Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/06—Antihyperlipidemics
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/18—Carboxylic ester hydrolases (3.1.1)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y301/00—Hydrolases acting on ester bonds (3.1)
  • C12Y301/01—Carboxylic ester hydrolases (3.1.1)
  • C12Y301/01034—Lipoprotein lipase (3.1.1.34)
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/07—Animals genetically altered by homologous recombination
  • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/10—Mammal
  • A01K2227/105—Murine
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/03—Animal model, e.g. for test or diseases
  • A01K2267/035—Animal model for multifactorial diseases
  • A01K2267/0362—Animal model for lipid/glucose metabolism, e.g. obesity, type-2 diabetes
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
  • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
  • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
  • C12N2710/00011—Details
  • C12N2710/10011—Adenoviridae
  • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
  • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
  • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

• the present disclosure relates generally to nucleic acid expression constructs for expressing lipoprotein lipase. More particularly, the present disclosure relates to improved recombinant expression constructs and viral particles for expression of human lipoprotein lipase, for treatment of lipoprotein lipase deficiency (LPLD).
• LPLD lipoprotein lipase deficiency
• LPL Lipoprotein lipase
• Tg triglycerides
• VLDL very low-density lipoproteins
• LPLD lipoprotein lipase deficiency
• type I hyperlipoproteinemia is a rare monogenetic autosomal recessive disease characterized by mutations within the LPL gene that results in a complete lack of catalytically active LPL protein 4-6 .
• LPLD is characterized by severe accumulation of chylomicrons within the blood, resulting in plasma lactescence (milky plasma) and hypertriglyceridemia (HTG) 4-6 .
• Prolonged HTG is a key factor associated with disease progression and the cause of severe complications, including hepatosplenomegaly, eruptive xanthomas, unbearable abdominal pain, leading to potentially lethal episodes of pancreatitis, chronic pancreatic insufficiency and diabetes 4-6 .
• AAV is a non-pathogenic virus that is commonly used as a vector to safely and effectively deliver exogenous genetic material in an in vivo setting 13-15 .
• GlyberaTM is a AAV gene replacement therapy product for the treatment of LPLD in adult patients suffering from severe recurrent pancreatitis attacks despite strict dietary fat restrictions. GlyberaTM was administered via a series of intramuscular (IM) injections in order to deliver a functional copy of a LPL transgene within skeletal muscle, which is one of the natural sites of LPL production.
• IM intramuscular
• GlyberaTM comprised of a protein shell derived from adeno-associated virus serotype 1 (AAV1), a cytomegalovirus (CMV) promoter driving a human LPL S447X (hLPL S447X ) transgene, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) and two flanking adeno-associated virus serotype 2 (AAV2)-derived inverted terminal repeats (ITR).
• GlyberaTM delivered a naturally occurring, gain of function hLPL S447X variant, present in approximately 20-25% of the general population 16-18 .
• the hLPL S447X variant is associated with increased lipolytic function via increased lipoprotein uptake, along with an anti-atherogenic, cardio-protective lipid profile resulting in decreased plasma Tg and increased high-density lipoprotein cholesterol 9 ’ 11 ’ 16-19 .
• GlyberaTM was produced using insect cells and recombinant baculovirus technology and was priced at approximately $1.2 million USD per patient. Due to economic considerations, potentially related to the use small-scale manufacturing processes, GlyberaTM was withdrawn from the market in 2017. Since the original development of GlyberaTM, there have been tremendous advances in the understanding of AAV biology and in the development of more efficient large-scale AAV manufacturing processes.
• a recombinant nucleic acid molecule for expressing human lipoprotein lipase comprising the gain of function mutation S447X (hLPL S447X ) or a polypeptide having at least 80% sequence identity thereto and comprising the mutation S447X
• the recombinant nucleic acid molecule comprising: a transcriptional unit comprising: a promoter for driving expression of the hLPL S447X or the polypeptide having at least 80% sequence identity thereto, the promoter comprising the sequence of any one of SEQ ID NOs: 13 to 16 or a sequence having at least 80% sequence identity thereto, a coding nucleic acid that encodes the hLPL S447X or the polypeptide having at least 80% sequence identity thereto, and a polyadenylation signal
• the recombinant nucleic acid molecule optionally comprises a truncated WPRE comprising the sequence of S
• a vector comprising the recombinant nucleic acid molecule as defined herein.
• the vector is a plasmid vector.
• the plasmid is an adeno-associated virus (AAV) transfer plasmid.
• AAV adeno-associated virus
• a host cell comprising the nucleic acid molecule as defined herein.
• the host cell is a cell line.
• the host cell is a human cell.
• the host cell is a human cell line.
• a recombinant viral particle comprising the recombinant nucleic acid molecule as defined herein.
• rAAV recombinant AAV viral particle
• composition comprising the recombinant nucleic acid molecule as defined herein, the vector as described herein, the recombinant viral particle as described herein, or the rAAV as described herein together with an acceptable excipient, diluent, or carrier.
• a pharmaceutical composition comprising the recombinant nucleic acid molecule as defined herein, the vector as described herein, the recombinant viral particle as described herein, or the rAAV as described herein together with a pharmaceutically acceptable excipient, diluent, or carrier.
• a method of delivering the recombinant nucleic acid molecule as defined herein to a cell comprising contacting the cell with the vector or the recombinant viral particle as defined herein.
• a method of delivering the recombinant nucleic acid molecule as defined herein to a cell comprising contacting the cell with the rAAV as defined herein.
• a method of treating plasma lipidemia comprising administering to a subject the rAAV as defined herein.
• a method of treating lipoprotein lipase deficiency in a subject comprising administering to a subject the rAAV as defined herein.
• a use for delivering the recombinant nucleic acid molecule as defined herein to a cell, of the vector or the recombinant viral particle as defined herein.
• rAAV as defined herein for delivering the recombinant nucleic acid molecule as defined herein.
• rAAV as defined herein for treatment of plasma lipidemia.
• rAAV as defined herein for treatment of lipoprotein lipase deficiency in a subject.
• the rAAV as defined here for use in treatment of plasma lipidemia in a subject.
• the rAAV as defined here for use in treatment of lipoprotein lipase deficiency in a subject.
• the rAAV is for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
• kits for use in delivering the recombinant nucleic acid molecule as defined herein to a cell comprising the vector or the recombinant viral particle as defined herein together with instructions for delivery to a cell.
• kits for use in treatment of plasma lipidemia comprising the rAAV as defined herein together with instructions for treatment of plasma lipidemia.
• kits for use for treatment of lipoprotein lipase deficiency in a subject comprising the rAAV as defined herein together with instructions for treatment of lipoprotein lipase deficiency.
• a method of producing recombinant AAV viral particles comprising transfecting cells with a transfer plasmid comprising the recombinant nucleic acid molecule as defined herein, wherein the cells express AAV components required for packaging the recombinant nucleic acid molecule into rAAV particles, culturing the cells to produce the rAAVs, and isolating the rAAVs.
• Figure 1 depicts a structural diagram of the adenovirus (adenovirus serotype 5 [Ad5]) vector expression cassette encoding hLPL S447X (AdV-hLPL S447X ) used for rescue of LPL-/- pups (C.O, codon-optimized; ITR; inverted terminal repeat; ⁇ P, packaging signal).
• Figure 2 depicts structural diagrams of novel AAV serotypes and expression cassettes encoding luciferase (luc) (ITR; inverted terminal repeat, WPRE, Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element; hGH, human growth hormone).
• luc luciferase
• WPRE inverted terminal repeat
• WPRE Woodchuck Hepatitis Virus
• hGH human growth hormone
• Figure 3 depicts structural diagrams of novel AAV serotypes and expression cassettes encoding hLPLS447X tested in LPL-/- mice (C.O, codon-optimized; ITR; inverted terminal repeat, WPRE, Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element; bGH, bovine growth hormone; hGH, human growth hormone).
• C.O codon-optimized
• ITR inverted terminal repeat
• WPRE Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element
• bGH bovine growth hormone
• hGH human growth hormone
• Figure 4 provides a study overview summarizing the experimental protocol in which 6- 8 week old (w.o) wild-type mice were treated with novel AAV-luciferase formulations and followed for 60 days post-AAV treatment, with bioluminescence imaging (BLI) at the indicated timepoints.
• Figure 10 shows a study overview summarizing the experimental protocol in which primary human muscle skeletal cells (HSkMCs) were differentiated into myotubes and infected with novel AAV-hLPL S447X formulations or Glybera at a MOI of 1x10 5 gc/cell in 96-well plates and assessed for LPL expression and activity 4 days following infection.
• HSkMCs primary human muscle skeletal cells
• Figure 11 depicts hLPL protein expression in primary human myotubes infected with AAV-hLPL S447X formulations, a vehicle control, or Glybera.
• Figure 14 depicts a study overview summarizing an experimental protocol in which mouse C2C12 myoblasts were differentiated into myotubes and infected with novel AAV- hLPL S447X formulations or Glybera at a MOI of 1x10 5 gc/cell in 96-well plates and assessed for LPL expression and activity 4 days following infection.
• Figure 15 depicts hLPL protein expression in mouse C2C12 myotubes infected with AAV-hLPL S447X formulations, a vehicle control, or Glybera.
• Figure 18 depicts a study overview summarizing an experimental protocol in which HepG2 cells were infected with novel AAV-hLPL S447X formulations, a vehicle control, or Glybera at a MOI of 1x10 5 gc/cell in 96-well plates and assessed for LPL expression and activity 3 days following infection.
• Figure 19 depicts hLPL protein expression in HepG2 cells infected with AAV-hLPL S447X formulations, a vehicle control, or Glybera.
• Figure 23 depicts plasmid triglyceride levels in LPL+/+ pups at 24 hours after birth and LPL-/- pups at 24 and 48 hours after birth.
• One-way ANOVA Fisher’s
• LSD p ⁇ 0.05 * vs LPL+/+ 24h, # vs LPL-/-24h).
• Figure 24 depicts plasmid cholesterol levels in LPL+/+ pups at 24 hours after birth and LPL-/- pups at 24 and 48 hours after birth.
• One-way ANOVA Fisher’s
• LSD p ⁇ 0.05 * vs LPL+/+ 24h, # vs LPL-/-24h).
• Figure 28 depicts a study overview summarizing an experimental protocol in which LPL- /- mice were rescued at birth with an intramuscular injection of AdV-hLPL S447X , treated with novel AAV-hLPL S447X formulations at 2-3 months (m.o) of age, and followed for 80 post-AAV treatment, with blood samples being routinely collected at the indicated timepoints.
• One-way ANOVA Fisher’s
• LSD p ⁇ 0.05 * vs vehicle-treated LPL-/- mice, # vs Glybera).
