EP4236975A1 - Aav capsids and compositions containing same - Google Patents

Aav capsids and compositions containing same

Info

Publication number
EP4236975A1
EP4236975A1 EP21824439.0A EP21824439A EP4236975A1 EP 4236975 A1 EP4236975 A1 EP 4236975A1 EP 21824439 A EP21824439 A EP 21824439A EP 4236975 A1 EP4236975 A1 EP 4236975A1
Authority
EP
European Patent Office
Prior art keywords
seq
capsid
hsa
mir
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP21824439.0A
Other languages
German (de)
English (en)
French (fr)
Inventor
James M. Wilson
Kalyani NAMBIAR
Qiang Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pennsylvania Penn
Original Assignee
University of Pennsylvania Penn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Pennsylvania Penn filed Critical University of Pennsylvania Penn
Publication of EP4236975A1 publication Critical patent/EP4236975A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14121Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • Adeno-associated virus (AAV) vectors hold great promise in human gene therapy and have been widely used to target liver, muscle, heart, brain, eye, kidney, and other tissues in various studies due to their ability to provide long-term gene expression and lack of pathogenicity.
  • AAV belongs to the parvovirus family and contains a single-stranded DNA genome flanked by two inverted terminal repeats. Dozens of naturally occurring AAV capsids have been reported; their unique capsid structures enable them to recognize and transduce different cell types and organs.
  • AAV is easily manipulated as the virus has a single-stranded DNA virus with a relatively small genome (—4.7 kb) and simple genetic components -inverted terminal repeats (ITR), the Rep and Cap genes.
  • ITRs and AAV capsid protein are required in AAV vectors, with the ITRs serving as replication and packaging signals for vector production and the capsid proteins playing a central role by forming capsids to accommodate vector genome DNA and determining tissue tropism.
  • AAVs are among the most effective vector candidates for gene therapy due to their low immunogenicity and non-pathogenic nature.
  • the AAV vectors currently used in the clinic can be hindered by preexisting immunity to the virus and restricted tissue tropism. Thus, additional AAV vectors are needed.
  • a recombinant adeno-associated virus comprising a capsid and a vector genome comprising an AAV 5’ inverted terminal repeat (ITR), an expression cassette comprising a nucleic acid sequence encoding a gene product operably linked to expression control sequences, and an AAV 3’ ITR, wherein the capsid is: (a) an AAVrh75 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 40 or a sequence at least 99% identical thereto having an Asn (N) amino acid residue at position 24 based on the numbering of SEQ ID NO: 40; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 39 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 40; or (iii) a capsid which is heterogeneous mixture of AAVrh75 vp
  • a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 6 (i) a capsid produced from a nucleic acid sequence of SEQ ID NO: 5of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 6; or (iii) a capsid which is a heterogeneous mixture of AAVhu79 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 6, and optionally deamidated in other positions; (d) an AAVhu80 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 8; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 7 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 8; or (iii) a capsid which is
  • a pharmaceutical composition comprising a rAAV, and a physiologically compatible carrier, buffer, adjuvant, and/or diluent.
  • a method of delivering a transgene to a cell comprising the step of contacting the cell with the rAAV according to any one of claims 1 to 5, wherein said rAAV comprises the transgene.
  • a method of generating a recombinant adeno- associated virus (rAAV) comprising an AAV capsid comprising culturing a host cell containing: (a) a molecule encoding an AAV vpl, vp2, and/or vp3 capsid protein of AAVrh75 (SEQ ID NO: 40), AAVhu71/74 (SEQ ID NO: 4), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu83 (SEQ ID NO: 10), AAVhu74/71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78/88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu76 (SEQ ID NO: 24), AAV
  • a plasmid comprising a vpl, vp2, and/or vp3 sequence of AAVrh75 (SEQ ID NO: 39), AAVhu71/74 (SEQ ID NO: 3), AAVhu79 (SEQ ID NO: 5), AAVhu80 (SEQ ID NO: 7), AAVhu83 (SEQ ID NO: 9), AAVhu74/71 (SEQ ID NO: 11), AAVhu77 (SEQ ID NO: 13), AAVhu78/88 (SEQ ID NO: 15), AAVhu70 (SEQ ID NO: 17), AAVhu72 (SEQ ID NO: 19), AAVhu75 (SEQ ID NO: 21), AAVhu76 (SEQ ID NO: 23), AAVhu81 (SEQ ID NO: 25), AAVhu82 (SEQ ID NO: 27), AAVhu84 (SEQ ID NO: 29), AAVhu86 (SEQ ID NO: 31), AAVhu87
  • FIG. 1 shows a diagram for AAV-Single Genome Amplification (AAV-SGA).
  • AAV-SGA AAV-Single Genome Amplification
  • FIG. 2A - FIG. 2D show an analysis of variable fidelity of DNA polymerases and bioactivity of PCR mutants.
  • FIG. 2B Vector production titers of AAV9-mutant PCR isolates generated by HiFi PCR.
  • FIG. 2D Schematic of aligned PCR mutant AAV Cap DNA sequences. Each nucleotide mismatch to AAV9 is shown as a black line. Sequence information for the mismatches in these experiments are detailed in Table 1.
  • FIG. 3 A - FIG. 3C show phylogenetic analyses of positive selection of AAV VP1 genes Neighbor-joining phylogenies of AAV VP1 DNA sequences from human isolates (FIG. 3A), rhesus macaque isolates (FIG. 3B), and previously reported human AAV HSC (FIG. 3C). Branches where BUSTED detected evidence of positive selection are colored in red. Circled branch nodes represent bootstrap support values >70.
  • FIG. 4 shows a phylogenetic analysis of HiFi PCR mutant AAV VP1 genes. Neighbor-joining phylogeny of AAV VP1 DNA sequences of HiFi PCR mutants.
  • FIG. 5A - FIG. 5C show an alignment of amino acid sequences for AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 81), AAVhu81 (SEQ ID NO: 26), AAVhu82 (SEQ ID NO: 28), AAVhu83 (SEQ ID NO: 10), and AAVhu86 (SEQ ID NO: 32).
  • FIG. 6A - FIG. 6G show an alignment of nucleotide sequences for AAVhu72 (SEQ ID NO: 19), AAVhu75 (SEQ ID NO: 21), AAVhu79 (SEQ ID NO: 5), AAVhu80 (SEQ ID NO: 7), AAVhu81 (SEQ ID NO: 25), AAVhu82 (SEQ ID NO: 27), AAVhu83 (SEQ ID NO: 9), and AAVhu86 (SEQ ID NO: 31).
  • FIG. 7A - FIG. 7D show an alignment of amino acid sequences for AAVhu69 (SEQ ID NO: 38), AAVhu70 (SEQ ID NO: 18), AAVhu71.74 (SEQ ID NO: 4), AAVhu73 (SEQ ID NO: 74), AAVhu74.71 (SEQ ID NO: 12), AAVhu76 (SEQ ID NO: 24), AAVhu77 (SEQ ID NO: 14), AAVhu78.88 (SEQ ID NO: 16), AAVhu84 (SEQ ID NO: 30), AAVhu87 (SEQ ID NO: 34), AAVhu88.78 (SEQ ID NO: 36), and AAVrh81 (SEQ ID NO: 50).
  • FIG. 8A - FIG. 8J show an alignment of nucleotide sequences for AAVhu69 (SEQ ID NO: 37), AAVhu70 (SEQ ID NO: 17), AAVhu71.74 (SEQ ID NO: 3), AAVhu73 (SEQ ID NO: 73), AAVhu74.71 (SEQ ID NO: 11), AAVhu76 (SEQ ID NO: 23), AAVhu77 (SEQ ID NO: 13), AAVhu78.88 (SEQ ID NO: 15), AAVhu84 (SEQ ID NO: 29), AAVhu87 (SEQ ID NO: 33), AAVhu88.78 (SEQ ID NO: 25), and AAVrh81 (SEQ ID NO: 49).
  • FIG. 9 A - FIG. 9B show an alignment of amino acid sequences for, AAVrh76 (SEQ ID NO: 42), AAVrh85 (SEQ ID NO: 60), AAVrh87 (SEQ ID NO: 62), AAVrh89 (SEQ ID NO: 52), and AAV7 (SEQ ID NO: 85).
  • FIG. 10A - FIG. 10E show an alignment of nucleotide sequences for AAVrh75 (SEQ ID NO: 39), AAVrh76 (SEQ ID NO: 41), AAVrh85 (SEQ ID NO: 59), AAVrh87 (SEQ ID NO: 61), AAVrh89 (SEQ ID NO: 51), and AAV7 (SEQ ID NO: 84).
  • FIG. 11 A - FIG. 1 IB show an alignment of amino acid sequences for AAVrh75 (SEQ ID NO: 40), AAVrh79 (SEQ ID NO: 48), AAVrh83 (SEQ ID NO: 56), AAVrh84 (SEQ ID NO: 58), and AAV8 (SEQ ID NO: 83).
  • FIG. 12A - FIG. 12E show an alignment of nucleotide sequences for AAVrh79 (SEQ ID NO: 47), AAVrh83 (SEQ ID NO: 55), AAVrh84 (SEQ ID NO: 57), and AAV8 (SED ID NO: 82).
  • FIG. 13 shows an alignment of amino acid sequences for AAVrh77 (SEQ ID NO: 44), AAVrh78 (SEQ ID NO: 46), and AAVrh82 (SEQ ID NO: 54).
  • FIG. 14A - FIG. 14C show an alignment of nucleotide sequences for AAVrh77 (SEQ ID NO: 43), AAVrh78 (SEQ ID NO: 45), and AAVrh82 (SEQ ID NO: 53).
  • FIG. 15 shows AAV vector yields.
  • Cis plasmids containing the capsid genes for the indicated isolates were used to package a vector genome containing the TBG promoter and an eGFP transgene.
  • the vectors were manufactured with triple-transfection (one CellStack each), purified with a iodixanol gradient, and titrated using qPCR.
  • E+ # refers to the exponent which follows the E+ in numerical value, e.g., E+13 refers to “x 10 13 “GC” refers vector genome copies.
  • FIG. 16 shows infectious titers for AAVrh75 and AAVrh81 vector preparations.
  • Vectors (carrying a reporter transgene cassette) with AAVrh75 and AAVrh81 capsids were prepared at the plate scale, with AAV8 as the control. Crude lysates were then used to transduce a human and a mouse cell line. The infectious titers for AAVrh75 and AAVrh81 are presented as the transduction relative to AAV8 control.
  • FIG. 17 shows liver transduction for an AAVrh81 vector.
  • C57BL/6J mice were dosed with AAVrh91.LSP.hF9 or AAV8.LSP.hF9 at 1 x 10 10 gc/animal intravenously and plasma was collected 28 days after dosing for human F9 (hF9) measurement.
  • FIG. 18 shows liver transduction for AAVrh83 and AAVrh84 vectors.
  • C57BL/6J mice were dosed with AAVrh83.TBG.eGFP or AAVrh84.TBG.eGFP at a dose of 1 x 10 11 gc/animal intravenously.
  • Livers were harvested 14 days later for GFP imaging. Representative images from each animal are shown.
  • FIG. 19 shows liver transduction for novel AAV isolates.
  • C57BL/6J mice were dosed with AAVrh78.TBG.eGFP, AAVrh78.TBG.eGFP, AAVrh78.TBG.eGFP, or AAVrh78.TBG.eGFP, or AAV8.TBG.eGFP at a dose of 1 x 10 11 gc/animal (AAVrh87 was 6.4 x 10 10 gc/animal due to low prep titer) intravenously. Livers were harvested 14 days later and genomic DNA was extracted for vector genome copy measurement by qPCR.
  • liver transduction levels for AAVrh78, AAVrh85, AAVrh87, and AAVrh89 were ⁇ 49%, 72%, 16% and 22% of AAV8, respectively.
  • the p values (t-test, compared to the AAV8 group) are shown.
  • AAV single genome amplification a technique used to accurately isolate individual AAV genomes from within a viral population (FIG. 1). Described herein is the isolation of novel AAV sequences from rhesus macaque tissues and human tissues that can be categorized in various clades.
  • the 12 novel AAV isolates from rhesus macaque tissues can be categorized in clades D, E, and the primate clade outgroup that contains AAVrh32.33.
  • the 20 novel AAV isolates from human tissues can be categorized in clades B and C, or similar to AAV2 and AAV2-AAV3 hybrids, respectively.
  • nucleic acid indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the aligned sequences.
  • the homology is over full-length sequence, or an open reading frame thereof, or another suitable fragment which is at least 15 nucleotides in length. Examples of suitable fragments are described herein.
  • sequence identity “percent sequence identity” or “percent identical” in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence.
  • the length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g., of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.
  • percent sequence identity may be readily determined for amino acid sequences, over the full-length of a protein, or a fragment thereof.
  • a fragment is at least about 8 amino acids in length and may be up to about 700 amino acids. Examples of suitable fragments are described herein.
  • substantially homology indicates that, when optimally aligned with appropriate amino acid insertions or deletions with another amino acid (or its complementary strand), there is amino acid sequence identity in at least about 95 to 99% of the aligned sequences.
  • the homology is over full-length sequence, or a protein thereof, e.g., a cap protein, a rep protein, or a fragment thereof which is at least 8 amino acids, or more desirably, at least 15 amino acids in length. Examples of suitable fragments are described herein.
  • highly conserved is meant at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. Identity is readily determined by one of skill in the art by resort to algorithms and computer programs known by those of skill in the art.
  • aligned sequences or alignments refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence.
  • AAV alignments are performed using the published AAV9 sequences as a reference point. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs.
  • Such programs include, “Clustal Omega”, “Clustal W”, “CAP Sequence Assembly”, “MAP”, and “MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using FastaTM, a program in GCG Version 6.1. FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences.
  • percent sequence identity between nucleic acid sequences can be determined using FastaTM with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference.
  • Multiple sequence alignment programs are also available for amino acid sequences, e.g., the “Clustal Omega”, “Clustal X”, “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed.
  • one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999).
  • AAV intermediate or “AAV vector intermediate” refers to an assembled rAAV capsid which lacks the desired genomic sequences packaged therein. These may also be termed an “empty” capsid. Such a capsid may contain no detectable genomic sequences of an expression cassette, or only partially packaged genomic sequences which are insufficient to achieve expression of the gene product.
  • a “genetic element” includes any nucleic acid molecule, e.g., naked DNA, a plasmid, phage, transposon, cosmid, episome, virus, etc., which transfers the sequences carried thereon.
  • a genetic element may utilize a lipid-based carrier.
  • the genetic element may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
  • a “stable host cell” for rAAV production is a host cell with had been engineered to contain one or more of the required rAAV production elements (e.g., mini gene, rep sequences, the AAVhu68 engineered cap sequences as defined herein, and/or helper functions) and its progeny.
  • a stable host cell may contain the required component(s) under the control of an inducible promoter. Alternatively, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion of regulatory elements suitable for use with the transgene.
  • a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters.
  • a stable host cell may be generated which is derived from HEK293 cells (which contain El helper functions under the control of a constitutive promoter), Huh7 cells, Vero cells, engineered to contain helper functions under the control of a suitable promoter, which optionally further contains the rep and/or cap proteins under the control of inducible promoters.
  • Still other stable host cells may be generated by one of skill in the art.
  • an “expression cassette” refers to a nucleic acid molecule which comprises a biologically useful nucleic acid sequence (e.g., a gene cDNA encoding a protein, enzyme or other useful gene product, mRNA, etc.) and regulatory sequences operably linked thereto which direct or modulate transcription, translation, and/or expression of the nucleic acid sequence and its gene product.
  • a biologically useful nucleic acid sequence e.g., a gene cDNA encoding a protein, enzyme or other useful gene product, mRNA, etc.
  • sc refers to self-complementary.
  • Self-complementary AAV refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double-stranded DNA template.
  • dsDNA double stranded DNA
  • operably linked refers to both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • heterologous when used with reference to a protein or a nucleic acid indicates that the protein or the nucleic acid comprises two or more sequences or subsequences which are not found in the same relationship to each other in nature.
  • the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid.
  • the nucleic acid has a promoter from one gene arranged to direct the expression of a coding sequence from a different gene.
  • the promoter is heterologous.
  • a “replication-defective virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
  • the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be “gutless” - containing only the gene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.
  • rAAV particles are referred to as DNase resistant.
  • DNase endonuclease
  • other endo- and exo- nucleases may also be used in the purification steps described herein, to remove contaminating nucleic acids.
  • Such nucleases may be selected to degrade single stranded DNA and/or double-stranded DNA, and RNA.
  • Such steps may contain a single nuclease, or mixtures of nucleases directed to different targets, and may be endonucleases or exonucleases.
  • nuclease-resistant indicates that the AAV capsid has fully assembled around the expression cassette which is designed to deliver a gene to a host cell and protects these packaged genomic sequences from degradation (digestion) during nuclease incubation steps designed to remove contaminating nucleic acids which may be present from the production process.
  • an “effective amount” refers to the amount of the rAAV composition which delivers and expresses in the target cells an amount of the gene product from the vector genome.
  • An effective amount may be determined based on an animal model, rather than a human patient. Examples of a suitable murine model are described herein.
  • the term “translation” in the context of the present invention relates to a process at the ribosome, wherein an mRNA strand controls the assembly of an amino acid sequence to generate a protein or a peptide.
  • the terms “a” or “an”, refers to one or more, for example, “an expression cassette” is understood to represent one or more expression cassettes. As such, the terms “a” (or “an”), “one or more,” and “at least one” are used interchangeably herein.
  • Nucleic acids encoding AAV capsids include three overlapping coding sequences, which vary in length due to alternative start codon usage.
  • the translated proteins are referred to as VP1, VP2 and VP3, with VP1 being the longest and VP3 being the shortest.
  • the AAV particle consists of all three capsid proteins at a ratio of -1:1: 10 (VP1:VP2:VP3).
  • VP3 which is comprised in VP1 and VP2 at the N-terminus, is the main structural component that builds the particle.
  • the capsid protein can be referred to using several different numbering systems. For convenience, as used herein, the AAV sequences are referred to using VP1 numbering, which starts with aa 1 for the first residue of VP1. However, the capsid proteins described herein include VP1, VP2, and VP3 (used interchangeably herein with vpl, vp2, and vp3).
  • novel AAV capsid proteins having vpl sequences set forth in the sequence listing: AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu81 (SEQ ID NO: 26), AAVhu82 (SEQ ID NO: 28), AAVhu83 (SEQ ID NO: 10), or AAVhu86 (SEQ ID NO: 32).
  • the numbering of the nucleotides and amino acids corresponding to the vpl, vp2, and vp3 are as follows: Nucleotides (nt)
  • AAVhu72 vpl- nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: vpl- nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: vpl- nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID
  • AAVhu75 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 21;
  • AAVhu79 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 5;
  • AAVhu80 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 7;
  • AAVhu81 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 25;
  • AAVhu82 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 27;
  • AAVhu83 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 9;
  • AAVhu86 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 31.
  • AAVhu72 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 20;
  • AAVhu75 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 22;
  • AAVhu79 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 6;
  • AAVhu80 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 8;
  • AAVhu81 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 26;
  • AAVhu82 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 28;
  • AAVhu83 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 10;
  • AAVhu86 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID
  • rAAV comprising at least one of the vpl, vp2, and vp3 of any of AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu81 (SEQ ID NO: 26), AAVhu82 (SEQ ID NO: 28), AAVhu83 (SEQ ID NO: 10), or AAVhu86 (SEQ ID NO: 32).
  • rAAV having a capsid protein comprising a vpl, vp2, and/or vp3 sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu81 (SEQ ID NO: 26), AAVhu82 (SEQ ID NO: 28), AAVhu83 (SEQ ID NO: 10), or AAVhu86 (SEQ ID NO: 32) are provided.
  • the vpl, vp2, and/or vp3 has up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 amino acid differences relative to the vpl, vp2, and/or vp3 of AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu81 (SEQ ID NO: 26), AAVhu82 (SEQ ID NO: 28), AAVhu83 (SEQ ID NO: 10), or AAVhu86 (SEQ ID NO: 32).
  • AAVhu72 SEQ ID NO: 20
  • AAVhu75 SEQ ID NO: 22
  • AAVhu79 SEQ ID NO: 6
  • AAVhu80 SEQ ID NO: 8
  • AAVhu81 SEQ ID NO: 26
  • AAVhu82 SEQ ID NO:
  • rAAV comprising AAV capsids encoded by at least one of the vpl, vp2, vp3 sequence of AAVhu72 (SEQ ID NO: 19), AAVhu75 (SEQ ID NO: 21), AAVhu79 (SEQ ID NO: 5), AAVhu80 (SEQ ID NO: 7), AAVhu81 (SEQ ID NO: 25), AAVhu82 (SEQ ID NO: 27), AAVhu83 (SEQ ID NO: 9), or AAVhu86 (SEQ ID NO: 31), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19, 21, 5, 7, 25, 27, 9, or 31.
  • the sequence encodes a full-length vpl, vp2 and/or vp3 of AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu81 (SEQ ID NO: 26), AAVhu82 (SEQ ID NO: 28), AAVhu83 (SEQ ID NO: 10), or AAVhu86 (SEQ ID NO: 32).
  • the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g. truncation(s) of about 1 to about 10 amino acids).
  • novel AAV capsid proteins having vpl sequences set forth in the sequence listing: AAVrh81(SEQ ID NO: 50), AAVhu71.74 (SEQ ID NO: 4), AAVhu73 (SEQ ID NO: 74), AAVhu74.71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78.88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu76 (SEQ ID NO: 24), AAVhu84 (SEQ ID NO: 30), hu87 (SEQ ID NO: 34), AAVhu88.78 (SEQ ID NO: 36), or AAVhu69 (SEQ ID NO: 38).
  • the numbering of the nucleotides and amino acids corresponding to the vpl, vp2, and vp3 are as follows: Nucleotides (nt)
  • AAVrh81 vpl- nt 1 to 2217; vp2- nt 412 to 2217; vp3- nt 619 to 2217 of SEQ ID NO: 49;
