WO2022232267A1 - Porcine-derived adeno-associated virus capsids and uses thereof - Google Patents

Porcine-derived adeno-associated virus capsids and uses thereof Download PDF

Info

Publication number
WO2022232267A1
WO2022232267A1 PCT/US2022/026531 US2022026531W WO2022232267A1 WO 2022232267 A1 WO2022232267 A1 WO 2022232267A1 US 2022026531 W US2022026531 W US 2022026531W WO 2022232267 A1 WO2022232267 A1 WO 2022232267A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
hsa
mir
acid sequence
vpl
Prior art date
Application number
PCT/US2022/026531
Other languages
French (fr)
Inventor
Qiang Wang
James M. Wilson
Original Assignee
The Trustees Of The University Of Pennsylvania
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of The University Of Pennsylvania filed Critical The Trustees Of The University Of Pennsylvania
Publication of WO2022232267A1 publication Critical patent/WO2022232267A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • Adeno-associated viruses are among the most effective vector candidates for gene therapy due to their low immunogenicity, non-pathogenic nature, and ability to establish long-term expression. Dozens of naturally occurring AAV capsids have been reported; their unique capsid structures enable them to recognize and transduce different cell types and organs. However, despite allowing for efficient gene transfer, the AAV vectors currently used in the clinic can be hindered by preexisting immunity to the virus and restricted tissue tropism.
  • a recombinant adeno-associated virus having a capsid comprising a capsid protein having a vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoG014 (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 2), AAVpoG002 (SEQ
  • AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO:
  • AAVpoG021 SEQ ID NO: 38
  • AAVpoG022 SEQ ID NO: 40
  • AAVpoG023 SEQ ID NO: 42
  • AAVpoG024 SEQ ID NO: 44
  • AAVpoG025 SEQ ID NO: 46
  • a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 32, 34, 36, 38, 40, 42, 44, or 46, and having packaged in said capsid a vector genome comprising a non- AAV nucleic acid sequence.
  • an rAAV having a capsid comprising a capsid protein encoded by a vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19),
  • AAVpoG013 (SEQ ID NO: 21), AAVpoG014 (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO:
  • AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at least 70% identity with SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45, and having packaged in said capsid a vector genome comprising a non- AAV nucleic acid sequence.
  • the sequence encodes the vpl, vp2, and/or vp3 is a sequence of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVp
  • AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40),
  • AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6,
  • the rAAV has capsid protein that is encoded by a nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45.
  • a host cell containing an rAAV described herein is provided.
  • Pharmaceutical compositions comprising an rAAV, and a physiologically acceptable carrier, buffer, adjuvant, and/or diluent are also provided.
  • a method of delivering a transgene to a cell comprises the step of contacting the cell with an rAAV described herein, and the rAAV comprises the transgene.
  • a method of generating an rAAV comprising an AAV capsid comprises culturing a host cell containing: (a) a nucleic acid comprising an AAV vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAV
  • AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a vpl, vp2, and/or vp3 nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45, (b) a functional rep gene; (c) a minigene comprising AAV inverted terminal repeats (ITRs) and a transgene; and (d) sufficient helper functions to permit packaging of the minigene into the AAV capsid.
  • ITRs AAV inverted terminal repeats
  • the vpl, vp2, and/or vp3 sequence encodes a sequence of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO:
  • AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36),
  • AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO:
  • composition comprises a stock of the generated according to such a method.
  • a plasmid comprising a vpl, vp2, and/or vp3 nucleotide sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016 (SEQ ID NO: 27),
  • AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO:
  • AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at 70% identity with a vpl, vp2, and/or vp3 nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45.
  • nucleotide sequence encodes the vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22),
  • AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO:
  • AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity any of SEQ ID NO: 32, 34,
  • FIG. 1A - FIG. 1G show an show an alignment of nucleotide sequences for AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17),
  • AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO:
  • AAVpoG015 SEQ ID NO: 25
  • AAVpoG016 SEQ ID NO: 27
  • AAVpoG017 SEQ ID NO: 29
  • AAVpoG018 SEQ ID NO: 31
  • AAVpoG019 SEQ ID NO: 33
  • AAVpoG020 SEQ ID NO: 35
  • AAVpoG021 SEQ ID NO: 37
  • AAVpoG022 SEQ ID NO: 39
  • AAVpoG023 SEQ ID NO: 41
  • AAVpoG024 SEQ ID NO: 43
  • AAVpoG025 capsid proteins.
  • FIG. 2 A - FIG. 2M show an alignment of amino acid sequences for AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30),
  • AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), and AAVpoG025 (SEQ ID NO: 46) capsid proteins.
  • FIG. 3 shows the frequencies of AAV isolates obtained from various porcine tissues.
  • FIG. 4 shows a phylogenetic tree that includes novel porcine isolates described herein.
  • AAV1-9 and AAVpol, po2.1, po4 and po5 were previously isolated and shown as references.
  • FIG. 5 A and FIG. 5B show levels of Huh7 transduction for viral particles having capsids from novel porcine isolates, relative to AAV9.
  • AAVpol-like isolates 001-005;
  • AAVpo2.1-like isolates 006, 009, 012, 013, and 014;
  • AAVpo4-like isolates 015-017;
  • AAVpo5-like isolates 018-025.
  • FIG. 6 shows production yields for AAVpoG013 and AAVpoG015 vectors, relative to AAV8 and AAV9.
  • FIG. 7 shows transduction efficiency for vectors with AAVpoG013 and AAVpoG015 capsids following IV delivery to mice.
  • FIG. 8A and FIG. 8B show vector biodistribution in a non-human primate following delivery of a recombinant AAV vector with an AAVpoG015 capsid.
  • a rhesus macaque received AAVpoG015.CB7.CI.eGFP.WPRE.RBG at a dose of 5 x 10 13 GC/kg via intravenous (IV) injection.
  • IV intravenous
  • GC vector genome copies
  • the result show higher vector genome copies in liver, heart and muscle.
  • Fiver F, R, M, C left, right, middle, and caudate lobes, respectively.
  • left column GC/pg gDNA
  • right column GC/pg RNA.
  • gDNA genomic DNA.
  • FIG. 9 shows aspartate transferase (AST) and alanine aminotransferase (AFT) levels in a rhesus macaque following delivery of a recombinant AAV vector with an AAVpoG015 capsid.
  • AST aspartate transferase
  • AFT alanine aminotransferase
  • FIG. 10A - FIG. IOC show vector biodistribution in a non-human primate following delivery of a recombinant AAV vector with an AAVpoG015 capsid.
  • a rhesus macaque received AAVpoG015.CB7.CI.eGFP.WPRE.RBG at a dose of 5 x 10 13 GC via intra-cistema magna (ICM) injection.
  • ICM intra-cistema magna
  • the animal was sacrificed and vector genome copies (GC) in tissues were determined by qPCR and RT-qPCR.
  • left column GC/pg gDNA
  • right column GC/pg RNA.
  • gDNA genomic DNA.
  • AAV adeno-associated virus
  • a or “an”, refers to one or more, for example, “a plasmid” is understood to represent one or more plasmids. As such, the terms “a” (or “an”), “one or more,” and “at least one” are used interchangeably herein.
  • Nucleic acids encoding AAV capsids include three overlapping coding sequences, which vary in length due to alternative start codon usage.
  • the translated proteins are referred to as VP1, VP2 and VP3, with VP1 being the longest and VP3 being the shortest.
  • the AAV particle consists of all three capsid proteins at a ratio of -1:1:10 (VP1:VP2:VP3).
  • VP3 which is comprised in VPl and VP2 at the N-terminus, is the main structural component that builds the particle.
  • the capsid protein can be referred to using several different numbering systems. For convenience, as used herein, the AAV sequences are referred to using VPl numbering, which starts with aa 1 for the first residue of VPl.
  • the capsid proteins described herein include VPl, VP2 and VP3 (used interchangeably herein with vpl, vp2, and vp3).
  • novel AAV capsid proteins encoded by sequences set forth in the sequence listing.
  • the numbering of the nucleotides and amino acids corresponding to the vpl, vp2, and vp3 are as follows:
  • AAVpoGOOl vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 1;
  • AAVpoG002 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 3;
  • AAVpoG003 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 5;
  • AAVpoG004 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 7;
  • AAVpoG005 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 9;
  • AAVpoG006 vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 11;
  • AAVpoG007 vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 13;
  • AAVpoG008 vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 15;
  • AAVpoG009 vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 17;
  • AAVpoG012 vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 19;
  • AAVpoG013 vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 21;
  • AAVpoGOM vpl- nt 1 to 2181; vp2- nt 409 to 2181; vp3- nt 604 to 2181 of SEQ ID NO: 23;
  • AAVpoG015 vpl- nt 1 to 2181; vp2- nt 409 to 2181; vp3- nt 604 to 2181 of SEQ ID NO: 25;
  • AAVpoG016 vpl- nt 1 to 2181; vp2- nt 409 to 2181; vp3- nt 604 to 2181 of SEQ ID NO: 27;
  • AAVpoG017 vpl- nt 1 to 2181; vp2- nt 409 to 2181; vp3- nt 604 to 2181 of SEQ ID NO: 29;
  • AAVpoG018 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 31;
  • AAVpoG019 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 33;
  • AAVpoG020 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 35;
  • AAVpoG021 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 37;
  • AAVpoG022 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 39;
  • AAVpoG023 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 41;
  • AAVpoG024 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 43;
  • AAVpoG025 vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 45.
  • AAVpoGOOl aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 2;
  • AAVpoG002 aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 4;
  • AAVpoG003 aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 6;
  • AAVpoG004 aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 8;
  • AAVpoG005 aavpl 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 10;
  • AAVpoG006 aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 12;
  • AAVpoG007 aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 14;
  • AAVpoG008 aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 16;
  • AAVpoG009 aavpl 1 to 728; vp2 - a
  • rAAV comprising at least one of the vpl, vp2, and vp3 of any of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO:
  • AAVpoG009 SEQ ID NO: 18
  • AAVpoG012 SEQ ID NO: 20
  • AAVpoG013 SEQ ID NO: 22
  • AAVpoGOM SEQ ID NO: 24
  • AAVpoG015 SEQ ID NO: 26
  • AAVpoG016 SEQ ID NO: 28
  • AAVpoG017 SEQ ID NO: 30
  • AAVpoG018 SEQ ID NO: 32
  • AAVpoG019 SEQ ID NO: 34
  • AAVpoG020 SEQ ID NO: 36
  • AAVpoG021 SEQ ID NO: 38
  • AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO:
  • AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO:
  • AAVpoG013 SEQ ID NO: 22
  • AAVpoGOM SEQ ID NO: 24
  • AAVpoG015 SEQ ID NO: 26
  • AAVpoG016 SEQ ID NO: 28
  • AAVpoG017 SEQ ID NO: 30
  • AAVpoG018 SEQ ID NO: 32
  • AAVpoG019 SEQ ID NO: 34
  • AAVpoG020 SEQ ID NO: 36
  • AAVpoG021 SEQ ID NO: 38
  • AAVpoG022 SEQ ID NO: 40
  • AAVpoG023 SEQ ID NO: 42
  • AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46) are provided.
  • the vpl, vp2, and/or vp3 has up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 amino acid differences relative to the vpl, vp2, and/or vp3 of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID
  • AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46).
  • rAAV comprising an AAV capsid protein encoded by at least one of the vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016 (SEQ ID NO: 27), AAVpoG00
  • AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO:
  • AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37,
  • the sequence encodes a full-length vpl, vp2 and/or vp3 of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVp
  • AAVpoG012 SEQ ID NO: 19
  • AAVpoG013 SEQ ID NO: 21
  • AAVpoGOM SEQ ID NO: 23
  • AAVpoG015 SEQ ID NO: 25
  • AAVpoG016 SEQ ID NO: 27
  • AAVpoG017 SEQ ID NO: 29
  • AAVpoG018 SEQ ID NO: 31
  • AAVpoG019 SEQ ID NO: 33
  • AAVpoG020 SEQ ID NO: 35
  • AAVpoG021 SEQ ID NO: 37
  • AAVpoG022 SEQ ID NO: 39
  • the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a “recombinant AAV” or “rAAV” is a DNAse-resistant viral particle containing two elements, an AAV capsid and a vector genome containing at least a non- AAV coding sequence packaged within the AAV capsid. Unless otherwise specified, this term may be used interchangeably with the phrase “rAAV vector”.
  • the rAAV is a “replication-defective virus” or “viral vector”, as it lacks any functional AAV rep gene or functional AAV cap gene and cannot generate progeny.
  • the only AAV sequences are the AAV inverted terminal repeat sequences (ITRs), typically located at the extreme 5’ and 3’ ends of the vector genome in order to allow the gene and regulatory sequences located between the ITRs to be packaged within the AAV capsid.
  • ITRs AAV inverted terminal repeat sequences
  • a “vector genome” refers to the nucleic acid sequence packaged inside the rAAV capsid which forms a viral particle. Such a nucleic acid sequence contains AAV inverted terminal repeat sequences (ITRs).
  • ITRs AAV inverted terminal repeat sequences
  • a vector genome contains, at a minimum, from 5’ to 3’, an AAV 5’ ITR, coding sequence(s), and an AAV 3’ ITR. ITRs from AAV2, a different source AAV than the capsid, or other than full-length ITRs may be selected.
  • the ITRs are from the same AAV source as the AAV which provides the rep function during production or a transcomplementing AAV. Further, other ITRs may be used.
  • the vector genome contains regulatory sequences winch direct expression of the gene products. Suitable components of a vector genome are discussed in more detail herein. The vector genome is sometimes referred to herein as the “minigene”.
  • an “expression cassette” refers to a nucleic acid molecule comprising a biologically useful nucleic acid sequence (e.g., a gene cDNA encoding a protein, enzyme, or other useful gene product, mRNA, etc.) and regulatory sequences operably linked thereto that direct or modulate transcription, translation, and/or expression of the nucleic acid sequence and its gene product.
  • a biologically useful nucleic acid sequence e.g., a gene cDNA encoding a protein, enzyme, or other useful gene product, mRNA, etc.
  • operably linked sequences include both regulatory sequences that are contiguous with the nucleic acid sequence and regulatory sequences that act in trans or at a distance to control the sequence.
  • regulatory sequences typically include, e.g., one or more of a promoter, an enhancer, an intron, a Kozak sequence, a polyadenylation sequence, and a TATA signal.
  • the expression cassette may contain regulatory sequences upstream of (5’ to) the gene sequence, e.g., one or more of a promoter, an enhancer, an intron, etc., and one or more of an enhancer, or regulatory sequences downstream of (3’ to) a gene sequence, e.g., 3’ untranslated region comprising a polyadenylation site, among other elements.
  • An rAAV is composed of an AAV capsid and a vector genome.
  • An AAV capsid is an assembly of a heterogeneous population of vpl, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins.
  • the term “heterogeneous” or any grammatical variation thereof refers to a population consisting of elements that are not the same, for example, having vpl, vp2, or vp3 monomers (proteins) with different modified amino acid sequences.
  • heterogeneous population refers to differences in the amino acid sequence of the vpl, vp2 and vp3 proteins within a capsid.
  • the AAV capsid contains subpopulations within the vpl proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues.
  • certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
  • N highly deamidated asparagines
  • a “subpopulation” of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified.
  • a “subpopulation” of vpl proteins may be at least one (1) vpl protein and less than all vpl proteins in an assembled AAV capsid, unless otherwise specified.
  • a “subpopulation” of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified.
  • vpl proteins may be a subpopulation of vp proteins; vp2 proteins may be a separate subpopulation of vp proteins, and vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid.
  • vpl, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine - glycine pairs.
  • highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position.
  • Such percentages may be determined using 20- gel, mass spectrometry techniques, or other suitable techniques.
  • the deamidation of at least highly deamidated residues in the vp proteins in the AAV capsid is believed to be primarily non-enzymatic in nature, being caused by functional groups within the capsid protein which deamidate selected asparagines, and to a lesser extent, glutamine residues.
  • Efficient capsid assembly of the majority of deamidation vpl proteins indicates that either these events occur following capsid assembly or that deamidation in individual monomers (vpl, vp2 or vp3) is well-tolerated structurally and largely does not affect assembly dynamics.
  • Extensive deamidation in the VP1 -unique (VPl-u) region ( ⁇ aa 1-137), generally considered to be located internally prior to cellular entry, suggests that VP deamidation may occur prior to capsid assembly.
  • the deamidation of N may occur through its C- terminus residue’s backbone nitrogen atom conducts a nucleophilic attack to the Asn side chain amide group carbon atom.
  • An intermediate ring-closed succinimide residue is believed to form.
  • the succinimide residue then conducts fast hydrolysis to lead to the final product aspartic acid (Asp) or iso aspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which may interconvert through the succinimide intermediate e.g., as illustrated below. o
  • each deamidated N in the vpl, vp2, or vp3 may independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and/or an interconverting blend of Asp and isoAsp, or combinations thereof.
  • Any suitable ratio of a- and isoaspartic acid may be present.
  • the ratio may be from 10:1 to 1:10 aspartic to isoaspartic, about 50:50 aspartic: isoaspartic, or about 1:3 aspartic: isoaspartic, or another selected ratio.
  • one or more glutamine (Q) may deami dates to glutamic acid (Glu), i.e., a-glutamic acid, g-glutamic acid (Glu), or a blend of a- and g-glutamic acid, which may interconvert through a common glutarimide intermediate.
  • Glu glutamic acid
  • Glu glutamic acid
  • Any suitable ratio of a- and g- glutamic acid may be present.
  • the ratio may be from 10: 1 to 1 : 10 a to g, about 50:50 a: g, or about 1 : 3 a : g, or another selected ratio.
  • an rAAV includes subpopulations within the rAAV capsid of vpl, vp2 and/or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine.
  • other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions.
  • modifications may include an amidation at an Asp position.
  • an AAV capsid contains subpopulations of vpl, vp2 and vp3 having at least 1, at least 2, at least 3, at least 4, at least 5 to at least about 25 deamidated amino acid residue positions, of which at least 1 to 10%, at least 10 to 25%, at least 25 to 50%, at least 50 to 70%, at least 70 to 100%, at least 75 to 100%, at least 80-100%, or at least 90-100% are deamidated as compared to the encoded amino acid sequence of the vp proteins. The majority of these may be N residues. However, Q residues may also be deamidated.
  • encoded amino acid sequence refers to the amino acid which is predicted based on the translation of a known DNA codon of a referenced nucleic acid sequence being translated to an amino acid.
  • an rAAV has an AAV capsid having vpl, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four, five or more deamidated residues at the positions set forth in the tables provided herein and incorporated herein by reference.
  • Deamidation in the rAAV may be determined using 2D gel electrophoresis, and/or mass spectrometry, and/or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific).
  • MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet-sequenced precursor ions from the survey scans (200-2000 m/z). Sequencing is performed via higher energy collisional dissociation fragmentation with a target value of le5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m/z. Survey scans were acquired at a resolution of 120,000 at m/z 200. Resolution for HCD spectra may be set to 30,000 at m/z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30.
  • the S-lens RF level may be set at 50, to give optimal transmission of the m/z region occupied by the peptides from the digest.
  • Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection.
  • BioPharma Finder 1.0 software (Thermo Fischer Scientific) may be used for analysis of the data acquired. For peptide mapping, searches are performed using a single entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as variable modifications, a 10-ppm mass accuracy, a high protease specificity, and a confidence level of 0.8 for MS/MS spectra.
  • proteases may include, e.g., trypsin or chymotrypsin.
  • Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule +0.984 Da (the mass difference between -OH and -MB groups).
  • the percent deamidation of a particular peptide is determined by mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species which are deamidated at different sites may co migrate in a single peak.
  • fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation.
  • the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent on the site of deamidation. It will be understood by one of skill in the art that a number of variations on these illustrative methods can be used.
  • suitable mass spectrometers may include, e.g, a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
  • QTOF quadrupole time of flight mass spectrometer
  • suitable orbitrap instrument such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
  • suitable liquid chromatography systems include, e.g., Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series).
  • Suitable data analysis software may include, e.g., MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques may be described, e.g., in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp
  • modifications may occur do not result in conversion of one amino acid to a different amino acid residue.
  • modifications may include acetylated residues, isomerizations, phosphorylations, or oxidations.
  • the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation.
  • the asparagine is altered to a different amino acid, e.g., a glutamine which deami dates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and/or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups).
  • amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and/or proline. Modifications such as described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine - glycine pairs. Thus, a method for reducing deamidation of AAV and/or engineered AAV variants having lower deamidation rates.
  • a mutant AAV capsid as described herein contains a mutation in an asparagine - glycine pair, such that the glycine is changed to an alanine or a serine.
  • a mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs.
  • an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs.
  • a mutant AAV capsid contains only a single mutation in an NG pair.
  • a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP1 -unique region. In certain embodiments, one of the mutations is in the VPl -unique region.
  • a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair.
  • a method of increasing the potency of an rAAV vector comprises engineering an AAV capsid which eliminating one or more of the NGs in the wild-type AAV capsid.
  • the coding sequence for the “G” of the “NG” is engineered to encode another amino acid.
  • an “S” or an “A” is substituted.
  • other suitable amino acid coding sequences may be selected. Amino acid modifications may be made by conventional genetic engineering techniques.
  • a nucleic acid sequence containing modified AAV vp codons may be generated in which one to three of the codons encoding glycine in asparagine - glycine pairs are modified to encode an amino acid other than glycine.
  • a nucleic acid sequence containing modified asparagine codons may be engineered at one to three of the asparagine - glycine pairs, such that the modified codon encodes an amino acid other than asparagine.
  • Each modified codon may encode a different amino acid.
  • one or more of the altered codons may encode the same amino acid.
  • these modified nucleic acid sequences may be used to generate a mutant rAAV having a capsid with lower deamidation than the native AAV3B variant capsid.
  • Such mutant rAAV may have reduced immunogenicity and/or increase stability on storage, particularly storage in suspension form.
  • nucleic acid sequences encoding the AAV capsids having reduced deamidation including DNA (genomic or cDNA), or RNA (e.g., mRNA).
  • Such nucleic acid sequences may be codon-optimized for expression in a selected system (i.e., cell type) and can be designed by various methods. This optimization may be performed using methods which are available on-line (e.g., GeneArt), published methods, or a company which provides codon optimizing services, e.g., DNA2.0 (Menlo Park, CA).
  • codon optimizing method is described, e.g., in International Patent Publication No. WO 2015/012924, which is incorporated by reference herein in its entirety. See also, e.g., US Patent Publication No. 2014/0032186 and US Patent Publication No. 2006/0136184.
  • ORF open reading frame
  • the entire length of the open reading frame (ORF) for the product is modified. However, in some embodiments, only a fragment of the ORF may be altered.
  • ORF open reading frame
  • one of these methods one can apply the frequencies to any given polypeptide sequence and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide.
  • a number of options are available for performing the actual changes to the codons or for synthesizing the codon-optimized coding regions designed as described herein.
  • oligonucleotide pairs of 80-90 nucleotides each in length and spanning the length of the desired sequence are synthesized by standard methods. These oligonucleotide pairs are synthesized such that upon annealing, they form double stranded fragments of 80-90 base pairs, containing cohesive ends, e.g., each oligonucleotide in the pair is synthesized to extend 3,
  • each pair of oligonucleotides are designed to anneal with the single-stranded end of another pair of oligonucleotides.
  • the oligonucleotide pairs are allowed to anneal, and approximately five to six of these double-stranded fragments are then allowed to anneal together via the cohesive single stranded ends, and then they ligated together and cloned into a standard bacterial cloning vector, for example, a TOPO® vector available from Invitrogen Corporation, Carlsbad, Calif.
  • the construct is then sequenced by standard methods.
  • AAV capsids are provided which have a heterogeneous population of AAV capsid isoforms (i.e., VP1, VP2, VP3) which contain multiple highly deamidated “NG” positions.
  • the highly deamidated positions are in the locations identified below, with reference to the predicted full-length VP1 amino acid sequence.
  • the capsid gene is modified such that the referenced “NG” is ablated and a mutant “NG” is engineered into another position.
  • porcine AAV capsids were identified in small intestine, which is a source of AAV not commonly found in humans.
  • rAAV having a porcine capsid (“rAAVpo”) as provided herein may be particularly well suited for targeting cells and tissue in the gut, including, but not limited to the small intestine.
  • rAAVpo vectors may be used for gene delivery or gene editing.
  • such rAAV vectors may be used to target viral reservoirs (e.g., hepatitis B virus (HBV), hepatitis C virus (HCV), Herpes simplex virus (HSV), Varicella Zoster Virus (VZV) and human immunodeficiency virus (HIV)) or undesirable cell (e.g., bacterial) populations in the gut.
  • viral reservoirs e.g., hepatitis B virus (HBV), hepatitis C virus (HCV), Herpes simplex virus (HSV), Varicella Zoster Virus (VZV) and human immunodeficiency virus (HIV)
  • undesirable cell e.g., bacterial populations in the gut.
  • a novel isolated AAVpoGOOl capsid is provided.
  • a nucleic acid sequence encoding the AAVpoGOOl capsid is provided in SEQ ID NO: 1 and the encoded amino acid sequence is provided in SEQ ID NO: 2.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoGOOl (SEQ ID NO: 2).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoGOOl (SEQ ID NO: 1).
  • the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoGOOl (SEQ ID NO: 2).
  • the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoGOOl capsid comprising one or more of: (1) AAVpoGOOl capsid proteins comprising: a heterogeneous population of AAVpoGOOl vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 2, vpl proteins produced from SEQ ID NO: 1, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 2, a heterogeneous population of AAVpoGOOl vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG002 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG002 capsid is provided in SEQ ID NO: 3 and the encoded amino acid sequence is provided in SEQ ID NO: 4.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG002 (SEQ ID NO: 4).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG002 (SEQ ID NO: 3).
  • the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoG002 (SEQ ID NO: 4). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG002 capsid comprising one or more of: (1) AAVpoG002 capsid proteins comprising: a heterogeneous population of AAVpoG002 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 4, vpl proteins produced from SEQ ID NO: 3, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 3 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 4, a heterogeneous population of AAVpoG002 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG003 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG003 capsid is provided in SEQ ID NO: 5 and the encoded amino acid sequence is provided in SEQ ID NO: 6.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG003 (SEQ ID NO: 6).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG003 (SEQ ID NO: 5).
  • the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoG003 (SEQ ID NO: 6). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG003 capsid comprising one or more of: (1) AAVpoG003 capsid proteins comprising: a heterogeneous population of AAVpoG003 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 6, vpl proteins produced from SEQ ID NO: 5, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 6, a heterogeneous population of AAVpoG003 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoGOOl capsid is provided.
  • a nucleic acid sequence encoding the AAVpoGOOl capsid is provided in SEQ ID NO: 7 and the encoded amino acid sequence is provided in SEQ ID NO: 8.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoGOOl (SEQ ID NO: 8).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoGOOl (SEQ ID NO: 7).
  • the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoGOOl (SEQ ID NO: 8). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoGOOl capsid comprising one or more of: (1) AAVpoGOOl capsid proteins comprising: a heterogeneous population of AAVpoGOOl vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 8, vpl proteins produced from SEQ ID NO: 7, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 7 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 8, a heterogeneous population of AAVpoGOOl vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG005 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG005 capsid is provided in SEQ ID NO: 9 and the encoded amino acid sequence is provided in SEQ ID NO: 10.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG005 (SEQ ID NO: 10).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG005 (SEQ ID NO: 9).
  • the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoG005 (SEQ ID NO: 10). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG005 capsid comprising one or more of: (1) AAVpoG005 capsid proteins comprising: a heterogeneous population of AAVpoG005 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 10, vpl proteins produced from SEQ ID NO: 9, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 9 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO:
  • a heterogeneous population of AAVpoG005 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 10, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 9, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 9 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 10, a heterogeneous population of AAVpoG005 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of
  • a novel isolated AAVpoG006 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG006 capsid is provided in SEQ ID NO: 11 and the encoded amino acid sequence is provided in SEQ ID NO: 12.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG006 (SEQ ID NO: 12).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG006 (SEQ ID NO: 11).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG006 (SEQ ID NO: 12). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG006 capsid comprising one or more of: (1) AAVpoG006 capsid proteins comprising: a heterogeneous population of AAVpoG006 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 12, vpl proteins produced from SEQ ID NO: 11, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 12, a heterogeneous population of AAVpoG006 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG007 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG007 capsid is provided in SEQ ID NO: 13 and the encoded amino acid sequence is provided in SEQ ID NO: 14.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG007 (SEQ ID NO: 14).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG007 (SEQ ID NO: 13).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG007 (SEQ ID NO: 14). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG007 capsid comprising one or more of: (1) AAVpoG007 capsid proteins comprising: a heterogeneous population of AAVpoG007 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 14, vpl proteins produced from SEQ ID NO: 13, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 13 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 14, a heterogeneous population of AAVpoG007 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG008 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG008 capsid is provided in SEQ ID NO: 15 and the encoded amino acid sequence is provided in SEQ ID NO: 16.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG008 (SEQ ID NO: 16).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG008 (SEQ ID NO: 15).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG008 (SEQ ID NO: 16). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG008 capsid comprising one or more of: (1) AAVpoG008 capsid proteins comprising: a heterogeneous population of AAVpoG008 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 16, vpl proteins produced from SEQ ID NO: 15, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 15 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 16, a heterogeneous population of AAVpoG008 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG009 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG009 capsid is provided in SEQ ID NO: 17 and the encoded amino acid sequence is provided in SEQ ID NO: 18.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG009 (SEQ ID NO: 18).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG009 (SEQ ID NO: 17).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG009 (SEQ ID NO: 18). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG009 capsid comprising one or more of: (1) AAVpoG009 capsid proteins comprising: a heterogeneous population of AAVpoG009 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 18, vpl proteins produced from SEQ ID NO: 17, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 17 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 18, a heterogeneous population of AAVpoG009 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG012 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG012 capsid is provided in SEQ ID NO: 19 and the encoded amino acid sequence is provided in SEQ ID NO: 20.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG012 (SEQ ID NO: 20).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG012 (SEQ ID NO: 19).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG012 (SEQ ID NO: 20). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG012 capsid comprising one or more of: (1) AAVpoG012 capsid proteins comprising: a heterogeneous population of AAVpoG012 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 20, vpl proteins produced from SEQ ID NO: 19, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 20, a heterogeneous population of AAVpoG012 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG013 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG013 capsid is provided in SEQ ID NO: 21 and the encoded amino acid sequence is provided in SEQ ID NO: 22.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG013 (SEQ ID NO: 22).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG013 (SEQ ID NO: 21).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG013 (SEQ ID NO: 22). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG013 capsid comprising one or more of: (1) AAVpoG013 capsid proteins comprising: a heterogeneous population of AAVpoG013 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 22, vpl proteins produced from SEQ ID NO: 21, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 21 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 22, a heterogeneous population of AAVpoG013 vp2 proteins selected from: vp2 proteins
  • an rAAV having a poG013 capsid as described herein is well suited for delivering genes to the liver.
  • an rAAVpoG013 vector is well suited for gene editing targets in the liver.
  • an rAAVpoG013 and compositions and regimens utilizing the same may be selected for use in targeting other tissues or cells.
  • a novel isolated AAVpoG014 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG014 capsid is provided in SEQ ID NO: 23 and the encoded amino acid sequence is provided in SEQ ID NO: 24.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG014 (SEQ ID NO: 24).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG014 (SEQ ID NO: 23).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG014 (SEQ ID NO: 24). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG014 capsid comprising one or more of: (1) AAVpoG014 capsid proteins comprising: a heterogeneous population of AAVpoG014 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 24, vpl proteins produced from SEQ ID NO: 23, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 23 which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 24, a heterogeneous population of AAVpoG014 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG015 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG015 capsid is provided in SEQ ID NO: 25 and the encoded amino acid sequence is provided in SEQ ID NO: 26.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG015 (SEQ ID NO: 26).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG015 (SEQ ID NO: 25).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG015 (SEQ ID NO: 26). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG015 capsid comprising one or more of: (1) AAVpoG015 capsid proteins comprising: a heterogeneous population of AAVpoG015 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 26, vpl proteins produced from SEQ ID NO: 25, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 25 which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 26, a heterogeneous population of AAVpoG015 vp2 proteins selected from: vp2 proteins
  • an rAAV vector having a poG015 capsid as described herein is well suited for delivering a gene to the liver.
  • an rAAV vector having a poG015 capsid is well-suited for delivering gene editing nucleases and/or donor constructs to the liver.
  • an rAAV vector having a poG015 capsid and compositions and regimens utilizing same may be selected for use in targeting other tissues or cells.
  • an rAAV vector having a poG015 capsid as described herein is well suited for delivering a gene to the heart.
  • an rAAV vector having a poG015 capsid is well-suited for delivering gene editing nucleases and/or donor constructs to the heart.
  • an rAAV vector having a poG015 capsid as described herein is well suited for delivering genes to the muscle. In certain embodiments, an rAAV vector having a poG015 capsid is well-suited for delivering gene editing nucleases and/or donor constructs to muscle.
  • a novel isolated AAVpoG016 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG016 capsid is provided in SEQ ID NO: 27 and the encoded amino acid sequence is provided in SEQ ID NO: 28.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG016 (SEQ ID NO: 28).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG016 (SEQ ID NO: 27).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG016 (SEQ ID NO: 28). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG016 capsid comprising one or more of: (1) AAVpoG016 capsid proteins comprising: a heterogeneous population of AAVpoG016 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 28, vpl proteins produced from SEQ ID NO: 27, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 27 which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 28, a heterogeneous population of AAVpoG016 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG017 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG017 capsid is provided in SEQ ID NO: 29 and the encoded amino acid sequence is provided in SEQ ID NO: 30.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG017 (SEQ ID NO: 30).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG017 (SEQ ID NO: 29).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG017 (SEQ ID NO: 30). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG017 capsid comprising one or more of: (1) AAVpoG017 capsid proteins comprising: a heterogeneous population of AAVpoG017 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 30, vpl proteins produced from SEQ ID NO: 29, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 29 which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 30, a heterogeneous population of AAVpoG017 vp2 proteins selected from: vp2 proteins
  • a novel isolated AAVpoG018 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG018 capsid is provided in SEQ ID NO: 31 and the encoded amino acid sequence is provided in SEQ ID NO: 32.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG018 (SEQ ID NO: 32).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG018 (SEQ ID NO: 31).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG018 (SEQ ID NO: 32). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG018 capsid comprising one or more of: (1) AAVpoG018 capsid proteins comprising: a heterogeneous population of AAVpoG018 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 32, vpl proteins produced from SEQ ID NO: 31, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 31 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 32, a heterogeneous population of AAVpoG018 vp2 proteins selected from: vp
  • a novel isolated AAVpoG019 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG019 capsid is provided in SEQ ID NO: 33 and the encoded amino acid sequence is provided in SEQ ID NO: 34.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG019 (SEQ ID NO: 34).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG019 (SEQ ID NO: 33).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG019 (SEQ ID NO: 34). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG019 capsid comprising one or more of: (1) AAVpoG019 capsid proteins comprising: a heterogeneous population of AAVpoG019 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 34, vpl proteins produced from SEQ ID NO: 33, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 33 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 34, a heterogeneous population of AAVpoG019 vp2 proteins selected from: v
  • a novel isolated AAVpoG020 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG020 capsid is provided in SEQ ID NO: 35 and the encoded amino acid sequence is provided in SEQ ID NO: 36.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG020 (SEQ ID NO: 36).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG020 (SEQ ID NO: 35).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG020 (SEQ ID NO: 36). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG020 capsid comprising one or more of: (1) AAVpoG020 capsid proteins comprising: a heterogeneous population of AAVpoG020 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 36, vpl proteins produced from SEQ ID NO: 35, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 35 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 36, a heterogeneous population of AAVpoG020 vp2 proteins selected from: v
  • a novel isolated AAVpoG021 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG021 capsid is provided in SEQ ID NO: 37 and the encoded amino acid sequence is provided in SEQ ID NO: 38.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG021 (SEQ ID NO: 38).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG021 (SEQ ID NO: 37).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG021 (SEQ ID NO: 38). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG021 capsid comprising one or more of: (1) AAVpoG021 capsid proteins comprising: a heterogeneous population of AAVpoG021 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 38, vpl proteins produced from SEQ ID NO: 37, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 37 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 38, a heterogeneous population of AAVpoG021 vp2 proteins selected from: v
  • a novel isolated AAVpoG022 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG022 capsid is provided in SEQ ID NO: 39 and the encoded amino acid sequence is provided in SEQ ID NO: 40.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG022 (SEQ ID NO: 40).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG022 (SEQ ID NO: 39).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG022 (SEQ ID NO: 40). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG022 capsid comprising one or more of: (1) AAVpoG022 capsid proteins comprising: a heterogeneous population of AAVpoG022 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 40, vpl proteins produced from SEQ ID NO: 39, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 39 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 40, a heterogeneous population of AAVpoG022 vp2 proteins selected from: v
  • a novel isolated AAVpoG023 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG023 capsid is provided in SEQ ID NO: 41 and the encoded amino acid sequence is provided in SEQ ID NO: 42.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG023 (SEQ ID NO: 42).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG023 (SEQ ID NO: 41).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG023 (SEQ ID NO: 42). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG023 capsid comprising one or more of: (1) AAVpoG023 capsid proteins comprising: a heterogeneous population of AAVpoG023 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 42, vpl proteins produced from SEQ ID NO: 41, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 41 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 42, a heterogeneous population of AAVpoG023 vp2 proteins selected from: v
  • a novel isolated AAVpoG024 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG024 capsid is provided in SEQ ID NO: 43 and the encoded amino acid sequence is provided in SEQ ID NO: 44.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG024 (SEQ ID NO: 44).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG024 (SEQ ID NO: 43).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG024 (SEQ ID NO: 44). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG024 capsid comprising one or more of: (1) AAVpoG024 capsid proteins comprising: a heterogeneous population of AAVpoG024 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 44, vpl proteins produced from SEQ ID NO: 43, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 43 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 44, a heterogeneous population of AAVpoG024 vp2 proteins selected from: v
  • a novel isolated AAVpoG025 capsid is provided.
  • a nucleic acid sequence encoding the AAVpoG025 capsid is provided in SEQ ID NO: 45 and the encoded amino acid sequence is provided in SEQ ID NO: 46.
  • an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG025 (SEQ ID NO: 46).
  • rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG025 (SEQ ID NO: 45).
  • the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG025 (SEQ ID NO: 46). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
  • a recombinant adeno-associated virus which comprises: (A) an AAVpoG025 capsid comprising one or more of: (1) AAVpoG025 capsid proteins comprising: a heterogeneous population of AAVpoG025 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 46, vpl proteins produced from SEQ ID NO: 45, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 45 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 46, a heterogeneous population of AAVpoG025 vp2 proteins selected from: v
  • the rAAV provided have a capsid as described herein, and have packaged in the capsid a vector genome comprising a non-AAV nucleic acid sequence.
  • the vectors useful in compositions and methods described herein contain, at a minimum, a AAV capsid vpl, vp2, and/or vp3, or fragment thereof, encoded by a sequence provided herein.
  • useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, or a fragment thereof.
  • such vectors may contain both AAV cap and rep proteins.
  • the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., all AAVpoGOOl, AAVpoG002, AAVpoG003, AAVpoG004, AAVpoG005, AAVpoG006, AAVpoG007, AAVpoG008, AAVpoG009, AAVpoG012, AAVpoG013, AAVpoGOM, AAVpoG015, AAVpoG016, AAVpoG017, AAVpoG018, AAVpoG019, AAVpoG020, AAVpoG021, AAVpoG022, AAVpoG023, AAVpoG024, or
  • the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector).
  • these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as AAV2/8 described in US Patent No. 7,282,199, which is incorporated by reference herein.
  • the vectors further contain a minigene comprising a selected transgene which is flanked by AAV 5' ITR and AAV 3' ITR.
  • the AAV is a self complementary AAV (sc-AAV) (See, US 2012/0141422 which is incorporated herein by reference).
  • Self-complementary vectors package an inverted repeat genome that can fold into dsDNA without the requirement for DNA synthesis or base-pairing between multiple vector genomes. Because scAAV have no need to convert the single-stranded DNA (ssDNA) genome into double-stranded DNA (dsDNA) prior to expression, they are more efficient vectors.
  • scAAV are useful for small protein-coding genes (up to ⁇ 55 kd) and any currently available RNA-based therapy.
  • AAV vectors utilizing a AAVpoGOOl, AAVpoG002, AAVpoG003, AAVpoG004, AAVpoG005, AAVpoG006, AAVpoG007, AAVpoG008, AAVpoG009, AAVpoG012, AAVpoG013, AAVpoGOM, AAVpoG015, AAVpoG016, AAVpoGO 17, AAVpoG018, AAVpoG019, AAVpoG020, AAVpoG021, AAVpoG022, AAVpoG023, AAVpoG024, or AAVpoG025 capsid as described herein, have AAV2 ITRs.
  • the AAV ITRs, and other selected AAV components described herein may be individually selected from among any AAV serotype, including, without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes.
  • the ITRs of AAV serotype 2 are used.
  • ITRs from other suitable serotypes may be selected. These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype.
  • AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA).
  • the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
  • the rAAV provided herein comprise a vector genome.
  • the vector genome is composed of, at a minimum, a non-AAV or heterologous nucleic acid sequence (e.g., a transgene), as described below, regulatory sequences, and 5’ and 3’ AAV inverted terminal repeats (ITRs). It is this minigene which is packaged into a capsid protein and delivered to a selected target cell or target tissue.
  • a non-AAV or heterologous nucleic acid sequence e.g., a transgene
  • regulatory sequences e.g., regulatory sequences, and 5’ and 3’ AAV inverted terminal repeats (ITRs). It is this minigene which is packaged into a capsid protein and delivered to a selected target cell or target tissue.
  • ITRs AAV inverted terminal repeats
  • the transgene is a nucleic acid sequence, heterologous to the vector sequences flanking the transgene, which encodes a polypeptide, protein, or other product, of interest.
  • the nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and/or expression in a target cell.
  • the heterologous nucleic acid sequence can be derived from any organism.
  • the AAV may comprise one or more transgenes.
  • target cell and “target tissue” can refer to any cell or tissue which is intended to be transduced by the subject AAV vector.
  • the term may refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (ocular cells), or heart.
  • the target tissue is liver.
  • the target tissue is the heart.
  • the target tissue is brain.
  • the target tissue is muscle.
  • the target tissue is the retina.
  • mamalian subject or “subject” includes any mammal in need of the methods of treatment described herein or prophylaxis, including particularly humans.
  • Other mammals in need of such treatment or prophylaxis include dogs, cats, or other domesticated animals, horses, livestock, laboratory animals, including non-human primates, etc.
  • the subject may be male or female.
  • the term “host cell” may refer to the packaging cell line in which the rAAV is produced from the plasmid. In the alternative, the term “host cell” may refer to a target cell in which expression of a transgene is desired.
  • a “stock” of rAAV refers to a population of rAAV. Despite heterogeneity in their capsid proteins due to deamidation, rAAV in a stock are expected to share an identical vector genome.
  • a stock can include rAAV vectors having capsids with, for example, heterogeneous deamidation patterns characteristic of the selected AAV capsid proteins and a selected production system. The stock may be produced from a single production system or pooled from multiple runs of the production system. A variety of production systems, including but not limited to those described herein, may be selected.
  • Useful products encoded by the transgene include a variety of gene products which replace a defective or deficient gene, inactivate or “knock-out”, or “knock-down” or reduce the expression of a gene which is expressing at an undesirably high level, or delivering a gene product which has a desired therapeutic effect.
  • the therapy will be “somatic gene therapy”, i.e., transfer of genes to a cell of the body which does not produce sperm or eggs.
  • the transgenes express proteins have the sequence of native human sequences. However, in other embodiments, synthetic proteins are expressed. Such proteins may be intended for treatment of humans, or in other embodiments, designed for treatment of animals, including companion animals such as canine or feline populations, or for treatment of livestock or other animals which come into contact with human populations.
  • suitable gene products may include those associated with familial hypercholesterolemia, muscular dystrophy, cystic fibrosis, and rare or orphan diseases.
  • rare disease may include spinal muscular atrophy (SMA), Huntingdon’s Disease, Rett Syndrome (e.g., methyl-CpG-binding protein 2 (MeCP2); UniProtKB - P51608), Amyotrophic Lateral Sclerosis (ALS), Duchenne Type Muscular dystrophy, Friedrichs Ataxia (e.g., frataxin), ATXN2 associated with spinocerebellar ataxia type 2 (SCA2)/ALS; TDP-43 associated with ALS, progranulin (PRGN) (associated with non- Alzheimer’s cerebral degenerations, including, frontotemporal dementia (FTD), progressive non-fluent aphasia (PNFA) and semantic dementia), among others.
  • SMA spinal muscular atrophy
  • Huntingdon’s Disease e.g., methyl-CpG-binding protein 2 (MeCP
  • the transgene is not human low-density lipoprotein receptor (hLDLR). In another embodiment, the transgene is not an engineered human low-density lipoprotein receptor (hLDLR) variant, such as those described in WO 2015/164778.
  • hLDLR human low-density lipoprotein receptor
  • suitable genes may include, e.g., hormones and growth and differentiation factors including, without limitation, insulin, glucagon, glucagon-like peptide -1 (GLP1), growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietins, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO) (including, e.g., human, canine or feline epo), connective tissue growth factor (CTGF), neutrophic factors including, e.g., basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin growth factors I and II (IGF-I and IGF-I
  • transgene products include proteins that regulate the immune system including, without limitation, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL) IL-1 through IL-36 (including, e.g., human interleukins IL-1, IL-la, IL-Ib, IL-2, IL-3, IL-4, IL-6, IL-8, IL-12, IL-11, IL-12, IL-13, IL-18, IL-31, IL-35), monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factors a and b, interferons a, b, and g, stem cell factor, flk- 2/flt3 ligand.
  • TPO thrombopoietin
  • IL interleukins
  • IL-1 through IL-36 including, e.g.,
  • Gene products produced by the immune system are also useful in the invention. These include, without limitations, immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, class I and class II MHC molecules, as well as engineered immunoglobulins and MHC molecules.
  • the rAAV antibodies may be designed to delivery canine or feline antibodies, e.g., such as anti-IgE, anti- IL31, anti-IL33, anti-CD20, anti-NGF, anti-GnRH.
  • Useful gene products also include complement regulatory proteins such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2, CD59, and Cl esterase inhibitor (Cl-INH).
  • Still other useful gene products include any one of the receptors for the hormones, growth factors, cytokines, lymphokines, regulatory proteins and immune system proteins.
  • the invention encompasses receptors for cholesterol regulation and/or lipid modulation, including the low- density lipoprotein (LDL) receptor, high density lipoprotein (HDL) receptor, the very low-density lipoprotein (VLDL) receptor, and scavenger receptors.
  • LDL low- density lipoprotein
  • HDL high density lipoprotein
  • VLDL very low-density lipoprotein
  • the invention also encompasses gene products such as members of the steroid hormone receptor superfamily including glucocorticoid receptors and estrogen receptors, Vitamin D receptors and other nuclear receptors.
  • useful gene products include transcription factors such as jun,fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding proteins, interferon regulation factor (IRF-1), Wilms tumor protein, ETS-binding protein, STAT, GATA-box binding proteins, e.g., GATA-3, and the forkhead family of winged helix proteins.
  • transcription factors such as jun,fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box
  • HMBS hydroxymethylbilane synthase
  • OTC ornithine transcarbamylase
  • ASL arginosuccinate synthetase
  • arginase fumarylacetate hydrolase
  • phenylalanine hydroxylase alpha- 1 antitrypsin
  • rhesus alpha- fetoprotein AFP
  • chorionic gonadotrophin CG
  • glucose-6-phosphatase porphobilinogen deaminase
  • cystathione beta- synthase branched chain ketoacid decarboxylase
  • albumin isovaleryl-coA dehydrogenase, propionyl CoA carboxylase, methyl malonyl CoA mutase, glutaryl CoA dehydrogenase, insulin, beta-glucos
  • Still other useful gene products include enzymes such as may be useful in enzyme replacement therapy, which is useful in a variety of conditions resulting from deficient activity of enzyme.
  • enzymes that contain mannose-6-phosphate may be utilized in therapies for lysosomal storage diseases (e.g ., a suitable gene includes that encoding b-glucuronidase (GUSB)).
  • GUSB b-glucuronidase
  • the gene product is ubiquitin protein ligase E3A (UBE3A).
  • Still useful gene products include UDP Glucuronosyltransferase Family 1 Member A1 (UGT1A1).