• One-way ANOVA Fisher’s
• LSD p ⁇ 0.05 * vs vehicle-treated LPL-/- mice, # vs Glybera).
• One-way ANOVA Fisher’s
• LSD p ⁇ 0.05 * vs vehicle-treated LPL-/- mice,
• One-way ANOVA Fisher’s LSD: p ⁇ 0.05 * vs Glybera).
• Figure 49 depicts Western blots showing LPL protein expression in the quad and liver of LPL-/- mice treated with control vehicle, Glybera at high dose (1x10 12 gc/kg) or AAV8 pVR59 administered at the indicated doses via IM, IV, or SQ-flank and SQ-hock
• One-way ANOVA Fisher’s
• LSD p ⁇ 0.05 * vs vehicle-treated LPL-/- mice, # vs Glybera administered via the same route of administration.
• Figure 52 depicts a schematic and experimental results for constructs bearing deletions of WPRE.
• Panel A shows a schematic representation of AAV8 pVR80 with deletion of WPRE compared to AAV8 pVR59.
• Panel B shows intracellular hLPLS447X protein expression in mouse myotubes treated with AAV8 pVR80 or AAV8 pVR59, with relative signal intensity quantified using densitometry relative to expression in vehicle treatment shown Panel C.
• Panel D shows secreted hLPLS447X protein expression, while Panel E shows lipolytic hLPLS447X activity in conditioned media from mouse myotubes treated with AAV8 pVR80 or AAV8 pVR59.
• Figure 53 depicts plasma samples from a LPLD +/+ mice or a mouse model of LPLD (LPL-/- mice) following intramuscular administration of control vehicle, AAV8 pVR80, or AAV8 pVR59 at 1x10 12 gc/kg, showing correction of visible hyperlipidemia in mice treated with AAV8 pVR59 or AAV8 pVR80.
• Figure 54 depicts (top graph) correction of plasma triglycerides (Tg) levels following IM treatment with vehicle control, AAV8 pVR80, or AAV8 pVR59 at the indicated doses in LPL-/- mice; and (bottom graph) correction of plasma cholesterol levels (Tc) following IM treatment with vehicle control, AAV8 pVR80, or AAV8 pVR59 at the indicated doses in LPL-/- mice.
• Tg plasma triglycerides
• Figure 55 provides a diagram of constructs with reduced number of CpGs.
• the description and nucleotide sequence of the elements making up each construct appear in Tables 4 and 6.
• the number of CpGs in each element is indicated above the corresponding element.
• the total number of CpGs in each construct is indicated on the right side of the construct sequence.
• Figure 56 depicts intracellular hLPLS447X protein expression in primary human myotubes treated with CpG-depleted AAV8-LPLD vectors compared to AAV8 pVR59.
• Figure 58 depicts intracellular hLPLS447X protein expression in primary human myotubes treated with immunostimulatory CpG-depleted AAV8-LPLD vectors compared to AAV8 pVR59.
• One-way ANOVA One-way ANOVA.
• IM intramuscular
• Figure 62 depicts a study overview summarizing the experimental protocol in 2-3- month-old LPL-/- mice
• Figure 64 shows that IM treatment of AAV8 pVR59 in adult LPL-/- mice resulted in > 95% reduction in plasma Tg at doses greater than 1x10 12 gc/kg.
• the present disclosure provides recombinant nucleic acid molecules for improved expression of human lipoprotein lipase (hLPL). Also described are recombinant AAV viral particles comprising the recombinant nucleic acid, which may be used in therapeutic applications, such as treating plasma lipidemia and/or lipoprotein lipase deficiency. Further described are modes of administration of AAV8 serotype particles that are improved compared to the same amount of alipogene tiparvovec (GlyberaTM).
• GlyberaTM alipogene tiparvovec
• a recombinant nucleic acid molecule for expressing human lipoprotein lipase comprising the gain of function mutation S447X (hLPL S447X ) or a polypeptide having at least 80% sequence identity thereto and comprising the mutation S447X
• the recombinant nucleic acid molecule comprising: a transcriptional unit comprising: a promoter for driving expression of the hLPL S447X or the polypeptide having at least 80% sequence identity thereto, the promoter comprising the sequence of any one of SEQ ID NOs: 13 to 16 or a sequence having at least 80% sequence identity thereto, a coding nucleic acid that encodes the hLPL S447X or the polypeptide having at least 80% sequence identity thereto, and a polyadenylation signal
• the recombinant nucleic acid molecule optionally comprises a truncated woodchuck hepatitis virus posttranscription
• Table 6 is a master table of reference sequences referred to herein.
• hLPL S447X will be understood as human lipoprotein lipase (hLPL) bearing the naturally occurring gain of function mutation S447X.
• the sequence of hLPL S447X is depicted in SEQ ID NO: 3. This mutation is present in approximately 20-25% of the general population and is associated with increased lipolytic function via increased lipoprotein uptake, along with an anti-atherogenic, cardio-protective lipid profile resulting in decreased plasma Tg and increased high-density lipoprotein cholesterol.
• transcriptional unit will be understood as a sequence of nucleotides that encodes an RNA molecule, along with the sequences necessary for its transcription, such as a promoter, an RNA-coding sequence, and a terminator, such as a polyadenylation signal.
• promoter will be understood as a sequence of nucleotides to which proteins bind to initiate transcription of an RNA molecule.
• WPRE woodchuck hepatitis virus posttranscriptional regulatory element, which is used in molecular biology to increase transgene expression from a variety of viral vectors. When transcribed, WPRE creates a tertiary structure that enhances expression.
• the WPRE sequence used in GlyberaTM is depicted in SEQ ID NO: 18. It has surprisingly been found that truncating or removing the WPRE can improve expression of hLPL S447X according to some embodiments.
• truncation or “truncated” and grammatical variations thereof will be understood as referring to a nucleic acid molecule or polypeptide that is shorter than the corresponding naturally occurring nucleic acid or polypeptide. Truncations may be 5' and/or 3' truncations in the case of nucleic acid molecules, and N- and/or C-terminal truncations in the case of polypeptides. For example, the truncated WPRE is shorter than the full-length WPRE depicted in SEQ ID NO: 18.
• polyadenylation signal will be understood as a signal sequence (often comprising AALIAAA in the RNA molecule), which results in cleavage of an RNA catalyzed by cleavage and polyadenylation specificity factor (CPSF) and addition of a poly(A) tail by polynucleotide adenylyltransferase.
• CPSF polyadenylation specificity factor
• nucleic acid feature or molecule is described as “encoding” or “coding for” a polypeptide, it will be readily understood that there are numerous ways the polypeptide could be encoded according to the degeneracy of the genetic code.
• sequence identity is referred to, this is to be determined across a full-length alignment of the variant molecule or subject molecule to the parent molecule or reference molecule. These determinations can be readily made, for example, using the “Blast 2 Sequences” tool at the website of the National Centre for Biotechnology Information (NCBI). Sequence variants referred to herein will be generally understood to encompass (i) nucleic acid insertions, deletions, and/or substitutions, or (ii) amino acid insertions, deletions, and/or substitutions, wherein the resultant variant molecule retains substantially the same function as the parent molecule from which it is described. This can be readily tested with the assays described herein.
• nucleic acid or amino acid sequences having a particular percent sequence identity to a reference sequence are specified, in some embodiments these sequences will have substantially the same activity as the parent molecule from which they are derived. In some embodiments, they will have the same activity as the parent molecule for which they are derived. Thus, for example, where a recombinant nucleic acid molecule for expressing hLPL is described as having a particular percent sequence identity to a reference sequence, in some embodiments the recombinant nucleic acid molecule will express hLPL at the same level as the reference sequence.
• the recombinant nucleic acid molecule is for expressing a polypeptide having at least 90% sequence identity to the hLPL S447X (SEQ ID NO: 3), wherein the coding nucleic acid molecule encodes a polypeptide having at least 90% sequence identity to the hLPL S447X
• the recombinant nucleic acid molecule is for expressing a polypeptide having at least 95% sequence identity to the hLPL S447X , wherein the coding nucleic acid molecule encodes a polypeptide having at least 95% sequence identity to the hLPL S447X .
• the recombinant nucleic acid molecule is for expressing a polypeptide having at least 99% sequence identity to the hLPL S447X , wherein the coding nucleic acid molecule encodes a polypeptide having at least 99% sequence identity to the hLPL S447X .
• the recombinant nucleic acid molecule is for expressing the hLPL S447X , wherein the coding nucleic acid molecule encodes the hLPL S447X .
• the promoter has at least 90% sequence identity to the sequence of any one of SEQ ID NO: 13 to 16. In one embodiment, the promoter has at least 95% sequence identity to the sequence of any one of SEQ ID NO: 13 to 16. In one embodiment, the promoter has at least 99% sequence identity to the sequence of any one of SEQ ID NO: 13 to 16.
• the promoter comprises the sequence of any one of SEQ ID NO: 13 to 16.
• promoters described herein lead to improved expression of hLPL S447X as compared to a construct derived from GlyberaTM.
• SEQ ID NO: 13 is what is known in the art as a “CAG” or “CAGG” promoter.
• This synthetic promoter comprises a ubiquitously-expressing cytomegalovirus promoter early enhancer fused to the promoter, first exon, and first intron of the chicken beta-actin gene promoter (CAG promoter) and the splice acceptor of the rabbit beta-globin gene.
• the promoter has at least 90% sequence identity to the sequence of SEQ ID NO: 13.
• the promoter has at least 95% sequence identity to the sequence of SEQ ID NO: 13.
• the promoter has at least 99% sequence identity to the sequence of SEQ ID NO: 13.
• the promoter comprises the sequence of SEQ ID NO: 13.
• the promoter consists of the sequence of SEQ ID NO: 13.
• SEQ ID NO: 14 corresponds to the CAGG promoter modified to remove certain CpGs.
• the promoter has at least 90% sequence identity to the sequence of SEQ ID NO: 14.
• the promoter has at least 95% sequence identity to the sequence of SEQ ID NO: 14.
• the promoter has at least 99% sequence identity to the sequence of SEQ ID NO: 14.
• the promoter comprises the sequence of SEQ ID NO: 14.
• the promoter consists of the sequence of SEQ ID NO: 14.
• SEQ ID NO: 15 corresponds to the CAGG promoter modified to mutate immunostimulatory CpGs.
• the promoter has at least 90% sequence identity to the sequence of SEQ ID NO: 15.
• the promoter has at least 95% sequence identity to the sequence of SEQ ID NO: 15. In one embodiment, the promoter has at least 99% sequence identity to the sequence of SEQ ID NO: 15. In one embodiment, the promoter comprises the sequence of SEQ ID NO: 15. In one embodiment, the promoter consists of the sequence of SEQ ID NO: 15.
