EP3917660A1 - Initiateurs réutilisables pour la synthèse d'acides nucléiques - Google Patents

Initiateurs réutilisables pour la synthèse d'acides nucléiques

Info

Publication number
EP3917660A1
EP3917660A1 EP20748810.7A EP20748810A EP3917660A1 EP 3917660 A1 EP3917660 A1 EP 3917660A1 EP 20748810 A EP20748810 A EP 20748810A EP 3917660 A1 EP3917660 A1 EP 3917660A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
oligonucleotide
sequence
acid initiator
solid support
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP20748810.7A
Other languages
German (de)
English (en)
Other versions
EP3917660A4 (fr
Inventor
J. William Efcavitch
Matthew T. HOLDEN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Molecular Assemblies Inc
Original Assignee
Molecular Assemblies Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US16/261,229 external-priority patent/US11331643B2/en
Application filed by Molecular Assemblies Inc filed Critical Molecular Assemblies Inc
Publication of EP3917660A1 publication Critical patent/EP3917660A1/fr
Publication of EP3917660A4 publication Critical patent/EP3917660A4/fr
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/14—Solid phase synthesis, i.e. wherein one or more library building blocks are bound to a solid support during library creation; Particular methods of cleavage from the solid support
    • C40B50/18—Solid phase synthesis, i.e. wherein one or more library building blocks are bound to a solid support during library creation; Particular methods of cleavage from the solid support using a particular method of attachment to the solid support
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the invention relates to methods and apparatus for synthesizing polynucleotides with a desired sequence and without the need for a template.
  • phosphoramidite-techniques Most de novo nucleic acid sequencing is performed using well-established solid-phase phosphoramidite-techniques.
  • the phosphor amidite technique involves the sequential de protection and synthesis of sequences built from phosphoramidite reagents corresponding to natural (or non-natural) nucleic acid bases.
  • Phosphoramidite nucleic acid synthesis is length- limited, however, in that nucleic acids greater than 200 base pairs (bp) in length experience high rates of breakage and side reactions.
  • phosphoramidite synthesis produces toxic by- products, and the disposal of this waste limits the availability of nucleic acid synthesizers, and increases the costs of contract oligonucleotide production. (It is estimated that the annual demand for oligonucleotide synthesis is responsible for greater than 300,000 gallons of hazardous chemical waste, including acetonitrile, trichloroacetic acid, toluene,
  • the invention provides improved methods for nucleic acid synthesis. Methods of the invention provide faster and longer de novo synthesis of polynucleotides. As such, the invention dramatically reduces the overall cost of custom nucleic acid synthesis. Methods of the invention are directed to template-independent synthesis of polynucleotides by using a nucleotidyl transferase enzyme to incorporate nucleotide analogs coupled to an inhibitor by a cleavable linker.
  • synthesis pauses with the addition of each new base, whereupon the linker is cleaved, separating the inhibitor and leaving a polynucleotide that is essentially identical to a naturally occurring nucleotide (i.e., is recognized by the enzyme as a substrate for further nucleotide incorporation).
  • the invention provides a renewable substrate for template-independent nucleic acid synthesis.
  • De novo synthesis begins with a nucleic acid initiator that is bound to a solid support.
  • a suitable enzyme e.g., a polymerase, e.g., a terminal deoxynucleotidyl transferase (TdT)
  • nucleotide analogs are added to the nucleic acid initiator in order to create an oligonucleotide.
  • the nucleotide analogs include removable terminating groups that cause the enzymatic addition to stop after the addition of one nucleotide.
  • a removable terminating group can be linked to the base portion of the nucleic acid and/or to the 3' hydroxyl of the nucleic acid. Deblocking of the terminating group and/or the 3' blocking group, creates a new active site that is a substrate for the enzyme. With subsequent addition of a new nucleotide or nucleotide analog, the oligonucleotide is extended.
  • the nucleic acid initiator comprises a 3' moiety that is a substrate for the enzyme.
  • a releasing agent is used to decouple the 3' moiety, thereby releasing the oligonucleotide.
  • the 3' moiety, the nucleic acid initiator, and the solid support are reusable after the release of the nascent oligonucleotide.
  • the invention additionally includes an apparatus that utilizes methods of the invention for the production of custom polynucleotides.
  • An apparatus of the invention includes one or more bioreactors providing aqueous conditions and a plurality of sources of nucleotide analogs.
  • the bioreactor may be e.g., a reservoir, a flow cell, or a multi-well plate.
  • the bioreactor may include a solid support having a nucleic acid initiator and a cleavable 3' moiety.
  • the polynucleotides are grown in the reactor by adding successive nucleotides via the natural activity of a nucleotidyl transferase, e.g., a terminal deoxynucleotidyl transferase (TdT)
  • a nucleotidyl transferase e.g., a terminal deoxynucleotidyl transferase (TdT)
  • a bioreactor may include a microfluidic device and/or use inkjet printing technology.
  • Terminating groups may include, for example, charged moieties or steric inhibitors.
  • large macromolecule that prevent nucleotidyl transferase enzymes from achieving a functional conformation are useful used to inhibit oligonucleotide synthesis.
  • macromolecules include polymers, polypeptides, polypeptoids, and nanoparticles.
  • the macromolecules should be large enough to physically block access to the active site of the nucleotidyl transferase, not so large as to negatively alter the reaction kinetics.
  • the macromolecules are linked to nucleotide analogs using any of a variety of linkers, as described below.
  • the 3'-0-blocking groups are typically small and easily removed, thus allowing use with engineered enzymes having modified active sites.
  • the 3'-0-blocking groups may comprise azidomethyl, amino, or allyl groups.
  • oligonucleotide synthesis may include introduction of a 3' exonuclease to the one or more synthesized oligonucleotides after each nucleotide analog addition, but before cleaving the terminating group.
  • the terminating group blocks the 3' exonuclease from acting on any oligonucleotide that to which a nucleotide analog has been added, while oligonucleotides that have not successfully added an analog containing a terminator are removed by the 3' exonuclease.
  • the invention allows for in- process quality control and may eliminate the need for post-synthesis purification.
  • FIG. 1A shows a genus of deoxycytidine triphosphate (dCTP) analogs having a cleavable terminator linked at the N-4 position;
  • dCTP deoxycytidine triphosphate
  • FIG. IB shows cleavage of the cleavable terminator from a dCTP analog of FIG. 1 A to achieve a“natural” dCTP and a cyclic leaving molecule;
  • FIG. 2 A shows a genus of deoxyadenosine triphosphate (dATP) analogs having a cleavable terminator linked at the N-6 position;
  • dATP deoxyadenosine triphosphate
  • FIG. 2B shows cleavage of the cleavable terminator from a dATP analog of FIG. 2A to achieve a“natural” dATP and a cyclic leaving molecule;
  • FIG. 3A shows a genus of deoxyguanosine triphosphate (dGTP) analogs having a cleavable terminator linked at the N-2 position;
  • dGTP deoxyguanosine triphosphate
  • FIG. 3B shows cleavage of the cleavable terminator from a dGTP analog of FIG. 3A to achieve a“natural” dGTP and a cyclic leaving molecule;
  • FIG. 4 A shows a genus of deoxy thymidine triphosphate (dTTP) analogs having a cleavable terminator linked at the N-3 position;
  • FIG. 4B shows cleavage of the cleavable terminator from a dTTP analog of FIG. 4A to achieve a“natural” dTTP and a cyclic leaving molecule;
  • FIG. 5A shows a genus of deoxyuridine triphosphate (dUTP) analogs having a cleavable terminator linked at the N-3 position;
  • dUTP deoxyuridine triphosphate
  • FIG. 5B shows cleavage of the cleavable terminator from a dUTP analog of FIG. 5A to achieve a dUTP and a cyclic leaving molecule
  • FIG. 6 shows an exemplary deoxycytidine triphosphate (dCTP) analog having a Staudinger linker connecting a blocking Asp-Asp molecule to the N-4 position of the deoxycytidine and subsequent cleavage of the Staudinger linker under aqueous conditions to achieve a dCTP and a leaving group;
  • dCTP deoxycytidine triphosphate
  • FIG. 7A shows a genus of cytidine triphosphate (rCTP) analogs having a cleavable terminator linked at the N-4 position;
  • FIG. 7B shows cleavage of the cleavable terminator from a rCTP analog of FIG. 7A to achieve a“natural” rCTP and a cyclic leaving molecule;
  • FIG. 8A shows a genus of adenosine triphosphate (rATP) analogs having a cleavable terminator linked at the N-6 position;
  • FIG. 8B shows cleavage of the cleavable terminator from an rATP analog of FIG. 8A to achieve a“natural” rATP and a cyclic leaving molecule;
  • FIG. 9A shows n genus of guanosine triphosphate (rGTP) analogs having a cleavable terminator linked at the N-2 position;