  • AAVhu71.74 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 3;
  • AAVhu73 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 73;
  • AAVhu74.71 vpl- nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 11;
  • AAVhu77 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 13;
  • AAVhu78.88 vpl- nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 15;
  • AAVhu70 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 17;
  • AAVhu76 vpl - nt 1 to 2202; vp2- nt 412 to 2202; vp3- nt 607 to 2202 of SEQ ID NO: 23;
  • AAVhu84 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 29;
  • AAVhu87 vpl - nt 1 to 2202; vp2- nt 412 to 2202; vp3- nt 607 to 2202 of SEQ ID NO: 33;
  • AAVhu88.78 vpl- nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 35;
  • AAVhu69 vpl - nt 1 to 2205; vp2- nt 412 to 2205; vp3- nt 607 to 2205 of SEQ ID NO: 37.
  • AAVrh81 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 207 to 739 of SEQ ID NO: 50;
  • AAVhu71.74 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 4;
  • AAVhu73 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 74;
  • AAVhu74.71 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 12;
  • AAVhu77 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 14;
  • AAVhu78.88 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 16;
  • AAVhu70 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 18;
  • AAVhu76 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 734 of SEQ ID NO: 24;
  • AAVhu84 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 30;
  • AAVhu87 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 734 of SEQ ID NO: 34;
  • AAVhu88.78 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 36;
  • AAVhu69 aa vpl - 1 to 735; vp2 - aa 138 to 735; vp3 - aa 203 to 735 of SEQ ID NO: 38.
  • rAAV comprising at least one of the vpl, vp2, and vp3 of any of AAVrh81(SEQ ID NO: 50), AAVhu71.74 (SEQ ID NO: 4), AAVhu73 (SEQ ID NO: 74), AAVhu74.71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78.88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu76 (SEQ ID NO: 24), AAVhu84 (SEQ ID NO: 30), hu87 (SEQ ID NO: 34), AAVhu88.78 (SEQ ID NO: 36), or AAVhu69 (SEQ ID NO: 38).
  • rAAV having a capsid protein comprising a vpl, vp2, and/or vp3 sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to AAVrh81(SEQ ID NO: 50), AAVhu71.74 (SEQ ID NO: 4), AAVhu73 (SEQ ID NO: 74), AAVhu74.71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78.88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu76 (SEQ ID NO: 24), AAVhu84 (SEQ ID NO: 30), hu87 (SEQ ID NO: 34), AAVhu88.78 (SEQ ID NO: 36), or AAVhu69 (SEQ ID NO: 38) are provided.
  • the vpl, vp2, and/or vp3 has up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 amino acid differences relative to the vpl, vp2, and/or vp3 of AAVrh81(SEQ ID NO: 50), AAVhu71.74 (SEQ ID NO: 4), AAVhu73 (SEQ ID NO: 74), AAVhu74.71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78.88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu76 (SEQ ID NO: 24), AAVhu84 (SEQ ID NO: 30), hu87 (SEQ ID NO: 34), AAVhu88.78 (SEQ ID NO: 36), or AAVhu69 (SEQ ID NO: 38).
  • rAAV comprising AAV capsids encoded by at least one of the vpl, vp2 and the vp3 sequence of AAVrh81(SEQ ID NO: 49), AAVhu71.74 (SEQ ID NO: 3), AAVhu73 (SEQ ID NO: 73), AAVhu74.71 (SEQ ID NO: 11), AAVhu77 (SEQ ID NO: 13), AAVhu78.88 (SEQ ID NO: 15), AAVhu70 (SEQ ID NO: 17), AAVhu76 (SEQ ID NO: 23), AAVhu84 (SEQ ID NO: 29), hu87 (SEQ ID NO: 33), AAVhu88.78 (SEQ ID NO: 35), or AAVhu69 (SEQ ID NO: 37) or a sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 49, 3, 73, 11, 13, 15, 17, 23, 29,
  • the sequence encodes a full-length vpl, vp2 and/or vp3 of AAVrh81(SEQ ID NO: 50), AAVhu71.74 (SEQ ID NO: 4), AAVhu73 (SEQ ID NO: 74), AAVhu74.71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78.88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu76 (SEQ ID NO: 24), AAVhu84 (SEQ ID NO: 30), hu87 (SEQ ID NO: 34), AAVhu88.78 (SEQ ID NO: 36), or AAVhu69 (SEQ ID NO: 38).
  • the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g. truncation(s) of about 1 to about 10 amino acids).
  • novel AAV capsid proteins having vpl sequences set forth in the sequence listing: AAVrh76 (SEQ ID NO: 42), AAVrh89 (SEQ ID NO: 52), AAVrh85 (SEQ ID NO: 60), or AAVrh87 (SEQ ID NO: 62).
  • the numbering of the nucleotides and amino acids corresponding to the vpl, vp2, and vp3 are as follows:
  • AAV rh76 vpl - nt 1 to 2211; vp2- nt 412 to 2211; vp3- nt 610 to 2211 of SEQ ID NO: 41;
  • AAVrh89 vpl- nt 1 to 2184; vp2- nt 412 to 2184; vp3- nt 595 to 2184 of SEQ ID NO: 51;
  • AAVrh85 vpl - nt 1 to 2211; vp2- nt 412 to 2211; vp3- nt 610 to 2211 of SEQ ID NO: 59;
  • AAVrh87 vpl - nt 1 to 2211; vp2- nt 412 to 2211; vp3- nt 610 to 2211 of SEQ ID NO: 61.
  • AAVrh76 aa vpl - 1 to 737; vp2 - aa 138 to 737; vp3 - aa 204 to 737 of SEQ ID NO: 42;
  • AAVrh89 aa vpl - 1 to 728; vp2 - aa 138 to 728; vp3 - aa 199 to 728 of SEQ ID NO: 52;
  • AAVrh85 aa vpl - 1 to 737; vp2 - aa 138 to 737; vp3 - aa 204 to 737 of SEQ ID NO: 60;
  • AAVrh87 aa vpl - 1 to 737; vp2 - aa 138 to 737; vp3 - aa 204 to 737 of SEQ ID NO: 62.
  • rAAV comprising at least one of the vpl, vp2, and vp3 of any of AAVrh76 (SEQ ID NO: 42), AAVrh89 (SEQ ID NO: 52), AAVrh85 (SEQ ID NO: 60), or AAVrh87 (SEQ ID NO: 62).
  • rAAV having a capsid protein comprising a vpl, vp2, and/or vp3 sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to AAVrh75 (SEQ ID NO: 40), AAVrh76 (SEQ ID NO: 42), AAVrh89 (SEQ ID NO: 52), AAVrh85 (SEQ ID NO: 60), or AAVrh87 (SEQ ID NO: 62) are provided.
  • the vpl, vp2, and/or has up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 amino acid differences relative to the vpl, vp2, and/or vp3 of AAVrh76 (SEQ ID NO: 42), AAVrh89 (SEQ ID NO: 52), AAVrh85 (SEQ ID NO: 60), or AAVrh87 (SEQ ID NO: 62).
  • rAAV comprising AAV capsids encoded by at least one of the vpl, vp2, and the vp3 sequence of any of AAVrh75 (SEQ ID NO: 39), AAVrh76 (SEQ ID NO: 41), AAVrh89 (SEQ ID NO: 51), AAVrh85 (SEQ ID NO: 59), or AAVrh87 (SEQ ID NO: 61) or a sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 39, 41, 51, 59, or 61.
  • the sequence encodes a full-length vpl, vp2 and/or vp3 of AAVrh75 (SEQ ID NO: 40), AAVrh76 (SEQ ID NO: 42), AAVrh89 (SEQ ID NO: 52), AAVrh85 (SEQ ID NO: 60), or AAVrh87 (SEQ ID NO: 62).
  • the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g. truncation(s) of about 1 to about 10 amino acids).
  • novel AAV capsid proteins having vpl sequences set forth in the sequence listing: AAVrh75 (SEQ ID NO: 40), AAVrh79 (SEQ ID NO: 48), AAVrh83 (SEQ ID NO: 56), or AAVrh84 (SEQ ID NO: 58).
  • the numbering of the nucleotides and amino acids corresponding to the vpl, vp2, and vp3 are as follows:
  • AAVrh75 vpl- nt 1 to 2208; vp2- nt 412 to 2208; vp3- nt 607 to 2208 of SEQ ID NO: 39;
  • AAVrh79 vpl- nt 1 to 2214; vp2- nt 412 to 2214; vp3- nt 610 to 2214 of SEQ ID NO: 47;
  • AAVrh83 vpl- nt 1 to 2211; vp2- nt 412 to 2211; vp3- nt 610 to 2211 of SEQ ID NO: 55;
  • AAVrh84 vpl- nt 1 to 2211; vp2- nt 412 to 2211; vp3- nt 610 to 221 lof SEQ ID NO: 57.
  • AAVrh75 aa vpl - 1 to 736; vp2 - aa 138 to 736; vp3 - aa 203 to 736 of SEQ ID NO: 40;
  • AAVrh79 aa vpl - 1 to 738; vp2 - aa 138 to 738; vp3 - aa 204 to 738 of SEQ ID NO: 48;
  • AAVrh83 aa vpl - 1 to 737; vp2 - aa 138 to 737; vp3 - aa 204 to 737 of SEQ ID NO: 56;
  • AAVrh84 aa vpl - 1 to 737; vp2 - aa 138 to 737; vp3 - aa 204 to 737 of SEQ ID NO: 58.
  • rAAV comprising at least one of the vpl, vp2 and the vp3 of any of AAVrh75 (SEQ ID NO: 40), AAVrh79 (SEQ ID NO: 48), AAVrh83 (SEQ ID NO: 56), or AAVrh84 (SEQ ID NO: 58).
  • rAAV having a capsid protein comprising a vpl, vp2, and/or vp3 sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to AAVrh75 (SEQ ID NO: 40), AAVrh79 (SEQ ID NO: 48), AAVrh83 (SEQ ID NO: 56), or AAVrh84 (SEQ ID NO: 58) are provided.
  • the vpl, vp2, and/or vp3 has up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 amino acid differences relative to the vpl, vp2, and/or vp3 of AAVrh79 (SEQ ID NO: 48), AAVrh83 (SEQ ID NO: 56), or AAVrh84 (SEQ ID NO: 58).
  • rAAV comprising AAV capsids encoded by at least one of the vpl, vp2, and vp3 of AAVrh75 (SEQ ID NO: 40), AAVrh79 (SEQ ID NO: 47), AAVrh83 (SEQ ID NO: 55), or AAVrh84 (SEQ ID NO: 57), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a SEQ ID NOs: 47, 55, or 57.
  • the sequence encodes a full-length vpl, vp2 and/or vp3 of AAVrh79 (SEQ ID NO: 48), AAVrh83 (SEQ ID NO: 56), or AAVrh84 (SEQ ID NO: 58).
  • the vpl, vp2 and/or vp3 has an N-terminal and/or a C -terminal truncation (e.g. truncation(s) of about 1 to about 10 amino acids).
  • AAVrh77 SEQ ID NO: 44
  • AAVrh78 SEQ ID NO: 46
  • AAVrh82 SEQ ID NO: 54.
  • the numbering of the nucleotides and amino acids corresponding to the vpl, vp2, and vp3 are as follows:
  • AAVrh77 vpl- nt 1 to 2199; vp2- nt 412 to 2199; vp3- nt 589 to 2199 of SEQ ID NO: 43;
  • AAVrh78 vpl- nt 1 to 2199; vp2- nt 412 to 2199; vp3- nt 589 to 2199 of SEQ ID NO: 45;
  • AAVrh82 vpl- nt 1 to 2199; vp2- nt 412 to 2199; vp3- nt 589 to 2199 of SEQ ID NO: 53.
  • AAVrh77 aa vpl - 1 to 733; vp2 - aa 138 to 733; vp3 - aa 197 to 733 of SEQ ID NO: 44;
  • AAVrh78 aa vpl - 1 to 733; vp2 - aa 138 to 733; vp3 - aa 197 to 733 of SEQ ID NO: 46;
  • AAVrh82 aa vpl - 1 to 733; vp2 - aa 138 to 733; vp3 - aa 197 to 733 of SEQ ID NO: 82.
  • rAAV comprising at least one of the vpl, vp2, and vp3 of any of AAVrh77 (SEQ ID NO: 44), AAVrh78 (SEQ ID NO: 46), or AAVrh82 (SEQ ID NO: 54).
  • rAAV having a capsid protein comprising a vpl, vp2, and/or vp3 sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to AAVrh77 (SEQ ID NO: 44), AAVrh78 (SEQ ID NO: 46), or AAVrh82 (SEQ ID NO: 54) are provided.
  • the vpl, vp2, and/or vp3 has up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 amino acid differences relative to the vpl, vp2, and/or vp3 AAVrh77 (SEQ ID NO: 44), AAVrh78 (SEQ ID NO: 46), or AAVrh82 (SEQ ID NO: 54).
  • rAAV comprising AAV capsids encoded by at least one of the vpl, vp2, and vp3 of AAVrh77 (SEQ ID NO: 43), AAVrh78 (SEQ ID NO: 45), or AAVrh82 (SEQ ID NO: 53), or a sequence at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 43, 45, 53.
  • the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVrh77 (SEQ ID NO: 44), AAVrh78 (SEQ ID NO: 46), or AAVrh82 (SEQ ID NO: 54).
  • the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g. truncation(s) of about 1 to about 10 amino acids).
  • a “recombinant AAV” or “rAAV” is a DNAse-resistant viral particle containing two elements, an AAV capsid and a vector genome containing at least a non- AAV coding sequence packaged within the AAV capsid. Unless otherwise specified, this term may be used interchangeably with the phrase “rAAV vector”.
  • the rAAV is a “replication-defective virus” or “viral vector”, as it lacks any functional AAV rep gene or functional AAV cap gene and cannot generate progeny.
  • the only AAV sequences are the AAV inverted terminal repeat sequences (ITRs), typically located at the extreme 5’ and 3’ ends of the vector genome in order to allow the gene and regulatory sequences located between the ITRs to be packaged within the AAV capsid.
  • ITRs AAV inverted terminal repeat sequences
  • a “vector genome” refers to the nucleic acid sequence packaged inside the rAAV capsid which forms a viral particle. Such a nucleic acid sequence contains AAV inverted terminal repeat sequences (ITRs).
  • ITRs AAV inverted terminal repeat sequences
  • a vector genome contains, at a minimum, from 5’ to 3’, an AAV 5’ ITR, coding sequence(s), and an AAV 3’ ITR. ITRs from AAV2, a different source AAV than the capsid, or other than full-length ITRs may be selected.
  • the ITRs are from the same AAV source as the AAV which provides the rep function during production or a transcomplementing AAV. Further, other ITRs may be used.
  • the vector genome contains regulatory sequences which direct expression of the gene products. Suitable components of a vector genome are discussed in more detail herein. The vector genome is sometimes referred to herein as the “minigene”.
  • a rAAV is composed of an AAV capsid and a vector genome.
  • An AAV capsid is an assembly of a heterogeneous population of vpl, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins.
  • the term “heterogeneous” or any grammatical variation thereof refers to a population consisting of elements that are not the same, for example, having vpl, vp2 or vp3 monomers (proteins) with different modified amino acid sequences.
  • heterogeneous population refers to differences in the amino acid sequence of the vpl, vp2 and vp3 proteins within a capsid.
  • the AAV capsid contains subpopulations within the vpl proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues.
  • certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
  • a “subpopulation” of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified.
  • a “subpopulation” of vpl proteins may be at least one (1) vpl protein and less than all vpl proteins in an assembled AAV capsid, unless otherwise specified.
  • a “subpopulation” of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified.
  • vpl proteins may be a subpopulation of vp proteins;
  • vp2 proteins may be a separate subpopulation of vp proteins, and
  • vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid.
  • vpl, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine - glycine pairs.
  • highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position.
  • Such percentages may be determined using 2D-gel, mass spectrometry techniques, or other suitable techniques.
  • the deamidation of at least highly deamidated residues in the vp proteins in the AAV capsid is believed to be primarily non-enzymatic in nature, being caused by functional groups within the capsid protein which deamidate selected asparagines, and to a lesser extent, glutamine residues.
  • Efficient capsid assembly of the majority of deamidation vpl proteins indicates that either these events occur following capsid assembly or that deamidation in individual monomers (vpl, vp2 or vp3) is well-tolerated structurally and largely does not affect assembly dynamics.
  • Extensive deamidation in the VP 1 -unique (VPl-u) region ( ⁇ aa 1-137), generally considered to be located internally prior to cellular entry, suggests that VP deamidation may occur prior to capsid assembly.
  • the deamidation of N may occur through its C -terminus residue’s backbone nitrogen atom conducts a nucleophilic attack to the Asn side chain amide group carbon atom.
  • An intermediate ring-closed succinimide residue is believed to form.
  • the succinimide residue then conducts fast hydrolysis to lead to the final product aspartic acid (Asp) or iso aspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which may interconvert through the succinimide intermediate e.g., as illustrated below.
  • each deamidated N in the VP1, VP2 or VP3 may independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and/or an interconverting blend of Asp and isoAsp, or combinations thereof.
  • Any suitable ratio of a- and isoaspartic acid may be present.
  • the ratio may be from 10:1 to 1:10 aspartic to isoaspartic, about 50:50 aspartic: isoaspartic, or about 1:3 aspartic: isoaspartic, or another selected ratio.
  • one or more glutamine (Q) may deamidates to glutamic acid (Glu), i.e., a-glutamic acid, y-glutamic acid (Glu), or a blend of a- and y-glutamic acid, which may interconvert through a common glutarinimide intermediate.
  • Glu glutamic acid
  • Glu y-glutamic acid
  • Any suitable ratio of a- and y-glutamic acid may be present.
  • the ratio may be from 10:1 to 1:10 a to y, about 50:50 a: y, or about 1:3 a : y, or another selected ratio.
  • an rAAV includes subpopulations within the rAAV capsid of vpl, vp2 and/or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine.
  • other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions.
  • modifications may include an amidation at an Asp position.
  • an AAV capsid contains subpopulations of vpl, vp2 and vp3 having at least 1, at least 2, at least 3, at least 4, at least 5 to at least about 25 deamidated amino acid residue positions, of which at least 1 to 10%, at least 10 to 25%, at least 25 to 50%, at least 50 to 70%, at least 70 to 100%, at least 75 to 100%, at least 80-100%, or at least
  • 90-100% are deamidated as compared to the encoded amino acid sequence of the vp proteins. The majority of these may be N residues. However, Q residues may also be deamidated.
  • encoded amino acid sequence refers to the amino acid which is predicted based on the translation of a known DNA codon of a referenced nucleic acid sequence being translated to an amino acid.
  • the following table illustrates DNA codons and twenty common amino acids, showing both the single letter code (SLC) and three letter code (3LC).
  • a rAAV has an AAV capsid having vpl, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four, five or more deamidated residues at the positions set forth in the tables provided herein and incorporated herein by reference.
  • Deamidation in the rAAV may be determined using 2D gel electrophoresis, and/or mass spectrometry, and/or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific). MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet-sequenced precursor ions from the survey scans (200-2000 m/z).
  • Sequencing is performed via higher energy collisional dissociation fragmentation with a target value of le5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m/z.
  • Survey scans were acquired at a resolution of 120,000 at m/z 200.
  • Resolution for HCD spectra may be set to 30,000 at m/z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30.
  • the S-lens RF level may be set at 50, to give optimal transmission of the m/z region occupied by the peptides from the digest.
  • Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection.
  • BioPharma Finder 1.0 software may be used for analysis of the data acquired.
  • suitable proteases may include, e.g., trypsin or chymotrypsin.
  • Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule +0.984 Da (the mass difference between - OH and -NH2 groups).
  • the percent deamidation of a particular peptide is determined by mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species which are deamidated at different sites may co-migrate in a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation.
  • suitable mass spectrometers may include, e.g, a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
  • QTOF quadrupole time of flight mass spectrometer
  • Agilent 6530 a Waters Xevo or Agilent 6530
  • orbitrap instrument such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
  • liquid chromatography systems include, e.g, Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series).
  • Suitable data analysis software may include, e.g., MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques may be described, e.g., in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online June 16, 2017.
  • the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation.
  • the asparagine is altered to a different amino acid, e.g., a glutamine which deamidates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and/or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups).
  • amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and/or proline.
  • Modifications such as described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine - glycine pairs.
  • a method for reducing deamidation of AAV and/or engineered AAV variants having lower deamidation rates may be changed to a non-amide amino acid to reduce deamidation of the AAV.
  • a mutant AAV capsid as described herein contains a mutation in an asparagine - glycine pair, such that the glycine is changed to an alanine or a serine.
  • a mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs. In certain embodiments, an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs. In certain embodiments, a mutant AAV capsid contains only a single mutation in an NG pair. In certain embodiments, a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP 1 -unique region. In certain embodiments, one of the mutations is in the VP 1 -unique region. Optionally, a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair.
  • a method of increasing the potency of a rAAV vector comprises engineering an AAV capsid which eliminating one or more of the NGs in the wild-type AAV capsid.
  • the coding sequence for the “G” of the “NG” is engineered to encode another amino acid.
  • an “S” or an “A” is substituted.
  • other suitable amino acid coding sequences may be selected.
  • Amino acid modifications may be made by conventional genetic engineering techniques.
  • a nucleic acid sequence containing modified AAV vp codons may be generated in which one to three of the codons encoding glycine in asparagine - glycine pairs are modified to encode an amino acid other than glycine.
  • a nucleic acid sequence containing modified asparagine codons may be engineered at one to three of the asparagine - glycine pairs, such that the modified codon encodes an amino acid other than asparagine.
  • Each modified codon may encode a different amino acid.
  • one or more of the altered codons may encode the same amino acid.
  • these modified nucleic acid sequences may be used to generate a mutant rAAV having a capsid with lower deamidation than the native AAV3B variant capsid.
  • Such mutant rAAV may have reduced immunogenicity and/or increase stability on storage, particularly storage in suspension form.
  • nucleic acid sequences encoding the AAV capsids having reduced deamidation including DNA (genomic or cDNA), or RNA (e.g., mRNA).
  • Such nucleic acid sequences may be codon-optimized for expression in a selected system (i.e., cell type) and can be designed by various methods. This optimization may be performed using methods which are available on-line (e.g, GeneArt), published methods, or a company which provides codon optimizing services, e.g., DNA2.0 (Menlo Park, CA).
  • GeneArt GeneArt
  • DNA2.0 Moenlo Park, CA
  • One codon optimizing method is described, e.g., in International Patent Publication No.
  • oligonucleotide pairs of 80-90 nucleotides each in length and spanning the length of the desired sequence are synthesized by standard methods. These oligonucleotide pairs are synthesized such that upon annealing, they form double stranded fragments of 80-90 base pairs, containing cohesive ends, e.g, each oligonucleotide in the pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10, or more bases beyond the region that is complementary to the other oligonucleotide in the pair.
  • each pair of oligonucleotides are designed to anneal with the single-stranded end of another pair of oligonucleotides.