• SEQ ID NO: 16 is a modified version of the CAGG promoter in which the first intron of chicken beta-actin is replaced with a short SV40 intron, with modification to remove CpGs in the SV40 intron.
• the promoter has at least 90% sequence identity to the sequence of SEQ ID NO: 16.
• the promoter has at least 95% sequence identity to the sequence of SEQ ID NO: 16.
• the promoter has at least 99% sequence identity to the sequence of SEQ ID NO: 16.
• the promoter comprises the sequence of SEQ ID NO: 16.
• the promoter consists of the sequence of SEQ ID NO: 16.
• the promoter comprises a CMV enhancer, a chicken beta-actin promoter, and the first intron of the chicken beta-actin gene; or comprises sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity thereto.
• These features may be modified to mutate or remove immunostimulatory CpGs.
• These features may also be modified to mutate or remove additional CpGs.
• the promoter comprises a CMV enhancer, a chicken beta-actin promoter, and an SV40 intron; or comprises sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity thereto.
• These features may be modified to mutate or remove immunostimulatory CpGs.
• These features may also be modified to mutate or remove additional CpGs.
• the polyadenylation signal is:
• hGH polyA a bovine growth hormone (bGH) polyadenylation signal comprising the sequence of SEQ ID NO: 20 or comprising a sequence having at least 80% sequence identity thereto,
• hGH polyA human growth hormone polyadenylation signal
• the polyadenylation signal has at least 90% sequence identity to the bGH polyadenylation signal of SEQ ID NO: 20. In one embodiment, the polyadenylation signal has at least 95% sequence identity to the bGH polyadenylation signal of SEQ ID NO: 20. In one embodiment, the polyadenylation signal has at least 99% sequence identity to the bGH polyadenylation signal of SEQ ID NO: 20. In one embodiment, the polyadenylation signal is the bGH polyadenylation signal (bGH polyA) comprising or consisting of the sequence of SEQ ID NO:
• the polyadenylation signal has at least 90% sequence identity to the hGH polyadenylation signal of SEQ ID NO: 21 . In one embodiment, the polyadenylation signal has at least 95% sequence identity to the hGH polyadenylation signal of SEQ ID NO: 21. In one embodiment, the polyadenylation signal has at least 99% sequence identity to the hGH polyadenylation signal of SEQ ID NO: 21. In one embodiment, the polyadenylation signal is the hGH polyadenylation signal (hGH polyA) comprising or consisting of the sequence of SEQ ID NO:
• the coding nucleic acid molecule comprises the sequence of any one of SEQ ID NOs: 4, and 6 to 9; or comprises a sequence having at least 80% sequence identity thereto. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 4, and 6 to 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 4, and 6 to 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to any one of SEQ ID NOs: 4, and 6 to 9. In one embodiment, the coding nucleic acid molecule comprises or consists of the sequence of any one of SEQ ID NOs: 4, and 6 to 9.
• SEQ ID NO: 4 depicts a nucleic acid sequence encoding hLPL S447X .
• the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 4.
• the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 4.
• the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 4.
• the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 4.
• the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 4.
• the coding nucleic acid is codon-optimized according to the cell type in which it is intended to be expressed.
• the coding nucleic acid is codon-optimized for expression in human cells.
• SEQ ID NO: 6 depicts an exemplary codon- optimized nucleic acid sequence encoding hLPL S447X .
• the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 6.
• the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 6.
• the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 6. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 6. In one embodiment, the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 6.
• the coding nucleic acid is modified to remove or reduce CpG dinucleotides.
• SEQ ID NO: 7 depicts an exemplary nucleic acid sequence with a reduced number of CpGs compared to SEQ ID NOs: 4 and 6.
• the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 7.
• the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 7.
• the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 7.
• the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 7.
• the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 7.
• the coding nucleic acid is both codon-optimized and modified to remove or reduce CpGs.
• SEQ ID NO: 8 depicts an exemplary sequence having such features.
• the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 8.
• the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 8.
• the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 8.
• the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 8.
• the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 8. [00138] In one embodiment, the coding nucleic acid is modified to mutate immunostimulatory CpGs. SEQ ID NO: 9 depicts an exemplary sequence having such features in addition to being codon-optimized. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 9. In one embodiment, the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 9.
• the transcriptional unit is flanked by 5' and 3' inverted terminal repeats (ITRs).
• ITRs inverted terminal repeats
• inverted terminal repeats refers to the palindromic, or at least partially palindromic sequences present at the end of adeno-associated virus (AAV) viral genomes. They are cis-elements required for genome rescue, replication, packaging, and vector persistence. In biotechnology, they are used to make an AAV transfer plasmid for packaging of transgenes into recombinant AAV particles (rAAV).
• AAV adeno-associated virus
• the 5' and 3' ITRs are from an adeno-associated virus of serotype 2 (AAV2) and comprise, respectively, the sequences of SEQ ID NOs: 10 and 11 , or sequences having at least 80% sequence identity thereto. In one embodiment, the 5' and 3' comprise sequences having at least 90% sequence identity to SEQ ID NOs: 10 and 11 , respectively. In one embodiment, the 5' and 3' comprise sequences having at least 95% sequence identity to SEQ ID NOs: 10 and 11 , respectively. In one embodiment, the 5' and 3' comprise sequences having at least 95% sequence identity to SEQ ID NOs: 10 and 11 , respectively. In one embodiment, the 5' and 3' ITRs comprise, respectively, the sequences of SEQ ID NOs: 10 and 11. In one embodiment, the 5' and 3' ITRs consist of, respectively, the sequences of SEQ ID NOs: 10 and 11.
• AAV2 adeno-associated virus of serotype 2
• the truncated WPRE is present in the recombinant nucleic acid molecule.
• the truncated WPRE comprises a sequence shorter than SEQ ID NO: 18.
• the truncated WRPE is shorter than SEQ ID NO: 18 and has at least 80%, 85%, 90%, 95%, or 95% sequence identity to SEQ ID NO: 18 across an aligned portion.
• SEQ ID NO: 19 depicts one exemplary truncated WPRE comprising a sequence modification.
• SEQ ID NO: 19 contains an open-reading frame (ORF) encoding a truncated peptide of the woodchuck hepatitis virus X protein (WHX), which is a transcriptional activator implicated in the development of liver tumors.
• the truncation is relative to SEQ ID NO: 18.
• the truncated WPRE of SEQ ID NO: 19 has mutations in the X-protein promoter and in the ATG so that X-protein (and/or portion of it) will not be produced.
• the truncated WPRE comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity to the sequence of SEQ ID NO: 19. In one embodiment, the truncated WPRE comprises the sequence of SEQ ID NO: 19. In one embodiment, the truncated WPRE consists of the sequence of SEQ ID NO: 19.
• the recombinant nucleic acid molecule comprises a sequence at least 80% sequence identity to the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 33 (from pVR59).
• the recombinant nucleic acid molecule comprises the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule consists of the sequence of SEQ ID NO: 33 (from pVR59).
• the recombinant nucleic acid molecule does not comprise either the WPRE or any truncation thereof. In one embodiment, the recombinant nucleic acid molecule is entirely free of both WPRE and WPRE-derived sequences.
• the recombinant nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 35 (from pVR80). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 90% sequence identity to the sequence of SEQ ID NO: 35 (from pVR80). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 95% sequence identity to the sequence of SEQ ID NO: 35 (from pVR80). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 99% sequence identity to the sequence of SEQ ID NO: 35 (from pVR80).
• the recombinant nucleic acid molecule comprises the sequence of SEQ ID NO: 35 (from pVR80). In an embodiment, the recombinant nucleic acid molecule consists of the sequence of SEQ ID NO: 35 (from pVR80).
• the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 80% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p-globin polyadenylation signal comprising a sequence of SEQ ID NO: 22 or the sequence having at least 85% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p- globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 90% sequence identity thereto.
• the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 95% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 98% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22. [00149] In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 37 (from pNC201).
• the recombinant nucleic acid molecule comprises a sequence that is at least 90% sequence identity to the sequence of SEQ ID NO: 37 (from pNC201). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 95% sequence identity to the sequence of SEQ ID NO: 37 (from pNC201). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 99% sequence identity to the sequence of SEQ ID NO: 37 (from pNC201). In one embodiment, the recombinant nucleic acid molecule comprises the sequence of SEQ ID NO: 37 (from pNC201). In an embodiment, the recombinant nucleic acid molecule consists of the sequence of SEQ ID NO: 37 (from pNC201).
• the recombinant nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 38 (from pNC182). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 90% sequence identity to the sequence of SEQ ID NO: 38 (from pNC182). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 95% sequence identity to the sequence of SEQ ID NO: 38 (from pNC182). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 99% sequence identity to the sequence of SEQ ID NO: 38 (from pNC182).
• the recombinant nucleic acid molecule comprises the sequence of SEQ ID NO: 38 (from pNC182). In an embodiment, the recombinant nucleic acid molecule consists of the sequence of SEQ ID NO: 38 (from pNC182).
• the recombinant nucleic acid molecule is a single stranded DNA (ssDNA) molecule, a double stranded DNA (dsDNA) molecule, a single stranded RNA (ssRNA) molecule, or a double stranded RNA (dsRNA) molecule.
• the recombinant nucleic acid molecule is a double stranded DNA (dsDNA) molecule.
• the recombinant nucleic acid molecule is a single stranded DNA (ssDNA) molecule.
• the recombinant nucleic acid molecule is a double stranded RNA (dsRNA) molecule.
• the recombinant nucleic acid molecule is a single stranded RNA (ssRNA) molecule.
• the recombinant nucleic acid molecule is a messenger RNA (mRNA).
• mRNA messenger RNA
• a vector comprising the recombinant nucleic acid molecule as defined herein.
• the vector is a plasmid vector.
• the plasmid is an adeno-associated virus (AAV) transfer plasmid.
• AAV adeno-associated virus
• a host cell comprising the nucleic acid molecule as defined herein.
• the host cell is a cell line.
• the host cell is a human cell.
• the host cell is a human cell line.
• a recombinant viral particle comprising the recombinant nucleic acid molecule as defined herein.
• rAAV recombinant AAV viral particle
• An “rAAV” will be understood as an AAV viral particle that lacks endogenous viral DNA and is essentially a protein-based nanoparticle engineered to traverse the cell membrane, where it can ultimately traffic and deliver exogenous DNA cargo into the nucleus of a cell.
• An rAAV can be produced by replacing the wild type AAV open reading frames with a desired nucleic acid molecule.