  • FIG. 9B shows cleavage of the cleavable terminator from a rGTP analog of FIG. 9A to achieve a“natural” rGTP and a cyclic leaving molecule;
  • FIG. 10A shows a genus of thymidine triphosphate (rTTP) analogs having a cleavable terminator linked at the N-3 position;
  • FIG. 10B shows cleavage of the cleavable terminator from a rTTP analog of FIG. 10A to achieve a“natural” rTTP and a cyclic leaving molecule
  • FIG. 11 A shows a genus of uridine triphosphate (rUTP) analogs having a cleavable terminator linked at the N-3 position;
  • FIG. 1 IB shows cleavage of the cleavable terminator from a rUTP analog of FIG. 11 A to achieve a rUTP and a cyclic leaving molecule;
  • FIG. 12 shows an exemplary cytidine triphosphate (rCTP) analog having a Staudinger linker connecting a blocking Asp-Asp molecule to the N-4 position of the cytidine and subsequent cleavage of the Staudinger linker under aqueous conditions to achieve a rCTP and a leaving group;
  • rCTP cytidine triphosphate
  • FIG. 14 shows an exemplary nucleotide analog with a cleavable linker comprising a variable number of methylene bridges
  • FIG. 15 shows an exemplary nucleotide analog with a cleavable linker comprising a cysteine residue
  • FIG. 16A shows an exemplary nucleotide analog with an anionic inhibitor comprising a single phosphate group
  • FIG. 16B shows an exemplary nucleotide analog with an anionic inhibitor comprising two phosphate groups
  • FIG. 16C shows an exemplary nucleotide analog with an anionic inhibitor comprising three phosphate groups
  • FIG. 17 shows an exemplary microfluidic polynucleotide synthesis device
  • FIG. 18 shows an exemplary polypeptoid inhibitor suitable for use in the invention
  • FIG. 19 shows a flow-chart describing the use of a 3' exonuclease to digest
  • FIG. 20 illustrates synthesis of a de novo oligonucleotide using nucleotide triphosphate analogs having a 3 '-O-blocking group
  • FIG. 21 shows four exemplary 3'-0-blocked nucleotide analogs that can be used for the synthesis of de novo oligonucleotides in conjunction with a suitable template-independent polymerase;
  • FIG. 22 illustrates the incorporation of a reusable 3' moiety into a nucleic acid coupled to a solid support, growth of a nucleic acid using a modified TdT, and release of the de novo oligonucleotide.
  • FIG. 23 shows the results of enzymatic installation of a 3’-poly-U tract with TdT, followed by USER digestion of the tract.
  • FIG. 24 shows the results of USER digestion of an internal poly-U tract to produce a 5’- monodisperse cleavage product.
  • FIG. 25 illustrates solid-phase dephosphorylation and TdT extension results.
  • FIG. 26 shows an exemplary resin regeneration cycle.
  • FIG. 27 shows an exemplary index strand regeneration process.
  • the invention provides improved methods for synthesizing polynucleotides, such as DNA and RNA, using enzymes and nucleic acid analogs. Using the disclosed methods, specific sequences of polynucleotides can be synthesized de novo , base by base, in an aqueous environment, and without the use of a nucleic acid template.
  • Nucleotide analogs may have an unmodified 3' hydroxyl, or may have a 3'-0-blocking group or may have a blocker releasably attached to a phosphate.
  • the blocking group is designed to not leave behind substantial additional molecules, i.e., designed to leave behind “scarless” nucleotides that are recognized as“natural” nucleotides by the enzyme.
  • polynucleotide with the same sequence.
  • the synthetic polynucleotide can, thus, be incorporated into living systems without concern that the synthesized polynucleotide will interfere with biochemical pathways or metabolism.
  • the process and analogs of the invention are used for the non-template mediated enzymatic synthesis of oligo- and oligodeoxynucleotides especially of long oligonucleotides ( ⁇ 5000 nt). Products can be single stranded or partially double stranded depending upon the initiator used.
  • the synthesis of long oligonucleotides requires high efficiency incorporation and high efficiency of reversible terminator removal.
  • the initiator bound to the solid support consists of a short, single strand DNA sequence that is either a short piece of the user defined sequence or a universal initiator from which the user defined single strand product is removed.
  • the disclosed methods employ commercially-available nucleotidyl transferase enzymes, such as terminal deoxynucleotidyl transferase (TdT), to synthesize polynucleotides from nucleotide analogs in a step-by-step fashion.
  • nucleotidyl transferase enzymes such as terminal deoxynucleotidyl transferase (TdT)
  • TdT terminal deoxynucleotidyl transferase
  • NTP is a nucleotide triphosphate (i.e., a dNTP or an rNTP)
  • the linker is a cleavable linker between the pyridine or pyrimidine of the base
  • the inhibitor is a group that prevents the enzyme from incorporating subsequent nucleotides.
  • a new nucleotide analog is incorporated into the growing polynucleotide chain, whereupon the enzyme is blocked from adding an additional nucleotide by the inhibitor group.
  • the inhibitor can be cleaved from the NTP, and new nucleotide analogs can be introduced in order to add the next nucleotide to the chain.
  • nucleotidyl transferases for polynucleotide synthesis include: 1) 3’- extension activity using single strand (ss) initiating primers in a template-independent polymerization, 2) the ability to extend primers in a highly efficient manner resulting in the addition of thousands of nucleotides, and 3) the acceptance of a wide variety of modified and substituted NTPs as efficient substrates.
  • the invention can make use of an initiator sequence that is a substrate for nucleotidyl transferase.
  • the initiator is attached to a solid support and serves as a recognition site for the enzyme.
  • the initiator is preferably a universal initiator for the enzyme, such as a homopolymer sequence, and is recyclable on the solid support, the formed oligonucleotide being cleavable from the initiator.
  • Methods of the invention are well-suited to a variety of applications that currently use synthetic nucleic acids, e.g., phosphoramidite-synthesized DNA oligonucleotides.
  • polynucleotides synthesized using the methods of the invention are used as primers for nucleic acid amplification, hybridization probes for detection of specific markers, and for incorporation into plasmids for genetic engineering.
  • the disclosed methods produce longer synthetic strings of nucleotides, at a faster rate, and in an aqueous environment, the disclosed methods also lend themselves to high-throughput applications, such as screening for expression of genetic variation in cellular assays, as well as synthetic biology.
  • the methods of the invention will provide the functionality needed for next-generation applications, such as using DNA as synthetic read/write memory, or creating macroscopic materials synthesized completely (or partially) from DNA.
  • the invention and systems described herein provide for synthesis of polynucleotides, including deoxyribonucleic acids (DNA) and ribonucleic acids (RNA). While synthetic pathways for“natural” nucleotides, such as DNA and RNA, are described in the context of the common nucleic acid bases, e.g., adenine (A), guanine (G), cytosine (C), thymine (T), and uracil(U), it is to be understood that the methods of the invention can be applied to so-called “non-natural” nucleotides, including nucleotides incorporating universal bases such as 3- nitropyrrole 2'-deoxynucloside and 5-nitroindole 2'-deoxynucleoside, alpha phosphorothiolate, phosphorothioate nucleotide triphosphates, or purine or pyrimidine conjugates that have other desirable properties, such as fluorescence.
  • DNA deoxyribonucleic acids
  • purine and pyrimidine bases include pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-brom
  • bases i.e., bases that do not react with other proteins, i.e., transcriptases, thus allowing the influence of sequence information to be decoupled from the structural effects of the bases.
  • NTP can be any nucleotide triphosphate, such as adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), thymidine triphosphate (TTP), uridine triphosphate (UTP), nucleotide triphosphates, deoxy adenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP), or deoxyuridine triphosphate (dUTP).
  • ATP adenosine triphosphate
  • GTP guanosine triphosphate
  • CTP cytidine triphosphate
  • TTP thymidine triphosphate
  • UTP uridine triphosphate
  • nucleotide triphosphates deoxy adenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), de
  • the linker can be any molecular moiety that links the inhibitor to the NTP and can be cleaved.
  • the linkers can be cleaved by adjusting the pH of the surrounding environment.
  • the linkers may also be cleaved by an enzyme that is activated at a given temperature, but inactivated at another temperature.
  • the linkers include disulfide bonds.
  • Linkers may, for example, include photocleavable, nucleophilic, or electrophilic cleavage sites.
  • Photocleavable linkers wherein cleavage is activated by a particular wavelength of light, may include benzoin, nitroveratryl, phenacyl, pivaloyl, sisyl, 2-hydroxy-cinamyl, coumarin-4-yl- methyl, or 2-nitrobenzyl based linkers.
  • nucleophilic cleavage sites include fluoride ion cleavable silicon-oxygen bonds or esters which may be cleaved in a basic solution.
  • Electrophilically-cleaved linkers may include acid induced cleavage sites which may comprise trityl, tert-butyloxycarbonyl groups, acetal groups, and p-alkoxybenzyl esters and amides.
  • a cleavable linker may include a cysteine residue as shown in FIG. 15.
  • the linker can be attached, for example, at the N4 of cytosine, the N3 or 04 of thymine, the N2 or N3 of guanine, and the N6 of adenine, or the N3 or 04 of uracil because attachment at a carbon results in the presence of a residual scar after removal of the polymerase-inhibiting group.
  • the linker is typically on the order of at least about 10 Angstroms long, e.g., at least about 20 Angstroms long, e.g., at least about 25 Angstroms long, thus allowing the inhibitor to be far enough from the pyridine or pyrimidine to allow the enzyme to bind the NTP to the polynucleotide chain via the attached sugar backbone.
  • the cleavable linkers are self-cyclizing in that they form a ring molecule that is particularly non-reactive toward the growing nucleotide chain.
  • a cleavable linker may include a variable number of methylene bridges on the NTP or the inhibitor side of a disulfide bond, including, for example, 1, 2, 3, or 4 methylene bridges as shown in FIGS. 14 and 16A-C. These methylene bridges may be used to increase the space between the NTP and the inhibitor.
  • the length of the cleavable linker may be selected in order to prevent the inhibitor from interfering with coupling of the NTP to the synthesized polynucleotide.
  • the distance of the charged group to the NTP plays an important role in the effectiveness of inhibiting a subsequent nucleotide incorporation.
  • the charged moiety may be from about 5 to about 60 bonds away from the NTP.
  • the charged moiety may be from about 5 to about 60 bonds away from the NTP.
  • the charged moiety of the inhibitor may be from about 10 to about 40 bonds away from the NTP. In some other embodiments, the charged moiety of the inhibitor can be from about 10 to about 35 bonds away from the NTP. In some other embodiments, the charged moiety of the inhibitor may be from about 10 to about 30 bonds away from the NTP. In some other embodiments, the charged moiety of the inhibitor is from about 10 to about 20 bonds away from the NTP. The number of bonds between the charged moiety and the NTP may be increased by including additional methylene bridges.
  • the nucleotide analogs can include any moiety linked to the NTP that inhibits the coupling of subsequent nucleotides by the enzyme.
  • the inhibitory group can be a charged group, such as a charged amino acid, or the inhibitory group can be a group that becomes charged depending upon the ambient conditions.
  • the inhibitor may include a moiety that is negatively charged or capable of becoming a negatively charged.
  • an inhibitor may include a chain of phosphate groups (e.g., 1, 2, or 3, phosphates) as shown in FIGS. 16A-C, wherein additional phosphates increase the overall anionic charge of the inhibitor.
  • the inhibitor group is positively charged or capable of becoming positively charged.
  • the inhibitor is an amino acid or an amino acid analog.
  • the inhibitor may be a peptide of 2 to 20 units of amino acids or analogs, a peptide of 2 to 10 units of amino acids or analogs, a peptide of 3 to 7 units of amino acids or analogs, a peptide of 3 to 5 units of amino acids or analogs.
  • the inhibitor includes a group selected from the group consisting of Glu, Asp, Arg, His, and Lys, and a combination thereof (e.g., Arg, Arg-Arg, Asp, Asp-Asp, Asp, Glu, Glu-Glu, Asp-Glu-Asp,
  • Peptides or groups may be combinations of the same or different amino acids or analogs.
  • a peptide inhibitor may be acetylated to discourage errant bonding of free amino groups.
  • the inhibitory group may also include a group that reacts with residues in the active site of the enzyme thus interfering with the coupling of subsequent nucleotides by the enzyme.
  • the inhibitor may have a charged group selected from the group consisting of— COO,— N02,— P04,— P03,— S02, or— NR3 where each R may be H or an alkyl group. In other embodiments, the inhibitor moiety does not comprise a— P04 group.
  • a terminator or inhibitor may include a steric inhibitor group.
  • a steric inhibitor group may allow for the NTP-linker-inhibitor (i.e., nucleotide analog) to be incorporated onto the unblocked 3' OH of an oligonucleotide, said incorporation being catalyzed by nucleotidyl transferase.
  • the steric inhibitor group may physically block the incorporation of nucleotides or additional nucleotide analogs onto the unblocked 3' OH of the incorporated nucleotide analog.
  • Steric inhibitors may also block 3' endonucleases from acting on a nucleotide analog and, accordingly, on oligonucleotides to which an un-cleaved nucleotide analog has been incorporated.
  • Steric inhibitors can include, for example, chemical polymers, nanoparticles, poly-N- substituted glycines (peptoids), or proteins.
  • a steric inhibitor of the invention may be a variety of sizes including, e.g., greater than 20 A, greater than 30 A, greater than 40 A, greater than 50 A, greater than 60 A, greater than 70 A, greater than 80 A, greater than 90 A, greater than 100 A, greater than 110 A, greater than 120 A, greater than 130 A, greater than 140 A, or greater than 150 A.
  • a steric inhibitor may be monodisperse or substantially monodisperse.
  • Steric inhibitors may be water soluble and conformationally-constrained (i.e., of a rigid or semi-rigid form).
  • a steric inhibitor will physically block access to the active site of the relevant nucleotidyl transferase enzyme because of the size or the conformation of the inhibitor.
  • the steric inhibitor may comprise a non-natural bio-inspired polymer such as a polypeptoid or a non-natural polypeptide.
  • a self-assembling polypeptoid sequence may be used as a steric inhibitor.
  • Peptoid monomers are often based on an N-substituted glycine backbone. Because the backbone is devoid of hydrogen bond donors, polypeptoids are readily processed while still being able to form secondary structures such as helices. They also provide the beneficial properties of allowing polarities and side chains similar to peptides, while being generally chemically and thermally stable.
  • Self- assembling polypeptoid steric inhibitors according to the invention may self-assemble single peptoid helices to form microspheres in the micrometer range of diameters including, .3 pm, .4 pm, .5 pm, .6 pm, .7 pm, .8 pm, .9 pm, 1.0 pm, 1.5 pm, 2 pm, 2.5 pm, 3 pm, or 3.5 pm, among others.
  • steric inhibitors may include peptoids with C-a-branched side chains, N-Aryl side chains, N-l-naphthylethyl side chains, or other formations capable of forming stable helical structures.
  • An example of a peptoid steric inhibitor is shown in FIG. 18.
  • a steric inhibitor may include a reactive group that is easily joined to a linker group, e.g., a cleavable linking group as described herein.
  • a steric inhibitor may comprise a polymer, such as a
  • the polymer may comprise blocks of different polymers, such that the blocks form a desired macroscopic structure, .e.g., a sphere when exposed to an aqueous environment.
  • the copolymer may comprise blocks of hydrophilic and hydrophobic blocks so that the polymer self-assembles into a micellar structure upon addition to water.
  • the hydrophobic blocks may be selected from
  • polycaprolactones PCL
  • polydimethylsiloxanes PDMS
  • polymethylmethacrylate PMMA
  • polylactides PLA
  • the hydrophilic blocks may include polyethylene glycol (PEG) or other poly alcohol.
  • the inhibitor may comprise a nanoparticle of sufficient size to block the activity of a nucleotidyl transferase.
  • nanoparticles may comprise, e.g., gold, silver, silicon, cerium oxide, iron oxide, titanium dioxide, silicon nitride, silicon boride, or silica, e.g., mesoporous silica.
  • the nanoparticles may comprise highly- ordered molecular structures, such as fullerenes, e.g., buckyballs and nanotubes, comprising carbon, or semiconductors.
  • Steric inhibitors may have no charge or may be positively or negatively charged to provide compatibility with the nucleotide to which it is linked and with the nucleotidyl transferase enzyme so that the inhibitor does not interfere with the incorporation reaction on the 5’ end of the NTP analog.
  • Steric inhibitors may incorporate a variety of amino acid residues in order to provide a desired conformation, charge, or attachment site.
  • FIG. 1 An example of a nucleotide analog of the type NTP-linker-inhibitor is shown in FIG.
  • the analog in FIG. 1A includes an inhibitory (-Asp-Asp-) group linked to the position of dCTP through a disulfide (-S-S-) bond while providing an unblocked, unmodified 3'-OH on the sugar ring.
  • the linker is constructed such that all linker atoms (including the 2nd incorporation-inhibiting moiety) can be removed, thereby allowing the nascent DNA strand to revert to natural nucleotides. As shown in FIG.
  • an aqueous reducing agent such as tris(2- carboxyethyl) phosphine (TCEP) or dithiothreitol (DTT)
  • TCEP tris(2- carboxyethyl) phosphine
  • DTT dithiothreitol
  • a self- cyclizing linker can be incorporated, resulting in a cyclic oxidized tetrahydrothiophene leaving group that is easily removed from the reagent solution at the conclusion of nucleotide synthesis.
  • NTP-linker-inhibitor can also be formed by attaching the linker-inhibitor moiety to the N6 of adenine (FIG. 2), the N2 of guanine (FIG. 3), the N3 of thymine (FIG. 4), or the N3 of uracil (FIG. 5), thereby providing analogs of the“naturally-occurring” dNTPs, as well as a deoxyuracil nucleotide (dUTP). While it is unlikely that there will be wide use of a dUTP, the synthesis is straightforward based upon the chemistry.
  • dCTP deoxycytidine triphosphate
  • Scheme 2 a deoxycytidine triphosphate
  • FIG. 6 the Staudinger dCTP analog undergoes cleavage under aqueous conditions with the addition of azide and triphenylphosphine.
  • the Staudinger analog shown in FIG. 6 is also suitable for nucleotide extension using nucleotidyl transferases, such as TdT, as described above and exemplified in FIGS. 1-5.
  • nucleotide analogs of Scheme 2 can be formed by attaching the Staudinger moiety to the N6 of adenine, the N2 of guanine, the N3 of thymine, or the N3 of uracil, thereby providing analogs of the“naturally-occurring” dNTPs, as well as a deoxyuracil nucleotide (dUTP).
  • Scheme 1A can be used to produce corresponding ribonucleotide analogs, e.g., as shown in FIGS. 7-10, by starting with the appropriate ribonucleotide reactants.
  • Ribonucleotide analogs comprising the Staudinger linker can also be created using Scheme 2 in order to form the needed ribonucleotide analogs, including, e.g., CTP analogs, as shown in FIG.
  • a 3'-0-blocked nucleotide analog can be used along with a modified enzyme capable of incorporating 3'-0-blocked nucleotide analogs into an oligonucleotide.
  • modified enzymes will allow 3'-0-blocked dNTP analogs to be used in a step-by-step method to extend an initiating nucleic acid into a user defined sequence (see FIG. 20).
  • the reactants can be recovered and recycled from the solid support back to the original reagent reservoir. Once that step is complete, the 3'-0-blocking group will be removed, allowing the cycle to start anew.
  • 3'-0-blocked deoxynucleotides may be used, but the choice of specific 3'-0-blocking groups is dictated by: 1) the smallest possible bulk to maximize substrate utilization by TdT and 2) removal of the blocking group with the mildest and preferably aqueous conditions in the shortest period of time.
  • the preferred removable 3’-0-blocking group is a 3’- O- amino, a 3’-0-allyl or a 3’-0-azidomethyl.
  • the removable 3’-0- blocking moiety is selected from the group consisting of O-phenoxyacetyl; O-methoxyacetyl; O- acetyl; Cl ip-toluene )-sulfonate; O-phosphate; O-nitrate; 0-[4-methoxy ]-tetrahydrothiopyranyl; O- tetrahydrothiopyranyl; 0-[5-methyl]-tetrahydrofuranyl; O- [2-methyl, 4-methoxy]- tetrahydropyranyl; 0-[5-methyl]-tetrahydropyranyl; and O-tetrahydrothiofuranyl (see US
  • the removable blocking moiety is selected from the group consisting of esters, ethers, carbonitriles, phosphates, carbonates, carbamates, hydroxylamine, borates, nitrates, sugars, phosphoramide, phosphoramidates, phenylsulfenates, sulfates, sulfones and amino acids (see Metzker ML et al. Nuc Acids Res. 1994;22(20):4259-67, U.S.P.N.
  • FIG. 21 shows four exemplary 3'-0-blocked dNTP analogs, namely 3'-0-azidomethyl- dATP, 3'-0-azidomethyl-dCTP, 3'-0-azidomethyl-dGTP, and 3'-0-azidomethyl-dTTP.
  • the 3'- O- blocked dNTP analogs can be purchased from specialty suppliers, such as Azco Biotech,
  • nucleotidyl transferases to assemble the nucleotide analogs into polynucleotides.
  • Nucleotidyl transferases include several families of related transferase and polymerase enzymes. Some nucleotidyl transferases polymerize
  • nucleotidyl transferases polymerize ribonucleotides more efficiently than deoxyribonucleotides
  • nucleotidyl transferases polymerize ribonucleotides and deoxyribonucleotides at approximately the same rate.
  • transferases having polymerase activity such as terminal deoxynucleotidyl transferase (TdT) are capable of catalyzing the addition of
  • TdT will only catalyze the addition of 1-2 ribonucleotides to the growing end of a DNA strand which could be useful in the construction of site specific DNA-RNA chimeric polynucleotides.
  • calf thymus TdT sourced from engineered E. coli, is suitable for use with the invention and available from commercial sources such as Thermo Scientific (Pittsburgh, PA).
  • the amino acid sequence corresponding to calf TdT is listed in Table 1 as SEQ ID NO. 1.
  • Table 1 Amino Acid Sequence of Bovine TdT
  • SEQ ID NO. 1 MAQQRQHQRL PMDPLCTASS GPRKKRPRQV GASMASPPHD
  • nucleotide sequence corresponding to calf TdT is listed in Table 2 as SEQ ID NO. 2.
  • modified TdT e.g., having an amino acid sequence at least 95% in common with SEQ ID NO. 1, e.g., having an amino acid sequence at least 98% in common with SEQ ID NO. 1, e.g., having an amino acid sequence at least 99% in common with SEQ ID NO. 1, may be used with the methods of the invention.
  • An organism that expresses a suitable nucleotidyl transferase may comprise a nucleic acid sequence at least 95% in common with SEQ ID NO. 2, e.g., at least 98% in common with SEQ ID NO. 2, e.g., at least 99% in common with SEQ ID NO. 2.
  • a modified TdT will result in more efficient generation of polynucleotides, or allow better control of chain length.
  • Other modifications to the TdT may change the release characteristics of the enzyme, thereby reducing the need for aqueous reducing agents such as TCEP or DTT.
  • a nucleotidyl transferase like E. coli poly(A) polymerase can be used to catalyze the addition of ribonucleotides to the 3’ end of a ribonucleotide initiator.
  • E. coli poly(U) polymerase may be more suitable for use with the methods of the invention.
  • Both E. coli poly(A) polymerase and E. coli poly(U) polymerase are available from New England Biolabs (Ipswich, MA). These enzymes may be used with
  • RNA may be synthesized using 3’blocked, 2’blocked, or 2’- 3’blocked rNTPs and poly(U) polymerase or poly(A) polymerase.
  • the amino acid and nucleotide sequences for E. coli Poly(A) polymerase and E. coli Poly(U) polymerase are reproduced below.
  • Modified E. coli Poly(A) polymerase or E. coli Poly(U) polymerase may be suitable for use with the methods of the invention.
  • an enzyme having an amino acid sequence at least 95% in common with SEQ ID NO.
  • An organism that expresses a suitable enzyme may comprise a nucleic acid sequence at least 95% in common with SEQ ID NO. 4, e.g., at least 98% in common with SEQ ID NO. 4, e.g., at least 99% in common with SEQ ID NO. 4.
  • An organism that expresses a suitable enzyme may comprise a nucleic acid sequence at least 95% in common with SEQ ID NO. 6, e.g., at least 98% in common with SEQ ID NO. 6, e.g., at least 99% in common with SEQ ID NO. 6.
  • the nucleotide sequence corresponding to E. coli poly(A) polymerase is listed in Table 4 as SEQ ID NO. 4.
  • SEQ ID NO. 5 GSHMSYQKVP NSHKEFTKFC YEVYNEIKIS DKEFKEKRAA
  • the nucleotide sequence corresponding to E. coli poly(U) polymerase is listed in Table 6 as SEQ ID NO. 6.
  • the inhibitor coupled to the nucleotide analog will cause the transferase, e.g., TdT, to not release from the polynucleotide or prevent other analogs from being incorporated into the growing chain.
  • TdT transferase
  • a charged moiety results in better inhibition, however, research suggests that the specific chemical nature of the inhibitor is not particularly important. For example, both phosphates and acidic peptides can be used to inhibit enzymatic activity.
  • the inhibitor will include single amino acids or dipeptides, like -(Asp)2, however the size and charge on the moiety can be adjusted, as needed, based upon experimentally determined rates of first nucleotide incorporation and second nucleotide incorporation. That is, other embodiments may use more or different charged amino acids or other biocompatible charged molecule.
  • nucleotide synthesis may be used to build de novo oligonucleotides in a template independent fashion using nucleotidyl transferases or modified nucleotidyl transferases.
  • the polymerase/transferase enzymes can be modified so that they cease nucleotide addition when they encounter a modification to the phosphate of a 3’-unmodified dNTP analog.
  • This scheme would require a deblocking reagent/reaction that modifies the phosphate end of the nucleotide analog, which frees up the nascent strand for subsequent nucleotide incorporation.
  • Preferred embodiments of this approach would use nucleotide analogs modified only at the phosphates (alpha, beta or gamma) although modifications of the purine/pyrimidine base of the nucleotide are allowed.
  • oligonucleotides that have not been properly terminated with an inhibitor prior to subsequent nucleotide analog addition.
  • the inhibitor of the nucleotide analog can be chosen to inhibit the activity of nucleotidyl transferase and 3' exonucleases, such that only properly terminated oligonucleotides would be built up.
  • this quality control technique the purity of the resulting oligonucleotide sequences would be improved.
  • use of such quality control measures can negate the need for post-synthesis purification.
  • This technique is represented schematically in FIG. 19, where a 3' exonuclease is introduced after a wash step to remove excess nucleotide analogs and prior to linker cleavage. Such a cleaning step, as shown in FIG. 19, will reduce the number of oligonucleotides that are of an undesired length and/or sequence.
  • non-template dependent polymerase/transferase enzymes would be to using protein engineering or protein evolution to modify the enzyme to remain tightly bound and inactive to the nascent strand after each single nucleotide incorporation, thus preventing any subsequent incorporation until such time as the polymerase/transferase is released from the strand by use of a releasing reagent/condition.
  • Such modifications would be selected to allow the use of natural unmodified dNTPs instead of reversible terminator dNTPs.
  • Releasing reagents could be high salt buffers, denaturants, etc.
  • Releasing conditions could be high temperature, agitation, etc.
  • mutations to the Loopl and SD1 regions of TdT have been shown to dramatically alter the activity from a template-independent activity to more of a template dependent activity. Specific mutations of interest include but are not limited to
  • TdT enzyme Q402K403C404DE402R403S404.
  • Other means of accomplishing the goal of a post- incorporation tight binding (i.e., single turnover) TdT enzyme could include mutations to the residues responsible for binding the three phosphates of the initiator strand including but not limited to K261, R432, and R454.
  • non-template dependent polymerase/transferase enzymes Another embodiment for using non-template dependent polymerase/transferase enzymes is to use protein engineering or protein evolution to modify the enzyme to accept 3 -blocked reversible terminators with high efficiency.
  • Naturally occurring polymerase/transferase enzymes will not incorporate 3’-blocked reversible terminators due to steric constraints in the active site of the enzyme. Modifying either single or several amino acids in the active site of the enzyme can allow the highly-efficient incorporation of 3’-blocked reversible terminators into a support bound initiator in a process completely analogous to that described above.
  • the 3’- reversible terminator is removed with a deblocking reagent/condition thus generating a completely natural (scarless) single strand molecule ready for subsequent controlled extension reactions.
  • the enzyme contains amino acids close to the 3’-OH of the incoming dNTP which explains the propensity of TdT for incorporating ribonucleotide triphosphates as readily as deoxyribonucleotide triphosphates; amino acids including but not limited to those between b ⁇ and b2 especially R334, Loopl, and those between al3 and al4, especially R454, are likely targets for mutagenesis to accommodate the bulk of 3’-reversible terminator groups and allow their efficient incorporation.
  • additional amino acid changes may be required to compensate for alterations made in order to accommodate a 3’-reversible terminator.
  • Another embodiment for using template- dependent polymerases is to use the either 3’blocked or 3’unblocked dNTP analogs with a plurality of primer-template pairs attached to a solid support where the template is a nucleic acid analog that supports polymerase mediated primer extension of any of the four bases as specified by the user.
  • an engineered TdT is used to achieve stepwise synthesis with 3'- O- blocked nucleotide analogs. It is possible to model the active site of the TdT protein using
  • Arg336 may help explain why substitutions at this position have a negative impact on the reactivity of modified TdT proteins.
  • the instability created by modifying position 336 may be overcome by using proline to stabilize cis-peptide bond conformation.
  • the entire TGSR motif (positions 451, 452, 435, 454) may also have to be modified to compensate for this change.
  • the TGSR motif may be modified to TPSR or TGPR.
  • substitutions at Arg454 to accommodate the steric bulk of a 3'- O-blocking group may require additional modifications to the al4 region to compensate for substitutions of glycine or alanine at Arg454.
  • substitutions for other amino acids in the al 1 region may be required to compensate for substitution to Arg336 either instead of, or in addition to, modification of the GSR motif.
  • Residues that are within 1.2 nm of the 3'-OH such as Glu457, Ala510, Asp509, Arg508, Lysl99, Serl96 Metl92, or Leul61 may also potentially interfere with the substrate utilization of a 3'-0-blocked dNTP and are thus targets for substitution in addition to or in combination with Arg336 and Arg454.
  • amino acid substitutions at positions 508, 509 and 510 it may be necessary to delete amino acids in order to remove interference with a 3’-0- blocking group. Since those amino acids are located near the C-terminus of the protein, and exist in a relatively unstructured region, they may be deleted singly or altogether, either instead of or in combination with the modifications described above.
  • Non-template dependent polymerase/transferase enzymes can use protein engineering or protein evolution to modify the enzyme to optimize the use of each of the four different nucleotides or even different modified nucleotide analogs in an analog specific manner.
  • Nucleotide specific or nucleotide analog specific enzyme variants could be engineered to possess desirable biochemical attributes like reduced Km or enhanced addition rate which would further reduce the cost of the synthesis of desired polynucleotides.
  • the methods of the invention can be practiced under a variety of reaction conditions, however the orderly construction and recovery of desired polynucleotides will, in most cases, require a solid support on which the polynucleotides can be extended.
  • the NTP, linker, and inhibitor analogs discussed above it is possible to construct specific polynucleotide sequences of DNA, as well as RNA, by using, for example, TdT or poly(A) polymerase in an aqueous environment. As shown in FIG. 13, the TdT can be used to effect the stepwise construction of custom polynucleotides by extending the polynucleotide sequence in a stepwise fashion.
  • the inhibitor group of each NTP analog causes the enzyme to stop with the addition of a nucleotide.
  • the reactants are washed away from the solid support prior to the removal of the inhibitor by cleaving the linker, and then new reactants are added, allowing the cycle to start anew.
  • an additional quality control step may be incorporated in which the oligonucleotide or polynucleotide is exposed to 3’ exonuclease after the nucleotidyl transferase- mediated nucleotide analog extension step and before inhibitor cleavage.
  • a 3’ exonuclease degrades oligonucleotide or polynucleotide strands with an unblocked 3’ OH.
  • An uncleaved inhibitor e.g., a steric inhibitor
  • Such a quality control step degrades only the oligonucleotides or polynucleotides that have unsuccessfully incorporated the desired nucleotide analog in the prior addition step, thereby eliminating any errors in the finished synthesized sequence.
  • the enzyme may be washed away before carrying on with the inhibitor cleavage step.
  • the 3’ exonuclease acts by shortening or completely degrading strands that have not successfully added the desired nucleotide analog. Strands that fail to be enzymatically extended at a given cycle will not have a terminal macromolecule-dNMP conjugate prior to the linker cleavage step. If a 3’-exonuclease is introduced at this stage, the full length strand could be protected from degradation while“failure” strands will be shorted in length or potentially degraded completely to mononucleotide phosphates.
  • a 3’-exonuclease step would have no impact on the quality of the synthesis if the deblocking/elimination step is less than quantitative because those strands would still be protected by the macromolecule terminator and fail to extend during the next extension step.
  • the finished full- length, single-strand polynucleotide is complete and is cleaved from the solid support and recovered for subsequent use in applications such as DNA sequencing or PCR.
  • the finished, full-length, single-strand polynucleotide can remain attached to the solid support for subsequent use in applications such as hybridization analysis, protein or DNA affinity capture.
  • partially double- stranded DNA can be used as an initiator, resulting in the synthesis of double- stranded polynucleotides.
  • a nucleic acid initiator will include a 3' moiety that will release the synthesized oligonucleotide when in the presence of a releasing agent. This feature is illustrated, generally, in FIG. 22, where a nucleic acid initiator (5'-initiator-) is shown coupled to a solid state support (open circle) and a releasable 3' moiety (open star).
  • the initiator is a single-stranded oligonucleotide, such as a dimer, trimer, tetramer, pentamer, hexamer, septamer, or octomer.
  • the enzyme can add additional nucleotides or nucleotide analogs in a stepwise fashion. With each addition, the length of the synthesized oligonucleotide increases.
  • a releasing agent can be introduced to cause the 3' moiety to decouple from the nucleic acid initiator.
  • the 3' moiety is a ribonucleotide, such as an A, C, G, or U ribonucleotide.
  • the 3' moiety is an abasic deoxyribose. In other embodiments, the 3' moiety is an abasic ribose. In other embodiments, the 3' moiety is a non-nucleoside 5'-monophosphate.
  • the releasing agent may include a basic solution or a metal ion.
  • the releasing agent can be a concentrated NH40H solution, having a pH greater than 8, i.e., greater than pH 8.5, i.e., greater than pH 9.0, i.e., greater than pH 9.5.
  • the releasing agent will be an enzyme, such as a type II restriction nuclease.
  • the enzyme will uniquely interact with the nucleic acid sequence of the initiator, and lyse the synthesized oligonucleotide from the initiator, leaving behind the initiator.
  • the initiator is a nucleic acid hexamer and the 3' moiety is a ribonucleotide, such as adenosine.
  • the oligonucleotide can be released by exposing the bound oligonucleotide to an ammonium hydroxide solution of a pH around 8.
  • the basic solution containing the synthesized oligonucleotides can then be separated from the solid substrate comprising the hexamer initiator.
  • the solid substrate is then washed and/or neutralized to prepare the initiator and 3' moiety for fabrication of a new oligonucleotide.
  • the terminal e.g., using nucleotides comprising a cleavable terminator linked at the N-4 position, or nucleotides having a 3'-0-blocked position.
  • ribonucleotide is regenerated prior to oligonucleotide synthesis with the use of a phosphatase or the 3' phosphatase activity of T4 polynucleotide kinase.
  • the solid support and nucleic acid initiator including the 3' moiety will be reusable, thereby allowing the initiator coupled to the solid support to be used again and again for the rapid synthesis of oligonucleotides.
  • Solid supports suitable for use with the methods of the invention may include glass and silica supports, including beads, slides, pegs, or wells.
  • the support may be tethered to another structure, such as a polymer well plate or pipette tip.
  • the solid support may have additional magnetic properties, thus allowing the support to be manipulated or removed from a location using magnets.
  • the solid support may be a silica coated polymer, thereby allowing the formation of a variety of structural shapes that lend themselves to automated processing.
  • initiator The selection of substrate material and covalent linkage chemistry between initiator and substrate is limited only by the ability of the construct to withstand the synthesis conditions without loss of initiator.
  • Preferred embodiments utilize substrates and linkers of greater chemical stability than the initiator so that the overall construct stability is that of the attached oligonucleotide and not dependent on the substrate.
  • initiators may be synthesized in a 5’ to 3’- direction from a material presenting surface hydroxyl groups, though in preferred embodiments the initiator is instead grafted to the substrate so that density and initiator quality can be precisely controlled.
  • the covalent linkage between the initiator and the substrate may be any bond which does not compromise the stability of the construct.
  • Preferred embodiments may utilize couplings between oligonucleotides containing either 5’-amine, 5’-hydroxyl, 5’-phosphate, 5’-sulfhydryl, or 5’-benzaldehyde groups and surfaces or resins containing formyl, chloromethyl, epoxide, amine, thiol, alkene, or terminal C-F bonds on the substrate.
  • the initiator may contain elements for sequence- specific cleavage strategies, such as those utilizing restriction enzymes, uracil specific excision reagent (USER), or any variety of sequence-specific nuclease.
  • these elements may instead be enzymatically synthesized or added to the initiator after it has been coupled to a resin.
  • the initiator is comprised of entirely thymidine in order to minimize potential side reactions with surface functional groups during the coupling process.
  • FIG. 23 shows a solution-phase example where a short poly-uracil (U) tract is added to the 3’-end of an initiator using TdT.
  • the resultant initiator may then be used for further extension reactions as described to generate the desired sequence.
  • the newly generated sequence may be cleaved at the internal poly-U tract to separate the new sequence from the original initiator.
  • the 30 nucleotide initiator used is of the sequence 5’- TT ATT ATT ATT ATT A A A A AGGCC A A A A A A A A A .
  • the gel shown in FIG. 23 includes the initiator run in lane 1 while the initiator after one or more additions of dUTP (i.e., the poly-uracil tract) was run in lane 2.
  • the generated sequence was then subjected to USER digestion for 10, 30, and 60 minutes and run in lanes 3, 4, and 5 respectively.
  • FIG. 24 shows that the cleavage of a sequence containing an internal poly-U tract produces a single product of homogenous length bearing a 5’-phosphate.
  • the cleavage process leaves a 3’- phosphate on the resin-bound initiator, which may be removed with treatment with T4
  • polynucleotide kinase, alkaline phosphatase or other dephosphorylation process See FIG. 25.
  • the internal poly-U tract sequence cleaved in the example depicted in FIG. 24 was of sequence 5’- TT AATT AATUUUU GTGAGCTT AATGTCCTT ATGT which, after USER digestion, resulted in a product of sequence 5’-phos-GTGAGCTTAATGTCCTTATGT.
  • the resulting product was run after 0, 10, 30, and 60 minutes of USER digestion in lanes, 1, 2, 3, and 4 as shown in FIG. 24, indicating the successful cleavage and homogenous length of the products.
  • a control oligonucleotide of sequence GTGAGCTTAATGTCCTTATGT was run.
  • FIG. 25 shows an exemplary solid-phase dephosphorylation and TdT extension process.
  • the chart depicts the absorbance of the TdT reaction mixture in a solid-phase extension.
  • dNTPs are added to the resin-bound initiator, they are depleted from solution, reducing absorbance of the supernatant.
  • Trace A shows the negligible rate of dNTP incorporation onto a resin where the 3’-end of the initiator is blocked with a terminal phosphate.
  • Trace B shows the rate of incorporation after such an initiator is treated with shrimp alkaline phosphatase for 15-minutes.
  • Trace C shows the rate of dNTP incorporation under the same conditions using an unblocked initiator.
  • FIG. 26 provides an overview of an exemplary regeneration cycle.
  • the cleavage site installation may be used to homogenize the enzymatic accessibility of the initiator oligonucleotides.
  • Each enzyme used during the enzymatic synthesis cycle has its own steric footprint with potentially distinct optimal loadings and spacing from the surface. This can produce unexpected behavior in regard to the kinetics of stepwise addition and yield from the enzymatic cleavage process.
  • repeated cycles of cleavage site installation, cleavage, and regeneration may be conducted prior to the oligonucleotide synthesis so that the cleavage enzyme and the template-independent polymerase are accessing the same population of surface oligonucleotides.
  • Some embodiments may install multiple different cleavage sites throughout a strand during synthesis. Upon digestion, a complex library of the strands located between the cleavage sites may be released from the resin. Such sequences can then be further amplified and used for enzymatic assembly processes by a skilled artisan. This approach may be uniquely suited to parallel synthesis schemes in order to produce greater varieties of sequence fragments with relatively few distinct locations on a surface, or to avoid the synthesis of contiguous strands which risk secondary structure formation during synthesis.
  • cleavage site installation may be used immediately after each cycle of enzymatic extension to assist in the removal of unreacted initiator sequences, analogous to the acetylation used in phosphoramidite-based oligonucleotide synthesis.
  • Strands which are unextended during the addition cycle act as substrates for a poly-U tract, while extended initiators bearing a chain terminator do not.
  • a single USER digestion is conducted so that the oligonucleotides are released from the support, and sequences containing failed additions are simultaneously digested to a shorter length than the full-sized product.
  • Failure sequences are also alike in that they are now phosphorylated at their 3’-ends, rendering them unreactive to further enzymatic extension.
  • the full-length sequences may then undergo extension to append any element which will enable selective capture, isolation, or enrichment.
  • Such elements may either be additional homopolymer tracts, such as further poly-U tracts, which can be isolated by hybridization-based approaches and subsequently digested, or biotinylated elements for non- covalent capture. This approach compensates for the lack of suitable chromatographic techniques suitable for long (150 nt-i- oligonucleotides), low sample quantities, or complex mixtures of sequences of varied lengths.
  • FIG. 27 An example is shown in FIG. 27. In such cases,
  • 5’-surface-immobilized sequences are terminated with a short poly-A tract.
  • Extension to produce a terminal 3’-poly-U site of sufficient length will allow a hairpin to fold under appropriate conditions, so that the elements of the initiator preceding the poly-A stretch can be replicated using a template-dependent polymerase.
  • the sequence can then be extended with a new homopolymer tract to leave a free 3’-terminus which can be used in subsequent data- writing operations.
  • the hairpin linker can then be digested with the USER enzyme to release the data strand, while leaving the template initiator to be regenerated with a 3’- dephosphorylation step, poly-U addition, and recopying of the template strand.
  • the use of homopolymer tracts in DNA-based data recording is described in co-owned U.S. Pat. App. Ser. No. 15/994,335, incorporated herein by reference.
  • synthesizer can be constructed to produce desired polynucleotides in substantial quantities.
  • a synthesizer will include four wells of the described NTP analog reagents, i.e., dCTP, dATP, dGTP, and dTTP, as well as TdT at concentrations sufficient to effect polynucleotide growth.
  • a plurality of initiating sequences can be attached to a solid support that is designed to be repeatedly dipped into each of the four wells, e.g., using a laboratory robot.
  • the robot could be additionally programmed to rinse the solid support in wash buffer between nucleotide additions, cleave the linking group by exposing the support to a deblocking agent, and wash the solid support a second time prior to moving the solid support to the well of the next desired nucleotide.
  • a highly parallel embodiment could consist of a series of initiator-solid supports on pegs in either 96 or 384 well formats that could be individually retracted or lowered so that the pegs can be indexed to contact the liquids in the wells in a controlled fashion.
  • the synthesizer could thus consist of the randomly addressable peg device, four enzyme-dNTP analog reservoirs in the same format as the peg device (96 or 384 spacing), additional reagent reservoirs (washing, deblocking, etc.) in the same format as the peg device (96 or 384 spacing), and a transport mechanism (e.g., a laboratory robot) for moving the peg device from one reservoir to another in a user programmable controlled but random access fashion. Care must be taken to avoid
  • the reagents e.g., nucleotide analogs, enzymes, buffers
  • the reagents will be moved between solid supports, allowing the reagents to be recycled.
  • a system of reservoirs and pumps can move four different nucleotide analog solutions, wash buffers, and/or reducing agent solutions between one or more reactors in which the oligonucleotides will be formed.
  • the reactors and pumps can be conventional, or the devices may be constructed using microfluidics. Because of the non-anhydrous (aqueous) nature of the process, no special care needs to be taken in the design of the hardware used to eliminate exposure to water. The synthesis process can take place with only precautions to control evaporative loss.
  • a highly parallel embodiment could consist of a monolithic series of initiator- solid supports on pegs in either 96 or 384 well format that can be interfaced to a series of wells in the same matching format.
  • Each well would actually be a reaction chamber that is fed by four enzyme-dNTP analog reservoirs and additional reagent reservoirs (washing, deblocking, etc.) with appropriate valves. Provisions would be made in the fluidics logic to recover the enzyme-dNTP reactants in a pristine fashion after each extension reaction since they are reused throughout the entire synthesis process to reduce the cost of each polynucleotide synthesis.
  • a system of pipetting tips could be used to add and remove reagents.
  • polynucleotides may be synthesized using microfluidic devices and/or inkjet printing technology.
  • An exemplary microfluidic polynucleotide synthesis device is shown in FIG. 17 for illustrative purposes and not to scale.
  • Microfluidic channels 255, including regulators 257 couple reservoirs 253 to a reaction chamber 251 and an outlet channel 259, including a regulator 257 can evacuate waste from the reaction chamber 251.
  • Microfluidic devices for polynucleotide synthesis may include, for example, channels 255, reservoirs 253, and/or regulators 257.
  • Polynucleotide synthesis may occur in a microfluidic reaction chamber 251 which may include a number of anchored synthesized nucleotide initiators which may include beads or other substrates anchored or bound to an interior surface of the reaction chamber and capable of releasably bonding a NTP analog or polynucleotide initiator.
  • the reaction chamber 251 may include at least one intake and one outlet channel 259 so that reagents may be added and removed to the reaction chamber 251.
  • the microfluidic device may include a reservoir 253 for each respective NTP analog. Each of these NTP analog reservoirs 253 may also include an appropriate amount of TdT or any other enzyme which elongates DNA or RNA strands without template direction.
  • Additional reservoirs 253 may contain reagents for linker/inhibitor cleavage and washing. These reservoirs 253 can be coupled to the reaction chamber 251 via separate channels 255 and reagent flow through each channel 255 into the reaction chamber 251 may be individually regulated through the use of gates, valves, pressure regulators, or other means. Flow out of the reaction chamber 251, through the outlet channel 259, may be similarly regulated.
  • reagents may be recycled, particularly the NTP analog-enzyme reagents.
  • Reagents may be drawn back into their respective reservoirs 253 from the reaction chamber 251 via the same channels 255 through which they entered by inducing reverse flow using gates, valves, pressure regulators or other means.
  • reagents may be returned from the reaction chamber 251 to their respective reservoirs 253 via independent return channels.
  • the microfluidic device may include a controller capable of operating the gates, valves, pressure, or other regulators 257 described above.
  • An exemplary microfluidic polynucleotide synthesis reaction may include flowing a desired enzyme-NTP analog reagent into the reaction chamber 251 ; after a set amount of time, removing the enzyme-NTP analog reagent from the reaction chamber 251 via an outlet channel 259 or a return channel; flowing a wash reagent into the reaction chamber 251; removing the wash reagent from the reaction chamber 251 through an outlet channel 259; flowing a de- blocking or cleavage reagent into the reaction chamber 251 ; removing the de-blocking or cleavage reagent from the reaction chamber 251 via an outlet channel 259 or a return channel; flowing a wash reagent into the reaction chamber 251 ; removing the wash reagent from the reaction chamber 251 through an outlet channel 259; flowing the enzyme-NTP analog reagent including the next NTP in the desired sequence to be synthesized into the reaction chamber 251 ; and repeating until the desired polynucleotide has been synthesized. After the desired
  • reagents and compounds including NTP analogs, TdT and/or other enzymes, and reagents for linker/inhibitor cleavage and/or washing may be deposited into a reaction chamber using inkjet printing technology or piezoelectric drop-on-demand (DOD) inkjet printing technology.
  • Inkjet printing technology can be used to form droplets, which can be deposited, through the air, into a reaction chamber.
  • Reagent droplets may have volumes in the picoliter to nanoliter scale. Droplets may be introduced using inkjet printing technology at a variety of frequencies including 1 Hz, 10, Hz, 100 Hz, 1 kHz, 2 kHz, and 2.5 kHz.
  • reagents may be stored in separate reservoirs within the inkjet printing device and the inkjet printing device may deliver droplets of various reagents to various discrete locations including, for example, different reaction chambers or wells within a chip.
  • inkjet and microfluidic technologies may be combined wherein certain reagents and compounds are delivered to the reaction chamber via inkjet printing technology while others are delivered via microfluidic channels or tubes.
  • An inkjet printing device may be controlled by a computing device comprising at least a non-transitory, tangible memory coupled to a processor.
  • the computing device may be operable to receive input from an input device including, for example, a touch screen, mouse, or keyboard and to control when and where the inkjet printing device deposits a droplet of reagent, the reagent it deposits, and/or the amount of reagent deposited.
  • an input device including, for example, a touch screen, mouse, or keyboard and to control when and where the inkjet printing device deposits a droplet of reagent, the reagent it deposits, and/or the amount of reagent deposited.
  • a desired polynucleotide sequence may be entered into the computing device through an input device wherein the computing device is operable to perform the necessary reactions to produce the desired polynucleotide sequence by sequentially depositing the
  • the released extension products can to be analyzed by high resolution PAGE to determine if the initiators have been extended by the anticipated number of bases compared to controls.
  • a portion of the recovered synthetic DNA may also be sequenced to determine if the synthesized polynucleotides are of the anticipated sequence.
  • synthesizers of the invention will be widely accessible for research institutions, biotechnology companies, and hospitals. Additionally, the ability to reuse/recycle reagents will reduce the waste produced and help reduce the costs of consumables. The inventors anticipate that the methods and systems will be useful in a number of applications, such as DNA sequencing, PCR, and synthetic biology.

Abstract

L'invention concerne des procédés améliorés de synthèse de polynucléotides, tels que l'ADN et l'ARN, au moyen d'initiateurs renouvelables couplés à un support solide. En utilisant les procédés de l'invention, des séquences spécifiques de polynucléotides peuvent être synthétisées de novo, base par base, dans un environnement aqueux, sans utiliser une matrice d'acide nucléique.
EP20748810.7A 2019-01-29 2020-01-29 Initiateurs réutilisables pour la synthèse d'acides nucléiques Pending EP3917660A4 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US16/261,229 US11331643B2 (en) 2013-04-02 2019-01-29 Reusable initiators for synthesizing nucleic acids
PCT/US2020/015640 WO2020160122A1 (fr) 2019-01-29 2020-01-29 Initiateurs réutilisables pour la synthèse d'acides nucléiques

Publications (2)

Publication Number Publication Date
EP3917660A1 true EP3917660A1 (fr) 2021-12-08
EP3917660A4 EP3917660A4 (fr) 2022-11-23

Family

ID=71840248

Family Applications (1)

Application Number Title Priority Date Filing Date
EP20748810.7A Pending EP3917660A4 (fr) 2019-01-29 2020-01-29 Initiateurs réutilisables pour la synthèse d'acides nucléiques

Country Status (3)

Country Link
EP (1) EP3917660A4 (fr)
JP (1) JP2022523711A (fr)
WO (1) WO2020160122A1 (fr)

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1573056A4 (fr) * 2002-05-17 2007-11-28 Nugen Technologies Inc Procedes de fragmentation, d'etiquetage et d'immobilisation d'acides nucleiques
US20040161749A1 (en) * 2003-01-24 2004-08-19 Hall Jeff G. 3' end tagged oligonucleotides
US20050260609A1 (en) * 2004-05-24 2005-11-24 Lapidus Stanley N Methods and devices for sequencing nucleic acids
EP2074133A2 (fr) * 2006-09-20 2009-07-01 Genovoxx GmbH Constituants et procédés de synthèse enzymatique d'acides nucléiques
US11331643B2 (en) * 2013-04-02 2022-05-17 Molecular Assemblies, Inc. Reusable initiators for synthesizing nucleic acids
US10683536B2 (en) * 2013-04-02 2020-06-16 Molecular Assemblies, Inc. Reusable initiators for synthesizing nucleic acids
WO2015172080A1 (fr) * 2014-05-08 2015-11-12 Fluidigm Corporation Séquençage intégré de cellules uniques
EP3527672B1 (fr) * 2015-06-09 2022-10-05 Centrillion Technology Holdings Corporation Matrices aux oligonucleotides pour la séquençage d'acides nucléiques

Also Published As

Publication number Publication date
EP3917660A4 (fr) 2022-11-23
JP2022523711A (ja) 2022-04-26
WO2020160122A1 (fr) 2020-08-06

Similar Documents

Publication Publication Date Title
US10683536B2 (en) Reusable initiators for synthesizing nucleic acids
US9771613B2 (en) Methods and apparatus for synthesizing nucleic acid
US20210340608A1 (en) Methods and apparatus for synthesizing nucleic acids
US9695470B2 (en) Methods and apparatus for synthesizing nucleic acids
CA2958581C (fr) Procedes et appareil de synthese d'acides nucleiques
US11331643B2 (en) Reusable initiators for synthesizing nucleic acids
CN105264085B (zh) 合成核酸的方法和设备
US20230227880A1 (en) Reusable initiators for synthesizing nucleic acids
EP3917660A1 (fr) Initiateurs réutilisables pour la synthèse d'acides nucléiques
AU2021252542A1 (en) Reusable initiators for synthesizing nucleic acids

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20210828

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20221020

RIC1 Information provided on ipc code assigned before grant

Ipc: C40B 50/18 20060101ALI20221014BHEP

Ipc: C07H 21/00 20060101ALI20221014BHEP

Ipc: B32B 17/10 20060101ALI20221014BHEP

Ipc: C12Q 1/6837 20180101ALI20221014BHEP

Ipc: C12Q 1/6811 20180101ALI20221014BHEP

Ipc: C12Q 1/6806 20180101ALI20221014BHEP

Ipc: C12P 19/34 20060101AFI20221014BHEP