  • the rAAV may be used in gene editing systems, which system may involve one rAAV or co-administration of multiple rAAV stocks.
  • the rAAV may be engineered to deliver SpCas9, SaCas9, ARCUS, Cpfl (also known as Casl2a), CjCas9, and other suitable gene editing constructs.
  • the minigene comprises first 57 base pairs of the Factor VIII heavy chain which encodes the 10 amino acid signal sequence, as well as the human growth hormone (hGH) polyadenylation sequence.
  • hGH human growth hormone
  • the minigene further comprises the A1 and A2 domains, as well as 5 amino acids from the N-terminus of the B domain, and/or 85 amino acids of the C-terminus of the B domain, as well as the A3, Cl and C2 domains.
  • the nucleic acids encoding Factor VIII heavy chain and light chain are provided in a single minigene separated by 42 nucleic acids coding for 14 amino acids of the B domain [US Patent No. 6,200,560]
  • Non-naturally occurring polypeptides such as chimeric or hybrid polypeptides having a non-naturally occurring amino acid sequence containing insertions, deletions, or amino acid substitutions.
  • single-chain engineered immunoglobulins could be useful in certain immunocompromised patients.
  • Other types of non- naturally occurring gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which could be used to reduce overexpression of a target.
  • Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperproliferative cells as compared to normal cells.
  • Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF.
  • target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease.
  • Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1 A and folate binding polypeptides.
  • T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis.
  • RA Rheumatoid arthritis
  • MS multiple sclerosis
  • Sjogren's syndrome sarcoidosis
  • IDDM insulin dependent diabetes mellitus
  • autoimmune thyroiditis reactive arthritis
  • ankylosing spondylitis scleroderma
  • polymyositis dermatomyositis
  • psoriasis psoriasis
  • vasculitis Wegener's granulomatosis
  • genes which may be delivered via the rAAV provided herein for treatment of, for example, liver indications include, without limitation, glucose-6-phosphatase, associated with glycogen storage disease or deficiency type 1A (GSD1), phosphoenolpyruvate- carboxykinase (PEPCK), associated with PEPCK deficiency; cyclin-dependent kinase-like 5 (CDKL5), also known as serine/threonine kinase 9 (STK9) associated with seizures and severe neurodevelopmental impairment; galactose- 1 phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase (PAH), associated with phenylketonuria (PKU); gene products associated with Primary Hyperoxaluria Type 1 including Hydroxyacid Oxidase 1 (GO/HAOl) and AGXT, branched chain alpha-ketoacid dehydrogenase, including BCKDH,
  • GSD1
  • dystonin gene related diseases such as Hereditary Sensory and Autonomic Neuropathy Type VI (the DST gene encodes dystonin; dual AAV vectors may be required due to the size of the protein (-7570 aa); SCN9A related diseases, in which loss of function mutants cause inability to feel pain and gain of function mutants cause pain conditions, such as erythromelagia.
  • CMT Charcot-Marie- Tooth
  • NEFL neuroofil ament light chain
  • Other gene products associated with CMT include mitofusin 2 (MFN2).
  • the rAAV described herein may be used in treatment of mucopolysaccaridoses (MPS) disorders.
  • Such rAAV may contain carry a nucleic acid sequence encoding a-L-iduronidase (IDUA) for treating MPS I (Hurler, Hurler-Scheie and Scheie syndromes); a nucleic acid sequence encoding iduronate-2-sulfatase (IDS) for treating MPS II (Hunter syndrome); a nucleic acid sequence encoding sulfamidase (SGSH) for treating MPSIII A, B, C, and D (Sanfilippo syndrome); a nucleic acid sequence encoding N-acetylgalactosamine-6- sulfate sulfatase (GALNS) for treating MPS IV A and B (Morquio syndrome); a nucleic acid sequence encoding arylsulfatase B (ARSB) for treating MPS VI (Maroteaux-IDUA
  • an rAAV vector comprising a nucleic acid encoding a gene product associated with cancer (e.g., tumor suppressors) may be used to treat the cancer, by administering an rAAV harboring the rAAV vector to a subject having the cancer.
  • an rAAV vector comprising a nucleic acid encoding a small interfering nucleic acid (e.g., shRNAs, miRNAs) that inhibits the expression of a gene product associated with cancer (e.g., oncogenes) may be used to treat the cancer, by administering an rAAV harboring the rAAV vector to a subject having the cancer.
  • a small interfering nucleic acid e.g., shRNAs, miRNAs
  • a gene product associated with cancer e.g., oncogenes
  • an rAAV vector comprising a nucleic acid encoding a gene product associated with cancer (or a functional RNA that inhibits the expression of a gene associated with cancer) may be used for research purposes, e.g., to study the cancer or to identify therapeutics that treat the cancer.
  • genes known to be associated with the development of cancer e.g., oncogenes and tumor suppressors: AARS, ABCBl, ABCC4, ABI2, ABLl, ABL2, ACK1, ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB, ANPEP, ANXA5, ANXA7, AP2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS, ATF4, ATM, ATP5B, ATP50, AXL, BARDl, BAX, BCL2, BHLHB2, BLMH, BRAF, BRCA1, BRCA2, BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBFB, CCF2, CCND1, CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59, CDC20, CDC25, CDC25A, CDC25B, CDC25B, CDC
  • SIVA TP53 SKI, SKIL, SLC16A1, SLC1A4, SLC20A1, SMO, sphingomyelin phosphodiesterase 1 (SMPD1), SNAI2, SND1, SNRPB2, SOCS1, SOCS3, SOD1, SORT1, SPINT2, SPRY2, SRC, SRPX, STAT1, STAT2, STAT3, STAT5B, STC1, TAFl, TBL3,
  • WNT5A WT1, XRCC1, YES1, YWHAB, YWHAZ, ZAP70, and ZNF9.
  • An rAAV vector may comprise as a transgene, a nucleic acid encoding a protein or functional RNA that modulates apoptosis.
  • the following is a non-limiting list of genes associated with apoptosis and nucleic acids encoding the products of these genes and their homologues and encoding small interfering nucleic acids (e.g., shRNAs, miRNAs) that inhibit the expression of these genes and their homologues are useful as transgenes in certain embodiments of the invention: RPS27A, ABLl, AKT1, APAFl, BAD, BAG1, BAG3, BAG4, BAK1, BAX, BCL10, BCL2, BCL2A1, BCL2L1, BCL2L10, BCL2L11, BCL2L12, BCL2L13, BCL2L2, BCLAFl, BFAR, BID, BIK, NAIP, BIRC2, BIRC3, XIAP, BIRC5, BIRC6,
  • Useful transgene products also include miRNAs.
  • miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA).
  • miRNAs are natively expressed, typically as final 19-25 non-translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a “mature” single stranded miRNA molecule.
  • This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.
  • miRNA genes are useful as transgenes or as targets for small interfering nucleic acids encoded by transgenes (e.g., miRNA sponges, antisense oligonucleotides, TuD RNAs) in certain embodiments of the methods: hsa-let- 7a, hsa-let-7a*, hsa-let-7b, hsa-let-7b*, hsa-let-7c, hsa-let-7c*, hsa-let-7d, hsa-let-7d*, hsa-let-7e, hsa-let-7e*, hsa-let-7f, hsa-let-7f-l*, hsa-let-7f-2*, hsa-let-7g, hsa-let-7g*, hsa-let-71, hsa-let- 71*, hsa-miR
  • a miRNA inhibits the function of the mRNAs it targets and, as a result, inhibits expression of the polypeptides encoded by the mRNAs.
  • blocking partially or totally
  • the activity of the miRNA e.g., silencing the miRNA
  • derepression of polypeptides encoded by mRNA targets of a miRNA is accomplished by inhibiting the miRNA activity in cells through any one of a variety of methods.
  • blocking the activity of a miRNA can be accomplished by hybridization with a small interfering nucleic acid (e.g., antisense oligonucleotide, miRNA sponge, TuD RNA) that is complementary, or substantially complementary to, the miRNA, thereby blocking interaction of the miRNA with its target mRNA.
  • a small interfering nucleic acid that is substantially complementary to a miRNA is one that is capable of hybridizing with an miRNA and blocking the miRNA's activity.
  • a small interfering nucleic acid that is substantially complementary to a miRNA is a small interfering nucleic acid that is complementary with the miRNA at all but 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 bases.
  • a “miRNA Inhibitor” is an agent that blocks miRNA function, expression and/or processing.
  • these molecules include but are not limited to microRNA specific antisense, microRNA sponges, tough decoy RNAs (TuD RNAs) and microRNA oligonucleotides (double-stranded, hairpin, short oligonucleotides) that inhibit miRNA interaction with a Drosha complex.
  • Still other useful transgenes may include those encoding immunoglobulins which confer passive immunity to a pathogen.
  • An “immunoglobulin molecule” is a protein containing the immunologically-active portions of an immunoglobulin heavy chain and immunoglobulin light chain covalently coupled together and capable of specifically combining with antigen. Immunoglobulin molecules are of any type (e.g IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
  • the terms “antibody” and “immunoglobulin” may be used interchangeably herein.
  • immunoglobulin heavy chain is a polypeptide that contains at least a portion of the antigen binding domain of an immunoglobulin and at least a portion of a variable region of an immunoglobulin heavy chain or at least a portion of a constant region of an immunoglobulin heavy chain.
  • the immunoglobulin derived heavy chain has significant regions of amino acid sequence homology with a member of the immunoglobulin gene superfamily.
  • the heavy chain in a Fab fragment is an immunoglobulin-derived heavy chain.
  • immunoglobulin light chain is a polypeptide that contains at least a portion of the antigen binding domain of an immunoglobulin and at least a portion of the variable region or at least a portion of a constant region of an immunoglobulin light chain.
  • the immunoglobulin- derived light chain has significant regions of amino acid homology with a member of the immunoglobulin gene superfamily.
  • immunoadhesin is a chimeric, antibody-like molecule that combines the functional domain of a binding protein, usually a receptor, ligand, or cell-adhesion molecule, with immunoglobulin constant domains, usually including the hinge and Fc regions.
  • fragment antigen-binding (Fab) fragment is a region on an antibody that binds to antigens. It is composed of one constant and one variable domain of each of the heavy and the light chain.
  • the anti-pathogen construct is selected based on the causative agent (pathogen) for the disease against which protection is sought.
  • pathogen may be of viral, bacterial, or fungal origin, and may be used to prevent infection in humans against human disease, or in non-human mammals or other animals to prevent veterinary disease.
  • the rAAV may include genes encoding antibodies, and particularly neutralizing antibodies against a viral pathogen.
  • anti-viral antibodies may include anti -influenza antibodies directed against one or more of Influenza A, Influenza B, and Influenza C.
  • the type A viruses are the most virulent human pathogens.
  • the serotypes of influenza A which have been associated with pandemics include, H1N1, which caused Spanish Flu in 1918, and Swine Flu in 2009; H2N2, which caused Asian Flu in 1957; H3N2, which caused Hong Kong Flu in 1968; H5N1, which caused Bird Flu in 2004; H7N7; H1N2; H9N2; H7N2; H7N3; and H10N7.
  • target pathogenic viruses include arenaviruses (including funin, machupo, and Lassa), filoviruses (including Marburg and Ebola), hantaviruses, picomoviridae (including rhinoviruses, echovirus), coronaviruses, paramyxovirus, morbillivirus, respiratory synctial virus, togavirus, coxsackievirus, JC virus, parvovirus B19, parainfluenza, adenoviruses, reoviruses, variola (Variola major (Smallpox)) and Vaccinia (Cowpox) from the poxvirus family, and varicella-zoster (pseudorabies).
  • arenaviruses including funin, machupo, and Lassa
  • filoviruses including Marburg and Ebola
  • hantaviruses including rhinoviruses, echovirus
  • coronaviruses paramyxovirus
  • Viral hemorrhagic fevers are caused by members of the arenavirus family (Lassa fever) (which family is also associated with Lymphocytic choriomeningitis (LCM)), filovirus (ebola virus), and hantavirus (puremala).
  • the members of picomavirus (a subfamily of rhinoviruses) are associated with the common cold in humans.
  • the coronavirus family which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinatin encephalomyelitis virus (pig), feline infectious peritonitis virus (cat), feline enteric coronavirus (cat), canine coronavirus (dog).
  • infectious bronchitis virus prine transmissible gastroenteric virus
  • porcine hemagglutinatin encephalomyelitis virus pig
  • feline infectious peritonitis virus cat
  • feline enteric coronavirus cat
  • canine coronavirus dog.
  • the human respiratory coronaviruses have been putatively associated with the common cold, non- A, B or C hepatitis, and sudden acute respiratory syndrome (SARS).
  • the paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus (RSV).
  • the parvovirus family includes feline parvovirus (feline enteritis), feline panleucopeniavirus, canine parvovirus, and porcine parvovirus.
  • the adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease.
  • an rAAV vector as described herein may be engineered to express an anti-ebola antibody, e.g., 2G4, 4G7, 13C6, an anti-influenza antibody, e.g., FI6, CR8033, and anti-RSV antibody, e.g, palivizumab, motavizumab.
  • a neutralizing antibody construct against a bacterial pathogen may also be selected for use in the present invention.
  • the neutralizing antibody construct is directed against the bacteria itself.
  • the neutralizing antibody construct is directed against a toxin produced by the bacteria.
  • airborne bacterial pathogens include, e.g., Neisseria meningitidis (meningitis), Klebsiella pneumonia (pneumonia), Pseudomonas aeruginosa (pneumonia), Pseudomonas pseudomallei (pneumonia), Pseudomonas mallei (pneumonia), Acinetobacter (pneumonia), Moraxella catarrhalis, Moraxella lacunata, Alkaligenes, Cardiobacterium, Haemophilus influenzae (flu), Haemophilus parainfluenzae, Bordetella pertussis (whooping cough), Francisella tularensis (pneumonia/fever), Legionella pneumonia (Legionnaires disease), Chlamydia psittaci (pneumonia), Chlamydia pneumoniae (pneumonia), Mycobacterium tuberculosis (tuberculosis (TB)), Mycobacter
  • the rAAV may include genes encoding antibodies, and particularly neutralizing antibodies against a bacterial pathogen such as the causative agent of anthrax, a toxin produced by Bacillius anthracis.
  • Neutralizing antibodies against protective agent (PA) one of the three peptides which form the toxoid, have been described.
  • the other two polypeptides consist of lethal factor (LF) and edema factor (EF).
  • Anti-PA neutralizing antibodies have been described as being effective in passively immunization against anthrax. See, e.g., US Patent number 7,442,373; R. Sawada-Hirai et al, J Immune Based Ther Vaccines. 2004; 2: 5. (on-line 2004 May 12).
  • Still other anti-anthrax toxin neutralizing antibodies have been described and/or may be generated.
  • neutralizing antibodies against other bacteria and/or bacterial toxins may be used to generate an AAV-delivered anti -pathogen construct as described herein
  • Antibodies against infectious diseases may be caused by parasites or by fungi, including, e.g., Aspergillus species, Absidia corymbifera, Rhixpus stolonifer, Mucor plumbeaus, Cryptococcus neoformans, Histoplasm capsulatum, Blastomyces dermatitidis, Coccidioides immitis, Penicillium species, Micropoly spora faeni, Thermoactinomyces vulgaris, Altemaria alternate, Cladosporium species, Helminthosporium, and Stachybotrys species.
  • Aspergillus species Absidia corymbifera, Rhixpus stolonifer, Mucor plumbeaus, Cryptococcus neoformans, Histoplasm capsulatum, Blastomyces dermatitidis, Coccidioides immitis, Penicillium species, Micropoly spora faeni, Thermoactinomy
  • the rAAV may include genes encoding antibodies, and particularly neutralizing antibodies, against pathogenic factors of diseases such as Alzheimer’s disease (AD), Parkinson’s disease (PD), GBA-associated - Parkinson’s disease (GBA - PD), Rheumatoid arthritis (RA), irritable bowel syndrome (IBS), chronic obstructive pulmonary disease (COPD), cancers, tumors, systemic sclerosis, asthma and other diseases.
  • AD Alzheimer’s disease
  • PD Parkinson’s disease
  • RA Rheumatoid arthritis
  • IBS irritable bowel syndrome
  • COPD chronic obstructive pulmonary disease
  • Such antibodies may be., without limitation, , e.g., alpha-synuclein, anti-vascular endothelial growth factor (VEGF) (anti-VEGF), , anti-VEGFA, anti-PD-1, anti-PDLl, anti-CTLA-4, anti-TNF-alpha, anti-IL-17, anti-IL-23, anti- IL-21, anti-IL-6, anti-IL-6 receptor, anti-IL-5, anti-IL-7, anti -Factor XII, anti-IL-2, anti-HIV, anti-IgE, anti -tumour necrosis factor receptor- 1 (TNFR1), anti -notch 2/3, anti -notch 1, anti- 0X40, anti-erb-b2 receptor tyrosine kinase 3 (ErbB3), anti-ErbB2, anti-beta cell maturation antigen, anti-B lymphocyte stimulator, anti-CD20, anti-HER2, anti-granulocyte macrophage colony- stimulating factor
  • suitable antibodies may include those useful for treating Alzheimer’s Disease, such as, e.g., anti-beta- amyloid (e.g., crenezumab, solanezumab, aducanumab), anti-beta-amyloid fibril, anti-beta- amyloid plaques, anti-tau, a bapineuzamab, among others.
  • anti-beta- amyloid e.g., crenezumab, solanezumab, aducanumab
  • anti-beta-amyloid fibril e.g., crenezumab, solanezumab, aducanumab
  • anti-beta-amyloid fibril e.g., crenezumab, solanezumab, aducanumab
  • anti-beta-amyloid fibril e.g., anti-beta- amyloid plaques, anti-tau, a bapineuzamab, among others.
  • Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperprobferative cells as compared to normal cells.
  • Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF.
  • target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease.
  • Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1 A and folate binding polypeptides.
  • T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis.
  • RA Rheumatoid arthritis
  • MS multiple sclerosis
  • Sjogren's syndrome sarcoidosis
  • IDDM insulin dependent diabetes mellitus
  • autoimmune thyroiditis reactive arthritis
  • ankylosing spondylitis scleroderma
  • polymyositis dermatomyositis
  • psoriasis psoriasis
  • vasculitis Wegener's granulomatosis
  • the vectors may contain AAV sequences of the invention and a transgene encoding a peptide, polypeptide or protein which induces an immune response to a selected immunogen.
  • immunogens may be selected from a variety of viral families.
  • desirable viral families against which an immune response would be desirable include, the picomavirus family, which includes the genera rhinoviruses, which are responsible for about 50% of cases of the common cold; the genera enteroviruses, which include polioviruses, coxsackieviruses, echoviruses, and human enteroviruses such as hepatitis A virus; and the genera apthoviruses, which are responsible for foot and mouth diseases, primarily in non human animals.
  • target antigens include the VP1, VP2, VP3, VP4, and VPG.
  • Another viral family includes the calcivirus family, which encompasses the Norwalk group of viruses, which are an important causative agent of epidemic gastroenteritis.
  • Still another viral family desirable for use in targeting antigens for inducing immune responses in humans and non-human animals is the togavirus family, which includes the genera alphavirus, which include Sindbis viruses, RossRiver virus, and Venezuelan, Eastern & Western Equine encephalitis, and rubivirus, including Rubella virus.
  • the flaviviridae family includes dengue, yellow fever, Japanese encephalitis, St. Louis encephalitis and tick-bome encephalitis viruses.
  • target antigens may be generated from the Hepatitis C or the coronavirus family, which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinating encephalomyelitis virus (pig), feline infectious peritonitis virus (cats), feline enteric coronavirus (cat), canine coronavirus (dog), and human respiratory coronaviruses, which may cause the common cold and/or non- A, B or C hepatitis.
  • infectious bronchitis virus proultry
  • porcine transmissible gastroenteric virus pig
  • porcine hemagglutinating encephalomyelitis virus pig
  • feline infectious peritonitis virus cats
  • feline enteric coronavirus cat
  • canine coronavirus dog
  • human respiratory coronaviruses which may cause the common cold and/or non- A, B or C hepatitis.
  • target antigens include the El (also called M or matrix protein), E2 (also called S or Spike protein), E3 (also called HE or hemagglutin-elterose) glycoprotein (not present in all coronaviruses), or N (nucleocapsid). Still other antigens may be targeted against the rhabdovirus family, which includes the genera vesiculovirus (e.g., Vesicular Stomatitis Virus), and the general lyssavirus (e.g., rabies). Within the rhabdovirus family, suitable antigens may be derived from the G protein or the N protein.
  • the family fdoviridae which includes hemorrhagic fever viruses such as Marburg and Ebola virus may be a suitable source of antigens.
  • the paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus.
  • the influenza virus is classified within the family orthomyxovirus and is a suitable source of antigen (e.g., the HA protein, the N1 protein).
  • the bunyavirus family includes the genera bunyavirus (California encephalitis, La Crosse), phlebovirus (Rift Valley Fever), hantavirus (puremala is a hemahagin fever virus), nairovirus (Nairobi sheep disease) and various unassigned bungaviruses.
  • the arenavirus family provides a source of antigens against LCM and Lassa fever virus.
  • the reovirus family includes the genera reovirus, rotavirus (which causes acute gastroenteritis in children), orbiviruses, and cultivirus (Colorado Tick fever, Lebombo (humans), equine encephalosis, blue tongue).
  • the retrovirus family includes the sub-family oncorivirinal which encompasses such human and veterinary diseases as feline leukemia virus, HTLVI and HTLVII, lentivirinal (which includes human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus, and spumavirinal).
  • lentivirinal which includes human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus, and spumavirinal.
  • HIV and SIV antigens include, without limitation the gag, pol, Vif, Vpx, VPR, Env, Tat and Rev proteins, as well as various fragments thereof.
  • a variety of modifications to these antigens have been described.
  • Suitable antigens for this purpose are known to those of skill in the art. For example, one may select a sequence encoding the gag, pol, Vif, and Vpr, Env, Tat and Rev, amongst other proteins. See, e.g., the modified gag protein which is described in US Patent 5,972,596. See, also, the HIV and SIV proteins described in D.H. Barouch et al, J. Virol., 75(5):2462-2467 (March 2001), and R.R. Amara, et al, Science, 292:69-74 (6 April 2001). These proteins or subunits thereof may be delivered alone, or in combination via separate vectors or from a single vector.
  • the papovavirus family includes the sub-family polyomaviruses (BKU and JCU viruses) and the sub-family papillomavirus (associated with cancers or malignant progression of papilloma).
  • the adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease and/or enteritis.
  • the herpesvirus family includes the sub-family alphaherpesvirinae, which encompasses the genera simplexvirus (HSVI, HSVII), varicellovirus (pseudorabies, varicella zoster) and the sub-family betaherpesvirinae, which includes the genera cytomegalovirus (HCMV, muromegalovirus) and the sub-family gammaherpesvirinae, which includes the genera lymphocryptovirus, EBV (Burkitts lymphoma), infectious rhinotracheitis, Marek's disease virus, and rhadinovirus.
  • HSVI simplexvirus
  • varicellovirus pseudorabies, varicella zoster
  • betaherpesvirinae which includes the genera cytomegalovirus (HCMV, muromegalovirus)
  • the sub-family gammaherpesvirinae which includes the genera lymphocryptovirus, EBV (Burkitts
  • the poxvirus family includes the sub-family chordopoxvirinae, which encompasses the genera orthopoxvirus (Variola (Smallpox) and Vaccinia (Cowpox)), parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus, and the sub-family entomopoxvirinae.
  • the hepadnavirus family includes the Hepatitis B virus.
  • One unclassified virus which may be suitable source of antigens is the Hepatitis delta virus.
  • Still other viral sources may include avian infectious bursal disease virus and porcine respiratory and reproductive syndrome virus.
  • the alphavirus family includes equine arteritis virus and various Encephalitis viruses.
  • the rAAV may also deliver a sequence encoding immunogens which are useful to immunize a human or non-human animal against other pathogens including bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or from a cancer cell or tumor cell.
  • pathogens include bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or from a cancer cell or tumor cell.
  • pathogens include pathogenic gram-positive cocci include pneumococci; staphylococci; and streptococci.
  • Pathogenic gram-negative cocci include meningococcus; gonococcus.
  • Pathogenic enteric gram-negative bacilli include enterobacteriaceae; pseudomonas, acinetobacteria and eikenella; melioidosis; salmonella; shigella; haemophilus; moraxella; H.
  • ducreyi which causes chancroid
  • brucella which causes chancroid
  • Franisella tularensis which causes tularemia
  • yersinia pasteurella
  • streptobacillus moniliformis and spirillum Gram-positive bacilli include listeria monocytogenes; erysipelothrix rhusiopathiae; Corynebacterium diphtheria (diphtheria); cholera; B. anthracis (anthrax); donovanosis (granuloma inguinale); and bartonellosis.
  • Pathogenic anaerobic bacteria Diseases caused by pathogenic anaerobic bacteria include tetanus; botulism; other clostridia; tuberculosis; leprosy; and other mycobacteria.
  • Pathogenic spirochetal diseases include syphilis; treponematoses: yaws, pinta and endemic syphilis; and leptospirosis.
  • infections caused by higher pathogen bacteria and pathogenic fungi include actinomycosis; nocardiosis; cryptococcosis, blastomycosis, histoplasmosis and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichosis; paracoccidiodomycosis, petriellidiosis, torulopsosis, mycetoma and chromomycosis; and dermatophytosis.
  • Rickettsial infections include Typhus fever, Rocky Mountain spotted fever, Q fever, and Rickettsialpox.
  • mycoplasma and chlamydial infections include: mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal chlamydial infections.
  • Pathogenic eukaryotes encompass pathogenic protozoans and helminths and infections produced thereby include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; Pneumocystis carinii Trichans ; Toxoplasma gondii ; babesiosis; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematodes or flukes; and cestode (tapeworm) infections.
  • viral vectors and other constructs described herein are useful to deliver antigens from these organisms, viruses, their toxins or other by-products, which will prevent and/or treat infection or other adverse reactions with these biological agents.
  • TCRs T cell receptors
  • RA rheumatoid arthritis
  • TCRs T cell receptors
  • these TCRs include V-3, V-14, V-17 and Va-17.
  • MS multiple sclerosis
  • TCRs include V-7 and Va-10.
  • TCRs include V-6, V-8, V-14 and Va-16, Va-3C, Va-7, Va-14, Va-15, Va-16, Va-28 and Va-12.
  • delivery of a nucleic acid molecule that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in scleroderma.
  • the transgene is selected to provide optogenetic therapy.
  • optogenetic therapy artificial photoreceptors are constructed by gene delivery of light-activated channels or pumps to surviving cell types in the remaining retinal circuit. This is particularly useful for patients who have lost a significant amount of photoreceptor function, but whose bipolar cell circuitry to ganglion cells and optic nerve remains intact.
  • the heterologous nucleic acid sequence (transgene) is an opsin.
  • the opsin sequence can be derived from any suitable single- or multicellular- organism, including human, algae and bacteria.
  • the opsin is rhodopsin, photopsin, L/M wavelength (red/green) -opsin, or short wavelength (S) opsin (blue). In another embodiment, the opsin is channelrhodopsin or halorhodopsin.
  • the transgene is selected for use in gene augmentation therapy, i.e., to provide replacement copy of a gene that is missing or defective.
  • the transgene may be readily selected by one of skill in the art to provide the necessary replacement gene.
  • the missing/defective gene is related to an ocular disorder.
  • the transgene is NYX, GRM6, TRPM1L or GPR179 and the ocular disorder is Congenital Stationary Night Blindness. See, e.g., Zeitz et al, Am J Hum Genet. 2013 Jan 10;92(l):67-75. Epub 2012 Dec 13 which is incorporated herein by reference.
  • the transgene is RPGR.
  • the gene is Rab escort protein 1 (REP-1) encoded by CHM, associated with choroideremia.
  • the transgene is selected for use in gene suppression therapy, i.e., expression of one or more native genes is interrupted or suppressed at transcriptional or translational levels. This can be accomplished using short hairpin RNA (shRNA) or other techniques well known in the art. See, e.g., Sun et al, Int J Cancer. 2010 Feb l;126(3):764-74 and O'Reilly M, et al. Am J Hum Genet. 2007 Jul;81(l): 127-35, which are incorporated herein by reference.
  • the transgene may be readily selected by one of skill in the art based upon the gene which is desired to be silenced.
  • the transgene comprises more than one transgene. This may be accomplished using a single vector carrying two or more heterologous sequences, or using two or more rAAV each carrying one or more heterologous sequences.
  • the rAAV is used for gene suppression (or knockdown) and gene augmentation co-therapy. In knockdown/augmentation co-therapy, the defective copy of the gene of interest is silenced and a non-mutated copy is supplied. In one embodiment, this is accomplished using two or more co administered vectors. See, Millington-Ward et al, Molecular Therapy, April 2011, 19(4):642-649 which is incorporated herein by reference. The transgenes may be readily selected by one of skill in the art based on the desired result.
  • the transgene is selected for use in gene correction therapy. This may be accomplished using, e.g., a zinc-finger nuclease (ZFN)-induced DNA double-strand break in conjunction with an exogenous DNA donor substrate.
  • ZFN zinc-finger nuclease
  • the transgene encodes a nuclease selected from a meganuclease, a zinc finger nuclease, a transcription activator - like (TAL) effector nuclease (TALEN), and a clustered, regularly interspaced short palindromic repeat (CRISPR)/endonuclease (Cas9, Cpfl, etc).
  • TAL transcription activator - like
  • CRISPR regularly interspaced short palindromic repeat
  • suitable meganucleases are described, e.g., in US Patent 8,445,251; US 9,340,777; US 9,434,931; US 9,683,257, and WO 2018/195449.
  • Other suitable enzymes include nuclease-inactive S.
  • the nuclease is not a zinc finger nuclease.
  • the nuclease is not a CRISPR-associated nuclease. In certain embodiments, the nuclease is not a TALEN. In one embodiment, the nuclease is not a meganuclease. In certain embodiments, the nuclease is a member of the LAGLIDADG (SEQ ID NO: 47) family of homing endonucleases. In certain embodiments, the nuclease is a member of the I-Crel family of homing endonucleases which recognizes and cuts a 22 base pair recognition sequence SEQ ID NO: 48 - C A AA ACGTCGT GAGAC AGTTT G.
  • Suitable gene editing targets include, e.g., liver-expressed genes such as, without limitation, proprotein convertase subtilisin/kexin type 9 (PCSK9) (cholesterol related disorders), transthyretin (TTR) (transthyretin amyloidosis), HAO, apolipoprotein C-III (APOC3), Factor Vni, Factor IX, low density lipoprotein receptor (LDLr), lipoprotein lipase (LPL) (Lipoprotein Lipase Deficiency), lecithin-cholesterol acyltransferase (LCAT), ornithine transcarbamylase (OTC), camosinase (CN1), sphingomyelin phosphodiesterase (SMPDl) (Niemann-Pick disease), hypoxanthine-guanine phosphoribosyltransferase (HGPRT), branched-chain alpha-keto acid dehydrogenase complex (
  • Other gene editing targets may include, e.g., hydroxymethylbilane synthase (LIMBS), carbamoyl synthetase I, ornithine transcarbamylase (OTC), arginosuccinate synthetase, alpha 1 anti -trypsin (A1 AT), aaporginosuccinate lyase (ASL) for treatment of argunosuccinate lyase deficiency, arginase, fumaryl acetate hydrolase, phenylalanine hydroxylase, alpha- 1 antitrypsin, rhesus alpha- fetoprotein (AFP), rhesus chorionic gonadotrophin (CG), glucose-6-phosphatase, porphobilinogen deaminase, cystathione beta-synthase, branched chain ketoacid decarboxylase, albumin, isovaleryl-coA dehydrogenase, propionyl Co
  • Still other useful gene products include enzymes such as may be useful in enzyme replacement therapy, which is useful in a variety of conditions resulting from deficient activity of enzyme.
  • enzymes that contain mannose-6-phosphate may be utilized in therapies for lysosomal storage diseases (e.g., a suitable gene includes that encoding b- glucuronidase (GUSB)).
  • GUSB b- glucuronidase
  • the gene product is ubiquitin protein ligase.
  • glucose-6-phosphatase associated with glycogen storage disease or deficiency type 1A (GSD1), phosphoenolpyruvate-carboxykinase (PEPCK), associated with PEPCK deficiency; cyclin- dependent kinase-like 5 (CDKL5), also known as serine/threonine kinase 9 (STK9) associated with seizures and severe neurodevelopmental impairment; galactose- 1 phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase (PAH), associated with phenylketonuria (PKU); gene products associated with Primary Hyperoxaluria Type 1 including Hydroxy acid Oxidase 1 (GO/HAOl) and AGXT, branched chain alpha-ketoacid dehydrogenase, including BCKDH, BCKDH-E2, BAKDH-Ela, and BAKDH-Elb, associated with Maple syrup urine disease; fumarylacetoacetate hydro
  • the capsids described herein are useful in the CRISPR-Cas dual vector system described in US Published Patent Application 2018/0110877, filed April 26, 2018, each of which is incorporated herein by reference.
  • the capsids are also useful for delivery homing endonucleases or other meganucleases.
  • the transgenes useful herein include reporter sequences, which upon expression produce a detectable signal.
  • reporter sequences include, without limitation, DNA sequences encoding b-lactamase, b -galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), red fluorescent protein (RFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2,
  • CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
  • another non- AAV coding sequence may be included, e.g., a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest.
  • Useful gene products may include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA). miRNAs are natively expressed, typically as final 19-25 non-translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs.
  • miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a “mature” single stranded miRNA molecule.
  • This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.
  • coding sequences when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • immunohistochemistry for example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for beta-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
  • the transgene encodes a product which is useful in biology and medicine, such as proteins, peptides, RNA, enzymes, or catalytic RNAs.
  • Desirable RNA molecules include shRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and antisense RNAs.
  • a useful RNA sequence is a sequence which extinguishes expression of a targeted nucleic acid sequence in a target cell.
  • Regulatory sequences include conventional control elements which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus produced as described herein.
  • Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • efficient RNA processing signals such as splicing and polyadenylation (poly A) signals
  • sequences that stabilize cytoplasmic mRNA sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • a great number of expression control sequences, including promoters, are known in the art and may be utilized.
  • the regulatory sequences useful in the constructs provided herein may also contain an intron, desirably located between the promoter/ enhancer sequence and the gene.
  • One desirable intron sequence is derived from SV-40, and is a 100 bp mini-intron splice donor/splice acceptor referred to as SD-SA.
  • Another suitable sequence includes the woodchuck hepatitis virus post- transcriptional element. (See, e.g., L. Wang and ! Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910).
  • PolyA signals may be derived from many suitable species, including, without limitation SV-40, human and bovine.
  • IRES internal ribosome entry site
  • An IRES sequence may be used to produce more than one polypeptide from a single gene transcript.
  • An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell.
  • An exemplary IRES is the poliovirus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells.
  • the IRES is located 3’ to the transgene in the rAAV vector.
  • the vector genome comprises a promoter (or a functional fragment of a promoter).
  • the selection of the promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired target cell.
  • the target cell is an ocular cell.
  • the promoter may be derived from any species, including human.
  • the promoter is “cell specific”.
  • the term “cell-specific” means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular cell tissue.
  • the promoter is specific for expression of the transgene in muscle cells.
  • the promoter is specific for expression in lung.
  • the promoter is specific for expression of the transgene in liver cells. In another embodiment, the promoter is specific for expression of the transgene in airway epithelium. In another embodiment, the promoter is specific for expression of the transgene in neurons. In another embodiment, the promoter is specific for expression of the transgene in heart.
  • the vector genome typically contains a promoter sequence as part of the expression control sequences, e.g., located between the selected 5’ ITR sequence and a coding sequence.
  • expression in liver is desirable.
  • a liver-specific promoter is used. Examples of liver-specific promoters may include, e.g., thyroid hormone binding globulin (TBG), albumin, Miyatake et al., (1997) J.
  • Tissue specific promoters constitutive promoters, regulatable promoters [see, e.g., WO 2011/126808 and WO 2013/04943], or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein. In another embodiment, expression in muscle is desirable.
  • a muscle-specific promoter is used.
  • the promoter is an MCK based promoter, such as the dMCK (509-bp) or tMCK (720-bp) promoters (see, e.g., Wang et al, Gene Ther. 2008 Nov;15(22):1489-99. doi: 10.1038/gt.2008.104. Epub 2008 Jun 19, which is incorporated herein by reference).
  • Another useful promoter is the SPc5-12 promoter (see Rasowo et al, European Scientific Journal June 2014 edition vol.10, No.18, which is incorporated herein by reference).
  • a promoter specific for the eye or a subpart thereof may be selected.
  • the promoter is a CMV promoter. In another embodiment, the promoter is a TBG promoter. In another embodiment, a CB7 promoter is used. CB7 is a chicken b-actin promoter with cytomegalovirus enhancer elements. Alternatively, other liver-specific promoters may be used [see, e.g., The Liver Specific Gene Promoter Database, Cold Spring Harbor, rulai.schl.edu/LSPD, alpha 1 anti-trypsin (A1AT); human albumin Miyatake et al., J.
  • the promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer/promoter, the SV40 early enhancer/promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter.
  • CMV human cytomegalovirus
  • MBP myelin basic protein
  • GFAP glial fibrillary acidic protein
  • HSV-1 herpes simplex virus
  • LAP rouse
  • the vector genome may contain at least one enhancer, i.e., CMV enhancer.
  • CMV enhancer may include, e.g., an apolipoprotein enhancer, a zebrafish enhancer, a GFAP enhancer element, and brain specific enhancers such as described in WO 2013/1555222, woodchuck post hepatitis post-transcriptional regulatory element.
  • other, e.g., the hybrid human cytomegalovirus (HCMV)-immediate early (IE)-PDGR promoter or other promoter - enhancer elements may be selected.
  • Other enhancer sequences useful herein include the IRBP enhancer (Nicoud 2007, J Gene Med. 2007 Dec;9(12): 1015-23), immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, the cis-acting element identified in the mouse proximal promoter, etc.
  • a vector genome may contain other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • poly A polyadenylation
  • suitable polyA are known.
  • the polyA is rabbit beta globin, such as the 127 bp rabbit beta-globin polyadenylation signal (GenBank # V00882.1).
  • an SV40 polyA signal is selected. Still other suitable polyA sequences may be selected.
  • an intron is included.
  • One suitable intron is a chicken beta-actin intron.
  • the intron is 875 bp (GenBank # X00182.1).
  • a chimeric intron available from Promega is used.
  • other suitable introns may be selected.
  • spacers are included such that the vector genome is approximately the same size as the native AAV vector genome (e.g., between 4.1 and 5.2 kb). In one embodiment, spacers are included such that the vector genome is approximately 4.7 kb. See, Wu et al, Effect of Genome Size on AAV Vector Packaging, Mol Ther. 2010 Jan; 18(1): 80-86, which is incorporated herein by reference.
  • the vector genome further comprises dorsal root ganglion (drg)- specific miRNA detargeting sequences operably linked to the transgene coding sequence.
  • the tandem miRNA target sequences are continuous or are separated by a spacer of 1 to 10 nucleic acids, wherein said spacer is not an miRNA target sequence.
  • the start of the first of the at least two drg- specific miRNA tandem repeats is within 20 nucleotides from the 3’ end of the transgene coding sequence.
  • the start of the first of the at least two drg-specific miRNA tandem repeats is at least 100 nucleotides from the 3’ end of the functional transgene coding sequence.
  • the miRNA tandem repeats comprise 200 to 1200 nucleotides in length.
  • at least two drg-specific miRNA target sequences are located in both 5’ and 3’ to the functional transgene coding sequence.
  • the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is selected from (I) AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 49); (h) AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 50), (in)
  • the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 49). In certain embodiments, the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (miR182, SEQ ID NO: 49). In certain embodiments, two or more consecutive miRNA target sequences are continuous and not separated by a spacer.
  • two or more of the miRNA target sequences are separated by a spacer and each spacer is independently selected from one or more of (A) GGAT; (B) CACGTG; or (C) GCATGC.
  • the spacer located between the miRNA target sequences may be located 3’ to the first miRNA target sequence and/or 5’ to the last miRNA target sequence.
  • the spacers between the miRNA target sequences are the same. See International Patent Application No. WO2020/132455, published June 25, 2020, US Provisional Patent Application No. 63/023,593, filed May 12, 2020, US Provisional Patent Application No. 63/038,488, filed June 12, 2020, US Provisional Patent Application No.
  • a method of generating a recombinant adeno-associated virus is provided.
  • a suitable recombinant adeno-associated virus is generated by culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein as described herein, or fragment thereof; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a heterologous nucleic acid sequence encoding a desirable transgene; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein.
  • AAV recombinant adeno-associated virus
  • the components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans.
  • any one or more of the required components e.g., minigene, rep sequences, cap sequences, and/or helper functions
  • host cells transfected with an AAV as described herein will contain the required component(s) under the control of an inducible promoter.
  • the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion below of regulatory elements suitable for use with the transgene.
  • a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters.
  • a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.
  • the host cell comprises a nucleic acid molecule (e.g., a plasmid) as described herein.
  • the minigene, rep sequences, cap sequences, and helper functions required for producing the rAAV described herein may be delivered to the packaging host cell in the form of any genetic element which transfers the sequences carried thereon.
  • the selected genetic element may be delivered by any suitable method, including those described herein.
  • any embodiment of this invention is known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, 1993 J. Virol., 70:520-532 and US Patent 5,478,745, among others. These publications are incorporated by reference herein.
  • plasmids for use in producing the vectors described herein.
  • Such plasmids include a nucleic acid sequence that encodes at least one of the vpl, vp2, and vp3 of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007
  • AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoG014 (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40),
  • AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a vpl, vp2, and/or vp3 sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
  • plasmids having the vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoG014 (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016
  • AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO:
  • the plasmids include a non- AAV sequence. Cultured host cells containing the plasmids described herein are also provided.
  • the recombinant AAV containing the desired transgene and promoter for use in the target cells as detailed above is optionally assessed for contamination by conventional methods and then formulated into a pharmaceutical composition intended for administration to a subject in need thereof.
  • a pharmaceutically and/or physiologically acceptable vehicle or carrier such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc.
  • the carrier will typically be a liquid.
  • Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free, phosphate buffered saline.
  • the carrier is an isotonic sodium chloride solution.
  • the carrier is balanced salt solution.
  • the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or Tween20.
  • the pharmaceutically acceptable carrier comprises a surfactant, such as perfluorooctane (Perfluoron liquid).
  • the vector is formulated in a buffer/carrier suitable for infusion in human subjects.
  • the buffer/carrier should include a component that prevents the rAAV from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo.
  • the pharmaceutical composition described above is administered to the subject intramuscularly (IM).
  • the pharmaceutical composition is administered by intravenously (IV).
  • the pharmaceutical composition is administered by intracerebroventricular (ICV) injection.
  • the pharmaceutical composition is administered by intra-cistema magna (ICM) injection .
  • Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye), including subretinal or intravitreal delivery, oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.
  • Intrathecal delivery or “intrathecal administration” refer to a route of administration via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF).
  • Intrathecal delivery may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital/intracistemal, and/or Cl -2 puncture.
  • material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture.
  • injection may be into the cistema magna.
  • intracistemal delivery or “intraci sternal administration” refer to a route of administration directly into the cerebrospinal fluid of the cistema magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cistema magna or via permanently positioned tube.
  • the composition may be delivered in a volume of from about 0.1 pL to about 10 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method.
  • the volume is about 50 pL.
  • the volume is about 70 pL.
  • the volume is about 100 pL.
  • the volume is about 125 pL.
  • the volume is about 150 pL. In another embodiment, the volume is about 175 pL. In yet another embodiment, the volume is about 200 pL. In another embodiment, the volume is about 250 pL. In another embodiment, the volume is about 300 pL. In another embodiment, the volume is about 450 pL. In another embodiment, the volume is about 500 pL.
  • the volume is about 600 pL. In another embodiment, the volume is about 750 pL. In another embodiment, the volume is about 850 pL. In another embodiment, the volume is about 1000 pL. In another embodiment, the volume is about 1.5 mL. In another embodiment, the volume is about 2 mL. In another embodiment, the volume is about 2.5 mL. In another embodiment, the volume is about 3 mL. In another embodiment, the volume is about 3.5 mL. In another embodiment, the volume is about 4 mL. In another embodiment, the volume is about 5 mL. In another embodiment, the volume is about 5.5 mL. In another embodiment, the volume is about 6 mL. In another embodiment, the volume is about 6.5 mL.
  • the volume is about 7 mL. In another embodiment, the volume is about 8 mL. In another embodiment, the volume is about 8.5 mL. In another embodiment, the volume is about 9 mL. In another embodiment, the volume is about 9.5 mL. In another embodiment, the volume is about 10 mL.
  • An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the regulatory sequences desirably ranges from about 10 7 and 10 14 vector genomes per milliliter (vg/mL) (also called genome copies/mL (GC/mL)).
  • vg/mL vector genomes per milliliter
  • GC/mL genome copies/mL
  • the rAAV vector genomes are measured by real-time PCR.
  • the rAAV vector genomes are measured by digital PCR. See, Lock et al, Absolute determination of single-stranded and self-complementary adeno- associated viral vector genome titers by droplet digital PCR, Hum Gene Ther Methods. 2014 Apr;25(2):115-25.
  • rAAV infectious units are measured as described in S.K. McLaughlin et al, 1988 J. Virol., 62:1963, which is incorporated herein by reference.
  • the concentration is from about 1.5 x 10 9 vg/mL to about 1.5 x 10 13 vg/mL, and more preferably from about 1.5 x 10 9 vg/mL to about 1.5 x 10 11 vg/mL.
  • the effective concentration is about 1.4 x 10 8 vg/mL.
  • the effective concentration is about 3.5 x 10 10 vg/mL.
  • the effective concentration is about 5.6 x 10 11 vg/mL.
  • the effective concentration is about 5.3 x 10 12 vg/mL.
  • the effective concentration is about 1.5 x 10 12 vg/mL.
  • the effective concentration is about 1.5 x 10 13 vg/mL. All ranges described herein are inclusive of the endpoints.
  • the dosage is from about 1.5 x 10 9 vg/kg of body weight to about 1.5 x 10 13 vg/kg, and more preferably from about 1.5 x 10 9 vg/kg to about 1.5 x 10 11 vg/kg. In one embodiment, the dosage is about 1.4 x 10 8 vg/kg. In one embodiment, the dosage is about 3.5 x 10 10 vg/kg. In another embodiment, the dosage is about 5.6 x 10 11 vg/kg. In another embodiment, the dosage is about 5.3 x 10 12 vg/kg. In yet another embodiment, the dosage is about 1.5 x 10 12 vg/kg. In another embodiment, the dosage is about 1.5 x 10 13 vg/kg. In another embodiment, the dosage is about 3.0 x 10 13 vg/kg. In another embodiment, the dosage is about 1.0 x 10 14 vg/kg.
  • the effective dosage is from about 10 7 to 10 13 vector genomes. In one embodiment, the total dosage is about 10 8 genome copies. In one embodiment, the total dosage is about 10 9 genome copies. In one embodiment, the total dosage is about 10 10 genome copies. In one embodiment, the total dosage is about 10 11 genome copies. In one embodiment, the total dosage is about 10 12 genome copies. In one embodiment, the total dosage is about 10 13 genome copies. In one embodiment, the total dosage is about 10 14 genome copies. In one embodiment, the total dosage is about 10 15 genome copies.
  • the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity.
  • Still other dosages and administration volumes in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular disorder and the degree to which the disorder, if progressive, has developed.
  • Intravenous delivery for example may require doses on the order of 1.5 X 10 13 vg/kg.
  • a method of transducing a target cell or tissue includes administering an rAAV as described herein.
  • Dosages of the viral vector depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and can thus vary among patients.
  • a therapeutically effective human dosage of the viral vector is generally in the range of from about 25 to about 1000 microliters to about 100 mL of solution containing concentrations of from about 1 x 10 9 to 1 x 10 16 vector genome copies.
  • a volume of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL suspension is delivered.
  • a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL suspension is delivered.
  • a dose of about 8.9 x 10 12 to 2.7 x 10 14 GC total is administered in this volume.
  • a dose of about 1.1 xlO 10 GC/g brain mass to about 3.3 x 10 11 GC/g brain mass is administered in this volume.
  • the dosage of an rAAV is about 1 x 10 9 GC to about 1 x 10 15 genome copies (GC) per dose (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 10 12 GC to 2.0 x 10 15 GC for a human patient. In another embodiment, the dose is less than about 1 x 10 14 GC/kg body weight of the subject.
  • the dose administered to a patient is at least about 1.0 x 10 9 GC/kg , about 1.5 x 10 9 GC/kg , about 2.0 x 10 9 GC/g, about 2.5 x 10 9 GC/kg , about 3.0 x 10 9 GC/kg , about 3.5 x 10 9 GC/kg , about 4.0 x 10 9 GC/kg , about 4.5 x 10 9 GC/kg , about 5.0 x 10 9 GC/kg , about 5.5 x 10 9 GC/kg , about 6.0 x
  • the method further comprises administering an immunosuppressive co-therapy to the subject.
  • immunosuppressive co-therapy may be started prior to delivery of an rAAV or a composition as disclosed, e.g., if undesirably high neutralizing antibody levels to the AAV capsid are detected.
  • co-therapy may also be started prior to delivery of the rAAV as a precautionary measure.
  • immunosuppressive co-therapy is started following delivery of the rAAV, e.g., if an undesirable immune response is observed following treatment.
  • Immunosuppressants for such co-therapy include, but are not limited to, a glucocorticoid, steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., a rapamycin or rapalog), and cytostatic agents including an alkylating agent, an anti -metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin.
  • a glucocorticoid e.g., steroids, antimetabolites, T-cell inhibitors
  • a macrolide e.g., a rapamycin or rapalog
  • cytostatic agents including an alkylating agent, an anti -metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin.
  • the immune suppressant may include prednisolone, a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- (CD25-) or CD3-directed antibodies, anti-IL-2 antibodies, ciclosporin, tacrolimus, sirolimus, IFN-b, IFN-g, an opioid, or TNF-a (tumor necrosis factor- alpha) binding agent.
  • prednisolone a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- (CD25-) or CD3-directed antibodies, anti
  • the immunosuppressive therapy may be started 0, 1, 2, 7, or more days prior to the rAAV administration, or 0, 1, 2, 3, 7, or more days post the rAAV administration.
  • Such therapy may involve a single drug (e.g., prednisolone) or co administration of two or more drugs, the (e.g., prednisolone, micophenolate mofetil (MMF) and/or sirolimus (i.e., rapamycin)) on the same day.
  • MMF micophenolate mofetil
  • sirolimus i.e., rapamycin
  • Such therapy may be for about 1 week (7 days), two weeks, three weeks, about 60 days, or longer, as needed.
  • a tacrolimus-free regimen is selected.
  • a co-therapy may involve co-administration of an rAAV as provided herein in combination with a ligand which inhibits binding of human neonatal Fc receptor (FcRn) and immunoglobulin G (IgG).
  • FcRn human neonatal Fc receptor
  • IgG immunoglobulin G
  • the viral vector is delivered systemically.
  • the ligand is a peptide, protein, an RNAi sequence, or a small molecule.
  • the protein is a monoclonal antibody, an immunoadhesin, a camelid antibody, a Fab fragment, an Fv fragment, or an scFv fragment.
  • the recombinant viral vector is a recombinant adeno-associated virus, a recombinant adenovirus, a recombinant herpes simplex virus, or a recombinant lentivirus.
  • the ligand is a monoclonal antibody which specifically inhibits FcRn- IgG binding without interfering with FcRn-albumin binding.
  • the monoclonal antibody is Nipocalimab (M281), rozanolixizumab (UCB7665); IMVT-1401, RVT- 1401, HL161, HBM916, ARGX-113 (efgartigimod), SYNT001, SYNT002, ABY-039, or DX- 2507, derivatives or combinations thereof.
  • the ligand is delivered one to 2 UPN-20-9394.P3 5 10 15 2025 30 seven days prior to administration of the viral vector.
  • the ligand is delivered daily. In certain embodiments, the ligand is dosed or administered on the same day the viral vector is administered. In certain embodiments, the ligand is dosed for one day to four weeks post-vector administration. In certain embodiments, the ligand is dosed via a different route of administration than the vector. In certain embodiments, the ligand is dosed orally. In certain embodiments, the viral vector is dosed intraperitoneally, intravenously, intramuscularly, intranasally, or intrathecally. In certain embodiments, the patient is predetermined to have a neutralizing antibody titer to the vector capsid which greater than 1:5 as determined in an in vitro assay.
  • the patient has not previously received gene therapy prior to the delivery of the viral vector in combination with the inhibitory ligand such that the patient’s pre-existing neutralizing antibodies are a result of wild-type infection.
  • the patient has previously received gene therapy treatment prior to the delivery of the viral vector in combination with the inhibitory immunoglobulin construct.
  • the regimen further comprises coadministering one or more of: (a) a steroid or combination of steroids and/or (b) an IgGcleaving enzyme, (c) an inhibitor of Fc-IgE binding; (d) an inhibitor of Fc-IgM binding;
  • Example 1 Isolation of novel AAV capsids from porcine tissues and production of recombinant AAV vectors
  • porcine tissues for new AAV isolates using a high-fidelity polymerase chain reaction (PCR) protocol.
  • PCR polymerase chain reaction
  • the small intestine samples showed a PCR-positive rate (targeting a small and relatively diverse region flanked by conserved regions for primer binding) much higher than samples of liver, heart, lung, and spleen (FIG. 3) .
  • FIG. 4 We successfully recovered more than twenty new porcine AAV capsid genes (FIG. 4).
  • Recombinant AAV vectors were produced by using an HEK293 triple transfection protocol as previously described, using a trans plasmid encoding AAV2 rep gene functions to transcomplement the AAV2 ITRs and the selected (porcine) AAV capsid gene, a trans plasmid carrying adenovirus helper functions, and a cis plasmid comprising an AAV2 5’ ITR, an CB7.CI.eGFP.WPRE.rBG expression cassette, and AAV2 3’ ITR.
  • AAVpoG015 for its serological profile. Preliminary results showed that AAVpoG015’s neutralizing antibody titer was only one-fold lower than AAV8’s titer when tested with two monkey sera from AAV8 vector-injected animals even though the two capsids are distant (the protein sequence similarity between AAVpoG015 and AAV8 is only 79%) (table below).
  • the AAVpoG015 capsid was used to package a vector genome having an eGFP transgene under the control of a CB7 promoter (AAV.CB7.CI.eGFP.WPRE.rBG) using triple transfected of HEK293 cells as previously described (Fock et al. Hum. Gene Ther. 21, 1259-1271; Fock et al. Hum. Gene Ther. Methods 25, 115-125). Cell culture supernatant was harvested, concentrated, and purified with an iodixanol gradient.
  • the purified vector was delivered to a rhesus macaque intravenously at a dose of 5 x 10 13 genome copies(GC)/kg. Ten days later, the animal was sacrificed and vector GC in various tissues were determined by qPCR and RT-qPCR. Tissue genomic DNA was extracted with
  • FIG. 9 shows relative AST and AFT levels following dosing. In contrast to clear AFT/AST elevation observed three days after IV dosing with a similar dose of other AAV serotypes, the AFT/AST levels were not elevated, indicating that AAVpoG015 likely induces less liver inflammation.
  • a dose of 3 x 10 13 GC was administered to a rhesus macaque via intra-cistema magna (ICM) injected. Fifteen days later, the animal was sacrificed and levels of vector GC were determined by qPCR and RT-qPCR as described above (FIG. 10A - FIG. IOC).
  • ICM intra-cistema magna

