a bacterium not further expressing the CA_C0764 gene of sequence SEQ ID NO: 37 or expressing a non-functional version thereof.
  • Particularly preferred genetically modified bacteria according to the invention correspond to the strain identified in the present description as IFP 971 as registered on February 17, 2023 under the deposit number LMG P-32995 with the BCCM-LMG collection (also identified in the present text as “ ⁇ hbd ⁇ bdhB::adh ⁇ CA_C0764”), and to the strain identified in the present description as IFP 970 as registered on February 17, 2023 under the deposit number LMG P-32994 with the BCCM-LMG collection (also identified in the present text as “ ⁇ hbd ⁇ bdhB::adh”), usable for preparing a strain equivalent to strain IFP 971.
  • the invention also relates to any bacteria derived, cloned, mutant or genetically modified version thereof.
  • Another preferred genetically modified bacterium described by the inventors is the strain identified in the present description as IFP 969 as registered on February 17, 2023 under deposit number LMG P-32993 with the BCCM-LMG collection (also identified in the present text as “ ⁇ hbd”), usable for preparing strains equivalent to strains IFP 970 and IFP 971.
  • the description also relates to any bacteria derived, cloned, mutant or genetically modified version thereof.
  • the inventors further describe methods for producing a recombinant bacterium as described herein, in particular methods comprising the deletion or inactivation of the hbd and bdhB genes, and optionally furthermore of the CA_C0764 gene, so as to prevent or decrease the expression of corresponding functional proteins, preferably a method involving CRISPR-Cas technology, as well as the genetically modified bacteria obtainable by this method, of which the bacteria IFP 969, IFP 970 and IFP 971 are examples.
  • a genetically modified bacterium belonging to the genus Clostridium characterized in that it does not express the products of the hbd and/or bdhB genes, and optionally in addition of the CA_C0764 gene, or expresses a non-functional version of the products of the hbd and bdhB genes, and optionally in addition of the CA_C0764 gene, such as the strain IFP 971, for preparing a genetically modified bacterium according to the invention not expressing the products of the hbd, bdhB and CA_C0764 genes, or expressing non-functional versions thereof.
  • the inventors further describe the plasmids pGRNA- ⁇ hbd of sequence SEQ ID NO: 31, pGRNA- ⁇ bdhB::adh of sequence SEQ ID NO: 33 and pGRNA- ⁇ CA_C0764 of sequence SEQ ID NO: 35, as well as the use of one, several or all of them for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium so as to improve its capacity for producing propan-2-ol or a mixture of propan-2-ol and ethanol.
  • a method for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium, as well as the genetically modified bacterium of the genus Clostridium obtained using the method are also described.
  • This method comprises a step of transforming the bacterium by introducing into said bacterium a plasmid selected from the plasmid pGRNA- ⁇ hbd of sequence SEQ ID NO: 31, the plasmid pGRNA- ⁇ bdhB::adh of sequence SEQ ID NO: 33 and the plasmid pGRNA- ⁇ CA_C0764 of sequence SEQ ID NO: 35.
  • the inventors further describe the use of a bacterium according to the invention for producing a biosourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, in particular propan-2-ol or a mixture of propan-2-ol and ethanol.
  • a biosourced molecule for example a solvent, a biofuel or any (bio)chemical intermediate product, in particular propan-2-ol or a mixture of propan-2-ol and ethanol.
  • Such bacteria can be advantageously used for producing a solvent or a mixture of solvents, in particular on an industrial scale.
  • the invention also relates to a fermentation method involving the use of a genetically modified bacterium as described in the present text.
  • kits in particular a kit for transforming and preferably genetically modifying a bacterium belonging to the genus Clostridium, and a kit for producing a biosourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, using a bacterium belonging to the genus Clostridium, in particular propan-2-ol, or a mixture of propan-2-ol and ethanol, said kit comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention and ii) a preservation medium or a culture medium for said bacterium, in particular a suitable culture medium containing a sugar or a mixture of sugars, preferably a hexose and/or a pentose, even more preferably glucose and/or arabinose and/or xylose.
  • a suitable culture medium containing a sugar or a mixture of sugars, preferably a hexose and/or a pentose, even
  • acetobutylicum bacteria capable of producing propan-2-ol (also identified in the present text as "isopropanol") or a mixture of propan-2-ol and ethanol with C3/C2 ratios largely improved compared to the ratio likely to be obtained using the ⁇ hbd mutant known to those skilled in the art (described in 2011 by Lehmann and Lütke-Eversloh). In a preferred embodiment, these mutants no longer produce butanol or butyrate.
  • the inventors have discovered and thus show for the first time that the joint inactivation of the hbd genes encoding an enzyme with 3-hydroxybutyryl-CoA dehydrogenase activity and bdhB genes encoding a NADPH-dependent alcohol dehydrogenase combined with the heterologous expression of the product of the adh gene of C. beijerinckii DSM 6423 in C. acetobutylicum makes it possible to obtain a strain not only capable of producing propan-2-ol but of producing it in substantially greater quantities than is possible with a mutant expressing the product of the adh gene of C.
  • acetobutylicum DSM 792 does not make it possible to obtain an efficient producer of propan-2-ol.
  • An object described by the inventors thus relates to a genetically modified bacterium belonging to the genus Clostridium, in particular a species of Clostridium of industrial interest, in particular C. acetobutylicum, characterized in that i) it does not express the products of the hbd genes, preferably of sequence SEQ ID NO: 39 when the bacterium considered is C. acetobutylicum, and bdhB, preferably of sequence SEQ ID NO: 36 when the bacterium considered is C. acetobutylicum, or expresses non-functional versions thereof, and ii) it expresses the adh gene of C.
  • hbd gene relates in particular to the sequence SEQ ID NO: 39 (CA_C2708).
  • the term “hbd gene” also refers to variants of said sequence SEQ ID NO: 39, in particular variants having a sequence homology with said sequence SEQ ID NO: 39.
  • bdhB gene refers in particular to the sequence SEQ ID NO: 36 (CA_C3298) or a variant of said sequence, in particular a variant having a sequence homology with said sequence SEQ ID NO: 36.
  • CA_C0764 gene refers in particular to the sequence SEQ ID NO: 37 or a variant of said sequence, in particular a variant having a sequence homology with said sequence SEQ ID NO: 37.
  • a typical example of a variant according to the invention has a sequence homology with the sequence SEQ ID NO: 39, with SEQ ID NO: 36 or with the sequence SEQ ID NO: 37 of between 95% and 100%, and preferably between 96% and 100%.
  • the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37 and its variant are for example homologous to at least 95%, for example to at least 96%, to at least 97%, to at least 98%, or to at least 99%.
  • sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37 and its variant have sequences homologous to at least 96%, to at least 97%, or to at least 98%.
  • the term "hbd gene” also refers to a sequence encoding a functional fragment or variant of the protein (enzyme) (S)-3-hydroxybutyryl-CoA dehydrogenase (Hbd), in particular a protein capable of/capable of exerting an (S)-3-hydroxybutyryl-CoA dehydrogenase activity.
  • the term "hbd gene” also refers to a sequence encoding a functional fragment or variant of the Hbd protein, in particular a protein capable of/able to exert an (S)-3-hydroxybutyryl-CoA dehydrogenase activity.
  • the term “bdhB gene” also refers to a sequence encoding a functional fragment or variant of the NADPH-dependent Butanol dehydrogenase B (BdhB) protein (enzyme), in particular a protein capable of/able to exert an NADPH-dependent alcohol dehydrogenase activity.
  • the term “bdhB gene” also refers to a sequence encoding a functional fragment or variant of the BdhB protein, in particular a protein capable of/able to exert an NADPH-dependent alcohol dehydrogenase activity.
  • the term “CA_C0764 gene” also refers to a sequence encoding a functional fragment or variant of ferredoxin-NADP + oxidoreductase (CAC0764).
  • CAC0764 gene also refers to a sequence encoding a functional fragment or variant of the CAC0764 protein, in particular a protein capable of/able to exert a ferredoxin-NADP + oxidoreductase.
  • Adh gene also refers to a sequence encoding a functional fragment or variant of a NADP-dependent Isopropanol dehydrogenase (Adh) protein (enzyme), in particular a protein capable of/able to exert an enzymatic activity catalyzing the reduction of acetone to propan-2-ol.
  • Adh NADP-dependent Isopropanol dehydrogenase
  • the term “adh gene” also refers to a sequence encoding a functional fragment or variant of the Adh protein, in particular a protein capable of/able to exert an NADPH-dependent Isopropanol dehydrogenase activity.
  • this text refers to a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the products of the genes hbd, bdhB and/or CA_C0764, or expresses non-functional versions thereof
  • the expression "non-functional version of the gene product" hbd, bdhB or CA_C0764 denotes a protein, typically a protein identified in this text as "Hbd”, “BdhB” or “CAC0764", non-functional, ie, incapable of carrying out the function of the protein encoded by the wild version of the targeted gene.
  • bacteria of the genus Clostridium is meant in particular the species of Clostridium said to be of industrial interest, typically the solventogenic or acetogenic bacteria of the genus Clostridium.
  • the expression "bacteria of the genus Clostridium” includes wild bacteria as well as strains derived therefrom, genetically modified for the purpose of improving their performance.
  • Clostridium species of industrial interest or “Clostridium bacteria of industrial interest” is meant species capable of producing, by fermentation, solvents such as ethanol, butanol, acetone or isopropanol and/or acids such as butyric acid, acetic acid or lactic acid, from sugars or oses, typically from sugars comprising 5 carbon atoms such as xylose, arabinose or fructose, from sugars comprising 6 carbon atoms such as glucose or mannose, from polysaccharides or polysaccharides such as cellulose or hemicellulose, and/or from any other source of carbon assimilable and usable by bacteria of the genus Clostridium (CO, CO 2 , and methanol for example).
  • solvents such as ethanol, butanol, acetone or isopropanol and/or acids such as butyric acid, acetic acid or lactic acid
  • sugars or oses typically from sugars comprising 5 carbon atoms such as xy
  • solvent-producing bacteria of interest are bacteria of the genus Clostridium producing acetone, butanol, ethanol and/or isopropanol (propan-2-ol), such as strains identified in the literature as "ABE strain” [strains carrying out fermentations allowing the production of acetone, butanol and ethanol], "IBE strain” [strains carrying out fermentations allowing the production of isopropanol (or propan-2-ol) by reduction of acetone, butanol and ethanol] and "AIBE strain” [strains carrying out fermentations allowing the production of acetone, isopropanol (or propan-2-ol), butanol and ethanol].
  • ABE strain strainstrains carrying out fermentations allowing the production of acetone, butanol and ethanol
  • IBE strain strainstrains carrying out fermentations allowing the production of isopropanol (or propan-2-ol) by reduction of acetone, butanol and
  • Solvent-producing bacteria of the genus Clostridium may be selected, for example, from, but not limited to, C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum and C. tyrobutyricum, preferably from C. acetobutylicum, C. beijerinckii, C. butyricum, C. tyrobutyricum and C. cellulolyticum, and even more preferably from C. acetobutylicum and C.
  • the acetogenic bacteria of interest are bacteria producing acids and/or solvents from CO2 and H2.
  • Acetogenic bacteria of the genus Clostridium may be selected, for example, from C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes and C. carboxidivorans.
  • the bacterium of the genus Clostridium concerned is an "ABE strain", preferably the bacterium C. acetobutylicum, for example the strain DSM 792 (also referred to as strain ATCC 824 or LMG 5710) of C. acetobutylicum.
  • the bacterium of the genus Clostridium concerned is an "ABE strain", preferably the bacterium C. beijerinckii, for example the strain NCIMB 8052 of C. beijerinckii.
  • the bacterium of the genus Clostridium concerned is an "IBE strain", preferably a subclade of C. beijerinckii selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593 and NCCB 27006.
  • the bacterium according to the invention belonging to the genus Clostridium is a Clostridium bacterium of industrial interest, in particular a solventogenic bacterium, capable, in the wild state, of producing solvents and/or acids by fermentation from a carbon source, said carbon source being chosen for example from a sugar, CO, CO 2 , an alcohol, and an organic acid.
  • the carbon source is a sugar, in particular a sugar comprising 5 carbon atoms such as xylose or arabinose, a sugar comprising 6 carbon atoms such as glucose, fructose or mannose, or a polysaccharide or polysaccharide such as cellulose or hemicellulose.
  • a particularly preferred bacterium belongs to the species C. acetobutylicum and, as explained above, does not express the products of the genes of sequence SEQ ID NO: 39 (CA_2708) (or a sequence homologous to at least 95%, for example to at least 96%, at least 97% or at least 98% thereof), of sequence SEQ ID NO: 36 (CA_3298) (or a sequence homologous to at least 95%, for example to at least 96%, at least 97% or at least 98% thereof), and preferably of sequence SEQ ID NO: 37 (CA_0764) (or a sequence homologous to at least 95%, for example to at least 96%, at least 97% or at least 98% thereof), or expresses non-functional versions of said expression products.
  • This genetically modified bacterium further expresses the functional product of the C. beijerinckii adh gene of SEQ ID NO: 38.
  • the bacteria thus modified have the technical abilities described above, ie, they are capable of producing propan-2-ol (also identified in the present text as "isopropanol") or a mixture of propan-2-ol and ethanol. Some are capable of producing a mixture of propan-2-ol and ethanol with C3/C2 ratios largely improved compared to the ratio likely to be obtained using the ⁇ hbd mutant known to those skilled in the art (described in 2011 by Lehmann and Lütke-Eversloh). Such strains are characterized for the first time in the context of the present application.
  • a second strain was registered on February 17, 2023 under the deposit number LMG P-32994 with the BCCM-LMG collection (IFP 970, “ ⁇ hbd ⁇ bdhB::adh”).
  • the hbd and bdhB genes have been (jointly) inactivated.
  • This strain further expresses the adh gene.
  • the description also concerns any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the hbd and bdhB genes, or in which said genes have also been inactivated, and expressing a functional version of the adh gene product.
  • a third strain was registered on February 17, 2023 under the deposit number LMG P-32993 with the BCCM-LMG collection (IFP 969, “ ⁇ hbd”).
  • the hbd gene has been inactivated.
  • the description also relates to any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the hbd gene, or in which said gene has also been inactivated.
  • Another subject of the invention is the use of a bacterium according to the invention for producing propan-2-ol or a mixture comprising propan-2-ol and ethanol.
  • the bacterium according to the invention is for example capable of producing a ratio C3 (acetone + propan-2-ol) / C2 (ethanol) greater than 0.10, for example 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18 or 0.19.
  • the bacterium according to the invention is capable of producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio greater than or equal to 0.20, for example 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28 or 0.29, greater than or equal to 0.30, for example 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38 or 0.39, greater than or equal to 0.40, for example 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, or 0.49, greater than or equal to 0.50, for example 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, or 0.59, or greater than or equal to 0.60, for example 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, or 0.69, even more preferably greater than or equal to 0.70, for example 0.71, 0.72, 0.73, 0.
  • the genetically modified bacterium according to the invention can be advantageously used to produce a solvent, for example a biofuel, preferably propan-2-ol, or a mixture of solvents, for example a mixture of biofuels, preferably a mixture comprising propan-2-ol and ethanol, in particular on an industrial scale.
  • the invention also relates to a fermentation process, typically an industrial process, involving the use of a bacterium according to the invention. Thanks to the present invention, the production of propan-2-ol is not only made possible but also greatly facilitated, as well as that of a mixture comprising propan-2-ol and ethanol.
  • the present invention offers a welcome solution which makes it possible to optimize the production of propan-2-ol, and to obtain a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio greater than 0.10.
  • a genetically modified bacterium according to the invention can also be advantageously used to produce a biosourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, from a biomass or from a dedicated energy crop.
  • bio-sourced molecule means a molecule, of the alcohol or ketone type, the specificity of which is that the raw material used for its production must necessarily come from plant biomass, for example lignocellulosic biomass, and not from resources of fossil origin such as oil, coal or natural gas.
  • bio-sourced molecules capable of being produced using the present invention are ethanol (usable as biofuel), or else propan-2-ol, 1,3-butanediol and 2,3-butanediol.
  • the invention further relates to a method for producing a recombinant bacterium according to the invention, comprising the deletion or inactivation of the hbd, bdhB and/or CA_C0764 genes so as to prevent or reduce the expression of functional Hbd and BdhB proteins, and preferably also of CA_C0764. and the transformation and genetic modification of the bacterium so as to enable it to express a functional Adh protein.
  • the most efficient known modification methods for obtaining genetically modified strains are based on homologous recombination events, which make it possible to modify the genome in a precise and stable manner.
  • a particular production method according to the invention comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest.
  • nucleic acid means any natural, synthetic, semi-synthetic or recombinant DNA or RNA molecule, optionally chemically modified (i.e. comprising non-natural bases, modified nucleotides comprising for example a modified bond, modified bases and/or modified sugars), or optimized so that the codons of the transcripts synthesized from the coding sequences are the codons most frequently found in a bacterium of the genus Clostridium for use therein.
  • the optimized codons are typically codons rich in adenine ("A") and thymine (“T”) bases.
  • C cysteine
  • D aspartic acid
  • E glutamic acid
  • F phenylalanine
  • G glycine
  • H histidine
  • I isoleucine
  • K lysine
  • L leucine
  • M methionine
  • N asparagine
  • P proline
  • Q glutamine
  • R arginine
  • S serine
  • T threonine
  • V valine
  • W tryptophan
  • Y tyrosine.
  • the nucleic acid of interest comprises at least two complementary regions each of a target sequence, 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to said targeted DNA region/portion/sequence within the bacterial genome. These regions are capable of hybridizing to all or part of the complementary sequence of said region/portion/sequence, typically to a sequence as described above comprising at least 1 nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides.
  • the complementary regions of the target sequence present within the nucleic acid of interest can recognize, preferably target, the 5' and 3' flanking regions of the targeted sequence in a genetic modification tool known to those skilled in the art, typically any tool based on homologous recombination.
  • a portion of the nucleic acid of interest further recognizes (at least partially binds), and preferably targets, ie recognizes and allows the cutting, in the genome of a Clostridium bacterium of interest, of at least one strand i) of a target sequence, ii) of a sequence controlling the transcription of a target sequence, or iii) of a sequence flanking a target sequence.
  • the nucleic acid of interest comprises at least one complementary region of the target sequence identical to 100% or identical to at least 80%, preferably to 85%, 90%, 95%, 96%, 97%, 98% or 99% at least to the targeted DNA region/portion/sequence within the bacterial genome and is capable of hybridizing to all or part of the complementary sequence of said region/portion/sequence, typically to a sequence comprising at least 5 nucleotides, preferably at least 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 15 and 30 nucleotides, preferably to a sequence comprising 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.
  • the nucleic acid(s) of interest as described in the context of the present invention are capable of deleting said target sequence(s) from the genome of the bacterium or of modifying their expression, for example of modulating/regulating them, in particular of inhibiting them, preferably of modifying them so as to render said bacterium incapable of expressing one or more proteins, in particular one or more functional proteins, from said sequence(s).
  • the nucleic acid(s) of interest as described in the context of the present invention are capable of introducing a sequence of interest into the genome of the bacterium so as to render said bacterium capable of expressing one or more proteins, in particular one or more functional proteins, from said sequence(s).
  • nucleic acids of interest can be constructed by conventional techniques well known to those skilled in the art and can comprise one or more promoters, bacterial origins of replication (ORI sequences), termination sequences, selection genes, for example antibiotic resistance genes, and sequences ("flanked regions") allowing the targeted insertion of the cassette or vector.
  • ORI sequences of interest can for example be chosen from pIP404, pAM ⁇ 1, repH (origin of replication in C. acetobutylicum), ColE1 or rep (origin of replication in E. coli), or any other origin of replication allowing the maintenance of the vector, typically the plasmid, within a bacterial cell belonging to the genus Clostridium.
  • Termination sequences of interest may be chosen, for example, from those of the adc, thl genes, of the bcs operon, or of any other terminator, well known to those skilled in the art, allowing the termination of transcription within a bacterial cell belonging to the genus Clostridium.
  • Selection genes (resistance genes) of interest may be chosen from ermB, catP, bla, tetA, tetM, and/or any other gene for resistance to ampicillin, erythromycin, chloramphenicol, thiamphenicol, spectinomycin, tetracycline, or any other antibiotic, well known to those skilled in the art, which can be used to select bacteria of the genus Clostridium.