  • the oligonucleotide pairs are allowed to anneal, and approximately five to six of these double-stranded fragments are then allowed to anneal together via the cohesive single stranded ends, and then they ligated together and cloned into a standard bacterial cloning vector, for example, a TOPO® vector available from Invitrogen Corporation, Carlsbad, Calif
  • the construct is then sequenced by standard methods.
  • AAV capsids are provided which have a heterogeneous population of AAV capsid isoforms (i. e. , VP1, VP2, VP3) which contain multiple highly deamidated “NG” positions.
  • the highly deamidated positions are in the locations identified below, with reference to the predicted full-length VP1 amino acid sequence.
  • the capsid gene is modified such that the referenced “NG” is ablated and a mutant “NG” is engineered into another position.
  • the rAAV provided have a capsid as described herein, and have packaged in the capsid a vector genome comprising a non- AAV nucleic acid sequence.
  • the vectors useful in compositions and methods described herein contain, at a minimum, sequences encoding a selected AAV capsid as described herein, e.g., an AAVhu71/74 (SEQ ID NO: 4), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu83 (SEQ ID NO: 10), AAVhu74/71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78/88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu76 (SEQ ID NO: 24), AAVhu81 (SEQ ID NO: 26), AAVhu82 (SEQ ID NO: 28), AAVhu84 (SEQ ID NO: 30), AAVhu86 (SEQ ID NO: 32), AAVhu87
  • useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, or a fragment thereof.
  • such vectors may contain both AAV cap and rep proteins.
  • the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., all AAVhu71/74, AAVhu79, AAVhu80, AAVhu83, AAVhu74/71, AAVhu77, AAVhu78/88, AAVhu70, AAVhu72, AAVhu75, AAVhu76, AAVhu81, AAVhu82, AAVhu84, AAVhu86, AAVhu87, AAVhu88/78, AAVhu69, AAVrh75, AAVrh76, AAVrh77, AAVrh78, AAVrh79, AAVrh81, AAVrh89, AAVr
  • the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector).
  • these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as AAV2/8 described in US Patent No. 7,282,199, which is incorporated by reference herein.
  • the vectors further contain a minigene comprising a selected transgene which is flanked by AAV 5' ITR and AAV 3' ITR.
  • the AAV is a self-complementary AAV (sc-AAV) (See, US 2012/0141422 which is incorporated herein by reference).
  • Self-complementary vectors package an inverted repeat genome that can fold into dsDNA without the requirement for DNA synthesis or basepairing between multiple vector genomes. Because scAAV have no need to convert the single-stranded DNA (ssDNA) genome into double-stranded DNA (dsDNA) prior to expression, they are more efficient vectors. However, the trade-off for this efficiency is the loss of half the coding capacity of the vector, ScAAV are useful for small protein-coding genes (up to ⁇ 55 kd) and any currently available RNA-based therapy.
  • AAV vectors utilizing an AAVhu71/74, AAVhu79, AAVhu80, AAVhu83, AAVhu74/71, AAVhu77, AAVhu78/88, AAVhu70, AAVhu72, AAVhu75, AAVhu76, AAVhu81, AAVhu82, AAVhu84, AAVhu86, AAVhu87, AAVhu88/78, AAVhu69, AAVrh75, AAVrh76, AAVrh77, AAVrh78, AAVrh79, AAVrh81, AAVrh89, AAVrh82, AAVrh83, AAVrh84, AAVrh85, AAVrh87, or AAVhu73 capsid as described herein, have AAV2
  • the AAV ITRs, and other selected AAV components described herein may be individually selected from among any AAV serotype, including, without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes.
  • the ITRs of AAV serotype 2 are used.
  • ITRs from other suitable serotypes may be selected. These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype.
  • AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA).
  • the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
  • the rAAV provided herein comprise a vector genome.
  • the vector genome is composed of, at a minimum, a non-AAV or heterologous nucleic acid sequence (e.g., a transgene), as described below, regulatory sequences, and 5’ and 3’ AAV inverted terminal repeats (ITRs). It is this minigene which is packaged into a capsid protein and delivered to a selected target cell or target tissue.
  • a non-AAV or heterologous nucleic acid sequence e.g., a transgene
  • regulatory sequences e.g., regulatory sequences, and 5’ and 3’ AAV inverted terminal repeats (ITRs). It is this minigene which is packaged into a capsid protein and delivered to a selected target cell or target tissue.
  • ITRs AAV inverted terminal repeats
  • the transgene is a nucleic acid sequence, heterologous to the vector sequences flanking the transgene, which encodes a polypeptide, protein, or other product, of interest.
  • the nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and/or expression in a target cell.
  • the heterologous nucleic acid sequence can be derived from any organism.
  • the AAV may comprise one or more transgenes.
  • target cell and “target tissue” can refer to any cell or tissue which is intended to be transduced by the subject AAV vector.
  • the term may refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (ocular cells), or heart.
  • the target tissue is liver.
  • the target tissue is the heart.
  • the target tissue is brain.
  • the target tissue is muscle.
  • mamalian subject or “subject” includes any mammal in need of the methods of treatment described herein or prophylaxis, including particularly humans.
  • Other mammals in need of such treatment or prophylaxis include dogs, cats, or other domesticated animals, horses, livestock, laboratory animals, including non-human primates, etc.
  • the subject may be male or female.
  • the term “host cell” may refer to the packaging cell line in which the rAAV is produced from the plasmid. In the alternative, the term “host cell” may refer to a target cell in which expression of the transgene is desired.
  • Useful products encoded by the transgene include a variety of gene products which replace a defective or deficient gene, inactivate or “knock-out”, or “knock-down” or reduce the expression of a gene which is expressing at an undesirably high level, or delivering a gene product which has a desired therapeutic effect.
  • the therapy will be “somatic gene therapy”, i.e., transfer of genes to a cell of the body which does not produce sperm or eggs.
  • the transgenes express proteins have the sequence of native human sequences. However, in other embodiments, synthetic proteins are expressed. Such proteins may be intended for treatment of humans, or in other embodiments, designed for treatment of animals, including companion animals such as canine or feline populations, or for treatment of livestock or other animals which come into contact with human populations.
  • suitable gene products may include those associated with familial hypercholesterolemia, muscular dystrophy, cystic fibrosis, and rare or orphan diseases.
  • rare disease may include spinal muscular atrophy (SMA), Huntingdon’s Disease, Rett Syndrome (e.g., methyl-CpG-binding protein 2 (MeCP2); UniProtKB - P51608), Amyotrophic Lateral Sclerosis (ALS), Duchenne Type Muscular dystrophy, Friedrichs Ataxia (e.g., frataxin), ATXN2 associated with spinocerebellar ataxia type 2 (SCA2)/ALS; TDP-43 associated with ALS, progranulin (PRGN) (associated with nonAlzheimer’s cerebral degenerations, including, frontotemporal dementia (FTD), progressive non-fluent aphasia (PNFA) and semantic dementia), among others.
  • SMA spinal muscular atrophy
  • Huntingdon’s Disease e.g., methyl-CpG-binding protein 2 (
  • the transgene is not human low-density lipoprotein receptor (hLDLR). In another embodiment, the transgene is not an engineered human low-density lipoprotein receptor (hLDLR) variant, such as those described in WO 2015/164778.
  • hLDLR human low-density lipoprotein receptor
  • suitable genes may include, e.g., hormones and growth and differentiation factors including, without limitation, insulin, glucagon, glucagon-like peptide - 1 (GLP1), growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietins, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO) (including, e.g., human, canine or feline epo), connective tissue growth factor (CTGF), neutrophic factors including, e.g., basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin growth factors I and II (IGF-I and IGF
  • transgene products include proteins that regulate the immune system including, without limitation, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL) IL-1 through IL-36 (including, e.g., human interleukins IL-1, IL-la, IL-ip, IL-2, IL-3, IL-4, IL-6, IL-8, IL-12, IL-11, IL-12, IL-13, IL-18, IL-31, IL-35), monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factors a and P, interferons a, P, and y, stem cell factor, Hk-2/flt3 ligand.
  • TPO thrombopoietin
  • IL-1 through IL-36 including, e.g., human interleukins IL-1, IL-la
  • Gene products produced by the immune system are also useful in the invention. These include, without limitations, immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, class I and class II MHC molecules, as well as engineered immunoglobulins and MHC molecules.
  • the rAAV antibodies may be designed to delivery canine or feline antibodies, e.g., such as anti-IgE, anti-IL31, anti-IL33, anti-CD20, anti-NGF, anti-GnRH
  • Useful gene products also include complement regulatory proteins such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2, CD59, and Cl esterase inhibitor (Cl-INH).
  • complement regulatory proteins such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2, CD59, and Cl esterase inhibitor (Cl-INH).
  • Still other useful gene products include any one of the receptors for the hormones, growth factors, cytokines, lymphokines, regulatory proteins and immune system proteins.
  • the invention encompasses receptors for cholesterol regulation and/or lipid modulation, including the low-density lipoprotein (LDL) receptor, high density lipoprotein (HDL) receptor, the very low density lipoprotein (VLDL) receptor, and scavenger receptors.
  • LDL low-density lipoprotein
  • HDL high density lipoprotein
  • VLDL very low density lipoprotein
  • the invention also encompasses gene products such as members of the steroid hormone receptor superfamily including glucocorticoid receptors and estrogen receptors, Vitamin D receptors and other nuclear receptors.
  • useful gene products include transcription factors such as jun,fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NF AT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding proteins, interferon regulation factor (IRF-1), Wilms tumor protein, ETS-binding protein, STAT, GATA-box binding proteins, e.g., GATA-3, and the forkhead family of winged helix proteins.
  • transcription factors such as jun,fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NF AT, CREB, HNF-4, C/EBP, SP1, CCAAT-box
  • HMBS hydroxymethylbilane synthase
  • OTC ornithine transcarbamylase
  • ASL arginosuccinate synthetase
  • arginase fumarylacetate hydrolase
  • phenylalanine hydroxylase alpha- 1 antitrypsin
  • AFP rhesus alphafetoprotein
  • CG chorionic gonadotrophin
  • glucose-6-phosphatase porphobilinogen deaminase
  • cystathione beta-synthase branched chain ketoacid decarboxylase
  • albumin isovaleryl-coA dehydrogenase, propionyl CoA carboxylase, methyl malonyl CoA mutase, glutaryl CoA dehydrogenase, insulin, beta-gluco
  • Still other useful gene products include enzymes such as may be useful in enzyme replacement therapy, which is useful in a variety of conditions resulting from deficient activity of enzyme.
  • enzymes that contain mannose-6-phosphate may be utilized in therapies for lysosomal storage diseases (e.g., a suitable gene includes that encoding P-glucuronidase (GUSB)).
  • GUSB P-glucuronidase
  • the gene product is ubiquitin protein ligase E3A (UBE3A).
  • Still useful gene products include UDP Glucuronosyltransferase Family 1 Member Al (UGT1A1).
  • the rAAV may be used in gene editing systems, which system may involve one rAAV or co-administration of multiple rAAV stocks.
  • the rAAV may be engineered to deliver SpCas9, SaCas9, ARCUS, Cpfl (also known as Cast 2a), CjCas9, and other suitable gene editing constructs.
  • the minigene comprises first 57 base pairs of the Factor VIII heavy chain which encodes the 10 amino acid signal sequence, as well as the human growth hormone (hGH) polyadenylation sequence.
  • hGH human growth hormone
  • the minigene further comprises the Al and A2 domains, as well as 5 amino acids from the N-terminus of the B domain, and/or 85 amino acids of the C-terminus of the B domain, as well as the A3, Cl and C2 domains.
  • the nucleic acids encoding Factor VIII heavy chain and light chain are provided in a single mini gene separated by 42 nucleic acids coding for 14 amino acids of the B domain [US Patent No. 6,200,560].
  • Other useful gene products include non-naturally occurring polypeptides, such as chimeric or hybrid polypeptides having a non-naturally occurring amino acid sequence containing insertions, deletions, or amino acid substitutions.
  • single-chain engineered immunoglobulins could be useful in certain immunocompromised patients.
  • Other types of non-naturally occurring gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which could be used to reduce overexpression of a target.
  • Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperproliferative cells as compared to normal cells.
  • Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF.
  • target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease.
  • Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1 A and folate binding polypeptides.
  • T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis.
  • RA Rheumatoid arthritis
  • MS multiple sclerosis
  • Sjogren's syndrome sarcoidosis
  • IDDM insulin dependent diabetes mellitus
  • autoimmune thyroiditis reactive arthritis
  • ankylosing spondylitis scleroderma
  • polymyositis dermatomyositis
  • psoriasis psoriasis
  • vasculitis Wegener's granulomatosis
  • genes which may be delivered via the rAAV provided herein for treatment of, for example, liver indications include, without limitation, glucose-6- phosphatase, associated with glycogen storage disease or deficiency type 1A (GSD1), phosphoenolpyruvate-carboxy kinase (PEPCK), associated with PEPCK deficiency; cyclin- dependent kinase-like 5 (CDKL5), also known as serine/threonine kinase 9 (STK9) associated with seizures and severe neurodev el opmental impairment; galactose- 1 phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase (PAH), associated with phenylketonuria (PKU); gene products associated with Primary Hyperoxaluria Type 1 including Hydroxy acid Oxidase 1 (GO/HAO1) and AGXT, branched chain alpha-ketoacid dehydrogenas
  • GSD1
  • dystonin gene related diseases such as Hereditary Sensory and Autonomic Neuropathy Type VI (the DST gene encodes dystonin; dual AAV vectors may be required due to the size of the protein (-7570 aa); SCN9A related diseases, in which loss of function mutants cause inability to feel pain and gain of function mutants cause pain conditions, such as erythromelagia.
  • Another condition is Charcot-Marie-Tooth (CMT) type IF and 2E due to mutations in the NEFL gene (neurofilament light chain) characterized by a progressive peripheral motor and sensory neuropathy with variable clinical and electrophysiologic expression.
  • CMT Charcot-Marie-Tooth
  • NEFL neuroofilament light chain
  • Other gene products associated with CMT include mitofusin 2 (MFN2).
  • the rAAV described herein may be used in treatment of mucopolysaccaridoses (MPS) disorders.
  • Such rAAV may contain carry a nucleic acid sequence encoding a-L-iduronidase (IDUA) for treating MPS I (Hurler, Hurler-Scheie and Scheie syndromes); a nucleic acid sequence encoding iduronate-2-sulfatase (IDS) for treating MPS II (Hunter syndrome); a nucleic acid sequence encoding sulfamidase (SGSH) for treating MPSIII A, B, C, and D (Sanfilippo syndrome); a nucleic acid sequence encoding N- acetylgalactosamine-6-sulfate sulfatase (GALNS) for treating MPS IV A and B (Morquio syndrome); a nucleic acid sequence encoding arylsulfatase B (ARSB) for treating MPS VI (Maroteaux-IDUA
  • an rAAV vector comprising a nucleic acid encoding a gene product associated with cancer (e.g., tumor suppressors) may be used to treat the cancer, by administering a rAAV harboring the rAAV vector to a subject having the cancer.
  • an rAAV vector comprising a nucleic acid encoding a small interfering nucleic acid (e.g., shRNAs, miRNAs) that inhibits the expression of a gene product associated with cancer (e.g., oncogenes) may be used to treat the cancer, by administering a rAAV harboring the rAAV vector to a subject having the cancer.
  • a small interfering nucleic acid e.g., shRNAs, miRNAs
  • an rAAV vector comprising a nucleic acid encoding a gene product associated with cancer (or a functional RNA that inhibits the expression of a gene associated with cancer) may be used for research purposes, e.g., to study the cancer or to identify therapeutics that treat the cancer.
  • genes known to be associated with the development of cancer e.g., oncogenes and tumor suppressors: AARS, ABCB1, ABCC4, ABI2, ABL1, ABL2, ACK1, ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB, ANPEP, ANXA5, ANXA7, AP2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS, ATF4, ATM, ATP5B, ATP5O, AXL, BARD1, BAX, BCL2, BHLHB2, BLMH, BRAF, BRCA1, BRCA2, BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBLB, CCL2, CCND1, CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59, CDC20, CDC25, CDC25A, CDC25B, CDC2L
  • a rAAV vector may comprise as a transgene, a nucleic acid encoding a protein or functional RNA that modulates apoptosis.
  • the following is a non-limiting list of genes associated with apoptosis and nucleic acids encoding the products of these genes and their homologues and encoding small interfering nucleic acids (e.g., shRNAs, miRNAs) that inhibit the expression of these genes and their homologues are useful as transgenes in certain embodiments of the invention: RPS27A, ABL1, AKT1, APAF1, BAD, BAG1, BAG3, BAG4, BAK1, BAX, BCL10, BCL2, BCL2A1, BCL2L1, BCL2L10, BCL2L11, BCL2L12, BCL2L13, BCL2L2, BCLAF1, BFAR, BID, BIK, NAIP, BIRC2, BIRC3, XI AP, BIRC5, BIRC6, BI
  • Useful transgene products also include miRNAs.
  • miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA).
  • miRNAs are natively expressed, typically as final 19-25 non-translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a “mature” single stranded miRNA molecule.
  • This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.
  • miRNA genes are useful as transgenes or as targets for small interfering nucleic acids encoded by transgenes (e.g., miRNA sponges, antisense oligonucleotides, TuD RNAs) in certain embodiments of the methods: hsa-let-7a, hsa-let-7a*, hsa-let-7b, hsa-let-7b*, hsa-let-7c, hsa-let-7c*, hsa-let-7d, hsa-let-7d*, hsa-let-7e, hsa-let-7e*, hsa-let-7f, hsa-let-7f-l*, hsa-let-7f-2*, hsa-let-7g, hsa-let- 7g*, hsa-let-71, hsa-let-71*, hsa-miR-1
  • transgenes e.g., mi
  • a miRNA inhibits the function of the mRNAs it targets and, as a result, inhibits expression of the polypeptides encoded by the mRNAs.
  • blocking partially or totally
  • the activity of the miRNA e.g., silencing the miRNA
  • derepression of polypeptides encoded by mRNA targets of a miRNA is accomplished by inhibiting the miRNA activity in cells through any one of a variety of methods.
  • blocking the activity of a miRNA can be accomplished by hybridization with a small interfering nucleic acid (e.g., antisense oligonucleotide, miRNA sponge, TuD RNA) that is complementary, or substantially complementary to, the miRNA, thereby blocking interaction of the miRNA with its target mRNA.
  • a small interfering nucleic acid that is substantially complementary to a miRNA is one that is capable of hybridizing with a miRNA, and blocking the miRNA's activity.
  • a small interfering nucleic acid that is substantially complementary to a miRNA is a small interfering nucleic acid that is complementary with the miRNA at all but 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 bases.
  • a “miRNA Inhibitor” is an agent that blocks miRNA function, expression and/or processing.
  • these molecules include but are not limited to microRNA specific antisense, microRNA sponges, tough decoy RNAs (TuD RNAs) and microRNA oligonucleotides (double-stranded, hairpin, short oligonucleotides) that inhibit miRNA interaction with a Drosha complex.
  • Still other useful transgenes may include those encoding immunoglobulins which confer passive immunity to a pathogen.
  • An “immunoglobulin molecule” is a protein containing the immunologically-active portions of an immunoglobulin heavy chain and immunoglobulin light chain covalently coupled together and capable of specifically combining with antigen. Immunoglobulin molecules are of any type (e.g, IgG, IgE, IgM, IgD, IgA and IgY), class (e.g, IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
  • the terms “antibody” and “immunoglobulin” may be used interchangeably herein.
  • immunoglobulin heavy chain is a polypeptide that contains at least a portion of the antigen binding domain of an immunoglobulin and at least a portion of a variable region of an immunoglobulin heavy chain or at least a portion of a constant region of an immunoglobulin heavy chain.
  • the immunoglobulin derived heavy chain has significant regions of amino acid sequence homology with a member of the immunoglobulin gene superfamily.
  • the heavy chain in a Fab fragment is an immunoglobulin-derived heavy chain.
  • immunoglobulin light chain is a polypeptide that contains at least a portion of the antigen binding domain of an immunoglobulin and at least a portion of the variable region or at least a portion of a constant region of an immunoglobulin light chain.
  • the immunoglobulin-derived light chain has significant regions of amino acid homology with a member of the immunoglobulin gene superfamily.
  • immunoadhesin is a chimeric, antibody-like molecule that combines the functional domain of a binding protein, usually a receptor, ligand, or cell-adhesion molecule, with immunoglobulin constant domains, usually including the hinge and Fc regions.
  • a “fragment antigen-binding” (Fab) fragment” is a region on an antibody that binds to antigens. It is composed of one constant and one variable domain of each of the heavy and the light chain.
  • the anti-pathogen construct is selected based on the causative agent (pathogen) for the disease against which protection is sought.