Abstract

Novel porcine-derived adeno-associated virus (AAV) capsids and recombinant AAV vectors comprising the same are provided. Also provided are methods for delivery of a transgene using the recombinant AAV vectors described herein.

Description

Porcine-Derived Adeno-Associated Virus Capsids and Uses Thereof
BACKGROUND OF THE INVENTION
Adeno-associated viruses (AAVs) are among the most effective vector candidates for gene therapy due to their low immunogenicity, non-pathogenic nature, and ability to establish long-term expression. Dozens of naturally occurring AAV capsids have been reported; their unique capsid structures enable them to recognize and transduce different cell types and organs. However, despite allowing for efficient gene transfer, the AAV vectors currently used in the clinic can be hindered by preexisting immunity to the virus and restricted tissue tropism.
Thus, what is needed in the art is new and effective AAV vectors for gene therapy.
SUMMARY OF THE INVENTION
In one aspect, provided herein is a recombinant adeno-associated virus (rAAV) having a capsid comprising a capsid protein having a vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoG014 (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30),
AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO:
36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 32, 34, 36, 38, 40, 42, 44, or 46, and having packaged in said capsid a vector genome comprising a non- AAV nucleic acid sequence.
In one aspect, provided herein is an rAAV having a capsid comprising a capsid protein encoded by a vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19),
AAVpoG013 (SEQ ID NO: 21), AAVpoG014 (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO:
25), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at least 70% identity with SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45, and having packaged in said capsid a vector genome comprising a non- AAV nucleic acid sequence. In a further aspect, the sequence encodes the vpl, vp2, and/or vp3 is a sequence of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO:
18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40),
AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6,
8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO:
32, 34, 36, 38, 40, 42, 44, or 46. In yet a further aspect, the rAAV has capsid protein that is encoded by a nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45.
In one aspect, a host cell containing an rAAV described herein is provided. Pharmaceutical compositions comprising an rAAV, and a physiologically acceptable carrier, buffer, adjuvant, and/or diluent are also provided.
In one aspect, a method of delivering a transgene to a cell is provided, where the method comprises the step of contacting the cell with an rAAV described herein, and the rAAV comprises the transgene.
In one aspect, a method of generating an rAAV comprising an AAV capsid is provided, wherein the method comprises culturing a host cell containing: (a) a nucleic acid comprising an AAV vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO:
37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a vpl, vp2, and/or vp3 nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45, (b) a functional rep gene; (c) a minigene comprising AAV inverted terminal repeats (ITRs) and a transgene; and (d) sufficient helper functions to permit packaging of the minigene into the AAV capsid. In a further aspect, the vpl, vp2, and/or vp3 sequence encodes a sequence of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO:
14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36),
AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO:
42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 32, 34, 36, 38, 40, 42, 44, or 46. In certain embodiments, a composition is provided that comprises a stock of the generated according to such a method.
In one aspect, provided herein is a plasmid comprising a vpl, vp2, and/or vp3 nucleotide sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016 (SEQ ID NO: 27),
AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO:
33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at 70% identity with a vpl, vp2, and/or vp3 nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45. In a further aspect, nucleotide sequence encodes the vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22),
AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO:
28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity any of SEQ ID NO: 32, 34, 36, 38, 40, 42, 44, or 46. Also provided is a cultured host cell containing a plasmid described herein.
Other aspects and advantages of the invention will be readily apparent from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1A - FIG. 1G show an show an alignment of nucleotide sequences for AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17),
AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO:
23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), and AAVpoG025 (SEQ ID NO: 45) capsid proteins.
FIG. 2 A - FIG. 2M show an alignment of amino acid sequences for AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30),
AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), and AAVpoG025 (SEQ ID NO: 46) capsid proteins.
FIG. 3 shows the frequencies of AAV isolates obtained from various porcine tissues.
FIG. 4 shows a phylogenetic tree that includes novel porcine isolates described herein. AAV1-9 and AAVpol, po2.1, po4 and po5 were previously isolated and shown as references.
FIG. 5 A and FIG. 5B show levels of Huh7 transduction for viral particles having capsids from novel porcine isolates, relative to AAV9. AAVpol-like isolates: 001-005; AAVpo2.1-like isolates: 006, 009, 012, 013, and 014; AAVpo4-like isolates: 015-017; and AAVpo5-like isolates: 018-025.
FIG. 6 shows production yields for AAVpoG013 and AAVpoG015 vectors, relative to AAV8 and AAV9.
FIG. 7 shows transduction efficiency for vectors with AAVpoG013 and AAVpoG015 capsids following IV delivery to mice.
FIG. 8A and FIG. 8B show vector biodistribution in a non-human primate following delivery of a recombinant AAV vector with an AAVpoG015 capsid. A rhesus macaque received AAVpoG015.CB7.CI.eGFP.WPRE.RBG at a dose of 5 x 1013 GC/kg via intravenous (IV) injection. Ten days later, the animal was sacrificed and vector genome copies (GC) in tissues were determined by qPCR and RT-qPCR. The result show higher vector genome copies in liver, heart and muscle. Fiver F, R, M, C: left, right, middle, and caudate lobes, respectively. For each sample, left column: GC/pg gDNA and right column: GC/pg RNA. gDNA: genomic DNA.
FIG. 9 shows aspartate transferase (AST) and alanine aminotransferase (AFT) levels in a rhesus macaque following delivery of a recombinant AAV vector with an AAVpoG015 capsid.
FIG. 10A - FIG. IOC show vector biodistribution in a non-human primate following delivery of a recombinant AAV vector with an AAVpoG015 capsid. A rhesus macaque received AAVpoG015.CB7.CI.eGFP.WPRE.RBG at a dose of 5 x 1013 GC via intra-cistema magna (ICM) injection. At fifteen days, the animal was sacrificed and vector genome copies (GC) in tissues were determined by qPCR and RT-qPCR. For each sample, left column: GC/pg gDNA and right column: GC/pg RNA. gDNA: genomic DNA.
DETAILED DESCRIPTION OF THE INVENTION
As adeno-associated virus (AAV) mediated gene therapy expands to cover more diseases, the demand is rising for new AAV capsids that can optimize gene delivery. There are three main strategies to obtain new AAV capsids: tapping the natural diversity of AAV, directed evolution, rational design, or a combination thereof. Provided herein are AAV capsids isolated from porcine tissues and rAAV vectors comprising these capsids. The rAAVs are useful for delivery of a gene therapy product, for gene editing, as a vaccine, amongst other suitable uses.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application. The following definitions are provided for clarity only and are not intended to limit the claimed invention.
As used herein, the terms “a” or “an”, refers to one or more, for example, “a plasmid” is understood to represent one or more plasmids. As such, the terms “a” (or “an”), “one or more,” and “at least one” are used interchangeably herein.
As used herein, the term “about” means a variability of 10% from the reference given, unless otherwise specified.
While various embodiments in the specification are presented using “comprising” language, under other circumstances, a related embodiment is also intended to be interpreted and described using “consisting of’ or “consisting essentially of’ language.
With regard to the following description, it is intended that each of the compositions herein described, is useful, in another embodiment, in the methods of the invention. In addition, it is also intended that each of the compositions described as useful in the methods, is, in another embodiment, itself an embodiment of the invention.
A. The AAV Capsid
Nucleic acids encoding AAV capsids include three overlapping coding sequences, which vary in length due to alternative start codon usage. The translated proteins are referred to as VP1, VP2 and VP3, with VP1 being the longest and VP3 being the shortest. The AAV particle consists of all three capsid proteins at a ratio of -1:1:10 (VP1:VP2:VP3). VP3, which is comprised in VPl and VP2 at the N-terminus, is the main structural component that builds the particle. The capsid protein can be referred to using several different numbering systems. For convenience, as used herein, the AAV sequences are referred to using VPl numbering, which starts with aa 1 for the first residue of VPl. However, the capsid proteins described herein include VPl, VP2 and VP3 (used interchangeably herein with vpl, vp2, and vp3).
Provided herein are novel AAV capsid proteins encoded by sequences set forth in the sequence listing. The numbering of the nucleotides and amino acids corresponding to the vpl, vp2, and vp3 are as follows:
Nucleotides (nt)
AAVpoGOOl: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 1; AAVpoG002: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 3; AAVpoG003 : vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 5;
AAVpoG004: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 7;
AAVpoG005: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 9;
AAVpoG006: vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 11;
AAVpoG007: vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 13;
AAVpoG008: vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 15;
AAVpoG009: vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 17;
AAVpoG012: vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 19;
AAVpoG013: vpl- nt 1 to 2184; vp2- nt 409 to 2184; vp3- nt 604 to 2184 of SEQ ID NO: 21; AAVpoGOM: vpl- nt 1 to 2181; vp2- nt 409 to 2181; vp3- nt 604 to 2181 of SEQ ID NO: 23;
AAVpoG015: vpl- nt 1 to 2181; vp2- nt 409 to 2181; vp3- nt 604 to 2181 of SEQ ID NO: 25;
AAVpoG016: vpl- nt 1 to 2181; vp2- nt 409 to 2181; vp3- nt 604 to 2181 of SEQ ID NO: 27;
AAVpoG017: vpl- nt 1 to 2181; vp2- nt 409 to 2181; vp3- nt 604 to 2181 of SEQ ID NO: 29;
AAVpoG018: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 31;
AAVpoG019: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 33;
AAVpoG020: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 35;
AAVpoG021: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 37;
AAVpoG022: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 39;
AAVpoG023 : vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 41;
AAVpoG024: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 43;
AAVpoG025: vpl- nt 1 to 2148; vp2- nt 409 to 2148; vp3- nt 550 to 2148 of SEQ ID NO: 45.
Amino acids (aa)
AAVpoGOOl: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 2;
AAVpoG002: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 4;
AAVpoG003 : aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 6;
AAVpoG004: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 8;
AAVpoG005: aavpl 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 10; AAVpoG006: aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 12; AAVpoG007: aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 14; AAVpoG008: aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 16; AAVpoG009: aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 18; AAVpoG012: aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 20; AAVpoG013: aavpl 1 to 728; vp2 - aa 137 to 728; vp3 - aa 202 to 728 of SEQ ID NO: 22; AAVpoG014: aavpl 1 to 727; vp2 - aa 137 to 727; vp3 - aa 202 to 727 of SEQ ID NO: 24; AAVpoG015: aavpl 1 to 727; vp2 - aa 137 to 727; vp3 - aa 202 to 727 of SEQ ID NO: 26; AAVpoG016: aa vpl - 1 to 727; vp2 - aa 137 to 727; vp3 - aa 202 to 727 of SEQ ID NO: 28; AAVpoG017: aa vpl - 1 to 727; vp2 - aa 137 to 727; vp3 - aa 202 to 727 of SEQ ID NO: 30; AAVpoG018: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 32; AAVpoG019: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 34; AAVpoG020: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 36; AAVpoG021: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 38; AAVpoG022: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 40; AAVpoG023 : aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 42; AAVpoG024: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 44; AAVpoG025: aa vpl - 1 to 716; vp2 - aa 137 to 716; vp3 - aa 184 to 716 of SEQ ID NO: 46.
In certain embodiments, provided herein are rAAV comprising at least one of the vpl, vp2, and vp3 of any of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO:
16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38),
AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO:
44), or AAVpoG025 (SEQ ID NO: 46). In certain embodiments, an rAAV having a capsid protein comprising a vpl, vp2, and/or vp3 sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14),
AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO:
20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42),
AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46) are provided. In certain embodiments, the vpl, vp2, and/or vp3 has up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 amino acid differences relative to the vpl, vp2, and/or vp3 of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40),
AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46).
Also provided herein are rAAV comprising an AAV capsid protein encoded by at least one of the vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31),
AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO:
37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37,
39, 41, 43, or 45. In certain embodiments, the sequence encodes a full-length vpl, vp2 and/or vp3 of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO:
17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39),
AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
A “recombinant AAV” or “rAAV” is a DNAse-resistant viral particle containing two elements, an AAV capsid and a vector genome containing at least a non- AAV coding sequence packaged within the AAV capsid. Unless otherwise specified, this term may be used interchangeably with the phrase “rAAV vector”. The rAAV is a “replication-defective virus” or “viral vector”, as it lacks any functional AAV rep gene or functional AAV cap gene and cannot generate progeny. In certain embodiments, the only AAV sequences are the AAV inverted terminal repeat sequences (ITRs), typically located at the extreme 5’ and 3’ ends of the vector genome in order to allow the gene and regulatory sequences located between the ITRs to be packaged within the AAV capsid.
As used herein, a “vector genome” refers to the nucleic acid sequence packaged inside the rAAV capsid which forms a viral particle. Such a nucleic acid sequence contains AAV inverted terminal repeat sequences (ITRs). In the examples herein, a vector genome contains, at a minimum, from 5’ to 3’, an AAV 5’ ITR, coding sequence(s), and an AAV 3’ ITR. ITRs from AAV2, a different source AAV than the capsid, or other than full-length ITRs may be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV which provides the rep function during production or a transcomplementing AAV. Further, other ITRs may be used. Further, the vector genome contains regulatory sequences winch direct expression of the gene products. Suitable components of a vector genome are discussed in more detail herein. The vector genome is sometimes referred to herein as the “minigene”.
As used herein, an “expression cassette” refers to a nucleic acid molecule comprising a biologically useful nucleic acid sequence (e.g., a gene cDNA encoding a protein, enzyme, or other useful gene product, mRNA, etc.) and regulatory sequences operably linked thereto that direct or modulate transcription, translation, and/or expression of the nucleic acid sequence and its gene product.
As used herein, “operably linked” sequences include both regulatory sequences that are contiguous with the nucleic acid sequence and regulatory sequences that act in trans or at a distance to control the sequence. Such regulatory sequences typically include, e.g., one or more of a promoter, an enhancer, an intron, a Kozak sequence, a polyadenylation sequence, and a TATA signal. The expression cassette may contain regulatory sequences upstream of (5’ to) the gene sequence, e.g., one or more of a promoter, an enhancer, an intron, etc., and one or more of an enhancer, or regulatory sequences downstream of (3’ to) a gene sequence, e.g., 3’ untranslated region comprising a polyadenylation site, among other elements.
An rAAV is composed of an AAV capsid and a vector genome. An AAV capsid is an assembly of a heterogeneous population of vpl, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins. As used herein when used to refer to vp capsid proteins, the term “heterogeneous” or any grammatical variation thereof, refers to a population consisting of elements that are not the same, for example, having vpl, vp2, or vp3 monomers (proteins) with different modified amino acid sequences.
As used herein, the term “heterogeneous population” as used in connection with vpl, vp2 and vp3 proteins (alternatively termed isoforms), refers to differences in the amino acid sequence of the vpl, vp2 and vp3 proteins within a capsid. The AAV capsid contains subpopulations within the vpl proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
As used herein, a “subpopulation” of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified. For example, a “subpopulation” of vpl proteins may be at least one (1) vpl protein and less than all vpl proteins in an assembled AAV capsid, unless otherwise specified. A “subpopulation” of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified. For example, vpl proteins may be a subpopulation of vp proteins; vp2 proteins may be a separate subpopulation of vp proteins, and vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid. In another example, vpl, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine - glycine pairs.
Unless otherwise specified, highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position. Such percentages may be determined using 20- gel, mass spectrometry techniques, or other suitable techniques.
Without wishing to be bound by theory, the deamidation of at least highly deamidated residues in the vp proteins in the AAV capsid is believed to be primarily non-enzymatic in nature, being caused by functional groups within the capsid protein which deamidate selected asparagines, and to a lesser extent, glutamine residues. Efficient capsid assembly of the majority of deamidation vpl proteins indicates that either these events occur following capsid assembly or that deamidation in individual monomers (vpl, vp2 or vp3) is well-tolerated structurally and largely does not affect assembly dynamics. Extensive deamidation in the VP1 -unique (VPl-u) region (~aa 1-137), generally considered to be located internally prior to cellular entry, suggests that VP deamidation may occur prior to capsid assembly.
Without wishing to be bound by theory, the deamidation of N may occur through its C- terminus residue’s backbone nitrogen atom conducts a nucleophilic attack to the Asn side chain amide group carbon atom. An intermediate ring-closed succinimide residue is believed to form. The succinimide residue then conducts fast hydrolysis to lead to the final product aspartic acid (Asp) or iso aspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which may interconvert through the succinimide intermediate e.g., as illustrated below. o
Figure imgf000013_0001
Iso aspartic acid
As provided herein, each deamidated N in the vpl, vp2, or vp3 may independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and/or an interconverting blend of Asp and isoAsp, or combinations thereof. Any suitable ratio of a- and isoaspartic acid may be present. For example, in certain embodiments, the ratio may be from 10:1 to 1:10 aspartic to isoaspartic, about 50:50 aspartic: isoaspartic, or about 1:3 aspartic: isoaspartic, or another selected ratio.
In certain embodiments, one or more glutamine (Q) may deami dates to glutamic acid (Glu), i.e., a-glutamic acid, g-glutamic acid (Glu), or a blend of a- and g-glutamic acid, which may interconvert through a common glutarimide intermediate. Any suitable ratio of a- and g- glutamic acid may be present. For example, in certain embodiments, the ratio may be from 10: 1 to 1 : 10 a to g, about 50:50 a: g, or about 1 : 3 a : g, or another selected ratio.
Figure imgf000014_0001
Thus, an rAAV includes subpopulations within the rAAV capsid of vpl, vp2 and/or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine. In addition, other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In still other embodiments, modifications may include an amidation at an Asp position.
In certain embodiments, an AAV capsid contains subpopulations of vpl, vp2 and vp3 having at least 1, at least 2, at least 3, at least 4, at least 5 to at least about 25 deamidated amino acid residue positions, of which at least 1 to 10%, at least 10 to 25%, at least 25 to 50%, at least 50 to 70%, at least 70 to 100%, at least 75 to 100%, at least 80-100%, or at least 90-100% are deamidated as compared to the encoded amino acid sequence of the vp proteins. The majority of these may be N residues. However, Q residues may also be deamidated.
As used herein, “encoded amino acid sequence” refers to the amino acid which is predicted based on the translation of a known DNA codon of a referenced nucleic acid sequence being translated to an amino acid.
In certain embodiments, an rAAV has an AAV capsid having vpl, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four, five or more deamidated residues at the positions set forth in the tables provided herein and incorporated herein by reference. Deamidation in the rAAV may be determined using 2D gel electrophoresis, and/or mass spectrometry, and/or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific). MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet-sequenced precursor ions from the survey scans (200-2000 m/z). Sequencing is performed via higher energy collisional dissociation fragmentation with a target value of le5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m/z. Survey scans were acquired at a resolution of 120,000 at m/z 200. Resolution for HCD spectra may be set to 30,000 at m/z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The S-lens RF level may be set at 50, to give optimal transmission of the m/z region occupied by the peptides from the digest. Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection. BioPharma Finder 1.0 software (Thermo Fischer Scientific) may be used for analysis of the data acquired. For peptide mapping, searches are performed using a single entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as variable modifications, a 10-ppm mass accuracy, a high protease specificity, and a confidence level of 0.8 for MS/MS spectra. Examples of suitable proteases may include, e.g., trypsin or chymotrypsin. Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule +0.984 Da (the mass difference between -OH and -MB groups). The percent deamidation of a particular peptide is determined by mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species which are deamidated at different sites may co migrate in a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation. In these cases, the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent on the site of deamidation. It will be understood by one of skill in the art that a number of variations on these illustrative methods can be used. For example, suitable mass spectrometers may include, e.g, a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher). Suitably liquid chromatography systems include, e.g., Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series). Suitable data analysis software may include, e.g., MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques may be described, e.g., in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online June 16, 2017.
In addition to deamidations, other modifications may occur do not result in conversion of one amino acid to a different amino acid residue. Such modifications may include acetylated residues, isomerizations, phosphorylations, or oxidations.
Modulation of Deamidation: In certain embodiments, the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation. In other embodiments, the asparagine is altered to a different amino acid, e.g., a glutamine which deami dates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and/or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups). As used herein, amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and/or proline. Modifications such as described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine - glycine pairs. Thus, a method for reducing deamidation of AAV and/or engineered AAV variants having lower deamidation rates. Additionally, or alternatively one or more other amide amino acids may be changed to a non-amide amino acid to reduce deamidation of the AAV. In certain embodiments, a mutant AAV capsid as described herein contains a mutation in an asparagine - glycine pair, such that the glycine is changed to an alanine or a serine. A mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs. In certain embodiments, an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs. In certain embodiments, a mutant AAV capsid contains only a single mutation in an NG pair. In certain embodiments, a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP1 -unique region. In certain embodiments, one of the mutations is in the VPl -unique region. Optionally, a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair.
In certain embodiments, a method of increasing the potency of an rAAV vector is provided which comprises engineering an AAV capsid which eliminating one or more of the NGs in the wild-type AAV capsid. In certain embodiments, the coding sequence for the “G” of the “NG” is engineered to encode another amino acid. In certain examples below, an “S” or an “A” is substituted. However, other suitable amino acid coding sequences may be selected. Amino acid modifications may be made by conventional genetic engineering techniques. For example, a nucleic acid sequence containing modified AAV vp codons may be generated in which one to three of the codons encoding glycine in asparagine - glycine pairs are modified to encode an amino acid other than glycine. In certain embodiments, a nucleic acid sequence containing modified asparagine codons may be engineered at one to three of the asparagine - glycine pairs, such that the modified codon encodes an amino acid other than asparagine. Each modified codon may encode a different amino acid. Alternatively, one or more of the altered codons may encode the same amino acid. In certain embodiments, these modified nucleic acid sequences may be used to generate a mutant rAAV having a capsid with lower deamidation than the native AAV3B variant capsid. Such mutant rAAV may have reduced immunogenicity and/or increase stability on storage, particularly storage in suspension form.
Also provided herein are nucleic acid sequences encoding the AAV capsids having reduced deamidation. It is within the skill in the art to design nucleic acid sequences encoding this AAV capsid, including DNA (genomic or cDNA), or RNA (e.g., mRNA). Such nucleic acid sequences may be codon-optimized for expression in a selected system (i.e., cell type) and can be designed by various methods. This optimization may be performed using methods which are available on-line (e.g., GeneArt), published methods, or a company which provides codon optimizing services, e.g., DNA2.0 (Menlo Park, CA). One codon optimizing method is described, e.g., in International Patent Publication No. WO 2015/012924, which is incorporated by reference herein in its entirety. See also, e.g., US Patent Publication No. 2014/0032186 and US Patent Publication No. 2006/0136184. Suitably, the entire length of the open reading frame (ORF) for the product is modified. However, in some embodiments, only a fragment of the ORF may be altered. By using one of these methods, one can apply the frequencies to any given polypeptide sequence and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide. A number of options are available for performing the actual changes to the codons or for synthesizing the codon-optimized coding regions designed as described herein.
Such modifications or synthesis can be performed using standard and routine molecular biological manipulations well known to those of ordinary skill in the art. In one approach, a series of complementary oligonucleotide pairs of 80-90 nucleotides each in length and spanning the length of the desired sequence are synthesized by standard methods. These oligonucleotide pairs are synthesized such that upon annealing, they form double stranded fragments of 80-90 base pairs, containing cohesive ends, e.g., each oligonucleotide in the pair is synthesized to extend 3,
4, 5, 6, 7, 8, 9, 10, or more bases beyond the region that is complementary to the other oligonucleotide in the pair. The single-stranded ends of each pair of oligonucleotides are designed to anneal with the single-stranded end of another pair of oligonucleotides. The oligonucleotide pairs are allowed to anneal, and approximately five to six of these double-stranded fragments are then allowed to anneal together via the cohesive single stranded ends, and then they ligated together and cloned into a standard bacterial cloning vector, for example, a TOPO® vector available from Invitrogen Corporation, Carlsbad, Calif. The construct is then sequenced by standard methods. Several of these constructs consisting of 5 to 6 fragments of 80 to 90 base pair fragments ligated together, i.e., fragments of about 500 base pairs, are prepared, such that the entire desired sequence is represented in a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and ligated together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector, and sequenced. Additional methods would be immediately apparent to the skilled artisan. In addition, gene synthesis is readily available commercially.
In certain embodiments, AAV capsids are provided which have a heterogeneous population of AAV capsid isoforms (i.e., VP1, VP2, VP3) which contain multiple highly deamidated “NG” positions. In certain embodiments, the highly deamidated positions are in the locations identified below, with reference to the predicted full-length VP1 amino acid sequence. In other embodiments, the capsid gene is modified such that the referenced “NG” is ablated and a mutant “NG” is engineered into another position.
Many of the porcine AAV capsids provided herein were identified in small intestine, which is a source of AAV not commonly found in humans. Thus, rAAV having a porcine capsid (“rAAVpo”) as provided herein may be particularly well suited for targeting cells and tissue in the gut, including, but not limited to the small intestine. Such rAAVpo vectors may be used for gene delivery or gene editing. In certain embodiments, such rAAV vectors may be used to target viral reservoirs (e.g., hepatitis B virus (HBV), hepatitis C virus (HCV), Herpes simplex virus (HSV), Varicella Zoster Virus (VZV) and human immunodeficiency virus (HIV)) or undesirable cell (e.g., bacterial) populations in the gut.
AAVpoGOOl
In certain embodiments, a novel isolated AAVpoGOOl capsid is provided. A nucleic acid sequence encoding the AAVpoGOOl capsid is provided in SEQ ID NO: 1 and the encoded amino acid sequence is provided in SEQ ID NO: 2. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoGOOl (SEQ ID NO: 2). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoGOOl (SEQ ID NO: 1). In certain embodiments, the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoGOOl (SEQ ID NO: 2). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids). In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoGOOl capsid comprising one or more of: (1) AAVpoGOOl capsid proteins comprising: a heterogeneous population of AAVpoGOOl vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 2, vpl proteins produced from SEQ ID NO: 1, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 2, a heterogeneous population of AAVpoGOOl vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 2, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 1, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 1 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 2, a heterogeneous population of AAVpoGOOl vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 2, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 1, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 1 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 1; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 2, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 2, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 2, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoGOOl capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AA VpoG002
In certain embodiments, a novel isolated AAVpoG002 capsid is provided. A nucleic acid sequence encoding the AAVpoG002 capsid is provided in SEQ ID NO: 3 and the encoded amino acid sequence is provided in SEQ ID NO: 4. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG002 (SEQ ID NO: 4). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG002 (SEQ ID NO: 3). In certain embodiments, the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoG002 (SEQ ID NO: 4). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG002 capsid comprising one or more of: (1) AAVpoG002 capsid proteins comprising: a heterogeneous population of AAVpoG002 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 4, vpl proteins produced from SEQ ID NO: 3, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 3 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 4, a heterogeneous population of AAVpoG002 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 4, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 3, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 3 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 4, a heterogeneous population of AAVpoG002 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 4, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 3, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 4 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 4; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 4, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 4, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 4, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 4, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG002 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AA VpoG003
In certain embodiments, a novel isolated AAVpoG003 capsid is provided. A nucleic acid sequence encoding the AAVpoG003 capsid is provided in SEQ ID NO: 5 and the encoded amino acid sequence is provided in SEQ ID NO: 6. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG003 (SEQ ID NO: 6). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG003 (SEQ ID NO: 5). In certain embodiments, the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoG003 (SEQ ID NO: 6). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG003 capsid comprising one or more of: (1) AAVpoG003 capsid proteins comprising: a heterogeneous population of AAVpoG003 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 6, vpl proteins produced from SEQ ID NO: 5, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 6, a heterogeneous population of AAVpoG003 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 6, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 5, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 amino acids 137 to 716 of SEQ ID NO: 6, a heterogeneous population of AAVpoG003 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 6, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 5, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 5 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 5; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 6, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 6, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 6, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 6, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG003 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AA VpoG004
In certain embodiments, a novel isolated AAVpoGOOl capsid is provided. A nucleic acid sequence encoding the AAVpoGOOl capsid is provided in SEQ ID NO: 7 and the encoded amino acid sequence is provided in SEQ ID NO: 8. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoGOOl (SEQ ID NO: 8). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoGOOl (SEQ ID NO: 7). In certain embodiments, the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoGOOl (SEQ ID NO: 8). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoGOOl capsid comprising one or more of: (1) AAVpoGOOl capsid proteins comprising: a heterogeneous population of AAVpoGOOl vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 8, vpl proteins produced from SEQ ID NO: 7, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 7 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 8, a heterogeneous population of AAVpoGOOl vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 8, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 7, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 7 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 8, a heterogeneous population of AAVpoGOOl vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 8, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 7, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 7 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 7; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 8, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 8, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 8, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 8, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoGOOl capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AA VpoG005
In certain embodiments, a novel isolated AAVpoG005 capsid is provided. A nucleic acid sequence encoding the AAVpoG005 capsid is provided in SEQ ID NO: 9 and the encoded amino acid sequence is provided in SEQ ID NO: 10. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG005 (SEQ ID NO: 10). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG005 (SEQ ID NO: 9). In certain embodiments, the vpl, vp2 and/or vp3 is the full-length capsid protein of AAVpoG005 (SEQ ID NO: 10). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG005 capsid comprising one or more of: (1) AAVpoG005 capsid proteins comprising: a heterogeneous population of AAVpoG005 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 10, vpl proteins produced from SEQ ID NO: 9, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 9 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO:
10, a heterogeneous population of AAVpoG005 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 10, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 9, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 9 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 10, a heterogeneous population of AAVpoG005 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 10, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 9, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 9 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 9; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 10, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 10, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 10, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 10, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG005 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AA VpoG006
In certain embodiments, a novel isolated AAVpoG006 capsid is provided. A nucleic acid sequence encoding the AAVpoG006 capsid is provided in SEQ ID NO: 11 and the encoded amino acid sequence is provided in SEQ ID NO: 12. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG006 (SEQ ID NO: 12). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG006 (SEQ ID NO: 11). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG006 (SEQ ID NO: 12). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG006 capsid comprising one or more of: (1) AAVpoG006 capsid proteins comprising: a heterogeneous population of AAVpoG006 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 12, vpl proteins produced from SEQ ID NO: 11, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 12, a heterogeneous population of AAVpoG006 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 12, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2184 of SEQ ID NO: 11, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2184 of SEQ ID NO: 11 which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 12, a heterogeneous population of AAVpoG006 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 12, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2184 of SEQ ID NO: 11, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2184 of SEQ ID NO: 11 which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 11; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 12, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 12, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 728 of SEQ ID NO: 12, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 12, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG006 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AAVpoG007
In certain embodiments, a novel isolated AAVpoG007 capsid is provided. A nucleic acid sequence encoding the AAVpoG007 capsid is provided in SEQ ID NO: 13 and the encoded amino acid sequence is provided in SEQ ID NO: 14. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG007 (SEQ ID NO: 14). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG007 (SEQ ID NO: 13). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG007 (SEQ ID NO: 14). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG007 capsid comprising one or more of: (1) AAVpoG007 capsid proteins comprising: a heterogeneous population of AAVpoG007 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 14, vpl proteins produced from SEQ ID NO: 13, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 13 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 14, a heterogeneous population of AAVpoG007 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 14, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2184 of SEQ ID NO: 13, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2184 of SEQ ID NO: 13 which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 14, a heterogeneous population of AAVpoG007 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 14, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2184 of SEQ ID NO: 13, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2184 of SEQ ID NO: 13 which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 13; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 14, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 14, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 728 of SEQ ID NO: 14, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 14, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG007 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AA VpoG008
In certain embodiments, a novel isolated AAVpoG008 capsid is provided. A nucleic acid sequence encoding the AAVpoG008 capsid is provided in SEQ ID NO: 15 and the encoded amino acid sequence is provided in SEQ ID NO: 16. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG008 (SEQ ID NO: 16). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG008 (SEQ ID NO: 15). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG008 (SEQ ID NO: 16). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG008 capsid comprising one or more of: (1) AAVpoG008 capsid proteins comprising: a heterogeneous population of AAVpoG008 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 16, vpl proteins produced from SEQ ID NO: 15, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 15 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 16, a heterogeneous population of AAVpoG008 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 16, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2184 of SEQ ID NO: 15, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2184 of SEQ ID NO: 15 which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 16, a heterogeneous population of AAVpoG008 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 16, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2184 of SEQ ID NO: 15, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2184 of SEQ ID NO: 15 which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 15; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 16, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 16, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 728 of SEQ ID NO: 16, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 16, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG008 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AA VpoG009