• the rAAV has capsid proteins of serotype 8 (AAV8).
• the rAAV has capsid proteins of serotype 1 (AAV1). [00165] Compositions
• composition comprising the recombinant nucleic acid molecule as defined herein, the vector as described herein, the recombinant viral particle as described herein, or the rAAV as described herein together with an acceptable excipient, diluent, or carrier.
• a pharmaceutical composition comprising the recombinant nucleic acid molecule as defined herein, the vector as described herein, the recombinant viral particle as described herein, or the rAAV as described herein together with a pharmaceutically acceptable excipient, diluent, or carrier.
• a method of delivering the recombinant nucleic acid molecule as defined herein to a cell comprising contacting the cell with the vector or the recombinant viral particle as defined herein.
• a method of delivering the recombinant nucleic acid molecule as defined herein to a cell comprising contacting the cell with the rAAV as defined herein.
• a method of treating plasma lipidemia comprising administering to a subject the rAAV as defined herein.
• a method of treating lipoprotein lipase deficiency in a subject comprising administering to a subject the rAAV as defined herein.
• the step of administering is intramuscular (IM) administration, intravenous (IV) administration, or subcutaneous (SQ) administration.
• IM intramuscular
• IV intravenous
• SQ subcutaneous
• the step of administering is the IM administration.
• the rAAV is of the AAV8 serotype and the rAAV is administered at an amount that is about one tenth of an amount of GlyberaTM required to achieve the same effects.
• the rAAV of serotype AAV8 is at least about twice as efficacious as an equivalent amount of GlyberaTM.
• the rAAV of serotype AAV8 is at least about five times as efficacious as an equivalent amount of GlyberaTM.
• the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of GlyberaTM.
• the step of administering is IV administration.
• the rAAV is of the AAV8 serotype and the rAAV is administered at an amount that is about one hundredth of an amount of GlyberaTM required to achieve the same effects.
• the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of GlyberaTM.
• the rAAV of serotype AAV8 is at least about fifty times as efficacious as an equivalent amount of GlyberaTM.
• the rAAV of serotype AAV8 is at least about one hundred times as efficacious as an equivalent amount of GlyberaTM.
• a use for delivering the recombinant nucleic acid molecule as defined herein to a cell, of the vector or the recombinant viral particle as defined herein.
• rAAV as defined herein for delivering the recombinant nucleic acid molecule as defined herein.
• rAAV as defined herein for treatment of plasma lipidemia.
• rAAV as defined herein for treatment of lipoprotein lipase deficiency in a subject.
• the rAAV is for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
• the rAAV is for IM use. In one embodiment, the rAAV is of the AAV8 serotype and is for use at an amount that is about one tenth of an amount of GlyberaTM required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about twice as efficacious as an equivalent amount of GlyberaTM. In one embodiment, the rAAV of serotype AAV8 is at least about five times as efficacious as an equivalent amount of GlyberaTM. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of GlyberaTM.
• the rAAV is for IV use. In one embodiment, the rAAV is of the AAV8 serotype and is for use at an amount that is about one hundredth of an amount of GlyberaTM required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of GlyberaTM. In one embodiment, the rAAV of serotype AAV8 is at least about fifty times as efficacious as an equivalent amount of GlyberaTM. In one embodiment, the rAAV of serotype AAV8 is at least about one hundred times as efficacious as an equivalent amount of GlyberaTM.
• the rAAV as defined here for use in treatment of plasma lipidemia in a subject.
• the rAAV as defined here for use in treatment of lipoprotein lipase deficiency in a subject.
• the rAAV is for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
• the rAAV is for IM use. In one embodiment, the rAAV is of the AAV8 serotype and is for use at an amount that is about one tenth of an amount of GlyberaTM required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about twice as efficacious as an equivalent amount of GlyberaTM. In one embodiment, the rAAV of serotype AAV8 is at least about five times as efficacious as an equivalent amount of GlyberaTM. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of GlyberaTM.
• the rAAV is for the IV use. In one embodiment, the rAAV is of the AAV8 serotype and is for use at an amount that is about one hundredth of an amount of GlyberaTM required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of GlyberaTM. In one embodiment, the rAAV of serotype AAV8 is at least about fifty times as efficacious as an equivalent amount of GlyberaTM. In one embodiment, the rAAV of serotype AAV8 is at least about one hundred times as efficacious as an equivalent amount of GlyberaTM.
• kits for use in delivering the recombinant nucleic acid molecule as defined herein to a cell comprising the vector or the recombinant viral particle as defined herein together with instructions for delivery to a cell.
• kits for use in treatment of plasma lipidemia comprising the rAAV as defined herein together with instructions for treatment of plasma lipidemia.
• kits for use for treatment of lipoprotein lipase deficiency in a subject comprising the rAAV as defined herein together with instructions for treatment of lipoprotein lipase deficiency.
• the instructions are for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
• IM intramuscular
• IV intravenous
• SQL subcutaneous
• the instructions are for the IM use.
• the rAAV is of the AAV8 serotype and is for use an amount that is about one tenth of an amount of GlyberaTM required to achieve the same effects.
• the rAAV of serotype AAV8 is at least about twice as efficacious as an equivalent amount of GlyberaTM.
• the rAAV of serotype AAV8 is at least about five times as efficacious as an equivalent amount of GlyberaTM .
• the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of GlyberaTM.
• the instructions are or IV use.
• the rAAV is of the AAV8 serotype and is for use an amount that is about one hundredth of an amount of GlyberaTM required to achieve the same effects.
• the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of GlyberaTM.
• the rAAV of serotype AAV8 is at least about fifty times as efficacious as an equivalent amount of GlyberaTM.
• the rAAV of serotype AAV8 is at least about one hundred times as efficacious as an equivalent amount of GlyberaTM.
• a method of producing recombinant AAV viral particles comprising transfecting cells with a transfer plasmid comprising the recombinant nucleic acid molecule as defined herein, wherein the cells express AAV components required for packaging the recombinant nucleic acid molecule into rAAV particles, culturing the cells to produce the rAAVs, and isolating the rAAVs.
• the cells express AAV rep and cap proteins, AAV E2 and E4A proteins and AAV virus-associated (VA) RNAs.
• the method further comprises transfecting or co-transfecting the cells with: a plasmid encoding AAV rep and cap proteins, and a helper plasmid encoding AAV E2 and E4A proteins and AAV virus-associated (VA) RNAs.
• the rAAVs are of adeno-associated virus serotype 8.
• the rAAVs are of adeno-associated virus serotype 1.
• the method is an in vitro method.
• the AAVs encoded either a luciferase (luc) transgene (biodistribution studies) or a hLPL S447X transgene (efficacy studies), driven by either the synthetic CAG promoter comprising a ubiquitously-expressing cytomegalovirus promoter early enhancer fused to the promoter, first exon, and first intron of the chicken beta-actin gene and the splice acceptor of the rabbit beta-globin gene, or a muscle-specific AUSEx4 promoter 2728 .
• the CAG promoter is sometimes referred to as the “CAGG” promoter and is part of the “pCAGGS” expression vector. It is not a promoter alone in the strict sense, as it includes a part of the transcribed sequence (the first exon and the first intron of chicken beta-actin gene) and enhancer elements.
• AAV formulations were administered via IM injection, as originally utilized for Glybera, or via novel routes of administration, including intravenous (IV) and subcutaneous (SQ) routes in wild-type mice (biodistribution studies) and in a mouse model of LPLD (efficacy studies).
• IV intravenous
• SQ subcutaneous
• LPLD LPLD
• AAV8 pVR59 CAG promoter
• AdV- hLPL S447X Recombinant adenovirus (human adenovirus serotype 5 AE1/E3) encoding the hLPL S447X transgene (AdV- hLPL S447X ) driven by a CMV promoter was used for rescue of neonatal LPL-/- mice, as described previously 9 11 .
• AdV- hLPL S447X was produced by VectorBuilder (Chicago, Illinois).
• AdV- hLPL S447X expression cassette design is provided in Figure 1.
• AdV- hLPL S447X was further amplified, using BMAdEI # 78-42 and SF-BMAdR#281 cell lines as described previously 29 .
• AdV-hLPL S447X was purified by ultracentrifugation using double CsCI gradients, as described previously 30 . Infectious titers were determined and calculated as the median tissue culture infective dose (TCID50)/ml 31 . Successful expression and enzymatic activity of hLPL S447X following infection was confirmed in HEK293A cells (data not shown).
• Novel AAV expression cassette formulations were constructed using the pAAV-MCS promoterless expression vector with inverted terminal repeats (ITR) from AAV2 and the human growth hormone (hGH) polyadenylation signal (hGH PolyA) (Cell Biolabs). Sequences of all expression cassettes were confirmed by Sanger sequencing (Genome Quebec).
• AAV expression cassettes encoding the luc transgene driven by a ubiquitously-expressing cytomegalovirus promoter enhancer fused to the chicken beta-actin (CAG) promoter were constructed by replacing the c2G4 antibody gene from pAAV-c2G4 (Robert et al, 2018) with the firefly luc gene derived from pGL3-Promoter cloning vector (Promega, GenBank: U47298.2), WPRE 589bp from pCDH-CuO-MCS-T2A-copGFP, System Biosciences, Palo Alto, CA) and hGH polyA 27 ’ 32 .
• CAG chicken beta-actin
• AAV expression cassettes encoding the luc transgene driven by a CMV promoter (referred to as pVR61) or the muscle specific promoter AUSEx4 (referred to as pVR56) were constructed by replacing the CAG promoter from pVR52 with the CMV promoter or the AUSEx4 promoter, respectively 28 .
• All AAV-luc expression cassette designs are depicted in Figure 2, which shows structural diagrams of novel AAV serotypes and expression cassettes encoding luc (ITR; inverted terminal repeat, WPRE, Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element; hGH, human growth hormone).
• the expression cassette for Glybera (pVR58), exactly as described previously, consisting of a CMV promoter, hLPL S447X transgene, WPRE 729bp and a bovine growth hormone (bGH) polyadenylation signal (bGH PolyA) was synthesized by GenScript for cloning into pAAV-MCS 8 ’ 920-25 .
• bGH bovine growth hormone polyadenylation signal
• Novel AAV expression cassettes encoding the C.O hLPL S447X transgene driven by a CAG promoter (referred to as pVR59), was constructed by replacing the luc transgene in pVR52 with the C.O hLPL S447X transgene.
• AAV expression cassettes encoding the C.O hLPL S447X transgene driven by AUSEx4 (referred to as pVR60) was constructed by replacing the CAG promoter of pVR59 with the AUSEx4 promoter 28 .
• a control AAV expression cassette (referred to as pVR67) to assess the impact of the change in the WPRE sequence (WPRE 729bp and WPRE 589bp ) and the PolyA sequence (bGH PolyA and hGH PolyA) was constructed by replacing WPRE 729bp and bGH polyA sequence from pVR58 with the novel WPRE 589bp sequence and hGH polyA isolated from pVR59.
• a control AAV expression cassette (refereed to as pVR74) to assess the impact of codon- optimization of the hLPL S447X transgene was constructed by replacing the luc transgene from pVR61 with C.O hLPL S447X transgene isolated from pVR60.
• HEK293SF-3F6 cells were used for AAV production 33 . Briefly, HEK293SF-3F6 cells were grown and maintained as a suspension culture in serum-free BalanCD HEK293 medium (FujiFilm) supplemented with 4 mM L-Glutamine (Cytiva), propagated at 37°C in 5% CO2. HEK293SF-3F6 cells were triple transfected at a mass ratio of 1 :1 :1 for AAV production using PEI Pro (Polyplus). The total plasmids were supplied at 1 pg/ml culture volume and PEI Pro to DNA ratio was 2:1.
• the rep/cap plasmid contained the rep of AAV2 serotype and capsid of either AAV1 or AAV8 (GENEMEDI).
• the transgene expression cassette plasmids contained the ITR-to-ITR sequences encoding the luc or hLPL S447X transgenes, as described above.
• the adenovirus helper-functions were supplied by pHelper plasmid that contained genes for E4 and E2A proteins and VA RNAs (Cell Biolabs).
• AAV productions were done in 5 L Thomson Optimum GrowthTM Flasks with a working volume of 2.5 L in an incubator on a rotary shaker at a speed of 110 rpm with a shaking throw of 25 mm at 37°C. Transfected cells were harvested at 72 hours (h) post transfection.
• AAV lysis was carried out as described previously with slight modifications 34 . Briefly, 72h following transfection of HEK293SF-3F6 cells, 1 % (v/v) of lysing buffer concentrate (200 mM MgCh, 1% Triton X-100) and 1% (v/v) of freshly diluted Benzonase 2.5 units/mL (U/rnL) (Merck) was introduced to the cells. After 2h of incubation at 37°C with agitation, concentrated MgSC t was added to obtain a final concentration of 37.5 mM, the solution was incubated further for 30 minutes (min), as described previously 35 .
• the addition of MgSC t was necessary to avoid AAV aggregation and AAV binding to other cellular components released during lysis.
• the lysed harvest was clarified using 5" SUPRAcaplOO NP5LPDH41 0.5-15 pm 0.025 m 2 (PALL) filters at a flow rate of 167 ml/min (flux of 400LMH). Filters were pre-wetted with 2.5L of Milli-Q® water at 600 ml/min and conditioned with 10mM Tris pH 7.5 and 0.1 % Kolliphor® P 188. The clarified material was then concentrated with tangential flow filtration (TFF) using hollow fibers with surface area of 1600cm 2 , 70kDa Molecular weight cut off (Repligen®).
• TMF tangential flow filtration
• the hollow fiber membranes Prior to use, the hollow fiber membranes were washed with Milli-Q water by permeating 2 ml/cm 2 .
• the crossflow rate was supplied by a MasterFlex® L/S Standard Digital Drive pump (Cole Palmer) at 552 ml/min to get maximum shear rate at the inlet of the hollow fiber of 3000 sec 1 with a constant transmembrane pressure (TMP) of 5 psi using a KrosFlo® Digital Pressure Monitor (Repligen).
• TFF transmembrane pressure
• Repligen a constant transmembrane pressure
• TFF was done in a continuous mode where the fresh feed was continuously added in vacuum sealed reservoir at the rate of permeate flow. The starting lysate was concentrated by approximately 30-fold.
• the membrane was rinsed with 10 ml of the Buffer A (20mM Tris pH 7.5, 150 mM MgSO4) and the final retentate volume containing AAV was approximately 80 ml.
• the TFF concentrate was then purified by iodixanol step gradient protocol, as described previously 36 , lodixanol concentration gradients of 15, 25, 40 and 54% were generated.
• the 15% iodixanol concentration also contained 600 mM MgSO4 to avoid aggregation of AAV with other cellular proteins and negatively charged nuclear or cellular components. Solutions were ultracentrifuged at 385,000 x g for 1 h and 35 min (Beckman Optima L-80 XP).
• the concentration of purified AAVs was quantified by digital droplet (ddPCR) using the Bio-Rad® QX200 droplet generator and reader, along with the Eppendorf® Master Cycler X50s. Briefly, purified AAV preparations were diluted in 0.05% Pluronic, 2 pg/ml Sheared Salmon Sperm DNA and were added to the master mix containing EvaGreen® supermix, 0.4 mg/ml BSA and 0.1 pM of each, forward and reverse primer, targeting the ITR regions (GGAACCCCTAGTGATGGAGTT, CGGCCTCAGTGAGCGA).
• Thermal cycling was carried out according to the Bio-Rad protocol with the following modifications: the first step, enzyme activation, was increased to 95°C for 10 min, the annealing and the extension steps were performed at 59°C for 1 min, and 72°C for 30 s, respectively, and the cycles were repeated 35 times. Data was acquired and analyzed using QX ManagerTM Software. The final concentrations of the AAV preparations were adjusted to > 1x10 12 genome copies/ml (gc/ml).
• HSkMCs Human primary skeletal muscle cells
• Promocell Human primary skeletal muscle cells
• C2C12 mouse myoblasts were purchased from ATCC, propagated in 10% fetal bovine serum in DMEM (4500 mg/L glucose) (Hyclone) supplemented with Glutamax® (Thermo Fisher) and differentiated into myotubes using 2% horse serum in DMEM (4500 mg/L glucose) (Hyclone®) supplemented with Glutamax (Thermo Fisher).
• Mature human or mouse myotubes (4 days post-differentiation) were pre-treated with hydroxyurea (2mM, 18h) and infected with AAV-hLPL S447X formulations at a multiplicity of infection (MOI) of 1x10 5 gc/cell, or otherwise indicated in black, clear-bottom 96-well plates.
• H eparin-treated (Fresenius Kabi) (20U/ml, 4h) conditioned media and cells were collected 4 days following infection for downstream analysis.
• Human hepatocellular carcinoma cell line (HepG2) was purchased from ATCC and propagated in 10% fetal bovine serum in DMEM (4500 mg/L glucose) (Hyclone) supplemented with Glutamax (Thermo Fisher).
• HepG2 cells were pretreated with hydroxyurea (2mM, 18h) and infected with AAV-hLPL S447X formulations at a MOI of 1x10 5 gc/cell, or otherwise indicated in black, clear-bottom 96-well plates.
• H eparin-treated (Fresenius Kabi) (20U/ml, 4h) conditioned media and cells were collected 2 days following infection for downstream analysis. All cell lines were propagated at 37°C in 5% CO2.
• LPL-/- mice were obtained via breeding as described previously 9 11 .
• LPL-/- pups shortly after birth exhibit extreme HTG and chylomicronemia resulting in severe cyanosis and neonatal death 37 .
• LPL-/- pups were rescued on the day of birth by IM administration (1 injection site/hindlimb) of 1x10 8 plaque forming units (pfu) of AdV-hLPL S447X , as described previosuly 9 11 .
• Genotypes were determined by PCR-based genotyping after weaning.
• C57BL/6J wild-type mice used for biodistribution studies were purchased from Charles River. All animals were maintained on a C57BL/6J background and raised on regular rodent diet with free access to water. All procedures involving animals were performed in accordance with protocols from the CCAC (Canadian Council for Animal Care).
• mice were administered with either 1x10 12 gc/kg of AAV-luc formulations (Figure 2) by either IM, IV, or SQ route of administration.
• Mice were administered with either 1x10 11 gc/kg (LD, low dose) or 1x10 12 gc/kg (HD, high dose) of AAV-hLPL S447X formulations ( Figure 3) by either IM, IV, or SQ route of administration.
• IM injections were administered to anesthetized mice within the hindlimb via one or two injection sites I hindlimb.
• IV injections were administered via the tail vein or retro-orbitally to anesthetized mice.
• SQ injections were either administered in the flanks (SQ-Flank) via 4 injection sites or in the hock (SQ-Hock) via 1 injection site/leg, as described previously 38 .
• a sterile PBS AAV dilution buffer containing 0.001 % Pluronic was used for all studies after confirming no impact on primary study outcomes (plasma triglycerides) after administration of an AAV-luc formulation in wild-type mice (data not shown).
• bioluminescence imaging (BLI) of AAV-luc expression in mice was performed twice a week for a period of 60 days using an IVIS-Lumina III (Perkin Elmer; Massachusetts, USA) preclinical imager. Briefly, prior to each imaging scan, animals were anesthetized with 2.5% isoflurane, injected SQ with 150 mg/Kg D-luciferin (Perkin Elmer) and imaged in dorsal and ventral position 20 min later (at the peak of bioluminescence emission).
• the conditions for BLI acquisition were as follows: open emission filter, blocked excitation filter, auto exposure time and binning medium.
• Fasted (4 h) blood samples were collected via the saphenous vein in Microvette® CB 300 Lithium-heparin coated tubes (Sarstedt Inc) before AAV-hLPL S447X administration (day 0) and then at regular intervals (day 10, 20, 40 and 80) for the duration of the experiment after AAV- hLPL S447X administration.
• Plasma was collected by centrifugation at 3,500xg for 5 min at 4°C.
• Plasma Tg were assessed using the colorimetric InfinityTM Triglycerides Liquid Stable Reagent (Thermo Fisher).
• Plasma total cholesterol (Tc) were assessed using the colorimetric Infinity Cholesterol Liquid Stable Reagent (Thermo Fisher).
• Absorbance values were measured using a POLARstar® Omega plate reader (BMG Labtech), with concentrations (mg/dl) extrapolated using either a Glycerol Standard Calibrator (Sigma) for triglycerides or a Cholesterol Standard Calibrator (Pointe Scientific).
• LPL Lipoprotein lipase
• EnzChekTM Lipase Substrate, green fluorescent, 505/515 (Thermo Fisher) was used, as described previously 39 . Briefly, plasma lipase activity was assessed using: 25pl of diluted (1 :100) plasma samples mixed with a 25pl of 4x LPL activity buffer (0.6M NaCI, 80mM Tris-HCI, pH8.0, 0.05% Zwittergent, 6% FA-Free BSA), along with 25pl of 4pM EnzChek lipase substrate solution.
• 4x LPL activity buffer 0.6M NaCI, 80mM Tris-HCI, pH8.0, 0.05% Zwittergent, 6% FA-Free BSA
• Plasma samples from AAV-hLPL S447X -treated mice were incubated with or without LPL-5D2 antibody (Bio-Rad) to specifically inhibit human LPL (30 min, room temperature [RT]).
• LPL-5D2 antibody Bio-Rad
• plasma was incubated with or without nANGPTL4 (recombinant protein produced in house, pNIC-Bio3 ANG4 26-164 plasmid provided generously by Dr. Saskia B. Neher) to inhibit both mouse (endogenous LPL) and human LPL (30 min, RT).
• mice were injected IV (tail vein) with 10% Intralipid (20% stock Intralipid solution diluted 1 :1 in sterile PBS, max volume of 250pl injected in a 25g mouse) (Sigma). Blood samples were taken pre-administration of intralipid, followed by sampling at 30 min, 1 h, 2h and 3h post infusion for determination of plasma triglycerides clearance. Peak of plasma triglycerides was set at 30 min post- Intralipid infusion and % plasma triglyceride clearance was calculated for up to 3h post-lntralipid infusion, at which point LPL+/+ mice were observed to clear >95% of plasma triglycerides.
• Total AAV and hLPL IgG antibody titers (neutralizing and non-neutralizing) in the plasma of mice before AAV-hLPL S447X administration (day 0) and at study endpoint (day 80) were measured using ELISA. Briefly, high binding ELISA plates (Corning) were coated with 1x10 8 gc/well of either AAV1 or AAV8 particles (for detection of anti-AAV antibodies) or 50ng/well of recombinant human recombinant hLPL (Novus Biologicals) (for detection of anti-hLPL antibodies).
• Tissue collection [00242] Anesthetized mice were cardiac perfused with ice-cold PBS. Tissues were either snap- frozen in liquid nitrogen dry ice or fixed in 10% buffered formalin for histological analysis.
• Membranes were blocked with SuperblockTM (Thermo Fisher), incubated with primary antibodies (overnight, 4°C) and detected using either Alexa Fluor® (Thermo Fisher) or IRDye® (Li-Cor) 800 labelled secondary antibodies (30 min, RT) (antibodies and dilutions used are provided in Table 1).
• Mouse IgG Peroxidase-labelled anti- ELISA 1 20,000 Jackson Immunoresearch Labs mouse IgG (H&L) (115-035-044)
• Relative target protein expression was normalized against total protein using RevertTM 700 Total Protein Stain (Li-Cor). All blots were scanned using the Odyssey® Infrared Imaging system (Li-Cor). Densitometry on band intensities was performed using Imaged.
• qRT- PCR quantitative real-time PCR
• 5ng of RNA was carried out using QuantiNova® SYBR Green RT-PCR Kit (Qiagen), following manufactures’ recommendation on the Applied Biosystems 7500/7500 Fast Real-Time PCR System.
• Hs_LPL_1_SG QuantiTect® Primer Assay (QT00036771 , Qiangen) was used to detect the hLPL S447X transgene in Glybera (AAV1 pVR58) and a hLPL_1 QuantiNova LNA PCR Custom Assay (GeneGlobe ID - SCB0420509-200, Qiagen) was used to detect the C.O hLPL S447X transgene in AAV8 pVR59.
• Mm_Rn18s_3_SG QuantiTect® Primer Assay (QT0244807518s, Qiagen) was used to detect 18s for normalization. Transgene mRNA expression and fold changes were calculated using the AACT method.
• DNA was extracted and purified using the Qiagen DNeasy® Blood & Tissue kit (Qiagen) from snap-frozen tissues, following manufactures’ recommendations.
• Qiagen Qiagen DNeasy® Blood & Tissue kit
• AAV viral vector genomes were quantified determined by ddPCR, as described above.
• DNA was diluted in water and 4 ul of each sample were added to 16 ul master mix containing Supermix for Probes (no dUTP, Bio-Rad), 2 U Msel, 0.4 mg/ml BSA, 950 nM of each, forward and reverse primers (ATCCTGGTTGCTGTCTCTTTAT, GAATTGTCAGTGCCCAACAG), and 250 nM probe (56- FAM/CTGTCAGCT/ZEN/CCTTTCCGGGACTTT/3IABkFQ).
• Thermal cycling was carried out according to the Bio-Rad protocol with the following modifications: an additional restriction digestion step at 37°C for 60 min was added prior to enzyme activation; annealing and extension were done in two steps, at 59.1°C for 60 s and 72°C for 30 s, respectively. The total number of cycles was reduced to 35. Data was represented as AAV vector genome copies normalized to ng of tissue DNA (gc/ng DNA).
• the IM route of administration resulted in robust and stable transgene expression after about 2-weeks post treatment, which was localized near the site of injection, regardless of the AAV formulation utilized ( Figures 5, 6).
• luciferase expression was lower in mice injected with AAV-luc formulations driven by the muscle specific AUSEx4 promoter compared to the CMV and CAG promoters regardless of the AAV capsid serotype.
• the SQ-flank route of administration resulted in stable transgene expression near the site of injection, regardless of the AAV formulation utilized.
• mice injected via the SQ-hock an area of the mouse which lacks panniculus carnosus muscle under the skin that has been previously reported to be highly transduced via the SQ-flank route of administration ( Figures 7, 8) 38 .
• luciferase expression was dramatically reduced in mice injected SQ with AAV-luc formulations driven by the muscle specific AUSEx4 promoter ( Figures 5, 6, 7, and 8).
• AAV1 capsid containing formulation resulted in the weakest transduction when delivered via IV.
• AAV8 capsid containing formulations when delivered via IV resulted in the most prominent hepatic transgene expression, which surprisingly, was transient, peaking around day 14-18 post injection, with no readily detectible expression found elsewhere.
• AAV1 capsid containing formulations, including the Glybera-equivalent formulation (AAV1 pVR61) when administered via localized route of administration, including IM and SQ, resulted in localized transgene expression near the site of administration, with no detectable expression found within other regions of the mouse, including the liver ( Figure 5).
• AAV8 capsid containing formulations using the CAG promoter resulted in hepatic transduction in conjunction with localized transgene expression near the site of administration when injected via IM and SQ.
• luc transgene expression was assessed at study endpoint ex vivo within the tissue of mice injected with the novel AAV-luc formulations. Similar to the in vivo findings, AAV8 capsid containing formulations resulted in the most prominent localized luc expression, either within the skeletal muscle via the IM route or adipose, skin via the SQ-flank and hock route, and hepatic luc transgene expression, regardless of the route of administration ( Figure 9).
• AAV1 capsid containing formulations while resulting in localized transgene expression depending on the route of administration (skeletal muscle for IM and adipose and skin for SQ-flank and hock), did not result in any detectable hepatic transduction when administered via IM or SQ.
• the systemic IV route of administration most prominently transduced the liver regardless of the AAV capsid and formulation utilized, although expression was substantially stronger with AAV8 capsid containing formulations compared to the AAV1 capsid containing formulations.
• hLPL S447X transgene production and lipolytic activity resulting from novel AAV-hLPL S447X gene therapy formulations was first confirmed compared to Glybera in vitro.
• the expression cassette of Glybera (AAV1 pVR58) along with the novel AAV-hLPL S447X expression cassette designs are summarized in Figure 3.
• the novel AAV-hLPL S447X formulations utilize a C.O hLPL S447X transgene along with a shorter optimized WPRE sequence (WRPE 529b P) and a hGH PolyA.
• Glybera utilized the wild-type, non-codon-optimized hLPLS447X transgene, along with a longer WPRE sequence (WPRE 729b P) and a bGH PolyA (Figure 2A).
• WPRE 729b P WPRE 729b P
• bGH PolyA Figure 2A.
• In vitro assessments were carried out in mouse myotubes, human myotubes derived from primary human skeletal muscle cells and a human hepatocellular carcinoma HepG2 cell line.
• AAV1 pVR67 or AAV1 pVR74 resulted in increased hLPL protein expression ( Figures 11, 12) and lipolytic activity ( Figure 13) compared to Glybera.
• formulations utilizing the AAV1 serotype, particularly AAV1 pVR59 resulted in significantly higher hLPL protein expression and lipolytic activity compared to formulations utilizing the AAV8 serotypes.
• significantly elevated hLPL protein expression and lipolytic activity was observed following infection with AAV1 pVR59, AAV1 pVR60 and AAV8 pVR59 compared to Glybera ( Figures 11, 12, 13). Similar trends were observed in mouse C2C12 derived myotubes infected with novel AAV S447X formulations, as described in Figure 14.
• AAV8 pVR59 resulted in significantly elevated transduction, resulting in increased hLPL protein and lipolytic activity compared to Glybera and the other AAV1 -based formulations ( Figures 19, 20, 21).
• LPL-/- mice were utilized. LPL-/- mice possess a homozygous recessive mutation in the LPL gene, resulting in a complete lack of LPL protein 37 . LPL-/- pups exhibit severe plasma lipemia shortly after initiation of suckling ( Figure 22). Following suckling, LPL-/- pups exhibit extreme HTG, characterized by a 320-fold increase in plasma Tg ( Figure 23), along with a 3-fold elevation in plasma Tc ( Figure 24). Within 24-48h after birth, LPL-/- pups become cyanotic and die.
• AAVs were injected at either 1x10 11 gc/kg (low dose: LD) or 1x10 12 gc/kg (high dose: HD) via IM, IV, SQ- Flank or SQ-Hock, as summarized in Figure 28.
• Plasma lipemia clearing was similar whether the AAV-hLPL S447X formulations were administered SQ via the flanks or the hock ( Figure 32). More specifically, visible lipemia in LPL- /- mice plasma was cleared and undistinguishable from LPL+/+ mice plasma within 10 days of SQ treatment (hock and flank) with AAV8 pVR59 at HD, similar to what was observed via the IM and IV route of administration. Intermediate clearance was seen at a 10-fold lower dose (LD) of AAV8 pVR59. Complete clearance was achieved after 10 days of administration with AAV1 pVR59 at HD via the flanks or hock, with moderate clearance observed at the 10-fold LD.
• LD 10-fold lower dose
• Table 2 Summary of therapeutic efficacy following treatment with novel AAV-hLPLS447X formulations in LPL-/- mice compared to Glybera
• IM treatment with Glybera at 1x10 12 gc/kg resulted in a consistent lowering of plasma Tg to approximately 3700 mg/dl at study endpoint, equivalent to a -60% decrease ( Figure 30 and Table 2).
• IM treatment with AAV8 pVR59 at HD resulted in a complete normalization of plasma Tg levels to 105. mg/dl at study endpoint, equivalent to a -98.5% decrease.