  • the nucleic acid of interest may be a natural, synthetic RNA or produced by a recombinant technique.
  • This nucleic acid of interest can be prepared by any method known to those skilled in the art such as, for example, chemical synthesis, in vivo transcription or amplification techniques.
  • RNA molecules mature or precursors
  • gRNA guide RNA
  • these Molecules may contain modified nucleotides or chemical modifications enabling them, for example, to increase their resistance to nucleases and thus increase their lifespan in the cell.
  • They may in particular comprise at least one modified or non-natural nucleotide such as, for example, a nucleotide comprising a modified base, such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2,6-purine, bromo-5-deoxyuridine or any other modified base enabling hybridization.
  • a modified base such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2,6-purine, bromo-5-deoxyuridine or any other modified base enabling hybridization.
  • nucleic acids of interest used according to the invention can also be modified at the level of the internucleotide bond as are for example phosphorothioates, H-phosphonates or alkyl-phosphonates, or at the level of the skeleton as are for example alpha-oligonucleotides, 2'-O-alkyl riboses or PNA (Peptide Nucleic Acids) (Egholm et al., 1992).
  • a particular example of a nucleic acid of interest, used to transform and/or genetically modify a bacterium of interest is a DNA fragment i) recognizing a coding sequence, ii) controlling the transcription of a coding sequence, or iii) flanking a coding sequence, the enzyme Hbd (3-hydroxybutyryl-CoA dehydrogenase), the enzyme BdhB (NADPH-dependent alcohol dehydrogenase) or the pyruvate NADP ferredoxin oxidoreductase, or the protein Adh (secondary alcohol dehydrogenase).
  • Hbd 3-hydroxybutyryl-CoA dehydrogenase
  • BdhB NADPH-dependent alcohol dehydrogenase
  • Adh secondary alcohol dehydrogenase
  • a nucleic acid of particular interest described by the inventors is for example a vector, preferably a plasmid, for example the plasmid pGRNA- ⁇ hbd of sequence SEQ ID NO: 31, the plasmid pGRNA- ⁇ bdhB::adh of sequence SEQ ID NO: 33 or the plasmid pGRNA- ⁇ CA_C0764 of sequence SEQ ID NO: 35, described in the experimental part of the present description.
  • the or one of the recognized sequences is preferably one of the sequences SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37 corresponding to the hbd, bdhB and CA_C0764 genes respectively encoding the Hbd protein, the BdhB protein and the CAC0764 protein, or an amino acid sequence identical to at least 70%, 75%, 80%, 85%, 90% or 95% to said protein, or a sequence comprising all or at least 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37.
  • the recognized sequence may be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides of the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37.
  • the target sequence may also be a sequence controlling the transcription of a coding sequence as described above, typically a promoter sequence, for example the promoter sequence of the “hbd” gene (CA_C2708, SEQ ID NO: 39), that of the “bdhB” gene (CA_C3298, SEQ ID NO: 36) or that of the gene “CA_C0764” (SEQ ID NO: 37).
  • the nucleic acid of interest then recognizes, and is thus typically capable of binding to, a sequence controlling the transcription of a coding sequence as described above.
  • the target sequence may be a sequence flanking a coding sequence as described above, for example a sequence flanking the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37, or a sequence at least 70% identical thereto.
  • flanking sequence typically comprises 1, 10 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides, between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 15 and 40 nucleotides, between 15 and 30 nucleotides or between 15 and 20 nucleotides.
  • the target sequence corresponds to the pair of sequences flanking such a coding sequence, each flanking sequence typically comprising at least 20 nucleotides, typically between 100 and 1000 nucleotides, preferably between 200 and 800 nucleotides.
  • the method according to the invention for producing a recombinant bacterium comprises transforming the bacterial cell using at least one nucleic acid of interest, for example one, two, three or four nucleic acids of interest as described above, said nucleic acid(s) of interest being capable i) of recognizing (and capable of binding at least in part) a sequence coding, controlling the transcription of a sequence coding, or flanking a sequence coding, the Hbd protein, ii) of recognizing (and capable of binding at least in part) a sequence coding, controlling the transcription of a sequence coding, or flanking a sequence coding, the BdhB protein, and preferably iii) of recognizing (and capable of binding at least in part) a sequence coding, controlling the transcription of a sequence coding, or flanking a sequence coding, the CAC0764 protein.
  • nucleic acid(s) of interest being capable i) of recognizing (and capable of binding at least in part) a sequence coding, controlling the transcription
  • the nucleic acid of interest as described in the context of the present invention is preferably capable of deleting said target sequence from the genome of the bacteria or of modifying its expression, for example of modulating/regulating it, in particular of inhibiting it, preferably of modifying it so as to render said bacteria incapable of expressing a protein (typically an Hbd, BdhB or CAC0764 protein), in particular a functional protein, from said sequence.
  • a protein typically an Hbd, BdhB or CAC0764 protein
  • the nucleic acid of interest is capable of modifying the bacteria so as to render it incapable of expressing one and/or the other of the Hbd, BdhB or CAC0764 proteins.
  • Another example of nucleic acid of interest is the sequence coding for the Adh protein.
  • the description more particularly relates to the use of the plasmid pGRNA- ⁇ hbd of sequence SEQ ID NO: 31, of the plasmid pGRNA- ⁇ bdhB::adh of sequence SEQ ID NO: 33 and/or of the plasmid pGRNA-CA_C0764 of sequence SEQ ID NO: 35 to transform, and preferably genetically modify a bacterium of the genus Clostridium so as to improve its capacity to produce propan-2-ol or a mixture of propan-2-ol and ethanol.
  • a method for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium characterized in that it comprises a step of transforming the bacterium by introducing into said bacterium a plasmid as described in the present text, preferably a plasmid selected from the plasmid pGRNA- ⁇ hbd of sequence SEQ ID NO: 31, the plasmid pGRNA- ⁇ bdhB::adh of sequence SEQ ID NO: 33 or the plasmid pGRNA- ⁇ CA_C0764 of sequence SEQ ID NO: 35.
  • the description also relates to any genetically modified bacterium of the genus Clostridium obtained using such a method.
  • nucleic acid of interest can be carried out by any method, direct or indirect, known to those skilled in the art, for example by transformation, conjugation, microinjection, transfection, electroporation, etc., preferably by electroporation (Mermelstein et al, 1993).
  • these nucleic acids of interest for example DNA fragments, RNA fragments, expression cassettes or expression vectors
  • the method for transforming, and preferably genetically modifying, a bacterium as described in the present text comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest according to the invention as described above and involves a genetic modification tool, for example a genetic modification tool selected from a CRISPR tool, an insertional mutagenesis tool, for example based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool).
  • a genetic modification tool for example a genetic modification tool selected from a CRISPR tool, an insertional mutagenesis tool, for example based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool).
  • the method for transforming, and preferably further genetically modifying, a Clostridium bacterium may further comprise a step of obtaining, recovering, selecting or isolating the transformed bacterium, i.e. the bacterium exhibiting the desired recombination(s)/modification(s)/optimization(s).
  • the method according to the invention is based on the use of (implements) the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology/genetic tool, in particular the CRISPR-Cas (CRISPR-associated protein) genetic tool.
  • the present invention can be implemented using a conventional CRISPR-Cas genetic tool using a single plasmid comprising a nuclease, a gRNA and a repair template as described by Wang et al. (2015).
  • a person skilled in the art can easily define the sequence and structure of the gRNAs according to the chromosomal region or the mobile genetic element to be targeted using well-known techniques (see for example the article by DiCarlo et al., 2013).
  • the inventors have otherwise developed and described a genetic tool for modifying bacteria, adapted to bacteria of the genus Clostridium, usable in the context of the present invention, based on the use of two plasmids (cf.
  • the method according to the invention is based on the use of insertional mutagenesis tools, for example the use of type II introns, and for example implements the ClosTron® technology/genetic tool or the Targetron® genetic tool.
  • the Targetron® technology is based on the use of a reprogrammable group II intron (based on the Ll.ltrB intron of Lactococcus lactis), capable of integrating the bacterial genome rapidly at a desired locus (Chen et al., 2005, Wang et al., 2013), typically for the purpose of inactivating a targeted gene.
  • ClosTron® technology is based on a similar approach, supplemented by the addition of a selection marker in the intron sequence (Heap et al., 2007). This marker makes it possible to select the integration of the intron into the genome, and therefore facilitates the obtaining of the desired mutants. This genetic system also exploits type I introns.
  • the selection marker (called RAM for retrotransposition-activated marker) is interrupted by such a genetic element, which prevents its expression from the plasmid (a more precise description of the system: Zhong et al.).
  • the splicing of this genetic element occurs before integration into the genome, which makes it possible to obtain a chromosome presenting an active form of the resistance gene.
  • An optimized version of the system comprises FLP/FRT sites upstream and downstream of this gene, which allows the use of the FRT recombinase to eliminate the resistance gene (Heap et al., 2010).
  • the method according to the invention is based on the use of an allelic exchange tool, and for example implements the ACE® technology/genetic tool.
  • the ACE® technology is based on the use of an auxotrophic mutant (for uracil in C. acetobutylicum ATCC 824 by deletion of the pyrE gene, which also causes resistance to 5-fluoroorotic acid (5-FOA); Heap et al., 2012).
  • the system uses the allelic exchange mechanism, well known to those skilled in the art. Following transformation with a pseudo-suicide vector (with very low copies), the integration of the latter into the bacterial chromosome by a first allelic exchange event can be verified using the resistance gene initially present on the plasmid.
  • the integration step can be carried out in two different ways, either within the pyrE locus or within another locus.
  • the pyrE gene is also placed on the plasmid, but without being expressed (no functional promoter).
  • the second recombination restores a functional pyrE gene and can then be selected by auxotrophy (minimal medium, not containing uracil). Since the non-functional pyrE gene also has a selectable characteristic (sensitivity to 5-FOA), other integrations can then be envisaged on the same model, by successively alternating the state of pyrE between functional and non-functional.
  • a genomic area allowing expression of the counter-selection marker after recombination is targeted. (typically, in operon after another gene, preferably a highly expressed gene).
  • This second recombination is then selected by auxotrophy (minimal medium not containing uracil).
  • auxotrophy minimum medium not containing uracil
  • the targeted sequence is typically one of the sequences described in the present text.
  • the invention further relates to a kit for transforming and/or genetically modifying a bacterium of the genus Clostridium comprising at least one nucleic acid of interest as described in the present text (for example two or three nucleic acids of interest, typically DNA fragments, each recognizing a target sequence) for transforming and preferably genetically modifying a bacterium of the genus Clostridium, and optionally one or more selection molecules.
  • a kit for transforming and/or genetically modifying a bacterium of the genus Clostridium comprising at least one nucleic acid of interest as described in the present text (for example two or three nucleic acids of interest, typically DNA fragments, each recognizing a target sequence) for transforming and preferably genetically modifying a bacterium of the genus Clostridium, and optionally one or more selection molecules.
  • a particular kit comprises the essential elements for the operation of a CRISPR tool (typically at least one nucleic acid usable as gRNA, one nucleic acid usable as a repair template, at least one pair of primers, and an inducer allowing the expression of a nuclease, in particular a Cas9 or Cas12 type nuclease, for example MAD7), the essential elements for the operation of a tool based on the use of type II introns (typically at least one type II intron, at least one pair of primers and an inducer allowing the expression of a reverse transcriptase, for example type LtrA RT or Tel4c RT), or the essential elements for the operation of an allelic exchange tool (typically at least two nucleic acids usable as a homologous recombination template, and at least one pair of primers).
  • a CRISPR tool typically at least one nucleic acid usable as gRNA, one nucleic acid usable as a repair template, at least one
  • kits according to the invention may further comprise one or more consumables such as a preservation medium or a culture medium, at least one competent bacterium of the genus Clostridium (i.e. conditioned for transformation), or an explanatory note.
  • the invention typically relates to a kit for implementing a method of transformation and/or genetic modification described in the present text using a bacterium of the genus Clostridium.
  • the invention relates in particular to the genetically modified bacterium belonging to the genus Clostridium having the essential characteristic i) of not expressing the products of the hbd and bdhB genes, and preferably CA_C0764, or of expressing non-functional versions thereof, and ii) of expressing the adh gene, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, and their uses.
  • strain IFP 969 (“ ⁇ hbd”), registered on February 17, 2023 under deposit number LMG P-32993 with the BCCM-LMG collection, in which the hbd gene has been inactivated, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the hbd gene, or in which said gene has also been inactivated preferably using CRISPR technology.
  • strain IFP 970 (“ ⁇ hbd ⁇ bdhB::adh”), registered on February 17, 2023 under deposit number LMG P-32994 with the BCCM-LMG collection, in which the hbd and bdhB genes have been inactivated and expressing the adh gene product, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the hbd and bdhB genes, or in which said genes have also been inactivated, and expressing the adh gene product.
  • a genetically modified bacterium belonging to the genus Clostridium characterized in that it does not express the products of the hbd gene, or expresses a non-functional version of the products of the hbd gene, for example the strain IFP 969, registered on February 17, 2023 under the deposit number LMG P-32993 with the BCCM-LMG collection, to prepare a genetically modified bacterium according to the invention not expressing the products of the hbd and bdhB genes, or expressing non-functional versions thereof, and expressing the product of the adh gene.
  • strain IFP 971 (“ ⁇ hbd ⁇ bdhB::adh ⁇ CA_C0764”), registered on February 17, 2023 under deposit number LMG P-32995 with the BCCM-LMG collection, in which the hbd, bdhb and CA_C0764 genes have been inactivated and expressing the adh gene product, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the hbd, bdhb and CA_C0764 genes, or in which said genes have also been inactivated, and expressing the adh gene product.
  • a genetically modified bacterium belonging to the genus Clostridium characterized in that it does not express the products of the hbd and bdhB genes, or expresses a non-functional version of the products of the hbd and bdhB genes, and expressing the product of the adh gene, for example the strain IFP 970, registered on February 17, 2023 under the deposit number LMG P-32994 with the BCCM-LMG collection, to prepare a genetically modified bacterium according to the invention not expressing the products of the hbd, bdhB and CA_C0764 genes, or expressing non-functional versions thereof, and expressing the product of the adh gene.
  • the invention further relates to a kit for producing a bio-sourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, using a bacterium belonging to the genus Clostridium, comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention, for example IFP 969, IFP 970 or IFP 971, and ii) a medium, typically a preservation medium or a culture medium for said bacterium.
  • the kit may further comprise an explanatory note.
  • the preservation or culture medium for the genetically modified bacterium (belonging to the genus Clostridium) according to the invention present in the kit is preferably supplemented with a carbon source composed of glucose and/or at least one pentose, preferably i) glucose and/or ii) arabinose and/or i) xylose.
  • This medium preferably comprises between 0.1 and 250 g/L, more preferably between 1 and 100 g/L, of said carbon source (composed of glucose and/or arabinose and/or xylose).
  • the conservation or culture medium of the genetically modified bacteria is preferably an RCM type culture medium, more preferably a GAPES type culture medium, even more preferably a CGM type culture medium.
  • the invention also relates to a particular kit for producing a solvent or a biofuel, or a mixture of solvents or biofuels, in particular propan-2-ol or a mixture comprising propan-2-ol and ethanol, using a bacterium belonging to the genus Clostridium, said kit comprising i) a bacterium (belonging to the genus Clostridium) genetically modified according to the invention, characterized in that it does not express the products of the hbd, bdhB and/or CA_C0764 genes, or expresses non-functional versions thereof, and ii) a culture medium, preferably an RCM-type culture medium, more preferably a GAPES-type culture medium, even more preferably a CGM-type culture medium, containing at least one carbon source, preferably glucose and/or arabinose and/or xylose.
  • a culture medium preferably an RCM-type culture medium, more preferably a GAPES-type culture medium, even more preferably
  • the invention further relates to the possible uses of the method or kit according to the invention for transforming and/or genetically modifying a bacterium of the genus Clostridium, typically a solvent-forming bacterium of the genus Clostridium, for example for generating improved variants of said bacterium.
  • a bacterium of the genus Clostridium typically a solvent-forming bacterium of the genus Clostridium
  • it relates to the possible uses of the method, the kit or a bacterium of the genus Clostridium transformed and preferably genetically modified according to the invention, in particular for enabling the production of biosourced molecules, for example solvent(s), biofuel(s) or (bio)chemical intermediate product(s), or mixtures thereof, typically on an industrial scale.
  • biosourced molecules for example solvent(s), biofuel(s) or (bio)chemical intermediate product(s), or mixtures thereof
  • FIGURE Figure 1 represents the central metabolism of C. acetobutylicum.
  • C. acetobutylicum produces acetate, butyrate and possibly lactate during acidogenesis.
  • Escherichia coli NEB 10-beta (New England Biolabs, NEB) was grown at 37°C under aerobic conditions in LB medium (tryptone 10 gL -1 , yeast extract 5 gL -1 , NaCl 10 gL -1 ). Solid media were made by adding 15 gL -1 of agarose to liquid media. If necessary, erythromycin (Em, 40 mg.L -1 ) and/or thiamphenicol (Tm, 15 mg.L -1 ) were used for C. acetobutylicum cultures.
  • Em erythromycin
  • Tm 15 mg.L -1
  • pCas9 acr (SEQ ID NO: 27) ermB, ColE1, pCB102, Pcm- tetO2/1-cas9, Pbgal-acrIIA4, tetR, bgaR (Wasels F. et al., 2020) pGRNAind (SEQ ID NO: 28) catP, ColE1, pIP404, gRNA expression cassette (Pcm-2tetO1 promoter) (Wasels F. et al., 2020) pAN2 (SEQ ID NO: 29) tetA, p15A ori, ⁇ 3TI (Heap JT et al.
  • pGRNA-hbd (SEQ ID NO: 30) Derivative of pGRNAind, targeting hbd pGRNA- ⁇ hbd (SEQ ID NO: 31) Derivative of pGRNA-hbd, with ⁇ hbd editing template pGRNA-bdhB (SEQ ID NO: 32) Derivative of pGRNA ind , targeting bdhB (Wasels F.
  • pGRNA- ⁇ bdhB::adh (SEQ ID NO: 33) Derived from pGRNA-bdhB, with editing template ⁇ bdhB::adh pGRNA-CA_C0764 (SEQ ID NO: 34) Derived from pGRNA ind , targeting CA_C0764 pGRNA- ⁇ CA_C0764 (SEQ ID NO: 35) Derived from pGRNA-bdhC, with editing template ⁇ CA_C0764 a ermB, erythromycin resistance gene; catP, thiamphenicol and chloramphenicol resistance gene; tetA, tetracycline resistance gene; ColE1 and p15A ori, origins of replication in E.
  • coli coli; pIP404, pAMB1 and pCB102, origins of replication in C. acetobutylicum.
  • the manipulated nucleic acids were purified using the QIAquick PCR Purification Kit (Qiagen), QIAprep Spin Miniprep Kit (Qiagen) and GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich). PCR amplifications were performed with Q5 High-Fidelity DNA Polymerase (NEB). The oligonucleotides used for plasmid construction are presented in Table 2 below.
  • Table 3 Locus Oligonucleotide Sequence (5'-3') hbd P19 (SEQ ID NO: 19) GTAATATTATAGCAGCTATTTTAAGTTTAC P20 (SEQ ID NO: 20) AAAGGTAAGGAAATGGCTGAG bdhB P21 (SEQ ID NO: 21) ACACATTGAAGGGAGCTTTT P22 (SEQ ID NO: 22) GGCAACAACATCAGGCCTTT CA_C0764 P25 (SEQ ID NO: 23) TGTTCATCGGTAACCTGTTCA P26 (SEQ ID NO: 24) ACGAAATGCCCAACTTGCAA
  • Other genetic tools such as those based on homologous recombination or the insertion of mobile genetic elements, can make it possible to obtain mutants with equivalent genotypes, i.e.
  • a mutant derived from ⁇ hbd producing isopropanol in the absence of selection pressure a ⁇ hbd mutant ⁇ bdhB::adh was constructed.
  • the bdhB gene (SEQ ID NO: 36) encodes a NADPH-dependent alcohol dehydrogenase.
  • the fermentation performances of this mutant are presented in Table 6 below.
  • Table 7 Strains Solvents (gL -1 ) C3/C2 Ratio Ethanol Acetone Propan-2-ol Total ⁇ hbd 33.3 ⁇ 1.3 2.9 ⁇ 0.2 0.0 ⁇ 0.0 36.3 ⁇ 1.5 0.09 ⁇ hbd 27.9 ⁇ 1.7 0.1 ⁇ 0.0 7.2 ⁇ 0.5 35.2 ⁇ 2.2 0.26 ⁇ bdhB ::adh ⁇ hbd 17.9 ⁇ 0.6 4.3 ⁇ 0.1 9.7 ⁇ 0.2 32.0 ⁇ 0.9 0.78 ⁇ bdhB ::adh ⁇ CA_C0764 Acids (gL -1 ) Acetic Ac. Butyric Ac.
  • this mutant produces a greater quantity of propan-2-ol than the DSM 792 strain containing the plasmid pFC002 (Table 6).
  • Conclusions The results presented in this example describe the production of C. acetobutylicum mutants that no longer produce butanol or butyrate and produce a propan-2-ol/ethanol mixture with an advantageous C3/C2 ratio, largely improved compared to the ⁇ hbd mutant described in the literature.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne la modification génétique de bactéries du genre Clostridium, typiquement de bactéries solvantogènes du genre Clostridium, de manière à permettre la production de propan-2-ol ou d'un mélange comprenant du propan-2-ol et de l'éthanol par lesdites bactéries. Sont en outre décrits des méthodes, outils et kits permettant l'obtention desdites bactéries, les bactéries génétiquement modifiées obtenues et leurs utilisations.