In certain embodiments, a novel isolated AAVpoG009 capsid is provided. A nucleic acid sequence encoding the AAVpoG009 capsid is provided in SEQ ID NO: 17 and the encoded amino acid sequence is provided in SEQ ID NO: 18. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG009 (SEQ ID NO: 18). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG009 (SEQ ID NO: 17). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG009 (SEQ ID NO: 18). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG009 capsid comprising one or more of: (1) AAVpoG009 capsid proteins comprising: a heterogeneous population of AAVpoG009 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 18, vpl proteins produced from SEQ ID NO: 17, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 17 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 18, a heterogeneous population of AAVpoG009 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 18, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2184 of SEQ ID NO: 17, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2184 of SEQ ID NO: 17 which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 18, a heterogeneous population of AAVpoG009 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 18, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2184 of SEQ ID NO: 17, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2184 of SEQ ID NO: 17 which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 17; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 18, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 18, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 728 of SEQ ID NO: 18, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 18, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG009 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AAVpoG012
In certain embodiments, a novel isolated AAVpoG012 capsid is provided. A nucleic acid sequence encoding the AAVpoG012 capsid is provided in SEQ ID NO: 19 and the encoded amino acid sequence is provided in SEQ ID NO: 20. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG012 (SEQ ID NO: 20). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG012 (SEQ ID NO: 19). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG012 (SEQ ID NO: 20). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG012 capsid comprising one or more of: (1) AAVpoG012 capsid proteins comprising: a heterogeneous population of AAVpoG012 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 20, vpl proteins produced from SEQ ID NO: 19, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 20, a heterogeneous population of AAVpoG012 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 20, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2187 of SEQ ID NO: 19, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2187 of SEQ ID NO: 19 which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 20, a heterogeneous population of AAVpoG012 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 20, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2187 of SEQ ID NO: 19, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2187 of SEQ ID NO: 19 which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 19; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 20, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 20, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 728 of SEQ ID NO: 20, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 20, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG012 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the gene product in a host cell.
AAVpoGOB
In certain embodiments, a novel isolated AAVpoG013 capsid is provided. A nucleic acid sequence encoding the AAVpoG013 capsid is provided in SEQ ID NO: 21 and the encoded amino acid sequence is provided in SEQ ID NO: 22. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG013 (SEQ ID NO: 22). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG013 (SEQ ID NO: 21). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG013 (SEQ ID NO: 22). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG013 capsid comprising one or more of: (1) AAVpoG013 capsid proteins comprising: a heterogeneous population of AAVpoG013 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 22, vpl proteins produced from SEQ ID NO: 21, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 21 which encodes the predicted amino acid sequence of 1 to 728 of SEQ ID NO: 22, a heterogeneous population of AAVpoG013 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 22, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2187 of SEQ ID NO: 21, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2187 of SEQ ID NO: 21 which encodes the predicted amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 22, a heterogeneous population of AAVpoG013 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 22, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2187 of SEQ ID NO: 21, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2187 of SEQ ID NO: 21 which encodes the predicted amino acid sequence of at least about amino acids 202 to 728 of SEQ ID NO: 21; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 22, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 728 of SEQ ID NO: 22, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 728 of SEQ ID NO: 22, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 22, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG013 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
In certain embodiments, an rAAV having a poG013 capsid as described herein is well suited for delivering genes to the liver. In certain embodiments, an rAAVpoG013 vector is well suited for gene editing targets in the liver. In other embodiments, an rAAVpoG013 and compositions and regimens utilizing the same may be selected for use in targeting other tissues or cells.
AA VpoGO 14
In certain embodiments, a novel isolated AAVpoG014 capsid is provided. A nucleic acid sequence encoding the AAVpoG014 capsid is provided in SEQ ID NO: 23 and the encoded amino acid sequence is provided in SEQ ID NO: 24. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG014 (SEQ ID NO: 24). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG014 (SEQ ID NO: 23). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG014 (SEQ ID NO: 24). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG014 capsid comprising one or more of: (1) AAVpoG014 capsid proteins comprising: a heterogeneous population of AAVpoG014 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 24, vpl proteins produced from SEQ ID NO: 23, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 23 which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 24, a heterogeneous population of AAVpoG014 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 24, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2184 of SEQ ID NO: 23, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2184 of SEQ ID NO: 23 which encodes the predicted amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 24, a heterogeneous population of AAVpoG014 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 727 of SEQ ID NO: 24, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2184 of SEQ ID NO: 23, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2184 of SEQ ID NO: 23 which encodes the predicted amino acid sequence of at least about amino acids 202 to 727 of SEQ ID NO: 23; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 24, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 24, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 727 of SEQ ID NO: 24, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 24, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG014 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AAVpoG015
In certain embodiments, a novel isolated AAVpoG015 capsid is provided. A nucleic acid sequence encoding the AAVpoG015 capsid is provided in SEQ ID NO: 25 and the encoded amino acid sequence is provided in SEQ ID NO: 26. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG015 (SEQ ID NO: 26). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG015 (SEQ ID NO: 25). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG015 (SEQ ID NO: 26). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG015 capsid comprising one or more of: (1) AAVpoG015 capsid proteins comprising: a heterogeneous population of AAVpoG015 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 26, vpl proteins produced from SEQ ID NO: 25, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 25 which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 26, a heterogeneous population of AAVpoG015 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 26, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2184 of SEQ ID NO: 25, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2184 of SEQ ID NO: 25 which encodes the predicted amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 26, a heterogeneous population of AAVpoG015 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 727 of SEQ ID NO: 26, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2184 of SEQ ID NO: 25, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2184 of SEQ ID NO: 25 which encodes the predicted amino acid sequence of at least about amino acids 202 to 727 of SEQ ID NO: 25; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 26, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 26, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 727 of SEQ ID NO: 26, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 26, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG015 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
In certain embodiments, an rAAV vector having a poG015 capsid as described herein is well suited for delivering a gene to the liver. In certain embodiments, an rAAV vector having a poG015 capsid is well-suited for delivering gene editing nucleases and/or donor constructs to the liver. In other embodiments, an rAAV vector having a poG015 capsid and compositions and regimens utilizing same may be selected for use in targeting other tissues or cells. In certain embodiments, an rAAV vector having a poG015 capsid as described herein is well suited for delivering a gene to the heart. In certain embodiments, an rAAV vector having a poG015 capsid is well-suited for delivering gene editing nucleases and/or donor constructs to the heart.
In certain embodiments, an rAAV vector having a poG015 capsid as described herein is well suited for delivering genes to the muscle. In certain embodiments, an rAAV vector having a poG015 capsid is well-suited for delivering gene editing nucleases and/or donor constructs to muscle.
AAVpoG016
In certain embodiments, a novel isolated AAVpoG016 capsid is provided. A nucleic acid sequence encoding the AAVpoG016 capsid is provided in SEQ ID NO: 27 and the encoded amino acid sequence is provided in SEQ ID NO: 28. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG016 (SEQ ID NO: 28). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG016 (SEQ ID NO: 27). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG016 (SEQ ID NO: 28). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG016 capsid comprising one or more of: (1) AAVpoG016 capsid proteins comprising: a heterogeneous population of AAVpoG016 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 28, vpl proteins produced from SEQ ID NO: 27, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 27 which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 28, a heterogeneous population of AAVpoG016 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 28, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2184 of SEQ ID NO: 27, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2184 of SEQ ID NO: 27 which encodes the predicted amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 28, a heterogeneous population of AAVpoG016 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 727 of SEQ ID NO: 28, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2184 of SEQ ID NO: 27, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2184 of SEQ ID NO: 27 which encodes the predicted amino acid sequence of at least about amino acids 202 to 727 of SEQ ID NO: 27; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 28, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 28, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 727 of SEQ ID NO: 28, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 28, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG016 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AA VpoGOl 7
In certain embodiments, a novel isolated AAVpoG017 capsid is provided. A nucleic acid sequence encoding the AAVpoG017 capsid is provided in SEQ ID NO: 29 and the encoded amino acid sequence is provided in SEQ ID NO: 30. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG017 (SEQ ID NO: 30). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG017 (SEQ ID NO: 29). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG017 (SEQ ID NO: 30). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG017 capsid comprising one or more of: (1) AAVpoG017 capsid proteins comprising: a heterogeneous population of AAVpoG017 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 30, vpl proteins produced from SEQ ID NO: 29, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 29 which encodes the predicted amino acid sequence of 1 to 727 of SEQ ID NO: 30, a heterogeneous population of AAVpoG017 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 30, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2184 of SEQ ID NO: 29, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2184 of SEQ ID NO: 29 which encodes the predicted amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 30, a heterogeneous population of AAVpoG017 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 202 to 727 of SEQ ID NO: 30, vp3 proteins produced from a sequence comprising at least nucleotides 604 to 2184 of SEQ ID NO: 29, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 604 to 2184 of SEQ ID NO: 29 which encodes the predicted amino acid sequence of at least about amino acids 202 to 727 of SEQ ID NO: 29; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 30, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 727 of SEQ ID NO: 30, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 202 to 727 of SEQ ID NO: 30, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 30, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG017 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AAVpoG018
In certain embodiments, a novel isolated AAVpoG018 capsid is provided. A nucleic acid sequence encoding the AAVpoG018 capsid is provided in SEQ ID NO: 31 and the encoded amino acid sequence is provided in SEQ ID NO: 32. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG018 (SEQ ID NO: 32). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG018 (SEQ ID NO: 31). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG018 (SEQ ID NO: 32). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG018 capsid comprising one or more of: (1) AAVpoG018 capsid proteins comprising: a heterogeneous population of AAVpoG018 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 32, vpl proteins produced from SEQ ID NO: 31, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 31 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 32, a heterogeneous population of AAVpoG018 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 32, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 31, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 31 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 32, a heterogeneous population of AAVpoG018 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 32, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 31, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 31 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 31 ; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 32, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 32, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 32, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 32, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG018 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AAVpoG019
In certain embodiments, a novel isolated AAVpoG019 capsid is provided. A nucleic acid sequence encoding the AAVpoG019 capsid is provided in SEQ ID NO: 33 and the encoded amino acid sequence is provided in SEQ ID NO: 34. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG019 (SEQ ID NO: 34). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG019 (SEQ ID NO: 33). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG019 (SEQ ID NO: 34). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG019 capsid comprising one or more of: (1) AAVpoG019 capsid proteins comprising: a heterogeneous population of AAVpoG019 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 34, vpl proteins produced from SEQ ID NO: 33, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 33 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 34, a heterogeneous population of AAVpoG019 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 34, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 33, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 33 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 34, a heterogeneous population of AAVpoG019 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 34, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 33, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 33 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 33; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 34, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 34, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 34, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 34, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG019 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AAVpoG020
In certain embodiments, a novel isolated AAVpoG020 capsid is provided. A nucleic acid sequence encoding the AAVpoG020 capsid is provided in SEQ ID NO: 35 and the encoded amino acid sequence is provided in SEQ ID NO: 36. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG020 (SEQ ID NO: 36). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG020 (SEQ ID NO: 35). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG020 (SEQ ID NO: 36). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG020 capsid comprising one or more of: (1) AAVpoG020 capsid proteins comprising: a heterogeneous population of AAVpoG020 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 36, vpl proteins produced from SEQ ID NO: 35, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 35 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 36, a heterogeneous population of AAVpoG020 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 36, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 35, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 35 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 36, a heterogeneous population of AAVpoG020 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 36, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 35, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 35 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 35; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 36, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 36, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 36, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 36, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG020 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AAVpoG021
In certain embodiments, a novel isolated AAVpoG021 capsid is provided. A nucleic acid sequence encoding the AAVpoG021 capsid is provided in SEQ ID NO: 37 and the encoded amino acid sequence is provided in SEQ ID NO: 38. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG021 (SEQ ID NO: 38). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG021 (SEQ ID NO: 37). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG021 (SEQ ID NO: 38). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG021 capsid comprising one or more of: (1) AAVpoG021 capsid proteins comprising: a heterogeneous population of AAVpoG021 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 38, vpl proteins produced from SEQ ID NO: 37, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 37 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 38, a heterogeneous population of AAVpoG021 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 38, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 37, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 37 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 38, a heterogeneous population of AAVpoG021 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 38, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 37, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 37 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 37; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 38, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 38, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 38, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 38, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG021 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AA VpoG022
In certain embodiments, a novel isolated AAVpoG022 capsid is provided. A nucleic acid sequence encoding the AAVpoG022 capsid is provided in SEQ ID NO: 39 and the encoded amino acid sequence is provided in SEQ ID NO: 40. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG022 (SEQ ID NO: 40). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG022 (SEQ ID NO: 39). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG022 (SEQ ID NO: 40). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG022 capsid comprising one or more of: (1) AAVpoG022 capsid proteins comprising: a heterogeneous population of AAVpoG022 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 40, vpl proteins produced from SEQ ID NO: 39, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 39 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 40, a heterogeneous population of AAVpoG022 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 40, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 39, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 39 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 40, a heterogeneous population of AAVpoG022 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 40, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 39, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 39 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 39; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 40, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 40, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 40, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 40, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG022 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AAVpoG023
In certain embodiments, a novel isolated AAVpoG023 capsid is provided. A nucleic acid sequence encoding the AAVpoG023 capsid is provided in SEQ ID NO: 41 and the encoded amino acid sequence is provided in SEQ ID NO: 42. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG023 (SEQ ID NO: 42). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG023 (SEQ ID NO: 41). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG023 (SEQ ID NO: 42). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG023 capsid comprising one or more of: (1) AAVpoG023 capsid proteins comprising: a heterogeneous population of AAVpoG023 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 42, vpl proteins produced from SEQ ID NO: 41, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 41 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 42, a heterogeneous population of AAVpoG023 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 42, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 41, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 41 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 42, a heterogeneous population of AAVpoG023 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 42, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 41, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 41 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 41; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 42, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 42, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 42, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 42, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG023 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AAVpoG024
In certain embodiments, a novel isolated AAVpoG024 capsid is provided. A nucleic acid sequence encoding the AAVpoG024 capsid is provided in SEQ ID NO: 43 and the encoded amino acid sequence is provided in SEQ ID NO: 44. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG024 (SEQ ID NO: 44). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG024 (SEQ ID NO: 43). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG024 (SEQ ID NO: 44). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG024 capsid comprising one or more of: (1) AAVpoG024 capsid proteins comprising: a heterogeneous population of AAVpoG024 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 44, vpl proteins produced from SEQ ID NO: 43, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 43 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 44, a heterogeneous population of AAVpoG024 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 44, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 43, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 43 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 44, a heterogeneous population of AAVpoG024 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 44, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 43, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 43 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 43; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 44, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 44, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 44, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 44, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG024 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
AA VpoG025
In certain embodiments, a novel isolated AAVpoG025 capsid is provided. A nucleic acid sequence encoding the AAVpoG025 capsid is provided in SEQ ID NO: 45 and the encoded amino acid sequence is provided in SEQ ID NO: 46. Provided herein is an rAAV comprising at least one of the vpl, vp2 and the vp3 of AAVpoG025 (SEQ ID NO: 46). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl, vp2 and the vp3 of AAVpoG025 (SEQ ID NO: 45). In certain embodiments, the vpl, vp2 and/or vp3 is the full- length capsid protein of AAVpoG025 (SEQ ID NO: 46). In other embodiments, the vpl, vp2 and/or vp3 has an N-terminal and/or a C-terminal truncation (e.g., truncation(s) of about 1 to about 10 amino acids).
In another embodiment, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAVpoG025 capsid comprising one or more of: (1) AAVpoG025 capsid proteins comprising: a heterogeneous population of AAVpoG025 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 46, vpl proteins produced from SEQ ID NO: 45, or vpl proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 45 which encodes the predicted amino acid sequence of 1 to 716 of SEQ ID NO: 46, a heterogeneous population of AAVpoG025 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 46, vp2 proteins produced from a sequence comprising at least nucleotides 409 to 2148 of SEQ ID NO: 45, or vp2 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 409 to 2148 of SEQ ID NO: 45 which encodes the predicted amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 46, a heterogeneous population of AAVpoG025 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 46, vp3 proteins produced from a sequence comprising at least nucleotides 550 to 2148 of SEQ ID NO: 45, or vp3 proteins produced from a nucleic acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least nucleotides 550 to 2148 of SEQ ID NO: 45 which encodes the predicted amino acid sequence of at least about amino acids 184 to 716 of SEQ ID NO: 45; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 46, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 137 to 716 of SEQ ID NO: 46, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 184 to 716 of SEQ ID NO: 46, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 46, and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAVpoG025 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a gene product operably linked to sequences which direct expression of the product in a host cell.
B. rAAV Vectors and Compositions
In one aspect, provided herein are nucleic acids having AAV capsid sequences described herein, including fragments thereof, for production of viral vectors useful in delivery of a heterologous gene or other nucleic acid sequences to a target cell. In certain embodiments, the rAAV provided have a capsid as described herein, and have packaged in the capsid a vector genome comprising a non-AAV nucleic acid sequence. In certain embodiments, the vectors useful in compositions and methods described herein contain, at a minimum, a AAV capsid vpl, vp2, and/or vp3, or fragment thereof, encoded by a sequence provided herein. In certain embodiments, useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors in which both AAV rep and cap are provided, the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., all AAVpoGOOl, AAVpoG002, AAVpoG003, AAVpoG004, AAVpoG005, AAVpoG006, AAVpoG007, AAVpoG008, AAVpoG009, AAVpoG012, AAVpoG013, AAVpoGOM, AAVpoG015, AAVpoG016, AAVpoG017, AAVpoG018, AAVpoG019, AAVpoG020, AAVpoG021, AAVpoG022, AAVpoG023, AAVpoG024, or AAVpoG025 origin. Alternatively, vectors may be used in which the rep sequences are from an AAV which differs from the wild type AAV providing the cap sequences, e.g., the same AAV providing the ITRs and rep.
In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as AAV2/8 described in US Patent No. 7,282,199, which is incorporated by reference herein. Optionally, the vectors further contain a minigene comprising a selected transgene which is flanked by AAV 5' ITR and AAV 3' ITR. In another embodiment, the AAV is a self complementary AAV (sc-AAV) (See, US 2012/0141422 which is incorporated herein by reference). Self-complementary vectors package an inverted repeat genome that can fold into dsDNA without the requirement for DNA synthesis or base-pairing between multiple vector genomes. Because scAAV have no need to convert the single-stranded DNA (ssDNA) genome into double-stranded DNA (dsDNA) prior to expression, they are more efficient vectors.
However, the trade-off for this efficiency is the loss of half the coding capacity of the vector, scAAV are useful for small protein-coding genes (up to ~55 kd) and any currently available RNA-based therapy.
Pseudotyped vectors, wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful herein. For example, AAV vectors utilizing a AAVpoGOOl, AAVpoG002, AAVpoG003, AAVpoG004, AAVpoG005, AAVpoG006, AAVpoG007, AAVpoG008, AAVpoG009, AAVpoG012, AAVpoG013, AAVpoGOM, AAVpoG015, AAVpoG016, AAVpoGO 17, AAVpoG018, AAVpoG019, AAVpoG020, AAVpoG021, AAVpoG022, AAVpoG023, AAVpoG024, or AAVpoG025 capsid as described herein, have AAV2 ITRs. See, Mussolini et al. Unless otherwise specified, the AAV ITRs, and other selected AAV components described herein, may be individually selected from among any AAV serotype, including, without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes. In one desirable embodiment, the ITRs of AAV serotype 2 are used. However, ITRs from other suitable serotypes may be selected. These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
The rAAV provided herein comprise a vector genome. The vector genome is composed of, at a minimum, a non-AAV or heterologous nucleic acid sequence (e.g., a transgene), as described below, regulatory sequences, and 5’ and 3’ AAV inverted terminal repeats (ITRs). It is this minigene which is packaged into a capsid protein and delivered to a selected target cell or target tissue.
The transgene is a nucleic acid sequence, heterologous to the vector sequences flanking the transgene, which encodes a polypeptide, protein, or other product, of interest. The nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and/or expression in a target cell. The heterologous nucleic acid sequence (transgene) can be derived from any organism. The AAV may comprise one or more transgenes.
As used herein, the terms “target cell” and “target tissue” can refer to any cell or tissue which is intended to be transduced by the subject AAV vector. The term may refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (ocular cells), or heart. In one embodiment, the target tissue is liver. In another embodiment, the target tissue is the heart. In another embodiment, the target tissue is brain. In another embodiment, the target tissue is muscle. In another embodiment, the target tissue is the retina.
As used herein, the term “mammalian subject” or “subject” includes any mammal in need of the methods of treatment described herein or prophylaxis, including particularly humans. Other mammals in need of such treatment or prophylaxis include dogs, cats, or other domesticated animals, horses, livestock, laboratory animals, including non-human primates, etc. The subject may be male or female.
As used herein, the term “host cell” may refer to the packaging cell line in which the rAAV is produced from the plasmid. In the alternative, the term “host cell” may refer to a target cell in which expression of a transgene is desired.
As used herein, a “stock” of rAAV refers to a population of rAAV. Despite heterogeneity in their capsid proteins due to deamidation, rAAV in a stock are expected to share an identical vector genome. A stock can include rAAV vectors having capsids with, for example, heterogeneous deamidation patterns characteristic of the selected AAV capsid proteins and a selected production system. The stock may be produced from a single production system or pooled from multiple runs of the production system. A variety of production systems, including but not limited to those described herein, may be selected.
Therapeutic transgenes
Useful products encoded by the transgene include a variety of gene products which replace a defective or deficient gene, inactivate or “knock-out”, or “knock-down” or reduce the expression of a gene which is expressing at an undesirably high level, or delivering a gene product which has a desired therapeutic effect. In most embodiments, the therapy will be “somatic gene therapy”, i.e., transfer of genes to a cell of the body which does not produce sperm or eggs. In certain embodiments, the transgenes express proteins have the sequence of native human sequences. However, in other embodiments, synthetic proteins are expressed. Such proteins may be intended for treatment of humans, or in other embodiments, designed for treatment of animals, including companion animals such as canine or feline populations, or for treatment of livestock or other animals which come into contact with human populations.
Examples of suitable gene products may include those associated with familial hypercholesterolemia, muscular dystrophy, cystic fibrosis, and rare or orphan diseases. Examples of such rare disease may include spinal muscular atrophy (SMA), Huntingdon’s Disease, Rett Syndrome (e.g., methyl-CpG-binding protein 2 (MeCP2); UniProtKB - P51608), Amyotrophic Lateral Sclerosis (ALS), Duchenne Type Muscular dystrophy, Friedrichs Ataxia (e.g., frataxin), ATXN2 associated with spinocerebellar ataxia type 2 (SCA2)/ALS; TDP-43 associated with ALS, progranulin (PRGN) (associated with non- Alzheimer’s cerebral degenerations, including, frontotemporal dementia (FTD), progressive non-fluent aphasia (PNFA) and semantic dementia), among others. See, e.g., www.orpha.net/consor/cgi-bin/Disease_Search_List.php; rarediseases.info.nih.gov/diseases. In one embodiment, the transgene is not human low-density lipoprotein receptor (hLDLR). In another embodiment, the transgene is not an engineered human low-density lipoprotein receptor (hLDLR) variant, such as those described in WO 2015/164778.
Examples of suitable genes may include, e.g., hormones and growth and differentiation factors including, without limitation, insulin, glucagon, glucagon-like peptide -1 (GLP1), growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietins, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO) (including, e.g., human, canine or feline epo), connective tissue growth factor (CTGF), neutrophic factors including, e.g., basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin growth factors I and II (IGF-I and IGF-II), any one of the transforming growth factor a superfamily, including TGFa, activins, inhibins, or any of the bone morphogenic proteins (BMP) BMPs 1-15, any one of the heregluin/neuregulin/ARIA/neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT- 4/5, ciliary neurotrophic factor (CNTF), glial cell line derived neurotrophic factor (GDNF), neurturin, agrin, any one of the family of semaphorins/collapsins, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrins, noggin, sonic hedgehog and tyrosine hydroxylase.
Other useful transgene products include proteins that regulate the immune system including, without limitation, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL) IL-1 through IL-36 (including, e.g., human interleukins IL-1, IL-la, IL-Ib, IL-2, IL-3, IL-4, IL-6, IL-8, IL-12, IL-11, IL-12, IL-13, IL-18, IL-31, IL-35), monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factors a and b, interferons a, b, and g, stem cell factor, flk- 2/flt3 ligand. Gene products produced by the immune system are also useful in the invention. These include, without limitations, immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, class I and class II MHC molecules, as well as engineered immunoglobulins and MHC molecules. For example, in certain embodiments, the rAAV antibodies may be designed to delivery canine or feline antibodies, e.g., such as anti-IgE, anti- IL31, anti-IL33, anti-CD20, anti-NGF, anti-GnRH. Useful gene products also include complement regulatory proteins such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2, CD59, and Cl esterase inhibitor (Cl-INH).
Still other useful gene products include any one of the receptors for the hormones, growth factors, cytokines, lymphokines, regulatory proteins and immune system proteins. The invention encompasses receptors for cholesterol regulation and/or lipid modulation, including the low- density lipoprotein (LDL) receptor, high density lipoprotein (HDL) receptor, the very low-density lipoprotein (VLDL) receptor, and scavenger receptors. The invention also encompasses gene products such as members of the steroid hormone receptor superfamily including glucocorticoid receptors and estrogen receptors, Vitamin D receptors and other nuclear receptors. In addition, useful gene products include transcription factors such as jun,fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding proteins, interferon regulation factor (IRF-1), Wilms tumor protein, ETS-binding protein, STAT, GATA-box binding proteins, e.g., GATA-3, and the forkhead family of winged helix proteins.
Other useful gene products include hydroxymethylbilane synthase (HMBS), carbamoyl synthetase I, ornithine transcarbamylase (OTC), arginosuccinate synthetase, arginosuccinate lyase (ASL) for treatment of argunosuccinate lyase deficiency, arginase, fumarylacetate hydrolase, phenylalanine hydroxylase, alpha- 1 antitrypsin, rhesus alpha- fetoprotein (AFP), chorionic gonadotrophin (CG), glucose-6-phosphatase, porphobilinogen deaminase, cystathione beta- synthase, branched chain ketoacid decarboxylase, albumin, isovaleryl-coA dehydrogenase, propionyl CoA carboxylase, methyl malonyl CoA mutase, glutaryl CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, a cystic fibrosis transmembrane regulator (CFTR) sequence, and a dystrophin gene product [e.g., a mini- or micro-dystrophin]. Still other useful gene products include enzymes such as may be useful in enzyme replacement therapy, which is useful in a variety of conditions resulting from deficient activity of enzyme. For example, enzymes that contain mannose-6-phosphate may be utilized in therapies for lysosomal storage diseases ( e.g ., a suitable gene includes that encoding b-glucuronidase (GUSB)). In another example, the gene product is ubiquitin protein ligase E3A (UBE3A). Still useful gene products include UDP Glucuronosyltransferase Family 1 Member A1 (UGT1A1).
In certain embodiments, the rAAV may be used in gene editing systems, which system may involve one rAAV or co-administration of multiple rAAV stocks. For example, the rAAV may be engineered to deliver SpCas9, SaCas9, ARCUS, Cpfl (also known as Casl2a), CjCas9, and other suitable gene editing constructs.
Still other useful gene products include those used for treatment of hemophilia, including hemophilia B (including Factor IX) and hemophilia A (including Factor VIII and its variants, such as the light chain and heavy chain of the heterodimer and the B-deleted domain; US Patent No. 6,200,560 and US Patent No. 6,221,349). In some embodiments, the minigene comprises first 57 base pairs of the Factor VIII heavy chain which encodes the 10 amino acid signal sequence, as well as the human growth hormone (hGH) polyadenylation sequence. In alternative embodiments, the minigene further comprises the A1 and A2 domains, as well as 5 amino acids from the N-terminus of the B domain, and/or 85 amino acids of the C-terminus of the B domain, as well as the A3, Cl and C2 domains. In yet other embodiments, the nucleic acids encoding Factor VIII heavy chain and light chain are provided in a single minigene separated by 42 nucleic acids coding for 14 amino acids of the B domain [US Patent No. 6,200,560]
Other useful gene products include non-naturally occurring polypeptides, such as chimeric or hybrid polypeptides having a non-naturally occurring amino acid sequence containing insertions, deletions, or amino acid substitutions. For example, single-chain engineered immunoglobulins could be useful in certain immunocompromised patients. Other types of non- naturally occurring gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which could be used to reduce overexpression of a target.
Reduction and/or modulation of expression of a gene is particularly desirable for treatment of hyperproliferative conditions characterized by hyperproliferating cells, as are cancers and psoriasis. Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperproliferative cells as compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF. In addition to oncogene products as target antigens, target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease. Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1 A and folate binding polypeptides.
Other suitable therapeutic polypeptides and proteins include those which may be useful for treating individuals suffering from autoimmune diseases and disorders by conferring a broad based protective immune response against targets that are associated with autoimmunity including cell receptors and cells which produce “self ’-directed antibodies. T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis. Each of these diseases is characterized by T cell receptors (TCRs) that bind to endogenous antigens and initiate the inflammatory cascade associated with autoimmune diseases.