• Treatment with a 10-fold lower dose (LD) of AAV8 pVR59 resulted in a lowering of plasma Tg to 2370.04 ⁇ 340.20 mg/dl, equivalent to a - 67.80% decrease.
• LD 10-fold lower dose
• Plasma Tc was normalized in LPL-/- mice treated IM with AAV1 pVR59 and AAV8 pVR59, but not with Glybera, AAV1 pVR60 or AAV8 pVR60 at HD ( Figure 33 and Table 2).
• IV treatment with Glybera at HD resulted in a steady lowering of plasma Tg to approximately 2945 mg/dl at study endpoint, equivalent to a 54% decrease from baseline ( Figure 34 and Table 2).
• IV treatment with AAV8 pVR59 at 1x10 12 gc/kg resulted in a complete normalization of plasma Tg levels to 93.19 ⁇ 4.30mg/dl at study endpoint, equivalent to a -98.69% decrease, similar to what was observed via the IM route of administration.
• Treatment with a 10- fold lower dose (LD) of AAV8 pVR59 resulted in a consistent lowering of plasma Tg to approximately 1092.44 ⁇ 674.45 mg/dl, equivalent to a -84.72% decrease from baseline, significantly more effective than a 10-fold higher dose of Glybera (HD).
• Treatment with AAV1 pVR59 at HD via IV resulted in an -87.17% plasma Tg lowering, while a 10-fold lower dose (LD) resulted in a -68.93% decrease in plasma Tg, which was also significantly more effective than a 10-fold higher dose (HD) of Glybera.
• Plasma Tc was normalized in LPL-/- mice treated IV with AAV1 pVR59 and AAV8 pVR59, but not with Glybera at HD ( Figure 35 and Table 2).
• Plasma triglyceride was lowered whether lowering was the AAV-hLPL formulations were administered SQ via the flanks or the hock ( Figure 35, 3I and Table 2). SQ treatment via the hock with Glybera at HD resulted in plasma Tg lowering to approximately 2514.81 ⁇ 633.46 mg/dl at study endpoint, equivalent to a -62.89% decrease from baseline.
• AAV8 pVR59 was the most effective AAV-hLPL S447X formulation at normalizing plasma lipids in LPL-/- mice via all routes of administration tested. More importantly, AAV8 pVR59 was found to be equally effective at a 10-fold lower dose of what was originally required to achieve similar therapeutic plasma Tg lowering efficacy with Glybera in previous reports 9 .
• LPL-/- mice exhibit a profound impairment in their ability to respond to a high fat load.
• AAV8 pVR59 At establishing superiority of AAV8 pVR59 at reducing fasting plasma Tg in LPL-/- mice compared to Glybera, the effectiveness of this formulation at normalizing the ability of LPL-/- mice to clear a high fat load was assessed. Briefly, vehicle-treated LPL+/+ mice or LPL-/- mice treated with vehicle or IM Glybera or IM AAV8 pVR59 (30 days post-treatment) at HD, were injected IV with a high fat load (Intralipid). Plasma samples were collected at baseline (pre-lntralipid treatment) and at regular intervals up to 3 hrs pot-lntralipid treatment.
• Vehicle-treated wild-type mice effectively clear more the Intralipid load within 3h post-infusion (Figure 40, Left Panel, associated with more than 95% reduction in plasma Tg (Figure 40, Right Panel).
• vehicle-treated LPL-/- mice exhibit significantly reduced clearance of plasma Tg compared to LPL+/+ mice ( Figure 40, Left Panel), with only approximately 11% clearance of plasma Tg following Intralipid infusion within 3h ( Figure 40, Right Panel).
• LPL-/- treated IM with Glybera exhibited approximately 40% clearance of plasma Tg following Intralipid infusion within 3h, which while it was a significant improvement over vehicle-treated LPL-/- mice, was not sufficient at completely clearing the fat load, as observed in LPL+/+ mice.
• LPL-/- mice treated IM with AAV8 pVR59 exhibited approximately 86% clearance of plasma Tg following Intralipid infusion within 3h, which was not significantly different compared to wild-type mice.
• AAV8 pVR59 treatment resulted in complete normalization, undistinguishable from LPL+/+ mice.
• hLPL S447X transgene expression and lipolytic activity in the post-heparin plasma of LPL- /- mice treated with novel AAV-hLPL S447X formulations was assessed using an ELISA specific for hLPL and a hLPL enzymatic activity assay.
• Vehicle-treated mice expressed negligible levels of hLPL protein and hLPL activity in post-heparin plasma.
• LPL+/+ mouse plasma contained on average of 344 mll/mL of endogenous mLPL lipolytic activity.
• IM treatment with AAV8 pVR59 at HD resulted in plasma hLPL expression of 1212 ng/ml, which was approximately 3-fold, 2-fold, 6-fold, and 6-fold higher than what was observed in the plasma collected from Glybera, AAV1 pVR59, AAV1 pVR60 and AAV8 pVR60 treated LPL- /-mice, respectively ( Figure 41).
• IM treatment with AAV8 pVR59 at HD resulted in a plasma hLPL activity level of 268 mll/mL, which fell within the normal range of endogenous mLPL activity observed in an LPL+/+ mouse ( Figure 42).
• Plasma hLPL activity levels from AAV8 pVR59 treated mice were 3.5-fold, 1.5-fold, 4-fold and 4-fold higher than what was observed in the plasma collected from Glybera, AAV1 pVR59, AAV1 pVR60 and AAV8 pVR60 treated LPL-/- mice, respectively.
• Treatment with a 10-fold lower dose of AAV8 pVR59 (LD) resulted in 1.6-fold higher hLPL activity compared to Glybera administered at a 10-fold higher dose.
• IV treatment with AAV8 pVR59 at HD resulted in plasma hLPL expression of 1841.
• ng/ml which was approximately 4.5-fold and 1.5-fold higher than what was observed in the plasma collected from Glybera and AAV1 pVR59 treated LPL-/-mice, respectively (Figure 43).
• Treatment with a 10-fold lower dose of AAV8 pVR59 (LD) resulted in transgene protein expression of 977.
• ng/ml which was 2- higher than what was observed in the plasma collected from Glybera- treated LPL-/- mice at a 10-fold higher dose.
• Plasma hLPL activity levels from AAV8 pVR59 treated mice were 5-fold and 2-fold higher than what was observed in the plasma collected from Glybera and AAV1 pVR59 treated LPL-/- mice, respectively.
• Treatment with a 10-fold lower dose of AAV8 pVR59 at HD resulted in 2-fold higher hLPL activity compared to Glybera administered at a 10- fold higher dose.
• Plasma hLPL activity levels from AAV8 pVR59 treated mice were 5-fold and 2-fold higher than what was observed in the plasma collected from Glybera and AAV1 pVR59 treated LPL-/- mice, respectively ( Figure 46).
• SQ hock treatment with AAV8 pVR59 at HD resulted in a plasma hLPL activity level of 349.26 ⁇ 77.50 mU/mL, which fell within the normal range of endogenous mLPL activity observed in an LPL+/+ mouse, which was comparable to the IM route of administration, but was significantly lower than what was observed via the IV route of administration.
• AAV1 pVR59 treatment also resulted in normalized level hLPL activity in LPL-/- mice at the HD which was not significantly different to what was achieved via treatment with AAV8 pVR59.
• plasma hLPL activity levels from AAV8 pVR59 treated mice were 3-fold higher than what was observed in the plasma collected from Glybera treated LPL-/- mice. No significant differences were observed within the novel formulation when comparing between hock and flank routes of SQ administration.
• mice treated with Glybera or AAV8 pVR59 via IM or IV were not significantly different within the skeletal muscle of mice treated with Glybera or AAV8 pVR59 via IM or IV.
• SQ-Flank-treated AAV8 pVR59 mice exhibited elevated AAV VG copies compared to Glybera within the skeletal muscle.
• mice treated via IV with either Glybera or AAV8 pVR59 had the lowest amount of detectable AAV VG present within the liver or skeletal muscle.
• hLPL transgene mRNA expression was analyzed within the skeletal muscle (quad) and liver of LPL-/- mice treated with Glybera and AAV8 pVR59 at study endpoint.
• IM-treated AAV8 pVR59 mice at HD exhibited 70-fold and 52-fold higher levels of hLPL mRNA in the liver and quad, respectively, compared to IM-treated Glybera mice ( Figure 48).
• IV- treated AAV8 pVR59 mice at HD exhibited 93-fold and 6-fold higher levels of hLPL mRNA in the liver and quad, respectively, compared to IV-treated Glybera mice.
• SQ-Flank treated AAV8 pVR59 mice at HD exhibited 0.6-fold and 5-fold higher levels of hLPL mRNA in the liver and quad, respectively, compared to SQ-Flank-treated Glybera mice.
• SQ-Hock treated AAV8 pVR59 mice exhibited 2-fold and 9-fold higher levels of hLPL mRNA in the liver and quad, respectively, compared to SQ- Hock-treated Glybera mice.
• In the livers of LPL-/- mice treated with AAV8 pVR59 at the LD there was 3-fold and 10-fold higher expression compared to Glybera treated mouse livers at HD.
• the quads of LPL-/- mice treated with AAV8 pVR59 at the LD there was 3-fold and 2-fold higher expression compared to Glybera treated mouse quads at HD.
• IM-treated AAV8 pVR59 tread LPL-/- mice in contrast to Glybera, while exhibiting skeletal muscle expression of the LPL transgene, also showed prominent expression within the liver, in a dose dependent manner.
• SQ route of administration with AAV8 pVR59 was stronger at inducing the liver compared to Glybera, but equal to Glybera at transducing skeletal muscle.
• Western blots quantified are provided in Figure 50.
• AAV8 pVR59 treatment resulted in strong, wide-spread hepatic expression of the hLPL S447X transgene, localized at the plasma membranes within hepatocytes regardless of the route of administration, albeit treatment via the IV route of administration exhibited the strongest liver (hepatocyte) expression ( Figure 51).
• IM route of administration was required with either AAV8 pVR59 or Glybera to obtain prominent hLPL S447X expression at the plasma membrane of individual myocytes.
• FIG 52 Panel A shows a Schematic representation of AAV8 pVR80 with deletion of WPRE compared to AAV8 pVR59.
• Panel B shows intracellular hLPLS447X protein expression in mouse myotubes treated with AAV8 pVR80 or AAV8 pVR59, with relative signal intensity quantified using densitometry relative to expression in vehicle treatment shown in Figure 52
• FIG 52 Panel D shows secreted hLPLS447X protein expression
• Tg plasma triglycerides
• AAV8 pVR80 was as effective as AAV8 pVR59 in correcting visible hyperlipidemia and correcting plasma triglycerides following intramuscular administration.
• NRC CMV indicates a CMV enhancer which was modified by removing 5 CpGs.
• EF1a indicates the EF1a enhancer.
• CBA in the above indicates the chicken beta-actin promoters.
• NRC CBA indicates a version of CBA which was modified by removing 1 CpG.
• EF1a indicates the EF1a promoter.
• CAGG indicates intron 1 of chicken beta-actin, as used in the CAGG promoter.
• NRC SV40 indicates an SV40 intron modified to remove two CpGs in the intron.
• EF1a indicates elongation factor 1a wild type sequence.
• Opt indicates codon-optimized, dCpG indicates
• CpGs are removed or mutated, and dCpG-Opt indicates that both modifications are present.
• Wt indicates wild type sequence.
• Table 5 presents the CpG content of these constructs.
• CpG-depleted formulations were developed based on AAV8 pVR59 ( Figure 55) and examined their efficacy in mouse skeletal muscle cells. Removal of CpG elements in the promoter (by replacing the CAGG intron with the SV40 intron) and therapeutic transgene (AAV8 pNC152, AAV8 pNC162 and AAV8 pNC163) resulted in a significant reduction in levels of intracellular hLPL transgene expression, secreted LPL expression, and activity (Figure 56,
• Both AAV8 pNC182 and AAV8 pNC201 showed comparable levels of intracellular hLPL transgene expression, secreted LPL expression, and activity compared to AAV8 pVR59 in mouse skeletal muscle cells ( Figure 58, Figure 59 Panels A-C). [00303] the in vivo efficacy of AAV8 pNC182 and AAV8 pNC201 were next validated compared to AAV8 pVR59 in a short-term study in LPL-/- mice.
• Intramuscular delivery of these CpG- depleted vectors in LPL-/- mice revealed AAV8 pNC182 to be equally efficacious as AAV8 pVR59 in normalizing plasma lipemia (Figure 60) and plasma triglyceride levels (Figure 61).
• a long-term efficacy study comparing AAV8 pNC182 to AAV8 pVR59 in LPL-/- mice was conducted, as outlined in Figure 62.
• AAV8 pNC182 delivered intramuscularly, led to complete correction of plasma lipemia in adult LPL-/- mice.
• plasma lipid levels became visually indistinguishable from those of LPL+/+ mice as early as day 10 post-treatment and remained persistently normalized for up to 180 days similar to what was observed in AAV8 pVR59-treated mice ( Figure 63).
• AAV8 pVR59 ( Figure 64) resulted in over a 95% reduction in plasma triglyceride (Tg) levels at doses exceeding 1x10 12 gc/kg, whereas AAV8 pNC182 (Figure 65) achieved over a 96% reduction in plasma Tg levels at doses as low as 5x10 11 gc/kg. Furthermore, plasma Tg levels remained indistinguishable from those of control LPL+/+ mice treated with vectors for up to 180 days.
• LPL-/- mice rescued at birth using AdV-hLPLS447X treatment were utilized.
• Rescued adult LPL-/- mice exhibit pronounced LPLD phenotypes, including plasma lipemia, severe HTG with plasma Tg levels as high as 10,000mg/dl, reduced plasma HDL-c and impaired fat tolerance.
• Plasma Tg levels are one of the most useful surrogate markers of determining the risk of pancreatitis, a common life-threatening manifestation of LPLD in humans.
• Rescued LPL-/- mice do not show any signs of pancreatitis. However, in humans with LPLD, the risk of pancreatitis drastically increases as plasma Tg levels are elevated above 800 mg/dL.
• the promoter is an important DNA regulatory element within an AAV gene therapy formulation that is responsible for mediating onset, strength and localization of transgene expression at the cellular level.
• the ubiquitous CMV promoter was utilized in Glybera to rapidly drive strong expression of the hLPLS447X transgene within the injected skeletal muscle.
• transgenes driven by a CMV promoter using AAV vectors may be prone to promoter silencing within several organs such as the liver and that sustained expression is dependent on the choice of promoter.
• AAV formulations utilizing the ubiquitously expressing, hybrid CAG promoter resulted in increased transgene expression compared to formulations utilizing the AUSEx4 muscle specific promoter or the CMV promoter.
• hLPL S447X For the therapeutic transgene, either a native hLPL S447X transgene, as utilized in Glybera, or a novel high-protein expression codon-optimized hLPL S447X transgene was used.
• the hLPL S447X mutation is a gain of function variant present within 20-25% of the general population, which is associated increased lipolytic function via increased lipoprotein uptake, along with an anti-atherogenic, cardio-protective lipid profile.
• Previous studies suggested that hLPL S447X is significantly more effective at normalizing plasma Tg compared to wild-type hLPL in LPL-/- mice.
• Glybera delivered a non-codon-optimized hLPLS447X transgene, while all of the novel AAV formulations described here, including AAV8 pVR59, delivered a codon-optimized hLPL S447X transgene, which has been optimized to maximize transgene expression, potentially allowing for increased therapeutic efficacies to be achieved at lower doses.
• LPL is primarily synthesized within skeletal muscle cells and adipose tissue. Following production, LPL is secreted and bound to the luminal surface of blood vessels via heparin sulfate proteoglycans, where it breaks down Tg within chylomicrons and VLDL 1-6.
• the transduction properties of an AAV serotype are primarily dependent on the interaction between viral capsid proteins and target specific cell surface receptors 14. The AAV1 serotype was selected for Glybera due its excellent tropism towards skeletal muscle cells.
• AAV1 or AAV8 serotype was utilized, with the aim of targeting the skeletal muscle and/or liver as the primary organs for hLPLS447X gene transfer.
• the in vitro studies showed that both human and mouse myotubes and HepG2 (liver cell line) are able to produce and secrete functionally active hLPLS447X protein following treatment with novel AAV-hLPLS447X formulations.
• the in vivo biodistribution studies revealed increased skeletal muscle transduction efficacies following IM administration of an AAV1 -based compared to an AAV8-based formulation.
• AAV8-based formulations towards the liver were compared to AAV1 -based formulations regardless of the ROA.
• Other groups have shown that the AAV8 serotypes exhibit a more uniform tissue transduction pattern throughout the hindlimb, abdominal, and thoracic regions compared to other serotypes including AAV1 , with the hindlimb skeletal muscle being the next most common area of transduction after liver hepatocytes, when delivered systemically via an IV ROA.
• Glybera delivered the hLPL S447X transgene to human skeletal muscle via a series of 30- 40 IM injections under epidural anesthesia. Based on previous data from Glybera in mice, cats and in humans, along with current findings, it is evident that the IM ROA is effective for obtaining skeletal muscle-specific expression of hLPL S447X when paired with an AAV1 -based formulation, such as Glybera. In the current studies, it was observed that AAV8-based formulations, such as AAV8 pVR59, when delivered into skeletal muscle via an IM ROA, are useful for obtaining more widespread hLPL S447X within the injected skeletal muscle and liver.
• AAV8-based formulations such as AAV8 pVR59
• An intra-adipose ROA has been tested with AAV formulations in mouse pre-clinical studies and they been shown to be effective at delivering transgenes to a wide variety of adipose tissues, including white and brown adipose.
• LPLD patients often have very low levels of adipose tissue, which may result in inefficient adipose-gene transfer, making the intra-adipose ROA challenging.
• a systemic IV ROA is easier to administer, less painful to the patients compared to the previously utilized IM ROA, and potentially exhibit improved efficacy when paired with an AAV8- based formulation such as AAV8 pVR59 due to its superior ability to transduce the liver compared to an AAV1 -based formulation such as Glybera.
• AAV8 exhibits strong liver tropism
• AAV8 pVR59 would result in enhanced hepatic gene transfer, allowing for increased secreted hLPL S447X expression, leading to enhanced therapeutic efficacies compared to an AAV1 -based formulation such as Glybera.
• Wild-type mice have approximately 100 ng/ml - 600 ng/ml of circulating LPL within plasma, while healthy humans have approximately 400 ng/ml of hLPL within plasma, secreted primarily from adipose tissue and skeletal muscle.
• AAV8 pVR59 Following the identification of AAV8 pVR59 as a potential candidate for AAV-based LPL gene replacement therapy, it was sought to optimize this vector to mitigate potential immunogenicity observed in humans. Unmethylated CpG dinucleotides within AAV have been shown in clinical studies to elicit TLR9-driven cytotoxic CD8+ T-cell responses, leading to rapid transgene elimination and clinical failure. Cell culture and mouse studies do not fully model these immune responses. However, it's desirable to minimize CpGs within AAV8 pVR59 to reduce potential immunogenicity in humans, while maintaining therapeutic efficacy. AAV8 pVR59 contains 341 CpGs (7.4% of the total sequence).
• novel AAV8 pVR59-based formulations were developed with reduced CpG content.
• four variants (AAV8 pVR80, AAV8 pNC152, AAV8 pNC162, and AAV8 pNC163) modified to minimize CpG dinucleotides ( Figures 52 and 55/Tables 4 and 5) were developed and tested.
• CpG reduction involved removing the WPRE sequence, using a shortened CAG promoter (CB promoter), employing a CpG-depleted hLPL S447X open reading frame (ORF), or utilizing a h - Globin polyA.
• CB promoter shortened CAG promoter
• ORF open reading frame
• AAV8 pNC182 demonstrated comparable hLPL transgene expression and activity in vitro in mouse skeletal muscle cells to AAV8 pNC201 and AAV8 pVR59. Notably, AAV8 pNC182 normalized plasma lipemia and Tg at lower doses over 180 days compared to AAV8 pVR59.
• Chylomicronemia Syndrome Front. Endocrinol. (Lausanne). 11 , 830 (2020).
• the LPL S447X cSNP is associated with decreased blood pressure and plasma triglycerides, and reduced risk of coronary artery disease. Clin. Genet. 60, 293-300 (2001).
• AAV adeno-associated virus
• Serotypes 1-9 Mediated Gene Expression and Tropism in Mice After Systemic Injection. Mol. Ther. 16, 1073-1080 (2008).

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Biochemistry (AREA)
• Molecular Biology (AREA)
• Biomedical Technology (AREA)
• Medicinal Chemistry (AREA)
• Microbiology (AREA)
• Pharmacology & Pharmacy (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Diabetes (AREA)
• Hematology (AREA)
• Obesity (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Virology (AREA)
• Plant Pathology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Epidemiology (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=92754170

Family Applications (1)

Country Status (2)

• 2024
  • 2024-03-11 WO PCT/CA2024/050295 patent/WO2024187274A1/en not_active Ceased
  • 2024-03-11 EP EP24769605.7A patent/EP4680751A1/de active Pending

Also Published As

Similar Documents

Legal Events