Description

BACTERIES CLOSTRIDIUM MODIFIEES PRODUISANT DU PROPAN-2-OL, PREPARATION ET UTILISATIONS DE CELLES-CI La présente invention concerne la modification génétique de bactéries du genre Clostridium, typiquement de bactéries solvantogènes du genre Clostridium. Les inventeurs décrivent en particulier des méthodes, outils et kits permettant l’élimination ou la modification de séquence(s) codant, ou contrôlant la transcription de séquence(s) codant, une enzyme à activité 3-hydroxybutyryl-CoA déshydrogénase (Hbd), une alcool déshydrogénase NADPH-dépendante (BdhB) et/ou une pyruvate NADP ferrédoxine oxydoréductase, ou permettant l’ajout d’une séquence codant une alcool-déshydrogénase secondaire (Adh). Les bactéries génétiquement modifiées ainsi obtenues sont également décrites de même que leurs utilisations, en particulier pour produire du propan-2-ol ou un mélange comprenant du propan-2-ol et de l’éthanol. ARRIERE-PLAN TECHNOLOGIQUE Les bactéries appartenant au genre Clostridium sont des bacilles anaérobies strictes à Gram positif, capables de former des endospores et appartenant au phylum des Firmicutes. Ce genre contient de nombreuses espèces étudiées en raison de leur caractère pathogène ou de leur intérêt industriel et médical. Les espèces de Clostridium dites d’intérêt industriel, non pathogènes, sont capables de produire des composés d’intérêt tels que des acides et solvants à partir d'une large variété de sucres et substrats allant du glucose à la cellulose. La croissance des bactéries Clostridium productrices de solvants (dites « solvantogènes » ou « acidogènes ») est dite biphasique. Des acides sont produits lors de la phase d’acidogenèse, qui correspond à la phase exponentielle de croissance. Lorsque la croissance cellulaire cesse et que les bactéries entrent en phase stationnaire, elles entrent en phase de solvantogenèse, réassimilent les acides produits et les transforment en solvants. Clostridium acetobutylicum est naturellement capable de produire un mélange d’éthanol, d’acétone et de n-butanol au cours d’une fermentation dite ABE (Figure 1). Certaines souches de Clostridium beijerinckii sont également capables de réduire tout ou partie de l'acétone en propan-2-ol. C’est le cas de la souche DSM 6423 qui possède dans son génome un gène (adh) (Ismail AA et al., 1993) codant une alcool- déshydrogénase secondaire catalysant la réduction de l'acétone en propan-2-ol. C. acetobutylicum est considéré comme un organisme modèle pour l’étude des micro-organismes solvantogènes, en raison des titres relativement élevés obtenus lors de fermentations. De nombreux outils génétiques ont été spécifiquement développés afin de réaliser de l’ingénierie métabolique permettant la réorientation de ses voies métaboliques. Lehmann et Lütke-Eversloh ont ainsi décrit en 2011 la construction d’un mutant ∆hbd ne produisant plus de butyrate ni de butanol comme produits finaux de fermentation, du fait de l’absence d’enzyme à activité 3-hydroxybutyryl-CoA déshydrogénase dans ce mutant. Le mutant obtenu produit principalement de l’éthanol, ainsi qu’une faible quantité d’acétone. En parallèle, Collas et al, Dusséaux et al, Lee et al ont décrit l’expression hétérologue du gène adh de C. beijerinckii DSM 6423 dans C. acetobutylicum afin d’obtenir un micro-organisme produisant un mélange d’éthanol, de propan-2- ol et de n-butanol (Collas F. et al., 2012 ; Dusséaux S. et al., 2013 ; Lee J. et al., 2012). Les inventeurs décrivent dans le contexte de la présente invention la combinaison de modifications génétiques permettant la création d’une souche produisant un mélange d’éthanol et de propan-2-ol, ainsi que des modifications génétiques et outils permettant, de manière surprenante, d’améliorer avantageusement les ratios (acétone + propan-2-ol) / éthanol (ratio C3/C2), par rapport à un mutant simple ∆hbd exprimant le gène adh. RESUME DE L’INVENTION Les inventeurs décrivent, dans le contexte de la présente invention, des bactéries du genre Clostridium, typiquement les bactéries solvantogènes, en particulier des mutants de C. acetobutylicum ne produisant plus de butanol ni de butyrate et produisant du propan-2-ol ou un mélange comprenant du propan-2-ol et de l’éthanol avec un ratio C3/C2 largement amélioré par rapport au mutant ∆hbd décrit dans la littérature. Les inventeurs décrivent en particulier une bactérie génétiquement modifiée, appartenant au genre Clostridium, en particulier une bactérie solvantogène, dont les gènes hbd et bdhB ont été inactivés. Cette bactérie génétiquement modifiée est une bactérie n’exprimant pas les produits des gènes hbd et bdhB, en particulier les produits des gènes de séquences SEQ ID NO : 39 et SEQ ID NO : 36, ou exprimant des versions non fonctionnelles desdits produits. Ces mutants bactériens sont identifiés respectivement dans le présent texte en tant que mutant Δhbd et mutant ΔbdhB. Une bactérie particulière décrite par les inventeurs dans le présent texte n’exprime en outre pas le gène CA_C0764 de séquence SEQ ID NO : 37 ou exprime une version non fonctionnelle de celui-ci. La bactérie n’exprimant pas les produits des gènes hbd et bdhB, ou exprimant des versions non fonctionnelles desdits produits, peut être avantageusement utilisée pour obtenir une bactérie n’exprimant en outre pas le gène CA_C0764 de séquence SEQ ID NO : 37 ou exprimant une version non fonctionnelle de celui-ci. Des bactéries génétiquement modifiées particulièrement préférées selon l’invention correspondent à la souche identifiée dans la présente description en tant que IFP 971 telle qu’enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32995 auprès de la collection BCCM-LMG (également identifié dans le présent texte en tant que « Δhbd ΔbdhB::adh ΔCA_C0764 »), et à la souche identifiée dans la présente description en tant que IFP 970 telle qu’enregistrée le 17 février 2023 sous le numéro de dépôt LMG P- 32994 auprès de la collection BCCM-LMG (également identifié dans le présent texte en tant que « Δhbd ΔbdhB::adh »), utilisable pour préparer une souche équivalente à la souche IFP 971. L’invention vise également toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celles-ci. Une autre bactérie génétiquement modifiée préférée décrite par les inventeurs est la souche identifiée dans la présente description en tant que IFP 969 telle qu’enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32993 auprès de la collection BCCM-LMG (également identifié dans le présent texte en tant que « Δhbd »), utilisable pour préparer des souches équivalentes aux souches IFP 970 et IFP 971. La description vise également toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci. Les inventeurs décrivent en outre des procédés de production d’une bactérie recombinante telle que décrite dans le présent texte, en particulier des procédés comprenant la délétion ou l’inactivation des gènes hbd et bdhB, et éventuellement en outre du gène CA_C0764, de manière à empêcher ou diminuer l’expression de protéines correspondantes fonctionnelles, de préférence un procédé faisant intervenir la technologie CRISPR-Cas, ainsi que les bactéries modifiées génétiquement susceptibles d’être obtenues par ce procédé, dont les bactéries IFP 969, IFP 970 et IFP 971 sont des exemples. Ils décrivent aussi l’utilisation d’une bactérie modifiée génétiquement appartenant au genre Clostridium, caractérisée en ce qu’elle n’exprime pas les produit des gènes hbd et/ou bdhB, et éventuellement en outre du gène CA_C0764, ou exprime une version non fonctionnelle des produits des gènes hbd et bdhB, et éventuellement en outre du gène CA_C0764, telle que la souche IFP 971, pour préparer une bactérie modifiée génétiquement selon l’invention n’exprimant pas les produits des gènes hbd, bdhB et CA_C0764, ou exprimant des versions non fonctionnelles de ceux-ci. Les inventeurs décrivent en outre les plasmides pGRNA-Δhbd de séquence SEQ ID NO : 31, pGRNA- ΔbdhB::adh de séquence SEQ ID NO : 33 et pGRNA-ΔCA_C0764 de séquence SEQ ID NO : 35, ainsi que l’utilisation de l’un, de plusieurs ou de l’ensemble d’entre eux pour transformer, et de préférence modifier génétiquement, une bactérie du genre Clostridium de manière à améliorer sa capacité de production de propan-2-ol ou d’un mélange de propan-2-ol et d’éthanol. Un procédé pour transformer, et de préférence modifier génétiquement, une bactérie du genre Clostridium, ainsi que la bactérie du genre Clostridium modifiée génétiquement obtenue à l’aide du procédé sont aussi décrits. Ce procédé comprend une étape de transformation de la bactérie par introduction dans ladite bactérie d’un plasmide sélectionné parmi le plasmide pGRNA-Δhbd de séquence SEQ ID NO : 31, le plasmide pGRNA-ΔbdhB::adh de séquence SEQ ID NO : 33 et le plasmide pGRNA-ΔCA_C0764 de séquence SEQ ID NO : 35. Les inventeurs décrivent par ailleurs l’utilisation d’une bactérie selon l’invention pour produire une molécule biosourcée, par exemple un solvant, un biocarburant ou tout produit intermédiaire (bio)chimique, en particulier du propan-2-ol ou un mélange de propan-2-ol et d’éthanol. De telles bactéries peuvent être avantageusement utilisées pour produire un solvant ou un mélange de solvants, en particulier à l’échelle industrielle. L’invention concerne aussi un procédé de fermentation impliquant l’utilisation d’une bactérie génétiquement modifiée telle que décrite dans le présent texte. Les inventeurs décrivent enfin des kits, en particulier un kit pour transformer et de préférence modifier génétiquement une bactérie appartenant au genre Clostridium, et un kit pour produire une molécule biosourcée, par exemple un solvant, un biocarburant ou tout produit intermédiaire (bio)chimique, à l’aide d’une bactérie appartenant au genre Clostridium, en particulier du propan-2-ol, ou un mélange de propan- 2-ol et d’éthanol, ledit kit comprenant i) une bactérie modifiée génétiquement appartenant au genre Clostridium selon l’invention et ii) un milieu de conservation ou un milieu de culture de ladite bactérie, en particulier un milieu de culture adapté contenant un sucre ou un mélange de sucres, préférentiellement un hexose et/ou un pentose, encore plus préférentiellement du glucose et/ou de l’arabinose et/ou du xylose. DESCRIPTION DETAILLEE DE L’INVENTION Bien qu’utilisées en industrie depuis plus d’un siècle, les connaissances sur les bactéries appartenant au genre Clostridium, en particulier sur les bactéries solvantogènes, restent très limitées. La bactérie Clostridium acetobutylicum est aujourd’hui considérée comme un représentant modèle des Clostridium solvantogènes. Malgré les difficultés, bien connues de l’homme du métier, rencontrées pour modifier génétiquement les bactéries appartenant au genre Clostridium, les inventeurs sont parvenus, pour la première fois dans le contexte de la présente invention, à obtenir des bactéries C. acetobutylicum capable de produire du propan-2-ol (également identifié dans le présent texte en tant que « isopropanol ») ou un mélange de propan-2-ol et d’éthanol avec des ratio C3/C2 largement améliorés par rapport au ratio susceptible d’être obtenu à l’aide du mutant Δhbd connu de l’homme du métier (décrit en 2011 par Lehmann et Lütke-Eversloh). Dans un mode de réalisation préféré, ces mutants ne produisent plus de butanol ni de butyrate. Les inventeurs ont découvert et montrent ainsi pour la première fois que l’inactivation conjointe des gènes hbd codant une enzyme à activité 3-hydroxybutyryl-CoA déshydrogénase et bdhB codant une alcool déshydrogénase NADPH-dépendante cumulée à l’expression hétérologue du produit du gène adh de C. beijerinckii DSM 6423 dans C. acetobutylicum permet d’obtenir une souche non seulement capable de produire du propan-2-ol mais de le produire en quantité substantiellement plus importante que ne le permet un mutant exprimant le produit du gène adh de C. beijerinckii DSM 6423 dans lequel seul le gène hbd est inactivé, ou en d’autres termes dans lequel le produit du gène bdhB est toujours exprimé de manière fonctionnelle. La partie expérimentale de la présente description montre en effet que la quantité de propan- 2-ol produite par le mutant ∆hbd contenant le plasmide pFC002 (contenant le gène adh de C. beijerinckii DSM 6423) est deux fois inférieure à la quantité d’acétone produite par ce même mutant contenant le plasmide vide pEC500E. Ceci indique que la combinaison de la délétion du gène hbd et de l’expression du gène adh de C. beijerinckii DSM 6423 dans C. acetobutylicum DSM 792 ne permet pas d’obtenir un producteur de propan-2-ol performant. Un objet décrit par les inventeurs vise ainsi une bactérie modifiée génétiquement appartenant au genre Clostridium, en particulier une espèce de Clostridium d’intérêt industriel, en particulier C. acetobutylicum, caractérisée en ce que i) elle n’exprime pas les produits des gènes hbd, de préférence de séquence SEQ ID NO : 39 lorsque la bactérie considérée est C. acetobutylicum, et bdhB, de préférence de séquence SEQ ID NO : 36 lorsque la bactérie considérée est C. acetobutylicum, ou exprime des versions non fonctionnelles de ceux-ci, et ii) elle exprime le gène adh de C. beijerinckii de séquence SEQ ID NO : 38. Dans le contexte de la présente invention, le terme « gène hbd » vise en particulier la séquence SEQ ID NO : 39 (CA_C2708). Le terme « gène hbd » vise aussi les variants de ladite séquence SEQ ID NO : 39, en particulier les variants présentant une homologie de séquence avec ladite séquence SEQ ID NO : 39. Dans le contexte de la présente invention, le terme « gène bdhB » vise en particulier la séquence SEQ ID NO : 36 (CA_C3298) ou un variant de ladite séquence, en particulier un variant présentant une homologie de séquence avec ladite séquence SEQ ID NO : 36. Dans le contexte de la présente invention, le terme « gène CA_C0764 » vise en particulier la séquence SEQ ID NO : 37 ou un variant de ladite séquence, en particulier un variant présentant une homologie de séquence avec ladite séquence SEQ ID NO : 37. Un exemple typique de variant selon l’invention présente une homologie de séquence avec la séquence SEQ ID NO : 39, avec la SEQ ID NO : 36 ou avec la séquence SEQ ID NO : 37 comprise entre 95% et 100%, et de préférence entre 96% et 100%. La séquence SEQ ID NO : 39, SEQ ID NO : 36 ou SEQ ID NO : 37 et son variant sont par exemple homologues à au moins 95%, par exemple à au moins 96%, à au moins 97%, à au moins 98%, ou à au moins 99%. Selon un mode de réalisation préféré, la séquence SEQ ID NO : 39, SEQ ID NO : 36 ou SEQ ID NO : 37 et son variant présentent des séquences