Further illustrative genes which may be delivered via the rAAV provided herein for treatment of, for example, liver indications include, without limitation, glucose-6-phosphatase, associated with glycogen storage disease or deficiency type 1A (GSD1), phosphoenolpyruvate- carboxykinase (PEPCK), associated with PEPCK deficiency; cyclin-dependent kinase-like 5 (CDKL5), also known as serine/threonine kinase 9 (STK9) associated with seizures and severe neurodevelopmental impairment; galactose- 1 phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase (PAH), associated with phenylketonuria (PKU); gene products associated with Primary Hyperoxaluria Type 1 including Hydroxyacid Oxidase 1 (GO/HAOl) and AGXT, branched chain alpha-ketoacid dehydrogenase, including BCKDH, BCKDH-E2, BAKDH-Ela, and BAKDH-Elb, associated with Maple syrup urine disease; fumarylacetoacetate hydrolase, associated with tyrosinemia type 1; methylmalonyl-CoA mutase, associated with methylmalonic acidemia; medium chain acyl CoA dehydrogenase, associated with medium chain acetyl CoA deficiency; ornithine transcarbamylase (OTC), associated with ornithine transcarbamylase deficiency; argininosuccinic acid synthetase (ASS1), associated with citrullinemia; lecithin-cholesterol acyltransferase (LCAT) deficiency; amethylmalonic acidemia (MMA); NPC1 associated with Niemann-Pick disease, type Cl); propionic academia (PA); TTR associated with Transthyretin (TTR)-related Hereditary Amyloidosis; low density lipoprotein receptor (LDLR) protein, associated with familial hypercholesterolemia (FH), LDLR variant, such as those described in WO 2015/164778; PCSK9; ApoE and ApoC proteins, associated with dementia; UDP-glucouronosyltransferase, associated with Crigler-Najjar disease; adenosine deaminase, associated with severe combined immunodeficiency disease; hypoxanthine guanine phosphoribosyl transferase, associated with Gout and Lesch-Nyan syndrome; biotimidase, associated with biotimidase deficiency; alpha-galactosidase A (a-Gal A) associated with Fabry disease); beta-galactosidase (GLB1) associated with GM1 gangliosidosis; ATP7B associated with Wilson’s Disease; beta-glucocerebrosidase, associated with Gaucher disease type 2 and 3; peroxisome membrane protein 70 kDa, associated with Zellweger syndrome; arylsulfatase A (ARSA) associated with metachromatic leukodystrophy, galactocerebrosidase (GALC) enzyme associated with Krabbe disease, alpha-glucosidase (GAA) associated with Pompe disease; sphingomyelinase (SMPD1) gene associated with Nieman Pick disease type A; argininosuccsinate synthase associated with adult onset type II citrullinemia (CTLN2); carbamoyl-phosphate synthase 1 (CPS1) associated with urea cycle disorders; survival motor neuron (SMN) protein, associated with spinal muscular atrophy; ceramidase associated with Farber lipogranulomatosis; b-hexosaminidase associated with GM2 gangliosidosis and Tay-Sachs and Sandhoff diseases; aspartylglucosaminidase associated with aspartyl-glucosaminuria; a- fucosidase associated with fucosidosis; a-mannosidase associated with alpha-mannosidosis; porphobilinogen deaminase, associated with acute intermittent porphyria (AIP); alpha- 1 antitrypsin for treatment of alpha- 1 antitrypsin deficiency (emphysema); erythropoietin for treatment of anemia due to thalassemia or to renal failure; vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for the treatment of ischemic diseases; thrombomodulin and tissue factor pathway inhibitor for the treatment of occluded blood vessels as seen in, for example, atherosclerosis, thrombosis, or embolisms; aromatic amino acid decarboxylase (AADC), and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease; the beta adrenergic receptor, anti-sense to, or a mutant form of, phospholamban, the sarco(endo)plasmic reticulum adenosine triphosphatase-2 (SERCA2), and the cardiac adenylyl cyclase for the treatment of congestive heart failure; a tumor suppressor gene such as p53 for the treatment of various cancers; a cytokine such as one of the various interleukins for the treatment of inflammatory and immune disorders and cancers; dystrophin or minidystrophin and utrophin or miniutrophin for the treatment of muscular dystrophies; and, insulin or GLP-1 for the treatment of diabetes.
Additional genes and diseases of interest include, e.g., dystonin gene related diseases such as Hereditary Sensory and Autonomic Neuropathy Type VI (the DST gene encodes dystonin; dual AAV vectors may be required due to the size of the protein (-7570 aa); SCN9A related diseases, in which loss of function mutants cause inability to feel pain and gain of function mutants cause pain conditions, such as erythromelagia. Another condition is Charcot-Marie- Tooth (CMT) type IF and 2E due to mutations in the NEFL gene (neurofil ament light chain) characterized by a progressive peripheral motor and sensory neuropathy with variable clinical and electrophysiologic expression. Other gene products associated with CMT include mitofusin 2 (MFN2). In certain embodiments, the rAAV described herein may be used in treatment of mucopolysaccaridoses (MPS) disorders. Such rAAV may contain carry a nucleic acid sequence encoding a-L-iduronidase (IDUA) for treating MPS I (Hurler, Hurler-Scheie and Scheie syndromes); a nucleic acid sequence encoding iduronate-2-sulfatase (IDS) for treating MPS II (Hunter syndrome); a nucleic acid sequence encoding sulfamidase (SGSH) for treating MPSIII A, B, C, and D (Sanfilippo syndrome); a nucleic acid sequence encoding N-acetylgalactosamine-6- sulfate sulfatase (GALNS) for treating MPS IV A and B (Morquio syndrome); a nucleic acid sequence encoding arylsulfatase B (ARSB) for treating MPS VI (Maroteaux-Lamy syndrome); a nucleic acid sequence encoding hyaluronidase for treating MPSI IX (hyaluronidase deficiency) and a nucleic acid sequence encoding beta-glucuronidase for treating MPS VII (Sly syndrome).
In some embodiments, an rAAV vector comprising a nucleic acid encoding a gene product associated with cancer (e.g., tumor suppressors) may be used to treat the cancer, by administering an rAAV harboring the rAAV vector to a subject having the cancer. In some embodiments, an rAAV vector comprising a nucleic acid encoding a small interfering nucleic acid (e.g., shRNAs, miRNAs) that inhibits the expression of a gene product associated with cancer (e.g., oncogenes) may be used to treat the cancer, by administering an rAAV harboring the rAAV vector to a subject having the cancer. In some embodiments, an rAAV vector comprising a nucleic acid encoding a gene product associated with cancer (or a functional RNA that inhibits the expression of a gene associated with cancer) may be used for research purposes, e.g., to study the cancer or to identify therapeutics that treat the cancer. The following is a non-limiting list of exemplary genes known to be associated with the development of cancer (e.g., oncogenes and tumor suppressors): AARS, ABCBl, ABCC4, ABI2, ABLl, ABL2, ACK1, ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB, ANPEP, ANXA5, ANXA7, AP2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS, ATF4, ATM, ATP5B, ATP50, AXL, BARDl, BAX, BCL2, BHLHB2, BLMH, BRAF, BRCA1, BRCA2, BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBFB, CCF2, CCND1, CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59, CDC20, CDC25, CDC25A, CDC25B, CDC2F5, CDK10, CDK4, CDK5, CDK9, CDKF1, CDKN1A, CDKN1B, CDKN1C, CDKN2A, CDKN2B, CDKN2D, CEBPG, CENPC1, CGRRF1, CHAF1A, CIBl, CKMT1, CFK1, CFK2, CFK3, CFNS1A, CFTC, COF1A1, COF6A3,
COX6C, COX7A2, CRAT, CRHRl, CSF1R, CSK, CSNK1G2, CTNNA1, CTNNB1, CTPS, CTSC, CTSD, CUF1, CYR61, DCC, DCN, DDX10, DEK, DHCR7, DHRS2, DHX8, DFG3, DVFl, DVF3, E2F1, E2F3, E2F5, EGFR, EGR1, EIF5, EPHA2, ERBB2, ERBB3, ERBB4, ERCC3, ETV1, ETV3, ETV6, F2R, FASTK, FBN1, FBN2, FES, FGFR1, FGR, FKBP8, FN1, FOS, FOSF1, FOSF2, FOXG1A, FOXOIA, FRAPl, FRZB, FTF, FZD2, FZD5, FZD9, G22P1, GAS6, GCN5F2, GDF15, GNA13, GNAS, GNB2, GNB2F1, GPR39, GRB2, GSK3A, GSPT1, GTF2I, HDAC1, HDGF, HMMR, HPRT1, HRB, HSPA4, HSPA5, HSPA8, HSPB1, HSPH1, HYALl, HYOU1, ICAM1, ID1, ID2, IDUA, IER3, IFITM1, IGFIR, IGF2R, IGFBP3, IGFBP4, IGFBP5, IL1B, ILK, ING1, IRF3, ITGA3, ITGA6, ITGB4, JAK1, JARID1A, JUN, JUNB, JUND, K-ALPHA-1, KIT, KITLG, KLKIO, KPNA2, KRAS2, KRT18, KRT2A, KRT9,
LAMB1, LAMP2, LCK, LCN2, LEP, LITAF, LRPAP1, LTF, LYN, LZTR1, MADH1,
MAP2K2, MAP3K8, MAPK12, MAPK13, MAPKAPK3, MAPREl, MARS, MAS1, MCC, MCM2, MCM4, MDM2, MDM4, MET, MGST1, MICB, MLLT3, MME, MMP1, MMP14, MMP17, MMP2, MNDA, MSH2, MSH6, MT3, MYB, MYBL1, MYBL2, MYC, MYCL1, MYCN, MYD88, MYL9, MYLK, NEOl, NF1, NF2, NFKBl, NFKB2, NFSF7, NID, NINE, NMBR, NMEl, NME2, NME3, NOTCH1, NOTCH2, NOTCH4, NPM1, NQOl, NR1D1, NR2F1, NR2F6, NRAS, NRG1, NSEP1, OSM, PA2G4, PABPC1, PCNA, PCTK1, PCTK2, PCTK3, PDGFA, PDGFB, PDGFRA, PDPK1, PEA15, PFDN4, PFDN5, PGAM1, PHB, PIK3CA, PIK3CB, PIK3CG, PIM1, PKM2, PKMYTl, PLK2, PPARD, PPARG, PPIH, PPP1CA, PPP2R5A, PRDX2, PRDX4, PRKARIA, PRKCBP1, PRNP, PRSS15, PSMA1, PTCH, PTEN, PTGS1, PTMA, PTN, PTPRN, RAB5A, RAC1, RAD50, RAF1, RALBP1, RAP1A, RARA, RARB, RASGRFl, RBI, RBBP4, RBL2, REA, REL, RELA, RELB, RET, RFC2, RGS19, RHOA, RHOB, RHOC, RHOD, RIPK1, RPN2, RPS6 KBl, RRMl, SARS, SELENBP1, SEMA3C, SEMA4D, SEPP1, SERPINH1, SFN, SFPQ, SFRS7, SHB, SHH, SIAH2, SIVA,
SIVA TP53, SKI, SKIL, SLC16A1, SLC1A4, SLC20A1, SMO, sphingomyelin phosphodiesterase 1 (SMPD1), SNAI2, SND1, SNRPB2, SOCS1, SOCS3, SOD1, SORT1, SPINT2, SPRY2, SRC, SRPX, STAT1, STAT2, STAT3, STAT5B, STC1, TAFl, TBL3,
TBRG4, TCF1, TCF7L2, TFAP2C, TFDP1, TFDP2, TGFA, TGFBl, TGFBI, TGFBR2, TGFBR3, THBS1, TIE, TIMP1, TIMP3, TJP1, TK1, TLE1, TNF, TNFRSF10A, TNFRSF10B, TNFRSF1A, TNFRSF1B, TNFRSF6, TNFSF7, TNK1, TOB1, TP53, TP53BP2, TP5313, TP73, TPBG, TPT1, TRADD, TRAM1, TRRAP, TSG101, TUFM, TXNRD1, TYR03, UBC, UBE2L6, UCHL1, USP7, VDAC1, VEGF, VHL, VIL2, WEE1, WNT1, WNT2, WNT2B, WNT3,
WNT5A, WT1, XRCC1, YES1, YWHAB, YWHAZ, ZAP70, and ZNF9.
An rAAV vector may comprise as a transgene, a nucleic acid encoding a protein or functional RNA that modulates apoptosis. The following is a non-limiting list of genes associated with apoptosis and nucleic acids encoding the products of these genes and their homologues and encoding small interfering nucleic acids (e.g., shRNAs, miRNAs) that inhibit the expression of these genes and their homologues are useful as transgenes in certain embodiments of the invention: RPS27A, ABLl, AKT1, APAFl, BAD, BAG1, BAG3, BAG4, BAK1, BAX, BCL10, BCL2, BCL2A1, BCL2L1, BCL2L10, BCL2L11, BCL2L12, BCL2L13, BCL2L2, BCLAFl, BFAR, BID, BIK, NAIP, BIRC2, BIRC3, XIAP, BIRC5, BIRC6, BIRC7, BIRC8, BNIP1, BNIP2, BNIP3, BNIP3L, BOK, BRAF, CARD10, CARD11, NLRC4, CARD 14, NOD2, NODI, CARD6, CARDS, CARDS, CASP1, CASP10, CASP14, CASP2, CASP3, CASP4, CASP5, CASP6, CASP7, CASP8, CASP9, CFLAR, CIDEA, CIDEB, CRADD, DAPK1, DAPK2, DFFA, DFFB, FADD, GADD45A, GDNF, HRK, IGF1R, LTA, LTBR, MCL1, NOL3, PYCARD, RIPK1, RIPK2, TNF, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, TNFRSF11B, TNFRSF12A, TNFRSF14, TNFRSF19, TNFRSF1A, TNFRSF1B, TNFRSF21, TNFRSF25, CD40, FAS, TNFRSF6B, CD27, TNFRSF9, TNFSF10, TNFSF14, TNFSF18, CD40LG,
FASLG, CD70, TNFSF8, TNFSF9, TP53, TP53BP2, TP73, TP63, TRADD, TRAFl, TRAF2, TRAF3, TRAF4, and TRAF5.
Useful transgene products also include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA). miRNAs are natively expressed, typically as final 19-25 non-translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a “mature” single stranded miRNA molecule. This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.
The following non-limiting list of miRNA genes, and their homologues, are useful as transgenes or as targets for small interfering nucleic acids encoded by transgenes (e.g., miRNA sponges, antisense oligonucleotides, TuD RNAs) in certain embodiments of the methods: hsa-let- 7a, hsa-let-7a*, hsa-let-7b, hsa-let-7b*, hsa-let-7c, hsa-let-7c*, hsa-let-7d, hsa-let-7d*, hsa-let-7e, hsa-let-7e*, hsa-let-7f, hsa-let-7f-l*, hsa-let-7f-2*, hsa-let-7g, hsa-let-7g*, hsa-let-71, hsa-let- 71*, hsa-miR-1, hsa-miR-100, hsa-miR-100*, hsa-miR-101, hsa-miR-101*, hsa-miR-103, hsa- miR-105, hsa-miR-105*, hsa-miR-106a, hsa-miR-106a*, hsa-miR-106b, hsa-miR-106b*, hsa- miR-107, hsa-miR-lOa, hsa-miR-10a*, hsa-miR-lOb, hsa-miR-10b*, hsa-miR-1178, hsa-miR- 1179, hsa-miR-1180, hsa-miR-1181, hsa-miR-1182, hsa-miR-1183, hsa-miR-1184, hsa-miR- 1185, hsa-miR-1197, hsa-miR-1200, hsa-miR-1201, hsa-miR-1202, hsa-miR-1203, hsa-miR- 1204, hsa-miR-1205, hsa-miR-1206, hsa-miR-1207-3p, hsa-miR-1207-5p, hsa-miR-1208, hsa- miR-122, hsa-miR-122*, hsa-miR-1224-3p, hsa-miR-1224-5p, hsa-miR-1225-3p, hsa-miR-1225- 5p, hsa-miR-1226, hsa-miR-1226*, hsa-miR-1227, hsa-miR-1228, hsa-miR-1228*, hsa-miR- 1229, hsa-miR-1231, hsa-miR-1233, hsa-miR-1234, hsa-miR-1236, hsa-miR-1237, hsa-miR- 1238, hsa-miR-124, hsa-miR-124*, hsa-miR-1243, hsa-miR-1244, hsa-miR-1245, hsa-miR-1246, hsa-miR-1247, hsa-miR-1248, hsa-miR-1249, hsa-miR-1250, hsa-miR-1251, hsa-miR-1252, hsa- miR-1253, hsa-miR-1254, hsa-miR-1255a, hsa-miR-1255b, hsa-miR-1256, hsa-miR-1257, hsa- miR-1258, hsa-miR-1259, hsa-miR-125a-3p, hsa-miR-125a-5p, hsa-miR-125b, hsa-miR-125b- 1*, hsa-miR-125b-2*, hsa-miR-126, hsa-miR-126*, hsa-miR-1260, hsa-miR-1261, hsa-miR- 1262, hsa-miR-1263, hsa-miR-1264, hsa-miR-1265, hsa-miR-1266, hsa-miR-1267, hsa-miR- 1268, hsa-miR-1269, hsa-miR-1270, hsa-miR-1271, hsa-miR-1272, hsa-miR-1273, hsa-miR-127- 3p, hsa-miR- 1274a, hsa-miR- 1274b, hsa-miR-1275, hsa-miR-127-5p, hsa-miR-1276, hsa-miR- 1277, hsa-miR- 1278, hsa-miR- 1279, hsa-miR- 128, hsa-miR- 1280, hsa-miR- 1281, hsa-miR- 1282, hsa-miR-1283, hsa-miR-1284, hsa-miR-1285, hsa-miR-1286, hsa-miR-1287, hsa-miR-1288, hsa- miR-1289, hsa-miR-129*, hsa-miR-1290, hsa-miR-1291, hsa-miR-1292, hsa-miR-1293, hsa- miR-129-3p, hsa-miR-1294, hsa-miR-1295, hsa-miR- 129-5p, hsa-miR-1296, hsa-miR-1297, hsa- miR- 1298, hsa-miR- 1299, hsa-miR- 1300, hsa-miR-1301, hsa-miR- 1302, hsa-miR- 1303, hsa- miR-1304, hsa-miR-1305, hsa-miR-1306, hsa-miR-1307, hsa-miR-1308, hsa-miR-130a, hsa- miR-130a*, hsa-miR-130b, hsa-miR- 13 Ob*, hsa-miR-132, hsa-miR-132*, hsa-miR-1321, hsa- miR-1322, hsa-miR-1323, hsa-miR-1324, hsa-miR-133a, hsa-miR-133b, hsa-miR-134, hsa-miR- 135a, hsa-miR-135a*, hsa-miR-135b, hsa-miR-135b*, hsa-miR-136, hsa-miR-136*, hsa-miR- 137, hsa-miR-138, hsa-miR-138-1*, hsa-miR-138-2*, hsa-miR-139-3p, hsa-miR- 139-5p, hsa- miR-140-3p, hsa-miR- 140-5p, hsa-miR-141, hsa-miR-141*, hsa-miR- 142-3p, hsa-miR- 142-5p, hsa-miR-143, hsa-miR-143*, hsa-miR-144, hsa-miR-144*, hsa-miR-145, hsa-miR-145*, hsa- miR-146a, hsa-miR- 146a*, hsa-miR-146b-3p, hsa-miR- 146b-5p, hsa-miR-147, hsa-miR-147b, hsa-miR-148a, hsa-miR- 148a*, hsa-miR-148b, hsa-miR-148b*, hsa-miR-149, hsa-miR-149*, hsa-miR-150, hsa-miR-150*, hsa-miR-151-3p, hsa-miR-151-5p, hsa-miR-152, hsa-miR-153, hsa- miR-154, hsa-miR-154*, hsa-miR-155, hsa-miR-155*, hsa-miR-15a, hsa-miR-15a*, hsa-miR- 15b, hsa-miR-15b*, hsa-miR-16, hsa-miR- 16-1*, hsa-miR- 16-2*, hsa-miR-17, hsa-miR-17*, hsa- miR-181a, hsa-miR-181a*, hsa-miR-181a-2*, hsa-miR-181b, hsa-miR-181c, hsa-miR-181c*, hsa-miR-181d, hsa-miR-182, hsa-miR-182*, hsa-miR-1825, hsa-miR-1826, hsa-miR-1827, hsa- miR-183, hsa-miR-183*, hsa-miR-184, hsa-miR-185, hsa-miR-185*, hsa-miR-186, hsa-miR- 186*, hsa-miR-187, hsa-miR-187*, hsa-miR-188-3p, hsa-miR-188-5p, hsa-miR-18a, hsa-miR- 18a*, hsa-miR-18b, hsa-miR-18b*, hsa-miR-190, hsa-miR-190b, hsa-miR-191, hsa-miR-191*, hsa-miR-192, hsa-miR-192*, hsa-miR- 193 a-3p, hsa-miR- 193 a-5p, hsa-miR-193b, hsa-miR- 193b*, hsa-miR-194, hsa-miR-194*, hsa-miR-195, hsa-miR-195*, hsa-miR-196a, hsa-miR- 196a*, hsa-miR-196b, hsa-miR-197, hsa-miR-198, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa- miR-199b-5p, hsa-miR-19a, hsa-miR-19a*, hsa-miR-19b, hsa-miR- 19b- 1*, hsa-miR-19b-2*, hsa- miR-200a, hsa-miR-200a*, hsa-miR-200b, hsa-miR-200b*, hsa-miR-200c, hsa-miR-200c*, hsa- miR-202, hsa-miR-202*, hsa-miR-203, hsa-miR-204, hsa-miR-205, hsa-miR-206, hsa-miR-208a, hsa-miR-208b, hsa-miR-20a, hsa-miR-20a*, hsa-miR-20b, hsa-miR-20b*, hsa-miR-21, hsa-miR- 21*, hsa-miR-210, hsa-miR-211, hsa-miR-212, hsa-miR-214, hsa-miR-214*, hsa-miR-215, hsa- miR-216a, hsa-miR-216b, hsa-miR-217, hsa-miR-218, hsa-miR-218-1*, hsa-miR-218-2*, hsa- miR-219-l-3p, hsa-miR-219-2-3p, hsa-miR-219-5p, hsa-miR-22, hsa-miR-22*, hsa-miR-220a, hsa-miR-220b, hsa-miR-220c, hsa-miR-221, hsa-miR-221*, hsa-miR-222, hsa-miR-222*, hsa- miR-223, hsa-miR-223*, hsa-miR-224, hsa-miR-23a, hsa-miR-23a*, hsa-miR-23b, hsa-miR- 23b*, hsa-miR-24, hsa-miR-24-1*, hsa-miR-24-2*, hsa-miR-25, hsa-miR-25*, hsa-miR-26a, hsa- miR-26a-l*, hsa-miR-26a-2*, hsa-miR-26b, hsa-miR-26b*, hsa-miR-27a, hsa-miR-27a*, hsa- miR-27b, hsa-miR-27b*, hsa-miR-28-3p, hsa-miR-28-5p, hsa-miR-296-3p, hsa-miR-296-5p, hsa- miR-297, hsa-miR-298, hsa-miR-299-3p, hsa-miR-299-5p, hsa-miR-29a, hsa-miR-29a*, hsa- miR-29b, hsa-miR-296-1*, hsa-miR-296-2*, hsa-miR-29c, hsa-miR-29c*, hsa-miR-300, hsa- miR-301a, hsa-miR-301b, hsa-miR-302a, hsa-miR-302a*, hsa-miR-302b, hsa-miR-302b*, hsa- miR-302c, hsa-miR-302c*, hsa-miR-302d, hsa-miR-302d*, hsa-miR-302e, hsa-miR-302f, hsa- miR-30a, hsa-miR-30a*, hsa-miR-30b, hsa-miR-30b*, hsa-miR-30c, hsa-miR-30c-l*, hsa-miR- 30c-2*, hsa-miR-30d, hsa-miR-30d*, hsa-miR-30e, hsa-miR-30e*, hsa-miR-31, hsa-miR-31*, hsa-miR-32, hsa-miR-32*, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa- miR-323-3p, hsa-miR-323-5p, hsa-miR-324-3p, hsa-miR-324-5p, hsa-miR-325, hsa-miR-326, hsa-miR-328, hsa-miR-329, hsa-miR-330-3p, hsa-miR-330-5p, hsa-miR-331-3p, hsa-miR-331- 5p, hsa-miR-335, hsa-miR-335*, hsa-miR-337-3p, hsa-miR-337-5p, hsa-miR-338-3p, hsa-miR- 338-5p, hsa-miR-339-3p, hsa-miR-339-5p, hsa-miR-33a, hsa-miR-33a*, hsa-miR-33b, hsa-miR- 33b*, hsa-miR-340, hsa-miR-340*, hsa-miR-342-3p, hsa-miR-342-5p, hsa-miR-345, hsa-miR- 346, hsa-miR-34a, hsa-miR-34a*, hsa-miR-34b, hsa-miR-34b*, hsa-miR-34c-3p, hsa-miR-34c- 5p, hsa-miR-361-3p, hsa-miR-361-5p, hsa-miR-362-3p, hsa-miR-362-5p, hsa-miR-363, hsa-miR- 363*, hsa-miR-365, hsa-miR-367, hsa-miR-367*, hsa-miR-369-3p, hsa-miR-369-5p, hsa-miR- 370, hsa-miR-371-3p, hsa-miR-371-5p, hsa-miR-372, hsa-miR-373, hsa-miR-373*, hsa-miR- 374a, hsa-miR-374a*, hsa-miR-374b, hsa-miR-374b*, hsa-miR-375, hsa-miR-376a, hsa-miR- 376a*, hsa-miR-376b, hsa-miR-376c, hsa-miR-377, hsa-miR-377*, hsa-miR-378, hsa-miR-378*, hsa-miR-379, hsa-miR-379*, hsa-miR-380, hsa-miR-380*, hsa-miR-381, hsa-miR-382, hsa-miR- 383, hsa-miR-384, hsa-miR-409-3p, hsa-miR-409-5p, hsa-miR-410, hsa-miR-411, hsa-miR- 411*, hsa-miR-412, hsa-miR-421, hsa-miR-422a, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR- 424, hsa-miR-424*, hsa-miR-425, hsa-miR-425*, hsa-miR-429, hsa-miR-431, hsa-miR-431*, hsa-miR-432, hsa-miR-432*, hsa-miR-433, hsa-miR-448, hsa-miR-449a, hsa-miR-449b, hsa- miR-450a, hsa-miR-450b-3p, hsa-miR-450b-5p, hsa-miR-451, hsa-miR-452, hsa-miR-452*, hsa- miR-453, hsa-miR-454, hsa-miR-454*, hsa-miR-455-3p, hsa-miR-455-5p, hsa-miR-483-3p, hsa- miR-483-5p, hsa-miR-484, hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-486-3p, hsa-miR-486-5p, hsa-miR-487a, hsa-miR-487b, hsa-miR-488, hsa-miR-488*, hsa-miR-489, hsa-miR-490-3p, hsa- miR-490-5p, hsa-miR-491-3p, hsa-miR-491-5p, hsa-miR-492, hsa-miR-493, hsa-miR-493*, hsa- miR-494, hsa-miR-495, hsa-miR-496, hsa-miR-497, hsa-miR-497*, hsa-miR-498, hsa-miR-499- 3p, hsa-miR-499-5p, hsa-miR-500, hsa-miR-500*, hsa-miR-501-3p, hsa-miR-501-5p, hsa-miR- 502-3p, hsa-miR-502-5p, hsa-miR-503, hsa-miR-504, hsa-miR-505, hsa-miR-505*, hsa-miR- 506, hsa-miR-507, hsa-miR-508-3p, hsa-miR-508-5p, hsa-miR-509-3-5p, hsa-miR-509-3p, hsa- miR-509-5p, hsa-miR-510, hsa-miR-511, hsa-miR-512-3p, hsa-miR-512-5p, hsa-miR-513a-3p, hsa-miR-513a-5p, hsa-miR-513b, hsa-miR-513c, hsa-miR-514, hsa-miR-515-3p, hsa-miR-515- 5p, hsa-miR-516a-3p, hsa-miR-516a-5p, hsa-miR-516b, hsa-miR-517*, hsa-miR-517a, hsa-miR- 517b, hsa-miR-517c, hsa-miR-518a-3p, hsa-miR-518a-5p, hsa-miR-518b, hsa-miR-518c, hsa- miR-518c*, hsa-miR-518d-3p, hsa-miR-518d-5p, hsa-miR-518e, hsa-miR-518e*, hsa-miR-518f, hsa-miR-518f*, hsa-miR-519a, hsa-miR-519b-3p, hsa-miR-519c-3p, hsa-miR-519d, hsa-miR- 519e, hsa-miR-519e*, hsa-miR-520a-3p, hsa-miR-520a-5p, hsa-miR-520b, hsa-miR-520c-3p, hsa-miR-520d-3p, hsa-miR-520d-5p, hsa-miR-520e, hsa-miR-520f, hsa-miR-520g, hsa-miR- 520h, hsa-miR-521, hsa-miR-522, hsa-miR-523, hsa-miR-524-3p, hsa-miR-524-5p, hsa-miR- 525-3p, hsa-miR-525-5p, hsa-miR-526b, hsa-miR-526b*, hsa-miR-532-3p, hsa-miR-532-5p, hsa- miR-539, hsa-miR-541, hsa-miR-541*, hsa-miR-542-3p, hsa-miR-542-5p, hsa-miR-543, hsa- miR-544, hsa-miR-545, hsa-miR-545*, hsa-miR-548a-3p, hsa-miR-548a-5p, hsa-miR-548b-3p, hsa-miR-5486-5p, hsa-miR-548c-3p, hsa-miR-548c-5p, hsa-miR-548d-3p, hsa-miR-548d-5p, hsa-miR-548e, hsa-miR-548f, hsa-miR-548g, hsa-miR-548h, hsa-miR-548i, hsa-miR-548j, hsa- miR-548k, hsa-miR-5481, hsa-miR-548m, hsa-miR-548n, hsa-miR-548o, hsa-miR-548p, hsa- miR-549, hsa-miR-550, hsa-miR-550*, hsa-miR-551a, hsa-miR-551b, hsa-miR-55 lb*, hsa-miR- 552, hsa-miR-553, hsa-miR-554, hsa-miR-555, hsa-miR-556-3p, hsa-miR-556-5p, hsa-miR-557, hsa-miR-558, hsa-miR-559, hsa-miR-561, hsa-miR-562, hsa-miR-563, hsa-miR-564, hsa-miR- 566, hsa-miR-567, hsa-miR-568, hsa-miR-569, hsa-miR-570, hsa-miR-571, hsa-miR-572, hsa- miR-573, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-575, hsa-miR-576-3p, hsa-miR-576-5p, hsa-miR-577, hsa-miR-578, hsa-miR-579, hsa-miR-580, hsa-miR-581, hsa-miR-582-3p, hsa- miR-582-5p, hsa-miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-586, hsa-miR-587, hsa-miR- 588, hsa-miR-589, hsa-miR-589*, hsa-miR-590-3p, hsa-miR-590-5p, hsa-miR-591, hsa-miR- 592, hsa-miR-593, hsa-miR-593*, hsa-miR-595, hsa-miR-596, hsa-miR-597, hsa-miR-598, hsa- miR-599, hsa-miR-600, hsa-miR-601, hsa-miR-602, hsa-miR-603, hsa-miR-604, hsa-miR-605, hsa-miR-606, hsa-miR-607, hsa-miR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsa-miR- 612, hsa-miR-613, hsa-miR-614, hsa-miR-615-3p, hsa-miR-615-5p, hsa-miR-616, hsa-miR- 616*, hsa-miR-617, hsa-miR-618, hsa-miR-619, hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa- miR-623, hsa-miR-624, hsa-miR-624*, hsa-miR-625, hsa-miR-625*, hsa-miR-626, hsa-miR-627, hsa-miR-628-3p, hsa-miR-628-5p, hsa-miR-629, hsa-miR-629*, hsa-miR-630, hsa-miR-631, hsa- miR-632, hsa-miR-633, hsa-miR-634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR-639, hsa-miR-640, hsa-miR-641, hsa-miR-642, hsa-miR-643, hsa-miR-644, hsa-miR- 645, hsa-miR-646, hsa-miR-647, hsa-miR-648, hsa-miR-649, hsa-miR-650, hsa-miR-651, hsa- miR-652, hsa-miR-653, hsa-miR-654-3p, hsa-miR-654-5p, hsa-miR-655, hsa-miR-656, hsa-miR- 657, hsa-miR-658, hsa-miR-659, hsa-miR-660, hsa-miR-661, hsa-miR-662, hsa-miR-663, hsa- miR-663b, hsa-miR-664, hsa-miR-664*, hsa-miR-665, hsa-miR-668, hsa-miR-671-3p, hsa-miR- 671-5p, hsa-miR-675, hsa-miR-7, hsa-miR-708, hsa-miR-708*, hsa-miR-7-1*, hsa-miR-7-2*, hsa-miR-720, hsa-miR-744, hsa-miR-744*, hsa-miR-758, hsa-miR-760, hsa-miR-765, hsa-miR- 766, hsa-miR-767-3p, hsa-miR-767-5p, hsa-miR-768-3p, hsa-miR-768-5p, hsa-miR-769-3p, hsa- miR-769-5p, hsa-miR-770-5p, hsa-miR-802, hsa-miR-873, hsa-miR-874, hsa-miR-875-3p, hsa- miR-875-5p, hsa-miR-876-3p, hsa-miR-876-5p, hsa-miR-877, hsa-miR-877*, hsa-miR-885-3p, hsa-miR-885-5p, hsa-miR-886-3p, hsa-miR-886-5p, hsa-miR-887, hsa-miR-888, hsa-miR-888*, hsa-miR-889, hsa-miR-890, hsa-miR-891a, hsa-miR-891b, hsa-miR-892a, hsa-miR-892b, hsa- miR-9, hsa-miR-9*, hsa-miR-920, hsa-miR-921, hsa-miR-922, hsa-miR-923, hsa-miR-924, hsa- miR-92a, hsa-miR-92a-l*, hsa-miR-92a-2*, hsa-miR-92b, hsa-miR-92b*, hsa-miR-93, hsa-miR- 93*, hsa-miR-933, hsa-miR-934, hsa-miR-935, hsa-miR-936, hsa-miR-937, hsa-miR-938, hsa- miR-939, hsa-miR-940, hsa-miR-941, hsa-miR-942, hsa-miR-943, hsa-miR-944, hsa-miR-95, hsa-miR-96, hsa-miR-96*, hsa-miR-98, hsa-miR-99a, hsa-miR-99a*, hsa-miR-99b, and hsa-miR- 99b*. For example, miRNA targeting chromosome 8 open reading frame 72 (C9orf72) which expresses superoxide dismutase (SOD1), associated with amyotrophic lateral sclerosis (ALS) may be of interest.
A miRNA inhibits the function of the mRNAs it targets and, as a result, inhibits expression of the polypeptides encoded by the mRNAs. Thus, blocking (partially or totally) the activity of the miRNA (e.g., silencing the miRNA) can effectively induce, or restore, expression of a polypeptide whose expression is inhibited (derepress the polypeptide). In one embodiment, derepression of polypeptides encoded by mRNA targets of a miRNA is accomplished by inhibiting the miRNA activity in cells through any one of a variety of methods. For example, blocking the activity of a miRNA can be accomplished by hybridization with a small interfering nucleic acid (e.g., antisense oligonucleotide, miRNA sponge, TuD RNA) that is complementary, or substantially complementary to, the miRNA, thereby blocking interaction of the miRNA with its target mRNA. As used herein, a small interfering nucleic acid that is substantially complementary to a miRNA is one that is capable of hybridizing with an miRNA and blocking the miRNA's activity. In some embodiments, a small interfering nucleic acid that is substantially complementary to a miRNA is a small interfering nucleic acid that is complementary with the miRNA at all but 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 bases. A “miRNA Inhibitor” is an agent that blocks miRNA function, expression and/or processing. For instance, these molecules include but are not limited to microRNA specific antisense, microRNA sponges, tough decoy RNAs (TuD RNAs) and microRNA oligonucleotides (double-stranded, hairpin, short oligonucleotides) that inhibit miRNA interaction with a Drosha complex.
Still other useful transgenes may include those encoding immunoglobulins which confer passive immunity to a pathogen. An “immunoglobulin molecule” is a protein containing the immunologically-active portions of an immunoglobulin heavy chain and immunoglobulin light chain covalently coupled together and capable of specifically combining with antigen. Immunoglobulin molecules are of any type ( e.g IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass. The terms “antibody” and “immunoglobulin” may be used interchangeably herein.
An “immunoglobulin heavy chain” is a polypeptide that contains at least a portion of the antigen binding domain of an immunoglobulin and at least a portion of a variable region of an immunoglobulin heavy chain or at least a portion of a constant region of an immunoglobulin heavy chain. Thus, the immunoglobulin derived heavy chain has significant regions of amino acid sequence homology with a member of the immunoglobulin gene superfamily. For example, the heavy chain in a Fab fragment is an immunoglobulin-derived heavy chain.
An “immunoglobulin light chain” is a polypeptide that contains at least a portion of the antigen binding domain of an immunoglobulin and at least a portion of the variable region or at least a portion of a constant region of an immunoglobulin light chain. Thus, the immunoglobulin- derived light chain has significant regions of amino acid homology with a member of the immunoglobulin gene superfamily.
An “immunoadhesin” is a chimeric, antibody-like molecule that combines the functional domain of a binding protein, usually a receptor, ligand, or cell-adhesion molecule, with immunoglobulin constant domains, usually including the hinge and Fc regions.
A “fragment antigen-binding” (Fab) fragment” is a region on an antibody that binds to antigens. It is composed of one constant and one variable domain of each of the heavy and the light chain.
The anti-pathogen construct is selected based on the causative agent (pathogen) for the disease against which protection is sought. These pathogens may be of viral, bacterial, or fungal origin, and may be used to prevent infection in humans against human disease, or in non-human mammals or other animals to prevent veterinary disease.
The rAAV may include genes encoding antibodies, and particularly neutralizing antibodies against a viral pathogen. Such anti-viral antibodies may include anti -influenza antibodies directed against one or more of Influenza A, Influenza B, and Influenza C. The type A viruses are the most virulent human pathogens. The serotypes of influenza A which have been associated with pandemics include, H1N1, which caused Spanish Flu in 1918, and Swine Flu in 2009; H2N2, which caused Asian Flu in 1957; H3N2, which caused Hong Kong Flu in 1968; H5N1, which caused Bird Flu in 2004; H7N7; H1N2; H9N2; H7N2; H7N3; and H10N7. Other target pathogenic viruses include arenaviruses (including funin, machupo, and Lassa), filoviruses (including Marburg and Ebola), hantaviruses, picomoviridae (including rhinoviruses, echovirus), coronaviruses, paramyxovirus, morbillivirus, respiratory synctial virus, togavirus, coxsackievirus, JC virus, parvovirus B19, parainfluenza, adenoviruses, reoviruses, variola (Variola major (Smallpox)) and Vaccinia (Cowpox) from the poxvirus family, and varicella-zoster (pseudorabies). Viral hemorrhagic fevers are caused by members of the arenavirus family (Lassa fever) (which family is also associated with Lymphocytic choriomeningitis (LCM)), filovirus (ebola virus), and hantavirus (puremala). The members of picomavirus (a subfamily of rhinoviruses) are associated with the common cold in humans. The coronavirus family, which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinatin encephalomyelitis virus (pig), feline infectious peritonitis virus (cat), feline enteric coronavirus (cat), canine coronavirus (dog). The human respiratory coronaviruses have been putatively associated with the common cold, non- A, B or C hepatitis, and sudden acute respiratory syndrome (SARS). The paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus (RSV). The parvovirus family includes feline parvovirus (feline enteritis), feline panleucopeniavirus, canine parvovirus, and porcine parvovirus. The adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease. Thus, in certain embodiments, an rAAV vector as described herein may be engineered to express an anti-ebola antibody, e.g., 2G4, 4G7, 13C6, an anti-influenza antibody, e.g., FI6, CR8033, and anti-RSV antibody, e.g, palivizumab, motavizumab. A neutralizing antibody construct against a bacterial pathogen may also be selected for use in the present invention. In one embodiment, the neutralizing antibody construct is directed against the bacteria itself. In another embodiment, the neutralizing antibody construct is directed against a toxin produced by the bacteria. Examples of airborne bacterial pathogens include, e.g., Neisseria meningitidis (meningitis), Klebsiella pneumonia (pneumonia), Pseudomonas aeruginosa (pneumonia), Pseudomonas pseudomallei (pneumonia), Pseudomonas mallei (pneumonia), Acinetobacter (pneumonia), Moraxella catarrhalis, Moraxella lacunata, Alkaligenes, Cardiobacterium, Haemophilus influenzae (flu), Haemophilus parainfluenzae, Bordetella pertussis (whooping cough), Francisella tularensis (pneumonia/fever), Legionella pneumonia (Legionnaires disease), Chlamydia psittaci (pneumonia), Chlamydia pneumoniae (pneumonia), Mycobacterium tuberculosis (tuberculosis (TB)), Mycobacterium kansasii (TB), Mycobacterium avium (pneumonia), Nocardia asteroides (pneumonia), Bacillus anthracis (anthrax), Staphylococcus aureus (pneumonia), Streptococcus pyogenes (scarlet fever), Streptococcus pneumoniae (pneumonia), Corynebacteria diphtheria (diphtheria), Mycoplasma pneumoniae (pneumonia).
The rAAV may include genes encoding antibodies, and particularly neutralizing antibodies against a bacterial pathogen such as the causative agent of anthrax, a toxin produced by Bacillius anthracis. Neutralizing antibodies against protective agent (PA), one of the three peptides which form the toxoid, have been described. The other two polypeptides consist of lethal factor (LF) and edema factor (EF). Anti-PA neutralizing antibodies have been described as being effective in passively immunization against anthrax. See, e.g., US Patent number 7,442,373; R. Sawada-Hirai et al, J Immune Based Ther Vaccines. 2004; 2: 5. (on-line 2004 May 12). Still other anti-anthrax toxin neutralizing antibodies have been described and/or may be generated. Similarly, neutralizing antibodies against other bacteria and/or bacterial toxins may be used to generate an AAV-delivered anti -pathogen construct as described herein.
Antibodies against infectious diseases may be caused by parasites or by fungi, including, e.g., Aspergillus species, Absidia corymbifera, Rhixpus stolonifer, Mucor plumbeaus, Cryptococcus neoformans, Histoplasm capsulatum, Blastomyces dermatitidis, Coccidioides immitis, Penicillium species, Micropoly spora faeni, Thermoactinomyces vulgaris, Altemaria alternate, Cladosporium species, Helminthosporium, and Stachybotrys species.
The rAAV may include genes encoding antibodies, and particularly neutralizing antibodies, against pathogenic factors of diseases such as Alzheimer’s disease (AD), Parkinson’s disease (PD), GBA-associated - Parkinson’s disease (GBA - PD), Rheumatoid arthritis (RA), irritable bowel syndrome (IBS), chronic obstructive pulmonary disease (COPD), cancers, tumors, systemic sclerosis, asthma and other diseases. Such antibodies may be., without limitation, , e.g., alpha-synuclein, anti-vascular endothelial growth factor (VEGF) (anti-VEGF), , anti-VEGFA, anti-PD-1, anti-PDLl, anti-CTLA-4, anti-TNF-alpha, anti-IL-17, anti-IL-23, anti- IL-21, anti-IL-6, anti-IL-6 receptor, anti-IL-5, anti-IL-7, anti -Factor XII, anti-IL-2, anti-HIV, anti-IgE, anti -tumour necrosis factor receptor- 1 (TNFR1), anti -notch 2/3, anti -notch 1, anti- 0X40, anti-erb-b2 receptor tyrosine kinase 3 (ErbB3), anti-ErbB2, anti-beta cell maturation antigen, anti-B lymphocyte stimulator, anti-CD20, anti-HER2, anti-granulocyte macrophage colony- stimulating factor, anti-oncostatin M (OSM), anti-lymphocyte activation gene 3 (LAG3) protein, anti-CCL20, anti-serum amyloid P component (SAP), anti-prolyl hydroxylase inhibitor, anti-CD38, anti-glycoprotein Ilb/IIIa, anti-CD52, anti-CD30, anti-IL-lbeta, anti-epidermal growth factor receptor, anti-CD25, anti-RANK ligand, anti-complement system protein C5, anti- CD 11 a, anti-CD3 receptor, anti-alpha-4 (a4) integrin, anti-RSV F protein, and anti-integrin afn. Still other pathogens and diseases will be apparent to one of skill in the art. Other suitable antibodies may include those useful for treating Alzheimer’s Disease, such as, e.g., anti-beta- amyloid (e.g., crenezumab, solanezumab, aducanumab), anti-beta-amyloid fibril, anti-beta- amyloid plaques, anti-tau, a bapineuzamab, among others. Other suitable antibodies for treating a variety of indications include those described, e.g., in PCT/US2016/058968, filed 27 October 2016, published as WO 2017/075119A1.
Reduction and/or modulation of expression of a gene is particularly desirable for treatment of hyperprobferative conditions characterized by hyperproliferating cells, as are cancers and psoriasis. Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperprobferative cells as compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF. In addition to oncogene products as target antigens, target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease. Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1 A and folate binding polypeptides.
Other suitable therapeutic polypeptides and proteins include those which may be useful for treating individuals suffering from autoimmune diseases and disorders by conferring a broad based protective immune response against targets that are associated with autoimmunity including cell receptors and cells which produce self-directed antibodies. T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis. Each of these diseases is characterized by T cell receptors (TCRs) that bind to endogenous antigens and initiate the inflammatory cascade associated with autoimmune diseases.
Alternatively, or in addition, the vectors may contain AAV sequences of the invention and a transgene encoding a peptide, polypeptide or protein which induces an immune response to a selected immunogen. For example, immunogens may be selected from a variety of viral families. Example of desirable viral families against which an immune response would be desirable include, the picomavirus family, which includes the genera rhinoviruses, which are responsible for about 50% of cases of the common cold; the genera enteroviruses, which include polioviruses, coxsackieviruses, echoviruses, and human enteroviruses such as hepatitis A virus; and the genera apthoviruses, which are responsible for foot and mouth diseases, primarily in non human animals. Within the picomavirus family of viruses, target antigens include the VP1, VP2, VP3, VP4, and VPG. Another viral family includes the calcivirus family, which encompasses the Norwalk group of viruses, which are an important causative agent of epidemic gastroenteritis.
Still another viral family desirable for use in targeting antigens for inducing immune responses in humans and non-human animals is the togavirus family, which includes the genera alphavirus, which include Sindbis viruses, RossRiver virus, and Venezuelan, Eastern & Western Equine encephalitis, and rubivirus, including Rubella virus. The flaviviridae family includes dengue, yellow fever, Japanese encephalitis, St. Louis encephalitis and tick-bome encephalitis viruses. Other target antigens may be generated from the Hepatitis C or the coronavirus family, which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinating encephalomyelitis virus (pig), feline infectious peritonitis virus (cats), feline enteric coronavirus (cat), canine coronavirus (dog), and human respiratory coronaviruses, which may cause the common cold and/or non- A, B or C hepatitis. Within the coronavirus family, target antigens include the El (also called M or matrix protein), E2 (also called S or Spike protein), E3 (also called HE or hemagglutin-elterose) glycoprotein (not present in all coronaviruses), or N (nucleocapsid). Still other antigens may be targeted against the rhabdovirus family, which includes the genera vesiculovirus (e.g., Vesicular Stomatitis Virus), and the general lyssavirus (e.g., rabies). Within the rhabdovirus family, suitable antigens may be derived from the G protein or the N protein. The family fdoviridae, which includes hemorrhagic fever viruses such as Marburg and Ebola virus may be a suitable source of antigens. The paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus. The influenza virus is classified within the family orthomyxovirus and is a suitable source of antigen (e.g., the HA protein, the N1 protein). The bunyavirus family includes the genera bunyavirus (California encephalitis, La Crosse), phlebovirus (Rift Valley Fever), hantavirus (puremala is a hemahagin fever virus), nairovirus (Nairobi sheep disease) and various unassigned bungaviruses. The arenavirus family provides a source of antigens against LCM and Lassa fever virus. The reovirus family includes the genera reovirus, rotavirus (which causes acute gastroenteritis in children), orbiviruses, and cultivirus (Colorado Tick fever, Lebombo (humans), equine encephalosis, blue tongue). The retrovirus family includes the sub-family oncorivirinal which encompasses such human and veterinary diseases as feline leukemia virus, HTLVI and HTLVII, lentivirinal (which includes human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus, and spumavirinal). Between the HTV and SIV, many suitable antigens have been described and can readily be selected. Examples of suitable HIV and SIV antigens include, without limitation the gag, pol, Vif, Vpx, VPR, Env, Tat and Rev proteins, as well as various fragments thereof. In addition, a variety of modifications to these antigens have been described. Suitable antigens for this purpose are known to those of skill in the art. For example, one may select a sequence encoding the gag, pol, Vif, and Vpr, Env, Tat and Rev, amongst other proteins. See, e.g., the modified gag protein which is described in US Patent 5,972,596. See, also, the HIV and SIV proteins described in D.H. Barouch et al, J. Virol., 75(5):2462-2467 (March 2001), and R.R. Amara, et al, Science, 292:69-74 (6 April 2001). These proteins or subunits thereof may be delivered alone, or in combination via separate vectors or from a single vector.
The papovavirus family includes the sub-family polyomaviruses (BKU and JCU viruses) and the sub-family papillomavirus (associated with cancers or malignant progression of papilloma). The adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease and/or enteritis. The parvovirus family feline parvovirus (feline enteritis), feline panleucopeniavirus, canine parvovirus, and porcine parvovirus. The herpesvirus family includes the sub-family alphaherpesvirinae, which encompasses the genera simplexvirus (HSVI, HSVII), varicellovirus (pseudorabies, varicella zoster) and the sub-family betaherpesvirinae, which includes the genera cytomegalovirus (HCMV, muromegalovirus) and the sub-family gammaherpesvirinae, which includes the genera lymphocryptovirus, EBV (Burkitts lymphoma), infectious rhinotracheitis, Marek's disease virus, and rhadinovirus. The poxvirus family includes the sub-family chordopoxvirinae, which encompasses the genera orthopoxvirus (Variola (Smallpox) and Vaccinia (Cowpox)), parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus, and the sub-family entomopoxvirinae. The hepadnavirus family includes the Hepatitis B virus. One unclassified virus which may be suitable source of antigens is the Hepatitis delta virus. Still other viral sources may include avian infectious bursal disease virus and porcine respiratory and reproductive syndrome virus. The alphavirus family includes equine arteritis virus and various Encephalitis viruses.
The rAAV may also deliver a sequence encoding immunogens which are useful to immunize a human or non-human animal against other pathogens including bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or from a cancer cell or tumor cell. Examples of bacterial pathogens include pathogenic gram-positive cocci include pneumococci; staphylococci; and streptococci.
Pathogenic gram-negative cocci include meningococcus; gonococcus. Pathogenic enteric gram-negative bacilli include enterobacteriaceae; pseudomonas, acinetobacteria and eikenella; melioidosis; salmonella; shigella; haemophilus; moraxella; H. ducreyi (which causes chancroid); brucella; Franisella tularensis (which causes tularemia); yersinia (pasteurella); streptobacillus moniliformis and spirillum; Gram-positive bacilli include listeria monocytogenes; erysipelothrix rhusiopathiae; Corynebacterium diphtheria (diphtheria); cholera; B. anthracis (anthrax); donovanosis (granuloma inguinale); and bartonellosis. Diseases caused by pathogenic anaerobic bacteria include tetanus; botulism; other clostridia; tuberculosis; leprosy; and other mycobacteria. Pathogenic spirochetal diseases include syphilis; treponematoses: yaws, pinta and endemic syphilis; and leptospirosis. Other infections caused by higher pathogen bacteria and pathogenic fungi include actinomycosis; nocardiosis; cryptococcosis, blastomycosis, histoplasmosis and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichosis; paracoccidiodomycosis, petriellidiosis, torulopsosis, mycetoma and chromomycosis; and dermatophytosis. Rickettsial infections include Typhus fever, Rocky Mountain spotted fever, Q fever, and Rickettsialpox. Examples of mycoplasma and chlamydial infections include: mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal chlamydial infections. Pathogenic eukaryotes encompass pathogenic protozoans and helminths and infections produced thereby include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; Pneumocystis carinii Trichans ; Toxoplasma gondii ; babesiosis; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematodes or flukes; and cestode (tapeworm) infections.
Many of these organisms and/or toxins produced thereby have been identified by the Centers for Disease Control [(CDC), Department of Health and Human Services, USA], as agents which have potential for use in biological attacks. For example, some of these biological agents, include, Bacillus anthracis (anthrax), Clostridium botulinum and its toxin (botulism), Yersinia pestis (plague), variola major (smallpox), Francisella tularensis (tularemia), and viral hemorrhagic fever, all of which are currently classified as Category A agents; Coxiella burnetti (Q fever); Brucella species (brucellosis), Burkholderia mallei (glanders), Ricinus communis and its toxin (ricin toxin), Clostridium perfringens and its toxin (epsilon toxin), Staphylococcus species and their toxins (enterotoxin B), all of which are currently classified as Category B agents; and Nipan virus and hantaviruses, which are currently classified as Category C agents. In addition, other organisms, which are so classified or differently classified, may be identified and/or used for such a purpose in the future. It will be readily understood that the viral vectors and other constructs described herein are useful to deliver antigens from these organisms, viruses, their toxins or other by-products, which will prevent and/or treat infection or other adverse reactions with these biological agents.
Administration of the vectors of the invention to deliver immunogens against the variable region of the T cells elicit an immune response including CTLs to eliminate those T cells. In rheumatoid arthritis (RA), several specific variable regions of T cell receptors (TCRs) which are involved in the disease have been characterized. These TCRs include V-3, V-14, V-17 and Va-17. Thus, delivery of a nucleic acid sequence that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in RA. In multiple sclerosis (MS), several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include V-7 and Va-10. Thus, delivery of a nucleic acid sequence that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in MS. In scleroderma, several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include V-6, V-8, V-14 and Va-16, Va-3C, Va-7, Va-14, Va-15, Va-16, Va-28 and Va-12. Thus, delivery of a nucleic acid molecule that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in scleroderma.
In one embodiment, the transgene is selected to provide optogenetic therapy. In optogenetic therapy, artificial photoreceptors are constructed by gene delivery of light-activated channels or pumps to surviving cell types in the remaining retinal circuit. This is particularly useful for patients who have lost a significant amount of photoreceptor function, but whose bipolar cell circuitry to ganglion cells and optic nerve remains intact. In one embodiment, the heterologous nucleic acid sequence (transgene) is an opsin. The opsin sequence can be derived from any suitable single- or multicellular- organism, including human, algae and bacteria. In one embodiment, the opsin is rhodopsin, photopsin, L/M wavelength (red/green) -opsin, or short wavelength (S) opsin (blue). In another embodiment, the opsin is channelrhodopsin or halorhodopsin.