  • pathogen may be of viral, bacterial, or fungal origin, and may be used to prevent infection in humans against human disease, or in non-human mammals or other animals to prevent veterinary disease.
  • the rAAV may include genes encoding antibodies, and particularly neutralizing antibodies against a viral pathogen.
  • anti-viral antibodies may include anti-influenza antibodies directed against one or more of Influenza A, Influenza B, and Influenza C.
  • the type A viruses are the most virulent human pathogens.
  • the serotypes of influenza A which have been associated with pandemics include, H1N1, which caused Spanish Flu in 1918, and Swine Flu in 2009; H2N2, which caused Asian Flu in 1957; H3N2, which caused Hong Kong Flu in 1968; H5N1, which caused Bird Flu in 2004; H7N7; H1N2; H9N2; H7N2; H7N3; and H10N7.
  • target pathogenic viruses include, arenaviruses (including funin, machupo, and Lassa), filoviruses (including Marburg and Ebola), hantaviruses, picomoviridae (including rhinoviruses, echovirus), coronaviruses, paramyxovirus, morbillivirus, respiratory synctial virus, togavirus, coxsackievirus, JC virus, parvovirus Bl 9, parainfluenza, adenoviruses, reoviruses, variola (Variola major (Smallpox)) and Vaccinia (Cowpox) from the poxvirus family, and varicella-zoster (pseudorabies).
  • Viral hemorrhagic fevers are caused by members of the arenavirus family (Lassa fever) (which family is also associated with Lymphocytic choriomeningitis (LCM)), filovirus (ebola virus), and hantavirus (puremala).
  • LCM Lymphocytic choriomeningitis
  • filovirus ebola virus
  • hantavirus puremala
  • the members of picomavirus a subfamily of rhinoviruses
  • the coronavirus family which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinatin encephalomyelitis virus (pig), feline infectious peritonitis virus (cat), feline enteric coronavirus (cat), canine coronavirus (dog).
  • infectious bronchitis virus prillus swine fever virus
  • pig porcine transmissible gastroenteric virus
  • feline infectious peritonitis virus cat
  • feline enteric coronavirus cat
  • canine coronavirus dog.
  • the human respiratory coronaviruses have been putatively associated with the common cold, non-A, B or C hepatitis, and sudden acute respiratory syndrome (SARS).
  • SARS sudden acute respiratory syndrome
  • the paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus (RSV).
  • the parvovirus family includes feline parvovirus (feline enteritis), feline panleucopeniavirus, canine parvovirus, and porcine parvovirus.
  • the adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease.
  • a rAAV vector as described herein may be engineered to express an anti-ebola antibody, e.g., 2G4, 4G7, 13C6, an anti-influenza antibody, e.g., FI6, CR8033, and anti-RSV antibody, e.g, palivizumab, motavizumab.
  • a neutralizing antibody construct against a bacterial pathogen may also be selected for use in the present invention.
  • the neutralizing antibody construct is directed against the bacteria itself.
  • the neutralizing antibody construct is directed against a toxin produced by the bacteria.
  • airborne bacterial pathogens include, e.g., Neisseria meningitidis (meningitis), Klebsiella pneumonia (pneumonia), Pseudomonas aeruginosa (pneumonia), Pseudomonas pseudomallei (pneumonia), Pseudomonas mallei (pneumonia), Acinetobacter (pneumonia), Moraxella catarrhalis, Moraxella lacunata, Alkaligenes, Cardiobacterium, Haemophilus influenzae (flu), Haemophilus parainfluenzae, Bordetella pertussis (whooping cough), Francisella tularensis (pneumonia/fever), Legionella pneumonia (Legionnaires disease), Chlamydia psittaci (pneumonia), Chlamydia pneumoniae (pneumonia), Mycobacterium tuberculosis (tuberculosis (TB)), Mycobacter
  • the rAAV may include genes encoding antibodies, and particularly neutralizing antibodies against a bacterial pathogen such as the causative agent of anthrax, a toxin produced by Bacillius anthracis.
  • Neutralizing antibodies against protective agent (PA) one of the three peptides which form the toxoid, have been described.
  • the other two polypeptides consist of lethal factor (LF) and edema factor (EF).
  • Anti-PA neutralizing antibodies have been described as being effective in passively immunization against anthrax. See, e.g., US Patent number 7,442,373; R. Sawada-Hirai et al, J Immune Based Ther Vaccines. 2004; 2: 5. (on-line 2004 May 12).
  • Still other anti-anthrax toxin neutralizing antibodies have been described and/or may be generated.
  • neutralizing antibodies against other bacteria and/or bacterial toxins may be used to generate an AAV-delivered antipathogen construct as described herein.
  • Antibodies against infectious diseases may be caused by parasites or by fungi, including, e.g., Aspergillus species, Absidia corymbifera, Rhixpus stolonifer , Mucor plumbeous, Cryptococcus neoformans, Histoplasm capsulatum, Blastomyces dermatitidis , Coccidioides immitis, Penicillium species, Micropolyspora faeni, Thermoactinomyces vulgaris, Alternaria alternate, Cladosporium species, Helminthosporium, and Stachybotrys species.
  • Aspergillus species Absidia corymbifera, Rhixpus stolonifer , Mucor plumbeous, Cryptococcus neoformans, Histoplasm capsulatum, Blastomyces dermatitidis , Coccidioides immitis, Penicillium species, Micropolyspora faeni, Thermoacti
  • the rAAV may include genes encoding antibodies, and particularly neutralizing antibodies, against pathogenic factors of diseases such as Alzheimer’s disease (AD), Parkinson’s disease (PD), GBA-associated - Parkinson’s disease (GBA - PD), Rheumatoid arthritis (RA), Irritable bowel syndrome (IBS), chronic obstructive pulmonary disease (COPD), cancers, tumors, systemic sclerosis, asthma and other diseases.
  • AD Alzheimer’s disease
  • PD Parkinson’s disease
  • RA Rheumatoid arthritis
  • IBS Irritable bowel syndrome
  • COPD chronic obstructive pulmonary disease
  • Such antibodies may be., without limitation, , e.g., alpha-synuclein, anti-vascular endothelial growth factor (VEGF) (anti-VEGF), , anti-VEGFA, anti-PD-1, anti-PDLl, anti-CTLA-4, anti-TNF-alpha, anti-IL-17, anti-IL-23, anti-IL-21, anti-IL-6, anti-IL-6 receptor, anti-IL-5, anti-IL-7, antiFactor XII, anti-IL-2, anti-HIV, anti-IgE, anti-tumour necrosis factor receptor- 1 (TNFR1), anti-notch 2/3, anti-notch 1, anti-OX40, anti-erb-b2 receptor tyrosine kinase 3 (ErbB3), anti- ErbB2, anti-beta cell maturation antigen, anti-B lymphocyte stimulator, anti-CD20, anti- HER2, anti-granulocyte macrophage colony- stimulating factor, anti-oncostat
  • suitable antibodies may include those useful for treating Alzheimer’s Disease, such as, e.g., anti-beta-amyloid (e.g., crenezumab, solanezumab, aducanumab), anti-beta-amyloid fibril, anti-beta-amyloid plaques, anti-tau, a bapineuzamab, among others.
  • anti-beta-amyloid e.g., crenezumab, solanezumab, aducanumab
  • anti-beta-amyloid fibril e.g., crenezumab, solanezumab, aducanumab
  • anti-beta-amyloid fibril e.g., anti-beta-amyloid fibril
  • anti-beta-amyloid plaques e.g., anti-tau, a bapineuzamab
  • bapineuzamab e.g., WO 2017/075119A1.
  • Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperproliferative cells as compared to normal cells.
  • Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF.
  • target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease.
  • Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1A and folate binding polypeptides.
  • T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis.
  • RA Rheumatoid arthritis
  • MS multiple sclerosis
  • Sjogren's syndrome sarcoidosis
  • IDDM insulin dependent diabetes mellitus
  • autoimmune thyroiditis reactive arthritis
  • ankylosing spondylitis scleroderma
  • polymyositis dermatomyositis
  • psoriasis psoriasis
  • vasculitis Wegener's granulomatosis
  • the vectors may contain AAV sequences of the invention and a transgene encoding a peptide, polypeptide or protein which induces an immune response to a selected immunogen.
  • immunogens may be selected from a variety of viral families.
  • desirable viral families against which an immune response would be desirable include, the picomavirus family, which includes the genera rhinoviruses, which are responsible for about 50% of cases of the common cold; the genera enteroviruses, which include polioviruses, coxsackieviruses, echoviruses, and human enteroviruses such as hepatitis A virus; and the genera aptho viruses, which are responsible for foot and mouth diseases, primarily in non-human animals.
  • target antigens include the VP1, VP2, VP3, VP4, and VPG.
  • Another viral family includes the calcivirus family, which encompasses the Norwalk group of viruses, which are an important causative agent of epidemic gastroenteritis.
  • Still another viral family desirable for use in targeting antigens for inducing immune responses in humans and non-human animals is the togavirus family, which includes the genera alphavirus, which include Sindbis viruses, RossRiver virus, and Venezuelan, Eastern & Western Equine encephalitis, and rubivirus, including Rubella virus.
  • the flaviviridae family includes dengue, yellow fever, Japanese encephalitis, St. Louis encephalitis and tick home encephalitis viruses.
  • target antigens may be generated from the Hepatitis C or the coronavirus family, which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinating encephalomyelitis virus (pig), feline infectious peritonitis virus (cats), feline enteric coronavirus (cat), canine coronavirus (dog), and human respiratory coronaviruses, which may cause the common cold and/or non- A, B or C hepatitis.
  • infectious bronchitis virus proultry
  • porcine transmissible gastroenteric virus pig
  • porcine hemagglutinating encephalomyelitis virus pig
  • feline infectious peritonitis virus cats
  • feline enteric coronavirus cat
  • canine coronavirus dog
  • human respiratory coronaviruses which may cause the common cold and/or non- A, B or C hepatitis.
  • target antigens include the El (also called M or matrix protein), E2 (also called S or Spike protein), E3 (also called HE or hemagglutin- elterose) glycoprotein (not present in all coronaviruses), or N (nucleocapsid). Still other antigens may be targeted against the rhabdovirus family, which includes the genera vesiculovirus (e.g., Vesicular Stomatitis Virus), and the general lyssavirus (e.g., rabies). Within the rhabdovirus family, suitable antigens may be derived from the G protein or the N protein.
  • the family filoviridae which includes hemorrhagic fever viruses such as Marburg and Ebola virus may be a suitable source of antigens.
  • the paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus.
  • the influenza virus is classified within the family orthomyxovirus and is a suitable source of antigen (e.g., the HA protein, the N1 protein).
  • the bunyavirus family includes the genera bunyavirus (California encephalitis, La Crosse), phlebovirus (Rift Valley Fever), hantavirus (puremala is a hemahagin fever virus), nairovirus (Nairobi sheep disease) and various unassigned bungaviruses.
  • the arenavirus family provides a source of antigens against LCM and Lassa fever virus.
  • the reovirus family includes the genera reovirus, rotavirus (which causes acute gastroenteritis in children), orbiviruses, and cultivirus (Colorado Tick fever, Lebombo (humans), equine encephalosis, blue tongue).
  • the retrovirus family includes the sub-family oncorivirinal which encompasses such human and veterinary diseases as feline leukemia virus, HTLVI and HTLVII, lentivirinal (which includes human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus, and spumavirinal).
  • HIV human immunodeficiency virus
  • SIV simian immunodeficiency virus
  • FV feline immunodeficiency virus
  • equine infectious anemia virus and spumavirinal
  • suitable antigens include, without limitation the gag, pol, Vif, Vpx, VPR, Env, Tat and Rev proteins, as well as various fragments thereof.
  • a variety of modifications to these antigens have been described.
  • Suitable antigens for this purpose are known to those of skill in the art. For example, one may select a sequence encoding the gag, pol, Vif, and Vpr, Env, Tat and Rev, amongst other proteins. See, e.g., the modified gag protein which is described in US Patent 5,972,596. See, also, the HIV and SIV proteins described in D.H. Barouch et al, J. Virol., 75(5):2462-2467 (March 2001), and R.R. Amara, et al, Science, 292:69-74 (6 April 2001). These proteins or subunits thereof may be delivered alone, or in combination via separate vectors or from a single vector.
  • the papovavirus family includes the sub-family polyomaviruses (BKU and JCU viruses) and the sub-family papillomavirus (associated with cancers or malignant progression of papilloma).
  • the adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease and/or enteritis.
  • the herpesvirus family includes the sub-family alphaherpesvirinae, which encompasses the genera simplexvirus (HSVI, HSVII), varicellovirus (pseudorabies, varicella zoster) and the sub-family betaherpesvirinae, which includes the genera cytomegalovirus (HCMV, muromegalovirus) and the sub-family gammaherpesvirinae, which includes the genera lymphocryptovirus, EBV (Burkitts lymphoma), infectious rhinotracheitis, Marek's disease virus, and rhadinovirus.
  • HSVI simplexvirus
  • varicellovirus pseudorabies, varicella zoster
  • betaherpesvirinae which includes the genera cytomegalovirus (HCMV, muromegalovirus)
  • the sub-family gammaherpesvirinae which includes the genera lymphocryptovirus, EBV (Burkitts
  • the poxvirus family includes the sub-family chordopoxvirinae, which encompasses the genera orthopoxvirus (Variola (Smallpox) and Vaccinia (Cowpox)), parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus, and the sub-family entomopoxvirinae.
  • the hepadnavirus family includes the Hepatitis B virus.
  • One unclassified virus which may be suitable source of antigens is the Hepatitis delta virus.
  • Still other viral sources may include avian infectious bursal disease virus and porcine respiratory and reproductive syndrome virus.
  • the alphavirus family includes equine arteritis virus and various Encephalitis viruses.
  • the rAAV may also deliver a sequence encoding immunogens which are useful to immunize a human or non-human animal against other pathogens including bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or from a cancer cell or tumor cell.
  • pathogens include pathogenic gram-positive cocci include pneumococci; staphylococci; and streptococci.
  • Pathogenic gram-negative cocci include meningococcus; gonococcus.
  • Pathogenic enteric gram-negative bacilli include enterobacteriaceae; pseudomonas, acinetobacteria and eikenella; melioidosis; salmonella; shigella; haemophilus; moraxella; H. ducreyi (which causes chancroid); brucella; Franisella tularensis (which causes tularemia); yersinia (pasteurella); streptobacillus moniliformis and spirillum; Gram-positive bacilli include listeria monocytogenes; erysipelothrix rhusiopathiae; Corynebacterium diphtheria (diphtheria); cholera; B.
  • anthracis anthracis
  • donovanosis granuloma inguinale
  • bartonellosis Diseases caused by pathogenic anaerobic bacteria include tetanus; botulism; other clostridia; tuberculosis; leprosy; and other mycobacteria.
  • Pathogenic spirochetal diseases include syphilis; treponematoses: yaws, pinta and endemic syphilis; and leptospirosis.
  • infections caused by higher pathogen bacteria and pathogenic fungi include actinomycosis; nocardiosis; cryptococcosis, blastomycosis, histoplasmosis and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichosis; paracoccidiodomy cosis, petriellidiosis, torulopsosis, mycetoma and chromomycosis; and dermatophytosis.
  • Rickettsial infections include Typhus fever, Rocky Mountain spotted fever, Q fever, and Rickettsialpox.
  • mycoplasma and chlamydial infections include: mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal chlamydial infections.
  • Pathogenic eukaryotes encompass pathogenic protozoans and helminths and infections produced thereby include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; Pneumocystis carinii,' Trichans,' Toxoplasma gondii,' babesiosis; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematodes or flukes; and cestode (tapeworm) infections.
  • viral vectors and other constructs described herein are useful to deliver antigens from these organisms, viruses, their toxins or other byproducts, which will prevent and/or treat infection or other adverse reactions with these biological agents.
  • TCRs T cell receptors
  • RA rheumatoid arthritis
  • TCRs T cell receptors
  • these TCRs include V-3, V-14, V-17 and Va-17.
  • MS multiple sclerosis
  • TCRs include V-7 and Va-10.
  • TCRs include V-6, V-8, V-14 and Va-16, Va-3C, Va-7, Va-14, Va-15, Va-16, Va-28 and Va-12.
  • delivery of a nucleic acid molecule that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in scleroderma.
  • the transgene is selected to provide optogenetic therapy.
  • optogenetic therapy artificial photoreceptors are constructed by gene delivery of light- activated channels or pumps to surviving cell types in the remaining retinal circuit. This is particularly useful for patients who have lost a significant amount of photoreceptor function, but whose bipolar cell circuitry to ganglion cells and optic nerve remains intact.
  • the heterologous nucleic acid sequence (transgene) is an opsin.
  • the opsin sequence can be derived from any suitable single- or multicellular- organism, including human, algae and bacteria.
  • the opsin is rhodopsin, photopsin, L/M wavelength (red/green) -opsin, or short wavelength (S) opsin (blue). In another embodiment, the opsin is channelrhodopsin or halorhodopsin.
  • the transgene is selected for use in gene augmentation therapy, i.e., to provide replacement copy of a gene that is missing or defective.
  • the transgene may be readily selected by one of skill in the art to provide the necessary replacement gene.
  • the missing/defective gene is related to an ocular disorder.
  • the transgene is NYX, GRM6, TRPM1L or GPR179 and the ocular disorder is Congenital Stationary Night Blindness. See, e.g., Zeitz et al, Am J Hum Genet. 2013 Jan 10;92(l):67-75. Epub 2012 Dec 13 which is incorporated herein by reference.
  • the transgene is RPGR.
  • the gene is Rab escort protein 1 (REP-1) encoded by CHM, associated with choroideremia.
  • the transgene is selected for use in gene suppression therapy, i.e., expression of one or more native genes is interrupted or suppressed at transcriptional or translational levels.
  • gene suppression therapy i.e., expression of one or more native genes is interrupted or suppressed at transcriptional or translational levels.
  • shRNA short hairpin RNA
  • the transgene may be readily selected by one of skill in the art based upon the gene which is desired to be silenced.
  • the transgene comprises more than one transgene. This may be accomplished using a single vector carrying two or more heterologous sequences, or using two or more rAAV each carrying one or more heterologous sequences.
  • the rAAV is used for gene suppression (or knockdown) and gene augmentation co-therapy. In knockdown/augmentation co-therapy, the defective copy of the gene of interest is silenced and a non-mutated copy is supplied. In one embodiment, this is accomplished using two or more co-administered vectors. See, Millington-Ward et al, Molecular Therapy, April 2011, 19(4): 642-649 which is incorporated herein by reference. The transgenes may be readily selected by one of skill in the art based on the desired result.
  • the transgene is selected for use in gene correction therapy. This may be accomplished using, e.g., a zinc-finger nuclease (ZFN)-induced DNA doublestrand break in conjunction with an exogenous DNA donor substrate.
  • ZFN zinc-finger nuclease
  • the transgene encodes a nuclease selected from a meganuclease, a zinc finger nuclease, a transcription activator-like (TAL) effector nuclease (TALEN), and a clustered, regularly interspaced short palindromic repeat (CRISPR)/endonuclease (Cas9, Cpfl, etc).
  • TAL transcription activator-like
  • CRISPR clustered, regularly interspaced short palindromic repeat
  • Cas9, Cpfl a clustered, regularly interspaced short palindromic repeat
  • Other suitable enzymes include nuclease-inactive S.
  • the nuclease is not a zinc finger nuclease.
  • the nuclease is not a CRISPR-associated nuclease. In certain embodiments, the nuclease is not a TALEN. In one embodiment, the nuclease is not a meganuclease. In certain embodiments, the nuclease is a member of the LAGLID ADG (SEQ ID NO: 45) family of homing endonucleases. In certain embodiments, the nuclease is a member of the I-Crel family of homing endonucleases which recognizes and cuts a 22 base pair recognition sequence SEQ ID NO: 46 - CAAAACGTCGTGAGACAGTTTG. See, e.g., WO 2009/059195.
  • a rAAV-based gene editing nuclease system is provided herein.
  • the gene editing nuclease targets sites in a disease-associated gene, i.e., gene of interest.
  • the AAV-based gene editing nuclease system comprises an rAAV comprising an AAV capsid and enclosed therein a vector genome, wherein the vector genome comprising AAV 5’ inverted terminal repeats (ITR), an expression cassette comprising a nucleic acid sequence encoding a gene editing nuclease which recognizes and cleaves a recognition site in a gene of interest, wherein said gene editing nuclease coding sequence is operably linked to expression control sequences which direct expression thereof in a cell comprising the gene of interest, and an AAV 3’ ITR.
  • the rAAV-based gene editing nuclease system is an rAAVhu71/74-based gene editing nuclease system.
  • the rAAV-based gene editing nuclease system is an rAAVhu79-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu80-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu83-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu74/71 -based gene editing nuclease system.
  • the rAAV-based gene editing nuclease system is an rAAVhu77-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu78/88-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu70-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu72-based gene editing nuclease system.
  • the rAAV-based gene editing nuclease system is an rAAVhu75 -based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu76-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu81 -based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu82-based gene editing nuclease system.
  • the rAAV-based gene editing nuclease system is an rAAVhu84-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu86-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu87-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu88/78-based gene editing nuclease system.
  • the rAAV-based gene editing nuclease system is an rAAVhu69-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh75-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh76-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh77-based gene editing nuclease system.
  • the rAAV-based gene editing nuclease system is an rAAVrh78-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh79-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh81-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh89-based gene editing nuclease system.
  • the rAAV-based gene editing nuclease system is an rAAVrh82-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh83-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh84-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVrh85-based gene editing nuclease system.
  • the rAAV-based gene editing nuclease system is an rAAVrh87-based gene editing nuclease system. In certain embodiments, the rAAV-based gene editing nuclease system is an rAAVhu73-based gene editing nuclease system.
  • Provided herein also is a method of treatment using an rAAV-based gene editing nuclease system.
  • the rAAV-based gene editing meganuclease system is used for treating diseases, disorders, syndrome and/or conditions.
  • the gene editing nuclease is targeted to a gene of interest, wherein the gene of interest has one or more genetic mutation, deletion, insertion, and/or a defect which is associated with and/or implicated in a disease, disorder, syndrome and/or conditions.
  • the disorder is selected but not limited to cardiovascular, hepatic, endocrine or metabolic, musculoskeletal, neurological, and/or renal disorders.
  • the indicated cardiovascular diseases, disorders, syndrome and/or conditions include, but not limited to, cardiovascular disease (associated lysophosphatidic acid, lipoprotein (a), or angiopoietin-like 3 (ANGPTL3), or apolipoprotein C-III (AP0C3) encoding genes), block coagulation, thrombosis, end stage renal disease, clotting disorders (associated with Factor XI (Fl 1) encoding gene), hypertension (angiotensinogen (AGT) encoding gene), and heart failure (angiotensinogen (AGT) encoding gene).
  • cardiovascular disease associated lysophosphatidic acid, lipoprotein (a), or angiopoietin-like 3 (ANGPTL3), or apolipoprotein C-III (AP0C3) encoding genes
  • block coagulation associated with Factor XI (Fl 1) encoding gene
  • hypertension angiotensinogen (AGT) encoding gene
  • heart failure angiotens
  • the indicated hepatic diseases, disorders, syndrome and/or conditions include, but not limited to, idiopathic pulmonary fibrosis (associated with SERPINH1 / Hsp47 gene), liver disease (associated with hydroxysteroid 17-beta dehydrogenase 13 (HSD17B13) encoding gene, non-alcoholic steatohepatitis (NASH) (associated with diacylglycerol O-acyltransferase-2 (DGAT2), hydroxy steroid 17-Beta Dehydrogenase 13 (HSD17B13), or patatin-like phospholipase domain-containing 3 (PNPLA3) encoding genes), and alcohol use disorder (associated with aldehyde dehydrogenase 2 (ALDH2) encoding gene).
  • idiopathic pulmonary fibrosis associated with SERPINH1 / Hsp47 gene
  • liver disease associated with hydroxysteroid 17-beta dehydrogenase 13 (HSD17B
  • the indicated musculoskeletal diseases, disorders, syndrome and/or conditions include, but not limited to, muscular dystrophy (associated with dystrophin, or integrin alpha(4) (VLA-4) (CD49D) encoding genes), Duchene muscular dystrophy (DMD) (associated with dystrophin (DMD) gene), centronuclear myopathy (associated with dynamin 2 (DNM2) encoding gene), and myotonic dystrophy (DM1) (associated with myotonic dystrophy protein kinase (DMPK) encoding gene).
  • VLA-4 integrin alpha(4)
  • the indicated endocrine or metabolic diseases, disorders, syndrome and/or conditions include, but not limited to, hypertriglyceridemia (associated with apolipoprotein C-III (APOC3), or angiopoietin-like 3 (ANGPTL3) encoding genes), lipodystrophy, hyperlipidemia (associated with apolipoprotein C-III (APOC3) encoding gene), hypercholesterolemia (associated with apolipoprotein B-100 (APOB- 100), proprotein convertase subtilisin kexin type 9 (PCSK9)), or amyloidosis (associated with transthyretin (TTR) encoding gene), porphyria (associated with aminolevulinate synthase-1 (ALAS-1) encoding gene), neuropathy (associated with transthyretin (TTR) encoding gene), primary hyperoxaluria type 1 (associated with glycolate oxidase encoding gene), diabetes (associated with Glucagon receptor (GCGR)
  • the indicated neurological diseases, disorders, syndrome and/or conditions include, but not limited to, spinal muscular atrophy (SMA) (associated with survival motor neuron protein (SMN2) gene), amyotrophic lateral sclerosis (ALS) (superoxide dismutase type 1 (SOD1), FUS RNA binding protein (FUS), microRNA-155, chromosome 9 open reading frame 72 (C9orf72), or ataxin-2 (ATXN2) genes), Huntington disease (associated with huntingtin (HTT) gene), hATTR polyneuropathy (associated with transthyretin (TTR) gene), Alzheimer's disease (associated with MAP-tau (MAPT) gene), Multiple System Atrophy (associated with alpha-synuclein (SNCA)), Parkinson's disease (associated with alpha-synuclein (SNCA), leucine rich repeat kinase 2 (LRRK2) genes), centronuclear myopathy (associated with dynamin 2 (DNM2) gene), Angelman syndrome
  • SMA
  • the indicated renal diseases, disorders, syndrome and/or conditions include, but not limited to, Glomerulonephritis (IgA Nephropathy) (associated with complement factor B encoding gene), Alport syndrome (associated with proteins in the PPARa signaling pathway), and neuropathy (associated with apolipoprotein LI (APOL1) encoding gene) or an APOL1 -associated chronic kidney disease.
  • Glomerulonephritis IgA Nephropathy
  • Alport syndrome associated with proteins in the PPARa signaling pathway
  • neuropathy associated with apolipoprotein LI (APOL1) encoding gene
  • APOL1 -associated chronic kidney disease apolipoprotein LI
  • the gene editing nuclease is targeted to the gene of interest, wherein the gene of interest includes but not limited to lysophosphatidic acid encoding gene, lipoprotein (a) encoding gene, ANGPTL3, APOC3, Fl 1, AGT, SERPINH1 / Hsp47, HSD17B13, DGAT2, PNPLA3, ALDH2, DMD, VLA-4, DNM2DM1, DMPK, APOC3, ANGPTL3, APOB-100, PCSK9, TTR, ALAS-1, glycolate oxidase encoding gene, GCGR, GHR, AATD, AAT, PCCA, PCCB, GDSIII, ASGPR, HAO1, SERPINA1, MMA, MMUT, MMAA, MMAB, MCEE, LMBRD1, ABCD4, G6PC, PAH, SMN2, SOD1, FUS, C9orf72, ATXN2, HTT, MAPT, SNCA, LRRK
  • Suitable gene editing targets include, e.g., liver-expressed genes such as, without limitation, proprotein convertase subtilisin/kexin type 9 (PCSK9) (cholesterol related disorders), transthyretin (TTR) (transthyretin amyloidosis), HAO, apolipoprotein C-III (APOC3), Factor VIII, Factor IX, low density lipoprotein receptor (LDLr), lipoprotein lipase (LPL) (Lipoprotein Lipase Deficiency), lecithin-cholesterol acyltransferase (LCAT), ornithine transcarbamylase (OTC), camosinase (CN1), sphingomyelin phosphodiesterase (SMPD1) (Niemann-Pick disease), hypoxanthine-guanine phosphoribosyltransferase (HGPRT), branched-chain alpha-keto acid dehydrogenase complex (BCKDC
  • HMBS hydroxy methylbilane synthase
  • OTC ornithine transcarbamylase
  • arginosuccinate synthetase alpha 1 anti -trypsin
  • Al AT alpha 1 anti -trypsin
  • ASL aaporginosuccinate lyase
  • argunosuccinate lyase deficiency arginase, fumarylacetate hydrolase
  • phenylalanine hydroxylase alpha- 1 antitrypsin
  • AFP rhesus alpha- fetoprotein
  • CG rhesus chorionic gonadotrophin
  • glucose- 6-phosphatase porphobilinogen deaminase
  • cystathione beta-synthase branched chain ketoacid decarboxylase
  • albumin isovaleryl-coA dehydrogenase
  • propionyl CoA carboxy alpha 1 anti -trypsin
  • Still other useful gene products include enzymes such as may be useful in enzyme replacement therapy, which is useful in a variety of conditions resulting from deficient activity of enzyme.
  • enzymes that contain mannose-6-phosphate may be utilized in therapies for lysosomal storage diseases (e.g., a suitable gene includes that encoding [>-glucuronidase (GUSB)).
  • the gene product is ubiquitin protein ligase, glucose-6-phosphatase, associated with glycogen storage disease or deficiency type 1A (GSD1), phosphoenolpyruvate-carboxy kinase (PEPCK), associated with PEPCK deficiency; cyclin- dependent kinase-like 5 (CDKL5), also known as serine/threonine kinase 9 (STK9) associated with seizures and severe neurodev el opmental impairment; galactose- 1 phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase (PAH), associated with phenylketonuria (PKU); gene products associated with Primary Hyperoxaluria Type 1 including Hydroxy acid Oxidase 1 (GO/HAO1) and AGXT, branched chain alpha-ketoacid dehydrogenase, including BCKDH, BCKDH-E2, BAKDH-El
  • the capsids described herein are useful in the CRISPR-Cas dual vector system described in US Published Patent Application 2018/0110877, filed April 26, 2018, each of which is incorporated herein by reference.
  • the capsids are also useful for delivery homing endonucleases or other meganucleases.
  • the transgenes useful herein include reporter sequences, which upon expression produce a detectable signal.
  • reporter sequences include, without limitation, DNA sequences encoding P-lactamase, P -galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), red fluorescent protein (RFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2, CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
  • another non- AAV coding sequence may be included, e.g., a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest.
  • Useful gene products may include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA). miRNAs are natively expressed, typically as final 19-25 non-translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs.
  • miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a “mature” single stranded miRNA molecule.
  • This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.
  • coding sequences when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • immunohistochemistry for example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for beta-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
  • the transgene encodes a product which is useful in biology and medicine, such as proteins, peptides, RNA, enzymes, or catalytic RNAs.
  • Desirable RNA molecules include shRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and antisense RNAs.
  • a useful RNA sequence is a sequence which extinguishes expression of a targeted nucleic acid sequence in a target cell.
  • Regulatory sequences include conventional control elements which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus produced as described herein.
  • operably linked sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • efficient RNA processing signals such as splicing and polyadenylation (poly A) signals
  • sequences that stabilize cytoplasmic mRNA sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • a great number of expression control sequences, including promoters, are known in the art and may be utilized.
  • the regulatory sequences useful in the constructs provided herein may also contain an intron, desirably located between the promoter/ enhancer sequence and the gene.
  • One desirable intron sequence is derived from SV-40, and is a 100 bp mini -intron splice donor/splice acceptor referred to as SD-SA.
  • Another suitable sequence includes the woodchuck hepatitis virus post-transcriptional element. (See, e.g., L. Wang and I. Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910).
  • PolyA signals may be derived from many suitable species, including, without limitation SV-40, human and bovine.
  • IRES internal ribosome entry site
  • An IRES sequence may be used to produce more than one polypeptide from a single gene transcript.
  • An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell.
  • An exemplary IRES is the poliovirus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells.
  • the IRES is located 3’ to the transgene in the rAAV vector.
  • the vector genome comprises a promoter (or a functional fragment of a promoter).
  • the selection of the promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired target cell.
  • the target cell is an ocular cell.
  • the promoter may be derived from any species, including human.
  • the promoter is “cell specific”.
  • the term “cell-specific” means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular cell tissue.
  • the promoter is specific for expression of the transgene in muscle cells.
  • the promoter is specific for expression in lung.
  • the promoter is specific for expression of the transgene in liver cells. In another embodiment, the promoter is specific for expression of the transgene in airway epithelium. In another embodiment, the promoter is specific for expression of the transgene in neurons. In another embodiment, the promoter is specific for expression of the transgene in heart.
  • the vector genome typically contains a promoter sequence as part of the expression control sequences, e.g, located between the selected 5’ ITR sequence and the immunoglobulin construct coding sequence.
  • expression in liver is desirable.
  • a liver-specific promoter is used. Examples of liverspecific promoters may include, e.g., thyroid hormone-binding globulin (TBG), albumin, Miyatake et al., (1997) J.
  • Tissue specific promoters constitutive promoters, regulatable promoters [see, e.g, WO 2011/126808 and WO 2013/04943], or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein. In another embodiment, expression in muscle is desirable.
  • a muscle-specific promoter is used.
  • the promoter is an MCK based promoter, such as the dMCK (509- bp) or tMCK (720-bp) promoters (see, e.g., Wang et al, Gene Ther. 2008 Nov;15(22): 1489- 99. doi: 10.1038/gt.2008.104. Epub 2008 Jun 19, which is incorporated herein by reference).
  • Another useful promoter is the SPc5-12 promoter (see Rasowo et al, European Scientific Journal June 2014 edition vol.10, No.18, which is incorporated herein by reference).
  • a promoter specific for the eye or a subpart thereof may be selected.
  • the promoter is a CMV promoter. In another embodiment, the promoter is a TBG promoter. In another embodiment, a CB7 promoter is used. CB7 is a chicken P-actin promoter with cytomegalovirus enhancer elements. Alternatively, other liverspecific promoters may be used [see, e.g., The Liver Specific Gene Promoter Database, Cold Spring Harbor, rulai.schl.edu/LSPD, alpha 1 anti-trypsin (A1AT); human albumin Miyatake et al., J.
  • TTR minimal enhancer/promoter, alpha-antitrypsin promoter, LSP (845 nt)25 (requires intron-less scAAV).
  • the promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer/promoter, the SV40 early enhancer/promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter.
  • CMV human cytomegalovirus
  • MBP myelin basic protein
  • GFAP glial fibrillary acidic protein
  • HSV-1 herpes simplex virus
  • LAP rouse
  • the vector genome may contain at least one enhancer, i.e., CMV enhancer.
  • CMV enhancer may include, e.g, an apolipoprotein enhancer, a zebrafish enhancer, a GFAP enhancer element, and brain specific enhancers such as described in WO 2013/1555222, woodchuck post hepatitis post-transcriptional regulatory element.
  • other, e.g., the hybrid human cytomegalovirus (HCMV)- immediate early (lE)-PDGR promoter or other promoter - enhancer elements may be selected.
  • Other enhancer sequences useful herein include the IRBP enhancer (Nicoud 2007, J Gene Med. 2007 Dec;9(12): 1015-23), immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, the cis-acting element identified in the mouse proximal promoter, etc.
  • a vector genome may contain other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • poly A polyadenylation
  • suitable polyA are known.
  • the polyA is rabbit beta globin, such as the 127 bp rabbit beta-globin polyadenylation signal (GenBank # V00882.1).
  • an SV40 polyA signal is selected. Still other suitable polyA sequences may be selected.
  • an intron is included.
  • One suitable intron is a chicken beta-actin intron.
  • the intron is 875 bp (GenBank # X00182.1).
  • a chimeric intron available from Promega is used.
  • other suitable introns may be selected.
  • spacers are included such that the vector genome is approximately the same size as the native AAV vector genome (e.g., between 4.1 and 5.2 kb). In one embodiment, spacers are included such that the vector genome is approximately 4.7 kb. See, Wu et al, Effect of Genome Size on AAV Vector Packaging, Mol Ther. 2010 Jan; 18(1): 80-86, which is incorporated herein by reference.
  • the vector genome further comprises dorsal root ganglion (drg)-specific miRNA detargeting sequences operably linked to the transgene coding sequence.
  • the tandem miRNA target sequences are continuous or are separated by a spacer of 1 to 10 nucleic acids, wherein said spacer is not an miRNA target sequence.
  • the start of the first of the at least two drg-specific miRNA tandem repeats is within 20 nucleotides from the 3’ end of the transgene coding sequence.
  • the start of the first of the at least two drg-specific miRNA tandem repeats is at least 100 nucleotides from the 3’ end of the functional transgene coding sequence.
  • the miRNA tandem repeats comprise 200 to 1200 nucleotides in length.
  • at least two drg-specific miRNA target sequences are located in both 5’ and 3’ to the functional transgene coding sequence.
  • the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is selected from (i) AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 78); (ii) AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 79), (iii) AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 80); or (iv) AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 81).
  • the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 78). In certain embodiments, the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 78). In certain embodiments, two or more consecutive miRNA target sequences are continuous and not separated by a spacer.
  • two or more of the miRNA target sequences are separated by a spacer and each spacer is independently selected from one or more of (A) GGAT; (B) CACGTG; or (C) GCATGC.
  • the spacer located between the miRNA target sequences may be located 3’ to the first miRNA target sequence and/or 5’ to the last miRNA target sequence.
  • the spacers between the miRNA target sequences are the same. See International Patent Application No. PCT/US 19/67872, filed December 20, 2019, US Provisional Patent Application No. 63/023,594, filed May 12, 2020, US Provisional Patent Application No. 63/038,488, filed June 12, 2020, US Provisional Patent Application No. 63/043,562, filed June 24, 2020, and US Provisional Patent Application No. 63/079,299, filed September 16, 2020, all of which are incorporated by reference in their entireties.
  • a method of generating a recombinant adeno-associated virus is provided.
  • a suitable recombinant adeno-associated virus is generated by culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein as described herein, or fragment thereof; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a heterologous nucleic acid sequence encoding a desirable transgene; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein.
  • AAV recombinant adeno-associated virus
  • the components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans.
  • any one or more of the required components e.g., minigene, rep sequences, cap sequences, and/or helper functions
  • host cells transfected with an AAV as described herein will contain the required component(s) under the control of an inducible promoter.
  • the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion below of regulatory elements suitable for use with the transgene.
  • a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters.
  • a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.
  • the host cell comprises a nucleic acid molecule (e.g., a plasmid) as described herein.
  • the minigene, rep sequences, cap sequences, and helper functions required for producing the rAAV described herein may be delivered to the packaging host cell in the form of any genetic element which transfers the sequences carried thereon.
  • the selected genetic element may be delivered by any suitable method, including those described herein.
  • the methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, 1993 J. Virol., 70:520-532 and US Patent 5,478,745, among others. These publications are incorporated by reference herein.
  • plasmids for use in producing the vectors described herein.
  • Such plasmids include a nucleic acid sequence encoding at least one of the vpl, vp2, and vp3 of AAVhu71/74 (SEQ ID NO: 4), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu83 (SEQ ID NO: 10), AAVhu74/71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78/88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu76 (SEQ ID NO: 24), AAVhu81 (SEQ ID NO: 26), AAVhu82 (SEQ ID NO: 28), AAVhu84 (SEQ ID NO: 30), AAVhu86 (SEQ ID NO:
  • plasmids having the a vpl, vp2, and/or vp3 sequence of AAVhu71/74 (SEQ ID NO: 3), AAVhu79 (SEQ ID NO: 5), AAVhu80 (SEQ ID NO: 7), AAVhu83 (SEQ ID NO: 9), AAVhu74/71 (SEQ ID NO: 11), AAVhu77 (SEQ ID NO: 13), AAVhu78/88 (SEQ ID NO: 15), AAVhu70 (SEQ ID NO: 17), AAVhu72 (SEQ ID NO: 19), AAVhu75 (SEQ ID NO: 21), AAVhu76 (SEQ ID NO: 23), AAVhu81 (SEQ ID NO: 25), AAVhu82 (SEQ ID NO: 27), AAVhu84 (SEQ ID NO: 29), AAVhu86 (SEQ ID NO: 31), AAVhu87 (SEQ ID NO: 33), AAVhu88/78
  • the plasmids generated are an AAV cis-plasmid encoding the AAV genome and the gene of interest, an AAV trans-plasmid containing AAV rep and the novel hu68 cap gene, and a helper plasmid.
  • These plasmids may be used in any suitable ratio, e.g., about 1 to about 1 to about 1, based on the total weight of the genetic elements.
  • the pRepCap to AAV cis-plasmid ratio of about 1 : 1 by weight of each coding sequence and the pHelper is about 2 times the weight.
  • the ratio may be about 3 to 1 helper: 10 to 1 pRepCap: 1 to 0.10 rAAV plasmid, by weight. Other suitable ratios may be selected.
  • the host cell may be stably transformed with one or more of these elements.
  • the host cell may contain a stable nucleic acid molecule comprising the AAVhu68M191 vpl coding sequence operably linked to regulatory sequences, a nucleic acid molecule encoding the rep coding sequences and/or one or more nucleic acid molecules encoding helper functions (e.g., adenovirus Ela, or the like).
  • the various genetic elements may be used in any suitable ratio, e.g., about 1 to about 1 to about 1, based on the total weight of the genetic elements.
  • the pRep DNA to Cap DNA to the AAV molecule e.g., plasmid carrying the vector genome to be packaged
  • ratio of about 1 to about 1 to about 1 (1:1:1) by weight.
  • certain host cells contain some helper elements (e.g., Ad E2a and/or AdE2b) provided in trans and others in cis (e.g., Ad Ela and/or Elb).
  • the helper sequences may be present in about 2 times the amount of the other genetic elements. Still other ratios may be determined.
  • the vector generation process can include method steps such as initiation of cell culture, passage of cells, seeding of cells, transfection of cells with the plasmid DNA, posttransfection medium exchange to serum free medium, and the harvest of vector-containing cells and culture media.
  • the harvested vector-containing cells and culture media are referred to herein as crude cell harvest.
  • the gene therapy vectors are introduced into insect cells by infection with baculovirus-based vectors.
  • baculovirus-based vectors See generally, e.g., Clement and Grieger, Mol Ther Methods Clin Dev, 2016: 3: 16002, published online 2016 Mar 16. Methods of making and using these and other AAV production systems are also described in the following U.S.
  • the crude cell harvest may thereafter be subject method steps such as concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and/or formulation and filtration to prepare bulk vector.
  • a variety of AAV purification methods are known in the art. See, e.g., WO 2017/160360 entitled “Scalable Purification Method for AAV9”, which is incorporated by reference herein, and describes methods generally useful for Clade F capsids.
  • a two-step affinity chromatography purification followed by anion exchange resin chromatography are used to purify the vector drug product and to remove empty capsids.
  • the crude cell harvest may be subject steps such as concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and/or formulation and filtration to prepare bulk vector.
  • An affinity chromatography purification followed anion exchange resin chromatography are used to purify the vector drug product and to remove empty capsids.
  • the diafiltered product may be applied to a Capture SelectTM Poros- AAV2/9 affinity resin (Life Technologies) that efficiently captures the AAV2/9 serotype.
  • the number of particles (pt) per 20 pL loaded is then multiplied by 50 to give particles (pt) /mL.
  • Pt/mL divided by GC/mL gives the ratio of particles to genome copies (pt/GC).
  • Pt/mL-GC/mL gives empty pt/mL.
  • Empty pt/mL divided by pt/mL and x 100 gives the percentage of empty particles.
  • the yield of packaged AAV vector genome copies may be assessed through use of a bioactivity assay for the encoded transgene.
  • a bioactivity assay for the encoded transgene For example, after production, culture supernatants may be collected and spun down to remove cell debris. The yields may be measured by a bioactivity assay using equal volume of the supernatant from a test sample as compared to a control (reference standard) to transduce a selected target cell and to evaluate bioactivity of the encoded protein.
  • Other suitable methods for assessing yield may be selected, including, for example, nanoparticle tracking [Povlich, S. F., et al. (2016) Particle Titer Determination and Characterization of rAAV Molecules Using Nanoparticle Tracking Analysis.
  • Gene therapy, 6(7), 1322-1330. doi.org/10.1038/sj.gt.3300946]; digital droplet (dd) polymerase chain reaction (PCR)Methods for determining single-stranded and self-complementary AAV vector genome titers by digital droplet (dd) polymerase chain reaction (PCR) have been described. See, e.g., M. Lock et al, Hum Gene Ther Methods.
  • An optimized -PCR method may be used which utilizes a broad spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size. The proteinase K buffer may be concentrated to 2 fold or higher.
  • a broad spectrum serine protease e.g., proteinase K (such as is commercially available from Qiagen).
  • the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in
  • proteinase K treatment is about 0.2 mg/mL, but may be varied from 0.1 mg/mL to about 1 mg/mL.
  • the treatment step is generally conducted at about 55 °C for about 15 minutes, but may be performed at a lower temperature (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes).
  • heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90 °C) and the time extended (e.g., about 20 minutes to about 30 minutes). Samples are then diluted (e.g., 1000 fold) and subjected to TaqMan analysis as described in the standard assay.
  • Yet another method is the quantitative DNA dot blot [Wu, Z., et al, (2008). Optimization of self-complementary AAV vectors for liver-directed expression results in sustained correction of hemophilia B at low vector dose. Molecular therapy: the journal of the American Society of Gene Therapy, 16(2), 280-289. doi. org/10.1038/sj. mt.6300355]. Still other methods may be selected.
  • the methods include subjecting the treated AAV stock to SDS-poly acrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in the buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes, preferably nylon.
  • Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, most preferably the Bl anti-AAV -2 monoclonal antibody (Wobus et al., J. Virol. (2000) 74:9281- 9293).
  • a secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti- IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase.
  • a method for detecting binding is used to semi-quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit.
  • a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit.
  • samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novex).
  • Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e., SYPRO ruby or coomassie stains.
  • the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR).
  • Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using primers and a TaqManTM fluorogenic probe specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 Sequence Detection System. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the Q-PCR reaction.
  • the cycle threshold (Ct) values obtained from the samples are used to determine vector genome titer by normalizing it to the Ct value of the plasmid standard curve. End-point assays based on the digital PCR can also be used.
  • genome copies (GC) and vector genomes (vg) in the context of a dose or dosage are meant to be interchangeable.
  • a “stock” of rAAV refers to a population of rAAV. Despite heterogeneity in their capsid proteins due to deamidation, rAAV in a stock are expected to share an identical vector genome.
  • a stock can include rAAV having capsids with, for example, heterogeneous deamidation patterns characteristic of the selected AAV capsid proteins and a selected production system.
  • the stock may be produced from a single production system or pooled from multiple runs of the production system (e.g., different runs of a production system using the same genetic elements for production). A variety of production systems, including but not limited to those described herein, may be selected.
  • the recombinant AAV containing the desired transgene and promoter for use in the target cells as detailed above is optionally assessed for contamination by conventional methods and then formulated into a pharmaceutical composition intended for administration to a subject in need thereof.
  • a pharmaceutically and/or physiologically acceptable vehicle or carrier such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc.
  • the carrier will typically be a liquid.
  • Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen- free, phosphate buffered saline.
  • the carrier is an isotonic sodium chloride solution.
  • the carrier is balanced salt solution.
  • the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or Tween20.
  • the pharmaceutically acceptable carrier comprises a surfactant, such as perfluorooctane (Perfluoron liquid).
  • the vector is formulated in a buffer/carrier suitable for infusion in human subjects.
  • the buffer/carrier should include a component that prevents the rAAV from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo.
  • the pharmaceutical composition described above is administered to the subject intramuscularly (IM).
  • the pharmaceutical composition is administered by intravenously (IV).
  • the pharmaceutical composition is administered by intracerebroventricular (ICV) injection.
  • the pharmaceutical composition is administered by intra-cistema magna (ICM) injection .
  • Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye), including subretinal or intravitreal delivery, oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.
  • Intrathecal delivery or “intrathecal administration” refer to a route of administration via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF).
  • Intrathecal delivery may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital/intracistemal, and/or Cl-2 puncture.
  • material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture.
  • injection may be into the cistema magna.
  • tracistemal delivery or “intracistemal administration” refer to a route of administration directly into the cerebrospinal fluid of the cistema magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cistema magna or via permanently positioned tube.
  • the composition may be delivered in a volume of from about 0.1 pL to about 10 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method.
  • the volume is about 50 pL.
  • the volume is about 70 pL.
  • the volume is about 100 pL.
  • the volume is about 125 pL.
  • the volume is about 150 pL.
  • the volume is about 175 pL.
  • the volume is about 200 pL.
  • the volume is about 250 pL.
  • the volume is about 300 pL.
  • the volume is about 450 pL. In another embodiment, the volume is about 500 pL. In another embodiment, the volume is about 600 pL. In another embodiment, the volume is about 750 pL. In another embodiment, the volume is about 850 pL. In another embodiment, the volume is about 1000 pL. In another embodiment, the volume is about 1.5 mL. In another embodiment, the volume is about 2 mL. In another embodiment, the volume is about 2.5 mL. In another embodiment, the volume is about 3 mL. In another embodiment, the volume is about 3.5 mL. In another embodiment, the volume is about 4 mL. In another embodiment, the volume is about 5 mL. In another embodiment, the volume is about 5.5 mL.
  • the volume is about 6 mL. In another embodiment, the volume is about 6.5 mL. In another embodiment, the volume is about 7 mL. In another embodiment, the volume is about 8 mL. In another embodiment, the volume is about 8.5 mL. In another embodiment, the volume is about 9 mL. In another embodiment, the volume is about 9.5 mL. In another embodiment, the volume is about 10 mL.
  • An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the regulatory sequences desirably ranges from about 10 7 and 10 14 vector genomes per milliliter (vg/mL) (also called genome copies/mL (GC/mL)).
  • vg/mL vector genomes per milliliter
  • GC/mL genome copies/mL
  • the rAAV vector genomes are measured by real-time PCR.
  • the rAAV vector genomes are measured by digital PCR. See, Lock et al, Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR, Hum Gene Ther Methods. 2014 Apr;25(2): 115-25.
  • rAAV infectious units are measured as described in S.K. McLaughlin et al, 1988 J. Virol., 62: 1963, which is incorporated herein by reference.
  • the concentration is from about 1.5 x 10 9 vg/mL to about 1.5 x 10 13 vg/mL, and more preferably from about 1.5 x 10 9 vg/mL to about 1.5 x 10 11 vg/mL.
  • the effective concentration is about 1.4 x 10 8 vg/mL.
  • the effective concentration is about 3.5 x 10 10 vg/mL.
  • the effective concentration is about 5.6 x 10 11 vg/mL.
  • the effective concentration is about 5.3 x 10 12 vg/mL.
  • the effective concentration is about 1.5 x 10 12 vg/mL.
  • the effective concentration is about 1.5 x 10 13 vg/mL. All ranges described herein are inclusive of the endpoints.
  • the dosage is from about 1.5 x 10 9 vg/kg of body weight to about
  • the dosage is about 1.4 x 10 8 vg/kg. In one embodiment, the dosage is about
  • the dosage is about 5.6 x 10 11 vg/kg. In another embodiment, the dosage is about 5.3 x 10 12 vg/kg. In yet another embodiment, the dosage is about 1.5 x 10 12 vg/kg. In another embodiment, the dosage is about 1.5 x 10 13 vg/kg. In another embodiment, the dosage is about 3.0 x 10 13 vg/kg. In another embodiment, the dosage is about 1.0 x 10 14 vg/kg. All ranges described herein are inclusive of the endpoints.
  • the effective dosage is from about 10 7 to 10 13 vector genomes. In one embodiment, the total dosage is about 10 8 genome copies. In one embodiment, the total dosage is about 10 9 genome copies. In one embodiment, the total dosage is about 10 10 genome copies. In one embodiment, the total dosage is about 10 11 genome copies. In one embodiment, the total dosage is about 10 12 genome copies. In one embodiment, the total dosage is about 10 13 genome copies. In one embodiment, the total dosage is about 10 14 genome copies. In one embodiment, the total dosage is about 10 15 genome copies.
  • the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity.
  • Still other dosages and administration volumes in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular disorder and the degree to which the disorder, if progressive, has developed.
  • Intravenous delivery for example may require doses on the order of 1.5 x 10 13 vg/kg.
  • a method of transducing a target cell or tissue includes administering an rAAV as described herein.
  • the dosage of an rAAV is about 1 x 10 9 GC to about 1 x 10 15 genome copies (GC) per dose (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 10 12 GC to 2.0 x 10 15 GC for a human patient. In another embodiment, the dose is less than about 1 x 10 14 GC/kg body weight of the subject.
  • the dose administered to a patient is at least about 1.0 x 10 9 GC/kg , about 1.5 x 10 9 GC/kg , about 2.0 x 10 9 GC/g, about 2.5 x 10 9 GC/kg , about 3.0 x 10 9 GC/kg , about 3.5 x 10 9 GC/kg , about 4.0 x 10 9 GC/kg , about 4.5 x 10 9 GC/kg , about 5.0 x 10 9 GC/kg , about 5.5 x 10 9 GC/kg , about 6.0 x 10 9 GC/kg , about 6.5 x 10 9 GC/kg , about 7.0 x 10 9 GC/kg , about 7.5 x 10 9 GC/kg , about 8.0 x 10 9 GC/kg , about 8.5 x 10 9 GC/kg , about 9.0 x 10 9 GC/kg , about 9.5 x 10 9 GC/kg , about 1.0 x 10 10 GC/kg , about
  • the method further comprises administering an immunosuppressive co-therapy to the subject.
  • immunosuppressive co-therapy may be started prior to delivery of an rAAV or a composition as disclosed, e.g, if undesirably high neutralizing antibody levels to the AAV capsid are detected.
  • co- therapy may also be started prior to delivery of the rAAV as a precautionary measure.
  • immunosuppressive co-therapy is started following delivery of the rAAV, e.g., if an undesirable immune response is observed following treatment.
  • Immunosuppressants for such co-therapy include, but are not limited to, a glucocorticoid, steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., a rapamycin or rapalog), and cytostatic agents including an alkylating agent, an anti-metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin.
  • a glucocorticoid e.g., steroids, antimetabolites, T-cell inhibitors
  • a macrolide e.g., a rapamycin or rapalog
  • cytostatic agents including an alkylating agent, an anti-metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin.
  • the immune suppressant may include prednelisone, a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- (CD25-) or CD3-directed antibodies, anti-IL-2 antibodies, ciclosporin, tacrolimus, sirolimus, IFN-P, IFN-y, an opioid, or TNF-a (tumor necrosis factor-alpha) binding agent.
  • prednelisone a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- (CD25-) or CD3-directed antibodies
  • the immunosuppressive therapy may be started 0, 1, 2, 7, or more days prior to the rAAV administration, or 0, 1, 2, 3, 7, or more days post the rAAV administration.
  • Such therapy may involve a single drug (e.g., prednelisone) or co-administration of two or more drugs, the (e.g, prednisolone, micophenolate mofetil (MMF) and/or sirolimus (i.e., rapamycin)) on the same day.
  • MMF micophenolate mofetil
  • sirolimus i.e., rapamycin
  • Such therapy may be for about 1 week (7 days), two weeks, three weeks, about 60 days, or longer, as needed.
  • a tacrolimus-free regimen is selected.
  • a recombinant adeno-associated virus comprising a capsid and a vector genome comprising an AAV 5’ inverted terminal repeat (ITR), an expression cassette comprising a nucleic acid sequence encoding a gene product operably linked to expression control sequences, and an AAV 3’ ITR, wherein the capsid is:
  • an AAVrh75 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 40 or a sequence at least 99% identical thereto having an Asn (N) amino acid residue at position 24 based on the numbering of SEQ ID NO: 40; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 39 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 40; or (iii) a capsid which is heterogeneous mixture of AAVrh75 vpl, vp2 and vp3 proteins which are 95% to 100% deamidated in at least position N57, N262, N384, and/or N512 of SEQ ID NO: 40, and optionally deamidated in other positions;
  • an AAVhu71/74 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 3; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 3 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 4; or (iii) a capsid which is a heterogeneous mixture of AAVrh71/74 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least 4 positions of SEQ ID NO: 4, and optionally deamidated in other positions;
  • an AAVhu79 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 6; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 5of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 6; or (iii) a capsid which is a heterogeneous mixture of AAVhu79 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 6, and optionally deamidated in other positions;
  • an AAVhu80 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 8; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 7 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 8; or (iii) a capsid which is a heterogeneous mixture of AAVhu80 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 8, and optionally deamidated in other positions;
  • an AAVhu83 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 10; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 9 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 10; or (iii) a capsid which is a heterogeneous mixture of AAVhu83 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 10, and optionally deamidated in other positions;
  • an AAVhu74/71 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 12; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 11 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 12; or (iii) a capsid which is a heterogeneous mixture of AAVhu74/71 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 12, and optionally deamidated in other positions;
  • an AAVhu77 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 14; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 13 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 14; or (iii) a capsid which is a heterogeneous mixture of AAVhu77 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 14, and optionally deamidated in other positions;
  • an AAVhu78/88 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 16; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 15 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 16; or (iii) a capsid which is a heterogeneous mixture of AAVhu78/88 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 16, and optionally deamidated in other positions;
  • an AAVhu70 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 18; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 17 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 18; or (iii) a capsid which is a heterogeneous mixture of AAVhu70 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 18, and optionally deamidated in other positions;
  • an AAVhu72 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 20; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 19 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 20; or (iii) a capsid which is a heterogeneous mixture of AAVhu72 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 20, and optionally deamidated in other positions;
  • an AAVhu75 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 22; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 21 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 22; or (iii) a capsid which is a heterogeneous mixture of AAVhu75 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 22, and optionally deamidated in other positions;
  • an AAVhu76 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 24; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 23 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 24; or (iii) a capsid which is a heterogeneous mixture of AAVhu76 vpl, vp2, and vp3 proteins which are 95% to 100%deami dated in at least four positions of SEQ ID NO: 24, and optionally deamidated in other positions;
  • an AAVhu81 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 26; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 25 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 26; or (iii) a capsid which is a heterogeneous mixture of AAVhu81 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 26, and optionally deamidated in other positions;
  • an AAVhu82 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 28; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 27 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 28; or (iii) a capsid which is a heterogeneous mixture of AAVhu82 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 28, and optionally deamidated in other positions;
  • an AAVhu84 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 30; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 29 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 30; or (iii) a capsid which is a heterogeneous mixture of AAVhu84 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 30, and optionally deamidated in other positions;
  • an AAVhu86 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 32; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 31 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 32; or (iii) a capsid which is a heterogeneous mixture of AAVhu86 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 32, and optionally deamidated in other positions;
  • an AAVhu87 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 34; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 33 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 34; or (iii) a capsid which is a heterogeneous mixture of AAVhu87 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 34, and optionally deamidated in other positions; (r) an AAVhu88/78 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 36; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 35 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO:
  • an AAVhu69 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 38; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 37 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 38; or (iii) a capsid which is a heterogeneous mixture of AAVhu69 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 38, and optionally deamidated in other positions;
  • an AAVrh76 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 42; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 41 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 42; or (iii) a capsid which is a heterogeneous mixture of AAVhu69 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 42, and optionally deamidated in other positions;
  • an AAVrh77 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 44; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 43 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 44; or (iii) a capsid which is a heterogeneous mixture of AAVrh71 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 44, and optionally deamidated in other positions;
  • an AAVrh78 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 46; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 45 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 46; or (iii) a capsid which is a heterogeneous mixture of AAVrh78 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 46, and optionally deamidated in other positions;
  • an AAVrh81 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 50; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 49 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 50; or (iii) a capsid which is a heterogeneous mixture of AAVrh81 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 50, and optionally deamidated in other positions;
  • an AAVrh89 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 52; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 51 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 52; or (iii) a capsid which is a heterogeneous mixture of AAVrh89 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 52, and optionally deamidated in other positions;
  • an AAVrh82 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 54; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 53 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 54; or (iii) a capsid which is a heterogeneous mixture of AAVrh82 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 54, and optionally deamidated in other positions;
  • an AAVrh83 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 56; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 55 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 56; or (iii) a capsid which is a heterogeneous mixture of AAVrh83 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 56, and optionally deamidated in other positions;
  • an AAVrh84 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 58; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 57 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 58; or (iii) a capsid which is a heterogeneous mixture of AAVrh84 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 58, and optionally deamidated in other positions;
  • an AAVrh85 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 60; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 59 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 60; or (iii) a capsid which is a heterogeneous mixture of AAVrh85 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 60, and optionally deamidated in other positions;
  • an AAVrh87 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 62; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 61 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 62; or (iii) a capsid which is a heterogeneous mixture of AAVrh87 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 62, and optionally deamidated in other positions; or
  • an AAVhu73 capsid consisting of (i) a capsid produced from a nucleic acid sequence encoding SEQ ID NO: 74; (ii) a capsid produced from a nucleic acid sequence of SEQ ID NO: 73 of a sequence or a sequence at least 95% identical thereto encoding SEQ ID NO: 74; or (iii) a capsid which is a heterogeneous mixture of AAVrh73 vpl, vp2, and vp3 proteins which are 95% to 100% deamidated in at least four positions of SEQ ID NO: 74, and optionally deamidated in other positions.
  • rAAV rAAV according to embodiment 1, wherein the gene product is useful in treating a disorder or disease of the liver, and wherein the capsid is an AAVrh75, AAVrh79, AAVrh83, or AAVrh84 capsid.
  • a pharmaceutical composition comprising the rAAV according to any one of embodiments 1 to 5, and a physiologically compatible carrier, buffer, adjuvant, and/or diluent.
  • a method of delivering a transgene to a cell comprising the step of contacting the cell with the rAAV according to any one of embodiments 1 to 5, wherein said rAAV comprises the transgene.
  • a method of generating a recombinant adeno-associated virus (rAAV) comprising an AAV capsid comprising culturing a host cell containing: (a) a molecule encoding an AAV vpl, vp2, and/or vp3 capsid protein of AAVrh75 (SEQ ID NO: 40), AAVhu71/74 (SEQ ID NO: 4), AAVhu79 (SEQ ID NO: 6), AAVhu80 (SEQ ID NO: 8), AAVhu83 (SEQ ID NO: 10), AAVhu74/71 (SEQ ID NO: 12), AAVhu77 (SEQ ID NO: 14), AAVhu78/88 (SEQ ID NO: 16), AAVhu70 (SEQ ID NO: 18), AAVhu72 (SEQ ID NO: 20), AAVhu75 (SEQ ID NO: 22), AAVhu76 (SEQ ID NO: 24), AAVhu81 (SEQ ID NO: 40),
  • AAVrh81 (SEQ ID NO: 50), AAVrh89 (SEQ ID NO: 52), AAVrh82 (SEQ ID NO: 54),
  • AAVrh83 (SEQ ID NO: 56), AAVrh84 (SEQ ID NO: 58), AAVrh85 (SEQ ID NO: 60),
  • AAVrh87 (SEQ ID NO: 62), or AAVhu73 (SEQ ID NO: 74), or an AAV vpl, vp2, and/or vp3 capsid protein sharing at least 99% identity with any of SEQ ID NOs: 40, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 46, 50, 52, 54, 56, 58, 60, 62, or 74, (b) a functional rep gene; (c) a vector genome comprising AAV inverted terminal repeats (ITRs) and a transgene; and (d) sufficient helper functions to permit packaging of the vector genome into the AAV capsid protein.
  • ITRs AAV inverted terminal repeats
  • a plasmid comprising a vpl, vp2, and/or vp3 sequence of AAVrh75 (SEQ ID NO: 39), AAVhu71/74 (SEQ ID NO: 3), AAVhu79 (SEQ ID NO: 5), AAVhu80 (SEQ ID NO: 7), AAVhu83 (SEQ ID NO: 9), AAVhu74/71 (SEQ ID NO: 11), AAVhu77 (SEQ ID NO: 13), AAVhu78/88 (SEQ ID NO: 15), AAVhu70 (SEQ ID NO: 17), AAVhu72 (SEQ ID NO: 19), AAVhu75 (SEQ ID NO: 21), AAVhu76 (SEQ ID NO: 23), AAVhu81 (SEQ ID NO: 25), AAVhu82 (SEQ ID NO: 27), AAVhu84 (SEQ ID NO: 29), AAVhu86 (SEQ ID NO: 31), AAVhu87 (SEQ ID NO: 33),
  • Adeno-associated viruses are advantageous as gene-transfer vectors due to their favorable biological and safety characteristics, with discovering novel AAV variants being key to improving this treatment platform.
  • PCR polymerase chain reaction
  • researchers have isolated over 200 AAVs from natural sources using polymerase chain reaction (PCR)-based methods.
  • PCR polymerase chain reaction
  • We compared two modem DNA polymerases and their utility for isolating and amplifying the AAV genome.
  • the higher-fidelity Q5 Hot Start High- Fidelity DNA Polymerase provided more precise and accurate amplification of the input AAV sequences.
  • the lower-fidelity HotStar DNA polymerase introduced mutations during the isolation and amplification processes, thus generating multiple mutant capsids with variable bioactivity compared to the input AAV gene.
  • the Q5 polymerase enabled the successful discovery of novel AAV capsid sequences from human and nonhuman primate tissue sources. Novel AAV sequences from these sources showed evidence of positive selection. This study highlights the importance of using the highest fidelity DNA polymerases available to accurately isolate and characterize AAV genomes from natural sources to ultimately develop more effective gene therapy vectors.
  • Adeno-associated viruses are safe and effective vehicles used for gene transfer for several clinical indications.
  • AAV-mediated gene therapy drugs have been approved by the FDA for the treatment of Spinal Muscular Atrophy and Leber Congenital Amaurosis. These approved gene therapy products, as well as many others currently under development, utilize AAV capsids isolated from natural sources as the delivery vehicle 4 .
  • the AAV genome consists of two major open reading frames (ORFs), Rep and Cap, which encode sequences for the translation of multiple protein products.
  • the Cap ORF translation occurs from multiple start sites to produce the three AAV structural proteins, VP1, VP2, and VP3. These structural protein subunits are assembled into icosahedral virions 5 which carry a genetic payload to their target.
  • AAV capsid genes contribute to variability in viral tropism, antigenicity, and packaging efficiency that is observed between viral clades. Discovering novel capsids with an array of tissue tropisms are necessary to advance the efficacy and utility of gene therapy.
  • AAV Cap sequences have been isolated from natural sources using a variety of techniques that have emerged and evolved over time, although the most common approach involves PCR amplification. Firstly, extracted viral DNA can be directly sequenced; this method was used to identify AAV2, which was found to be propagated with helper Adenovirus in cell culture. Secondly, extracted viral DNA can be extracted, cloned into a plasmid backbone, and sequenced (AAV1, AAV3, AAV3B, AAV6, and AAV5). Thirdly, it is possible to extract viral genomes via PCR and clone the amplicons into plasmids before Sanger sequencing. Many AAVs from primate, bovine, porcine, rodent, and others have been isolated using this method.
  • NGS Next-generation sequencing
  • PCR for AAV amplification provides a straightforward and effective means to discover novel AAV capsid sequences.
  • Nonhuman primate (Macaca mulatta) tissue samples were collected postmortem from the Gene Therapy Program at the University of Pennsylvania’s Perelman School of Medicine. Human tissue samples (including aortic valve, bone marrow, brain, breast, cervix, colon, heart, intestine, kidney, liver, lung, lymph node, ovary, pancreas, pericardium, skeleton muscle, and spleen) were obtained. Genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN Inc., Germantown, MD). Conventional AAV isolation
  • T is the primary nucleotide that is represented in the AAV sequence phylogeny across many clades of AAV.
  • Each primer was used at a 0.5 pM final concentration, as described in the Q5 protocol (New England Biolabs, Ipswich, MA). The following thermal cycling conditions were applied: 98°C for 30 s; 98°C for 10 s, 59°C for 10 s, 72°C for 93 s, 50 cycles; and a 72°C extension for 120 s.
  • PCR products were TOPO-cloned (Thermo Fisher Scientific, Waltham, MA) and Sanger-sequenced (GENEWIZ, South Plainfield, NJ). For most PCR products, we sequenced at least three clones.
  • Genomic DNA from a human heart tissue sample that was previously found to be AAV-positive by conventional AAV isolation PCR was subjected to AAV-SGA.
  • AAV- containing genomic DNA was endpoint-diluted in 20ng/pL sheared-salmon sperm DNA (Ambion, Inc, Austin, TX) by serial dilutions. Material from each serial dilution was used as the template for 96 PCR reactions using the AVINS and AV2CAS primers (Mueller C et al. Curr Protoc Microbiol 2012;Chapter 14:Unitl4Dll).
  • AAV DNA amplicons from positive PCR reactions were purified using Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA), libraries were constructed using the NEBNext® UltraTM II DNA Library Prep Kit for Illumina® (NEB, Ipswich, MA), and sequenced using the Illumina MiSeq 2x250 (Illumina, San Diego, CA) paired-end sequencing platform, and the resulting reads were assembled de novo using the SPAdes assembler (cab.spbu.ru/software/spades/). Sequence analysis
  • the pAAV2/9 trans plasmid was used as the template. To make sure the template was pure, we first re-transformed the plasmid into Stable Competent E. coli cells (Thermo Fisher, Waltham, MA), and sequenced two, single colony clones viaNGS (Illumina, San Diego, CA) as described previously (Saveliev A et al. Human Gene Therapy Methods 2018;29:201-11). To ensure complete sequence identity to the input pAAV2/9 trans plasmid, we used one of the two sequenced plasmids as the template for subsequent experiments.
  • HiFi Hot Star HiFidelity polymerase
  • Q5 Hot Start High-Fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA) was the higher-fidelity polymerase.
  • HiFi Circular the pAAV2/9 trans plasmid was diluted and used as the PCR template.
  • HiFi Linear and “Q5 Linear,” the pAAV2/9 trans plasmid was linearized with the restriction enzyme PvuII (New England Biolabs, Ipswich, MA) and then diluted for use as the template.
  • McapF3SpeI (5’-ATCGATACTAGTCCATCGACGTCAGACGCGGAAG-3’; SEQ ID NO: 65) and McapRINotl (5’- ATCGATGCGGCCGCAGTTCAACTGAAACGAATTAAACGGT-3’; SEQ ID NO: 66) to perform a nested reaction.
  • McapF3SpeI and McapRINotl were described in a previous publication on an AAV PCR technique (Smith LJ et al. Molecular Therapy 2014;22: 1625- 1634).
  • McapRINotl is a modified version of the primer McapRINotl from the aforementioned publication; we modified McapRINotl to correct for two base pairs near its 3’ end that do not align with any reported AAV sequences, including the isolates reported in the previous publication.
  • 1 pL of the first-round PCR product was used as the template in the second, nested, round of PCR.
  • the following thermal cycling conditions were used for the second round of PCR: 95°C for 300 s; 94°C for 15 s, 63°C for 60 s, 68°C for 315 s, 40 cycles; and a 72°C extension for 600 s.
  • 1 pL of the first-round “Q5” PCR product was used as the template in the second, nested, round of PCR in each 50-pL reaction.
  • the thermal cycling conditions were as follows: 98°C for 30 s; 98°C for 10 s, 66°C for 30 s, 72°C for 164 s, 40 cycles; and a 72°C extension for 120 s.
  • the PCR products were then TOPO-cloned and sequenced.
  • the plasmid ratio used was 2: 1 :0.1 (helper plasmid containing the required Adenovirus helper genes: trans plasmid containing AAV2 Rep and AAV capsid genes: cis plasmid containing the CB7 promoter, Firefly luciferase gene, and the rabbit beta globin polyadenylation sequence transgene (i.e., CB7.ffluciferase.rBG), by weight), and 2) at harvest, no other treatment was performed beyond freezing/thawing (Lock M et al. Human Gene Therapy 2010;21:1259-1271).
  • We measured the vector production titer by qPCR using primers and probe against the vector poly A sequence.
  • FIG. 2 A we performed pairwise comparison between each group using the Wilcoxon rank-sum test using the “wilcox.tesf ’ function within the R Program (version 3.5.0; cran.r-project.org).
  • FIG. 2B and FIG. 2C the Student's /-test was used to compare each mutant to AAV9 using the “t.tesf ’ function within the R Program (version 4.0.0; cran.r- project.org). Statistical significance was assessed at the 0.05 level.
  • Example 3 Novel AAV sequences from multiple clades were isolated from nonhuman primate and human tissues using a high-fidelity PCR polymerase The advancement of gene therapy requires the identification of novel AAV capsids.
  • Novel AAV natural isolates recovered from nonhuman primate intestinal tissue samples and sequence similarity to closest known AAVs. a The DNA sequence of AAVrh81 was substantially different from that of all AAVs in the GenBank database; hence, the DNA difference value is not included in this table.
  • Novel AAV natural isolates recovered from human tissue samples and sequence similarity to closest known AAVs.
  • b Recovered clones have the same amino acid sequence as previously reported AAVs, but exhibit variation in their DNA sequences.
  • AAV Single Genome Amplification (AAV-SGA) identifies natural isolate AAVhu68 capsid sequences with high precision and accuracy
  • SGA Single Genome Amplification
  • This method prevents sequence ambiguity caused by DNA polymerase-induced mutations due to the method’s replicative nature. This technique also mitigates possible DNA polymerase template-switching issues that can occur in DNA mixtures (thus leading lead to the recovery of artificially recombined amplicons) because only one AAV genome is amplified in each reaction.
  • MEME detected thirteen sites that displayed evidence of positive diversifying selection in the VP1 genes of the AAVs isolated from human samples (Table 5). Four of these sites are located in the hypervariable regions (HVRs) of the capsid gene (i.e., surface- exposed capsid regions that display significant sequence diversity). Six sites are located in the internal VP1 unique region (VPlu). Additionally, we found 19 sites of significance in the capsid sequence dataset in samples from rhesus macaques (Table 5). Among these 19 sites, 10 are located in HVR regions, while one was located in VPlu. Both sets of sequences also showed evidence of positive selection in areas between the HVRs, which comprise the nonsurface-exposed regions of the capsid structure (Table 5). MEME was unable to detect any sites that were subject to positive selection in either the AAVHSC sequences or the HiFi PCR mutant-capsid sequences.
  • AAV sequence isolation techniques have greatly evolved since the discovery of AAVs in 1965.
  • HiFi polymerase and a protocol with a high number of PCR cycles a method previously used to discover novel AAVs — resulted in a significantly higher rate of random mutations in amplicons generated from template DNA compared to the method utilizing the Q5 polymerase.
  • the mutant-PCR isolates produced vector and transduced Huh7 cells in vitro at variable levels.
  • Tindall et al. were among the first to demonstrate that DNA polymerases can generate mutations in amplified DNA (Tindall KR et al. Biochemistry 1988;27:6008-6013). Since then, researchers have isolated and engineered a variety of new polymerases to address this issue, including Q5 — one of the most accurate polymerases — with a base substitution rate of 5.3 x 10' 7 bp, which corresponds to an approximately 280-fold higher fidelity compared with Taq polymerase (Potapov V et al. PloS one 2017;12:e016977). In contrast, the fidelity of the HotStar HiFi polymerase is reported to be only 10-fold higher than that of Taq. We demonstrated that optimal AAV isolation requires using the highest-fidelity DNA polymerases available, in this case Q5.
  • AAV-SGA did recover a small minority of amplicon sequences in which 1-2 nucleotides were mismatched from the AAVhu68 genome, which may be attributed to NGS error, the low error rate of Q5, or DNA damage induced by thermocy cling, as characterized by Potapov et al (PloS one 2017;12:e0169774) These data demonstrate that AAV-SGA is a robust tool for analyzing viral populations with very high precision and accuracy.
  • the novel AAV natural isolates recovered from human tissue samples non-human primate tissue samples and sequences thereof are summarized in Table 7 and Table 8 below.
  • Table 8 Novel AAV natural isolates recovered from nonhuman primate intestinal tissue samples and sequences thereof.
  • Example 6 Evaluation of production yields and transduction levels for recombinant AAV vectors with novel capsids
  • rAAV vectors were produced and purified using the protocol described by Lock et al. (Human Gene Therapy 21:1259-1271, October 2010). The titers of the purified products were measured by Droplet Digital PCR described by Lock et al. (Human Gene Therapy 25: 115-25, April 2014).
  • the three plasmids used in the tripletransfection part of the protocol were: adenovirus helper plasmid pAdAF6, a trans plasmid carrying AAV2 rep gene and the capsid gene of a novel AAV isolate, and a cis plasmid carrying a transgene cassete flanked by AAV2 5’ and 3’ ITRs.
  • the cis plasmid included an expression cassete having TBG promoter and eGFP transgene. Yields for the recombinant vectors having AAVrh75, AAVrh76, AAVrh77, AAVrh78, AAAVrh79, AAVrh81, AAVrh82, AAVrh83, AAVrh84, AAVrh87, AAVrh89 capsids are shown in FIG. 15.
  • the protocol was adapted from the CellSTACK® protocol mentioned above without the purification step, mainly by reducing the materials used proportionally to cell culture areas.
  • the trans plasmids used here included AAVrh75 and AAVrh81 capsid genes.
  • the cis plasmid used here included a CB7 promoter and firefly luciferase gene. After production, culture supernatants were collected and spun down to remove cell debris. The yields were then measured by a bioactivity assay where an equal volume of the supernatants was used to transduce Huh7 and MC57G cells, and luciferase activity was measured with a luminometer (BioTek).
  • the AAVrh81 vector had higher levels of infectivity than the AAVrh75 vector in the human cell line Huh7, but exhibited lower levels of infectivity in the mouse cell line MC57G.
  • transgenes were evaluated in vivo.
  • Mice were injected intravenously with rAAV having an AAV8 or AAVrh81 capsid and a vector genome containing a liver-specific promoter (LSP) promoter and human factor IX transgene.
  • LSP liver-specific promoter
  • rAAV vectors having AAVrh78, AAVrh83, AAVrh84, AAVrh85, AAVrh87, AAVrh89, or AAV8 capsids and a vector genome with a TBG promoter and eGFP transgene were administered intravenously at 1 x 10 11 GC/mouse. Livers were harvested on day 14 to evaluate GFP expression. Transduction was comparable to AAV8 for AAVrh83, while levels were GFP were very low following delivery of the AAVrh84 vector (FIG. 18). Genomic DNA was extracted from liver to measure vector genome copies qPCR. Liver transduction levels for AAVrh78, AAVrh85, AAVrh87, and AAVrh89 were about 49%, 72%, 16%, and 22% of levels detected with AAV8, respectively (FIG. 19).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
EP21824439.0A 2020-10-29 2021-10-29 Aav capsids and compositions containing same Withdrawn EP4236975A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202063107030P 2020-10-29 2020-10-29
US202163214530P 2021-06-24 2021-06-24
PCT/US2021/057201 WO2022094180A1 (en) 2020-10-29 2021-10-29 Aav capsids and compositions containing same

Publications (1)

Publication Number Publication Date
EP4236975A1 true EP4236975A1 (en) 2023-09-06

Family

ID=78851102

Family Applications (1)

Application Number Title Priority Date Filing Date
EP21824439.0A Withdrawn EP4236975A1 (en) 2020-10-29 2021-10-29 Aav capsids and compositions containing same

Country Status (9)

Country Link
US (1) US20230407333A1 (https=)
EP (1) EP4236975A1 (https=)
JP (1) JP2023550581A (https=)
CN (1) CN117042787A (https=)
AU (1) AU2021369793A1 (https=)
CA (1) CA3196499A1 (https=)
MX (1) MX2023005113A (https=)
TW (1) TW202233844A (https=)
WO (1) WO2022094180A1 (https=)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240376496A1 (en) * 2021-09-03 2024-11-14 Biomarin Pharmaceutical Inc. Aav capsid compositions and methods for delivery
WO2023220476A2 (en) * 2022-05-13 2023-11-16 The Broad Institute, Inc. Adeno-associated viral vectors and uses thereof
WO2024015966A2 (en) * 2022-07-15 2024-01-18 The Trustees Of The University Of Pennsylvania Recombinant aav having aav clade d and clade e capsids and compositions containing same
WO2024077089A2 (en) * 2022-10-04 2024-04-11 Siren Biotechnology, Inc. Modified cpg dinucleotides for recombinant viral vector production
WO2025212884A1 (en) * 2024-04-05 2025-10-09 University Of Massachusetts Discovery of novel aav capsid proteins through directed evolution of the vp1u region

Family Cites Families (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US6174666B1 (en) 1992-03-27 2001-01-16 The United States Of America As Represented By The Department Of Health And Human Services Method of eliminating inhibitory/instability regions from mRNA
US6268213B1 (en) 1992-06-03 2001-07-31 Richard Jude Samulski Adeno-associated virus vector and cis-acting regulatory and promoter elements capable of expressing at least one gene and method of using same for gene therapy
US5869305A (en) 1992-12-04 1999-02-09 The University Of Pittsburgh Recombinant viral vector system
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US6204059B1 (en) 1994-06-30 2001-03-20 University Of Pittsburgh AAV capsid vehicles for molecular transfer
US6093570A (en) 1995-06-07 2000-07-25 The University Of North Carolina At Chapel Hill Helper virus-free AAV production
US5741683A (en) 1995-06-07 1998-04-21 The Research Foundation Of State University Of New York In vitro packaging of adeno-associated virus DNA
WO1998046728A1 (en) 1997-04-14 1998-10-22 Cell Genesys, Inc. Methods for increasing the efficiency of recombinant aav product
WO1999061643A1 (en) 1998-05-27 1999-12-02 University Of Florida Method of preparing recombinant adeno-associated virus compositions by using an iodixananol gradient
US6221349B1 (en) 1998-10-20 2001-04-24 Avigen, Inc. Adeno-associated vectors for expression of factor VIII by target cells
US6200560B1 (en) 1998-10-20 2001-03-13 Avigen, Inc. Adeno-associated virus vectors for expression of factor VIII by target cells
ES2340230T3 (es) 1998-11-10 2010-05-31 University Of North Carolina At Chapel Hill Vectores viricos y sus procedimientos de preparacion y administracion.
PT1916258E (pt) 1999-08-09 2014-07-29 Genzyme Corp Aumento da expressão de uma sequência nucleotídica heteróloga de cadeia simples a partir de vectores virais recombinantes por concepção da sequência de maneira que esta forme pares de bases intracadeia
US7201898B2 (en) 2000-06-01 2007-04-10 The University Of North Carolina At Chapel Hill Methods and compounds for controlled release of recombinant parvovirus vectors
DK2359869T3 (en) 2001-12-17 2019-04-15 Univ Pennsylvania Sequences of adeno-associated virus (AAV) serotype 8, vectors containing these, and uses thereof
AU2003274397A1 (en) 2002-06-05 2003-12-22 University Of Florida Production of pseudotyped recombinant aav virions
EP1486567A1 (en) 2003-06-11 2004-12-15 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Improved adeno-associated virus (AAV) vector for gene therapy
EP1660970A4 (en) 2003-08-01 2007-02-14 Dna Twopointo Inc SYSTEMS AND METHODS FOR BIOPOLYMER TECHNOLOGY
US8005620B2 (en) 2003-08-01 2011-08-23 Dna Twopointo Inc. Systems and methods for biopolymer engineering
CN1856576B (zh) * 2003-09-30 2011-05-04 宾夕法尼亚州立大学托管会 腺伴随病毒(aav)进化支、序列、含有这些序列的载体及它们的应用
US20060246079A1 (en) 2003-11-14 2006-11-02 Morrow Phillip R Neutralizing human antibodies to anthrax toxin
EP1777906A1 (en) 2005-06-09 2007-04-25 Matsushita Electric Industrial Co., Ltd. Amplitude error compensating apparatus and orthogonality error compensating apparatus
CA2891996A1 (en) 2005-10-18 2007-04-26 Duke University Rationally-designed meganucleases with altered sequence specificity and dna-binding affinity
EP2215223B1 (en) 2007-10-31 2013-05-01 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
DK3211075T3 (en) 2008-07-14 2019-01-21 Prec Biosciences Inc RECOGNITION SEQUENCES FOR I-CREI-DERIVED MECHANUCLEASES AND APPLICATIONS THEREOF
EP2287323A1 (en) 2009-07-31 2011-02-23 Association Institut de Myologie Widespread gene delivery to the retina using systemic administration of AAV vectors
US20130023033A1 (en) 2010-03-29 2013-01-24 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
FR2977562B1 (fr) 2011-07-06 2016-12-23 Gaztransport Et Technigaz Cuve etanche et thermiquement isolante integree dans une structure porteuse
WO2013155222A2 (en) 2012-04-10 2013-10-17 The Regents Of The University Of California Brain-specific enhancers for cell-based therapy
US9719106B2 (en) 2013-04-29 2017-08-01 The Trustees Of The University Of Pennsylvania Tissue preferential codon modified expression cassettes, vectors containing same, and uses thereof
ES2876409T3 (es) 2014-04-25 2021-11-12 Univ Pennsylvania Variantes del RLBD y su uso en composiciones para reducir los niveles de colesterol
EP3288594B1 (en) 2015-04-27 2022-06-29 The Trustees of The University of Pennsylvania Dual aav vector system for crispr/cas9 mediated correction of human disease
HK1257801A1 (zh) 2015-10-28 2019-11-01 宾夕法尼亚州大学信托人 用於基因治疗的腺伴随病毒载体的鞘内给药
EP3387138B1 (en) 2015-12-11 2022-01-26 The Trustees Of The University Of Pennsylvania Scalable purification method for aav9
JP7455579B2 (ja) * 2017-02-28 2024-03-26 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 新規アデノ随伴ウイルス(aav)クレードfベクター及びその用途
EP3612205B9 (en) 2017-04-21 2023-10-04 Precision Biosciences, Inc. Engineered meganucleases specific for recognition sequences in the pcsk9 gene
IL276859B2 (en) * 2018-02-27 2025-12-01 Univ Pennsylvania Novel adeno-associated virus (aav) vectors, aav vectors having reduced capsid deamidation and uses therefor
WO2019241535A2 (en) 2018-06-14 2019-12-19 Regenxbio Inc. Anion exchange chromatography for recombinant aav production
WO2021158915A1 (en) 2020-02-06 2021-08-12 Precision Biosciences, Inc. Recombinant adeno-associated virus compositions and methods for producing and using the same
EP3868886A1 (en) 2020-02-21 2021-08-25 Bia Separations D.O.O. A method for separation or depletion of empty aav capsids from full aav capsids

Also Published As

Publication number Publication date
US20230407333A1 (en) 2023-12-21
CA3196499A1 (en) 2022-05-05
WO2022094180A1 (en) 2022-05-05
CN117042787A (zh) 2023-11-10
TW202233844A (zh) 2022-09-01
JP2023550581A (ja) 2023-12-04
MX2023005113A (es) 2023-08-04
AU2021369793A1 (en) 2023-06-08
CN117042787A8 (zh) 2023-12-08

Similar Documents

Publication Publication Date Title
US20260049334A1 (en) Novel adeno-associated virus (aav) vectors, aav vectors having reduced capsid deamidation and uses therefor
US20240117322A1 (en) Novel adeno-associated virus (aav) clade f vector and uses therefor
AU2019227726B2 (en) Novel adeno-associated virus (AAV) vectors, aav vectors having reduced capsid deamidation and uses therefor
US20230407333A1 (en) Aav capsids and compositions containing same
US20230002788A1 (en) Aav3b variants with improved production yield and liver tropism
US20260021205A1 (en) Recombinant aav having aav clade d and clade e capsids and compositions containing same
WO2022232267A1 (en) Porcine-derived adeno-associated virus capsids and uses thereof
EA049701B1 (ru) Новые векторы на основе аденоассоциированного вируса (aav), векторы aav, со сниженным дезамидированием капсида, а также их применение

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20230505

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
P01 Opt-out of the competence of the unified patent court (upc) registered

Free format text: CASE NUMBER: APP_45295/2024

Effective date: 20240806

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20250807