homologues à au moins 96%, au moins 97%, ou au moins 98%. Le terme « gène hbd » vise également une séquence codant un fragment ou variant fonctionnel de la protéine (enzyme) (S)-3-hydroxybutyryl-CoA déshydrogénase (Hbd), en particulier une protéine apte à/ capable d’exercer une activité (S)-3-hydroxybutyryl-CoA déshydrogénase. Dans un mode de réalisation particulier, Le terme « gène hbd » vise également une séquence codant un fragment ou variant fonctionnel de la protéine Hbd, en particulier une protéine apte à/ capable d’exercer une activité (S)-3-hydroxybutyryl-CoA déshydrogénase. Le terme « gène bdhB » vise également une séquence codant un fragment ou variant fonctionnel de la protéine (enzyme) Butanol déshydrogénase B dépendante du NADPH (BdhB), en particulier une protéine apte à/ capable d’exercer une activité alcool déshydrogénase NADPH-dépendante. Dans un mode de réalisation particulier, Le terme « gène bdhB » vise également une séquence codant un fragment ou variant fonctionnel de la protéine BdhB, en particulier une protéine apte à/ capable d’exercer une activité alcool déshydrogénase NADPH-dépendante. Le terme « gène CA_C0764 » vise également une séquence codant un fragment ou variant fonctionnel de la ferrédoxine-NADP+ oxydoréductase (CAC0764). Dans un mode de réalisation particulier, Le terme « gène CA_C0764 » vise également une séquence codant un fragment ou variant fonctionnel de la protéine CAC0764, en particulier une protéine apte à/ capable d’exercer une ferrédoxine-NADP+ oxydoréductase. Le terme « gène adh » vise également une séquence codant un fragment ou variant fonctionnel une protéine (enzyme) Isopropanol déshydrogénase dépendante du NADP (Adh), en particulier une protéine apte à/ capable d’exercer une activité enzymatique catalysant la réduction de l'acétone en propan-2-ol. Dans un mode de réalisation particulier, Le terme « gène adh » vise également une séquence codant un fragment ou variant fonctionnel de la protéine Adh, en particulier une protéine apte à/ capable d’exercer une activité Isopropanol déshydrogénase NADPH dépendante. Lorsque le présent texte fait référence à une bactérie modifiée génétiquement appartenant au genre Clostridium, caractérisée en ce qu’elle n’exprime pas les produits des gènes hbd, bdhB et/ou CA_C0764, ou exprime des versions non fonctionnelles de ceux-ci, l’expression « version non fonctionnelle du produit du gène » hbd, bdhB ou CA_C0764 désigne une protéine, typiquement une protéine identifiée dans le présent texte en tant que « Hbd », « BdhB » ou « CAC0764 », non fonctionnelle, i.e., incapable d’exercer la fonction de la protéine codée par la version sauvage du gène visé. Par « bactérie du genre Clostridium », on entend en particulier les espèces de Clostridium dites d’intérêt industriel, typiquement les bactéries solvantogènes ou acétogènes du genre Clostridium. L’expression « bactérie du genre Clostridium » englobe les bactéries sauvages ainsi que les souches dérivées de celles- ci, modifiées génétiquement dans le but d’améliorer leur performance. Par « espèce de Clostridium d’intérêt industriel » ou bactérie « Clostridium d’intérêt industriel » on entend les espèces capables de produire, par fermentation, des solvants tels que l’éthanol, le butanol, l’acétone ou l’isopropanol et/ou des acides tels que l’acide butyrique, l’acide acétique ou l’acide lactique, à partir de sucres ou d’oses, typiquement à partir de sucres comprenant 5 atomes de carbone tels que le xylose, l’arabinose ou le fructose, de sucres comprenant 6 atomes de carbones tels que le glucose ou le mannose, de polysaccharides ou polyosides tels que la cellulose ou une hémicellulose, et/ou de toute autre source de carbone assimilable et utilisable par les bactéries du genre Clostridium (CO, CO2, et méthanol par exemple). Des exemples de bactéries solvantogènes d’intérêt sont les bactéries du genre Clostridium productrices d’acétone, de butanol, d’éthanol et/ou d’isopropanol (propan-2-ol), telles que les souches identifiées dans la littérature en tant que « souche ABE » [souches réalisant des fermentations permettant la production d’acétone, de butanol et d’éthanol], « souche IBE » [souches réalisant des fermentations permettant la production d’isopropanol (ou propan-2-ol) par réduction de l’acétone, de butanol et d’éthanol] et « souche AIBE » [souches réalisant des fermentations permettant la production d’acétone, d'isopropanol (ou propan- 2-ol), de butanol et d’éthanol]. Des bactéries solvantogènes du genre Clostridium peuvent être sélectionnées par exemple parmi, sans être limitées à, C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum et C. tyrobutyricum, de manière préférée parmi C. acetobutylicum, C. beijerinckii, C. butyricum, C. tyrobutyricum et C. cellulolyticum, et de manière encore plus préférée parmi C. acetobutylicum et C. beijerinckii. Les bactéries acétogènes d’intérêt sont des bactéries productrices d’acides et/ou de solvants à partir de CO2 et H2. Des bactéries acétogènes du genre Clostridium peuvent être sélectionnées par exemple parmi C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes et C. carboxidivorans. Dans un mode de réalisation particulier, la bactérie du genre Clostridium concernée est une « souche ABE », de préférence la bactérie C. acetobutylicum, par exemple la souche DSM 792 (également désignée souche ATCC 824 ou encore LMG 5710) de C. acetobutylicum. Dans un autre mode de réalisation particulier, la bactérie du genre Clostridium concernée est une « souche ABE », de préférence la bactérie C. beijerinckii, par exemple la souche la souche NCIMB 8052 de C. beijerinckii. Dans un autre mode de réalisation particulier, la bactérie du genre Clostridium concernée est une « souche IBE », de préférence un sous-clade de C. beijerinckii sélectionné parmi DSM 6423, LMG 7814, LMG 7815, NRRL B-593 et NCCB 27006. Ainsi, selon un mode de réalisation préféré, la bactérie selon l’invention appartenant au genre Clostridium est une bactérie Clostridium d’intérêt industriel, en particulier une bactérie solvantogène, capable, à l’état sauvage, de produire des solvants et/ou des acides par fermentation à partir d’une source de carbone, ladite source de carbone étant choisie par exemple parmi un sucre, du CO, du CO2, un alcool, et un acide organique. Dans un mode de réalisation particulier préféré, la source de carbone est un sucre, en particulier un sucre comprenant 5 atomes de carbone tels que le xylose ou l’arabinose, un sucre comprenant 6 atomes de carbones tels que le glucose, le fructose ou le mannose, ou un polysaccharide ou polyoside tels que la cellulose ou l’hémicellulose. Une bactérie particulièrement préférée appartient à l’espèce C. acetobutylicum et, comme expliqué ci- dessus, n’exprime pas les produits des gènes de séquence SEQ ID NO : 39 (CA_2708) (ou une séquence homologue à au moins 95%, par exemple à au moins 96%, au moins 97% ou à au moins 98% de celle-ci), de séquence SEQ ID NO : 36 (CA_3298) (ou une séquence homologue à au moins 95%, par exemple à au moins 96%, au moins 97% ou à au moins 98% de celle-ci), et de préférence de séquence SEQ ID NO : 37 (CA_0764) (ou une séquence homologue à au moins 95%, par exemple à au moins 96%, au moins 97% ou à au moins 98% de celle-ci), ou exprime des versions non fonctionnelles desdits produits d’expression. Cette bactérie modifiée génétiquement exprime en outre le produit fonctionnel du gène adh de C. beijerinckii de SEQ ID NO : 38. Les bactéries ainsi modifiées, particulièrement préférées, présentent les aptitudes techniques décrites ci- dessus, i.e., elles sont capables de produire du propan-2-ol (également identifié dans le présent texte en tant que « isopropanol ») ou un mélange de propan-2-ol et d’éthanol. Certaines sont capables de produire un mélange de propan-2-ol et d’éthanol avec des ratio C3/C2 largement améliorés par rapport au ratio susceptible d’être obtenu à l’aide du mutant Δhbd connu de l’homme du métier (décrit en 2011 par Lehmann et Lütke-Eversloh). De telles souches sont caractérisées pour la première fois dans le cadre de la présente demande. L’une de ces souches a été enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32995 auprès de la collection BCCM-LMG (IFP 971, « Δhbd ΔbdhB::adh ΔCA_C0764 »). Dans cette souche, les gènes hbd, bdhB et CA_C0764 ont été (conjointement) inactivés. Cette souche exprime en outre le gène adh. La description concerne également toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci, typiquement dépourvues des gènes hbd, bdhB et CA_C0764, ou dans lesquels lesdits gènes ont également été inactivés, et exprimant une version fonctionnelle du produit du gène adh. Une seconde souche a été enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32994 auprès de la collection BCCM-LMG (IFP 970, « Δhbd ΔbdhB::adh »). Dans cette souche, les gènes hbd et bdhB ont été (conjointement) inactivés. Cette souche exprime en outre le gène adh. La description concerne également toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci, typiquement dépourvues des gènes hbd et bdhB, ou dans lesquels lesdits gènes ont également été inactivés, et exprimant une version fonctionnelle du produit du gène adh. Une troisième souche a été enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32993 auprès de la collection BCCM-LMG (IFP 969, « Δhbd »). Dans cette souche, le gène hbd a été inactivé. La description concerne également toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci, typiquement dépourvu du gène hbd, ou dans lesquels ledit gène a également été inactivé. Un autre objet de l’invention vise l’utilisation d’une bactérie selon l’invention pour produire du propan-2- ol ou un mélange comprenant du propan-2-ol et de l’éthanol. Dans un mode de réalisation particulier, la bactérie selon l’invention est par exemple capable de produire un ratio C3 (acétone + propan-2-ol) / C2 (éthanol) supérieur à 0.10, par exemple de 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18 ou 0.19. Dans un mode de réalisation particulier préféré, la bactérie selon l’invention est apte à produire un ratio C3 (acétone + propan-2-ol) / C2 (éthanol) supérieur ou égal à 0.20 par exemple de 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28 ou 0.29, supérieur ou égal à 0.30 par exemple de 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38 ou 0.39, supérieur ou égal à 0.40 par exemple de 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, ou 0.49, supérieur ou égal à 0.50, par exemple de 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, ou 0.59, ou supérieur ou égal à 0.60, par exemple de 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, ou 0.69, encore plus préférentiellement supérieur ou égal à 0.70 par exemple de 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, supérieur ou égal à 0.80 par exemple de 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, ou supérieur ou égal à 0.90 par exemple de 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98 ou 0.99. La bactérie modifiée génétiquement selon l’invention peut être avantageusement utilisée pour produire un solvant, par exemple un biocarburant, de préférence le propan-2-ol, ou un mélange de solvants, par exemple un mélange de biocarburants, de préférence un mélange comprenant du propan-2-ol et de l’éthanol, en particulier à l’échelle industrielle. L’invention vise aussi un procédé de fermentation, typiquement un procédé industriel, impliquant l’utilisation d’une bactérie selon l’invention. Grâce à la présente invention, la production de propan-2-ol est non seulement rendue possible mais également grandement facilitée, de même que celle d’un mélange comprenant du propan-2-ol et de l’éthanol. La présente invention offre une solution bienvenue qui permet d’optimiser la production de propan-2-ol, et d’obtenir un ratio C3 (acétone + propan-2-ol) / C2 (éthanol) supérieur à 0.10. Une bactérie modifiée génétiquement selon l’invention peut aussi être avantageusement utilisée pour produire une molécule biosourcée, par exemple un solvant, un biocarburant ou tout produit intermédiaire (bio)chimique, à partir d’une biomasse ou à partir d’une culture énergétique dédiée. Dans le contexte de la présente invention, on entend par « molécule biosourcée » une molécule, de type alcool ou cétone, dont la spécificité est que la matière première utilisée pour sa production est obligatoirement issue de biomasse végétale, par exemple de biomasse lignocellulosique, et non pas issue de ressources d’origines fossiles telles que le pétrole, le charbon ou le gaz naturel. Il s’agit, par exemple, des alcools issus de la fermentation de jus sucrés notamment en C5 (à 5 carbones) et/ou en C6 (à 6 carbones) réalisée par des souches « solvantogènes » du genre Clostridium. Des exemples de molécules biosourcées susceptibles d’être produites grâce à la présente invention sont l’éthanol (utilisable comme biocarburant), ou encore le propan-2-ol, le 1,3-butanediol et le 2,3-butanediol. L’invention vise par ailleurs un procédé de production d’une bactérie recombinante selon l’invention, comprenant la délétion ou l’inactivation des gènes hbd, bdhB et/ou CA_C0764 de manière à empêcher ou diminuer l’expression de protéines Hbd et BdhB, et de préférence également de CA_C0764, fonctionnelles et la transformation et modification génétique de la bactérie de manière à lui permettre d’exprimer une protéine Adh fonctionnelle. Les procédés de modification connus les plus performants pour obtenir des souches modifiées génétiquement sont basés sur des événements de recombinaison homologue, ceux-ci permettant de modifier le génome de manière précise et stable. Un procédé de production particulier selon l’invention comprend une étape de transformation de la bactérie par introduction dans ladite bactérie d’un acide nucléique d’intérêt. Par « acide nucléique », on entend au sens de l’invention, toute molécule d’ADN ou d’ARN naturelle, synthétique, semi-synthétique ou recombinante, éventuellement modifiée chimiquement (i.e. comprenant des bases non naturelles, des nucléotides modifiés comprenant par exemple une liaison modifiée, des bases modifiées et/ou des sucres modifiés), ou optimisée de manière à ce que les codons des transcrits synthétisés à partir des séquences codantes soient les codons les plus fréquemment trouvés chez une bactérie du genre Clostridium en vue de son utilisation chez celle-ci. Dans le cas du genre Clostridium, les codons optimisés sont typiquement des codons riches en bases adénines (« A ») et thymines (« T »). Dans les séquences peptidiques