EP4153733A1 - Verwendung eines fusionsproteins zur induktion genetischer modifikationen durch gezielte meiotische rekombination - Google Patents

Verwendung eines fusionsproteins zur induktion genetischer modifikationen durch gezielte meiotische rekombination

Info

Publication number
EP4153733A1
EP4153733A1 EP21733496.0A EP21733496A EP4153733A1 EP 4153733 A1 EP4153733 A1 EP 4153733A1 EP 21733496 A EP21733496 A EP 21733496A EP 4153733 A1 EP4153733 A1 EP 4153733A1
Authority
EP
European Patent Office
Prior art keywords
fusion protein
cell
nuclease
spoll
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP21733496.0A
Other languages
English (en)
French (fr)
Inventor
Alexandre SERERO
Alain Nicolas
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut Curie
Sorbonne Universite
Meiogenix SAS
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut Curie
Sorbonne Universite
Meiogenix SAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Institut Curie, Sorbonne Universite, Meiogenix SAS filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP4153733A1 publication Critical patent/EP4153733A1/de
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y599/00—Other isomerases (5.99)
    • C12Y599/01—Other isomerases (5.99.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to the field of targeted genetic modifications in eukaryotes. It relates in particular to a method for improving or modifying a eukaryotic cell by inducing targeted meiotic recombinations.
  • BACKGROUND OF THE INVENTION Modification of the genetic material of eukaryotic organisms has greatly developed over the past twenty years, and has found application in the field of plants, human and animal cells as well as microorganisms such as as yeasts for applications in the fields of agriculture, human health, agro-food G and environmental protection.
  • Yeasts find their application in extremely varied industrial fields. Due to the harmlessness of a large number of species, yeasts are used in particular in the food industry as a fermentation agent in bakery, brewery, wine making or distillery, or in the form of extracts as nutritional elements or agents. of palatability.
  • yeasts and plants The diversity of industrial applications of yeasts and plants implies that there is a constant demand for strains of yeast and plant varieties exhibiting improved characteristics or, at the very least, adapted to a new use or new cultivation conditions.
  • those skilled in the art can use sexual reproduction and select a cell or a hybrid organism providing the desired combination. parental characteristics. This method is however random and the selection step can generate significant delays, especially in the case of yeasts and plants.
  • GMOs genetically modified organisms
  • a third alternative consists in causing a reassortment of alleles of paternal and maternal origin in the genome, during meiotic recombination.
  • Meiotic recombination is an exchange of DNA between homologous chromosomes during meiosis. After DNA replication, recombination is initiated by the formation of double-stranded breaks in one (or the other) chromatids of homologous chromosomes, followed by the repair of these breaks, using a chromatid from homologous chromosome.
  • Meiotic recombinations however, have the disadvantage of being non-uniform. Indeed, the double-stranded cut sites at the origin of these recombinations are not distributed homogeneously in the genome.
  • Spoll is the protein catalyzing double-stranded breaks during meiosis. It acts as a dimer in cooperation with other partner proteins. To this day, the factors determining the choice of double-strand cleavage sites by Spoll and its partners remain poorly understood.
  • the objective of the present invention is to provide a fusion protein as well as a method for inducing targeted meiotic recombinations in eukaryotic cells, preferably yeast or plant cells, in any region of the genome. , preferably several different regions of the genome, independently of any known binding site, and in particular in so-called “cold” chromosomal regions.
  • the present invention relates to a fusion protein comprising (i) a nuclease associated with a CRIS PR system, preferably a class 2 CRIS PR system, and (ii) a Spoll protein or one of its partners involved in the formation and repair of double-stranded breaks during meiosis, in which the nuclease associated with the CRISPR system is not a Cas9 nuclease.
  • the nuclease associated with a CRISPR system is not a class II and type IL nuclease
  • the nuclease (i) is associated with a class II CRISPR system, preferably of type V.
  • the nuclease associated with a CRISPR system is a Cpfl nuclease.
  • said Cpfl nuclease may be a Cpfl nuclease comprising a sequence chosen from the sequences SEQ ID NO: 3, 4 and 22 to 33, and variants of said sequences exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these sequences and Cpfl activity.
  • the fusion protein may comprise a nuclease associated with a CRISPR system that is deficient for nuclease activity.
  • this nuclease can be a variant of a wild-type Cpfl protein exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with said Cpfl protein and in which the corresponding residue to the aspartate at position 832 of SEQ ID NO: 4 is substituted, preferably by an alanine.
  • this nuclease can be a variant of a Cpfl protein chosen from the sequences SEQ ID NO: 3, 4 and 22 to 33, exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with said sequence and in which the residue corresponding to the aspartate at position 832 of SEQ ID NO: 4 is substituted, preferably by an alanine.
  • the fusion protein comprises a Spol 1 protein.
  • the Spoll protein can in particular be chosen from the sequences of SEQ ID NOs: 1, 10 to 21 and 40-42, and the variants thereof comprising a sequence exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these sequences and a Spoll activity.
  • the fusion protein may comprise a Spoll protein deficient for nuclease activity.
  • the Spoll protein deficient for nuclease activity may be a variant of a wild-type Spoll protein exhibiting at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% of identity with said Spoll protein and in which the residue corresponding to the tyrosine at position 135 of SEQ ID NO: 1 is substituted, preferably by a phenylalanine.
  • the Spoll protein deficient for nuclease activity can be a variant of a Spoll protein of one of the sequences SEQ ID NO: 1, 10 to 21 and 40-42, comprising a sequence having at least 80%, 85 %, 90%, 95%, 96%, 97%, 98%, or at least 99% identity with one of these sequences and in which the residue corresponding to tyrosine at position 135 of SEQ ID NO: 1 is substituted, preferably by phenylalanine.
  • the fusion protein can comprise a Spoll partner, preferably chosen from the group consisting of Rec102, MTOPVIB / TOPOVIBL, Rec103 / Ski8, Rec104, Red 14, Merl, Mer2 / Recl07, Mei4, Mre2 / Nam8, Mrell, Rad50, Xrs2 / Nbsl, Hopl, Redl, Mekl, Setl and Sppl, and the orthologs thereof.
  • a Spoll partner preferably chosen from the group consisting of Rec102, MTOPVIB / TOPOVIBL, Rec103 / Ski8, Rec104, Red 14, Merl, Mer2 / Recl07, Mei4, Mre2 / Nam8, Mrell, Rad50, Xrs2 / Nbsl, Hopl, Redl, Mekl, Setl and Sppl, and the orthologs thereof.
  • the present invention relates to a nucleic acid encoding the fusion protein defined above.
  • the present invention also relates to an expression cassette or a vector comprising a nucleic acid as defined above.
  • the present invention also relates to a host cell, preferably non-human, comprising a fusion protein, a nucleic acid, a cassette or a vector as defined above.
  • the host cell is a eukaryotic cell, more preferably a yeast, plant, fungal or animal cell, and very particularly preferably the host cell is a plant cell or a yeast cell.
  • the host cell is a plant cell, the plant preferably being of agronomic, horticultural, pharmaceutical or cosmetic interest, in particular vegetables, fruits, herbs, flowers, trees and shrubs.
  • the plant cell is selected from monocotyledonous plants and dicotyledonous plants, more particularly preferably selected from the group consisting of rice, wheat, soybean, corn, tomato, onion, sugar.
  • the plant cell can be selected from the group consisting of rice, wheat, soybean, corn, tomato, onion, cucumber, lettuce, asparagus, carrot, turnip, Arabidopsis thaliana, barley, rapeseed, cotton, grapevine, sugar cane, beet, cotton, sunflower, olive palm, coffee , tea, cocoa, chicory, pepper, chili, lemon, orange, nectarine, mango, apple, banana, peach, apricot, sweet potatoes, yams, almonds, hazelnuts, strawberries, melons, watermelons, olive trees, and horticultural plants such as roses, tulips, orchids and geraniums.
  • the plant cell is selected from the group consisting of rice, wheat, soybean, corn and tomato.
  • the invention relates to a method for inducing targeted meiotic recombinations in a eukaryotic cell, preferably non-human, comprising
  • the present invention also relates, in a sixth aspect, to a method for generating variants of a eukaryotic organism, preferably non-human, comprising:
  • the present invention also relates to a method for identifying or locating genetic information encoding a characteristic of interest in a eukaryotic cell genome, preferably non-human, comprising:
  • the characteristic of interest is a quantitative characteristic of interest (QTL).
  • the present invention finally relates to the use of a fusion protein, of a nucleic acid, of an expression cassette or of a vector for (i) inducing targeted meiotic recombinations in a cell.
  • eukaryotic preferably non-human
  • (ii) generate variants of a eukaryotic, preferably non-human organism, and / or
  • iii) identify or locate genetic information encoding a characteristic of interest in a eukaryotic cell genome , preferably non-human.
  • the eukaryotic cell is a yeast, plant, fungus or animal cell, preferably a yeast, plant or fungus cell.
  • FIG. 1 illustrates the formation of meiotic double-stranded breaks (CBD) induced by the Cpf 1 -Spo 1 1 Y135F fusion protein and their repair by homologous recombination in the promoter region of the GAL2 gene.
  • Figure 2 illustrates the ability of the Cpfl -Spo 11 Y135F fusion protein to stimulate meiotic recombination in the target region of the promoter of the GAL2 gene.
  • the CRISPR system (“Clustered Regularly Interspaced Short Palindromie Repeats”) is a defense system demonstrated in bacteria and archaea against DNA foreigners. These short fragments corresponding to the infectious agent are inserted into a series of CRISPR repeats and are used as a CRISPR RNA guide (crRNA) to target the infectious agent in subsequent infections.
  • This system is essentially based on the association of a Cas endonuclease protein (CRISPR-associated) and a “guide” RNA (gRNA or sgRNA) responsible for the specificity of the cleavage site. It allows double-stranded DNA (CBD) breaks to be made at sites targeted by the CRISPR system.
  • CRISPR-associated Cas endonuclease protein
  • gRNA or sgRNA guide RNA
  • CRISPR systems There are five main types of CRISPR systems that are distinguished by the repertoires of genes associated with CRISPR, the organization of Cas operons, and the structure of repeats within CRISPR matrices. These five types of systems have been divided into two classes: class I grouping together types I, III and IV which use a multimeric crRNA effector module and class II grouping together types II, V and VI which use a monomeric crRNA effector module.
  • the class II and type II CRISPR systems predominantly represented by the Cas9 and Csn2 nucleases, comprise a small trans-acting RNA called tracrRNA ("trans-acting crRNA") which pairs with each repeat of the pre-crRNA (“ CRISPR RNA ”) to form a double-stranded RNA [tracrRNA: crRNA] cleaved by RNase III in the presence of the endonuclease.
  • trans-acting crRNA small trans-acting RNA
  • CRISPR RNA pre-crRNA
  • the class II and type VI CRISPR systems are represented by the proteins Cl 3a (previously known as C2c2), Cl 3b and Cl 3c.
  • the CRISPR-C13 system was discovered in the bacterium Leptotrichia shahii (Abudayyeh et al., Science 2016; 353 (6299): aaf5573) and is analogous to the CRISPR-Cas9 system.