In another embodiment, the transgene is selected for use in gene augmentation therapy, i.e., to provide replacement copy of a gene that is missing or defective. In this embodiment, the transgene may be readily selected by one of skill in the art to provide the necessary replacement gene. In one embodiment, the missing/defective gene is related to an ocular disorder. In another embodiment, the transgene is NYX, GRM6, TRPM1L or GPR179 and the ocular disorder is Congenital Stationary Night Blindness. See, e.g., Zeitz et al, Am J Hum Genet. 2013 Jan 10;92(l):67-75. Epub 2012 Dec 13 which is incorporated herein by reference. In another embodiment, the transgene is RPGR. In another embodiment, the gene is Rab escort protein 1 (REP-1) encoded by CHM, associated with choroideremia. In another embodiment, the transgene is selected for use in gene suppression therapy, i.e., expression of one or more native genes is interrupted or suppressed at transcriptional or translational levels. This can be accomplished using short hairpin RNA (shRNA) or other techniques well known in the art. See, e.g., Sun et al, Int J Cancer. 2010 Feb l;126(3):764-74 and O'Reilly M, et al. Am J Hum Genet. 2007 Jul;81(l): 127-35, which are incorporated herein by reference. In this embodiment, the transgene may be readily selected by one of skill in the art based upon the gene which is desired to be silenced.
In another embodiment, the transgene comprises more than one transgene. This may be accomplished using a single vector carrying two or more heterologous sequences, or using two or more rAAV each carrying one or more heterologous sequences. In one embodiment, the rAAV is used for gene suppression (or knockdown) and gene augmentation co-therapy. In knockdown/augmentation co-therapy, the defective copy of the gene of interest is silenced and a non-mutated copy is supplied. In one embodiment, this is accomplished using two or more co administered vectors. See, Millington-Ward et al, Molecular Therapy, April 2011, 19(4):642-649 which is incorporated herein by reference. The transgenes may be readily selected by one of skill in the art based on the desired result.
In another embodiment, the transgene is selected for use in gene correction therapy. This may be accomplished using, e.g., a zinc-finger nuclease (ZFN)-induced DNA double-strand break in conjunction with an exogenous DNA donor substrate. See, e.g., Ellis et al, Gene Therapy (epub January 2012) 20:35-42 which is incorporated herein by reference. In one embodiment, the transgene encodes a nuclease selected from a meganuclease, a zinc finger nuclease, a transcription activator - like (TAL) effector nuclease (TALEN), and a clustered, regularly interspaced short palindromic repeat (CRISPR)/endonuclease (Cas9, Cpfl, etc). Examples of suitable meganucleases are described, e.g., in US Patent 8,445,251; US 9,340,777; US 9,434,931; US 9,683,257, and WO 2018/195449. Other suitable enzymes include nuclease-inactive S. pyogenes CRISPR/Cas9 that can bind RNA in a nucleic-acid-programmed manner (Nelles et al, Programmable RNA Tracking in Live Cells with CRISPR/Cas9, Cell, 165(2):P488-96 (April 2016)), and base editors (e.g., Levy et al. Cytosine and adenine base editing of the brain, liver, retina, heart and skeletal muscle of mice via adeno-associated viruses, Nature Biomedical Engineering, 4, 97-110 (Jan 2020)). In certain embodiments, the nuclease is not a zinc finger nuclease. In certain embodiments, the nuclease is not a CRISPR-associated nuclease. In certain embodiments, the nuclease is not a TALEN. In one embodiment, the nuclease is not a meganuclease. In certain embodiments, the nuclease is a member of the LAGLIDADG (SEQ ID NO: 47) family of homing endonucleases. In certain embodiments, the nuclease is a member of the I-Crel family of homing endonucleases which recognizes and cuts a 22 base pair recognition sequence SEQ ID NO: 48 - C A AA ACGTCGT GAGAC AGTTT G. See, e g., WO 2009/059195. Methods for rationally designing mono-LAGLIDADG (SEQ ID NO: 47) homing endonucleases were described which are capable of comprehensively redesigning ICrel and other homing endonucleases to target widely divergent DNA sites, including sites in mammalian, yeast, plant, bacterial, and viral genomes (WO 2007/047859).
Suitable gene editing targets include, e.g., liver-expressed genes such as, without limitation, proprotein convertase subtilisin/kexin type 9 (PCSK9) (cholesterol related disorders), transthyretin (TTR) (transthyretin amyloidosis), HAO, apolipoprotein C-III (APOC3), Factor Vni, Factor IX, low density lipoprotein receptor (LDLr), lipoprotein lipase (LPL) (Lipoprotein Lipase Deficiency), lecithin-cholesterol acyltransferase (LCAT), ornithine transcarbamylase (OTC), camosinase (CN1), sphingomyelin phosphodiesterase (SMPDl) (Niemann-Pick disease), hypoxanthine-guanine phosphoribosyltransferase (HGPRT), branched-chain alpha-keto acid dehydrogenase complex (BCKDC) (maple syrup urine disease), erythropoietin (EPO), Carbamyl Phosphate Synthetase (CPS1), N-Acetylglutamate Synthetase (NAGS), Argininosuccinic Acid Synthetase (Citrullinemia), Argininosuccinate Lyase (ASL) (Argininosuccinic Aciduria), and Arginase (AG).
Other gene editing targets may include, e.g., hydroxymethylbilane synthase (LIMBS), carbamoyl synthetase I, ornithine transcarbamylase (OTC), arginosuccinate synthetase, alpha 1 anti -trypsin (A1 AT), aaporginosuccinate lyase (ASL) for treatment of argunosuccinate lyase deficiency, arginase, fumaryl acetate hydrolase, phenylalanine hydroxylase, alpha- 1 antitrypsin, rhesus alpha- fetoprotein (AFP), rhesus chorionic gonadotrophin (CG), glucose-6-phosphatase, porphobilinogen deaminase, cystathione beta-synthase, branched chain ketoacid decarboxylase, albumin, isovaleryl-coA dehydrogenase, propionyl CoA carboxylase, methyl malonyl CoA mutase (MUT), glutaryl CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, a cystic fibrosis transmembrane regulator (CFTR) sequence, and a dystrophin gene product [e.g., a mini- or micro-dystrophin]. Still other useful gene products include enzymes such as may be useful in enzyme replacement therapy, which is useful in a variety of conditions resulting from deficient activity of enzyme. For example, enzymes that contain mannose-6-phosphate may be utilized in therapies for lysosomal storage diseases (e.g., a suitable gene includes that encoding b- glucuronidase (GUSB)). In another example, the gene product is ubiquitin protein ligase. glucose-6-phosphatase, associated with glycogen storage disease or deficiency type 1A (GSD1), phosphoenolpyruvate-carboxykinase (PEPCK), associated with PEPCK deficiency; cyclin- dependent kinase-like 5 (CDKL5), also known as serine/threonine kinase 9 (STK9) associated with seizures and severe neurodevelopmental impairment; galactose- 1 phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase (PAH), associated with phenylketonuria (PKU); gene products associated with Primary Hyperoxaluria Type 1 including Hydroxy acid Oxidase 1 (GO/HAOl) and AGXT, branched chain alpha-ketoacid dehydrogenase, including BCKDH, BCKDH-E2, BAKDH-Ela, and BAKDH-Elb, associated with Maple syrup urine disease; fumarylacetoacetate hydrolase, associated with tyrosinemia type 1; methylmalonyl- CoA mutase, associated with methylmalonic acidemia; medium chain acyl CoA dehydrogenase, associated with medium chain acetyl CoA deficiency; ornithine transcarbamylase (OTC), associated with ornithine transcarbamylase deficiency; argininosuccinic acid synthetase (ASS1), associated with citrullinemia; lecithin-cholesterol acyltransferase (LCAT) deficiency; amethylmalonic acidemia (MMA); NPC1 associated with Niemann-Pick disease, type Cl); propionic academia (PA); TTR associated with Transthyretin (TTR)-related Hereditary Amyloidosis; low density lipoprotein receptor (LDLR) protein, associated with familial hypercholesterolemia (FH), LDLR variant, such as those described in WO 2015/164778; PCSK9; ApoE and ApoC proteins, associated with dementia; UDP-glucouronosyltransferase, associated with Crigler-Najjar disease; adenosine deaminase, associated with severe combined immunodeficiency disease; hypoxanthine guanine phosphoribosyl transferase, associated with Gout and Lesch-Nyan syndrome; biotimidase, associated with biotimidase deficiency; alpha- galactosidase A (a-Gal A) associated with Fabry disease); beta-galactosidase (GLB1) associated with GM1 gangliosidosis; ATP7B associated with Wilson’s Disease; beta-glucocerebrosidase, associated with Gaucher disease type 2 and 3; peroxisome membrane protein 70 kDa, associated with Zellweger syndrome; arylsulfatase A (ARSA) associated with metachromatic leukodystrophy, galactocerebrosidase ( GALC) enzyme associated with Krabbe disease, alpha- glucosidase (GAA) associated with Pompe disease; sphingomyelinase (SMPDl) gene associated with Nieman Pick disease type A; argininosuccsinate synthase associated with adult onset type II citrullinemia (CTLN2); carbamoyl -phosphate synthase 1 (CPS1) associated with urea cycle disorders; survival motor neuron (SMN) protein, associated with spinal muscular atrophy; ceramidase associated with Farber lipogranulomatosis; b-hexosaminidase associated with GM2 gangliosidosis and Tay-Sachs and Sandhoff diseases; aspartylglucosaminidase associated with aspartyl-glucosaminuria; a-fucosidase associated with fucosidosis; a-mannosidase associated with alpha-mannosidosis; porphobilinogen deaminase, associated with acute intermittent porphyria (AIP); alpha- 1 antitrypsin for treatment of alpha- 1 antitrypsin deficiency (emphysema); erythropoietin for treatment of anemia due to thalassemia or to renal failure; vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for the treatment of ischemic diseases; thrombomodulin and tissue factor pathway inhibitor for the treatment of occluded blood vessels as seen in, for example, atherosclerosis, thrombosis, or embolisms; aromatic amino acid decarboxylase (AADC), and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease; the beta adrenergic receptor, anti-sense to, or a mutant form of, phospholamban, the sarco(endo)plasmic reticulum adenosine triphosphatase-2 (SERCA2), and the cardiac adenylyl cyclase for the treatment of congestive heart failure; a tumor suppressor gene such as p53 for the treatment of various cancers; a cytokine such as one of the various interleukins for the treatment of inflammatory and immune disorders and cancers; dystrophin or minidystrophin and utrophin or miniutrophin for the treatment of muscular dystrophies; and, insulin or GLP-1 for the treatment of diabetes.
In one embodiment, the capsids described herein are useful in the CRISPR-Cas dual vector system described in US Published Patent Application 2018/0110877, filed April 26, 2018, each of which is incorporated herein by reference. The capsids are also useful for delivery homing endonucleases or other meganucleases.
In another embodiment, the transgenes useful herein include reporter sequences, which upon expression produce a detectable signal. Such reporter sequences include, without limitation, DNA sequences encoding b-lactamase, b -galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), red fluorescent protein (RFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2,
CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
In certain embodiments, in addition to the transgene coding sequence, another non- AAV coding sequence may be included, e.g., a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest. Useful gene products may include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA). miRNAs are natively expressed, typically as final 19-25 non-translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a “mature” single stranded miRNA molecule. This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.
These above coding sequences, when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry. For example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for beta-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
Desirably, the transgene encodes a product which is useful in biology and medicine, such as proteins, peptides, RNA, enzymes, or catalytic RNAs. Desirable RNA molecules include shRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and antisense RNAs. One example of a useful RNA sequence is a sequence which extinguishes expression of a targeted nucleic acid sequence in a target cell.
Regulatory sequences include conventional control elements which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus produced as described herein.
Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters, are known in the art and may be utilized.
The regulatory sequences useful in the constructs provided herein may also contain an intron, desirably located between the promoter/ enhancer sequence and the gene. One desirable intron sequence is derived from SV-40, and is a 100 bp mini-intron splice donor/splice acceptor referred to as SD-SA. Another suitable sequence includes the woodchuck hepatitis virus post- transcriptional element. (See, e.g., L. Wang and ! Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910). PolyA signals may be derived from many suitable species, including, without limitation SV-40, human and bovine.
Another regulatory component of the rAAV useful in the methods described herein is an internal ribosome entry site (IRES). An IRES sequence, or other suitable systems, may be used to produce more than one polypeptide from a single gene transcript. An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell. An exemplary IRES is the poliovirus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells. Preferably, the IRES is located 3’ to the transgene in the rAAV vector.
In certain embodiments, the vector genome comprises a promoter (or a functional fragment of a promoter). The selection of the promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired target cell. In one embodiment, the target cell is an ocular cell. The promoter may be derived from any species, including human. Desirably, in one embodiment, the promoter is “cell specific”. The term “cell-specific” means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular cell tissue. In one embodiment, the promoter is specific for expression of the transgene in muscle cells. In another embodiment, the promoter is specific for expression in lung. In another embodiment, the promoter is specific for expression of the transgene in liver cells. In another embodiment, the promoter is specific for expression of the transgene in airway epithelium. In another embodiment, the promoter is specific for expression of the transgene in neurons. In another embodiment, the promoter is specific for expression of the transgene in heart.
The vector genome typically contains a promoter sequence as part of the expression control sequences, e.g., located between the selected 5’ ITR sequence and a coding sequence. In one embodiment, expression in liver is desirable. Thus, in one embodiment, a liver-specific promoter is used. Examples of liver-specific promoters may include, e.g., thyroid hormone binding globulin (TBG), albumin, Miyatake et al., (1997) J. Virol., 71:5124 32; hepatitis B virus core promoter, Sandig et al., (1996) Gene Ther., 3: 1002 9; or human alpha 1 -antitrypsin, phosphoenolpyruvate carboxykinase (PECK), or alpha fetoprotein (AFP), Arbuthnot et al., (1996) Hum. Gene Ther., 7:1503 14). Tissue specific promoters, constitutive promoters, regulatable promoters [see, e.g., WO 2011/126808 and WO 2013/04943], or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein. In another embodiment, expression in muscle is desirable. Thus, in one embodiment, a muscle-specific promoter is used. In one embodiment, the promoter is an MCK based promoter, such as the dMCK (509-bp) or tMCK (720-bp) promoters (see, e.g., Wang et al, Gene Ther. 2008 Nov;15(22):1489-99. doi: 10.1038/gt.2008.104. Epub 2008 Jun 19, which is incorporated herein by reference). Another useful promoter is the SPc5-12 promoter (see Rasowo et al, European Scientific Journal June 2014 edition vol.10, No.18, which is incorporated herein by reference). In certain embodiments, a promoter specific for the eye or a subpart thereof (e.g., retina) may be selected.
In one embodiment, the promoter is a CMV promoter. In another embodiment, the promoter is a TBG promoter. In another embodiment, a CB7 promoter is used. CB7 is a chicken b-actin promoter with cytomegalovirus enhancer elements. Alternatively, other liver-specific promoters may be used [see, e.g., The Liver Specific Gene Promoter Database, Cold Spring Harbor, rulai.schl.edu/LSPD, alpha 1 anti-trypsin (A1AT); human albumin Miyatake et al., J. Virol., 71:5124 32 (1997), humAlb; and hepatitis B virus core promoter, Sandig et al, Gene Ther., 3: 1002 9 (1996)]. TTR minimal enhancer/promoter, alpha-antitrypsin promoter, LSP (845 nt)25(requires intron-less scAAV).
The promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer/promoter, the SV40 early enhancer/promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter.
The vector genome may contain at least one enhancer, i.e., CMV enhancer. Still other enhancer elements may include, e.g., an apolipoprotein enhancer, a zebrafish enhancer, a GFAP enhancer element, and brain specific enhancers such as described in WO 2013/1555222, woodchuck post hepatitis post-transcriptional regulatory element. Additionally, or alternatively, other, e.g., the hybrid human cytomegalovirus (HCMV)-immediate early (IE)-PDGR promoter or other promoter - enhancer elements may be selected. Other enhancer sequences useful herein include the IRBP enhancer (Nicoud 2007, J Gene Med. 2007 Dec;9(12): 1015-23), immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, the cis-acting element identified in the mouse proximal promoter, etc.
In addition to a promoter, a vector genome may contain other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A variety of suitable polyA are known. In one example, the polyA is rabbit beta globin, such as the 127 bp rabbit beta-globin polyadenylation signal (GenBank # V00882.1). In other embodiments, an SV40 polyA signal is selected. Still other suitable polyA sequences may be selected. In certain embodiments, an intron is included. One suitable intron is a chicken beta-actin intron. In one embodiment, the intron is 875 bp (GenBank # X00182.1). In another embodiment, a chimeric intron available from Promega is used. However, other suitable introns may be selected. In one embodiment, spacers are included such that the vector genome is approximately the same size as the native AAV vector genome (e.g., between 4.1 and 5.2 kb). In one embodiment, spacers are included such that the vector genome is approximately 4.7 kb. See, Wu et al, Effect of Genome Size on AAV Vector Packaging, Mol Ther. 2010 Jan; 18(1): 80-86, which is incorporated herein by reference.
In certain embodiments, the vector genome further comprises dorsal root ganglion (drg)- specific miRNA detargeting sequences operably linked to the transgene coding sequence. In certain embodiments, the tandem miRNA target sequences are continuous or are separated by a spacer of 1 to 10 nucleic acids, wherein said spacer is not an miRNA target sequence. In certain embodiments, there are at least two drg-specific miRNA sequences located at 3’ to a functional transgene coding sequence. In certain embodiments, the start of the first of the at least two drg- specific miRNA tandem repeats is within 20 nucleotides from the 3’ end of the transgene coding sequence. In certain embodiments, the start of the first of the at least two drg-specific miRNA tandem repeats is at least 100 nucleotides from the 3’ end of the functional transgene coding sequence. In certain embodiments, the miRNA tandem repeats comprise 200 to 1200 nucleotides in length. In certain embodiments, there are at least two drg-specific miRNA target sequences located at 5’ to the functional transgene coding sequence. In certain embodiments, at least two drg-specific miRNA target sequences are located in both 5’ and 3’ to the functional transgene coding sequence. In certain embodiments, the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is selected from (I) AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 49); (h) AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 50), (in)
AGT GT GAGTT CT ACC ATTGCC AA A (SEQ ID NO: 51); or (IV)
AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 52). In certain embodiments, the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 49). In certain embodiments, the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (miR182, SEQ ID NO: 49). In certain embodiments, two or more consecutive miRNA target sequences are continuous and not separated by a spacer. In certain embodiments, two or more of the miRNA target sequences are separated by a spacer and each spacer is independently selected from one or more of (A) GGAT; (B) CACGTG; or (C) GCATGC. In certain embodiments, the spacer located between the miRNA target sequences may be located 3’ to the first miRNA target sequence and/or 5’ to the last miRNA target sequence. In certain embodiments, the spacers between the miRNA target sequences are the same. See International Patent Application No. WO2020/132455, published June 25, 2020, US Provisional Patent Application No. 63/023,593, filed May 12, 2020, US Provisional Patent Application No. 63/038,488, filed June 12, 2020, US Provisional Patent Application No. 63/043,562, filed June 24, 2020, and US Provisional Patent Application No. 63/079,299, filed September 16, 2020, and US Provisional Patent Application No. 63/152,043, filed February 22, 2021, all of which are incorporated by reference in their entireties.
Selection of these and other common vector and regulatory elements are conventional and many such sequences are available. See, e.g., Sambrook et al, and references cited therein at, for example, pages 3.18-3.26 and 16.17-16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989. Of course, not all vectors and expression control sequences will function equally well to express all of the transgenes as described herein.
However, one of skill in the art may make a selection among these, and other, expression control sequences without departing from the scope of this invention.
In another embodiment, a method of generating a recombinant adeno-associated virus is provided. A suitable recombinant adeno-associated virus (AAV) is generated by culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein as described herein, or fragment thereof; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a heterologous nucleic acid sequence encoding a desirable transgene; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein. The components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., minigene, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
Also provided herein are host cells transfected with an AAV as described herein. Most suitably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion below of regulatory elements suitable for use with the transgene. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art. In another embodiment, the host cell comprises a nucleic acid molecule (e.g., a plasmid) as described herein. The minigene, rep sequences, cap sequences, and helper functions required for producing the rAAV described herein may be delivered to the packaging host cell in the form of any genetic element which transfers the sequences carried thereon. The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, 1993 J. Virol., 70:520-532 and US Patent 5,478,745, among others. These publications are incorporated by reference herein.
Also provided herein, are plasmids for use in producing the vectors described herein.
Such plasmids include a nucleic acid sequence that encodes at least one of the vpl, vp2, and vp3 of AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO:
18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoG014 (SEQ ID NO: 24), AAVpoG015 (SEQ ID NO: 26), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40),
AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a vpl, vp2, and/or vp3 sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46. In certain embodiments, provided are plasmids having the vpl, vp2, and/or vp3 sequence of AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoG014 (SEQ ID NO: 23), AAVpoG015 (SEQ ID NO: 25), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31),
AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO:
37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a vpl, vp2, and/or vp3 nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45. In further embodiments, the plasmids include a non- AAV sequence. Cultured host cells containing the plasmids described herein are also provided.
C. Pharmaceutical Compositions and Administration
In one embodiment, the recombinant AAV containing the desired transgene and promoter for use in the target cells as detailed above is optionally assessed for contamination by conventional methods and then formulated into a pharmaceutical composition intended for administration to a subject in need thereof. Such formulation involves the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free, phosphate buffered saline. A variety of such known carriers are provided in US Patent Publication No. 7,629,322, incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or Tween20. In another embodiment, the pharmaceutically acceptable carrier comprises a surfactant, such as perfluorooctane (Perfluoron liquid). The vector is formulated in a buffer/carrier suitable for infusion in human subjects. The buffer/carrier should include a component that prevents the rAAV from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo.
In certain embodiments of the methods described herein, the pharmaceutical composition described above is administered to the subject intramuscularly (IM). In other embodiments, the pharmaceutical composition is administered by intravenously (IV). In other embodiments, the pharmaceutical composition is administered by intracerebroventricular (ICV) injection. In other embodiments, the pharmaceutical composition is administered by intra-cistema magna (ICM) injection . Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye), including subretinal or intravitreal delivery, oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.
As used herein, the terms “intrathecal delivery” or “intrathecal administration” refer to a route of administration via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital/intracistemal, and/or Cl -2 puncture. For example, material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture. In another example, injection may be into the cistema magna.
As used herein, the terms “intracistemal delivery” or “intraci sternal administration” refer to a route of administration directly into the cerebrospinal fluid of the cistema magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cistema magna or via permanently positioned tube.
The composition may be delivered in a volume of from about 0.1 pL to about 10 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume is about 50 pL. In another embodiment, the volume is about 70 pL. In another embodiment, the volume is about 100 pL. In another embodiment, the volume is about 125 pL.
In another embodiment, the volume is about 150 pL. In another embodiment, the volume is about 175 pL. In yet another embodiment, the volume is about 200 pL. In another embodiment, the volume is about 250 pL. In another embodiment, the volume is about 300 pL. In another embodiment, the volume is about 450 pL. In another embodiment, the volume is about 500 pL.
In another embodiment, the volume is about 600 pL. In another embodiment, the volume is about 750 pL. In another embodiment, the volume is about 850 pL. In another embodiment, the volume is about 1000 pL. In another embodiment, the volume is about 1.5 mL. In another embodiment, the volume is about 2 mL. In another embodiment, the volume is about 2.5 mL. In another embodiment, the volume is about 3 mL. In another embodiment, the volume is about 3.5 mL. In another embodiment, the volume is about 4 mL. In another embodiment, the volume is about 5 mL. In another embodiment, the volume is about 5.5 mL. In another embodiment, the volume is about 6 mL. In another embodiment, the volume is about 6.5 mL. In another embodiment, the volume is about 7 mL. In another embodiment, the volume is about 8 mL. In another embodiment, the volume is about 8.5 mL. In another embodiment, the volume is about 9 mL. In another embodiment, the volume is about 9.5 mL. In another embodiment, the volume is about 10 mL.
An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the regulatory sequences desirably ranges from about 107 and 1014 vector genomes per milliliter (vg/mL) (also called genome copies/mL (GC/mL)). In one embodiment, the rAAV vector genomes are measured by real-time PCR. In another embodiment, the rAAV vector genomes are measured by digital PCR. See, Lock et al, Absolute determination of single-stranded and self-complementary adeno- associated viral vector genome titers by droplet digital PCR, Hum Gene Ther Methods. 2014 Apr;25(2):115-25. doi: 10.1089/hgtb.2013.131. Epub 2014 Feb 14, which are incorporated herein by reference. In another embodiment, the rAAV infectious units are measured as described in S.K. McLaughlin et al, 1988 J. Virol., 62:1963, which is incorporated herein by reference.
Preferably, the concentration is from about 1.5 x 109 vg/mL to about 1.5 x 1013 vg/mL, and more preferably from about 1.5 x 109 vg/mL to about 1.5 x 1011 vg/mL. In one embodiment, the effective concentration is about 1.4 x 108 vg/mL. In one embodiment, the effective concentration is about 3.5 x 1010 vg/mL. In another embodiment, the effective concentration is about 5.6 x 1011 vg/mL. In another embodiment, the effective concentration is about 5.3 x 1012 vg/mL. In yet another embodiment, the effective concentration is about 1.5 x 1012 vg/mL. In another embodiment, the effective concentration is about 1.5 x 1013 vg/mL. All ranges described herein are inclusive of the endpoints.
In one embodiment, the dosage is from about 1.5 x 109 vg/kg of body weight to about 1.5 x 1013 vg/kg, and more preferably from about 1.5 x 109 vg/kg to about 1.5 x 1011 vg/kg. In one embodiment, the dosage is about 1.4 x 108 vg/kg. In one embodiment, the dosage is about 3.5 x 1010 vg/kg. In another embodiment, the dosage is about 5.6 x 1011 vg/kg. In another embodiment, the dosage is about 5.3 x 1012 vg/kg. In yet another embodiment, the dosage is about 1.5 x 1012 vg/kg. In another embodiment, the dosage is about 1.5 x 1013 vg/kg. In another embodiment, the dosage is about 3.0 x 1013 vg/kg. In another embodiment, the dosage is about 1.0 x 1014 vg/kg.
All ranges described herein are inclusive of the endpoints.
In one embodiment, the effective dosage (total genome copies delivered) is from about 107 to 1013 vector genomes. In one embodiment, the total dosage is about 108 genome copies. In one embodiment, the total dosage is about 109 genome copies. In one embodiment, the total dosage is about 1010 genome copies. In one embodiment, the total dosage is about 1011 genome copies. In one embodiment, the total dosage is about 1012 genome copies. In one embodiment, the total dosage is about 1013 genome copies. In one embodiment, the total dosage is about 1014 genome copies. In one embodiment, the total dosage is about 1015 genome copies.
It is desirable that the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity. Still other dosages and administration volumes in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular disorder and the degree to which the disorder, if progressive, has developed. Intravenous delivery, for example may require doses on the order of 1.5 X 1013 vg/kg.
D. Methods
In another aspect, a method of transducing a target cell or tissue is provided. In one embodiment, the method includes administering an rAAV as described herein. Dosages of the viral vector (for example, rAAV) depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and can thus vary among patients. For example, a therapeutically effective human dosage of the viral vector is generally in the range of from about 25 to about 1000 microliters to about 100 mL of solution containing concentrations of from about 1 x 109 to 1 x 1016 vector genome copies. In certain embodiments, a volume of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL suspension is delivered. In certain embodiments, a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL suspension is delivered. In certain embodiments, a dose of about 8.9 x 1012 to 2.7 x 1014 GC total is administered in this volume. In certain embodiments, a dose of about 1.1 xlO10 GC/g brain mass to about 3.3 x 1011 GC/g brain mass is administered in this volume. In certain embodiments, a dose of about 3.0 xlO9, about 4.0 xlO9, about 5.0 xlO9, about 6.0 xlO9, about 7.0 xlO9, about 8.0 xlO9, about 9.0 xlO9, about 1.0 xlO10, about 1.1 xlO10, about 1.5 xlO10, about 2.0 xlO10, about 2.5 xlO10, about 3.0 xlO10, about 3.3 xlO10, about 3.5 xlO10, about 4.0 xlO10, about 4.5 xlO10, about 5.0 xlO10, about 5.5 xlO10, about 6.0 xlO10, about 6.5 xlO10, about 7.0 xlO10, about 7.5 xlO10, about 8.0 xlO10, about 8.5 xlO10, about 9.0 xlO10, about 9.5 xlO10, about 1.0 xlO11, about 1.1 xlO11, about 1.5 xlO11, about 2.0 xlO11, about 2.5 xlO11, about 3.0 xlO11, about 3.3 xlO11, about 3.5 xlO11, about 4.0 xlO11, about 4.5 xlO11, about 5.0 xlO11, about 5.5 xlO11, about 6.0 xlO11, about 6.5 xlO11, about 7.0 xlO11, about 7.5 xlO11, about 8.0 xlO11, about 8.5 xlO11, about 9.0 xlO11 GC per gram brain mass is administered in this volume.
In certain embodiments, the dosage of an rAAV is about 1 x 109 GC to about 1 x 1015 genome copies (GC) per dose (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 1012 GC to 2.0 x 1015 GC for a human patient. In another embodiment, the dose is less than about 1 x 1014 GC/kg body weight of the subject. In certain embodiments, the dose administered to a patient is at least about 1.0 x 109 GC/kg , about 1.5 x 109 GC/kg , about 2.0 x 109 GC/g, about 2.5 x 109 GC/kg , about 3.0 x 109 GC/kg , about 3.5 x 109 GC/kg , about 4.0 x 109 GC/kg , about 4.5 x 109 GC/kg , about 5.0 x 109 GC/kg , about 5.5 x 109 GC/kg , about 6.0 x
109 GC/kg , about 6.5 x 109 GC/kg , about 7.0 x 109 GC/kg , about 7.5 x 109 GC/kg , about 8.0 x
109 GC/kg , about 8.5 x 109 GC/kg , about 9.0 x 109 GC/kg , about 9.5 x 109 GC/kg , about 1.0 x
1010 GC/kg , about 1.5 x 1010 GC/kg , about 2.0 x 1010 GC/kg , about 2.5 x 1010 GC/kg , about 3.0 x 1010 GC/kg , about 3.5 x 1010 GC/kg , about 4.0 x 1010 GC/kg , about 4.5 x 1010 GC/kg , about 5.0 x 1010 GC/kg , about 5.5 x 1010 GC/kg , about 6.0 x 1010 GC/kg , about 6.5 x 1010 GC/kg , about 7.0 x 1010 GC/kg , about 7.5 x 1010 GC/kg , about 8.0 x 1010 GC/kg , about 8.5 x 1010 GC/kg , about 9.0 x 1010 GC/kg , about 9.5 x 1010 GC/kg , about 1.0 x 1011 GC/kg , about 1.5 x
1011 GC/kg , about 2.0 x 1011 GC/kg , about 2.5 x 1011 GC/kg , about 3.0 x 1011 GC/kg , about 3.5 x 1011 GC/kg , about 4.0 x 1011 GC/kg , about 4.5 x 1011 GC/kg , about 5.0 x 1011 GC/kg , about
5.5 x 1011 GC/kg , about 6.0 x 1011 GC/kg , about 6.5 x 1011 GC/kg , about 7.0 x 1011 GC/kg , about 7.5 x 1011 GC/kg , about 8.0 x 1011 GC/kg , about 8.5 x 1011 GC/kg , about 9.0 x 1011 GC/kg , about 9.5 x 1011 GC/kg , about 1.0 x 1012 GC/kg , about 1.5 x 1012 GC/kg , about 2.0 x
1012 GC/kg , about 2.5 x 1012 GC/kg , about 3.0 x 1012 GC/kg , about 3.5 x 1012 GC/kg , about 4.0 x 1012 GC/kg , about 4.5 x 1012 GC/kg , about 5.0 x 1012 GC/kg , about 5.5 x 1012 GC/kg , about 6.0 x 1012 GC/kg , about 6.5 x 1012 GC/kg , about 7.0 x 1012 GC/kg , about 7.5 x 1012 GC/kg , about 8.0 x 1012 GC/kg , about 8.5 x 1012 GC/kg , about 9.0 x 1012 GC/kg , about 9.5 x 1012 GC/kg , about 1.0 x 1013 GC/kg , about 1.5 x 1013 GC/kg , about 2.0 x 1013 GC/kg , about 2.5 x
1013 GC/kg , about 3.0 x 1013 GC/kg , about 3.5 x 1013 GC/kg , about 4.0 x 1013 GC/kg , about 4.5 x 1013 GC/kg , about 5.0 x 1013 GC/kg , about 5.5 x 1013 GC/kg , about 6.0 x 1013 GC/kg , about
6.5 x 1013 GC/kg , about 7.0 x 1013 GC/kg , about 7.5 x 1013 GC/kg , about 8.0 x 1013 GC/kg , about 8.5 x 1013 GC/kg , about 9.0 x 1013 GC/kg , about 9.5 x 1013 GC/kg , or about 1.0 x 1014 GC/kg body weight or the subject.
In one embodiment, the method further comprises administering an immunosuppressive co-therapy to the subject. Such immunosuppressive co-therapy may be started prior to delivery of an rAAV or a composition as disclosed, e.g., if undesirably high neutralizing antibody levels to the AAV capsid are detected. In certain embodiments, co-therapy may also be started prior to delivery of the rAAV as a precautionary measure. In certain embodiments, immunosuppressive co-therapy is started following delivery of the rAAV, e.g., if an undesirable immune response is observed following treatment.
Immunosuppressants for such co-therapy include, but are not limited to, a glucocorticoid, steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., a rapamycin or rapalog), and cytostatic agents including an alkylating agent, an anti -metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin. The immune suppressant may include prednisolone, a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- (CD25-) or CD3-directed antibodies, anti-IL-2 antibodies, ciclosporin, tacrolimus, sirolimus, IFN-b, IFN-g, an opioid, or TNF-a (tumor necrosis factor- alpha) binding agent. In certain embodiments, the immunosuppressive therapy may be started 0, 1, 2, 7, or more days prior to the rAAV administration, or 0, 1, 2, 3, 7, or more days post the rAAV administration. Such therapy may involve a single drug (e.g., prednisolone) or co administration of two or more drugs, the (e.g., prednisolone, micophenolate mofetil (MMF) and/or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after gene therapy administration, at the same dose or an adjusted dose. Such therapy may be for about 1 week (7 days), two weeks, three weeks, about 60 days, or longer, as needed.
In certain embodiments, a tacrolimus-free regimen is selected.
In certain embodiments, a co-therapy may involve co-administration of an rAAV as provided herein in combination with a ligand which inhibits binding of human neonatal Fc receptor (FcRn) and immunoglobulin G (IgG). See, e.g., US Provisional Patent Application No. 63/040,381, filed June 17, 2020, and US Provisional Patent Application No. 63/135,998, filed January 11, 2021, and US Provisional Patent Application No. 63/153,085, filed February 22,
2021, each of which is incorporated herein by reference. In certain embodiments, the viral vector is delivered systemically. In certain embodiments, the ligand is a peptide, protein, an RNAi sequence, or a small molecule. In certain embodiments, the protein is a monoclonal antibody, an immunoadhesin, a camelid antibody, a Fab fragment, an Fv fragment, or an scFv fragment. In certain embodiments, the recombinant viral vector is a recombinant adeno-associated virus, a recombinant adenovirus, a recombinant herpes simplex virus, or a recombinant lentivirus. In certain embodiments, the ligand is a monoclonal antibody which specifically inhibits FcRn- IgG binding without interfering with FcRn-albumin binding. In certain embodiments, the monoclonal antibody is Nipocalimab (M281), rozanolixizumab (UCB7665); IMVT-1401, RVT- 1401, HL161, HBM916, ARGX-113 (efgartigimod), SYNT001, SYNT002, ABY-039, or DX- 2507, derivatives or combinations thereof. In certain embodiments, the ligand is delivered one to 2 UPN-20-9394.P3 5 10 15 2025 30 seven days prior to administration of the viral vector. In certain embodiments, the ligand is delivered daily. In certain embodiments, the ligand is dosed or administered on the same day the viral vector is administered. In certain embodiments, the ligand is dosed for one day to four weeks post-vector administration. In certain embodiments, the ligand is dosed via a different route of administration than the vector. In certain embodiments, the ligand is dosed orally. In certain embodiments, the viral vector is dosed intraperitoneally, intravenously, intramuscularly, intranasally, or intrathecally. In certain embodiments, the patient is predetermined to have a neutralizing antibody titer to the vector capsid which greater than 1:5 as determined in an in vitro assay. In certain embodiments, the patient has not previously received gene therapy prior to the delivery of the viral vector in combination with the inhibitory ligand such that the patient’s pre-existing neutralizing antibodies are a result of wild-type infection. In certain embodiments, the patient has previously received gene therapy treatment prior to the delivery of the viral vector in combination with the inhibitory immunoglobulin construct. In certain embodiments, the regimen further comprises coadministering one or more of: (a) a steroid or combination of steroids and/or (b) an IgGcleaving enzyme, (c) an inhibitor of Fc-IgE binding; (d) an inhibitor of Fc-IgM binding;
(e) an inhibitor of Fc-IgA binding; and/or (f) gamma interferon. The following example is illustrative of certain embodiments of the invention and is not a limitation thereon.
EXAMPLES
Example 1 : Isolation of novel AAV capsids from porcine tissues and production of recombinant AAV vectors
We screened porcine tissues for new AAV isolates using a high-fidelity polymerase chain reaction (PCR) protocol. Among the porcine tissues, tested the small intestine samples showed a PCR-positive rate (targeting a small and relatively diverse region flanked by conserved regions for primer binding) much higher than samples of liver, heart, lung, and spleen (FIG. 3) . We successfully recovered more than twenty new porcine AAV capsid genes (FIG. 4).
Recombinant AAV vectors were produced by using an HEK293 triple transfection protocol as previously described, using a trans plasmid encoding AAV2 rep gene functions to transcomplement the AAV2 ITRs and the selected (porcine) AAV capsid gene, a trans plasmid carrying adenovirus helper functions, and a cis plasmid comprising an AAV2 5’ ITR, an CB7.CI.eGFP.WPRE.rBG expression cassette, and AAV2 3’ ITR.
Transduction efficiency was measured in vitro using Huh7 cells. AAVpoG013 and AAVpoG015 had the highest levels of transduction (FIG. 5) and were selected for further analysis. Vectors with both capsids had very good yields (FIG. 6) and showed mouse liver transduction through intravenous injection with an efficiency comparable to AAV8 (FIG. 7).
We also evaluated AAVpoG015 for its serological profile. Preliminary results showed that AAVpoG015’s neutralizing antibody titer was only one-fold lower than AAV8’s titer when tested with two monkey sera from AAV8 vector-injected animals even though the two capsids are distant (the protein sequence similarity between AAVpoG015 and AAV8 is only 79%) (table below).
Figure imgf000088_0001
Our results indicate that 1) natural AAV diversity is rich; 2) the small intestine is rich in natural AAVs among porcine samples (unlike human samples previously investigated); and 3) AAVpoG013 and AAVpoG015 capsids are attractive candidates for liver-directed gene delivery. Example 2: Biodistribution following transgene delivery to a non-human primate using recombinant AAV having an AAVpoG015 capsid
The AAVpoG015 capsid was used to package a vector genome having an eGFP transgene under the control of a CB7 promoter (AAV.CB7.CI.eGFP.WPRE.rBG) using triple transfected of HEK293 cells as previously described (Fock et al. Hum. Gene Ther. 21, 1259-1271; Fock et al. Hum. Gene Ther. Methods 25, 115-125). Cell culture supernatant was harvested, concentrated, and purified with an iodixanol gradient.
The purified vector was delivered to a rhesus macaque intravenously at a dose of 5 x 1013 genome copies(GC)/kg. Ten days later, the animal was sacrificed and vector GC in various tissues were determined by qPCR and RT-qPCR. Tissue genomic DNA was extracted with
QIAamp DNA Mini Kit (QIAGEN), and AAV vector genomes were quantified by real-time PCR using Taqman reagents (Applied Biosystems, Fife Technologies) with primers/probe targeting the eGFP sequence of the vector. Higher levels of vector GC were detected in liver, heart, and muscle tissues (FIG. 8A and FIG. 8B). FIG. 9 shows relative AST and AFT levels following dosing. In contrast to clear AFT/AST elevation observed three days after IV dosing with a similar dose of other AAV serotypes, the AFT/AST levels were not elevated, indicating that AAVpoG015 likely induces less liver inflammation.
A dose of 3 x 1013 GC was administered to a rhesus macaque via intra-cistema magna (ICM) injected. Fifteen days later, the animal was sacrificed and levels of vector GC were determined by qPCR and RT-qPCR as described above (FIG. 10A - FIG. IOC).
(Sequence Listing Free Text)
The following information is provided for sequences containing free text under numeric identifier <223>.
Figure imgf000089_0001
Figure imgf000090_0001
All patents, patent publications, and other publications listed in this specification are incorporated herein by reference. US Provisional Patent Application No. 63/180,372, filed April 27, 2021, is incorporated by reference. The appended Sequence Listing is incorporated herein by reference. The amino acid and nucleotide sequences set forth in the SEQ ID NOs which are referenced herein and which appear in the appended Sequence Listing labeled “21- 9621PCT ST25” are incorporated by reference While the invention has been described with reference to a particularly preferred embodiment, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