décrites dans ce document, les acides aminés sont représentés par leur code à une lettre selon la nomenclature suivante : C : cystéine; D : acide aspartique; E : acide glutamique; F : phénylalanine; G : glycine; H : histidine; I : isoleucine; K : lysine; L : leucine ; M : méthionine ; N : asparagine ; P : proline ; Q : glutamine ; R : arginine ; S : sérine ; T : thréonine ; V : valine ; W : tryptophane et Y : tyrosine. Dans un mode de réalisation particulier décrit, l’acide nucléique d’intérêt comprend au moins deux régions complémentaires chacune d’une séquence cible, identiques à 100% ou identiques à 80% au moins, de préférence à 85%, 90%, 95%, 96%, 97%, 98% ou 99% au moins à ladite région/portion/séquence d’ADN ciblée au sein du génome bactérien. Ces régions sont capables de s’hybrider à tout ou partie de la séquence complémentaire de ladite région/portion/séquence, typiquement à une séquence telle que décrite ci-dessus comprenant au moins 1 nucléotide, de préférence au moins 100 nucléotides, typiquement entre 100 et 1000 nucléotides. Les régions complémentaires de la séquence cible présentes au sein de l’acide nucléique d’intérêt peuvent reconnaître, de préférence cibler, les régions flanquantes en 5’ et en 3’ de la séquence ciblée dans un outil de modification génétique connu de l’homme du métier, typiquement tout outil basé sur la recombinaison homologue. Dans un mode de réalisation particulier préféré, une partie de l’acide nucléique d’intérêt reconnait en outre (lie au moins en partie), et de préférence cible, i.e. reconnait et permet la coupure, dans le génome d’une bactérie Clostridium d’intérêt, d’au moins un brin i) d’une séquence cible, ii) d’une séquence contrôlant la transcription d’une séquence cible, ou iii) d’une séquence flanquant une séquence cible. La séquence reconnue est également identifiée dans le présent texte en tant que « séquence cible » ou « séquence ciblée ». Dans ce même mode de réalisation particulier préféré, l’acide nucléique d’intérêt comprend au moins une région complémentaire de la séquence cible identique à 100% ou identique à 80% au moins, de préférence à 85%, 90%, 95%, 96%, 97%, 98% ou 99% au moins à la région/portion/séquence d’ADN ciblée au sein du génome bactérien et est capable de s’hybrider à tout ou partie de la séquence complémentaire de ladite région/portion/séquence, typiquement à une séquence comprenant au moins 5 nucléotides, de préférence au moins 5, 10, 14, 15, 20, 25, 30, 35 ou 40 nucléotides, typiquement entre 15 et 30 nucléotides, de préférence à une séquence comprenant 18 ,19, 20, 21, 22, 23, 24 ou 25 nucléotides. Le ou les acides nucléiques d’intérêt tels que décrits dans le cadre de la présente l’invention sont capables de supprimer la ou lesdites séquences cibles du génome de la bactérie ou de modifier leur expression, par exemple de les moduler/ réguler, en particulier de les inhiber, de préférence de les modifier de manière à rendre ladite bactérie incapable d’exprimer une ou plusieurs protéines, en particulier une ou plusieurs protéines fonctionnelles, à partir de ladite ou desdites séquences. Selon un autre aspect de l’invention, le ou les acides nucléiques d’intérêt tels que décrits dans le cadre de la présente l’invention sont capables d’introduire une séquence d’intérêt dans le génome de la bactérie de manière à rendre ladite bactérie capable d’exprimer une ou plusieurs protéines, en particulier une ou plusieurs protéines fonctionnelles, à partir de ladite ou desdites séquences. Les « acides nucléiques d’intérêt », typiquement les cassettes ou vecteurs d’expression, peuvent être construits par des techniques classiques bien connues de l’homme du métier et peuvent comporter un ou plusieurs promoteurs, origines de réplication bactérienne (séquences ORI), séquences de terminaison, gènes de sélection, par exemple gènes de résistance à un antibiotique, et séquences (« régions flanquées ») permettant l’insertion ciblée de la cassette ou du vecteur. Des séquences ORI d’intérêt peuvent par exemple être choisies parmi pIP404, pAMβ1, repH (origine de réplication chez C. acetobutylicum), ColE1 ou rep (origine de réplication chez E. coli), ou toute autre origine de réplication permettant le maintien du vecteur, typiquement du plasmide, au sein d’une cellule bactérienne appartenant au genre Clostridium. Des séquences de terminaison d’intérêt peuvent être choisies par exemple parmi celles des gènes adc, thl, de l’opéron bcs, ou de tout autre terminateur, bien connu de l’homme de l’art, permettant l’arrêt de la transcription au sein d’une cellule bactérienne appartenant au genre Clostridium. Des gènes de sélection (gènes de résistance) d’intérêt peuvent être choisis parmi ermB, catP, bla, tetA, tetM, et/ou tout autre gène de résistance à l’ampicilline, à l’érythromycine, au chloramphenicol, au thiamphénicol, à la spectinomycine, à la tétracycline, ou à tout autre antibiotique, bien connu de l’homme de l’art, pouvant être utilisé pour sélectionner des bactéries du genre Clostridium. L’acide nucléique d’intérêt peut être un ARN naturel, synthétique ou produit par une technique de recombinaison. Cet acide nucléique d’intérêt peut être préparé par toute méthode connue de l’homme du métier telles que, par exemple, la synthèse chimique, la transcription in vivo ou des techniques d’amplification. Lorsque le ou les acides nucléiques d’intérêt sont introduits dans la cellule directement sous la forme de molécules d’ARN (matures ou précurseurs), par exemple d’ARN guide (ARNg), ces molécules peuvent contenir des nucléotides modifiés ou des modifications chimiques leur permettant, par exemple, d’augmenter leur résistance aux nucléases et d’augmenter ainsi leur durée de vie dans la cellule. Ils peuvent notamment comprendre au moins un nucléotide modifié ou non naturel tel que, par exemple, un nucléotide comportant une base modifiée, telle que l'inosine, la méthyl-5-désoxycytidine, la diméthylarnino-5-désoxyuridine, la désoxyuridine, la diamino-2,6-purine, la bromo-5-désoxyuridine ou toute autre base modifiée permettant l'hybridation. Les acides nucléiques d’intérêt utilisés selon l’invention peuvent également être modifiés au niveau de la liaison internucléotidique comme le sont par exemple les phosphorothioates, les H-phosphonates ou les alkyl-phosphonates, ou au niveau du squelette comme le sont par exemple les alpha-oligonucléotides, les 2'-O-alkyl riboses ou les PNA (Peptide Nucleic Acids) (Egholm et al., 1992). Dans le contexte de la présente description, un exemple particulier d’acide nucléique d’intérêt, utilisé pour transformer et/ou modifier génétiquement une bactérie d’intérêt, est un fragment d’ADN i) reconnaissant une séquence codant, ii) contrôlant la transcription d’une séquence codant, ou iii) flanquant une séquence codant, l’enzyme Hbd (3-hydroxybutyryl-CoA déshydrogénase), l’enzyme BdhB (alcool déshydrogénase NADPH-dépendante) ou la pyruvate NADP ferrédoxine oxydoréductase, ou la protéine Adh (alcool- déshydrogénase secondaire). Un acide nucléique d’intérêt particulier décrit par les inventeurs est par exemple un vecteur, de préférence un plasmide, par exemple le plasmide pGRNA-Δhbd de séquence SEQ ID NO : 31, le plasmide pGRNA- ΔbdhB::adh de séquence SEQ ID NO : 33 ou le plasmide pGRNA-ΔCA_C0764 de séquence SEQ ID NO : 35, décrits dans la partie expérimentale de la présente description. La ou l’une des séquences reconnues (séquence(s) cible(s)) est de préférence l’une des séquences SEQ ID NO : 39, SEQ ID NO : 36 ou SEQ ID NO : 37 correspondant aux gènes hbd, bdhB et CA_C0764 codant respectivement la protéine Hbd, la protéine BdhB et la protéine CAC0764, ou une séquence d’acides aminés identique à au moins 70%, 75%, 80%, 85%, 90% ou 95% à ladite protéine, ou une séquence comprenant tout ou au moins 95%, 96%, 97%, 98% ou 99% de la séquence SEQ ID NO : 39, SEQ ID NO : 36 ou SEQ ID NO : 37. Autrement formulé, la séquence reconnue peut être une séquence comprenant au moins 1 nucléotide, de préférence au moins 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 ou 40 nucléotides, typiquement entre 1 et 40 nucléotides, de préférence une séquence comprenant 14, 15, 16, 17, 18 ,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 ou 30 nucléotides de la séquence SEQ ID NO : 39, SEQ ID NO : 36 ou SEQ ID NO : 37. Selon un autre exemple particulier, la séquence cible peut aussi être une séquence contrôlant la transcription d’une séquence codante telle que décrite précédemment, typiquement une séquence promotrice, par exemple la séquence promotrice du gène « hbd » (CA_C2708, SEQ ID NO : 39), celle du gène « bdhB » (CA_C3298, SEQ ID NO : 36) ou celle du gène « CA_C0764 » (SEQ ID NO : 37). L’acide nucléique d’intérêt reconnaît alors, et est donc typiquement capable de se lier à une séquence contrôlant la transcription d’une séquence codante telle que décrite précédemment. Selon un autre exemple particulier, la séquence cible peut être une séquence flanquant une séquence codante telle que décrite précédemment, par exemple une séquence flanquant la séquence SEQ ID NO : 39, SEQ ID NO : 36 ou SEQ ID NO : 37, ou une séquence identique à au moins 70% à celle-ci. Une telle séquence flanquante comprend typiquement 1, 10 ou 20 et 1000 nucléotides, par exemple entre 1, 10 ou 20 et 900, 800, 700, 600, 500, 400, 300 ou 200 nucléotides, entre 1, 10 ou 20 et 100 nucléotides, entre 1, 10 ou 20 et 50 nucléotides, ou entre 1, 10 ou 20 et 40 nucléotides, par exemple entre 10 et 40 nucléotides, entre 10 et 30 nucléotides, entre 10 et 20 nucléotides, entre 20 et 30 nucléotides, entre 15 et 40 nucléotides, entre 15 et 30 nucléotides ou entre 15 et 20 nucléotides. Selon un aspect particulier, la séquence cible correspond à la paire de séquences flanquant une telle séquence codante, chaque séquence flanquante comprenant typiquement au moins 20 nucléotides, typiquement entre 100 et 1000 nucléotides, de préférence entre 200 et 800 nucléotides. De préférence, le procédé selon l’invention de production d’une bactérie recombinante comprend la transformation de la cellule bactérienne à l’aide d’au moins un acide nucléique d’intérêt, par exemple un, deux, trois ou quatre acides nucléiques d’intérêt tels que décrits précédemment, le ou lesdits acides nucléiques d’intérêt étant capables i) de reconnaître (et capable de lier au moins en partie) une séquence codant, contrôlant la transcription d’une séquence codant, ou flanquant une séquence codant, la protéine Hbd, ii) de reconnaître (et capable de lier au moins en partie) une séquence codant, contrôlant la transcription d’une séquence codant, ou flanquant une séquence codant, la protéine BdhB, et de préférence iii) de reconnaître (et capable de lier au moins en partie) une séquence codant, contrôlant la transcription d’une séquence codant, ou flanquant une séquence codant, la protéine CAC0764. L’acide nucléique d’intérêt tel que décrit dans le cadre de la présente invention est de préférence capable de supprimer ladite séquence cible du génome de la bactérie ou de modifier son expression, par exemple de la moduler/ réguler, en particulier de l’inhiber, de préférence de la modifier de manière à rendre ladite bactérie incapable d’exprimer une protéine (typiquement une protéine Hbd, BdhB ou CAC0764), en particulier une protéine fonctionnelle, à partir de ladite séquence. Dans un mode de réalisation particulièrement préféré, l’acide nucléique d’intérêt est capable de modifier la bactérie de manière à la rendre incapable d’exprimer l’une et/ou l’autre des protéines Hbd, BdhB ou CAC0764. Un autre exemple d’acide nucléique d’intérêt est la séquence codant la protéine Adh. Selon un mode de réalisation particulier, la description vise plus particulièrement l’utilisation du plasmide pGRNA-Δhbd de séquence SEQ ID NO : 31, du plasmide pGRNA-ΔbdhB::adh de séquence SEQ ID NO : 33 et/ou du plasmide pGRNA-CA_C0764 de séquence SEQ ID NO : 35 pour transformer, et de préférence modifier génétiquement, une bactérie du genre Clostridium de manière à améliorer sa capacité de production de propan-2-ol ou d’un mélange de propan-2-ol et d’éthanol. Elle vise également un procédé pour transformer, et de préférence modifier génétiquement, une bactérie du genre Clostridium, caractérisé en ce qu’il comprend une étape de transformation de la bactérie par introduction dans ladite bactérie d’un plasmide tel que décrit dans le présent texte, de préférence un plasmide sélectionné parmi le plasmide pGRNA-Δhbd de séquence SEQ ID NO : 31, le plasmide pGRNA- ΔbdhB::adh de séquence SEQ ID NO : 33 ou le plasmide pGRNA-ΔCA_C0764 de séquence SEQ ID NO : 35. La description vise aussi toute bactérie du genre Clostridium modifiée génétiquement obtenue à l’aide d’un tel procédé. L’introduction dans la bactérie de tout acide nucléique d’intérêt peut être réalisée par toute méthode, directe ou indirecte, connue de l’homme du métier, par exemple par transformation, conjugaison, microinjection, transfection, électroporation, etc., de préférence par électroporation (Mermelstein et al, 1993). Par ailleurs, ces acides nucléiques d’intérêt (par exemple les fragments d’ADN, fragments d’ARN, cassettes d’expression ou vecteurs d’expression) peuvent être intégrés au sein du génome bactérien par des techniques elles-aussi bien connues de l’homme du métier. Dans un mode de réalisation particulier, le procédé pour transformer, et de préférence modifier génétiquement, une bactérie telle que décrite dans le présent texte, comprend une étape de transformation de la bactérie par introduction dans ladite bactérie d’un acide nucléique d’intérêt selon l’invention tel que décrit plus haut et fait intervenir un outil de modification génétique par exemple un outil de modification génétique sélectionné parmi un outil CRISPR, un outil de mutagénèse insertionnelle, par exemple basé sur l’utilisation d’introns de type II (par exemple l’outil Targetron® ou l’outil ClosTron®) et un outil d’échange allélique (par exemple l’outil ACE®). Le procédé pour transformer, et de préférence en outre modifier génétiquement, une bactérie Clostridium peut comprendre en outre une étape d’obtention, de récupération, de sélection ou d’isolement de la bactérie transformée, i.e. de la bactérie présentant la ou les recombinaisons/modifications/optimisations recherchées. Dans un mode de réalisation particulier, le procédé selon l’invention est basé sur l’utilisation de (met en œuvre) la technologie / l’outil génétique CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), en particulier l’outil génétique CRISPR-Cas (CRISPR-associated protein). La présente invention peut être mise en œuvre à l’aide d’un outil génétique CRISPR-Cas classique utilisant un unique plasmide comprenant une nucléase, un ARNg et une matrice de réparation tel que décrit par Wang et al. (2015). L’homme du métier peut aisément définir la séquence et la structure des ARNg selon la région chromosomique ou l’élément génétique mobile à cibler en utilisant des techniques bien connues (voir par exemple l’article de DiCarlo et al., 2013). Les inventeurs ont autrement mis au point et décrit un outil génétique de modification de bactéries, adapté aux bactéries du genre Clostridium, utilisable dans le contexte de la présente invention, basé sur l’utilisation de deux plasmides (cf. WO2017/064439, Wasels et al., 2017). Dans un autre mode de réalisation, le procédé selon l’invention est basé sur l’utilisation d’outil de mutagénèse insertionnelle, par exemple l’utilisation d’introns de type II, et met par exemple en œuvre la technologie / l’outil génétique ClosTron® ou l’outil génétique Targetron®. La technologie Targetron® repose sur l’utilisation d’un intron de groupe II (basé sur l’intron Ll.ltrB de Lactococcus lactis) reprogrammable, capable d’intégrer le génome bactérien rapidement à un locus désiré (Chen et al., 2005, Wang et al., 2013), typiquement dans le but d’inactiver un gène ciblé. Les mécanismes de reconnaissance de la zone éditée ainsi que d’insertion dans le génome par rétro-épissage sont basés sur une homologie entre l’intron et ladite zone d’une part, et sur l’activité d’une protéine (LtrA) d’autre part. La technologie ClosTron® repose sur une approche similaire, complétée par l’ajout d’un marqueur de sélection dans la séquence de l’intron (Heap et al., 2007). Ce marqueur permet de sélectionner l’intégration de l’intron dans le génome, et facilite donc l’obtention des mutants désirés. Ce système génétique exploite également les introns de type I. En effet, le marqueur de sélection (appelé RAM pour retrotransposition- activated marker) est interrompu par un tel élément génétique, qui empêche son expression depuis le plasmide (une description plus précise du système : Zhong et al.). L’épissage de cet élément génétique se produit avant intégration dans le génome, ce qui permet l’obtention d’un chromosome présentant une forme active du gène de résistance. Une version optimisée du système comprend des sites FLP/FRT en amont et en aval de ce gène, ce qui permet d’utiliser la recombinase FRT pour éliminer le gène de résistance (Heap et al., 2010). Dans un autre mode de réalisation, le procédé selon l’invention est basé sur l’utilisation d’un outil d’échange allélique, et met par exemple en œuvre la technologie / l’outil génétique ACE®. La technologie ACE® repose sur l’utilisation d’un mutant auxotrophe (pour l’uracile chez C. acetobutylicum ATCC 824 par délétion du gène pyrE, qui provoque également une résistance à l’acide 5- fluoroorotique (5-FOA) ; Heap et al., 2012). Le système utilise le mécanisme d’échange allélique, bien connu de l’homme de métier. Suite à une transformation avec un vecteur pseudo-suicide (à très faibles copies), l’intégration de ce dernier dans le chromosome bactérien par un premier évènement d’échange allélique peut être vérifiée grâce au gène de résistance présent initialement sur le plasmide. L’étape d’intégration peut être réalisée de deux manières différentes, soit au sein du locus pyrE soit au sein d’un autre locus. Dans le cas de l’intégration au locus pyrE, le gène pyrE est également placé sur le plasmide, sans toutefois être exprimé (pas de promoteur fonctionnel). La deuxième recombinaison restaure un gène pyrE fonctionnel et peut alors être sélectionnée par auxotrophie (milieu minimum, ne contenant pas d’uracile). Le gène pyrE non-fonctionnel présentant également un caractère sélectionnable (sensibilité au 5-FOA), d’autres intégrations sont ensuite envisageables sur le même modèle, en alternant successivement l’état de pyrE entre fonctionnel et non-fonctionnel. Dans le cas de l’intégration à un autre locus, une zone génomique permettant une expression du marqueur de contre-sélection après recombinaison est ciblée (typiquement, en opéron après un autre gène, de préférence un gène fortement exprimé). Cette deuxième recombinaison est alors sélectionnée par auxotrophie (milieu minimum ne contenant pas d’uracile). Dans les modes de réalisation décrits basés sur l’utilisation d’introns de type II, et mettant par exemple en œuvre la technologie / l’outil génétique ClosTron® ou l’outil génétique Targetron®, ou basés sur l’utilisation d’un outil d’échange allélique, et mettant par exemple en œuvre la technologie / l’outil génétique ACE®, la séquence ciblée est typiquement l’une des séquences décrites dans le présent texte. L’invention concerne par ailleurs un kit (trousse) pour transformer et/ou modifier génétiquement une bactérie du genre Clostridium comprenant au moins un acide nucléique d’intérêt tel que décrit dans le présent texte (par exemple deux ou trois acides nucléiques d’intérêt, typiquement fragment d’ADN, reconnaissant chacun une séquence cible) pour transformer et de préférence modifier génétiquement une bactérie du genre Clostridium, et éventuellement une ou plusieurs molécules de sélection. Un kit particulier comprend les éléments essentiels au fonctionnement d’un outil CRISPR (typiquement au moins un acide nucléique utilisable en tant qu’ARNg, un acide nucléique utilisable en tant que matrice de réparation, au moins une paire d’amorces, et un inducteur permettant l’expression d’une nucléase, en particulier d’une nucléase de type Cas9 ou Cas12, par exemple MAD7), les éléments essentiels au fonctionnement d’un outil basé sur l’utilisation d’introns de type II (typiquement au moins un intron de type II, au moins une paire d’amorces et un inducteur permettant l’expression d’un rétrotranscriptase, par exemple type LtrA RT ou Tel4c RT), ou les éléments essentiels au fonctionnement d’un outil d’échange allélique (typiquement au moins deux acides nucléiques utilisables en tant que matrice de recombinaison homologue, et au moins un couple d’amorces). Les kits selon l’invention peuvent en outre comprendre un ou plusieurs consommables tels qu’un milieu de conservation ou un milieu de culture, au moins une bactérie compétente du genre Clostridium (i.e. conditionnée en vue de la transformation), ou encore une notice explicative. L’invention concerne typiquement un kit pour la mise en œuvre d’un procédé de transformation et/ou de modification génétique décrit dans le présent texte à l’aide d’une bactérie du genre Clostridium. L’invention vise en particulier la bactérie modifiée génétiquement appartenant au genre Clostridium ayant pour caractéristique essentielle i) de ne pas exprimer les produits des gènes hbd et bdhB, et de préférence CA_C0764, ou d’exprimer des versions non fonctionnelles de ceux-ci, et ii) d’exprimer le gène adh, ainsi que toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci, et leurs utilisations. La demande décrit aussi la souche IFP 969 (« Δhbd »), enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32993 auprès de la collection BCCM-LMG, dans laquelle, le gène hbd a été inactivé, ainsi que toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci, typiquement dépourvues du gène hbd, ou dans lequel ledit gène a également été inactivé de préférence à l’aide de la technologie CRISPR. La demande décrit aussi la souche IFP 970 (« Δhbd ΔbdhB::adh »), enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32994 auprès de la collection BCCM-LMG, dans laquelle, les gènes hbd et bdhB ont été inactivés et exprimant le produit du gène adh, ainsi que toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci, typiquement dépourvues des gènes hbd et bdhB, ou dans lesquels lesdits gènes ont également été inactivés, et exprimant le produit du gène adh. Elle vise en particulier l’utilisation d’une bactérie modifiée génétiquement appartenant au genre Clostridium, caractérisée en ce qu’elle n’exprime pas les produits du gène hbd, ou exprime une version non fonctionnelle des produits du gène hbd, par exemple la souche IFP 969, enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32993 auprès de la collection BCCM-LMG, pour préparer une bactérie modifiée génétiquement selon l’invention n’exprimant pas les produits des gènes hbd et bdhB, ou exprimant des versions non fonctionnelles de ceux-ci, et exprimant le produit du gène adh. La demande décrit encore la souche IFP 971 (« Δhbd ΔbdhB::adh ΔCA_C0764 »), enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32995 auprès de la collection BCCM-LMG, dans laquelle, les gènes hbd, bdhb et CA_C0764 ont été inactivés et exprimant le produit du gène adh, ainsi que toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci, typiquement dépourvues des gènes hbd, bdhb et CA_C0764, ou dans lesquels lesdits gènes ont également été inactivés, et exprimant le produit du gène adh. Elle vise en particulier l’utilisation d’une bactérie modifiée génétiquement appartenant au genre Clostridium, caractérisée en ce qu’elle n’exprime pas les produits des gènes hbd et bdhB, ou exprime une version non fonctionnelle des produits des gènes hbd et bdhB, et exprimant le produit du gène adh, par exemple la souche IFP 970, enregistrée le 17 février 2023 sous le numéro de dépôt LMG P-32994auprès de la collection BCCM-LMG, pour préparer une bactérie modifiée génétiquement selon l’invention n’exprimant pas les produits des gènes hbd, bdhB et CA_C0764, ou exprimant des versions non fonctionnelles de ceux-ci, et exprimant le produit du gène adh. L’invention concerne par ailleurs un kit pour produire une molécule biosourcée, par exemple un solvant, un biocarburant ou tout produit intermédiaire (bio)chimique, à l’aide d’une bactérie appartenant au genre Clostridium, comprenant i) une bactérie modifiée génétiquement appartenant au genre Clostridium selon l’invention, par exemple IFP 969, IFP 970 ou IFP 971, et ii) un milieu, typiquement un milieu de conservation ou un milieu de culture de ladite bactérie. Le kit peut en outre comprendre une notice explicative. Le milieu de conservation ou de culture de la bactérie modifiée génétiquement (appartenant au genre Clostridium) selon l’invention présent au sein du kit est de préférence supplémenté en une source de carbone composée de glucose et/ou d’au moins un pentose, de préférence i) de glucose et/ou ii) d’arabinose et/ou i) de xylose. Ce milieu comprend de préférence entre 0,1 et 250 g/L, plus préférentiellement entre 1 et 100 g/L, de ladite source de carbone (composée de glucose et/ou d’arabinose et/ou de xylose). Le milieu de conservation ou de culture de la bactérie modifiée génétiquement est de préférence un milieu de culture de type RCM, plus préférentiellement un milieu de culture de type GAPES, encore plus préférentiellement un milieu de culture de type CGM. L’invention concerne aussi un kit particulier pour produire un solvant ou un biocarburant, ou un mélange de solvants ou de biocarburants, en particulier du propan-2-ol ou un mélange comprenant du propan-2-ol et de l’éthanol, à l’aide d’une bactérie appartenant au genre Clostridium, ledit kit comprenant i) une bactérie (appartenant au genre Clostridium) modifiée génétiquement selon l’invention, caractérisée en ce qu’elle n’exprime pas les produits des gènes hbd, bdhB et/ou CA_C0764, ou exprime des versions non fonctionnelles de ceux-ci, et ii) un milieu de culture, préférentiellement un milieu de culture de type RCM, plus préférentiellement un milieu de culture de type GAPES, encore plus préférentiellement un milieu de culture de type CGM, contenant au moins une source de carbone, préférentiellement du glucose et/ou de l’arabinose et/ou du xylose. L’invention concerne par ailleurs les utilisations possibles du procédé ou du kit selon l’invention pour transformer et/ou modifier génétiquement une bactérie du genre Clostridium, typiquement une bactérie solvantogène du genre Clostridium, par exemple pour générer des variants améliorés de ladite bactérie. Elle concerne enfin les utilisations possibles du procédé, du kit ou d’une bactérie du genre Clostridium transformée et de préférence modifiée génétiquement selon l’invention, en particulier pour permettre la production de molécules biosourcées, par exemple de solvant(s), biocarburant(s) ou produit(s) intermédiaire(s) (bio)chimique(s), ou de mélanges de ceux-ci, typiquement à l’échelle industrielle. Les exemples et figure ci-après ont pour but d’illustrer plus pleinement l’invention sans pour autant en limiter la portée. En particulier, ces exemples présentent l’obtention et la caractérisation de bactéries selon l’invention, dans lesquels l’inactivation de gènes hbd, bdhB et/ou CA_C0764, et/ou l’insertion du gène adh, est réalisée selon un mode de réalisation particulier préféré à l’aide d’un outil CRISPR-Cas9. Lesdits gènes peuvent être inactivés, ou introduits, selon d’autres modes de réalisation particuliers, bien connus de l’homme de métier, basés par exemple sur l’inactivation, ou l’introduction, de gène par recombinaison homologue ou par mutagénèse insertionnelle, comme expliqué ci-dessus. FIGURE La Figure 1 représente le métabolisme central de C. acetobutylicum. C. acetobutylicum produit de l’acétate, du butyrate et éventuellement du lactate lors de l’acidogenèse. Lors de la phase de solvantogenèse, le butyrate et l’acétate sont réassimilés, et le flux de carbone est réorienté vers la production d’acétone, d’éthanol et de n-butanol. Ack, acétate kinase ; Adc, acétoacétate décarboxylase ; Adh, alcool déshydrogénase ; Ald, aldéhyde déshydrogénase ; Aldc, acétolactate décarboxylase ; Als, acétolactate synthase ; Bcd, butyryl-CoA déshydrogénase ; Buk, butyrate kinase ; CtfA-CtfB, butyrate-acétoacétate CoA-transférase (sous-unités A et B) ; Crt, crotonase ; EtfA-EtfB, flavoprotéine de transfert d'électrons (sous-unités α et β) ; Fnor, ferrédoxine-NAD(P)+ oxydoréductase ; Hbd, 3-hydroxybutyryl-CoA déshydrogénase ; HydA, hydrogénase ; Ldh, lactate déshydrogénase ; Pdc, pyruvate décarboxylase ; Pfor, pyruvate ferrédoxine oxydoréductase ; Pta, phosphate acétyltransférase ; Ptb, phosphate butyryltransférase ; Thl, thiolase. EXEMPLES EXEMPLE n°1 : Souche C. acetobutylicum produisant un mélange de propan-2-ol et d’éthanol Matériels et méthodes Conditions de culture C. acetobutylicum DSM 792 (Deutsche Sammlung von Mikroorganismen und Zellkulturen, DSMZ) et C. beijerinckii DSM 6423 (DSMZ) ont été cultivées à 34°C en conditions anaérobies (90 % N2, 5 % CO2, 5 % N2) en milieu 2YTG (tryptone 16 g.L-1, extrait de levure 10 g.L-1, glucose 5 g.L-1, NaCl 4 g.L-1). Escherichia coli NEB 10-beta (New England Biolabs, NEB) a été cultivée à 37°C en conditions aérobies en milieu LB (tryptone 10 g.L-1, extrait de levure 5 g.L-1, NaCl 10 g.L-1). Les milieux solides ont été réalisés en ajoutant 15 g.L-1 d’agarose aux milieux liquides. Si nécessaire, de l’érythromycine (Em, 40 mg.L-1) et/ou du thiamphénicol (Tm, 15 mg.L-1) ont été utilisés pour les cultures de C. acetobutylicum. De même, du chloramphénicol (12,5 mg.L-1 en milieu liquide et 25 mg.L-1 en milieu solide) et/ou de la tétracycline (20 mg.L-1) ont été utilisés pour les cultures d’E. coli. Acides nucléiques et vecteurs plasmidiques La liste des plasmides utilisés est présentée dans le Tableau 1 ci-dessous. Tableau 1 : Plasmides Caractéristiquesa pEC500E (SEQ ID NO : 25) ermB, bla, ColE1, pAMB1 pFC002 (SEQ ID NO : 2) Dérivé de pEC500E avec insertion du gène adh (Collas F. et al.) pCas9acr (SEQ ID NO : 27) ermB, ColE1, pCB102, Pcm- tetO2/1-cas9, Pbgal-acrIIA4, tetR, bgaR (Wasels F. et al., 2020) pGRNAind (SEQ ID NO : 28) catP, ColE1, pIP404, cassette d’expression d’ARNg (promoteur Pcm-2tetO1) (Wasels F. et al., 2020) pAN2 (SEQ ID NO : 29) tetA, p15A ori, Φ3TI (Heap JT et al.) pGRNA-hbd (SEQ ID NO : 30) Dérivé de pGRNAind, ciblant hbd pGRNA-Δhbd (SEQ ID NO : 31) Dérivé de pGRNA-hbd, avec matrice d’édition Δhbd pGRNA-bdhB (SEQ ID NO : 32) Dérivé de pGRNAind, ciblant bdhB (Wasels F. et al., 2020) pGRNA-ΔbdhB::adh (SEQ ID NO : 33) Dérivé de pGRNA-bdhB, avec matrice d’édition ΔbdhB::adh pGRNA-CA_C0764 (SEQ ID NO : 34) Dérivé du pGRNAind, ciblant CA_C0764 pGRNA-ΔCA_C0764 (SEQ ID NO : 35) Dérivé de pGRNA-bdhC, avec matrice d’édition ΔCA_C0764 aermB, gène de résistance à l’érythromycine ; catP, gène de résistance au thiamphénicol et au chloramphénicol ; tetA, gène de résistance à la tétracycline ; ColE1 et p15A ori, origines de réplication chez E. coli ; pIP404, pAMB1 et pCB102, origines de réplication chez C. acetobutylicum. Les acides nucléiques manipulés ont été purifiés à l’aide des kits QIAquick PCR Purification Kit (Qiagen), QIAprep Spin Miniprep Kit (Qiagen) et GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich). Les amplifications PCR ont été réalisées avec la Q5 High-Fidelity DNA Polymerase (NEB). Les oligonucléotides utilisés pour la construction des plasmides sont présentés dans le Tableau 2 ci-dessous. Tableau 2 : Oligonucléotide Séquence (5’-3’) P01 (SEQ ID NO : 1) TCATACTTGGAGCTAATCACCCAA P02 (SEQ ID NO : 2) AAACTTGGGTGATTAGCTCCAAGT P03 (SEQ ID NO : 3) ATGCATGTCGACCAAAATCCTTCTCTGTAAATTCATG P04 (SEQ ID NO : 4) GAAAAAGGTATATTCAAAATAAGTTTACAAGAATCCCC P05 (SEQ ID NO : 5) ATTTTGAATATACCTTTTTCATTAAACAGACCTCC P06 (SEQ ID NO : 6) ATGCATGAATTCTGCAAATGTTTCTGATGATAAAATAG P07 (SEQ ID NO : 7) ATTCGAGCTCGGTACCCGGGGATCCAAAAACTGTAGTAAACGAACCCAAA AAGAAAGTTTC P08 (SEQ ID NO : 8) GTTATATTATAAACCTACCGGGGTTTGGGC P09 (SEQ ID NO : 9) AACCTTTCATTTTAACCCCTCCTGTTTAG P10 (SEQ ID NO : 10) CAAGCTTGCATGCCTGCAGGTCGACTAGCAGAAGCAATCTTAAG P11 (SEQ ID NO : 11) CCCGGTAGGTTTATAATATAACTACTGCTTTAATTAAGTC P12 (SEQ ID NO : 12) AGGGGTTAAAATGAAAGGTTTTGCAATGC P13 (SEQ ID NO : 13) TCATATAGTTGGAGGAGGTCCAGC P14 (SEQ ID NO : 14) AAACGCTGGACCTCCTCCAACTAT P15 (SEQ ID NO : 15) AAAAAAGTCGACATGCATTCGATGTAATGTACTTCAGA P16 (SEQ ID NO : 16) AATTTAATTATTGTTATCCATAATAATTAATATCTCTCCTTTT P17 (SEQ ID NO : 17) TATGGATAACAATAATTAAATTAATTTGAAGTGAAATTTGGA P18 (SEQ ID NO : 18) AAAAAAGGATCCCGCATTTATTAAAGACATTTGACCCC Le plasmide pGRNA-hbd (SEQ ID NO : 30) a été construit en clonant le produit d’hybridation des oligonucléotides P01 et P02 dans le pGRNAind (SEQ ID NO : 28) à l’aide de BsaI et de la T4 DNA ligase (NEB). Le fragment obtenu par PCR chevauchante des amplifications obtenues à partir de l’ADNg de DSM 792 à l’aide des couples d’oligonucléotides P03-P04 et P05-P06 a été cloné au niveau des sites BamHI et SalI dans le pGRNA-hbd pour obtenir pGRNA-∆hbd (SEQ ID NO : 31). Le fragment obtenu par PCR chevauchante des amplifications obtenues à partir de l’ADNg de DSM 792 à l’aide des couples d’oligonucléotides P07-P08 et P09-P10 et à partir de l’ADNg de DSM 6423 à l’aide du couple d’oligonucléotides P11-P12 a été cloné au niveau des sites BamHI et SalI dans le pGRNA-bdhB (SEQ ID NO : 32) pour obtenir pGRNA-∆bdhB::adh (SEQ ID NO : 33). Le plasmide pGRNA-CA_C0764 (SEQ ID NO : 34) a été construit en clonant le produit d’hybridation des oligonucléotides P13 et P14 dans le pGRNAind. Le fragment obtenu par PCR chevauchante des amplifications obtenues à partir de l’ADNg de DSM 792 à l’aide des couples d’oligonucléotides P15-P16 et P17-P18 a été cloné au niveau des sites BamHI et SalI dans le pGRNA-CA_C0764 pour obtenir le pGRNA-∆CA_C0764 (SEQ ID NO : 35). Edition génétique Les constructions plasmidiques ont été introduites dans C. acetobutylicum comme décrit par Mermelstein LD et al.. Les événements d’édition génétique ont été réalisés selon le protocole décrit par Wasels F. et al. (2020) et Wasels F. et al. (2017). Les oligonucléotides utilisés pour la confirmation des éditions génétiques sont présentés dans le Tableau 3 ci-dessous. Tableau 3 : Locus Oligonucléotide Séquence (5’-3’) hbd P19 (SEQ ID NO : 19) GTAATATTATAGCAGCTATTTTAAGTTTAC P20 (SEQ ID NO : 20) AAAGGTAAGGAAATGGCTGAG bdhB P21 (SEQ ID NO : 21) ACACATTGAAGGGAGCTTTT P22 (SEQ ID NO : 22) GGCAACAACATCAGGCCTTT CA_C0764 P25 (SEQ ID NO : 23) TGTTCATCGGTAACCTGTTCA P26 (SEQ ID NO : 24) ACGAAATGCCCAACTTGCAA L’emploi d’autres outils génétiques, telle que ceux basés sur la recombinaison homologue ou l’insertion d’éléments génétiques mobiles, peut permettre d’obtenir des mutants possédant des génotypes équivalents, i.e. n’exprimant plus les produits des gènes hbd, bdhB ou CA_C0764, ou exprimant une version non fonctionnelle de ceux-ci. Fermentation Les performances fermentaires des micro-organismes décrits dans cet exemple ont été évaluées en batch. Des précultures ont été réalisées en chambre anaérobie dans un volume de 1 mL de milieu CGM (KH2PO4 0,75 g.L-1, K2HPO40,75 g.L-1, MgSO4∙H2O 0,4 g.L-1, MnSO4∙H2O 0,01 g.L-1, FeSO4∙7H2O 0,01 g.L-1, NaCl 1,0 g.L-1, Asparagine 2,0 g.L-1, Extrait de levure 5,0 g.L-1, (NH4)2SO42,0 g.L-1, Glucose 80 g.L-1). Après une incubation de 18h, un volume de 500 µL de ces précultures a été utilisé pour inoculer 9,5 mL de milieu CGM dans des fioles. Une fois serties, ces dernières ont ensuite été incubées pendant 96h à 34°C, 100 rpm. En fin de fermentation, des échantillons ont été centrifugés à 5000 g pendant 5 minutes, et les surnageants ont été dilués à l’aide d’un standard interne (concentration finale de 0,5 g.L-1 de n-propanol) puis filtrés à 0,22 µm avant d’être analysés par chromatographie. La détection des solvants a été réalisée par chromatographie en phase gazeuse sur une colonne PoraBOND-Q (Agilent Technologies) avec un détecteur à ionisation de flamme. L’hélium a été utilisé comme gaz vecteur à un débit de 1,6 mL.min-1, et la colonne chauffée de 50 à 250°C au cours d’un run de 30 min. La détection des acides a été réalisée par chromatographie en phase liquide à haute performance sur une colonne Aminex HPX-87H (Biorad) couplée à un refractomètre Spectra System RI-150 et un détecteur UV Waters 2487 dual λ réglé à 210 nm. La phase mobile consistait en une solution d’acide sulfurique 0,1 M, et la température de la colonne a été fixée à 60°C. Sauf mention contraire, les résultats présentés sont la moyenne d’au moins trois essais indépendants. Résultats Un mutant Δhbd a été construit dans la souche DSM 792 de C. acetobutylicum. Les performances fermentaires de ce mutant par rapport à la souche sauvage sont présentées dans le tableau 4 ci-dessous. Tableau 4 : Souches Solvants (g.L-1) Ethanol Acétone Propan-2-ol n-Butanol Total DSM 792 1,1 ± 0,2 8,6 ± 0,8 0,1 ± 0,0 12,3 ± 0,7 22,1 ± 0,4 Δhbd 33,3 ± 1,3 2,9 ± 0,2 0,0 ± 0,0 0,0 ± 0,0 36,3 ± 1,5 Acides (g.L-1) Ac. acétique Ac. Butyrique Ac. Lactique Total DSM 792 1,6 ± 0,5 1,6 ± 0,5 0,0 ± 0,0 3,1 ± 1,0 Δhbd 0,7 ± 0,0 0,0 ± 0,0 0,5 ± 0,0 1,3 ± 0,0 Comme attendu, ce mutant n’est plus capable de produire de n-butanol ni de butyrate. Il permet la production de quantités importantes d’éthanol, qui devient son produit de fermentation largement majoritaire. La quantité d’acétone produite est diminuée de plus de 65% par rapport à la souche sauvage. Afin de transformer ce mutant en un producteur de propan-2-ol, le plasmide pFC002 (SEQ ID NO : 26) a été introduit dans ce mutant. Les performances fermentaires de transformants de la souche sauvage et du mutant Δhbd contenant le plasmide vide pEC500E (SEQ ID NO : 25) ou le plasmide pFC002 (SEQ ID NO : 26) sont présentées dans le tableau 5 ci-dessous. Tableau 5 : Souches Solvants (g.L-1) Ethanol Acétone Propan-2-ol n-Butanol Total DSM 792 1,4 ± 0,0 7,2 ± 0,1 0,1 ± 0,0 13,9 ± 0,3 22,7 ± 0,4 pEC500E DSM 792 1,5 0,1 7,5 16,2 25,4 pFC002* Δhbd pEC500E 32,9 ± 0,5 4,4 ± 0,1 0,0 ± 0,0 0,0 ± 0,0 37,3 ± 0,4 Δhbd pFC002* 35,7 0,2 2,3 0,0 38,2 Acides (g.L-1) Ac. acétique Ac. Butyrique Ac. Lactique Total DSM 792 1,0 ± 0,1 1,3 ± 0,1 0,0 ± 0,0 2,3 ± 0,1 pEC500E DSM 792 1,5 2,5 0,0 4 pFC002* Δhbd pEC500E 0,5 ± 0,1 0,0 ± 0,0 0,0 ± 0,0 0,5 ± 0,1 Δhbd pFC002* 0,8 0,0 0,0 0,8 * Les clones DSM 792 pFC002 et Δhbd pFC002 n’ont pas été testés en duplicata Le plasmide pFC002 (SEQ ID NO : 26) contenant le gène adh de C. beijerinckii DSM 6423 permet de transformer la souche sauvage DSM 792 ainsi que le mutant ∆hbd en producteurs de propan-2-ol. Il est à noter que la quantité de propan-2-ol produite par le mutant ∆hbd contenant le plasmide pFC002 est deux fois inférieure à la quantité d’acétone produite par ce même mutant contenant le plasmide vide pEC500E. Il apparait donc que la combinaison de la délétion du gène hbd et de l’expression du gène adh de C. beijerinckii DSM 6423 dans C. acetobutylicum DSM 792 ne permet pas d’obtenir un producteur de propan- 2-ol performant. Afin d’obtenir un mutant dérivé de ∆hbd produisant de l’isopropanol en l’absence de pression de sélection, un mutant Δhbd ΔbdhB::adh a été construit. Le gène bdhB (SEQ ID NO : 36) code une alcool déshydrogénase NADPH-dépendante. Les performances fermentaires de ce mutant sont présentées dans le tableau 6 ci-dessous. Tableau 6 : Souches Solvants (g.L-1) Ratio Propan- Ethanol Acétone Propan-2-ol Total 2-ol/Ethanol Δhbd 33,3 ± 1,3 2,9 ± 0,2 0,0 ± 0,0 36,3 ± 1,5 0,00 Δhbd pFC002* 35,7 0,2 2,3 38,2 0,06 Δhbd 27,9 ± 1,7 0,1 ± 0,0 7,2 ± 0,5 35,2 ± 2,2 0,26 ΔbdhB::adh Acides (g.L-1) Ac. acétique Ac. Butyrique Ac. Lactique Total Δhbd 0,7 ± 0,0 0,0 ± 0,0 0,5 ± 0,0 1,3 ± 0,0 Δhbd pFC002* 0,8 0,0 0,0 0,8 Δhbd 0,8 ± 0,1 0,0 ± 0,0 1,2 ± 0,2 2,0 ± 0,3 ΔbdhB::adh * Le clone Δhbd pFC002 n’a pas été testé en duplicata De manière surprenante, cette modification permet d’améliorer le ratio propan-2-ol/éthanol par rapport au mutant Δhbd contenant le plasmide pFC002, qui est multiplié par un facteur 4. D’autres modifications ont été envisagées afin d’améliorer encore le ratio C3 (acétone + propan-2-ol) /C2 (éthanol). En particulier, les performances fermentaires d’un mutant dérivant de Δhbd ΔbdhB::adh, dans lequel le gène CA_C0764 (SEQ ID NO : 37) codant une pyruvate NADP ferrédoxine oxydoréductase est délété, sont présentées dans le tableau 7. Tableau 7 : Souches Solvants (g.L-1) Ratio C3/C2 Ethanol Acétone Propan-2-ol Total Δhbd 33,3 ± 1,3 2,9 ± 0,2 0,0 ± 0,0 36,3 ± 1,5 0,09 Δhbd 27,9 ± 1,7 0,1 ± 0,0 7,2 ± 0,5 35,2 ± 2,2 0,26 ΔbdhB ::adh Δhbd 17,9 ± 0,6 4,3 ± 0,1 9,7 ± 0,2 32,0 ± 0,9 0,78 ΔbdhB ::adh ΔCA_C0764 Acides (g.L-1) Ac. Acétique Ac. Butyrique Ac. Lactique Total Δhbd 0,7 ± 0,0 0,0 ± 0,0 0,5 ± 0,0 1,3 ± 0,0 Δhbd 0,8 ± 0,1 0,0 ± 0,0 1,2 ± 0,2 2,0 ± 0,3 ΔbdhB ::adh Δhbd 1,3 ± 0,2 0,0 ± 0,0 0,0 ± 0,0 1,3 ± ,0,2 ΔbdhB ::adh ΔCA_C0764 Le ratio C3 (acétone + propan-2-ol) /C2 (éthanol) est amélioré d’un facteur 3 dans le mutant Δhbd ΔbdhB::adh ΔCA_C0764 par rapport au mutant Δhbd ΔbdhB::adh et d’un facteur 9 par rapport au mutant Δhbd. Par ailleurs, ce mutant produit une quantité plus importante de propan-2-ol que la souche DSM 792 contenant le plasmide pFC002 (Tableau 6). Conclusions Les résultats présentés dans cet exemple décrivent l’obtention de mutants de C. acetobutylicum ne produisant plus de butanol ni de butyrate et produisant un mélange propan-2-ol/éthanol avec un ratio C3/C2 avantageux, largement amélioré par rapport au mutant ∆hbd décrit dans la littérature. REFERENCES - Collas F, Kuit W, Clément B, Marchal R, López-Contreras AM, Monot F.2012. Simultaneous production of isopropanol, butanol, ethanol and 2,3-butanediol by Clostridium acetobutylicum ATCC 824 engineered strains. AMB Expr 2:45. doi:10.1186/2191-0855-2-45. - Dusséaux S, Croux C, Soucaille P, Meynial-Salles I. 2013. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for the high-yield production of a biofuel composed of an isopropanol/butanol/ethanol mixture. Metabolic Engineering 18:1–8. doi:10.1016/j.ymben.2013.03.003. - Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. 2007. The ClosTron: a universal gene knock-out system for the genus Clostridium. Journal of Microbiological Methods 70:452–464. doi:10.1016/j.mimet.2007.05.021. - Ismaiel AA, Zhu CX, Colby GD, Chen JS.1993. Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J Bacteriol 175:5097–5105. doi:10.1128/jb.175.16.5097-5105.1993. - Lee J, Jang Y-S, Choi SJ, Im JA, Song H, Cho JH, Seung DY, Papoutsakis ET, Bennett GN, Lee SY. 2012. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Applied and Environmental Microbiology 78:1416–1423. doi:10.1128/AEM.06382-11. - Lehmann D, Lütke-Eversloh T. 2011. Switching Clostridium acetobutylicum to an ethanol producer by disruption of the butyrate/butanol fermentative pathway. Metabolic Engineering 13:464–473. doi:10.1016/j.ymben.2011.04.006. - Mermelstein LD, Papoutsakis ET. 1993. In vivo methylation in Escherichia coli by the Bacillus subtilis phage phi 3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Applied and Environmental Microbiology 59:1077–1081. doi:10.1128/aem.59.4.1077-1081.1993 - Wasels F, Jean-Marie J, Collas F, López-Contreras AM, Lopes Ferreira N.2017. A two-plasmid inducible CRISPR/Cas9 genome editing tool for Clostridium acetobutylicum. Journal of Microbiological Methods 140:5–11. doi:10.1016/j.mimet.2017.06.010. - Wasels F, Chartier G, Hocq R, Lopes Ferreira N. 2020. A CRISPR/Anti-CRISPR Genome Editing Approach Underlines the Synergy of Butanol Dehydrogenases in Clostridium acetobutylicum DSM 792. Applied and Environmental Microbiology 86. doi:10.1128/AEM.00408-20.