  • Cas9 which targets DNA
  • O3 proteins target and cleave single stranded RNA.
  • Cpfl nuclease also called Cas 12a
  • C2cl also called Cas 12b
  • C2c3 nucleases identified in Alicyclobacillus acidoterrestris (Shmakov et al., Molecular Cell, 2015 Volume 60, Issue 3, P385-397).
  • Cpfl contains a mixed alpha / beta domain, an RuvC-I domain followed by a helical region, an RuvC-II domain and a zinc finger domain.
  • a functional CRISPR-Cpfl system does not require tracrRNA but only crRNA.
  • a crRNA of 42-44 nucleotides with a direct repeat sequence of about 19 nucleotides followed by a proto-spacer sequence of 23-25 nucleotides is sufficient to guide the endonuclease Cpfl to the target nucleic acid.
  • the Cpfl-crRNA complex cleaves the target DNA or RNA by identifying a 5'-YTN-3 'or 5'-TTTN-3' PAM motif adjacent to the protospacer (where "Y” is a pyrimidine and "N "is any nucleobase), as opposed to the guanine-rich PAM motif (5'-NGG-3 ') targeted by Cas9.
  • Cpf1 introduces a double-stranded break releasing sticky ends, generally generating 4 or 5 overhanging nucleotides.
  • This type of cut is different from the breaks generated by class II and type II nucleases such as Cas9, which generate blunt ends after cleavage, and allows, like a Velcro, to carry out directional insertions of genes, analogous to those achieved by traditional restriction enzymes.
  • Cpfl cleaves DNA 18-23 bp downstream of the PAM site, which results in no disturbance of the recognition sequence after repair of double-stranded breaks (CBD). As a result, Cpfl allows multiple rounds of DNA cleavage and offers an increased possibility of obtaining the desired genomic modification.
  • the inventors have demonstrated that it is possible to modify the CRISPR-Cpfl system in order to induce targeted meiotic recombinations in a eukaryotic cell, and in particular in a yeast or a plant cell. They have in fact shown that the combined expression of a fusion protein comprising a Cpfl domain and a Spol 1 domain and of a guide RNA surprisingly made it possible to induce targeted meiotic recombinations by means of double-strand breaks. during meiosis prophase I and repair of these breaks.
  • the present invention relates to a fusion protein comprising (i) a first domain (CRISPR domain) which is a nuclease associated with a CRISPR system, preferably a class II CRISPR system, and (ii) a second domain (Spoll domain) which is a Spoll protein or one of the Spoll partners involved in the formation and repair of double-stranded breaks during meiosis.
  • CRISPR domain a nuclease associated with a CRISPR system
  • Spoll domain which is a Spoll protein or one of the Spoll partners involved in the formation and repair of double-stranded breaks during meiosis.
  • fusion protein refers to a chimeric protein comprising at least two domains derived from the combination of different proteins or protein fragments.
  • the nucleic acid encoding this protein is obtained by juxtaposition of the regions encoding the proteins or protein fragments so that they are in phase and transcribed on the same mRNA.
  • the different domains of the fusion protein can be directly adjacent or be separated by binding sequences (or linker) which introduce a certain structural flexibility in the construction.
  • the fusion protein according to the present invention comprises a first domain (CRISPR domain) which is a nuclease associated with a CRISPR system and a second domain (Spol 1 domain) which is a Spol 1 protein or one of the Spol 1 partners involved.
  • CRISPR domain a nuclease associated with a CRISPR system
  • Spol 1 domain a second domain which is a Spol 1 protein or one of the Spol 1 partners involved.
  • Spoll is a protein related to the catalytic subunit A of a type II topoisomerase present in archaebacteria (Bergerat et al, Nature, vol. 386, pp 414-7). It catalyzes DNA double-strand breaks initiating meiotic recombinations. It is a protein very conserved at the evolutionary level for which there are homologs in all eukaryotes.
  • Spoll is active as a dimer made up of two subunits, each of which cleaves a strand of DNA. Although essential, Spoll does not act on its own to generate double-stranded breaks during meiosis. In the yeast S. cerevisiae, for example, it cooperates with the proteins, Recl02, MTOPVIB, Recl03 / Skl8, Recl04, Réel 14, Merl, Mer2 / Recl07, Mei4, Mre2 / Nam8, Mrell, Rad50, Xrs2 / Nbsl, Hopl , Redl, Mekl, Setl and Sppl as described in the articles by Keeney et al. (2001 Curr. Top. Dev. Biol, 52, pp.
  • the Spoll protein, the fragment or domain thereof as used in the present invention can be obtained from any known Spoll protein such as the Spoll protein of Saccharomyces cerevisiae (Gene ID: 856364, NCBI accession number : NP_011841 (SEQ ID NO: 1), Esposito and Esposito, Genetics, 1969, 61, pp. 79-89), the AtSpoll-1 and AtSpoll-2 proteins of Arabidopsis thaliana (Grêlon M. et al, 2001, Embo J., 20, pp. 589-600), the murine mSpoll protein (Baudat F et al, Molecular Cell, 2000, 6, pp. 989-998), the Spoll protein of C.
  • Spoll protein of Saccharomyces cerevisiae Gene ID: 856364, NCBI accession number : NP_011841 (SEQ ID NO: 1), Esposito and Esposito, Genetics, 1969, 61, pp. 79
  • the Spoll protein is obtained from one of the Spoll proteins of the eukaryotic cell of interest.
  • the Spoll domain comprises, or consists of, a Spoll protein, preferably a wild-type Spoll protein, in particular a Spoll protein of the eukaryotic cell of interest, or a sequence exhibiting at least 80%, 85 %, 90%, 95%, 96%, 97%, 98%, or at least 99% identity with said Spoll protein and exhibiting Spoll activity.
  • the Spoll domain comprises, or consists of, a Spoll protein, preferably a Spoll protein of Saccharomyces cerevisiae, such as for example the protein of sequence NP_011841 (SEQ ID NO: 1) or a sequence exhibiting at at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with a Spoll protein, preferably with a Spoll protein of Saccharomyces cerevisiae or else a related protein bearing motifs conserved with the Spoll protein , in particular the protein of sequence SEQ ID NO: 1
  • several fusion proteins according to the invention comprising different Spoll domains can be introduced into the same cell.
  • the various fusion proteins can comprise homologs different from Spol 1.
  • two fusion proteins according to the invention respectively comprising Spol domains.
  • Arabidopsis thaliana 1-1 and Spol 1-2 can be introduced into the same cell, preferably into the same Arabidopsis thaliana cell.
  • one or more fusion proteins according to the invention comprising Spol 1-1, Spol 1-2, Spol 1-3 and / or Spol 1-4 domains of rice can be introduced into the same cell. , preferably in the same rice cell.
  • the Spoll domain comprises, or consists of, a plant Spoll protein, in particular chosen from: the Spoll proteins of Arabidopsis thaliana, for example as described under the reference Uniprot Q9M4A2-1 (SEQ ID NO : 10), the Spoll proteins of Oryza sativa (rice), for example as described by Fayos I. et al., 2019 Plant Biotechnol J.
  • the Spoll domain can comprise, or consist of, a Spoll protein chosen from one of the Spoll proteins mentioned above, preferably the sequences of SEQ ID NO: I, 2 and 10 to 21 and 40-42, and variants thereof comprising a sequence exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these sequences and a Spoll activity. More particularly, the Spoll domain can comprise, or consist of, a Spoll protein chosen from the sequences of SEQ ID NOs: 1, 10 to 21 and 40-42, and the variants thereof comprising a sequence exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these sequences and Spoll activity.
  • the Spoll domain can comprise, or consist of, a Spoll protein chosen from the sequences of SEQ ID NOs: 10 to 21 and 40-42, and the variants thereof comprising a sequence exhibiting at least 80%, 85 %, 90%, 95%, 96%, 97%, 98%, or at least 99% identity with one of these sequences and Spoll activity.
  • a Spoll protein chosen from the sequences of SEQ ID NOs: 10 to 21 and 40-42, and the variants thereof comprising a sequence exhibiting at least 80%, 85 %, 90%, 95%, 96%, 97%, 98%, or at least 99% identity with one of these sequences and Spoll activity.
  • Spoll activity refers to the ability of a protein to induce double-stranded breaks during prophase I of meiosis and / or the ability of a protein to recruit one or more partners of meiosis.
  • Spoll as defined below.
  • this term refers to the ability of a protein to recruit one or more partners of Spoll and, optionally, to the ability of a protein to induce double-strand breaks during prophase I of meiosis.
  • the ability of a protein to induce double-stranded breaks during prophase I of meiosis and to recruit one or more Spo 11 partners can be easily tested by those skilled in the art, for example by a complementation test in a yeast.
  • a protein to recruit another for example of a protein to recruit a Spol 1 partner or a Spoll partner to recruit a Spoll protein, can be readily tested by those skilled in the art by the practitioner. through conventional techniques, such as the double hydride technique or the ChIP technique (chromatin immunoprecipitation).
  • the ability of a protein to induce double-strand breaks during prophase I of meiosis can be easily tested by a person skilled in the art by means of standard techniques, for example by Southern blot or by sequencing of the oligonucleotides associated with a protein, especially Spoll.
  • the term “Spoll activity” preferably refers to the ability of a protein to induce double-strand breaks during prophase I of meiosis and the ability of a protein to induce double-stranded breaks during prophase I of meiosis. protein to be recruited, directly or indirectly, one or more Spoll partners as defined below.
  • the term “Spoll activity” preferably refers to the ability of a protein to recruit one or more Spoll partners as defined below.
  • the Spoll domain of the fusion protein comprises a variant of a Spoll protein, preferably a variant whose nuclease activity has been abolished, reduced or improved compared to the wild-type Spoll protein.
  • the Spoll domain of the fusion protein according to the invention is endowed with nuclease activity and responsible for double-stranded breaks.
  • This domain may consist of a Spoll protein or a fragment thereof capable of inducing double strand breaks in DNA.
  • the Spoll domain can comprise a variant of a Spoll protein which exhibits a deficient nuclease activity also called "dead Spoll” or "dSpol 1".
  • the fusion protein used in the present invention may comprise a domain which is a nuclease associated with a CRISPR system and a Spoll domain which is a variant of Spoll exhibiting deficient nuclease activity.
  • the different Spoll domains are all deficient for nuclease activity.
  • nuclease activity refers to the enzymatic activity of an endonuclease which has an active site for creating nicks within DNA or RNA chains, preferably DNA or RNA chains. double strand DNA breaks.
  • nuclease activity “deficient” is understood in particular to mean a reduced, diminished or non-existent nuclease activity, in particular in relation to the nuclease activity of the wild-type protein from which the variant is derived.
  • the capacity for cleavage of DNA or of RNA and / or the hydrolase activity of the nuclease is reduced or diminished, in particular compared with the nuclease activity of the wild-type protein.
  • the nuclease activity of a Spoll domain exhibiting a deficient nuclease activity is reduced by at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or by 100%, relative to the nuclease activity of the wild-type Spoll domain.
  • a Spoll domain exhibiting deficient nuclease activity is a Spoll domain incapable of generating double-stranded breaks.
  • the Spoll domain exhibiting a deficient nuclease activity can comprise a mutated catalytic site which induces a deficient nuclease activity, the mutation negatively impacting the nuclease or hydrolytic capacity of the Spoll domain.
  • the Spoll domain can comprise, or consist of, a mutant Spoll protein in which the residue corresponding to the tyrosine at position 135 of SEQ ID NO: 1 is substituted, preferably by a phenylalanine.
  • a Spoll protein exhibiting such a substitution is incapable of inducing double-stranded DNA breaks (Bergerat et al, Nature, vol. 386, pp 414-417) and may in particular exhibit a sequence as described in SEQ ID NO: 2.
  • the residue corresponding to the tyrosine at position 135 of SEQ ID NO: 1 in the sequence of a Spoll protein can be easily identified by standard sequence alignment techniques.
  • the Spoll domain can be a variant of a Spoll protein, preferably of a wild-type Spoll protein, in particular of the eukaryotic cell of interest, exhibiting at least 80%, 85%, 90%, 95%, 96 %, 97%, 98%, or at least 99% identity with said Spoll protein and in which the residue corresponding to the tyrosine at position 135 of SEQ ID NO: 1 is substituted, preferably by a phenylalanine.
  • the Spoll domain can be a variant of the sequences SEQ ID NO: 1, 2 and 10 to 21 and 40-42, exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% of identity with one of these sequences and in which the residue corresponding to the tyrosine at position 135 of SEQ ID NO: 1 is substituted, preferably by a phenylalanine, as presented in SEQ ID NO: 2.
  • the Spoll domain can be a variant of a Spoll protein, said variant comprising a sequence exhibiting at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99%.
  • the Spoll domain can be a variant of a Spol 1 protein, said variant comprising a sequence exhibiting at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least. at least 99% identity with one of the sequences of SEQ ID NO: 10 to 21 and 40-42 and in which the residue corresponding to the tyrosine at position 135 of SEQ ID NO: 1 is substituted, preferably by a phenylalanine.
  • the Spoll domain exhibiting a deficient nuclease activity is still capable of recruiting one or more of the partners of Spoll, in particular one or more of the partners described below.
  • the nuclease activity of the Spoll domain may be impaired, its ability to interact with Spoll partners is preferably retained.
  • the Spoll domain of the fusion protein can be replaced by one of the Spoll partners involved in the formation and repair of double-stranded breaks during meiosis.
  • the Spoll partner as used in the fusion protein is capable of recruiting Spo 11, preferably is a protein which forms a complex with Spo 11 and thus induces the formation of double-strand breaks or their repair. This partner can be chosen from the proteins mentioned in the articles by Keeney et al.
  • the fusion protein according to the invention comprises a Spoll partner chosen from Recl02, Recl03 / Skl8, Recl04, Réel 14, MTOPOVIB, Merl, Mer2 / Recl07, Mei4, Mre2 / Nam8, Mrell, Rad50, Xrs2 / Nbsl, Hopl, Redl, Mekl, Setl, Ski8, and Sppl, and variants and orthologs thereof.
  • a Spoll partner chosen from Recl02, Recl03 / Skl8, Recl04, Réel 14, MTOPOVIB, Merl, Mer2 / Recl07, Mei4, Mre2 / Nam8, Mrell, Rad50, Xrs2 / Nbsl, Hopl, Redl, Mekl, Setl, Ski8, and Sppl, and variants and orthologs thereof.
  • the partner replacing the Spoll domain comprises a protein selected from Mei4, Mer2, Rec102, Rec104, Real 14, Set1, Sppl and MTOPVIB, and variants and orthologs of As contemplated herein, variants of these proteins exhibit at least 80, 85, 90, 95, 96, 97, 98, or at least 99% sequence identity with any of these proteins and are capable of recruiting Spoll.
  • the partner of Spoll is a topoisomerase, preferably chosen from the TOPOVIB family and one of these variants and orthologs, preferably an MTOPOVIB or MTOPOVIBL active in meiosis (Vrielynck, et al., (2016 Science 351 pp 939-943). All the embodiments described for the fusion protein with a Spol 1 domain which is a Spol 1 protein or a variant thereof, also apply to the fusion proteins in which the Spol 1 domain is one of the partners of Spol 1. 1.
  • the fusion protein according to the present invention also comprises a domain which is a nuclease associated with a CRISPR system (CRISPR domain).
  • CRISPR domain is the domain of the fusion protein that is able to interact with the guide RNA (s) and target the activity of the fusion protein to a given chromosomal region.
  • the fusion protein according to the invention comprises a nuclease associated with a class II CRISPR system, preferably of type II, V or VI, preferably of type V or of type VI, preferably of type V.
  • the fusion protein according to the invention comprises a nuclease associated with a class II and type II CRISPR system, in particular to the exclusion of a Cas9 type nuclease, for example Cns2, in particular the Cns2 nuclease from Streptococcus thermophilus, for example as described under the GenBank accession number: AEM62890.1, from Streptococcus pyogenes, for example as described under the GenBank accession number: ANC25453.1, or from Streptococcus canis for example as described under the GenBank accession number: VTR80107.1
  • the nuclease associated with a CRISPR system is not a Cas9 nuclease.
  • the fusion protein according to the invention comprises a nuclease associated with a class II and type VI CRISPR system, preferably Casl3a (C2c2), Casl3b or Casl3c, for example the Casl3a nuclease from Herbinix hemicellulosilytica, in particular as described under the GenBank accession number: WP_103203632.1, the Casl3a nuclease from Lachnospiraceae bacterium, in particular as described under the GenBank accession number: WP_022785443.1, or the Cas 13a nuclease from Leptotrichia wadei, in particular as described under the GenBank accession number: WP_021746003.1.
  • Casl3a C2c2
  • Casl3b Casl3c
  • Casl3a nuclease from Herbinix hemicellulosilytica in particular as described under the GenBank accession number: WP_103
  • the fusion protein according to the invention comprises a nuclease associated with a class II and type V CRISPR system, preferably Cpf 1 (also called Cas 12a), C2cl (also called Cas 12b) or C2c3 .
  • the fusion protein comprises a class II CRISPR domain, preferably of type V and preferably a Cpfl domain.
  • the nucleases associated with a CRISPR system can comprise, or consist of, a nuclease chosen from one of the nucleases mentioned above, and the variants thereof comprising a sequence exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these sequences, and a nuclease activity associated with a system CRISPR.
  • nuclease activity associated with a CRISPR system refers to nuclease activity and / or the ability to interact with guide DNA and recognize the targeted region of the nucleic acid.
  • the nuclease associated with a CRISPR system is a Cpfl nuclease, a variant or a fragment thereof capable of interacting with the guide RNAs.
  • the nuclease associated with a CRISPR system is a Cpfl nuclease or a variant thereof.
  • the Cpfl nuclease can be chosen from the Cpfl proteins derived from bacteria of the genus Prevotella, Moraxella, Leptospira, Lachnospiraceae, Francissela, Candidatus, Eubacterium, Parcubacteria, Peregrinibacteria, Acidmicococcus and Prophyromonas.
  • the Cpfl domain can be selected from the Cpfl proteins of Parcubacteria bacterium GWC2011_GWC2_44_17 (PbCpfl, for example as described under the Genbank accession number KKT48220.1, SEQ ID NO: 22), Peregrinibacteria bacterium GW2011_GWA_33_10 (Pegrinibacteria bacterium GW2011_GWA_33_10 for example as described under the accession number Genbank KKP36646.1, SEQ ID NO: 23), Acidaminococcus sp.
  • BVBLG (AsCpfl, for example as described under Genbank accession number WP_021736722.1, SEQ ID NO: 24), Prophyromonas macacae (PmCpfl, for example as described under Genbank accession number WP_018359861.1, SEQ ID NO: 25), Prophyromonas crevioricanis (PeCpfl, e.g. as described under Genbank accession number WP_036890108.1, SEQ ID NO: 26), Francisella tularensis (UniProtKB: A0Q7Q2, SEQ ID NO: 27) Acidaminococcus sp.
  • the Cpfl domain comprises, or consists of, a Cpfl protein chosen from wild-type Cpfl proteins, the variants and fragments of these exhibiting a Cpfl activity.
  • said variants exhibit at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these Cpfl proteins.
  • the Cpfl domain comprises, or consists of, a protein comprising a sequence chosen from the sequences described above, in particular chosen from the sequences SEQ ID NO: 22 to 33 and the variants thereof.
  • Cpf1 activity refers to nuclease activity and / or the ability to interact with guide RNA and recognize the targeted region of the nucleic acid, preferably the ability to interact. with the guide RNA and to recognize the targeted region of the nucleic acid and optionally a nuclease activity, in particular a DNA endonuclease activity.
  • the ability of a protein to interact with guide DNA and to recognize the targeted region of the nucleic acid can be easily tested by those skilled in the art, in particular by conventional techniques such as chromatin immunoprecipitation (ChIP ) with an antibody that recognizes the protein and its location on DNA by PCR or sequencing.
  • the nuclease activity, and in particular the DNA endonuclease activity can be easily tested by a person skilled in the art, in particular by conventional techniques such as hybridization of DNA by Southern blot or by using the technique described in article by Zetsche, et al. (2015) Cell, 163, 759-771.
  • Cpfl activity preferably refers to a nuclease activity, in particular DNA endonuclease and to the capacity to interact with the guide RNA and to recognize the region. targeted nucleic acid.
  • Cpfl activity preferably refers to the ability to interact with guide RNA and recognize the targeted region of nucleic acid.
  • the fusion protein comprises a variant or a mutant of Cpfl.
  • the fusion protein according to the invention can comprise a Cpfl domain whose nuclease activity has been abolished, reduced or improved.
  • This type of mutant comprises in particular mutations in the RuvC nuclease domain of Cpf1.
  • the Cpfl domain can also comprise mutations altering the recognition of PAMs as described in Gao et al., Nat Biotechnol. 2017 Aug; 35 (8): 789-792.
  • the Cpfl protein can also be truncated in order to remove the domains of the protein not essential for the functions of the fusion protein, in particular those domains of the Cpf1 protein which are not necessary for the interaction with the guide RNA.
  • the Cpfl domain comprises, or consists of, the sequence of imCpfl (SEQ ID NO: 3), or Lb Cpf 1 (SEQ ID NO: 4) or else a sequence exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these sequences.
  • the Cpfl domain comprises, or consists of, a protein comprising a sequence chosen from the sequences described above, in particular chosen from the sequences SEQ ID NO: 3, 4 and 22 to 33, and the sequences variants and fragments of said sequences exhibiting Cpf1 activity.
  • said variants exhibit at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these Cpfl proteins.
  • the Cpfl domain comprises, or consists of, a protein comprising a sequence chosen from the sequences described above, in particular chosen from the sequences SEQ ID NO: 3, 4 and 22 to 33 and the sequences. variants of said sequences comprising a sequence exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with one of these sequences and a Cpfl activity.
  • the domain which is a nuclease associated with a CRISPR system may exhibit deficient nuclease activity.
  • deficient nuclease activity is meant in particular a reduced nuclease activity, reduced or nonexistent in particular compared to the nuclease activity of the wild protein.
  • the nuclease associated with a CRISPR system exhibits reduced or suppressed DNA endonuclease activity relative to the nuclease activity of the wild-type protein. Nuclease associated with a CRISPR system which exhibits deficient nuclease activity retains its ability to interact with a guide RNA and therefore still allows the targeting of the fusion protein to a given chromosomal region.
  • the capacity for cleavage of DNA or of RNA and / or the hydrolase activity of the nuclease is reduced or diminished, in particular compared with the nuclease activity of the wild-type protein.
  • the nuclease activity of the protein associated with a CRISPR system exhibiting deficient nuclease activity is reduced by at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or by 100%, relative to the nuclease activity of the wild-type protein.
  • the nuclease associated with a CRISPR system preferably of class II and of type V, exhibiting deficient nuclease activity can comprise a mutated catalytic site, the mutation having a negative impact on the nuclease or hydrolytic capacity of the protein.
  • the nuclease associated with a CRISPR system deficient for nuclease activity can comprise, or consist of, a mutant Cpfl protein, for example as described in Zhang et al., Cell Discov. 2018; 4:36, with the D832A mutation.
  • a Cpfl protein exhibiting such a substitution is incapable of inducing double-strand breaks in DNA, and can in particular take the name “dead Cpfl” or “dCpfl”.
  • the Cpfl domain can be a variant of a Cpfl protein, preferably of a wild-type Cpfl, exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity with said Cpfl protein and in which the residue corresponding to the aspartate at position 832 of SEQ ID NO: 4 is substituted, preferably by an alanine.
  • the Cpfl domain can be a variant of the sequences SEQ ID NO: 3, 4 and 22 to 33 exhibiting at least 80, 85, 90, 95, 96, 97, 98, or at least 99% identity.
  • the dCpf 1 domain can comprise or consist of the sequence SEQ ID NO: 5 or SEQ ID NO: 6.
  • the residue corresponding to aspartate at position 832 of SEQ ID NO: 4 in the sequence of a protein Cpf1 can be easily identified by standard sequence alignment techniques.
  • the fusion protein preferably comprises at least one domain, CRISPR or Spol 1, exhibiting nuclease activity.
  • the fusion protein comprises a Spol 1 domain exhibiting nuclease activity and a domain which is a nuclease associated with a CRISPR system, preferably a Cpfl nuclease, deficient for nuclease activity.
  • the fusion protein comprises a Spoll domain deficient for nuclease activity and a domain which is a nuclease associated with a CRISPR system, preferably a Cpfl nuclease, exhibiting nuclease activity.
  • the fusion protein comprises (i) a Spoll domain exhibiting deficient nuclease activity and (ii) a CRISPR domain exhibiting deficient nuclease activity.
  • the fusion protein of the present invention can comprise a domain which is a nuclease associated with a CRISPR system and a Spoll domain, both domains having deficient nuclease activity.
  • the Spoll domain is on the N-terminal side and the CRISPR domain, preferably the Cpfl domain, on the C-terminal side of the fusion protein.
  • the Spoll domain is on the C-terminal side and the CRISPR domain, preferably the Cpfl domain, on the N-terminal side of the fusion protein.
  • the fusion protein can also include a nuclear localization signal (SLN) sequence.
  • SLN sequences are well known to those skilled in the art and generally comprise a short sequence of basic amino acids.
  • the SLN sequence can comprise the PKKKRKV sequence (SEQ ID NO: 7).
  • the SLN sequence can be present at the N-terminus, C-terminus, or in an internal region of the fusion protein.
  • the fusion protein may also include an additional domain of entry into the cell, that is, a domain that facilitates entry of the fusion protein into the cell.
  • This type of domain is well known to those skilled in the art and may for example comprise a penetrating peptide sequence derived from the TAT protein of HIV-1 such as GRKKRRQRRRPPQPKKKRKV (SEQ ID NO: 8), derived from the TLM sequence of the virus human hepatitis B such as PLSSIFSRIGDPPKKKRKV (SEQ ID NO: 9), or a polyarginine peptide sequence.
  • This domain of penetration into the cell can be present at the N-terminus, C-terminus, or within the fusion protein.
  • the fusion protein may further comprise one or more binding sequences (linkers) between the CRIS PR domain, in particular of class II, preferably of type V and preferably Cpfl, and the Spoll domain, and optionally between these domains and the other domains of the protein such as the nuclear localization signal sequence or the cell penetrating domain.
  • binding sequences linkers
  • the length of these binding sequences is easily adjustable by those skilled in the art. In general, these sequences comprise between 10 and 20 amino acids, preferably about 15 amino acids and more preferably 12 amino acids.
  • the binding sequences between the different domains can be of the same or different lengths.
  • the fusion protein comprises, or consists of, successively, from the N-terminal end to the C-terminal end: a nuclear localization signal, a first binding sequence (linkerl) , a CRISPR domain, preferably a Cpfl domain, a second binding sequence (linker2) and a Spoll domain.
  • the fusion protein comprises, or consists of, successively, from the N-terminal end to the C-terminal end: a nuclear localization signal, a first binding sequence (linkerl ), a Spoll domain, a second binding sequence (linker2) and a CRISPR domain, preferably a Cpfl domain.
  • the fusion protein can further include a tag (or tag) which is a defined sequence of amino acids. This tag can in particular be used in order to detect the expression of the fusion protein, to identify the proteins which interact with the fusion protein or to characterize the binding sites of the fusion protein in the genome. Detection of the tag attached to the fusion protein can be carried out with an antibody specific for said tag or any other technique well known to those skilled in the art.
  • Identification of proteins interacting with the fusion protein can be accomplished, for example, by co-immunoprecipitation techniques.
  • the characterization of the binding sites of the fusion protein in the genome can be carried out, for example, by techniques of immunoprecipitation, chromatin immunoprecipitation coupled with quantitative real-time PCR (ChIP-qPCR), chromatin immunoprecipitation coupled with sequencing techniques (ChIP-Seq), mapping using oligonucleotides (oligo mapping) or any other technique well known to those skilled in the art.
  • This tag can be present at the N-terminus of the fusion protein, at the C-terminus of the fusion protein, or at a non-terminal position in the fusion protein. Preferably, the tag is present at the C-terminus of the fusion protein.
  • the fusion protein can comprise one or more tags, identical or different and in any combination of localization, in particular at the level of the N-terminus, C-terminus, N- and C-terminus or in positions internal to the fusion protein.
  • Tags can be selected from the many tags well known to those skilled in the art.
  • the tags used in the present invention can be peptide tags and / or protein tags.
  • the tags used in the present invention are peptide tags.
  • peptide tags usable in the present invention include, but are not limited to, tags formed from repeats of at least six Histidines (His), in particular tags formed from six or eight histidines, as well as Flag tags, polyglutamates, hemagglutinin (HA), calmodulin, Strep, E-tag, myc, V5, Xpress, VSV, S-tag, Avi, SBP, Softag 1, Softag 2, Softag 3, isopetag, SpyTag, tetracysteines and combinations thereof -this.
  • Histidines Histidines
  • Flag tags polyglutamates
  • HA hemagglutinin
  • calmodulin Strep
  • E-tag myc
  • V5 Xpress
  • VSV Xpress
  • S-tag Avi
  • SBP Softag 1, Softag 2, Softag 3
  • isopetag SpyTag
  • tetracysteines and combinations thereof -this.
  • GST Glutathione-S-Transferase
  • CBP chitin binding protein
  • MBP thioredoxin
  • MBP carboxylated biotin transporter proteins
  • Fc fragment constant immunoglobulin
  • labels comprising a fluorescent protein such as GFP (Green Fluorescent Protein), RFP (Red Fluorescent Protein), CFP (C
  • the fusion protein comprises a tag formed from six histidines and / or one or more Flag motifs, preferably three Flag motifs.
  • the fusion protein comprises a tag formed of three Flag motifs followed by ôhistin at the C-terminal of the fusion protein.
  • the fusion protein comprises a V5 motif, preferably on the N-terminal side of the fusion protein.
  • the V5 tag is derived from a small epitope (Pk) found on the P and V proteins of the paramyxovirus of the simian virus family 5 (SV5).
  • the V5 tag is generally used with 14 amino acids (GKPIPNPLLGLDST, SEQ ID NO 38) or 9 shorter amino acids (IPNPLLGLD, SEQ ID NO: 39).
  • the fusion protein comprises a tag formed of six histidines and three Flag motifs, preferably at the C-terminal, and a V5 motif at the N-terminal.
  • the fusion protein as described above can be introduced into the cell in a protein form, in particular in its mature form or in the form of a precursor, preferably in its mature form, or in the form of an acid. nucleic acid encoding said protein.
  • protecting groups can be added to the C- and / or N-terminus in order to improve the resistance of the fusion protein to peptidases.
  • the protective group at the N-terminus may be acylation or acetylation and the protective group at the C-terminus may be amidation or esterification.
  • the action of proteases can also be counteracted by the use of amino acids of D configuration, the cyclization of the protein by formation of disulfide bonds, lactam rings or bonds between the N- and C-terminus.
  • the fusion protein can also comprise one or more amino acids which are rare amino acids in particular hydroxyproline, hydroxylysine, allohydroxylysine, 6-N-methyl lysine, N-ethylglycine, N-methylglycine, N-ethylasparagine, allo-isoleucine, N-methylisoleucine, N-methylvaline, pyroglutamine, aminobutyric acid; or synthetic amino acids in particular ornithine, norleucine, norvaline and cyclohexyl-alanine.
  • amino acids which are rare amino acids in particular hydroxyproline, hydroxylysine, allohydroxylysine, 6-N-methyl lysine, N-ethylglycine, N-methylglycine, N-ethylasparagine, allo-isoleucine, N-methylisoleucine, N-methylvaline, pyroglutamine, aminobutyric acid; or synthetic amino acids in particular ornithine
  • the fusion protein according to the invention can be obtained by conventional chemical synthesis (in solid phase or in liquid homogeneous phase) or by enzymatic synthesis (Kullmann W, Enzymatic peptide synthesis, 1987, CRC Press, Florida). It can also be obtained by a method consisting in cultivating a host cell expressing a nucleic acid encoding the fusion protein and recovering said protein from these cells or from the culture medium.
  • the present invention also relates to a nucleic acid encoding the fusion protein according to the invention, in particular a fusion protein comprising a class II nuclease of the CRISPR system, preferably of type V and preferably Cpfl, and a Spoll protein or partner of Spoll as described above.
  • nucleic acid is intended to mean any molecule based on DNA or RNA. They may be synthetic or semi-synthetic, recombinant molecules, optionally amplified or cloned in vectors, chemically modified, comprising non-natural bases or modified nucleotides comprising for example a modified bond, a modified purine or pyrimidine base, or a modified sugar.
  • codons is optimized according to the nature of the eukaryotic cell of interest.
  • the nucleic acid according to the invention can be in the form of DNA and / or RNA, single stranded or double stranded.
  • the nucleic acid is an isolated DNA molecule, synthesized by recombinant techniques well known to those skilled in the art.
  • the nucleic acid according to the invention can be deduced from the sequence of the fusion protein according to the invention and the use of codons can be adapted according to the host cell into which the nucleic acid is to be transcribed.
  • the present invention further relates to an expression cassette comprising a nucleic acid according to the invention operably linked to the sequences necessary for its expression.
  • the nucleic acid can be under the control of a promoter allowing its expression in a eukaryotic host cell.
  • an expression cassette comprises, or consists of, a promoter for initiating transcription, a nucleic acid according to the invention, and a transcription terminator.
  • expression cassette refers to a nucleic acid construct comprising a coding region and a regulatory region, operably linked.
  • operably linked indicates that the elements are combined such that the expression of the coding sequence is under the control of the transcriptional promoter.
  • the promoter sequence is placed upstream of the gene of interest, at a distance of the latter compatible with the control of its expression. Spacer sequences can be present, between the regulatory elements and the gene, as long as they do not prevent expression.
  • the expression cassette can also comprise at least one “enhancer” activator sequence operably linked to the promoter.
  • promoters which can be used for the expression of genes of interest in cells or host organisms are available to those skilled in the art. They include constitutive promoters as well as inducible promoters which are activated or repressed by exogenous physical or chemical stimuli.
  • the nucleic acid according to the invention is placed under the control of a constitutive promoter or of a promoter specific for meiosis.
  • meiosis-specific promoters which can be used in the context of the present invention include, but are not limited to, endogenous Spoll promoters, promoters of Spoll partners for the formation of double-stranded breaks, the Rec8 promoter (Murakami & Nicolas, 2009, Mol. Cell. Biol, 29, 3500-16,), or the Spol3 promoter (Malkova et al, 1996, Genetics, 143, 741-754,), meiotic promoters of Arabidopsis thaliana for example such as described in Li et al., BMC Plant Biol. 2012; 12: 104, Eid et al., Plant Cell Rep. 2016 Jul; 35 (7): 1555-8, Xu et al., Front. Plant Sci., 13 July 2018e, Da Inippo et al., PLoS Genet, 2013, 9, el003787.).
  • inducible promoters can also be used such as the estradiol promoter (Carlie & Amon, 2008 Cell, 133, 280-91,), the methionine promoter (Care et al, 1999, Molecular Microb 34, 792-798,), the TetO / TetR system inducible by doxycline, promoters induced by thermal shock, metals, steroids, antibiotics and alcohol.
  • Constitutive promoters which can be used in the context of the present invention are, by way of nonlimiting examples: the promoter of the immediate early genes of cytomegalovirus (CMV), the promoter of the simian virus (SV40), the major late promoter of adenoviruses, the Rous sarcoma virus (RSV) promoter, mouse mammary tumor virus (MMTV) promoter, phosphoglycerate kinase (PGK) promoter, ED1-alpha elongation factor promoter, ubiquitin, actin promoters, tubulin promoters, immunoglobulin promoters, alcohol dehydrogenase 1 (ADH1) promoter, RNA polymerase III dependent promoters such as U6, U3, H1, 7SL, pRPR1 (“Ribonuclease P RNA 1”), SNR52 (“small nuclear RNA 52”) promoters, or the pZmUbi promoter.
  • CMV cytomegalovirus
  • the expression cassette and / or the nucleic acid according to the invention is operably linked to a transcriptional promoter allowing expression of the expression cassette and / or the nucleic acid during meiosis.
  • a transcriptional promoter can be pREC8.
  • the transcription terminator can be readily selected by one skilled in the art.
  • this terminator is RPRlt, the 3 ′ flanking sequence of the Saccharomyces cerevisiae SUP4 gene or the tNOS nopaline synthase terminator.
  • the present invention further relates to an expression vector comprising a nucleic acid or an expression cassette according to the invention.
  • This expression vector can be used to transform a host cell and allow expression of the nucleic acid according to the invention in said cell.
  • the vectors can be constructed by conventional techniques of molecular biology, well known to those skilled in the art.
  • the expression vector comprises regulatory elements allowing the expression of the nucleic acid according to the invention. These elements can include, for example, transcription promoters, transcription activators, terminator sequences, initiation and termination codons. The methods for selecting these elements depending on the host cell in which expression is desired are well known to those skilled in the art.
  • the expression vector comprises a nucleic acid encoding the fusion protein according to the invention, placed under the control of a constitutive promoter, preferably the ADH1 promoter (pADH1). It can also include a terminator sequence such as the ADH1 terminator (tADH1).
  • the expression vector can comprise one or more origins of replication, bacterial or eukaryotic.
  • the expression vector may in particular comprise an origin of bacterial replication which is functional in E.coli, such as the origin of replication ColE1.
  • the vector may comprise a eukaryotic origin of replication, preferably functional in plants and in yeasts, in particular in S. cerevisiae.
  • the vector may further comprise elements allowing its selection in a bacterial or eukaryotic host cell such as, for example, a gene for resistance to an antibiotic or a selection gene ensuring the complementation of the respective inactivated gene in the genome of the host cell.
  • elements are well known to those skilled in the art and widely described in the literature.
  • the expression vector comprises one or more genes for resistance to antibiotics, preferably a gene for resistance to ampicillin, kanamycin, hygromycin, geneticin and / or gene. nourseothricin.
  • the expression vector may also include one or more sequences allowing the targeted insertion of the vector, expression cassette or nucleic acid into the genome of a host cell.
  • the insertion is carried out at the level of a gene whose activation allows the selection of host cells which have integrated the vector, the cassette or the nucleic acid, such as the TRP1 locus.
  • the vector can be circular or linear, single- or double-stranded. It is advantageously chosen from plasmids, phages, phagemids, viruses, cosmids and artificial chromosomes. Preferably, the vector is a plasmid.
  • the present invention relates in particular to a vector, preferably a plasmid, comprising a bacterial origin of replication, preferably the ColE1 origin, a nucleic acid as defined above under the control of a promoter, preferably a constitutive promoter such as the ADH1 promoter, a terminator, preferably the ADH1 terminator, one or more selection markers, preferably resistance markers such as the kanamycin or ampicillin resistance gene, and one or more sequences allowing the targeted insertion of the vector, of the expression cassette or of the nucleic acid into the genome of the host cell, preferably at the level of the TRP1 locus of the genome of a yeast.
  • a promoter preferably a constitutive promoter such as the ADH1 promoter, a terminator, preferably the ADH1 terminator, one or more selection markers, preferably resistance markers such as the kanamycin or ampicillin resistance gene, and one or more sequences allowing the targeted insertion of the vector, of the expression cassette or of the nucleic acid into
  • the invention relates in particular to a vector, preferably a plasmid, compatible for agrotransfection, in particular using Agrobacterium tumefaciens (Fraley et al. Crit. Rev. Plant. Sci. 4 ppl-46; Fromm et al., (1990) Biotechnology 8, pp 833-844) or Agrobacterium rhizogenes (Cho et al. (2000) Planta 210 pp 195-204) and aimed at the transformation of plants.
  • Agrobacterium tumefaciens Fraley et al. Crit. Rev. Plant. Sci. 4 ppl-46; Fromm et al., (1990) Biotechnology 8, pp 833-844) or Agrobacterium rhizogenes (Cho et al. (2000) Planta 210 pp 195-204) and aimed at the transformation of plants.
  • An example of a compatible plasmid is the Ti-type plasmid, in particular
  • the vector according to the invention comprises a selectable marker.
  • selectable markers for plant transformation include the gene conferring resistance to kanamycin neomycin phosphotransferase II (NPTII), used for selection in a culture containing kanamycin, the phosphinothricin acetyltransferase (HPH) gene, used for selection in a culture containing hygromycin B.
  • NPTII kanamycin neomycin phosphotransferase II
  • HPH phosphinothricin acetyltransferase
  • the nucleic acid according to the invention carried by the vector encodes a fusion protein comprising one or more tags, preferably comprising a tag consisting of six histidines and / or one or more Flag motifs, of preferably three Flag patterns.
  • the tag (s) are in C-terminal.
  • the present invention also relates to the use of a nucleic acid, an expression cassette or an expression vector according to the invention to transform or transfect a cell.
  • the host cell can be transiently or stably transformed / transfected and the nucleic acid, cassette or vector can be contained in the cell as an episome or integrated into the genome of the host cell.
  • the present invention thus relates to a host cell comprising a fusion protein, a nucleic acid, a cassette or an expression vector according to the invention.
  • the cell is a eukaryotic cell.
  • the term "eukaryotic cell” refers to a yeast, plant, fungal or animal cell, particularly a mammalian cell such as a mouse or rat cell, or a cell. insect cell.
  • the eukaryotic cell is preferably non-human and / or non-embryonic.
  • the eukaryotic cell is not an embryonic stem cell of human and / or animal origin.
  • the eukaryotic cell expresses a Spoll protein endowed with nuclease activity, that is to say a Spoll protein capable of inducing double-stranded breaks during prophase I of meiosis.
  • the eukaryotic cell is a yeast cell, in particular a yeast of industrial interest.
  • yeasts of interest include, but are not limited to, yeasts of the genus Saccharomyces sensu stricto, Schizosaccharomyces, Yarrowia, Hansenula, Kluyveromyces, Pichia or Candida, as well as hybrids obtained from a strain belonging to one of of these kinds.
  • the yeast of interest belongs to the genus Saccharomyces.
  • Saccharomyces cerevisiae preferably Saccharomyces bayanus, Saccharomyces castelli, Saccharomyces eubayanus, Saccharomyces kluyveri, Saccharomyces kudriavzevii, Saccharomyces mikatae, Saccharomyces uvarum, Saccharomyces paradoxus, Saccharomyces pastorianus (also called Saccharomyces carlsbergensis), and from at least one of the hybrids obtained from one strain these species such as for example a hybrid S. cerevisiae / S. paradoxus or a hybrid S. cerevisiae / S. uvarum., more preferably said eukaryotic host cell is Saccharomyces cerevisiae.
  • the eukaryotic cell is a fungus cell, in particular a fungus cell of industrial interest.
  • fungi include, but are not limited to, cells of filamentous fungi.
  • Filamentous fungi include fungi belonging to the Eumycota and Oomycota subdivisions.
  • Filamentous fungal cells can be selected from the group consisting of Trichoderma, Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Flumicallola, Magnaportheceliospora, Neurosporinus, Flumicalla, Magnaportceliospora, Neurosporium, Mycimophthora, , Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Sordaria, Talaromyces, Thermoascus, Thielavia, Tolypocladium or Trametes.
  • the eukaryotic cell is a plant cell, in particular a plant cell of agronomic, horticultural, pharmaceutical or cosmetic interest, in particular vegetables, fruits, herbs, flowers, trees and others. shrubs.
  • the plant cell is selected from monocotyledonous plants and dicotyledonous plants, more particularly preferably selected from the group consisting of rice, wheat, soybean, corn, tomato, onion, cucumber. , lettuce, asparagus, carrot, turnip, Arabidopsis thaliana, barley, rapeseed, cotton, vine, sugar cane, beet, cotton, sunflower, palm oil, coffee, tea, cocoa, chicory, pepper, chili, lemon, orange, nectarine, mango, apple, banana , peach, apricot, sweet potato, yams, almond, hazelnut, strawberry, melon, watermelon, olive tree, potato, zucchini, eggplant, avocado, cabbage, plum, cherry, pineapple, spinach, apple, tangerine, grapefruit, pear, grape , cloves, cashews u, coconut, sesame, rye, hemp, tobacco, berries such as raspberry or blackcurrant, peanut, castor, vanilla, poplar, eucalyptus, green
  • the plant cell can be selected from the group consisting of rice, wheat, soybean, corn, tomato, onion, cucumber, lettuce, asparagus, carrot, turnip, Arabidopsis thaliana, barley, rapeseed, cotton, vine, sugar cane, beet, cotton, sunflower, olive palm, coffee , tea, cocoa, chicory, pepper, chili, lemon, orange, nectarine, mango, apple, banana, peach, apricot, sweet potatoes, yams, almonds, hazelnuts, strawberries, melons, watermelons, olive trees, and horticultural plants such as roses, tulips, orchids and geraniums.
  • Each of the different cells described above can in particular be used in the methods according to the invention described below.
  • the present invention also relates to the use of the fusion protein, of the nucleic acid, of the expression cassette or of the expression vector according to the invention for (i) inducing targeted meiotic recombinations in a cell.
  • eukaryotic (ii) generate variants of a eukaryotic organism, and / or (iii) identify or localize the genetic information encoding a characteristic of interest in a eukaryotic cell genome.
  • the methods according to the invention can be in vitro, in vivo or ex vivo methods, preferably in vitro.
  • the invention relates in particular to a method for inducing targeted meiotic recombinations in a eukaryotic cell, preferably non-human, comprising - the introduction into said cell: a) of a fusion protein, of a nucleic acid, of a expression cassette or a vector as described above; and b) one or more guide RNAs or one or more nucleic acids encoding said guide RNAs, said guide RNAs comprising a nuclease binding RNA structure associated with a CRISPR system of the fusion protein and a sequence complementary to the targeted chromosomal region; and - induction of entry into prophase I of meiosis of said cell.
  • the eukaryotic cell is as described above.
  • guide RNA designates an RNA molecule capable of interacting with the CRISPR domain, preferably with a Cpfl protein, of the fusion protein in order to guide it. to a target chromosomal region.
  • Each gRNA includes a region (commonly referred to as the "SDS" region) at the 3 'end of the gRNA that is complementary to the target chromosomal region and mimics the endogenous CRISPR system's rRNA.
  • SDS region
  • Cpfl gRNA does not require a second region (commonly referred to as the “handle” region), at the 3 'end of the gRNA, which mimics pairing interactions. of bases between the tracrRNA and the crRNA of the endogenous CRISPR system.
  • the sequence of the gRNA varies depending on the chromosome sequence targeted.
  • the "SDS" region of the gRNA which is complementary to the target chromosomal region generally comprises between 10 and 25 nucleotides. Preferably, this region is 19, 20 or 21 nucleotides in length, and particularly preferably 25 nucleotides.
  • the total length of a gRNA is generally 30 to 140 nucleotides, preferably 30 to 125 nucleotides, and more particularly preferably 40 to 100 nucleotides.
  • a gRNA as used in the present invention has a length of 30 to 75 nucleotides, preferably 35 to 65 nucleotides, more preferably 44 to 63 nucleotides.
  • gRNAs can easily define the sequence and structure of gRNAs according to the chromosomal region to be targeted using well known techniques.
  • one or more gRNA can be used simultaneously. These gRNAs can be different or identical. These gRNAs can target identical or different, preferably different, chromosomal regions.
  • GRNAs can be introduced into the eukaryotic cell in the form of mature gRNA molecules, in the form of precursors or in the form of one or more nucleic acids encoding said gRNAs.
  • these gRNAs can contain modified nucleotides or chemical modifications allowing them, for example, to increase their resistance to nucleases and thus increase their lifespan in the cell. They can in particular comprise at least one modified or unnatural nucleotide such as, for example, a nucleotide comprising a modified base, such as inosine, methyl-5-deoxycytidine, dimethylarnino-5-deoxyuridine, deoxyuridine, diamino -2,6-purine, bromo-5-deoxyuridine or any other modified base allowing hybridization.
  • modified base such as inosine, methyl-5-deoxycytidine, dimethylarnino-5-deoxyuridine, deoxyuridine, diamino -2,6-purine, bromo-5-deoxyuridine or any other modified base allowing hybridization.
  • the gRNAs used according to the invention can also be modified at the level of the intemucleotide bond such as for example the phosphorothioates, the H-phosphonates or the alkyl-phosphonates, or at the level of the backbone such as for example the alpha-oligonucleotides, the 2'- O-Alkyl ribose or PNAs (Peptid Nucleic Acid) (Egholm et al, 1992 J. Am. Chem. Soc., 114, pp 1895-1897).
  • GRNAs can be natural, synthetic or produced by recombinant techniques. These gRNAs can be prepared by any method known to those skilled in the art such as, for example, chemical synthesis, in vivo transcription or amplification techniques.
  • the method comprises the introduction into the eukaryotic cell of the fusion protein and one or more gRNAs capable of targeting the action of the fusion protein towards a given chromosomal region.
  • the protein and the gRNAs can be introduced into the cytoplasm or the nucleus of the eukaryotic cell by any method known to those skilled in the art, for example by microinjection.
  • the fusion protein can in particular be introduced into the cell as part of a protein-RNA complex comprising at least one gRNA.
  • the method comprises introducing into the eukaryotic cell the fusion protein and one or more nucleic acids encoding one or more gRNAs.
  • the method comprises introducing into the eukaryotic cell a nucleic acid encoding the fusion protein and one or more gRNAs.
  • the method comprises introducing into the eukaryotic cell a nucleic acid encoding the fusion protein and one or more nucleic acids encoding one or more gRNAs.
  • the eukaryotic cell is heterozygous for the gene (s) targeted by the guide RNA (s).
  • the eukaryotic cell is homozygous for the gene (s) targeted by the guide RNA (s).
  • the fusion protein, or the nucleic acid encoding the same, and the gRNA (s), or the nucleic acid (s) encoding them, can be introduced simultaneously or sequentially into the cell.
  • the nucleic acid encoding the fusion protein and the nucleic acid (s) encoding the gRNA (s) can be introduced into a cell by crossing two cells into which have respectively been introduced the nucleic acid encoding the fusion protein and the nucleic acid (s) encoding the gRNA (s).
  • the nucleic acid encoding the fusion protein and the nucleic acid (s) encoding the gRNA (s) can be introduced into a cell by mitosis of a cell in which the acid nucleic acid encoding the fusion protein and the nucleic acid (s) encoding the gRNA (s) have previously been introduced.
  • the expression of said nucleic acids allows to produce the fusion protein and / or the gRNA (s) in the cell.
  • the nucleic acids encoding the fusion protein and those encoding the gRNAs can be placed under the control of identical or different promoters, constitutive or inducible, in particular promoters specific for meiosis.
  • the nucleic acids are placed under the control of constitutive promoters such as the ADH1 promoter or the pRPR1 and SNR52 promoters dependent on RNA polymerase III, more preferably the pRPR1 promoter.
  • constitutive promoters such as the ADH1 promoter or the pRPR1 and SNR52 promoters dependent on RNA polymerase III, more preferably the pRPR1 promoter.
  • the nature of the promoter may also depend on the nature of the eukaryotic cell.
  • the eukaryotic cell is a plant cell, preferably a rice cell, and the nucleic acids are placed under the control of a promoter chosen from pZmUbi promoters (maize pubiquitin promoter) and them. U3 and U6 polymerase III promoters.
  • the nucleic acid encoding the fusion protein is placed under the control of the pZmUbi promoter and the nucleic acids encoding the gRNAs are placed under the control of the U3 or U6 promoter, preferably of the U3 promoter.
  • the expression of the gRNA is placed under the control of the tetracycline operator.
  • the Tet system comprises two complementary circuits: the tTA dependent circuit (Tet-Off system) and the rtTA dependent circuit (Tet-On system).
  • Tet-Off system the tTA dependent circuit
  • Tet-On system the rtTA dependent circuit
  • the expression of the gRNA is monitored by a Tet-On system.
  • the expression of gRNA is thus regulated by the presence or absence of tetracycline or one of its derivatives such as doxycycline.
  • nucleic acids encoding the fusion protein and the gRNA (s) can be arranged on the same construct, in particular on the same expression vector, or on separate constructs. Alternatively, the nucleic acids can be inserted into the genome of the eukaryotic cell at the same or separate regions. According to a preferred embodiment, the nucleic acids encoding the fusion protein and the gRNA (s) are placed on the same expression vector.
  • the nucleic acids as described above can be introduced into the eukaryotic cell by any method known to those skilled in the art, in particular by microinjection, transfection, agro-infection, electroporation or biolistics.
  • the expression or the activity of the endogenous Spoll protein of the eukaryotic cell can be suppressed in order to better control the phenomena of meiotic recombination.
  • This inactivation can be carried out by techniques well known to man. of the art, in particular by inactivating the gene encoding the endogenous Spoll protein or by inhibiting its expression by means of interfering RNAs.
  • the Spoll domain of the fusion protein is endowed with nuclease activity in order to complement the absence of endogenous Spoll activity.
  • the method according to the invention comprises the induction of the entry into prophase I of meiosis of said cell.
  • This induction can be done according to different methods, well known to those skilled in the art.
  • the eukaryotic cell is a mouse cell
  • the entry of cells into meiosis prophase I can be induced by the addition of retinoic acid (Bowles J et al, 2006, Sciences, 312 (5773 ), pp. 596-600).
  • the eukaryotic cell is a plant cell
  • the induction of meiosis occurs naturally.
  • a plant is regenerated and placed under conditions favoring the induction of a reproductive phase and thus of the meiosis process. These conditions are well known to those skilled in the art.
  • this induction can be carried out by the transfer of the yeast into a sporulation medium, in particular from a rich medium to a sporulation medium, said sporulation medium preferably being devoid of a carbon source. fermentable or nitrogen, and incubation of the yeasts in the sporulation medium for a time sufficient to induce double-stranded breaks.
  • the initiation of the meiotic cycle depends on several signals: the presence of the two mating type alleles MATa and MAT ⁇ , the absence of a source of nitrogen and fermentable carbon.
  • the term “rich medium” refers to a culture medium comprising a source of fermentable carbon and a source of nitrogen as well as all the nutrients necessary for the yeasts to multiply by mitotic division.
  • This medium can be easily chosen by a person skilled in the art and can, for example, be selected from the group consisting of YPD medium (1% yeast extract, 2% bactopeptone and 2% glucose), YPG medium (1% extract yeast, 2% bactopeptone and 3% glycerol) and a complete synthetic medium (or SC medium) (Treco and Lundblad, 2001, Curr. Protocol. Mol. Biol., Chapter 13, Unit 13.1).
  • sporulation medium refers to any medium inducing entry into meiosis prophase of yeast cells without vegetative growth, in particular to a culture medium not comprising a carbon source. fermentable or nitrogen source but comprising a carbon source metabolizable by respiration such as acetate.
  • This medium can be easily chosen by a person skilled in the art and can, for example, be selected from the group consisting of 1% KAc medium (Wu and Lichten, 1994, Science, 263, pp. 515-518), SPM medium (Kassir and Simchen, 1991, Meth. Enzymol., 194, pp. 94-110) and sporulation media described in the article by Sherman (Sherman, Meth.
  • the cells before being incubated in the sporulation medium, the cells are cultured for a few cycles of division in a pre-sporulation medium so as to obtain efficient and synchronous sporulation.
  • the pre-sporulation medium can be easily chosen by a person skilled in the art. This medium can be, for example, SPS medium (Wu and Lichten, 1994, Science, 263, pp. 515-518).
  • SPS medium Wang and Lichten, 1994, Science, 263, pp. 515-518.
  • the choice of media depends on the physiological and genetic characteristics of the yeast strain, in particular if this strain is auxotrophic for one or more compounds.
  • the meiotic process can continue until it produces four daughter cells carrying the desired recombinations.
  • the eukaryotic cell is a yeast, and in particular a yeast of the genus Saccharomyces
  • the cells can be replaced in growth conditions in order to resume a mitotic process.
  • This phenomenon called “retum-to-growth” or “RTG” has been described previously in the patent application WO 2014/083142 and occurs when the cells entered into meiosis in response to a nutritional deficiency are placed in the presence of a source.
  • the method may further comprise obtaining the cell (s) exhibiting the desired recombination (s).
  • the method may further comprise a step of culturing and / or multiplying the cell (s) exhibiting the desired recombination (s).
  • the method may further comprise a step of somatic embryogenesis, that is to say the regeneration of a plant embryo from a callus comprising the cells exhibiting the recombination (s). sought.
  • the method according to the invention can be used in all applications where it is desirable to improve and control the phenomena of meiotic recombination.
  • the invention makes it possible to associate, in a preferential manner, genetic traits of interest. This preferential association allows, on the one hand, to reduce the time necessary for their selection, on the other hand, to generate possible but improbable natural combinations.
  • the organisms obtained by this process can be considered as non-genetically modified (non-GMO) organisms.
  • the present invention relates to a method for generating variants of a eukaryotic organism, with the exception of man, preferably a yeast or a plant, more preferably a yeast, in particular a strain of yeast. of industrial interest, including
  • variant should be understood broadly, it designates an organism having at least one genotypic or phenotypic difference from the parent organisms.
  • the recombinant cells can be obtained by allowing meiosis to continue until the spores are obtained, or, in the case of yeasts, by replacing the cells in growth conditions after the induction of the double-strand breaks in order to resume a mitotic process.
  • a plant variant can be generated by fusion of plant gametes, at least one of the gametes being a cell recombined by the method according to the invention.
  • the present invention also relates to a method for identifying or localizing genetic information encoding a characteristic of interest in a eukaryotic cell genome, preferably a yeast or a plant, comprising:
  • the characteristic of interest is a quantitative characteristic of interest (QTL).
  • QTL quantitative trait locus
  • LCQ or QTL for quantitative trait loci is a larger or smaller region of DNA that is closely associated with a quantitative trait, i.e. a chromosomal region where one or more genes are located. at the origin of the character in question.
  • the present invention finally relates to a kit comprising a fusion protein, a nucleic acid, an expression cassette or an expression vector according to the invention, or a host cell transformed or transfected with a nucleic acid, an expression cassette or an expression vector according to the invention. It also relates to the use of said kit for implementing a method according to the invention, in particular for (i) inducing targeted meiotic recombinations in a eukaryotic cell, (ii) generating variants of a eukaryotic organism, and / or (iii) identify or locate genetic information encoding a characteristic of interest in a eukaryotic cell genome.
  • C cysteine
  • D aspartic acid
  • E glutamic acid
  • F phenylalanine
  • G glycine
  • H histidine
  • I isoleucine
  • K lysine
  • L leucine
  • M methionine
  • N asparagine
  • P proline
  • Q glutamine
  • R arginine
  • S serine
  • T threonine
  • V valine
  • W tryptophan
  • Y tyrosine.
  • all of the identity percentages mentioned in this application can be set at at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, identity.
  • all the percentages of sequence identity are at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least are considered as described. minus 99%, sequence identity.
  • the humanized version of the CPF1 gene from Francisella novicida carried by the plasmid pY004 was obtained from the Addgene platform (http://n2t.net/addgene:69976; RRID: Addgene_69976) Zetsche, B. , et al., 2015, Cell, 163, 759- 771.
  • the plasmid pAS604 containing the fragment P ADH I-NLS-Fn CPFI-T ADH I was constructed by cloning the sequence of FnCPFl (amplified by PCR from pY004) in the plasmid pAS565 linearized with the Apal-Ndel enzymes.
  • the Spel-Xmal fragment of Plasmid pAS532 was replaced by the Spel-Xmal fragment of plasmid pAS604 containing the sequence NLS (Nuclear Localization Signal; GGMAAPKKKRKVDGG SEQ ID NO: 34) and the part encoding the protein FnCPFl.
  • NLS Nuclear Localization Signal
  • the resulting plasmid, pAS608 contains the PADHi-NLS-FnCPF1-SP011 Y135F -6xFHis-3xFlag-TADm cassette.
  • the PADHI promoter was replaced by the PRECS specific meiosis promoter cloned by Gibson reaction in the vector pAS604 digested with SpeI-XhoI.
  • the final plasmid, pAS628, contains the PREC8-NLS-FnCPFl-SP011 Y135F -6xFHis-3xFlag-TADHi cassette in which the NLS and the N-terminus of FnCpf1 are separated by a linker (GIHGVPAA, SEQ ID NO: 35 ).
  • the FnCpf1 crRNA expression cassette was designed from the plasmid pUD628 (Swiat, et al., 2017Nucleic acids research, 45, 12585-12598); the expression of the crRNAs therein is controlled by the SNR52 promoter (PSNR52) and by the S IJ P 4 terminator (TSUP4).
  • PSNR52 SNR52 promoter
  • TSUP4 S IJ P 4 terminator
  • the final plasmid pAS631 therefore contains the crRNA expression system Ps NR 52-tetO-DR-DR-Tsup4-TetR inducible to doxycycline.
  • the 25 nucleotide guide sequence (5 'GTCCGTGCGG AG AT ATCTGCGCCGT 3' SEQ ID NO: 45) targeting the Gal4 UAS-B , C site in the promoter of the GAL2 gene was inserted between the DR sequences by Gibson reaction in the plasmid pAS631 linearized with BglII.
  • the plasmids pAS533 and pAS628 respectively carrying the P REC8 cassettes -FnCPFl-SP011 Y135F - 6xHis-Flag-T ADHi- TRP1-KanMX were linearized with the restriction enzyme Xbal and integrated into the TRP1 locus by electroporation of the cells.
  • the integration junctions of the expression cassettes of FnCPFl -SPOl 1 Y135F at the TRP1 locus were verified by PCR.
  • the frequency of recombination around the GAL2 gene (chromosome XII) is measured between the NatMX cassette integrated at position 287 725 in the promoter of the EMP46 gene (pEMP46) and the HphMX cassette integrated at position 292068 in the terminator of the GAL2 gene ( tGALZ).
  • the diploid cells are inoculated in a rich liquid medium (YPD) or in a complete synthetic medium lacking Leucine (SC-Leu) in order to maintain the plasmids carrying the LEU2 selection marker.
  • the cells multiply with stirring at 30 ° C. for 24 hours (“Mitotic” point).
  • the saturated SC-Leu liquid cultures are diluted in SPS pre-sporulation medium (2-16 x10 5 cells / ml) and cultured with shaking at 30 ° C for ⁇ 15 hours. Cultures having reached an OD 600 between 2 and 4 are centrifuged, washed twice with water and transferred to the sporulation medium (KAc 1%) with a final OD 600 of 1. This is the To point of the meiotic progression.
  • doxycycline hyclate is added at a final concentration of 10 ⁇ g / ml in the sporulation medium at time To.
  • the YPD growth, SPS pre-sporulation and 1% KAc sporulation media are described in the reference Murakami et al., (2009) Methods Mol Biol, 557, pp 117-142.
  • the YPD medium consists of yeast extract 1%), peptone (2%) and glucose (2%).
  • the complete synthetic medium devoid of Leucine is composed of Yeast Nitrogen Base (0.17%), Ammonium Sulfate (0.5%), Drop-out Mix Synthetic without Leucine (0.16%) and Glucose ( 2%).
  • the 4-spore tetrads were dissected on YPD dishes after 48 hours of incubation in the sporulation medium.
  • the segregation of the NatMX and HygMX markers is visualized by replicating the colonies on YPD dishes respectively containing nourseothricin (100 mg / l) or hygromycin (300 mg / i).
  • the Cpfl-Spo11 Y135F fusion stimulates the formation of meiotic CBDs and their repair by homologous recombination in the promoter region of the GAL2 gene
  • the gene encoding the Cpfl -Spo 11 Y135F fusion protein is induced in diploid SPO11 / SPO11 cells which contain the wild-type target sequence pGAL2B, c (5 'ACGGCGCAGATATCTCCGCACGGAC 3', SEQ ID NO: 43) on the parental chromosome PI and a target sequence pGAL2 b, c mutated resistant to cuts of Cpfl on the parental chromosome P2 (5 'AttcCGC AG AT ATCTCCGC Atat AC 3', SEQ ID NO: 44).
  • doxycycline hyclate is added to the meiotic culture (1% KAc) at time 0 for a final concentration of 10 ⁇ g / ml.
  • the genomic DNA is extracted from yeast cells, digested with the restriction enzyme Xbal, deposited on an agarose gel (0.6%) and separated by electrophoresis, then transferred to a nitrocellulose membrane and hybridized with a radioactive probe located en in the coding region of the GAL2 gene.
  • the position of the DNA fragments corresponding to the parental chromosomes (PI and P2) as well as to the recombinant molecules (RI and R2) is indicated on the left of the gel.
  • the thick black arrow indicates the CDBs induced by Cpfl -Spo 11 Y135F in the promoter of the target gene GAL2 at the level of the Ga14 uAs -B, C sites on the PI chromosomes.
  • the map of the GAL2 region shows the open reading frames (the arrows indicating the direction of transcription), the heterozygous genetic markers NatMX and HphMX located in trans from the target site GAL2 B, C as well as the position of the probe (hatched rectangle ).
  • the frequency of CDBs as well as the sum of the frequencies of the recombinant molecules R1 and R2 are indicated under the gel.
  • the minimum threshold for detection of DNA molecules is 0.3%.
  • ANT2951 MATa / ⁇ trpl :: pAS628 (CPFl-SP011 Y135F -6xHis-Flag-TRPl-
  • KanMX / trpl :: hisG pGAL2_AB 2 CD 2 E / pGAL2_ab 2 cD 2 E tGAL2 :: HphMX / - pEMP46 :: NatMX / - his4 / "leu2 /" ura3 / "+ plasmid pAS632-crRNA UAS-: B: L , ECU2.
  • the Cpfl-Spol I Y135F fusion stimulates meiotic recombination in the target region of the promoter of the GAL2 gene (FIG. 2).
  • SPOll diploid cells possess the markers NatMX and HphMX heterozygotes on either side of the targeted regions. Their segregation was followed in the meiosis products by dissection of the 4-spore tetrads.
  • the NatMX gene confers resistance to nourseothricin (Nat R ) and the HphMX gene confers resistance to hygromycin (Hyg R ).
  • the four meiosis products are of the parental type: 2 Nat R Hyg s , 2 Nat s Hyg R (parental ditypes PD).
  • TT tetratype
  • NPD non-parental ditype-type
  • Genotype of strain ANT2945 MATa / ⁇ trpl :: pAS628 (CPFESP011 Y135F -6xHis-Flag- TRP1 -KanMX) / trpl :: hisG pGAL2_AB 2 CD 2 E / pGAL2_ab 2 cd 2 e tGAL2 :: HphMX / - pEMP 46: : NatMX / - his4 / "leu2 /" ura3 / "and contains the plasmid pAS632-crRNA UAS-B, C..LEU2.
  • the NatMX and HphMX cassettes were respectively integrated into the GAL2 terminator (tGAL2) between positions 292068 and 292069, and into the EMP46 promoter (pEMP46) between positions 287725 and 287 726.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
EP21733496.0A 2020-05-20 2021-05-20 Verwendung eines fusionsproteins zur induktion genetischer modifikationen durch gezielte meiotische rekombination Pending EP4153733A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR2005370A FR3110575A1 (fr) 2020-05-20 2020-05-20 utilisation d’une protéine de fusion pour induire des modifications génétiques par recombinaison méiotique ciblée
PCT/FR2021/050917 WO2021234315A1 (fr) 2020-05-20 2021-05-20 Utilisation d'une proteine de fusion pour induire des modifications genetiques par recombinaison meiotique ciblee

Publications (1)

Publication Number Publication Date
EP4153733A1 true EP4153733A1 (de) 2023-03-29

Family

ID=74045449

Family Applications (1)

Application Number Title Priority Date Filing Date
EP21733496.0A Pending EP4153733A1 (de) 2020-05-20 2021-05-20 Verwendung eines fusionsproteins zur induktion genetischer modifikationen durch gezielte meiotische rekombination

Country Status (7)

Country Link
US (1) US20240263157A1 (de)
EP (1) EP4153733A1 (de)
AU (1) AU2021274109A1 (de)
BR (1) BR112022023471A2 (de)
CA (1) CA3177793A1 (de)
FR (1) FR3110575A1 (de)
WO (1) WO2021234315A1 (de)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240052359A1 (en) 2021-02-10 2024-02-15 Limagrain Europe Multiplex targeted recombinations for trait introgression applications
EP4544034A1 (de) 2022-06-24 2025-04-30 Meiogenix Induktion der meiotischen rekombination unter verwendung eines crispr-systems

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2998898A1 (fr) 2012-11-30 2014-06-06 Inst Curie Procede d'amelioration de souches de levure
US11248240B2 (en) * 2015-01-29 2022-02-15 Meiogenix Method for inducing targeted meiotic recombinations

Also Published As

Publication number Publication date
US20240263157A1 (en) 2024-08-08
CA3177793A1 (fr) 2021-11-25
FR3110575A1 (fr) 2021-11-26
AU2021274109A1 (en) 2022-12-08
BR112022023471A2 (pt) 2023-01-24
WO2021234315A1 (fr) 2021-11-25

Similar Documents

Publication Publication Date Title
EP3250688B1 (de) Verfahren zur induzierung von zielgerichteten meiotischen rekombinationen
AU2018216169B2 (en) Expression of nitrogenase polypeptides in plant cells
CN114269933B (zh) 通过使用grf1加强基因实现的增强的植物再生及转化
JPWO2018043219A1 (ja) Ｃａｓタンパク質発現カセット
EP4153733A1 (de) Verwendung eines fusionsproteins zur induktion genetischer modifikationen durch gezielte meiotische rekombination
WO2021234317A1 (fr) Utilisation d'une proteine de fusion deficiente pour l'activite nuclease pour induire des recombinaisons meiotiques
AU2023288913A1 (en) Induction of meiotic recombination using a crispr system
CA2947506C (fr) Augmentation de la recombinaison meiotique chez les plantes par inhibition d'une proteine recq4 ou top3a du complexe rtr
CA2974681C (fr) Procede pour induire des recombinaisons meiotiques ciblees
US20260125698A1 (en) Induction of meiotic recombination using a crispr system
FR3032203A1 (fr) Procede pour induire des recombinaisons meiotiques ciblees
RU2809244C2 (ru) Экспрессия полипептидов нитрогеназы в растительных клетках
JP2026061863A (ja) ゲノム編集された植物の製造方法
BR122024004319A2 (pt) Proteína de fusão compreendendo uma proteína cas9 e uma proteína spo11, e célula hospedeira compreendendo a proteína de fusão
BR122024004319B1 (pt) PROTEÍNA DE FUSÃO COMPREENDENDO UMA PROTEÍNA CAS9 E UMA PROTEÍNA SPOll, E CÉLULA HOSPEDEIRA COMPREENDENDO A PROTEÍNA DE FUSÃO

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20221115

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)