CLAIMS:
1. A recombinant adeno-associated virus (rAAV) having a capsid comprising a capsid protein having a vpl, vp2, and/or vp3 sequence of AAVpoG015 (SEQ ID NO: 26), AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO:
18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoG014 (SEQ ID NO: 24), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42),
AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 32, 34, 36, 38, 40, 42, 44, or 46, and having packaged in said capsid a vector genome comprising a non- AAV nucleic acid sequence.
2. An rAAV having a capsid comprising a capsid protein encoded by a vpl, vp2, and/or vp3 sequence of AAVpoG015 (SEQ ID NO: 25), AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at least 70% identity with SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45, and having packaged in said capsid a vector genome comprising a non- AAV nucleic acid sequence.
3. The rAAV according to claim 2, wherein the sequence encodes the vpl, vp2, and/or vp3 sequence of AAVpoG015 (SEQ ID NO: 26), AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO:
14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO:
44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 32, 34, 36, 38, 40, 42, 44, or 46.
4. The rAAV according to any one of claims 1 to 3, wherein the capsid protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45.
5. The rAAV according to any one of claims 1 to 4, wherein the vector genome comprises AAV inverted terminal repeats and the non- AAV sequence operably linked to regulatory sequences that direct expression of a gene product encoded by the non- AAV nucleic acid sequence in a target cell.
6. The rAAV according to any one of claims 1 to 5, wherein the vector genome comprises a tissue-specific promoter, optionally a liver-specific promoter.
7. A host cell containing the rAAV according to any one of claims 1 to 6.
8. A pharmaceutical composition comprising an rAAV according to any one of claims 1 to 6, and a physiologically acceptable carrier, buffer, adjuvant, and/or diluent.
9. A method of delivering a transgene to a cell, said method comprising the step of contacting the cell with the rAAV according to any one of claims 1 to 6, wherein said rAAV comprises the transgene.
10. A method of generating an rAAV comprising an AAV capsid, the method comprising culturing a host cell containing: (a) a nucleic acid comprising an AAV vpl, vp2, and/or vp3 sequence of AAVpoG015 (SEQ ID NO: 25), AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO:
19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a vpl, vp2, and/or vp3 nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45, (b) a functional rep gene; (c) a minigene comprising AAV inverted terminal repeats (ITRs) and a transgene; and (d) sufficient helper functions to permit packaging of the minigene into the AAV capsid.
11. The method according to claim 10, wherein the vpl, vp2, and/or vp3 sequence encodes a sequence of AAVpoG015 (SEQ ID NO: 26), AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO:
14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO: 18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38),
AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42), AAVpoG024 (SEQ ID NO:
44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 32, 34, 36, 38, 40, 42, 44, or 46.
12. A composition comprising a stock of the rAAV generated according to the method of claim 10 or 11.
13. A plasmid comprising a vpl, vp2, and/or vp3 nucleotide sequence of AAVpoG015 (SEQ ID NO: 25), AAVpoGOOl (SEQ ID NO: 1), AAVpoG002 (SEQ ID NO: 3), AAVpoG003 (SEQ ID NO: 5), AAVpoG004 (SEQ ID NO: 7), AAVpoG005 (SEQ ID NO: 9), AAVpoG006 (SEQ ID NO: 11), AAVpoG007 (SEQ ID NO: 13), AAVpoG008 (SEQ ID NO: 15), AAVpoG009 (SEQ ID NO: 17), AAVpoG012 (SEQ ID NO: 19), AAVpoG013 (SEQ ID NO: 21), AAVpoGOM (SEQ ID NO: 23), AAVpoG016 (SEQ ID NO: 27), AAVpoG017 (SEQ ID NO: 29), AAVpoG018 (SEQ ID NO: 31), AAVpoG019 (SEQ ID NO: 33), AAVpoG020 (SEQ ID NO: 35), AAVpoG021 (SEQ ID NO: 37), AAVpoG022 (SEQ ID NO: 39), AAVpoG023 (SEQ ID NO: 41), AAVpoG024 (SEQ ID NO: 43), or AAVpoG025 (SEQ ID NO: 45), or a sequence sharing at 70% identity with a vpl, vp2, and/or vp3 nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45.
14. The plasmid according to claim 12, wherein the vpl, vp2, and/or vp3 nucleotide sequence encodes the vpl, vp2, and/or vp3 sequence of AAVpoG015 (SEQ ID NO: 26), AAVpoGOOl (SEQ ID NO: 2), AAVpoG002 (SEQ ID NO: 4), AAVpoG003 (SEQ ID NO: 6), AAVpoG004 (SEQ ID NO: 8), AAVpoG005 (SEQ ID NO: 10), AAVpoG006 (SEQ ID NO: 12), AAVpoG007 (SEQ ID NO: 14), AAVpoG008 (SEQ ID NO: 16), AAVpoG009 (SEQ ID NO:
18), AAVpoG012 (SEQ ID NO: 20), AAVpoG013 (SEQ ID NO: 22), AAVpoGOM (SEQ ID NO: 24), AAVpoG016 (SEQ ID NO: 28), AAVpoG017 (SEQ ID NO: 30), AAVpoG018 (SEQ ID NO: 32), AAVpoG019 (SEQ ID NO: 34), AAVpoG020 (SEQ ID NO: 36), AAVpoG021 (SEQ ID NO: 38), AAVpoG022 (SEQ ID NO: 40), AAVpoG023 (SEQ ID NO: 42),
AAVpoG024 (SEQ ID NO: 44), or AAVpoG025 (SEQ ID NO: 46), or a sequence sharing at least 98% or at least 99% identity with any of SEQ ID NO: 2, 4, 6, 8, or a sequence sharing at least 96%, at least 97%, at least 98%, or at least 99% identity with any of SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or a sequence sharing at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity any of SEQ ID NO: 32, 34, 36, 38, 40, 42, 44, or 46.
15. A cultured host cell containing the plasmid according to claim 13 or 14.
PCT/US2022/026531 2021-04-27 2022-04-27 Porcine-derived adeno-associated virus capsids and uses thereof WO2022232267A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163180372P 2021-04-27 2021-04-27
US63/180,372 2021-04-27

Publications (1)

Publication Number Publication Date
WO2022232267A1 true WO2022232267A1 (en) 2022-11-03

Family

ID=81654855

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/026531 WO2022232267A1 (en) 2021-04-27 2022-04-27 Porcine-derived adeno-associated virus capsids and uses thereof

Country Status (3)

Country Link
AR (1) AR125467A1 (en)
TW (1) TW202309066A (en)
WO (1) WO2022232267A1 (en)

Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US5972596A (en) 1992-03-27 1999-10-26 The United States Of America As Represented By The Department Of Health And Human Services Nucleic acid constructs containing HIV genes with mutated inhibitory/instability regions and methods of using same
US6200560B1 (en) 1998-10-20 2001-03-13 Avigen, Inc. Adeno-associated virus vectors for expression of factor VIII by target cells
US6221349B1 (en) 1998-10-20 2001-04-24 Avigen, Inc. Adeno-associated vectors for expression of factor VIII by target cells
US20060136184A1 (en) 2003-08-01 2006-06-22 Dna Twopointo Inc. Systems and methods for antibody engineering
WO2007047859A2 (en) 2005-10-18 2007-04-26 Precision Biosciences Rationally-designed meganucleases with altered sequence specificity and dna-binding affinity
US7282199B2 (en) 2001-12-17 2007-10-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
US7442373B2 (en) 2003-11-14 2008-10-28 Emergent Product Development Gaithersburg Inc. Antibodies against protective antigen and methods of use for passive immunization and treatment of anthrax
WO2009059195A2 (en) 2007-10-31 2009-05-07 Precision Biosciences Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US7629322B2 (en) 2003-06-11 2009-12-08 Kleinschmidt Juergon AAV vector for gene therapy
WO2011126808A2 (en) 2010-03-29 2011-10-13 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
US20120141422A1 (en) 2009-07-31 2012-06-07 Association Institute De Myologie Widespread gene delivery to the retina using systemic administration of aav vectors
WO2013004943A1 (en) 2011-07-06 2013-01-10 Gaztransport Et Technigaz Thermally-insulating sealed tank built into a load-bearing structure
WO2013155222A2 (en) 2012-04-10 2013-10-17 The Regents Of The University Of California Brain-specific enhancers for cell-based therapy
US20140032186A1 (en) 2003-08-01 2014-01-30 Dna Twopointo, Inc. Systems and methods for antibody engineering
WO2015012924A2 (en) 2013-04-29 2015-01-29 The Trustees Of The University Of Pennsylvania Tissue preferential codon modified expression cassettes, vectors containing same, and use thereof
WO2015164778A1 (en) 2014-04-25 2015-10-29 The Trustees Of The University Of Pennysylvania Ldlr variants and their use in compositions for reducing cholesterol levels
WO2015191508A1 (en) * 2014-06-09 2015-12-17 Voyager Therapeutics, Inc. Chimeric capsids
WO2017075119A1 (en) 2015-10-28 2017-05-04 The Trustees Of The Univeresity Of Pennsylvania Intrathecal administration of adeno-associated-viral vectors for gene therapy
US9683257B2 (en) 2008-07-14 2017-06-20 Precision Biosciences, Inc. Recognition sequences for I-CreI-derived meganucleases and uses thereof
US20180110877A1 (en) 2015-04-27 2018-04-26 The Trustees Of The University Of Pennsylvania DUAL AAV VECTOR SYSTEM FOR CRISPR/Cas9 MEDIATED CORRECTION OF HUMAN DISEASE
WO2018195449A1 (en) 2017-04-21 2018-10-25 Precision Biosciences, Inc. Engineered meganucleases specific for recognition sequences in the pcsk9 gene
WO2019191701A1 (en) * 2018-03-30 2019-10-03 The Board Of Trustees Of Leland Stanford Junior University Novel recombinant adeno-associated virus capsids with enhanced human pancreatic tropism
WO2019222441A1 (en) * 2018-05-16 2019-11-21 Voyager Therapeutics, Inc. Aav serotypes for brain specific payload delivery
WO2020132455A1 (en) 2018-12-21 2020-06-25 The Trustees Of The University Of Pennsylvania Compositions for drg-specific reduction of transgene expression

Patent Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5972596A (en) 1992-03-27 1999-10-26 The United States Of America As Represented By The Department Of Health And Human Services Nucleic acid constructs containing HIV genes with mutated inhibitory/instability regions and methods of using same
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US6200560B1 (en) 1998-10-20 2001-03-13 Avigen, Inc. Adeno-associated virus vectors for expression of factor VIII by target cells
US6221349B1 (en) 1998-10-20 2001-04-24 Avigen, Inc. Adeno-associated vectors for expression of factor VIII by target cells
US7282199B2 (en) 2001-12-17 2007-10-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
US7629322B2 (en) 2003-06-11 2009-12-08 Kleinschmidt Juergon AAV vector for gene therapy
US20060136184A1 (en) 2003-08-01 2006-06-22 Dna Twopointo Inc. Systems and methods for antibody engineering
US20140032186A1 (en) 2003-08-01 2014-01-30 Dna Twopointo, Inc. Systems and methods for antibody engineering
US7442373B2 (en) 2003-11-14 2008-10-28 Emergent Product Development Gaithersburg Inc. Antibodies against protective antigen and methods of use for passive immunization and treatment of anthrax
WO2007047859A2 (en) 2005-10-18 2007-04-26 Precision Biosciences Rationally-designed meganucleases with altered sequence specificity and dna-binding affinity
WO2009059195A2 (en) 2007-10-31 2009-05-07 Precision Biosciences Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US8445251B2 (en) 2007-10-31 2013-05-21 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US9340777B2 (en) 2007-10-31 2016-05-17 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US9434931B2 (en) 2007-10-31 2016-09-06 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US9683257B2 (en) 2008-07-14 2017-06-20 Precision Biosciences, Inc. Recognition sequences for I-CreI-derived meganucleases and uses thereof
US20120141422A1 (en) 2009-07-31 2012-06-07 Association Institute De Myologie Widespread gene delivery to the retina using systemic administration of aav vectors
WO2011126808A2 (en) 2010-03-29 2011-10-13 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
WO2013004943A1 (en) 2011-07-06 2013-01-10 Gaztransport Et Technigaz Thermally-insulating sealed tank built into a load-bearing structure
WO2013155222A2 (en) 2012-04-10 2013-10-17 The Regents Of The University Of California Brain-specific enhancers for cell-based therapy
WO2015012924A2 (en) 2013-04-29 2015-01-29 The Trustees Of The University Of Pennsylvania Tissue preferential codon modified expression cassettes, vectors containing same, and use thereof
WO2015164778A1 (en) 2014-04-25 2015-10-29 The Trustees Of The University Of Pennysylvania Ldlr variants and their use in compositions for reducing cholesterol levels
WO2015191508A1 (en) * 2014-06-09 2015-12-17 Voyager Therapeutics, Inc. Chimeric capsids
US20180110877A1 (en) 2015-04-27 2018-04-26 The Trustees Of The University Of Pennsylvania DUAL AAV VECTOR SYSTEM FOR CRISPR/Cas9 MEDIATED CORRECTION OF HUMAN DISEASE
WO2017075119A1 (en) 2015-10-28 2017-05-04 The Trustees Of The Univeresity Of Pennsylvania Intrathecal administration of adeno-associated-viral vectors for gene therapy
WO2018195449A1 (en) 2017-04-21 2018-10-25 Precision Biosciences, Inc. Engineered meganucleases specific for recognition sequences in the pcsk9 gene
WO2019191701A1 (en) * 2018-03-30 2019-10-03 The Board Of Trustees Of Leland Stanford Junior University Novel recombinant adeno-associated virus capsids with enhanced human pancreatic tropism
WO2019222441A1 (en) * 2018-05-16 2019-11-21 Voyager Therapeutics, Inc. Aav serotypes for brain specific payload delivery
WO2020132455A1 (en) 2018-12-21 2020-06-25 The Trustees Of The University Of Pennsylvania Compositions for drg-specific reduction of transgene expression

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
ALEXANDER BELLO ET AL: "Novel Adeno-associated Viruses Derived From Pig Tissues Transduce Most Major Organs in Mice", SCIENTIFIC REPORTS, vol. 4, 22 October 2014 (2014-10-22), pages 6644, XP055349487, DOI: 10.1038/srep06644 *
ARBUTHNOT ET AL., HUM. GENE THER., vol. 7, no. 1503, 1996, pages 14
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY & SONS
D.H. BAROUCH ET AL., J. VIROL., vol. 75, no. 5, March 2001 (2001-03-01), pages 2462 - 2467
ELLIS ET AL., GENE THERAPY, vol. 20, January 2012 (2012-01-01), pages 35 - 42
HUM GENE THER METHODS, vol. 25, no. 2, April 2014 (2014-04-01), pages 115 - 25
K. FISHER ET AL., J. VIROL., vol. 70, 1993, pages 520 - 532
L. WANGI. VERMA, PROC. NATL. ACAD. SCI., USA, vol. 96, 1999, pages 3906 - 3910
LEVY ET AL.: "Cytosine and adenine base editing of the brain, liver, retina, heart and skeletal muscle of mice via adeno-associated viruses", NATURE BIOMEDICAL ENGINEERING, vol. 4, January 2020 (2020-01-01), pages 97 - 110, XP036990727, DOI: 10.1038/s41551-019-0501-5
LOCK ET AL., HUM. GENE THER. METHODS, vol. 25, pages 115 - 125
LOCK ET AL., HUM. GENE THER., vol. 21, pages 1259 - 1271
MILLINGTON-WARD ET AL., MOLECULAR THERAPY, vol. 19, no. 4, April 2011 (2011-04-01), pages 642 - 649
MIYATAKE ET AL., J. VIROL., vol. 71, no. 5124, 1997, pages 32
NELLES ET AL.: "Programmable RNA Tracking in Live Cells with CRISPR/Cas9", CELL, vol. 165, no. 2, April 2016 (2016-04-01), pages 488 - 96, XP029496630, DOI: 10.1016/j.cell.2016.02.054
NICOUD, J GENE MED, vol. 9, no. 12, December 2007 (2007-12-01), pages 1015 - 23
O'REILLY M ET AL., AM J HUM GENET, vol. 81, no. l, July 2007 (2007-07-01), pages 127 - 35
R. SAWADA-HIRAI ET AL., J IMMUNE BASED THER VACCINES, vol. 2, 12 May 2004 (2004-05-12), pages 5
R.R. AMARA ET AL., SCIENCE, vol. 292, 6 April 2001 (2001-04-06), pages 69 - 74
RASOWO ET AL., EUROPEAN SCIENTIFIC JOURNAL, vol. 10, no. 18, June 2014 (2014-06-01)
S.K. MCLAUGHLIN ET AL., J. VIROL., vol. 62, 1988, pages 1963
SANDIG ET AL., GENE THER., vol. 3, no. 1002, 1996, pages 9
SUN ET AL., INT J CANCER, vol. 126, no. 3, 1 February 2010 (2010-02-01), pages 764 - 74
WANG ET AL., GENE THER, vol. 15, no. 22, November 2008 (2008-11-01), pages 1489 - 99
WU ET AL.: "Effect of Genome Size on AAV Vector Packaging", MOL THER, vol. 18, no. 1, January 2010 (2010-01-01), pages 80 - 86, XP055235504, DOI: 10.1038/mt.2009.255
X. JIN ET AL., HU GENE THERAPY METHODS, vol. 28, no. 5, 16 June 2017 (2017-06-16), pages 255 - 267
ZEITZ ET AL., AM J HUM GENET, vol. 92, no. 1, 10 January 2013 (2013-01-10), pages 67 - 75

Also Published As

Publication number Publication date
TW202309066A (en) 2023-03-01
AR125467A1 (en) 2023-07-19

Similar Documents

Publication Publication Date Title
US20240117322A1 (en) Novel adeno-associated virus (aav) clade f vector and uses therefor
US20200407750A1 (en) Novel adeno-associated virus (aav) vectors, aav vectors having reduced capsid deamidation and uses therefor
US20210123073A1 (en) Novel adeno-associated virus (aav) vectors, aav vectors having reduced capsid deamidation and uses therefor
US20180265863A1 (en) Novel high efficiency library-identified aav vectors
US20230407333A1 (en) Aav capsids and compositions containing same
US20230002788A1 (en) Aav3b variants with improved production yield and liver tropism
WO2022232267A1 (en) Porcine-derived adeno-associated virus capsids and uses thereof
WO2024015966A2 (en) Recombinant aav having aav clade d and clade e capsids and compositions containing same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22723905

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22723905

Country of ref document: EP

Kind code of ref document: A1