Claims

REVENDICATIONS 1. Bactérie modifiée génétiquement appartenant au genre Clostridium, caractérisée en ce que i) elle n’exprime pas les produits des gènes hbd de séquence SEQ ID NO : 39 et bdhB de séquence SEQ ID NO : 36, ou exprime des versions non fonctionnelles de ceux-ci, et ii) elle exprime le gène adh de C. beijerinckii de séquence SEQ ID NO : 38. 2. Bactérie selon la revendication 1, caractérisée en ce que la bactérie n’exprime pas le gène CA_C0764 de séquence SEQ ID NO : 37. 3. Bactérie selon la revendication 1 ou 2, caractérisée en ce que la bactérie est une bactérie solvantogène, de manière préférée C. acetobutylicum. 4. Bactérie selon la revendication 3, caractérisée en ce que la bactérie est la souche IFP970 enregistrée le 17 février 2023 sous le numéro LMG P-32994 auprès de la collection BCCM-LMG, ou version génétiquement modifiée de celle-ci produisant un ratio C3 (acétone + propan-2-ol) / C2 (éthanol) supérieur à celui d’une souche Δhbd. 5. Bactérie selon la revendication 3, caractérisée en ce que la bactérie est la souche IFP971 enregistrée le 17 février 2023 sous le numéro LMG P-32995 auprès de la collection BCCM-LMG ou version génétiquement modifiée de celle-ci produisant un ratio C3 (acétone + propan-2-ol) / C2 (éthanol) supérieur à celui d’une souche Δhbd. 6. Utilisation d’une bactérie selon la revendication 1 pour obtenir une bactérie selon la revendication 2. 7. Utilisation de la bactérie modifiée génétiquement selon l’une des revendications 1 à 5, pour produire du propan-2-ol ou un mélange comprenant du propan-2-ol et de l’éthanol, de préférence à l’échelle industrielle. 8. Procédé de fermentation impliquant l’utilisation d’une bactérie telle que décrite dans l’une quelconque des revendications 1 à 5. 9. Kit pour produire du propan-2-ol, ou un mélange de propan-2-ol et d’éthanol, à l’aide d’une bactérie appartenant au genre Clostridium, comprenant une bactérie modifiée génétiquement appartenant au genre Clostridium selon l’une quelconque des revendications 1 à 5 et un milieu de conservation ou de culture de ladite bactérie.
EP24722061.9A 2023-03-31 2024-03-29 Bacteries clostridium modifiees produisant du propan-2-ol, preparation et utilisations de celles-ci Pending EP4689058A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR2303222A FR3147287A1 (fr) 2023-03-31 2023-03-31 Bacteries clostridium modifiees produisant du propan-2-ol, preparation et utilisations de celles-ci
PCT/FR2024/050414 WO2024200979A1 (fr) 2023-03-31 2024-03-29 Bacteries clostridium modifiees produisant du propan-2-ol, preparation et utilisations de celles-ci

Publications (1)

Publication Number Publication Date
EP4689058A1 true EP4689058A1 (fr) 2026-02-11

Family

ID=88146971

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24722061.9A Pending EP4689058A1 (fr) 2023-03-31 2024-03-29 Bacteries clostridium modifiees produisant du propan-2-ol, preparation et utilisations de celles-ci

Country Status (5)

Country Link
EP (1) EP4689058A1 (fr)
CN (1) CN121100174A (fr)
FR (1) FR3147287A1 (fr)
TW (1) TW202444890A (fr)
WO (1) WO2024200979A1 (fr)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR3042506B1 (fr) 2015-10-16 2018-11-30 IFP Energies Nouvelles Outil genetique de transformation de bacteries clostridium
FR3096373B1 (fr) * 2019-05-24 2024-09-13 Ifp Energies Now Outil genetique optimisé pour modifier les bacteries

Also Published As

Publication number Publication date
CN121100174A (zh) 2025-12-09
WO2024200979A1 (fr) 2024-10-03
FR3147287A1 (fr) 2024-10-04
TW202444890A (zh) 2024-11-16

Similar Documents

Publication Publication Date Title
EP3362559B1 (fr) Outil genetique de transformation de bacteries clostridium
US9359611B2 (en) Recombinant microorganism and methods of production thereof
JP6302471B2 (ja) 組換え微生物およびその使用
US9284580B2 (en) Metabolic engineering of clostridium tyrobutyricum for butanol production
FR3081881A1 (fr) Outil genetique optimise pour modifier les bacteries du genre clostridium
JP2013505739A (ja) 乳酸菌におけるアセト乳酸誘導生成物への改善されたフラックス
Berezina et al. Microbial producers of butanol
EP2766332B1 (fr) Production d'isopropanol par des souches recombinantes ameliorees
CN114901827A (zh) 在乙酰乳酸脱羧酶基因座敲入的微生物
WO2016192871A1 (fr) Souches mutantes du genre clostridium beijerinckii
EP3898970A1 (fr) Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci
Zhang et al. Engineering Corynebacterium glutamicum mutants for 3-methyl-1-butanol production
EP4689058A1 (fr) Bacteries clostridium modifiees produisant du propan-2-ol, preparation et utilisations de celles-ci
WO2020240122A1 (fr) Outil genetique optimisé pour modifier les bacteries
FR3160415A1 (fr) Bacteries clostridium modifiees produisant de l’ethanol, preparation et utilisations de celles-ci
CN104204206A (zh) 一种用于生产丁醇的方法
CA2880181C (fr) Micro-organisme recombine ayant une capacite accrue pour produire du butanol, et procede de production de butanol utilisant ledit micro-organisme
WO2024200980A1 (fr) Bacteries clostridium modifiees, outil d'edition genetique du plasmide psol de bacteries clostridium, et utilisations
FR3137108A1 (fr) Bacteries clostridium modifiees pour assimiler plusieurs sucres simultanement, preparation et utilisations de celles-ci
CA3001815C (fr) Outil genetique de transformation de bacteries clostridium

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20251028

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR