EP3749321A1 - Gamma-polyglutamatierte antifolate und verwendungen davon - Google Patents

Gamma-polyglutamatierte antifolate und verwendungen davon

Info

Publication number
EP3749321A1
EP3749321A1 EP19752055.4A EP19752055A EP3749321A1 EP 3749321 A1 EP3749321 A1 EP 3749321A1 EP 19752055 A EP19752055 A EP 19752055A EP 3749321 A1 EP3749321 A1 EP 3749321A1
Authority
EP
European Patent Office
Prior art keywords
ypantifol
antifolate
cancer
gamma
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP19752055.4A
Other languages
English (en)
French (fr)
Other versions
EP3749321A4 (de
Inventor
Clet Niyikiza
Victor Mandla MOYO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
LEAF Holdings Group LLC
Original Assignee
LEAF Holdings Group LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by LEAF Holdings Group LLC filed Critical LEAF Holdings Group LLC
Publication of EP3749321A1 publication Critical patent/EP3749321A1/de
Publication of EP3749321A4 publication Critical patent/EP3749321A4/de
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/555—Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A61K33/243—Platinum; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • A61K47/551—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds one of the codrug's components being a vitamin, e.g. niacinamide, vitamin B3, cobalamin, vitamin B12, folate, vitamin A or retinoic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • A61K47/6913—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome the liposome being modified on its surface by an antibody
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D475/00—Heterocyclic compounds containing pteridine ring systems
    • C07D475/06—Heterocyclic compounds containing pteridine ring systems with a nitrogen atom directly attached in position 4
    • C07D475/08—Heterocyclic compounds containing pteridine ring systems with a nitrogen atom directly attached in position 4 with a nitrogen atom directly attached in position 2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure generally relates to gamma polyglutamated Antifolate compositions, including delivery vehicles such as liposomes containing the gamma polyglutamated Antifolate compositions, and methods of making and using the compositions to treat diseases including hyperproliferative diseases such as cancer, disorders of the immune system including inflammation and autoimmune diseases such as rheumatoid arthritis, and infectious disease such as HIV, malaria, and schistomiasis.
  • diseases including hyperproliferative diseases such as cancer, disorders of the immune system including inflammation and autoimmune diseases such as rheumatoid arthritis, and infectious disease such as HIV, malaria, and schistomiasis.
  • Folate is an essential cofactor that mediates the transfer of one-carbon units involved in nucleotide biosynthesis and DNA repair, the remethylation of homocysteine (Hey), and the methylation of DNA, proteins, and lipids.
  • the only circulating forms of folates in the blood are monoglutamates and folate monoglutamates are the only form of folate that is transported across the cell membrane - likewise, the monoglutamate form of polyglutamatable antifolates are transported across the cell membrane.
  • FPGS folylpoly-gamma-glutamate synthetase
  • Antifolate is transported into cells by the reduced folate carrier (RFC) system and folate receptors (FRs) a and b and by Proton Coupled Folate Transporter (PCFT) that is generally most active in a lower pH environment.
  • RFC is the main transporter of antifolates at physiologic pH and is ubiquitously expressed in both normal and diseased cells. Consequently, Antifolate treatment often suffers from the dose-limiting toxicity that is a major obstacle in cancer chemotherapy.
  • antifolates are polyglutamated by FPGS, which may add up to 6 glutamyl groups in an L-gamma carboxyl group linkage to the antifolate.
  • the L-gamma polyglutamation of antifolates by FPGS serves at least 2 main therapeutic purposes: (1) it greatly enhances Antifolate affinity and inhibitory activity for DHFR; and (2) it facilitates the accumulation of polyglutamated antifolate, which unlike antifolate (monoglutamate), is not easily transported out of cells by cell efflux pumps.
  • Resistance to antifolate therapy is typically associated with one or more of, (a) increased cell efflux pump activity, (b) decreased transport of antifolates into cells (c) increased DHFR activity, (d) decreased folylpoly-gamma-glutamate synthetase (FPGS) activity, and (e) increased gamma-glutamyl hydrolase (GGH) activity, which cleaves gamma polyglutamate chains attached to folates and antifolates.
  • FPGS folylpoly-gamma-glutamate synthetase
  • GGH gamma-glutamyl hydrolase
  • the provided gamma polyglutamated Antifolate compositions deliver a strategy for overcoming the pharmacological challenges associated with the dose limiting toxicities and with treatment resistance associated with antifolate therapy.
  • the provided methods deliver to cancer cells a gamma polyglutamated form of the antifolate while (1) minimizing/reducing exposure to normal tissue cells, (2) optimizing/improving the cytotoxic effect of antifolate-based agents on cancer cells and (3) minimizing/reducing the impact of the efflux pumps, and other resistance mechanisms that limit the therapeutic efficacy of antifolates.
  • This disclosure generally relates gamma polyglutamated Antifolate (yPANTIFOL) compositions and methods of making and using the compositions to treat diseases including hyperproliferative diseases such as cancer, disorders of the immune system such as inflammation and rheumatoid arthritis, cardiovascular disease such as coronary artery disease, and infectious disease such as HIV, malaria, and schistomiasis.
  • diseases including hyperproliferative diseases such as cancer, disorders of the immune system such as inflammation and rheumatoid arthritis, cardiovascular disease such as coronary artery disease, and infectious disease such as HIV, malaria, and schistomiasis.
  • the disclosure provides:
  • composition comprising a gamma polyglutamated Antifolate
  • LV etoposide
  • L-leucovorin L-5-formyltetrahydrofolate
  • 5-CH3-THF 5- methyltetrahydrofolate
  • FA folic acid
  • PteGlu pteroyl glutamate
  • MTX methotrexate
  • 2-dMTX 2-desamino-MTX
  • 2-CH3-MTX 2-desamino-2-methyl- MTX
  • AMT aminopterin
  • 2-dAMT 2-desamino-AMT
  • 2-CH3-AMT 2-desamino- 2-methyl- AMT
  • lO-EdAM 10-ethyl- lO-deazaaminopterin
  • DDATHF laometrexol
  • raltitrexed, plevitrexed, pemetrexed, lometrexol LMX; 5,l0-dideazatetrahydrofolic acid
  • (a) is gamma tetraglutamated Antifolate
  • (b) is gamma pentaglutamated Antifolate
  • (c) is gamma hexaglutamated Antifolate
  • each of the glutamyl groups of the gamma polyglutamated Antifolate is in the L- form
  • At least 2 of the glutamyl groups of the gamma polyglutamated Antifolate are in the L-form and at least 1 of the glutamyl groups is in the D-form;
  • a liposomal composition comprising the gamma polyglutamated Antifolate
  • Antifolate is selected from: LV (etoposide), L-leucovorin (L-5- formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2- desamino- AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; lO-EdAM, lO-ethyl-lO- deazaaminopterin; PT523, N alpha -(4-amino-4-deoxypteroyl)-N delta- (hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5
  • Antifolate is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,l0-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as 6- R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89;
  • liposome comprises a gamma polyglutamated Antifolate containing 4, 5, 2-10, 4-6, or more than 5, gamma glutamyl groups;
  • liposome comprises a gamma tetraglutamated Antifolate
  • liposome comprises a gamma pentaglutamated Antifolate
  • liposome comprises a gamma hexaglutamated Antifolate; [20] the Lp-yPANTIFOL composition according to any of [ l2]-[ 19] , wherein the gamma polyglutamated Antifolate comprises 1-10 glutamyl groups having a gamma carboxyl group linkage;
  • each of the glutamyl groups of the gamma polyglutamated Antifolate is in the L- form
  • each of the glutamyl groups of the gamma polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form;
  • At least 2 of the glutamyl groups of the gamma polyglutamated Antifolate are in the L-form and at least 1 of the glutamyl groups is in the D-form;
  • each of the glutamyl groups of the gamma polyglutamated Antifolate is in the L- form
  • each of the glutamyl groups of the gamma polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form;
  • At least 2 of the glutamyl groups of the gamma polyglutamated Antifolate are in the L-form and at least 1 of the glutamyl groups is in the D-form;
  • liposome is pegylated (PLp-yPANTIFOL);
  • liposome is not pegylated; [25] the Lp-yPANTIFOL composition according to any of [l2]-[24], wherein the liposome has a diameter in the range of 20 nm to 200 nm;
  • liposome has a diameter in the range of 80 nm to 120 nm;
  • liposome is formed from liposomal components
  • components comprise at least one of an anionic lipid and a neutral lipid
  • the Lp-yPANTIFOL composition according to [27] or [28], wherein the liposomal components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG- maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol- maleimide;
  • liposomal components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylamide)
  • PVA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • phosphatidyl polyglycerol poly[N-(2-hydroxypropyl) methacrylamide]
  • amphiphilic poly-N- vinylpyrrolidones L-amino-acid-based polymer
  • oligoglycerol copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol
  • GM1 monosialoganglioside
  • PVP
  • liposome has a zeta potential that is less than or equal to zero;
  • liposome has a zeta potential that is between 0 to -150 mV;
  • liposome has a zeta potential that is between -30 to -50 mV;
  • liposome is cationic
  • liposome has an interior space comprising the gamma polyglutamated Antifolate and an aqueous pharmaceutically acceptable carrier;
  • a tonicity agent such as dextrose, mannitol, glycerine, potassium chloride, sodium chloride, at a concentration of greater than 1%;
  • pharmaceutically acceptable carrier comprises 1% to 50% dextrose solution
  • pharmaceutically acceptable carrier comprises a buffer such as HEPES Buffered Saline (HBS) or similar, at a concentration of between 1 to 200 mM and a pH of between 2 to 8; [46] the Lp-yPANTIFOL composition according to any of [39]-[45], wherein the pharmaceutically acceptable carrier comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM;
  • HBS HEPES Buffered Saline
  • liposome comprises less than 500,000 or less than 200,000 molecules of the gamma polyglutamated Antifolate
  • liposome comprises between 10 to 100,000 molecules of the gamma polyglutamated Antifolate, or any range therein between;
  • the targeting moiety comprises a targeting moiety and wherein the targeting moiety has a specific affinity for a surface antigen on a target cell of interest;
  • targeting moiety is an antibody or an antigen binding fragment of an antibody
  • targeting moiety binds the surface antigen with an equilibrium dissociation constant (Kd) in a range of 0;5 x 10-10 to 10 x 10 6 as determined using BIACORE® analysis;
  • targeting moiety specifically binds one or more folate receptors selected from: folate receptor alpha (FR-a), folate receptor beta (FR-b), and folate receptor delta (FR-d); [56] the Lp-yPANTIFOL composition according to any of [50]-[55], wherein the targeting moiety comprises one or more selected from: an antibody, a humanized antibody, an antigen binding fragment of an antibody, a single chain antibody, a single-domain antibody, a bi-specific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody;
  • pegylated liposome comprises from 1 to 1000 or 30-200 targeting moieties
  • the Lp-yPANTIFOL composition according to any of [39]-[57], further comprising one or more of an immunostimulatory agent, a detectable marker and a maleimide, wherein the immunostimulatory agent, the detectable marker or the maleimide is attached to said PEG or the exterior of the liposome;
  • immunostimulatory agent and the detectable marker is the same;
  • a targeted composition comprising the composition according to any of [l]-[64];
  • a non-targeted composition comprising the composition according to any of [ l]-[49] ;
  • a pharmaceutical composition comprising the liposomal gamma polyglutamated Antifolate composition according to any of [l2]-[67];
  • [72] a method for treating or preventing disease in a subject needing such treatment or prevention, the method comprising administering the composition of any of [l]-[70] to the subject;
  • the hyperproliferative cell is a cancer cell, a mammalian cell, and/or a human cell;
  • [77] a method for treating cancer that comprises administering an effective amount of the composition of any of [l]-[69] to a subject having or at risk of having cancer;
  • [78] A method for treating cancer that comprises administering an effective amount of the liposomal gamma polyglutamated Antifolate composition of any of [l2]-[68] to a subject having or at risk of having cancer;
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma ( e.g ., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dyscrasias;
  • a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dyscrasias
  • cancer selected from: lung cancer, breast cancer, colon cancer, pancreatic cancer, gastric cancer, bladder cancer, head and neck cancer, ovarian cancer, and cervical cancer;
  • cancer selected from: colorectal cancer, lung cancer, breast cancer, head and neck cancer, and pancreatic cancer;
  • cancer selected from: colorectal cancer, breast cancer, ovarian cancer, lung cancer, head and neck cancer, pancreatic cancer, gastric cancer, and mesothelioma;
  • [83] a method for treating cancer that comprises administering an effective amount of the Lp-yPANTIFOL composition of any of [50] -[66] to a subject having or at risk of having a cancer cell that expresses on its surface a folate receptor bound by the targeting moiety;
  • a maintenance therapy for subjects that are undergoing or have undergone cancer therapy that comprise administering an effective amount of the composition of any of [l]-[69] to a subject that is undergoing or has undergone cancer therapy;
  • a maintenance therapy for subjects that are undergoing or have undergone cancer therapy that comprise administering an effective amount of the liposomal gamma polyglutamated Antifolate composition of any of [l2]-[69] to a subject that is undergoing or has undergone cancer therapy;
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the composition of any of [l]-[69] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., Crohn disease
  • dermatomyositis/ polymyositis e.g., systemic erythematosus
  • Takayasu psoriasis
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the liposomal gamma polyglutamated Antifolate composition of any of [8] -[69] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., dermatomyositis/ polymyositis
  • systemic lupus erythematosus e.g.,
  • an infectious disease, cardiovascular disease, metabolic disease, or another disease that comprises administering an effective amount of the composition according to of any of any of [l]-[69] to a subject having or at risk of having an infectious disease, cardiovascular diease, or another disease, wherein the disease is a member selected from: atherosclerosis, cardiovascular disease (CVD), coronary artery disease, myocardial infarction, stroke, metabolic syndrome, a gestational trophoblastic disease, and ectopic pregnancy;
  • an autoimmune disease that comprises administering an effective amount of the composition according to of any of any of [l]-[69] to a subject having or at risk of having an autoimmune disease;
  • rheumatoid arthritis that comprises administering an effective amount of the composition according to of any of any of [l]-[69] to a subject having or at risk of having rheumatoid arthritis;
  • an inflammatory condition that comprises administering an effective amount of the composition according to of any of any of [l]-[69] to a subject having or at risk of having inflammation, optionally wherein the inflammation is acute, chronic, and/or systemic inflammation; or
  • a method for treating an infectious disease that comprises administering an effective amount of the liposomal gamma polyglutamated Antifolate composition of any of [l2]-[69] to a subject having or at risk of having an infectious disease;
  • a method of delivering gamma polyglutamated Antifolate to a tumor expressing a folate receptor on its surface comprising: administering the Lp- yPANTIFOL composition of any of [l]-[69] to a subject having the tumor in an amount to deliver a therapeutically effective dose of the gamma polyglutamated Antifolate to the tumor;
  • a method of preparing a gamma polyglutamated Antifolate composition comprising the liposomal gamma polyglutamated Antifolate composition of any of [l2]-[69], the method comprising: forming a mixture comprising: liposomal components and gamma polyglutamated antifolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing gamma polyglutamated Antifolate; [92] A method of preparing the composition of any of [l2]-[69] comprising the steps of: forming a mixture comprising: liposomal components and gamma polyglutamated Antifolate in a solution; homogenizing the mixture to form liposomes in the solution; processing the mixture to form liposomes entrapping and/or encapsulating gamma polyglutamated Antifolate; and providing a targeting moiety on a surface of the liposomes, the targeting
  • the processing step includes one or more steps of: thin film hydration, extrusion, in-line mixing, ethanol injection technique, freezing-and-thawing technique, reverse-phase evaporation, dynamic high pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor method, and stirring; and/or
  • processing step includes one or more steps of modifying the size of the liposomes by one or more of steps of extrusion, high-pressure microfluidization, and/or sonication.
  • the disclosure provides a gamma polyglutamated Antifolate (yPANTIFOL) composition wherein at least 2 of the glutamyl residues of the gamma polyglutamated Antifolate have a gamma carboxyl group linkage.
  • the yPANTIFOL contains 2-20, 2-15, 2-10, 2-5, or more than 5, glutamyl groups (including the glutamyl group of the Antifolate).
  • the gamma polyglutamated Antifolate is selected from: (a) AG2034, piritrexim, pralatrexate, GW1843, Antifolate, and LY309887; or (b) PMX, MTX, RTX, and LTX, or a stereoisomer thereof.
  • the gamma polyglutamated Antifolate is selected from: LV (etoposide), L- leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2- CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2- CH3-AMT, 2-desamino-2-methyl-AMT; lO-EdAM, lO-ethyl-lO-deazaaminopterin; PT523, N alpha-(4-amino-4-deoxypteroyl)-N delta-(hemiphthaloyl)-L-ornithine; DDATHF (l)
  • the gamma polyglutamated Antifolate is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,l0-dideaza tetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89.
  • the yPANTIFOL comprises two or more glutamyl groups in the L-form.
  • the yPANTIFOL comprises a glutamyl group in the D-form. In further embodiments, the yPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. [0011] In one embodiment, the yPANTIFOL composition contains a chain of 3 glutamyl groups attached to the glutamyl group in the Antifolate (i.e., a g tetraglutamated Antifolate). In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the tetraglutamated Antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the tetraglutamated Antifolate comprises a glutamyl group in the D-form. In some embodiments, the tetraglutamated Antifolate comprises two or more glutamyl groups in the D-form.
  • the tetraglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the tetraglutamated Antifolate comprises one, two, or three, glutamyl groups in the D-form and three, two, or one, glutamyl groups in the L- form, respectively.
  • the yPANTIFOL composition contains a chain of 4 g-glutamyl groups attached to the glutamyl group in the Antifolate (i.e., a g pentaglutamated Antifolate).
  • the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the pentaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • the pentaaglutamated Antifolate comprises a glutamyl group in the D-form.
  • the pentaglutamated Antifolate comprises two or more glutamyl groups in the D-form.
  • the pentaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the pentaglutamated Antifolate comprises one, two, three, or four, glutamyl groups in the D-form and four, three, two, or one, glutamyl groups in the L-form, respectively.
  • the yPANTIFOL composition contains a chain of 5 g-glutamyl groups attached to the glutamyl group in the Antifolate (i.e., a g hexaglutamated Antifolate).
  • the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the hexaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • the hexaglutamated Antifolate comprises a glutamyl group in the D-form.
  • the hexaglutamated Antifolate comprises two or more glutamyl groups in the D-form.
  • the hexaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the pentaglutamated Antifolate comprises one, two, three, four, or five glutamyl groups in the D-form and five, four, three, two, or one, glutamyl groups in the L-form, respectively.
  • compositions containing delivery vehicles such as liposomes filled with ( ie ., encapsulating) and/or otherwise associated with gamma polyglutamated Antifolate, and methods of making and using the yPANTIFOL filled/associated delivery vehicle compositions (DV-yPANTIFOL) to deliver gamma polyglutamated Antifolate to diseased (e.g ., cancerous) and/or targeted cells.
  • delivery vehicles such as liposomes filled with ( ie ., encapsulating) and/or otherwise associated with gamma polyglutamated Antifolate
  • DV-yPANTIFOL yPANTIFOL filled/associated delivery vehicle compositions
  • These compositions have uses that include but are not limited to treating diseases that include for example, hyperproliferative diseases such as cancer, disorders of the immune system such as inflammation and rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • the yPANTIFOL filled/associated delivery vehicle compositions provide improvements to the efficacy and safety of delivering Antifolate to cancer cells by providing the preferential delivery of a more cytotoxic payload (e.g polyglutamated Antifolate) compared to the cytotoxicity the Antifolate administered in its monoglutamate state (ANTIFOL).
  • a more cytotoxic payload e.g polyglutamated Antifolate
  • gamma polyglutamated Antifolate in the DV- yPANTIFOL contains 2-20, 2-15, 2-10, 2-5, more than 5, or more than 20, glutamyl groups (including the glutamyl group of the Antifolate).
  • the delivery vehicle contains a polyglutamated Antifolate according to any of [l]-[l 1] of the Brief Summary Section.
  • the delivery vehicle contains a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the delivery vehicle is a liposome according to any of [12]-[67
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) gamma polyglutamated Antifolate (Lp-gR ANTIFOL).
  • Lp-gR ANTIFOL gamma polyglutamated Antifolate
  • the gamma polyglutamated Antifolate in the Lp-gR ANTIFOL contains 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in the Antifolate).
  • the gamma polyglutamated Antifolate encapsulated by the liposome is selected from: (a) AG2034, piritrexim, pralatrexate, GW 1843, Antifolate, and LY309887; or (b) PMX, MTX, RTX, and LTX, or a stereoisomer thereof.
  • the gamma polyglutamated Antifolate encapsulated by the liposome is selected from: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5- methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; lO-EdAM, 10-ethyl- lO-deazaaminopterin; PT523, N alpha -(4-amino-4-deoxypteroyl)-N delta-(hemiphthaloyl)-L- orni
  • the gamma polyglutamated Antifolate encapsulated by the liposome is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10- dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89.
  • LMX 5,10- dideazatetrahydrofolic acid
  • the gamma polyglutamated Antifolate in the Lp- yPANTIFOL comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises a glutamyl group in the D-form. In further embodiments, the gamma polyglutamated Antifolate in the Lp- yPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPANTIFOL composition comprises a gamma polyglutamated Antifolate that contains a chain of 3 glutamyl groups attached to the glutamyl group in the Antifolate (i.e ., tetraglutamated Antifolate).
  • the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the tetraglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • the tetraglutamated Antifolate comprises a glutamyl group in the D-form.
  • the tetraglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPANTIFOL composition comprises a gamma polyglutamated Antifolate that contains a chain of 4 g-glutamyl groups attached to the glutamyl group in the Antifolate ie.g., g-pentaglutamated Antifolate).
  • the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the gamma pentaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • the pentaglutamated Antifolate comprises a glutamyl group in the D- form.
  • the pentaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPANTIFOL composition comprises a gamma polyglutamated Antifolate that contains a chain of 5 y-glutamyl groups attached to the glutamyl group in the Antifolate (e.g y-hexaglutamated Antifolate).
  • the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the gamma hexaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • the gamma hexaglutamated Antifolate comprises a glutamyl group in the D-form.
  • the gamma hexaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPANTIFOL composition is cationic.
  • the Lp-yPANTIFOL liposome is cationic and has a diameter in the range of 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between.
  • the Lp-yPANTIFOL liposome is cationic and has a diameter in the range of 30nm to 175 nm or 50 nm to 150 nm, or any range therein between.
  • the Lp-yPANTIFOL liposome is cationic and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the cationic Lp- yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma tetraglutamated Antifolate.
  • the cationic Lp-yPANTIFOL composition comprises at least 11%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma pentaglutamated Antifolate.
  • the Lp-yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma hexaglutamated Antifolate.
  • the gamma polyglutamated Antifolate encapsulated by the liposome is in a HEPES buffered solution within the liposome.
  • Lp-yPANTIFOL composition is anionic or neutral. In some embodiments, the Lp-yPANTIFOL composition is cationic. In some embodiments, the Lp- yPANTIFOL liposome is anionic or neutral and has a diameter in the range of 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In further embodiments, the Lp-yPANTIFOL liposome is anionic or neutral and has a diameter in the range of 30nm to 175 nm or 50 nm to 150 nm, or any range therein between.
  • the Lp-yPANTIFOL liposome is anionic or neutral and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between. In some embodiments, the Lp-yPANTIFOL liposome is anionic and has a diameter in the range of 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In further embodiments, the Lp-yPANTIFOL liposome is anionic and has a diameter in the range of 30nm to 175 nm or 50 nm to 150 nm, or any range therein between.
  • the Lp- yPANTIFOL liposome is anionic and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between. In some embodiments, the Lp-yPANTIFOL liposome is neutral and has a diameter in the range of 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In further embodiments, the Lp-yPANTIFOL liposome is neutral and has a diameter in the range of 30nm to 175 nm or 50 nm to 150 nm, or any range therein between.
  • the Lp-yPANTIFOL liposome is neutral and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the anionic or neutral Lp-yPANTIFOL composition comprises at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma tetraglutamated Antifolate.
  • the anionic or neutral Lp-yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma pentaglutamated Antifolate.
  • the Lp-yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma hexaglutamated Antifolate.
  • the gamma polyglutamated Antifolate encapsulated by the liposome is in a FIEPES buffered solution within the liposome.
  • the liposomal gamma polyglutamated Antifolate composition is pegylated (PLp-yPANTIFOL).
  • the liposomal gamma polyglutamated Antifolate composition is non-targeted (NTLp-yPANTIFOL). That is, the NTLp-yPANTIFOL composition does not have specific affinity towards an epitope (e.g., an epitope on a surface antigen) expressed on the surface of a target cell of interest. In some embodiments, the NTLp-yPANTIFOL composition does not comprise a targeting moiety. In further embodiments, the non-targeted liposomal gamma polyglutamated Antifolate composition is pegylated (NTPLp-yPANTIFOL).
  • the liposomal gamma polyglutamated Antifolate composition is targeted (TLp-yPANTIFOL). That is, the TLp-yPANTIFOL composition contains a targeting moiety that has specific affinity for an epitope (surface antigen) on a target cell of interest. In some embodiments, the targeting moiety of the TLp-yPANTIFOL or TPLp- yPANTIFOL is not attached to the liposome through a covalent bond. In other embodiments, the targeting moiety of the TLp-yPANTIFOL or TPLp-yPANTIFOL is attached to one or both of a PEG and the exterior of the liposome.
  • the targeting moiety of the TLp-yPANTIFOL or TPLp-yPANTIFOL is attached to the liposome through a covalent bond.
  • Functions of the targeting moiety of the TLp-yPANTIFOL and/or TPLp-yPANTIFOL compositions include but are not limited to, targeting the liposome to the target cell of interest in vivo or in vitw, interacting with the surface antigen for which the targeting moiety has specific affinity, and delivering the liposome payload (yPANTIFOL) into the cell.
  • Suitable targeting moieties are known in the art and include, but are not limited to, antibodies, antigen binding antibody fragments, scaffold proteins, polypeptides, and peptides.
  • the targeting moiety is a polypeptide.
  • the targeting moiety is a polypeptide that comprises at least 3, 5, 10, 15, 20, 30, 40, 50, or 100, amino acid residues.
  • Targeted liposomal gamma polyglutamated Antifolate compositions provide further improvements over the efficacy and safety profile of the Antifolate, by specifically delivering gamma polyglutamated (e.g., y- pentaglutamated and/or y-hexaglutamated) Antifolate to target cells such as cancer cells.
  • gamma polyglutamated e.g., y- pentaglutamated and/or y-hexaglutamated
  • the targeted liposomal gamma polyglutamated Antifolate composition is pegylated (TPLp-yPANTIFOL).
  • the targeting moiety of the TLp- yPANTIFOL or TPLp-yPANTIFOL is attached to one or both of a PEG and the exterior of the liposome. In some embodiments, the targeting moiety of the TLp-yPANTIFOL or TPLp- yPANTIFOL is attached to the liposome through a covalent bond. yPANTIFOL).
  • Function of the targeting moiety of the TLp-yPANTIFOL and/or TPLp-yPANTIFOL compositions include but are not limited to, targeting the liposome to the target cell of interest in vivo or in vitro, interacting with the surface antigen for which the targeting moiety has specific affinity, and delivering the liposome payload (yPANTIFOL) into the cell.
  • Suitable targeting moieties are known in the art and include, but are not limited to, antibodies, antigen-binding antibody fragments, scaffold proteins, polypeptides, and peptides.
  • the targeting moiety is a polypeptide.
  • the targeting moiety is a polypeptide that comprises at least 3, 5, 10, 15, 20, 30, 40, 50, or 100, amino acid residues.
  • the targeting moiety of the TLp-yPANTIFOL or TPLp- yPANTIFOL is an antibody or an antigen-binding antibody fragment.
  • the targeting moiety comprises one or more of an antibody, a humanized antibody, an antigen binding fragment of an antibody, a single chain antibody, a single-domain antibody, a bi specific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody.
  • the targeting moiety of the TLp-yPANTIFOL or TPLp-yPANTIFOL has specific affinity for an epitope that is preferentially expressed on a target cell such as a tumor cell, compared to normal or non-tumor cells.
  • the targeting moiety has specific affinity for an epitope on a tumor cell surface antigen that is present on a tumor cell but absent or inaccessible on a non-tumor cell. In some embodiments, the targeting moiety binds an epitope of interest with an equilibrium dissociation constant (Kd) in a range of 0.5 x 10 10 to 10 x 10 6 as determined using BIACORE® analysis.
  • Kd equilibrium dissociation constant
  • the TLp-y P A NT IFO L or TPLp-yPANTIFOL targeting moiety comprises a polypeptide that specifically binds a folate receptor.
  • the targeting moiety is an antibody or an antigen-binding antibody fragment.
  • the folate receptor bound by the targeting moiety is one or more folate receptors selected from: folate receptor alpha (FR-a, FOLR1), folate receptor beta (FR-b, FOLR2), and folate receptor delta (FR-d, FOLR4).
  • the folate receptor bound by the targeting moiety is folate receptor alpha (FR-a).
  • the folate receptor bound by the targeting moiety is folate receptor beta (FR-b).
  • the targeting moiety specifically binds FR-a and FR-b.
  • the Lp-yPANTIFOL composition comprises one or more of an immuno stimulatory agent, a detectable marker, and a maleimide, disposed on at least one of the PEG and the exterior of the liposome.
  • the liposome yPANTIFOL composition e.g ., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp- yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL
  • Lp-yPANTIFOL e.g ., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp- yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL
  • the liposome yPANTIFOL composition e.g., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp- yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL
  • Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp- yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL is anionic or neutral.
  • the liposome of the liposome yPANTIFOL composition (e.g., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL or TPLp-yPANTIFOL) has a diameter in the range of 20 nm to 200 nm, or any range therein between. In further embodiments, the liposome of the liposome yPANTIFOL composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the liposome yPANTIFOL composition is pegylated (e.g., PLp- yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL).
  • the liposome yPANTIFOL composition comprises a targeting moiety (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL).
  • the liposome yPANTIFOL composition is pegylated and targeted (e.g., TPLp-yPANTIFOL).
  • the liposome yPANTIFOL composition comprises gamma polyglutamated Antifolate that contains 4, 5, 2- 10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome yPANTIFOL composition comprises gamma tetraglutamated Antifolate. In some embodiments, the liposome yPANTIFOL composition comprises gamma pentaglutamated Antifolate. In other embodiments, the liposome yPANTIFOL composition comprises gamma hexaglutamated Antifolate. In some embodiments, the liposome composition comprises a gamma polyglutamated Antifolate of any of [l]-[l 1] of the Brief Summary Section.
  • the liposome comprises a liposome composition according to any of [l l]-[69] of the Brief Summary Section.
  • the composition comprises a gamma polyglutamated Antifolate descibed in the Brief Summary Section.
  • the liposome yPANTIFOL composition (i.e., Lp- yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL or TPLp-yPANTIFOL) comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma polyglutamated Antifolate.
  • Lp- yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL or TPLp-yPANTIFOL
  • the liposome yPANTIFOL composition comprises 1% - 98.5% liposome entrapped gamma polyglutamated Antifolate. In additional embodiments, the liposome yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the liposome yPANTIFOL composition comprises 1% - 98.5% liposome entrapped gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma tetraglutamated Antifolate.
  • the liposome yPANTIFOL composition comprises 1% - 98.5% liposome entrapped gamma tetraglutamated Antifolate In some embodiments, the liposome yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma pentaglutamated Antifolate. In some embodiments, the liposome yPANTIFOL composition comprises 1% - 98.5% liposome entrapped gamma pentaglutamated Antifolate.
  • the liposome yPANTIFOL composition comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma hexaglutamated Antifolate.
  • the liposome yPANTIFOL composition comprises l%-98.5% liposome entrapped gamma pentaglutamated Antifolate.
  • the liposome composition comprises a gamma polyglutamated Antifolate of any of [l]-[l l] of the Brief Summary Section.
  • the liposome comprises a liposome composition according to any of [ 11]-[69] of the Brief Summary Section.
  • the composition comprises a gamma polyglutamated Antifolate descibed in the Brief Summary Section or a Figure, herein
  • Liposomal compositions comprising liposomes encapsulating yPANTIFOL are also provided.
  • the liposomal composition comprises a pegylated yPANTIFOL composition.
  • the liposomal composition comprises a yPANTIFOL composition that is linked to or otherwise associated with a targeting moiety.
  • the liposomal composition comprises a yPANTIFOL composition that is pegylated and linked to or otherwise associated with a targeting moiety.
  • the liposomal composition comprises yPANTIFOL that contains 4, 5, 2-10, 4- 6, or more than 5, glutamyl groups.
  • the liposomal composition comprises gamma tetraglutamated Antifolate. In some embodiments, the liposomal composition comprises gamma pentaglutamated Antifolate. In other embodiments, the liposomal composition comprises gamma hexaglutamated Antifolate.
  • the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the liposomal composition comprises a liposome yPANTIFOL
  • the liposome yPANTIFOL is pegylated (e.g., NTPLp-yPANTIFOL, and TPLp-yPANTIFOL).
  • the pharmaceutical composition comprises yPANTIFOL that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the pharmaceutical composition comprises gamma tetraglutamated Antifolate.
  • the pharmaceutical composition comprises gamma pentaglutamated Antifolate. In other embodiments, the pharmaceutical composition comprises gamma hexaglutamated Antifolate.
  • the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the liposome yPANTIFOL comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a target cell of interest such as a cancer cell (e.g., TLp- yPANTIFOL or TPLp-yPANTIFOL).
  • the liposomal composition comprises a liposome yPANTIFOL that is pegylated and further comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a target cell of interest such as a cancer cell (e.g., TPLp-yPANTIFOL).
  • the liposomal composition comprises a liposome yPANTIFOL that is cationic.
  • the liposomal composition comprises a liposome yPANTIFOL that is anionic or neutral.
  • the liposomal composition comprises a liposome yPANTIFOL that has a diameter in the range of 20 nm to 200 nm, or any range therein between.
  • the liposome yPANTIFOL has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • compositions comprising gamma polyglutamated Antifolate
  • the pharmaceutical composition comprises a pegylated yPANTIFOL composition.
  • the pharmaceutical composition comprise a yPANTIFOL composition that is linked to or otherwise associated with a targeting moiety.
  • the pharmaceutical composition comprise a yPANTIFOL composition that is pegylated and linked to or otherwise associated with a targeting moiety.
  • the pharmaceutical composition comprises yPANTIFOL that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the pharmaceutical composition comprises gamma tetraglutamated Antifolate.
  • the pharmaceutical composition comprises gamma pentaglutamated Antifolate. In other embodiments, the pharmaceutical composition comprises gamma hexaglutamated Antifolate. In some embodiments, the gamma polyglutamated Antifolate is a polyglutamated Antifolate according to any of [l]-[l l] of the Brief Summary Section. In some embodiments, the gamma polyglutamated Antifolate is a polyglutamted Antifolate descibed in the Brief Summary Section.
  • the pharmaceutical compositions comprise a liposome yPANTIFOL (e.g., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp- yPANTIFOL, TLp-yPANTIFOL, and TPLp -yPANTIFOL).
  • the liposome yPANTIFOL composition is pegylated (e.g., NTPLp-yPANTIFOL, and TPLp- yPANTIFOL).
  • the liposome yPANTIFOL comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a target cell of interest such as a cancer cell (e.g ., TLp-yPANTIFOL or TPLp-yPANTIFOL).
  • the pharmaceutical composition comprises a liposome yPANTIFOL composition that is pegylated and further comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a target cell of interest such as a cancer cell (e.g., TPLp-yPANTIFOL).
  • the pharmaceutical composition comprises a liposome yPANTIFOL that is cationic.
  • the pharmaceutical composition comprises a liposome yPANTIFOL that is anionic or neutral.
  • the pharmaceutical composition comprises a liposome yPANTIFOL that has a diameter in the range of 20 nm to 200 nm, or any range therein between.
  • the liposome yPANTIFOL composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the pharmaceutical composition comprises yPANTIFOL that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the pharmaceutical composition comprises gamma tetraglutamated Antifolate.
  • the pharmaceutical composition comprises gamma pentaglutamated Antifolate. In other embodiments, the pharmaceutical composition comprises gamma hexaglutamated Antifolate. In some embodiments, the composition comprises a gamma polyglutamated Antifolate according to any of [1]-[11] of the Brief Summary Section.In some embodiments, the pharmaceutical composition comprises a liposome composition according to any of [l l]-[69] of the Brief Summary Section. In some embodiments, the composition comprises a gamma polyglutamated Antifolate descibed in the Brief Summary Section.
  • the disclosure provides a method of modulating the activation, chemokine production, or metabolic activity of a cell that comprises contacting the cell with a composition comprising a gamma polyglutamated Antifolate (yPANTIFOL) composition.
  • a composition comprising a gamma polyglutamated Antifolate (yPANTIFOL) composition.
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the cell is an immune cell.
  • the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the yPANTIFOL contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the yPANTIFOL composition comprises a gamma tetraglutamated Antifolate. In some embodiments, the yPANTIFOL composition comprises a gamma pentaglutamated Antifolate. In other embodiments, the yPANTIFOL composition comprises a gamma hexaglutamated Antifolate. In some embodiments, the composition comprises a gamma polyglutamated Antifolate according to any of [l]-[l l] of the Brief Summary Section. In some embodiments, the pharmaceutical composition comprises a liposome composition according to any of [11]-[69] of the Brief Description Section. In some embodiments, the composition comprises a gamma polyglutamated Antifolate descibed in the Brief Summary Section or a Figure, herein
  • the disclosure provides a method of modulating the activation, chemokine production, or metabolic activity of a cell that comprises contacting the cell with a liposome comprising a gamma polyglutamated Antifolate (yPANTIFOL) composition.
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the cell is an immune cell.
  • the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the yPANTIFOL contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the yPANTIFOL composition comprises a gamma tetraglutamated Antifolate. In some embodiments, the yPANTIFOL composition comprises a gamma pentaglutamated Antifolate. In other embodiments, the yPANTIFOL composition comprises a gamma hexaglutamated Antifolate. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief Summary Section.
  • the polyglutamated Antifolate is an Antifolate listed in [4] of the Brief Summary Section. In some embodiments, the polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section. [0035] In additional embodiments, the disclosure provides a method of killing a cell that comprises contacting the cell with a composition comprising a gamma polyglutamated Antifolate (yPANTIFOL) composition. In some embodiments, the contacted cell is a mammalian cell. In further embodiments, the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the hyperproliferative cell is a cancer cell.
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non- hematologic malignancy including such as
  • the cancer is selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non- Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from lung cancer (e.g., NSCLC or mesothelioma).
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from breast cancer (e.g. , HER2++ or triple negative breast cancer). In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from colorectal cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from ovarian cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from endometrial cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from pancreatic cancer.
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from liver cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from head and neck cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from osteosarcoma. In some embodiments, the method is performed in vivo. In other embodiments, the method is performed in vitro. In some embodiments, the yPANTIFOL contains 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups. In some embodiments, the yPANTIFOL composition comprises gamma tetraglutamated Antifolate.
  • the yPANTIFOL composition comprises gamma pentaglutamated Antifolate. In other embodiments, the yPANTIFOL composition comprises gamma hexaglutamated Antifolate. In some embodiments, the gamma polyglutamated Antifolate is a polyglutamated Antifolate according to any of [l]-[ll] of the Brief Summary Section. In some embodiments, the gamma polyglutamated Antifolate is an polyglutamted Antifolate descibed in the Brief Summary Section.
  • the disclosure provides a method of killing a cell that comprises contacting the cell with a liposome containing gamma polyglutamated Antifolate (e.g., an Lp-yPANTIFOL such as, PLp -yPANTIFOL, NTLp-yPANTIFOL, NTPLp- yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL).
  • a liposome containing gamma polyglutamated Antifolate e.g., an Lp-yPANTIFOL such as, PLp -yPANTIFOL, NTLp-yPANTIFOL, NTPLp- yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL.
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the contacted hyperproliferative cell
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal
  • the cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from colorectal cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from ovarian cancer.
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from endometrial cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from pancreatic cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from liver cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from head and neck cancer. In some embodiments, the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from osteosarcomaln some embodiments, the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the liposome contains a yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome contains gamma tetraglutamated Antifolate. In some embodiments, the liposome contains gamma pentaglutamated Antifolate. In some embodiments, the liposome contains gamma hexaglutamated Antifolate. In some embodiments, the gamma polyglutamated Antifolate is a polyglutamated Antifolate according to any of [l]-[l 1] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome is a liposome according to any of [12] -[67] of the Brief Summary Section.
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a delivery vehicle (e.g., an antibody immunoconjugate or liposome) comprising gamma polyglutamated Antifolate to a subject having or at risk of having cancer.
  • a delivery vehicle e.g., an antibody immunoconjugate or liposome
  • the delivery vehicle is an antibody containing immunoconjugate (comprising e.g., a full-length IgG antibody, a bispecific antibody, or a scFv).
  • the delivery vehicle is a liposome (e.g., an Lp- yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL, or TPLp-yPANTIFOL).
  • the administered delivery vehicle is pegylated.
  • the admini tered delivery vehicle is not pegylated.
  • the administered delivery vehicle comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a cancer cell.
  • the delivery vehicle comprises a targeting moiety that specifically binds a cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC-l), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC- 16, Tissue factor, LIV-l (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-
  • the delivery vehicle comprises a targeting moiety that specifically binds a cell surface antigen(s) derived from, or determined to be expressed on, a specific subject’s cancer (tumor) such as a neoantigen.
  • the targeting moiety specifically binds a cell surface antigen(s) derived from or determined to be expressed on a specific subject’ s tumor such as a neoantigen.
  • the targeting moiety is an antibody or an antigen binding antibody fragment.
  • the administered delivery vehicle comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the administered delivery vehicle comprises gamma tetraglutamated Antifolate. In some embodiments, the admini tered delivery vehicle comprises gamma pentaglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises L gamma polyglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups. In some embodiments, the administered delivery vehicle comprises D gamma polyglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some embodiments, the administered delivery vehicle comprises L and D gamma polyglutamated Antifolate.
  • the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
  • the cancer is selected from: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma, brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate
  • the cancer is selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • the cancer is lung cancer (e.g ., NSCLC or mesothelioma).
  • the cancer is breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma. In some embodiments, the administered delivery vehicle comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the administered delivery vehicle comprises a gamma tetraglutamated Antifolate.
  • the administered delivery vehicle comprises a gamma pentaglutamated Antifolate. In other embodiments, the administered delivery vehicle comprises a gamma hexaglutamated Antifolate. In some embodiments, the administered delivery vehicle comprises a polyglutamated Antifolate according to any of [l]-[l 1] of the Brief Summary Section. In some embodiments, the delivery vehicle comprises a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the administered delivery vehicle is a liposomal composition comprising a polyglutamated Antifolate according to any of [l]-[l l] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in Brief Summary Section.
  • the liposomal composition comprises a liposome according to any of [12]-[67] of the Brief Summary Section.
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a liposome comprising gamma polyglutamated Antifolate (e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL. NTPLp- yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL) to a subject having or at risk of having cancer.
  • an Lp-yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL. NTPLp- yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL
  • the liposome is pegylated. In some embodiments, the liposome is not pegylated.
  • the liposome comprises a targeting moiety that has a specific affinity for an epitope of antigen on the surface of a cancer cell.
  • the liposome comprises a targeting moiety that specifically binds a cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC- 1), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC- 16, Tissue factor, LIV-l (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD
  • the liposome comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the liposome comprises gamma tetraglutamated Antifolate.
  • the liposome comprises gamma pentaglutamated Antifolate.
  • the liposome comprises gamma hexaglutamated Antifolate.
  • the polyglutamated Antifolate is an Antifolate according to any of [l]-[l l] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the liposomal composition comprises a liposome according to any of [l2]-[67] of the Brief Summary Section.
  • the liposome liposome comprises L gamma polyglutamated Antifolate.
  • the liposome comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups.
  • the liposome comprises D gamma polyglutamated Antifolate.
  • the liposome comprises 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some embodiments, the administered liposome comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups. In some embodiments, the liposome comprises L and D gamma polyglutamated Antifolate. In some embodiments, the liposome n comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
  • the cancer is selected from: lung (e.g., non-small lung cancer), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, and a hematologic malignancy (e.g., a leukemia or lymphoma).
  • lung e.g., non-small lung cancer
  • pancreatic cancer breast cancer, ovarian cancer, prostate cancer, head and neck cancer
  • gastric cancer gastrointestinal cancer
  • colorectal cancer esophageal cancer
  • cervical cancer cervical cancer
  • liver cancer liver cancer
  • kidney cancer biliary duct cancer
  • gallbladder cancer gallbladder cancer
  • bladder cancer sarcoma (e.g., osteo
  • the cancer is selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • the cancer is lung cancer (e.g., NSCLC or mesothelioma).
  • the cancer is breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma
  • the disclosure provides a method for treating cancer that comprises administering to a subject having or at risk of having cancer, an effective amount of a liposomal composition comprising a liposome that comprises gamma polyglutamated Antifolate and a targeting moiety that has a specific affinity for an epitope of antigen on the surface of the cancer.
  • the liposome comprises a targeting moiety that specifically binds a cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC-l), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-l (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR
  • the liposome comprises a targeting moiety that specifically binds a cell surface antigen(s) derived from or determined to be expressed on a specific subject’s tumor such as a neoantigen.
  • the targeting moiety is an antibody or an antigen binding antibody fragment.
  • the liposome comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • the liposome comprises a gamma tetraglutamated Antifolate.
  • the liposome comprises a gamma pentaglutamated Antifolate.
  • the liposome comprises a gamma hexaglutamated Antifolate.
  • the polyglutamated Antifolate is an Antifolate according to any of [l]-[l l] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the liposomal composition comprises a liposome according to any of [12]-[67] of the Brief Summary Section.
  • the liposome comprises a yPANTIFOL containing g-glutamyl groups in the L-form.
  • the liposome comprises a yPANTIFOL containing g-glutamyl groups in the D-form. In some embodiments, the liposome comprises a yPANTIFOL containing at least one g-glutamyl group in the L-form and at least one g-glutamyl group in the D form.
  • the cancer is selected from: lung (e.g., non-small lung cancer), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, and a hematologic malignancy (e.g., a leukemia or lymphoma).
  • lung e.g., non-small lung cancer
  • pancreatic cancer breast cancer, ovarian cancer, prostate cancer, head and neck cancer
  • gastric cancer gastrointestinal cancer
  • colorectal cancer esophageal cancer
  • cervical cancer cervical cancer
  • liver cancer liver cancer
  • kidney cancer biliary duct cancer
  • gallbladder cancer gallbladder cancer
  • bladder cancer sarcoma (e.g., osteo
  • the cancer is selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • the cancer is lung cancer (e.g., NSCLC or mesothelioma).
  • the cancer is breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma.
  • the administered liposomal composition comprises pegylated liposomes (e.g ., TPLp-gR ANT IFO L) .
  • the administered liposomal composition comprises liposomes that are not pegylated.
  • liposomes of the administered liposomal composition comprise a yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • liposomes of the administered liposomal composition comprise gamma tetraglutamated Antifolate.
  • liposomes of the administered liposomal composition comprise gamma pentaglutamated Antifolate.
  • liposomes of the administered liposomal composition comprise gamma hexaglutamated Antifolate.
  • the liposome comprises a polyglutamated Antifolate according to any of [l]-[l 1] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section.
  • the liposome composition comprises a liposome according to any of [l2]-[67] of the Brief Summary Section.
  • the liposomal composition is administered to treat a cancer selected from: lung cancer (e.g., non-small cell), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, myeloma and other plasma cell dysplasias or dyscrasias, and leukemia and a lymphoma and other B cell malignancies.
  • lung cancer e.g., non-small cell
  • pancreatic cancer breast cancer, ovarian cancer, prostate cancer, head and neck cancer
  • gastric cancer gastrointestinal cancer
  • colorectal cancer esophageal cancer
  • cervical cancer cervical cancer
  • liver cancer liver cancer
  • kidney cancer biliary duct cancer
  • the liposomal composition is administered to treat a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • the liposomal composition is administered to treat lung cancer (e.g., NSCLC or mesothelioma).
  • the liposomal composition is administered to treat breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the liposomal composition is administered to treat colorectal cancer. In some embodiments, the liposomal composition is administered to treat ovarian cancer. In some embodiments, the liposomal composition is administered to treat endometrial cancer. In some embodiments, the liposomal composition is admini tered to treat pancreatic cancer. In some embodiments, the liposomal composition is administered to treat liver cancer. In some embodiments, the liposomal composition is administered to treat head and neck cancer. In some embodiments, the liposomal composition is administered to treat osteosarcoma.
  • breast cancer e.g., HER2++ or triple negative breast cancer.
  • the liposomal composition is administered to treat colorectal cancer.
  • the liposomal composition is administered to treat ovarian cancer.
  • the liposomal composition is administered to treat endometrial cancer.
  • the liposomal composition is
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a liposomal composition to a subject having or at risk of having a cancer that expresses folate receptor on its cell surface, wherein the liposomal composition comprises liposomes that comprise (a) gamma polyglutamated Antifolate (yPANTIFOL) and (b) a targeting moiety that has specific binding affinity for a folate receptor.
  • the targeting moiety has specific binding affinity for folate receptor alpha (FR-a), folate receptor beta (FR-b), and/or folate receptor delta (FR-d).
  • the targeting moiety has a specific binding affinity for folate receptor alpha (FR-a) and folate receptor beta (FR-b).
  • the administered liposomal composition comprises pegylated liposomes (e.g., TPLp-gR ANT IFO L) .
  • the administered liposomal composition comprises liposomes that are not pegylated.
  • liposomes of the administered liposomal composition comprises a yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, y-glutamyl groups.
  • liposomes of the administered liposomal composition comprise gamma tetraglutamated Antifolate.
  • liposomes of the administered liposomal composition comprise gamma pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise gamma hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [l]-[l l] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [l2]-[67] of the Brief Summary Section.
  • the liposomal composition is administered to treat a cancer selected from: a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a cancer selected from: a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer
  • the liposomal composition is administered to treat a cancer selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T- cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • the liposomal composition is administered to treat lung cancer (e.g., NSCLC or mesothelioma).
  • the liposomal composition is administered to treat breast cancer (e.g., HER2++ or triple negative breast cancer). In some embodiments, the liposomal composition is administered to treat colorectal cancer. In some embodiments, the liposomal composition is administered to treat ovarian cancer. In some embodiments, the liposomal composition is administered to treat endometrial cancer. In some embodiments, the liposomal composition is administered to treat pancreatic cancer. In some embodiments, the liposomal composition is administered to treat liver cancer. In some embodiments, the liposomal composition is administered to treat head and neck cancer. In some embodiments, the liposomal composition is administered to treat osteosarcoma.
  • breast cancer e.g., HER2++ or triple negative breast cancer.
  • the liposomal composition is administered to treat colorectal cancer.
  • the liposomal composition is administered to treat ovarian cancer.
  • the liposomal composition is administered to treat endometrial cancer.
  • the liposomal composition is administered to treat
  • the disclosure provides a method for cancer maintenance therapy that comprises administering an effective amount of a liposomal composition comprising liposomes that contain gamma polyglutamated Antifolate (Lp-yPANTIFOL) to a subject that is undergoing or has undergone cancer therapy.
  • the administered liposomal composition is a PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp- yPANTIFOL, T Lp-yP A NT I FO L or TPLp-yPANTIFOL.
  • the administered liposomal composition comprises pegylated liposomes (e.g., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the administered liposomal composition comprises targeted liposomes (e.g., TLp-yPANTIFOL or TPLp- yPANTIFOL). In some embodiments, the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-yPANTIFOL).
  • pegylated liposomes e.g., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL.
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-yPANTIFOL or TPLp- yPANTIFOL).
  • the administered liposomal composition comprises liposomes that are
  • liposomes of the administered liposomal composition comprises gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, y-glutamyl groups. In some embodiments, liposomes of the administered liposomal composition comprise gamma tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise gamma pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise gamma hexaglutamated Antifolate.
  • the liposomal composition comprises liposomes that contain a gamma polyglutamate according to any of [l]-[l l] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the liposomal composition comprises a liposome according to any of [l2]-[67] of the Brief Summary Section.
  • the disclosure provides a method for treating a disorder of the immune system that comprises administering an effective amount of a liposomal composition comprising liposomes that contain gamma polyglutamated Antifolate (e.g., Lp- yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL or TPLp-yPANTIFOL) to a subject having or at risk of having a disorder of the immune system.
  • the liposomal composition is administered to treat an autoimmune disease.
  • the liposomal composition is administered to treat rheumatoid arthritis.
  • the liposomal composition is administered to treat inflammation.
  • the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, Takayasu, and psoriasis.
  • the administered liposomal composition comprises pegylated liposomes (e.g., PLp-gR A NT IFO L, NTPLp- yPANTIFOL, or TPLp-yPANTIFOL).
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL) that contain a targeting moiety having a specific affinity for a surface antigen on a target cell of interest (e.g., an immune cell).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-yPANTIFOL).
  • a liposome of the administered liposomal composition comprises gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • liposomes of the administered liposomal composition comprise gamma tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise gamma pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise gamma hexaglutamated Antifolate. In some embodiments, the liposomal composition comprises liposomes that contain a gamma polyglutamate according to any of [l]-[l l] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section. In some embodiments, the liposomal composition comprises a liposome according to any of [l2]-[67] of the Brief Summary Section.
  • the disclosure provides a method for treating an autoimmune disease that comprises administering an effective amount of a liposomal composition comprising liposomes that contain gamma polyglutamated Antifolate (e.g., Lp- yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL or TPLp-yPANTIFOL) to a subject having or at risk of having an autoimmune disease.
  • a liposomal composition comprising liposomes that contain gamma polyglutamated Antifolate (e.g., Lp- yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL or TPLp-yPANTIFOL)
  • a liposomal composition comprising liposomes that contain gamma polyglutamated Antif
  • the autoimmune disease is a disease or disorder selected from: inflammatory bowel disease (IBD), Crohn disease, systemic lupus erythematosus, and psoriasis.
  • the autoimmune disease is a disease or disorder selected from: Addison’s disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, diabetes (Type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, s
  • IBD inflammatory
  • the administered liposomal composition comprises pegylated liposomes (e.g ., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL).
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL) that contain a targeting moiety having a specific affinity for a surface antigen on a target cell of interest (e.g., an immune cell).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-yPANTIFOL).
  • liposomes of the administered liposomal composition comprise gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, liposomes of the administered liposomal composition comprise gamma tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise gamma pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise gamma hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [l]-[l 1] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate described in Bthe rief Summary Section.
  • the liposome composition comprises a liposome according to any of [12]-[67] of the Brief Summary Section.
  • the disclosure provides a method for treating an inflammatory disorder that comprises administering an effective amount of a liposomal composition comprising liposomes that contain gamma polyglutamated Antifolate (e.g., Lp- yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL or TPLp-yPANTIFOL) to a subject having or at risk of having an inflammatory disorder.
  • gamma polyglutamated Antifolate e.g., Lp- yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp- yPANTIFOL or TPLp-yPANTIFOL
  • the inflammatory disorder is a disorder selected from: acute inflammation, chronic inflammation, systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, and systemic lupus erythematosus.
  • IBD inflammatory bowel disease
  • Crohn disease dermatomyositis/ polymyositis
  • systemic lupus erythematosus selected from: acute inflammation, chronic inflammation, systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, and systemic lupus erythematosus.
  • the inflammatory disorder is a disorder selected from: a rheumatoid disease or other arthritic disease (e.g ., acute arthritis, acute gouty arthritis, bacterial arthritis, chronic inflammatory arthritis, degenerative arthritis (osteoarthritis), infectious arthritis, juvenile arthritis, mycotic arthritis, neuropathic arthritis, polyarthritis, proliferative arthritis, psoriatic arthritis, venereal arthritis, viral arthritis), fibrositis, pelvic inflammatory disease, acne, psoriasis, actinomycosis, dysentery, biliary cirrhosis, Lyme disease, heat rash, Stevens-Johnson syndrome, mumps, pemphigus vulgaris, and blastomycosis.
  • a rheumatoid disease or other arthritic disease e.g ., acute arthritis, acute gouty arthritis, bacterial arthritis, chronic inflammatory arthritis, degenerative arthritis (osteoarthritis), infectious arthritis, juvenile arthritis, mycotic arthritis
  • the inflammatory disorder is an inflammatory bowel disease.
  • Inflammatory bowel diseases are chronic inflammatory diseases of the gastrointestinal tract which include, without limitation, Crohn's disease, ulcerative colitis, and indeterminate colitis.
  • the administered liposomal composition comprises pegylated liposomes (e.g., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp- yPANTIFOL).
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL) that contain a targeting moiety having a specific affinity for a surface antigen on a target cell of interest (e.g., an immune cell).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-yPANTIFOL).
  • liposomes of the administered liposomal composition comprise gamma pentaglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • liposomes of the administered liposomal composition comprise gamma tetraglutamated Antifolate. In some embodiments, liposomes of the administered liposomal composition comprise gamma pentaglutamated Antifolate. In other embodiments, liposomes of the administered liposomal composition comprise gamma hexaglutamated Antifolate. In some embodiments, the liposome comprises a polyglutamated Antifolate according to any of [l]-[l l] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the liposome composition comprises a liposome according to any of [12]-[67] of the Brief Summary Section. [0046] The disclosure also provides a method of delivering gamma polyglutamated
  • Antifolate to a site of inflammation in a subject that comprises: administering to the subject having the inflammation, a composition comprising gamma polyglutamated Antifolate (L- yPANTIFOL) and a targeting moiety that has a specific binding affinity for an epitope on a surface antigen on a cell that is located at, or otherwise influences the inflammation (e.g., via proinflammatory cytokine production).
  • the administered targeting moiety is associated with a delivery vehicle.
  • the delivery vehicle is an antibody or an antigen binding fragment of an antibody.
  • the delivery vehicle is a liposome.
  • the antibody, antigen-binding antibody fragment, or liposome is pegylated liposomes (e.g., TPLp-yPANTIFOL).
  • the administered composition comprises a gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the administered composition comprises a gamma tetraglutamated Antifolate.
  • the administered composition comprises a gamma pentaglutamated Antifolate.
  • the administered composition comprises a gamma hexaglutamated Antifolate.
  • the yPANTIFOL is a polyglutamated Antifolate according to any of [l]-[l l] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate described in the Brief Summary Section. In some embodiments, the delivery vehicle is a liposome according to any of [l2]-[67] of the Brief Summary Section.
  • the disclosure also provides a method of delivering gamma polyglutamated Antifolate to a tumor and/or cancer cell that comprises: administering to a subject having the tumor, a composition comprising gamma polyglutamated Antifolate (L-yPANTIFOL) and a targeting moiety that has a specific binding affinity for an epitope on a surface antigen on the tumor cell or cancer cell.
  • the administered targeting moiety is associated with a delivery vehicle.
  • the delivery vehicle is an antibody or an antigen binding fragment of an antibody.
  • the delivery vehicle is a liposome.
  • the antibody, antigen-binding antibody fragment, or liposome is pegylated liposomes (e.g., TPLp-yPANTIFOL).
  • the administered composition comprises gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the administered composition comprises gamma tetraglutamated Antifolate.
  • the administered composition comprises gamma pentaglutamated Antifolate.
  • the administered composition comprises gamma hexaglutamated Antifolate.
  • the administered composition comprises an Antifolate according to any of [l]-[l l] of the Brief Summary Section.
  • the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section.
  • the administered composition comprises a liposome according to any of [l2]-[67] of the Brief Summary Section.
  • the disclosure provides a method of preparing a liposomal composition that comprises a liposomal gamma polyglutamated Antifolate (yPANTIFOL) composition, the method comprising: forming a mixture comprising: liposomal components and g polyglutamated Antifolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing polyglutamated Antifolate.
  • the gamma polyglutamated Antifolate contains 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • the yPANTIFOL comprises gamma tetraglutamated Antifolate.
  • the yPANTIFOL comprises gamma pentaglutamated Antifolate. In other embodiments, the yPANTIFOL comprises gamma hexaglutamated Antifolate. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate according to any of [l]-[l l] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary Section. In some embodiments, the liposomal composition comprises a liposome according to any of [12]- [67] of the Brief Summary Section.
  • the disclosure provides a kit comprising an Antifolate gamma poylglutamate composition and/or yPANTIFOL delivery vehicles such as liposomes containing yPANTIFOL and yPANTIFOL immunoconjugates (e.g., ADCs) described herein.
  • yPANTIFOL delivery vehicles such as liposomes containing yPANTIFOL and yPANTIFOL immunoconjugates (e.g., ADCs) described herein.
  • FIGS. 1A-1N show chemical formulas of the Antifolate pemetrexed (FIG. 1A), exemplary gamma pemetrexed polyglutamates, gamma pemetrexed diglutamate (FIG. IB), gamma pemetrexed triglutamate (FIGS. 1C and ID), gamma pemetrexed tetraglutamate (FIGS. IE and IF), gamma pemetrexed pentaglutamates (FIGS. 1G and 1H), gamma pemetrexed hexaglutamates (FIGS. II and U), gamma pemetrexed heptaglutamate (FIGS. IK and 1L), and gamma pemetrexed octaglutamates (FIGS. 1M and IN).
  • FIGS. 1A-1A show chemical formulas of the Antifolate pemetrexed (FIG. 1A), exemplary gamma pemetrexed polygluta
  • FIG. 2 presents the relative potency of liposomal pemetrexed gamma-L hexaglutamate (liposomal aG6) and its mirror image, liposomal gamma-D hexaglutamate (liposomal aDG6) relative to pemetrexed following exposure of the cancer cell lines SW620 (CRC), HT-29 (colon cancer), H1806 (triple negative breast cancer), OAW28 (ovarian cancer), H292 (NSCLC, adenocarcinoma subtype), and H2342 (NSCLC, adenocarcinoma subtype), over 48 hours.
  • CRC cancer cell lines
  • HT-29 colon cancer
  • H1806 triple negative breast cancer
  • OAW28 ovarian cancer
  • H292 NSCLC, adenocarcinoma subtype
  • H2342 NSCLC, adenocarcinoma subtype
  • FIG. 3 presents an example dose response relationship of free pemetrexed L-gamma hexaglutamate (gG6), liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6), pemetrexed, and folate receptor alpha targeting antibody (FRlAb) liposomal pemetrexed L- gamma hexaglutamate (liposomal gG6-FRlAb) in the HT-29 (colon cancer) at 48 hours.
  • gG6 free pemetrexed L-gamma hexaglutamate
  • liposomal pemetrexed L-gamma hexaglutamate liposomal gG6-FRlAb
  • HT-29 colon cancer
  • FIG. 4 shows the effect of free pemetrexed L-gamma hexaglutamate (hexa gG6) and liposomal pemetrexed L-gamma hexaglutamate (liposomal hexa gG6), on the growth of colon cancer SW260 cells following exposure of 256 nM of the corresponding agent for 48 hours.
  • the non-targeted and targeted liposomal pemetrexed hexa gG6 are able to enter cells more efficiently than free pemetrexed hexa gG6 to inhibit growth of the colon cancer SW260 cells.
  • FIG. 5 presents the relative potency of liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6) and its mirror image, liposomal pemetrexed gamma-D hexaglutamate (liposomal gDG6) relative to pemetrexed following exposure of the cancer cell lines SW620 (CRC), HT-29 (colon cancer), H1806 (triple negative breast cancer), OAW28 (ovarian cancer), H292 (NSCLC, adenocarcinoma subtype), and H2342 (NSCLC, adenocarcinoma subtype), over 48 hours.
  • CRC cancer cell lines
  • HT-29 colon cancer
  • H1806 triple negative breast cancer
  • OAW28 ovarian cancer
  • H292 NSCLC, adenocarcinoma subtype
  • H2342 NSCLC, adenocarcinoma subtype
  • FIG. 6 presents the treatment effect on HCC1806 triple negative breast cancer cells following exposure of liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6), liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), and to pemetrexed over 48 hours.
  • Lps Hexa gG6 liposomal pemetrexed gamma-L hexaglutamate
  • Lps Hexa gDG6 liposomal pemetrexed gamma-D hexaglutamate
  • FIG. 8 presents the treatment effect on H292 non-small cell lung cancer cells following exposure of liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6), liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), and to pemetrexed over 48 hours.
  • Lps Hexa gG6 liposomal pemetrexed gamma-L hexaglutamate
  • Lps Hexa gDG6 liposomal pemetrexed gamma-D hexaglutamate
  • FIG. 9 presents the treatment effect on H292 non-small cell lung cancer cells following exposure of various dose levels ranging from 16 to 128 nM of liposomal pemetrexed gamma-L hexaglutamate (Liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (Liposomal gDG6), and pemetrexed over 48 hours.
  • the liposomal pemetrexed gG6 formulation is superior to inhibiting H292 non-small cell lung cancer cells compared to pemetrexed.
  • FIG. 10 presents the treatment effect on HCC 1806 triple negative breast cancer cells following exposure of various dose levels ranging from 16 to 128 nM of liposomal pemetrexed gamma-L hexaglutamate (Liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (Liposomal gDG6), and pemetrexed over 48 hours.
  • the liposomal pemetrexed gG6 formulation is superior to pemetrexed in inhibiting HCC 1806 triple negative breast cancer cells.
  • FIG. 11 presents the treatment effect on OAW28 ovarian cancer cells of liposomal pemetrexed gamma-L hexaglutamate (LiposomalgG6), liposomal gamma-D hexaglutamate (LiposomalgDG6), and pemetrexed following exposure over 48 hours following exposure over a range of concentrations.
  • LiposomalgG6 liposomal pemetrexed gamma-L hexaglutamate
  • LiposomalgDG6 liposomal gamma-D hexaglutamate
  • pemetrexed following exposure over 48 hours following exposure over a range of concentrations.
  • pemetrexed appears to more effective than the Liposomal pemetrexed gG6 liposomal formulation, whereas the liposomal formulation at the dose of 32 nM and 64 nM has a better treatment effect than pemetrexed; at 16 nM the Liposomal pemetrexed gG6 treatment effect is similar in to pemetrexed.
  • FIG. 12 shows the toxicity of liposomal pemetrexed gamma-L hexaglutamate
  • LiposomalgG6 liposomal pemetrexed gamma-D hexaglutamate
  • Liposomal gDG6 liposomal pemetrexed gamma-D hexaglutamate
  • pemetrexed on differentiating human neutrophils at 64 nM, 128 nM, and 264 nM The figure demonstrates that liposomal pemetrexed gG6 is significantly less toxic to differentiating human neutrophils than pemetrexed.
  • FIG. 13 shows the effect of liposomal pemetrexed gamma-L hexaglutamate
  • liposomalgG6 liposomal gamma-D hexaglutamate
  • liposomalgDG6 liposomal gamma-D hexaglutamate
  • pemetrexed on neutrophils following exposure of various dose levels ranging from 16 to 128 nM of the corresponding agent over 48 hours.
  • FIG. 14 shows the effect of liposomal pemetrexed gamma-L hexaglutamate
  • liposomalgG6 liposomal pemetrexed gamma-D hexaglutamate
  • liposomalgDG6 liposomal pemetrexed gamma-D hexaglutamate
  • pemetrexed treatment results in a reduction in the AML12 liver cell counts of approximately 40% at all doses studied.
  • FIG. 15 shows the effect of liposomal pemetrexed gamma-L hexaglutamate
  • liposomalgG6 liposomal pemetrexed gamma-D hexaglutamate
  • liposomalgDG6 liposomal pemetrexed gamma-D hexaglutamate
  • pemetrexed on CCD841 colon epithelium cells following exposure over 48 hours at 16 nM, 32 nM, and 64 nM, and 128 nM, of the corresponding agent.
  • pemetrexed leads to approximately a >50% decrease in the number of CCD841 colon epithelium cells compared to approximately a 20% or less decrease in cell number after treatment with each of the liposome compositions tested.
  • FIG. 16 depicts the structure of polyglutamate antifolate, Cisplatin (CDDP) and two potential gG6-Cisplatin complexes.
  • CDDP Cisplatin
  • the pH dependent formation of the interstrand and/or instrastrand coordination between the carboxyl groups of the polyglutamated antifolate and cisplatin is likely to disassemble into individual molecules of gG6 and cisplatin upon encountering acidic pH of lysosomes (pH 3-5) and presence of chloride ions inside the cells.
  • FIG. 17 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and
  • WBC white blood cell
  • FIG. 18 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and 80 mg/kg given once weekly for 4 weeks upon hemoglobin and reticulocyte indices. There is a minimal decrease in mean hemoglobin concentrations at the higher dose level. In parallel there is a slight increase in mean reticulocytosis indices
  • FIG. 19 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and
  • liver transaminases 80 mg/kg given once weekly for 4 weeks upon hepatic markers including serum aspartate transaminase (AST) and serum alanine transaminase (ALT) along with serum albumin.
  • AST serum aspartate transaminase
  • ALT serum alanine transaminase
  • FIG. 20 presents the relative tumor volume of immunodeficient female Nu/J mice (6- 8 weeks old) inoculated with NCI-H292 (Non-Small Cell Lung Cancer) cells and administered control, pemetrexed, and Liposomal aG6 intravenously at 167 mg/kg once every three weeks.
  • liposomal aG6 provides reduced tumor control compared to pemetrexed.
  • FIGS. 21A-F present the dose response relationship of liposomal pemetrexed alpha- L triglutamate (Liposomal aG3), liposomal pemetrexed alpha-L pentaglutamate (Liposomal aG5), liposomal pemetrexed alpha-L octaglutamate (Liposomal aG7), and a combination of liposomal pemetrexed alpha-L hexaglutamate (aG6) and alpha-L dodecaglutamate (aGl2) (Liposomal aG6 and aGl2), over 48 hours on H2342 (NSCLC, adenocarcinoma subtype)(FIG.
  • NSCLC adenocarcinoma subtype
  • the disclosure generally relates to gamma polyglutamated Antifolate compositions.
  • compositions provide advances over prior treatments of hyperproliferative diseases such as cancer.
  • Methods of making, delivering and using the gamma polyglutamated Antifolate compositions are also provided.
  • the gamma polyglutamated compositions have uses that include but are not limited to treating or preventing hyperproliferative diseases such as cancer, disorders of the immune system including inflammation and autoimmune disease such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • the term“and/or” as used in a phrase such as“A and/or B” herein is intended to include both A and B; A or B; A (alone); and B (alone).
  • the term“and/or” as used in a phrase such as“A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
  • Headings and subheadings are used for convenience and/or formal compliance only, do not limit the subject technology, and are not referred to in connection with the interpretation of the description of the subject technology.
  • Features described under one heading or one subheading of the subject disclosure may be combined, in various embodiments, with features described under other headings or subheadings. Further it is not necessarily the case that all features under a single heading or a single subheading are used together in embodiments.
  • Antifolate and “ANTIFOL” are used interchangeably to include a salt, acid and and/or free base form of an antifolate (e.g., Antifolate disodium).
  • Compositions containing a Antifolate salt may further contain any of a variety of cations, such as Na+, Mg2+, K+, NH4+, and/or Ca2+.
  • the salts are pharmaceutically acceptable salts.
  • Antifolate contains one L-gamma glutamyl group, and is therefore considered to be monoglutamated for the purpose of this disclosure.
  • the compounds of the present invention can exist as a mixture of stereoisomers it is preferred that they are resolved into one optically active isomeric form. Such a requirement complicates the synthesis of the compounds and it is preferred therefore that they contain as few asymmetric carbon atoms as possible consistent with achieving the desired activity.
  • the cyclopenta[g]quinazolines of the present invention contain at least three asymmetric carbon atoms.
  • that at the 6 position of the ring system preferably has the 6S orientation rather than the 6R orientation.
  • the preferred compounds (I) described hereinbefore thus preferably have such a configuration at this asymmetric carbon atoms or less preferably are a mixture in which one or both of these asymmetric carbon atoms is unresolved.
  • the Antifolate can be any known or future derived folate or antifolate that is polyglutamated.
  • the Antifolate is selected from LV (etoposide), L- leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2- CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2- CH3-AMT, 2-desamino-2-methyl-AMT; lO-EdAM, lO-ethyl-lO-deazaaminopterin; PT523, N alpha -(4-amino-4-deoxypteroyl)-N delta-
  • the Antifolate is a member selected from: Aminopterin, methotrexate, raltitrexed (also referred to as TOMUDEX®, ZD1694 (RTX)), plevitrexed (also referred to as BGC 9331; ZD9331), pemetrexed (also referred to as ALIMTA, LY231514), lometrexol (LMX) (5,l0-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945 (also referred to as BGC945) or a stereoisomer thereof such as, 6-R,S-BGC 945 (ONX-0801), CB300638 (also referred to as BGC638), and BW1843U89.
  • Aminopterin methotrexate
  • raltitrexed also referred to as TOMUDEX®, ZD1694 (RTX)
  • PG “PANTIFOL” and iterations thereof, are used interchangeably herein to refer to a Antifolate composition that comprises at least one glutamyl group in addition to the glutamyl group in the Antifolate (i.e., ANTIFOL-PGn, wherein n > 1).
  • ANTIFOL-PG a ANTIFOL-PG composition containing 5 glutamyl residues in addition to the glutamyl group of ANTIFOL is referred to herein as hexaglutamated Antifolate or Antifolate hexaglutamate.
  • Polyglutamate chains comprise an N-terminal glutamyl group and one or more C-terminal glutamyl groups.
  • the N-terminal glutamyl group of a polyglutamate chain is not linked to another glutamyl group via its amine group, but is linked to one or more glutamyl group via its carboxylic acid group.
  • the N-terminal glutamyl group of a polyglutamated- Antifolate is the glutamyl group of Antifolate.
  • the C-terminal glutamyl group or groups of a polyglutamate chain are linked to another glutamyl group via their amine group, but are not linked to another glutamyl group via their carboxylic acid group.
  • the terms“alpha glutamyl group”,“alpha glutamate”,“alpha linkage”, and iterations thereof, as they relate to the linkage of a glutamyl group refers to a glutamyl group that contains an alpha carboxyl group linkage. In some embodiments, none of the glutamyl groups of the provided polyglutamated Antifolates contain an alpha linkage.
  • the terms“gamma glutamyl group”,“gamma glutamate”, and“gamma linkage”, as they relate to the linkage of a glutamyl group refers to a glutamyl group that contains a gamma carboxyl group linkage.
  • the gamma linkage is an amide bond between the gamma carboxyl group of one glutamyl group and a second glutamyl group.
  • the gamma linkage can be between a glutamyl group and the glutamyl group in the Antifolate, or between the glutamyl group and a second glutamyl group that is not present in Antifolate, such as a glutamyl group within a polyglutamate chain attached to Antifolate.
  • the gamma linkage refers to the amide bond of the glutamyl group of the Antifolate.
  • Reference to gamma linkages are inclusive of gamma linkage of the glutamyl group of the Antifolate unless it is expressly stated or is unambiguously clear from the context that such is not intended.
  • the gamma glutamyl group is in the L-form.
  • the gamma glutamyl group is in the D-form.
  • antifolates enter the cell and are polyglutamated by the enzyme folylpoly-gamma-glutamate synthetase (FPGS), which adds L glutamyl groups serially to the gamma carboxyl group of the glutamate within the L-glutamyl group in the antifolate. Consequently, D-gamma polyglutamated antifolate compositions are not formed within cells during antifolate therapy.
  • FPGS folylpoly-gamma-glutamate synthetase
  • yPANTIFOL gamma polyglutamated- Antifolate
  • polyglutamated-ANTIFOL polyglutamated-ANTIFOL
  • yANTIFOL-PG iterations thereof, are used interchangeably herein to refer to a Antifolate composition that comprises at least one gamma glutamyl group having a gamma carboxyl group linkage in addition to the gamma glutamyl group in the Antifolate (e.g ., ANTIFOL-PGn, wherein n > 1 g glutamyl group).
  • ANTIFOL-PGn wherein n > 1 g glutamyl group.
  • a yANTIFOL-PG composition containing 5 g-glutamyl groups in addition to the glutamyl group in the Antifolate may be referred to herein as gamma hexaglutamated Antifolate or gamma Antifolate hexaglutamate.
  • alpha glutamyl group refers to a glutamyl group that contains an alpha carboxyl group linkage.
  • Isolated refers to a composition which is in a form not found in nature.
  • Isolated gamma polyglutamated compositions include those which have been purified to a degree that they are no longer in a form in which they are found in nature.
  • a gamma polyglutamated Antifolate which is isolated is substantially pure. Isolated compositions will be free or substantially free of material with which they are naturally associated such as other cellular components such as proteins and nucleic acids with which they may potentially be found in nature, or the environment in which they are prepared (e.g., cell culture).
  • the gamma polyglutamated compositions may be formulated with diluents or adjuvants and still for practical purposes be isolated - for example, the gamma polyglutamated compositions will normally be mixed with pharmaceutically acceptable carriers or diluents when used in diagnosis or therapy.
  • the isolated gamma polyglutamated compositions e.g., gamma polyglutamates and delivery vehicles such as liposomes containing the gamma polyglutamate contain less than 1% or less than 0.1% undesired DNA or protein content.
  • the gamma polyglutamate compositions are "isolated.”
  • targeting moiety is used herein to refer to a molecule that provides an enhanced affinity for a selected target, e.g., a cell, cell type, tissue, organ, region of the body, or a compartment, e.g., a cellular, tissue or organ compartment.
  • the targeting moiety can comprise a wide variety of entities. Targeting moieties can include naturally occurring molecules, or recombinant or synthetic molecules. In some embodiments, the targeting moiety is an antibody, antigen-binding antibody fragment, bispecific antibody or other antibody-based molecule or compound.
  • the targeting moiety is an aptamer, avimer, a receptor-binding ligand, a nucleic acid, a biotin-avidin binding pair, a peptide, protein, carbohydrate, lipid, vitamin, toxin, a component of a microorganism, a hormone, a receptor ligand or any derivative thereof.
  • Other targeting moieties are known in the art and are encompassed by the disclosure.
  • the terms“specific affinity” or“specifically binds” mean that a targeting moiety such as an antibody or antigen binding antibody fragment, reacts or associates more frequently, more rapidly, with greater duration, with greater affinity, or with some combination of the above to the epitope, protein, or target molecule than with alternative substances, including proteins unrelated to the target epitope. Because of the sequence identity between homologous proteins in different species, specific affinity can, in several embodiments, include a binding agent that recognizes a protein or target in more than one species. Likewise, because of homology within certain regions of polypeptide sequences of different proteins, the term “specific affinity” or“specifically binds” can include a binding agent that recognizes more than one protein or target.
  • a targeting moiety that specifically binds a first target may or may not specifically bind a second target.
  • “specific affinity” does not necessarily require (although it can include) exclusive binding, e.g. , binding to a single target.
  • a targeting moiety may, in certain embodiments, specifically bind more than one target. In certain embodiments, multiple targets may be bound by the same targeting moiety.
  • epitope refers to that portion of an antigen capable of being recognized and specifically bound by a targeting moiety (i.e., binding moiety) such as an antibody.
  • a targeting moiety i.e., binding moiety
  • epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing.
  • An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.
  • Expressions like“binding affinity for a target”,“binding to a target” and analogous expressions known in the art refer to a property of a targeting moiety which may be directly measured through the determination of the affinity constants, e.g., the amount of targeting moiety that associates and dissociates at a given antigen concentration.
  • Different methods can be used to characterize the molecular interaction, such as, but not limited to, competition analysis, equilibrium analysis and microcalorimetric analysis, and real-time interaction analysis based on surface plasmon resonance interaction (for example using a BIACORE® instrument).
  • delivery vehicle refers generally to any compositions that acts to assist, promote or facilitate entry of gamma polyglutamated Antifolate into a cell.
  • delivery vehicles include, but are not limited to, liposomes, lipospheres, polymers (e.g., polymer-conjugates), peptides, proteins such as antibodies (e.g., immunoconjugates, such as Antibody Drug Conjugates (ADCs) and antigen binding antibody fragments and derivatives thereof), cellular components, cyclic oligosaccharides (e.g., cyclodextrins), micelles, microparticles (e.g., microspheres), nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles), hydrogels, lipoprotein particles, viral sequences, viral material, or lipid or liposome formulations, and combinations thereof.
  • the delivery vehicle can be linked directly or indirectly
  • A“subject” refers to a human or vertebrate mammal including but not limited to a dog, cat, horse, goat and primate, e.g., monkey.
  • the invention can also be used to treat diseases or conditions in non-human subjects. For instance, cancer is one of the leading causes of death in companion animals ⁇ e.g., cats and dogs).
  • the subject is a human.
  • the term “subject” and “patient” is used interchangeably and has the same meaning. It is preferred generally that a maximum dose be used, that is, the highest safe dose according to sound medical judgment.
  • an“effective amount” refers to a dosage of an agent sufficient to provide a medically desirable result.
  • the effective amount will vary with the desired outcome, the particular condition being treated or prevented, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent or combination therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner.
  • An “effective amount” can be determined empirically and in a routine manner, in relation to the stated purpose.
  • the effective amount of an agent may reduce the number of cancer cells; reduce the tumor size; inhibit (i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the disorder.
  • the dmg may prevent growth and/or kill existing cancer cells, it may be cytostatic and/or cytotoxic.
  • efficacy in vivo can, for example, be measured by assessing the duration of survival, duration of progression free survival (PFS), the response rates (RR), duration of response, and/or quality of life.
  • the terms“hyperproliferative disorder”, “proliferative disease”, and“proliferative disorder”, are used interchangeably herein to pertain to an unwanted or uncontrolled cellular proliferation of excessive or abnormal cells which is undesired, such as, neoplastic or hyperplastic growth, whether in vitro or in vivo.
  • the proliferative disease is cancer or tumor disease (including benign or cancerous) and/or any metastases, wherever the cancer, tumor and/or the metastasis is located.
  • the proliferative disease is a benign or malignant tumor.
  • the proliferative disease is a non-cancerous disease.
  • the proliferative disease is a hyperproliferative condition such as hyperplasias, fibrosis (especially pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth muscle proliferation in the blood vessels, such as stenosis or restenosis following angioplasty.
  • hyperproliferative condition such as hyperplasias, fibrosis (especially pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth muscle proliferation in the blood vessels, such as stenosis or restenosis following angioplasty.
  • Cancer “tumor,” or“malignancy” are used as synonymous terms and refer to any of a number of diseases that are characterized by uncontrolled, abnormal proliferation of cells, the ability of affected cells to spread locally or through the bloodstream and lymphatic system to other parts of the body (metastasize) as well as any of a number of characteristic structural and/or molecular features.“Tumor,” as used herein refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. A“cancerous tumor”, or“malignant cell” is understood as a cell having specific structural properties, lacking differentiation and being capable of invasion and metastasis.
  • a cancer that can be treated using a yPANTIFOL composition provided herein includes without limitation, a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g.
  • osteosarcoma brain cancer, central nervous system cancer, and melanoma
  • a hematologic malignancy such as for example, a leukemia, a lymphoma, and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • the cancer is selected from: breast cancer, advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer.
  • NNL Non-Hodgkin's lymphoma
  • ALL acute lymphoblastic leukemia
  • mycosis fungoides cutaneous T-cell lymphoma
  • choriocarcinoma choriocarcinoma
  • chorioadenoma nonleukemic meningeal cancer
  • soft tissue sarcoma demoid tumors, aggressive fibromatosis
  • bladder cancer and central nervous system (CNS) cancer.
  • CNS
  • tumor refers to spread or dissemination of a tumor, cancer or neoplasia to other sites, locations, regions or organ or tissue systems within the subject, in which the sites, locations regions or organ or tissue systems are distinct from the primary tumor, cancer or neoplasia.
  • cancer “cancerous,”“cell proliferative disorder,”“proliferative disorder,” and“tumor” are not mutually exclusive as referred to herein.
  • Terms such as “treating,” or “treatment,” or “to treat” refer to both (a) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and (b) prophylactic or preventative measures that prevent and/or slow the development of a targeted disease or condition.
  • subjects in need of treatment include those already with the cancer, disorder or disease; those at risk of having the cancer or condition; and those in whom the infection or condition is to be prevented.
  • Subjects are identified as“having or at risk of having” cancer, an infectious disease, a disorder of the immune system, a hyperproliferative disease, or another disease or disorder referred to herein using well-known medical and diagnostic techniques.
  • a subject is successfully "treated” according to the methods provided herein if the subject shows, e.g., total, partial, or transient amelioration or elimination of a symptom associated with the disease or condition (e.g., cancer, inflammation, and rheumatoid arthritis).
  • a symptom associated with the disease or condition e.g., cancer, inflammation, and rheumatoid arthritis.
  • the terms treating,” or “treatment,” or “to treat” refer to the amelioration of at least one measurable physical parameter of a proliferative disorder, such as growth of a tumor, not necessarily discernible by the patient.
  • the terms treating,” or “treatment,” or “to treat” refer to the inhibition of the progression of a proliferative disorder, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both.
  • the terms treating,” or “treatment,” or “to treat” refer to the reduction or stabilization of tumor size, tumor cell proliferation or survival, or cancerous cell count. Treatment can be with a g-PANTIFOL composition, alone or in combination with an additional therapeutic agent.
  • Subject and“patient,” and“animal” are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, rats, and mice, and other animals. Animals include all vertebrates, e.g., mammals and non-mammals, such as chickens, amphibians, and reptiles.“Mammal” as used herein refers to any member of the class Mammalia, including, without limitation, humans and nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and other members of the class Mammalia known in the art. In a particular embodiment, the patient is a human.
  • Treatment of a proliferative disorder is used herein to include maintaining or decreasing tumor size, inducing tumor regression (either partial or complete), inhibiting tumor growth, and/or increasing the life span of a subject having the proliferative disorder.
  • the proliferative disorder is a solid tumor.
  • Such tumors include, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma.
  • the proliferative disorder is a hematologic malignancy.
  • Such hematologic malignancies include for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • autoimmune disease as used herein is defined as a disorder that results from an autoimmune response.
  • An autoimmune disease is the result of an inappropriate and excessive response to a self-antigen.
  • autoimmune diseases include but are not limited to, Addison’s disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes (Type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarth
  • inflammation refers to a disease or disorder characterized or caused by inflammation.
  • Inflammation refers to a local response to cellular injury that is marked by capillary dilatation, leukocytic infiltration, redness, heat, and pain that serves as a mechanism initiating the elimination of noxious agents and of damaged tissue.
  • the site of inflammation includes the lungs, the pleura, a tendon, a lymph node or gland, the uvula, the vagina, the brain, the spinal cord, nasal and pharyngeal mucous membranes, a muscle, the skin, bone or bony tissue, a joint, the urinary bladder, the retina, the cervix of the uterus, the canthus, the intestinal tract, the vertebrae, the rectum, the anus, a bursa, a follicle, and the like.
  • Such inflammatory diseases include, but are not limited to, inflammatory bowel disease, rheumatoid diseases (e.g ., rheumatoid arthritis), other arthritic diseases (e.g., acute arthritis, acute gouty arthritis, bacterial arthritis, chronic inflammatory arthritis, degenerative arthritis (osteoarthritis), infectious arthritis, juvenile arthritis, mycotic arthritis, neuropathic arthritis, polyarthritis, proliferative arthritis, psoriatic arthritis, venereal arthritis, viral arthritis), fibrositis, pelvic inflammatory disease, acne, psoriasis, actinomycosis, dysentery, biliary cirrhosis, Lyme disease, heat rash, Stevens- Johnson syndrome, mumps, pemphigus vulgaris, and blastomycosis.
  • rheumatoid diseases e.g ., rheumatoid arthritis
  • other arthritic diseases e.g., acute arthritis, acute gout
  • Inflammatory bowel diseases are chronic inflammatory diseases of the gastrointestinal tract which include, without limitation, Crohn's disease, ulcerative colitis, and indeterminate colitis.
  • Rheumatoid arthritis is a chronic inflammatory disease primarily of the joints, usually polyarticular, marked by inflammatory changes in the synovial membranes and articular structures and by muscle atrophy and rarefaction of the bones.
  • therapeutic agent is used herein to refer to an agent or a derivative or prodrug thereof, that can interact with a hyperproliferative cell such as a cancer cell or an immune cell, thereby reducing the proliferative status of the cell and/or killing the cell.
  • therapeutic agents include, but are not limited to, chemotherapeutic agents, cytotoxic agents, platinum-based agents (e.g., cisplatin, carboplatin, oxaliplatin), taxanes (e.g., TAXOL®), etoposide, alkylating agents (e.g., cyclophosphamide, ifosamide), metabolic antagonists (e.g., an Antifolate (ANTIFOL), 5- fluorouracil gemcitabine, or derivatives thereof), antitumor antibiotics (e.g., mitomycin, doxorubicin), plant-derived antitumor agents (e.g., vincristine, vindesine, Taxol).
  • chemotherapeutic agents e.g., cytotoxic agents, platinum-based agents (e.g., cisplatin, carboplatin, oxaliplatin), taxanes (e.g., TAXOL®), etoposide, alkylating agents
  • Such agents may further include, but are not limited to, the anticancer agents trimetrexate, temozolomide, raltitrexed, S-(4-Nitrobenzyl)-6-thioinosine (NBMPR), 6-benzyguanidine (6-BG), bis-chloronitrosourea (BCNU) and CAMPTOTHECINTM, or a therapeutic derivative of any thereof.
  • NBMPR S-(4-Nitrobenzyl)-6-thioinosine
  • 6-BG 6-benzyguanidine
  • BCNU bis-chloronitrosourea
  • CAMPTOTHECINTM CAMPTOTHECINTM
  • therapeutic agents include, without limitation, anti-restenosis, pro- or anti-proliferative, anti-inflammatory, anti neoplastic, antimitotic, anti-platelet, anticoagulant, antifibrin, antithrombin, cytostatic, antibiotic and other anti-infective agents , anti-enzymatic, anti-metabolic, angiogenic, cytoprotective, angiotensin converting enzyme (ACE) inhibiting, angiotensin II receptor antagonizing and/or cardioprotective agents.“Therapeutic agents” also refer to salts, acids, and free based forms of the above agents.
  • the term“chemotherapeutic agent” when used in relation to cancer therapy refers to any agent that results in the death of cancer cells or inhibits the growth or spread of cancer cells.
  • chemotherapeutic agents include alkylating agents, antibiotics, antimetabolitic agents, plant-derived agents, and hormones.
  • the chemotherapeutic agent is cisplatin.
  • the chemotherapeutic agent is carboplatin.
  • the chemotherapeutic agent is oxaliplatin.
  • the chemotherapeutic agent is gemcitabine.
  • the chemotherapeutic agent is doxorubicin.
  • antimetabolite is used herein to refer to an antineoplastic drug that inhibits the utilization of a metabolite or a prodrug thereof.
  • antimetabolites include Antifolate, pemetrexed, 5-fluorouracil, 5-fluorouracil prodrugs such as capecitabine, 5- fluorodeoxyuridine monophosphate, cytarabine, cytarabine prodrugs such as nelarabine, 5- azacytidine, gemcitabine, mercaptopurine, thioguanine, azathioprine, adenosine, pentostatin, erythrohydroxynonyladenine, and cladribine.
  • Anti-metabolites useful for practicing the disclosed methods include nucleoside analogs, including a purine or pyrimidine analogs.
  • the gamma polyglutamated Antifolate compositions are used in combination with an antimetabolite selection from fluoropyrimidine 5-fluorouracil, 5 -fluoro- 2'-deoxycytidine, cytarabine, gemcitabine, troxacitabine, decitabine, Azacytidine, pseudoisocytidine, Zebularine, Ancitabine, Fazarabine, 6- azacytidine, capecitabine, N4- octadecyl-cytarabine, elaidic acid cytarabine, fludarabine, cladribine, clofarabine, nelarabine, forodesine, and pentostatin, or a derivative thereof.
  • the nucleoside analog is a substrate for a nucleoside deaminase that is adenosine deaminase or cytidine deaminase.
  • the nucleoside analog is selected from among fludarabine, cytarabine, gemcitabine, decitabine and azacytidine or derivatives thereof.
  • the antimetabolite is 5-fluorouracil.
  • a“taxane” is an anti-cancer agent that interferes with or dismpts microtubule stability, formation and/or function.
  • Taxane agents include paclitaxel and docetaxel as well as derivatives thereof, wherein the derivatives function against microtubules by the same mode of action as the taxane from which they are derived.
  • the taxane is paclitaxel or docetaxel, or a pharmaceutically acceptable salt, acid, or derivative of paclitaxel or docetaxel.
  • the taxane is paclitaxel (TAXOL®), docetaxel (TAXOTERE®), albumin-bound paclitaxel (nab-paclitaxel; ABRAXANE®), DHA-paclitaxel, or PG-paclitaxel.
  • a “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
  • Pharmaceutically-acceptable carriers can include for example, one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other subject.
  • This disclosure generally relates gamma polyglutamated Antifolate (yANTIFOL) compositions and methods of making and using the compositions to treat diseases including hyperproliferative diseases such as cancer, disorders of the immune system such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • diseases including hyperproliferative diseases such as cancer, disorders of the immune system such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
  • the disclosure provides:
  • composition comprising a gamma polyglutamated Antifolate
  • LV etoposide
  • L-leucovorin L-5-formyltetrahydrofolate
  • 5-CH3-THF 5- methyltetrahydrofolate
  • FA folic acid
  • PteGlu pteroyl glutamate
  • MTX methotrexate
  • 2-dMTX 2-desamino-MTX
  • 2-CH3-MTX 2-desamino-2-methyl- MTX
  • AMT aminopterin
  • 2-dAMT 2-desamino-AMT
  • 2-CH3-AMT 2-desamino- 2-methyl-AMT
  • lO-EdAM 10-ethyl- lO-deazaaminopterin
  • DDATHF N alpha -(4- amino-4-deoxypteroyl)-N delta-(
  • raltitrexed, plevitrexed, pemetrexed, lometrexol LMX; 5,l0-dideazatetrahydrofolic acid
  • (a) is gamma tetraglutamated Antifolate
  • (b) is gamma pentaglutamated Antifolate
  • (c) is gamma hexaglutamated Antifolate
  • each of the glutamyl groups of the gamma polyglutamated Antifolate is in the L-form
  • each of the glutamyl groups of the gamma polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form, or
  • At least 2 of the glutamyl groups of the gamma polyglutamated Antifolate are in the L-form and at least 1 of the glutamyl groups is in the D-form;
  • composition according to any of [l]-[9], wherein the polyglutamate is branched; [12] a liposomal composition comprising the gamma polyglutamated Antifolate according to any of [l]-[l l] (Lp-yPANTIFOL);
  • Antifolate is selected from: LV (etoposide), L-leucovorin (L-5- formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2- desamino- AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, l0-ethyl-10- deazaaminopterin; PT523, N alpha -(4-amino-4-deoxypteroyl)-N delta- (hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8,-
  • Antifolate is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,l0-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as 6- R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89;
  • liposome comprises a gamma polyglutamated Antifolate containing 4, 5, 2-10, 4-6, or more than 5, gamma glutamyl groups;
  • liposome comprises a gamma tetraglutamated Antifolate
  • liposome comprises a gamma pentaglutamated Antifolate
  • liposome comprises a gamma hexaglutamated Antifolate
  • the Lp-yPANTIFOL composition according to any of [ l2]-[ 19] , wherein the gamma polyglutamated Antifolate comprises 1-10 glutamyl groups having a gamma carboxyl group linkage;
  • each of the glutamyl groups of the gamma polyglutamated Antifolate is in the L-form;
  • at least 1 of the glutamyl groups of the gamma polyglutamated Antifolate is in the D- form;
  • each of the glutamyl groups of the gamma polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form;
  • At least 2 of the glutamyl groups of the gamma polyglutamated Antifolate are in the L-form and at least 1 of the glutamyl groups is in the D-form;
  • each of the glutamyl groups of the gamma polyglutamated Antifolate is in the L-form
  • each of the glutamyl groups of the gamma polyglutamated Antifolate other than the glutamyl group of the Antifolate is in the D-form;
  • At least 2 of the glutamyl groups of the gamma polyglutamated Antifolate are in the L-form and at least 1 of the glutamyl groups is in the D-form;
  • liposome is pegylated (PLp-yPANTIFOL);
  • liposome is not pegylated
  • liposome has a diameter in the range of 20 nm to 200 nm;
  • liposome has a diameter in the range of 80 nm to 120 nm;
  • liposome is formed from liposomal components
  • the liposomal components comprise at least one of an anionic lipid and a neutral lipid; [29] the Lp-yPANTIFOL composition according to [27] or [28], wherein the liposomal components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG- maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol- maleimide;
  • liposomal components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylamide)
  • PVA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • phosphatidyl polyglycerol poly[N-(2-hydroxypropyl) methacrylamide]
  • amphiphilic poly-N- vinylpyrrolidones L-amino-acid-based polymer
  • oligoglycerol copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol
  • GM1 monosialoganglioside
  • PVP
  • liposome is anionic or neutral
  • liposome has a zeta potential that is less than or equal to zero;
  • liposome has a zeta potential that is between 0 to -150 mV;
  • liposome has a zeta potential that is between -30 to -50 mV; [38] the Lp-yPANTIFOL composition according to any of [l2]-[33], wherein the liposome is cationic;
  • liposome has an interior space comprising the gamma polyglutamated Antifolate and an aqueous pharmaceutically acceptable carrier;
  • a tonicity agent such as dextrose, mannitol, glycerine, potassium chloride, sodium chloride, at a concentration of greater than 1%;
  • pharmaceutically acceptable carrier comprises 1% to 50% dextrose solution
  • pharmaceutically acceptable carrier comprises a buffer such as HEPES Buffered Saline (HBS) or similar, at a concentration of between 1 to 200 mM and a pH of between 2 to 8;
  • HBS HEPES Buffered Saline
  • pharmaceutically acceptable carrier comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM;
  • liposome comprises less than 500,000 or less than 200,000 molecules of the gamma polyglutamated Antifolate; [49] the Lp-yPANTIFOL composition according to any of [l2]-[48], wherein the liposome comprises between 10 to 100,000 molecules of the gamma polyglutamated Antifolate, or any range therein between;
  • the targeting moiety comprises a targeting moiety and wherein the targeting moiety has a specific affinity for a surface antigen on a target cell of interest;
  • targeting moiety is an antibody or an antigen binding fragment of an antibody
  • targeting moiety binds the surface antigen with an equilibrium dissociation constant (Kd) in a range of 0.5 x 10 10 to 10 x 10 6 as determined using BIACORE® analysis;
  • targeting moiety specifically binds one or more folate receptors selected from: folate receptor alpha (FR-a), folate receptor beta (FR-b), and folate receptor delta (FR-d);
  • targeting moiety comprises one or more selected from: an antibody, a humanized antibody, an antigen binding fragment of an antibody, a single chain antibody, a single-domain antibody, a bi-specific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody;
  • pegylated liposome comprises from 1 to 1000 or 30-200 targeting moieties
  • the Lp-yPANTIFOL composition according to any of [39]-[57], further comprising one or more of an immunostimulatory agent, a detectable marker and a maleimide, wherein the immunostimulatory agent, the detectable marker or the maleimide is attached to said PEG or the exterior of the liposome;
  • immunostimulatory agent and the detectable marker is the same;
  • cryoprotectant selected from mannitol; trehalose; sorbitol; and sucrose;
  • a targeted composition comprising the composition according to any of [l]-[64];
  • a pharmaceutical composition comprising the liposomal gamma polyglutamated Antifolate composition according to any of [l2]-[67];
  • [72] a method for treating or preventing disease in a subject needing such treatment or prevention, the method comprising administering the composition of any of [l]-[70] to the subject;
  • hyperproliferative cell with the composition of any of [ l]-[69] ;
  • the hyperproliferative cell is a cancer cell, a mammalian cell, and/or a human cell;
  • [77] a method for treating cancer that comprises administering an effective amount of the composition of any of [l]-[69] to a subject having or at risk of having cancer;
  • [78] a method for treating cancer that comprises administering an effective amount of the liposomal gamma polyglutamated Antifolate composition of any of [l2]-[68] to a subject having or at risk of having cancer;
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma ( e.g ., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dyscrasias; [80] the method of [77] or [78], wherein the cancer is selected from: lung cancer, breast cancer, colon cancer, pancreatic cancer, gastric cancer, bladder cancer, head and neck cancer, ovarian cancer, and cervical cancer;
  • cancer selected from: colorectal cancer, lung cancer, breast cancer, head and neck cancer, and pancreatic cancer;
  • cancer selected from: colorectal cancer, breast cancer, ovarian cancer, lung cancer, head and neck cancer, pancreatic cancer, gastric cancer, and mesothelioma;
  • [83] a method for treating cancer that comprises administering an effective amount of the Lp-yPANTIFOL composition of any of [50] -[66] to a subject having or at risk of having a cancer cell that expresses on its surface a folate receptor bound by the targeting moiety;
  • a maintenance therapy for subjects that are undergoing or have undergone cancer therapy that comprise administering an effective amount of the composition of any of [l]-[69] to a subject that is undergoing or has undergone cancer therapy;
  • a maintenance therapy for subjects that are undergoing or have undergone cancer therapy that comprise administering an effective amount of the liposomal gamma polyglutamated Antifolate composition of any of [l2]-[69] to a subject that is undergoing or has undergone cancer therapy;
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the composition of any of [l]-[69] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., Crohn disease
  • dermatomyositis/ polymyositis e.g., systemic erythematosus
  • Takayasu psoriasis
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the liposomal gamma polyglutamated Antifolate composition of any of [8] -[69] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g ., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g ., acute and chronic
  • systemic inflammation e.g ., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g inflammatory bowel disease
  • dermatomyositis/ polymyositis e.g erythematosus
  • an infectious disease, cardiovascular disease, metabolic disease, or another disease that comprises administering an effective amount of the composition according to of any of any of [l]-[69] to a subject having or at risk of having an infectious disease, cardiovascular diease, or another disease, wherein the disease is a member selected from: atherosclerosis, cardiovascular disease (CVD), coronary artery disease, myocardial infarction, stroke, metabolic syndrome, a gestational trophoblastic disease, and ectopic pregnancy;
  • CVD cardiovascular disease
  • CVD cardiovascular disease
  • coronary artery disease myocardial infarction
  • stroke stroke
  • metabolic syndrome a gestational trophoblastic disease
  • ectopic pregnancy ectopic pregnancy
  • an autoimmune disease that comprises administering an effective amount of the composition according to of any of any of [l]-[69] to a subject having or at risk of having an autoimmune disease;
  • rheumatoid arthritis that comprises administering an effective amount of the composition according to of any of any of [l]-[69] to a subject having or at risk of having rheumatoid arthritis;
  • an inflammatory condition that comprises administering an effective amount of the composition according to of any of any of [l]-[69] to a subject having or at risk of having inflammation, optionally wherein the inflammation is acute, chronic, and/or systemic inflammation; or
  • a skin condition that comprises administering an effective amount of the composition according to of any of claims any of [l]-[69] to a subject having or at risk of having a skin condition, optionally wherein the skin condition is psoriasis;
  • a method for treating an infectious disease that comprises administering an effective amount of the liposomal gamma polyglutamated Antifolate composition of any of [12]-[69] to a subject having or at risk of having an infectious disease;
  • [90] a method of delivering gamma polyglutamated Antifolate to a tumor expressing a folate receptor on its surface, the method comprising: administering the Lp- yPANTIFOL composition of any of [l]-[69] to a subject having the tumor in an amount to deliver a therapeutically effective dose of the gamma polyglutamated Antifolate to the tumor;
  • a method of preparing a gamma polyglutamated Antifolate composition comprising the liposomal gamma polyglutamated Antifolate composition of any of [12]-[69], the method comprising: forming a mixture comprising: liposomal components and gamma polyglutamated antifolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing gamma polyglutamated Antifolate;
  • [92] a method of preparing a gamma polyglutamated Antifolate composition comprising the liposomal gamma polyglutamated Antifolate composition of any of [12]-[69], the method comprising: forming a mixture comprising: liposomal components and gamma polyglutamated Antifolate in solution; and processing the mixture to form liposomes containing gamma polyglutamated Antifolate,
  • [94] a method of preparing the composition of any of [50] -[69] comprising the steps of: forming a mixture comprising: liposomal components and gamma polyglutamated Antifolate in a solution; homogenizing the mixture to form liposomes in the solution; processing the mixture to form liposomes entrapping and/or encapsulating gamma polyglutamated Antifolate; and providing a targeting moiety on a surface of the liposomes, the targeting moiety having specific affinity for at least one of folate receptor alpha (FR-a), folate receptor beta (FR-b) and folate receptor delta (FR-d); [95] a method of preparing the composition of any of [50] -[69], comprising the steps of: forming a mixture comprising: liposomal components and gamma polyglutamated Antifolate in a solution; processing the mixture to form liposomes entrapping and/or encapsulating gamma polyglutamated Anti
  • the processing step includes one or more steps of: thin film hydration, extrusion, in-line mixing, ethanol injection technique, freezing-and-thawing technique, reverse-phase evaporation, dynamic high pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor method, and stirring; and/or
  • the disclosure generally relates gamma polyglutamated Antifolate (yPANTIFOL) compositions.
  • the yPANTIFOL compositions comprise at least one glutamyl group having a gamma carboxyl group linkage. These compositions are stmcturally distinct from the L- gamma polyglutamated forms the Antifolate (LylPANTIFOL) that are produced by the enzyme folylpoly-gamma-glutamate synthetase (FPGS) in cells during Antifolate therapy.
  • FPGS folylpoly-gamma-glutamate synthetase
  • the yPANTIFOF composition contains 2-20, 2-15, 2-10, 2-5, or more than 5, glutamyl groups (including the glutamyl group of the Antifolate).
  • each of the glutamyl groups in the yPANTIFOL other than the glutamyl group of the Antifolate has a gamma linkage.
  • 2 or more of the glutamyl groups in the yPANTIFOL have a gamma linkage.
  • each of the glutamyl groups in the yPANTIFOL is in the L-form.
  • each of the glutamyl groups in the yPANTIFOL other than the glutamyl group in the Antifolate is in the D-form.
  • the yPANTIFOL comprises two or more glutamyl groups in the L-form and one or more glutamyl groups in the D-form.
  • the Antifolate is selected from: PMX, MTX, RTX, and LTX, or a stereoisomer thereof.
  • the Antifolate is selected from: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2- desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2- desamino-2-methyl-AMT; lO-EdAM, lO-ethyl-lO-deazaaminopterin; PT523, N alpha -(4- amino-4-deoxypteroyl)-N delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol)
  • the Antifolate is selected from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), a eye lopenta[g] quinazoline with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89.
  • LMX 5,10-dideazatetrahydrofolic acid
  • a eye lopenta[g] quinazoline with a dipeptide ligand CB3717, CB300945, or a stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89.
  • the Antifolate is a 6-substituted pyrrolo[2,3-d]pyrimidine benzoyl antifolate.
  • the Antifolate is a 6-substituted thieno[2,3-d]pyrimidine benzoyl antifolates with bridge with a bridge length from 2-8 carbons (e.g.
  • the Antifolate is selected from: an indoline ring and modified ornithine-bearing methotrexate derivative, an indoline ring and modified glutamic acid bearing methotrexate derivative, an alkyl-substituted benzene ring C bearing methotrexate derivative, a benzoxazine moiety-bearing methotrexate derivative, a benzothiazine moiety bearing methotrexate derivative, a lO-deazaminopterin analog, a 5-deazaminopterin methotrexate analog, a 5,l0-dideazaminopterin methotrexate analog, a indoline moiety- bearing methotrexate derivative, a lipophilic amide methotrexate derivative, a L-threo- (2S,4S)-4-fluoro-glutamic acid containing methotrexate analog, a DL-3,3-difluoroglutamic acid-containing
  • an N delta-acyl- N a-(4-amino-4-deoxypteroyl)-L-omithine derivative a 8-deaza methotrexate analogue, an acivicin methotrexate analog, a polymeric platinol methotrexate derivative, a methotrexate-g- dimyristoylphophatidylethanolamine, a methotrexate polyglutamate analog, a poly-g- glutamyl methotrexate derivative, a deoxyuridylate methotrexate derivative, a iodoacetyl lysine methotrexate analog, a 2,omega.-diaminoalkanoid acid-containing methotrexate analog, a polyglutamate methotrexate derivative, a 5-methyl-5-deaza
  • a g-tert-butyl methotrexate ester a fluorinated methotrexate analog, a folate methotrexate analog, a phosphonoglutamic acid analog, a poly (L-lysine) methotrexate conjugate, a dilysine or trilysine methotrexate derivate, a 7-hydroxymethotrexate, a poly-y-glutamyl methotrexate analog, a 3 ',5'- dichloromethotrexate, a diazoketone or chloromethylketone methotrexate analog, a 10- propargylaminopterin, an alkyl methotrexate homologs, a lectin derivative of methotrexate, a polyglutamate methotrexate derivative, a halogentated methotrex
  • the Antifolate has the Formula (IV):
  • the Antifolate has the Formula (V):
  • the Antifolate has the Formula (VI):
  • the Antifolate has the Formula (VIII):
  • A NH, NCH 3 , or CH 2 .
  • the Antifolate has the Formula (IX):
  • the Antifolate is a cyclopenta[g]quinazoline derivative.
  • the cyclopenta[g]quinazoline derivative is N- ⁇ N- ⁇ 4-[N-(2-methyl-4- oxo-3, 4,7, 8-tetrahydro-6H-cyclopenta[g]quinazolin-6-yl)-N-(prop-2- ynyl)amino]benzoyl]-L- g-glutamylJ-D-glutamic acid; or N- ⁇ N- ⁇ 4-[N-(2-hydroxymethyl-4-oxo-3,4,7,8-tetrahydro- 6H-cyclopenta[g]-quinazolin-6-yl)-N-(prop-2-ynyl)amino]benzoyl ⁇ -L-Y-glutamyl ⁇ -D- glutamic acid; or a pharmaceutically acceptable salt or ester thereof.
  • the Antifolate has the Formula (X):
  • Rl is H, amino, Cl -4 alkyl, Cl -4 alkoxy, Cl -4 hydroxyalkyl or Cl— 4 fluoroalkyl
  • R2 is hydrogen, Cl-4 alkyl, C3-4 alkenyl, C3-4 alkynyl, C2-4 hydroxyalkyl C2-4 halogenoalkyl or Cl-4 cyanoalkyl
  • Ar is phenylene, thiophenediyl, thiazolediyl, pyridinediyl or pyrimidinediyl which may optionally bear one or two substituents selected from halogeno, hydroxy, amino, nitro, cyano, trifluoromethyl, Cl-4 alkyl and Cl-4 alkoxy; and
  • R3 is a group of one of the following formulae: -NHCH(C02H)-A1-Y1-NH-A3-Y3 or R3 is an alpha or gamma carboxyl linked L- or D- glutamyl group.
  • the Antifolate has the Formula (X) wherein, Rl is Cl-4 alkyl or Cl-4 hydroxyalkyl (e.g., a methyl or a hydroxymethyl); R2 is (a) methyl, ethyl, propyl, prop-2-enyl, prop-2-ynyl, 2-hydroxy-ethyl, 2-fluoroethyl, 2-bromoethyl or 2-cyanoethyl, (b) methyl or (c) prop-2-ynyl; and Ar is l,4-phenylene or a 1 ,4-phenylene having one or two substituents selected from chloro and fluoro (e.g.
  • 2-fluoro substituent such as 2-fluoro- 1,4- phenylene or 2,6-difluoro-l,4-phenylene
  • thiophene-2 5-diyl
  • thiazole-2 5-diyl
  • pyridine- 2 5-diyl
  • the Antifolate has the Formula (X) wherein, Rl is methyl or hydroxymethyl; R2 is methyl or prop-2-ynyl; and Ar is l,4-phenylene or 1 ,4-phenylene having a 2-fluoro substituent as in 2,6-difluoro-l,4-phenylene or especially 2-fluoro- l,4-phenylene or is pyridine 2, 5-diyl.
  • Ar is 1 ,4-phenylene or 2-fluoro- 1,4-phenylene.
  • the gamma polyglutamated Antifolate is a cyclopenta[g]quinazoline disclosed in W02009/115776, WO 2003/020300, WO 2003/020706, WO 2003/020748, Gibbs et ak, Cancer Research 65 (15): 11721- 11728 (2005), and Bavetsias et ak, Tetrahedron 63(7): 1537-1543 (2007), the contents of each of which is herein incorporated by reference in its entirety.
  • the gamma polyglutamated Antifolate is diglutamated.
  • the gamma polyglutamated Antifolate contains 1 g-glutamyl group in addition to the glutamyl group in the Antifolate (yANTIFOL-PGl), and the additional glutamyl group is linked to the glutamyl group in the Antifolate through a gamma linkage.
  • each of the glutamyl groups of the gamma diglutamated Antifolate is in the L-form.
  • the gamma diglutamated Antifolate comprises a glutamyl group in the D-form.
  • the gamma polyglutamated Antifolate is triglutamated. That is, the gamma polyglutamated Antifolate contains 2 g-glutamyl groups in addition to the glutamyl group in the Antifolate (g A NT I F O L- PG2 ) . In some embodiments, each of the 2 additional glutamyl groups have a gamma linkage. In other embodiments, one of the 2 glutamyl groups have a gamma linkage and the other glutamyl group has a gamma linkage. In some embodiments, each of the glutamyl groups of the gamma triglutamated Antifolate is in the L- form.
  • the gamma triglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the g-triglutamated Antifolate other than the g-glutamyl group in the Antifolate is in the D-form.
  • the g-triglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is tetraglutamated and thus contains 3 g-glutamyl groups in addition to the glutamyl group of the Antifolate (gA NTIFOL- PG3 ) .
  • the gamma tetraglutamated Antifolate comprises two or more g-glutamyl groups in the L-form.
  • each of the g-glutamyl groups of the gamma tetraglutamated Antifolate is in the L-form.
  • the gamma tetraglutamated Antifolate comprises a g-glutamyl group in the D-form.
  • the gamma tetraglutamated Antifolate comprises 2 g-glutamyl groups in the D- form.
  • each of the glutamyl groups of the gamma tetraglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the tetraglutamated Antifolate comprises a g-glutamyl group in the D-form and two or more g-glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is pentaglutamated (y A NT I F O L- PG4 ) and contains a chain of 4 y-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma pentaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma pentaglutamated Antifolate is in the L-form.
  • the gamma pentaglutamated Antifolate comprises a glutamyl group in the D-form.
  • the gamma tetraglutamated Antifolate comprises 2 or 3, g-glutamyl groups in the D-form.
  • each of the g-glutamyl groups of the gamma pentaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the pentaglutamated Antifolate comprises a g-glutamyl group in the D-form and two or more y- glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is hexaglutamated (yANTIFOL-PG5) and contains a chain of 5 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma hexaglutamated Antifolate comprises two or more g-glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma hexaglutamated Antifolate is in the L-form.
  • the gamma hexaglutamated Antifolate comprises a g-glutamyl group in the D-form.
  • the gamma tetraglutamated Antifolate comprises 2, 3, 4, or 5, g-glutamyl groups in the D-form.
  • each of the glutamyl groups of the gamma hexaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the hexaglutamated Antifolate comprises a g-glutamyl group in the D-form and two or more g-glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is heptaglutamated (yANTIFOL-PG6) and thus contains a chain of 6 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma heptaglutamated Antifolate comprises two or more g-glutamyl groups in the L-form.
  • each of the g-glutamyl groups of the gamma heptaglutamated Antifolate is in the L-form.
  • the gamma heptaglutamated Antifolate comprises a g-glutamyl group in the D- form.
  • the gamma tetraglutamated Antifolate comprises 2, 3, 4, 5, or 6, g-glutamyl groups in the D-form.
  • each of the g-glutamyl groups of the gamma heptaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the heptaglutamated Antifolate comprises a g- glutamyl group in the D-form and two or more g-glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is octaglutamated (g A NT I FO L- PG7 ) and thus contains a chain of 7 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma octaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma octaglutamated Antifolate is in the L-form.
  • the gamma octaglutamated Antifolate comprises a glutamyl group in the D- form.
  • the gamma octaglutamated Antifolate comprises 2, 3, 4, 5, 6, or 7, g-glutamyl groups in the D-form.
  • each of the glutamyl groups of the gamma octaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the octaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is nonaglutamated ( y A N T I F O L - P G 8 ) and contains a chain of 8 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma nonaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma nonaglutamated Antifolate is in the L-form.
  • the gamma nonaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma nonaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the nonaglutamated Antifolate comprises a g-glutamyl group in the D-form and two or more g-glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is decaglutamated (y A N T I F O L- P G 9 ) (i.e., contains a chain of 9 g-glutamyl groups attached to the glutamyl group in the Antifolate).
  • the gamma decaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma decaglutamated Antifolate is in the L-form.
  • the gamma decaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma decaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the decaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is undecaglutamated (yANTIFOL-PGlO) and contains a chain of 10 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma undecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma undecaglutamated Antifolate is in the L-form.
  • the gamma undecaglutamated Antifolate comprises a D glutamyl group.
  • each of the glutamyl groups of the gamma undecaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the undecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is dodecaglutamated (yANTIFOL-PGl l) and contains a chain of 11 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma dodecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma dodecaglutamated Antifolate is in the L-form.
  • the gamma dodecaglutamated Antifolate comprises a glutamyl group in the D- form.
  • each of the glutamyl groups of the gamma dodecaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the dodecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is tridecaglutamated (yANTIFOL-PG12) and contains a chain of 12 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma tridecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma tridecaglutamated Antifolate is in the L-form.
  • the gamma tridecaglutamated Antifolate comprises a glutamyl group in the D- form.
  • each of the glutamyl groups of the gamma tridecaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the tridecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is tetradecaglutamated (yANTIFOL-PG 13) and contains a chain of 13 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma tetradecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma tetradecaglutamated Antifolate is in the L-form.
  • the gamma tetradecaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma tetradecaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D- form.
  • the tetradecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is pentadecaglutamated (yANTIFOL-PG 14) and contains a chain of 14 y-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma pentadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma pentadecaglutamated Antifolate is in the L-form.
  • the gamma pentadecaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma pentadecaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D- form.
  • the pentadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is hexadecaglutamated (yANTIFOL-PG 15) and contains a chain of 15 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma hexadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma hexadecaglutamated Antifolate is in the L-form.
  • the gamma hexadecaglutamated Antifolate comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma hexadecaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D- form.
  • the hexadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is heptadecaglutamated ( /ANTIFOL-PG 16) and contains a chain of 16 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma heptadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma heptadecaglutamated Antifolate is in the L-form.
  • the gamma heptadecaglutamated Antifolate comprises a D glutamyl group.
  • each of the glutamyl groups of the gamma heptadecaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the heptadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is octadecaglutamated ( /ANTIFOL-PG 17) and contains a chain of 17 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma octadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma octadecaglutamated Antifolate is in the L-form.
  • the gamma octadecaglutamated Antifolate comprises a D glutamyl group.
  • each of the glutamyl groups of the gamma octadecaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the octadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is nonadecaglutamated (yANTIFOL-PG18) and contains a chain of 18 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma nonadecaglutamated Antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each of the glutamyl groups of the gamma nonadecaglutamated Antifolate is in the L-form. In other embodiments, the gamma nonadecaglutamated Antifolate comprises a D glutamyl group. In further embodiments, each of the glutamyl groups of the gamma nonadecaglutamated Antifolate other than the glutamyl group in the Antifolate, is in the D-form. In additional embodiments, the nonadecaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is icosaglutamated (yANTIFOL-PG 19) and contains a chain of 19 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma icosaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma icosaglutamated Antifolate is in the L-form.
  • the gamma icosaglutamated Antifolate comprises a D glutamyl group.
  • each of the glutamyl groups of the gamma icosaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the icosaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate is henicosaglutamated (yANTIFOL-PG20) and contains a chain of 20 g-glutamyl groups attached to the glutamyl group in the Antifolate.
  • the gamma henicosaglutamated Antifolate comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma henicosaglutamated Antifolate is in the L-form.
  • the gamma henicosaglutamated Antifolate comprises a D glutamyl group.
  • each of the glutamyl groups of the gamma henicosaglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • the henicosaglutamated Antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • each of the 4-7 attached glutamyl groups is in the L-form.
  • each of the 4-7 attached glutamyl groups is in the D-form.
  • the 4-7 attached glutamyl groups are in the L-form and the D-form.
  • the gamma polyglutamated Antifolate contains a total of 1-15, 1-10, 2-15, 2-10, 3-15, 3-10, 3-6, 3-5, 4-10, 4-7, or 4-6, glutamyl groups including the glutamyl group of the Antifolate, or any range therein between.
  • each of the glutamyl groups in the yPANTIFOL other than the glutamyl group in the Antifolate have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of the glutamyl groups in the yPANTIFOL have a gamma linkage.
  • the yPANTIFOL comprises y glutamyl groups in the L-form and the D-form.
  • each of the glutamyl groups in the polyglutamate structure of the polyglutamated Antifolate is in the L-form.
  • each of the glutamyl groups in the yPANTIFOL other than the glutamyl group in the Antifolate is in the D-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, of the glutamyl groups in the yPANTIFOL is in the L-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of the glutamyl groups in the yPANTIFOL is in the D-form.
  • the gamma polyglutamated Antifolate contains a total of 2-20, 2-15, 2-10, 2-5, glutamyl groups including the glutamyl group of the Antifolate, or any range therein between.
  • each of the glutamyl groups in the yPANTIFOL is in the L-form.
  • each of the glutamyl groups in the yPANTIFOL other than the glutamyl group in the Antifolate is in the D-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, of the glutamyl groups in the yPANTIFOL are in the L-form.
  • glutamyl groups in the yPANTIFOL is in the D-form.
  • the gamma polyglutamated Antifolate contains a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, glutamyl groups in addition to the glutamyl group of the Antifolate).
  • a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, glutamyl groups in the gamma polyglutamated Antifolate are in the L-form, the D-form, or in the L-form and the D-form.
  • each of the glutamyl groups of the gamma polyglutamated Antifolate is in the L-form.
  • each of the glutamyl groups of the gamma polyglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • At least two of the glutamyl groups in the gamma polyglutamated Antifolate are in the L-form and at least one of the glutamyl groups in the gamma polyglutamated Antifolate is in the D-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 glutamyl groups in the gamma polyglutamated Antifolate are in the L-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, glutamyl groups in the gamma polyglutamated Antifolate are in the D-form.
  • the gamma polyglutamated Antifolate contains 20-100, 20-75, 20-50, 20-40, 20-30, 20-25, or more than 100, gamma glutamyl groups, or any range therein between.
  • each of the glutamyl groups of the gamma polyglutamated Antifolate is in the L-form.
  • each of the glutamyl groups of the gamma polyglutamated Antifolate other than the glutamyl group in the Antifolate is in the D-form.
  • At least two of the glutamyl groups in the gamma polyglutamated Antifolate are in the L-form and at least one of the glutamyl groups in the gamma polyglutamated Antifolate is in the D-form
  • the provided compositions comprise a gamma polyglutamated Antifolate that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups that have gamma linkages.
  • the gamma polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate contains 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups in the D-form.
  • the gamma polyglutamated Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups in the L-form and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10 or 1-20, glutamyl groups in the D- form.
  • the gamma polyglutamated Antifolate composition provided herein is capable of adding one or more additional glutamyl groups that, is the composition is able to act as a substrate for by FPGS (folylpolyglutamate synthetase).
  • FPGS molecular biological synthetase
  • Reagents and assays and reagents for determining the ability of a gamma polyglutamated Antifolate composition to act as a substrate for FPGS e.g., human FPGS, or rat liver FPGS
  • the rate of uptake of naked gamma PANTIFOL compositions disclosed herein is significantly reduced compared to the uptake rate of the Antifolate under physiologic conditions.
  • the rate of hepatic cell uptake of the naked gamma PANTIFOL composition is less than 30%, 20%, 15%, or 10% compared to the rate of the Antifolate.
  • the rate of the efflux (transport out) of gamma PANTIFOL compositions disclosed herein from hepatic-cells occurs at a rate that is significantly reduced compared to the Antifolate (e.g., less than 30%, 20%, 15%, or 10%) compared to the rate of the Antifolate.
  • a gamma polyglutamated Antifolate composition provided herein is more cytotoxic to hyperproliferative cells than Antifolate.
  • the hyperproliferative cells are cancer cells.
  • the hyperproliferative cells a colorectal carcinoma cells, colon cancer cells, breast cancer cells, or ovarian cancer cells.
  • the cancer cells are mesothelioma cells or non- small cell lung carcinoma cells.
  • cytotoxicity is measured in an in vitro assay.
  • the gamma polyglutamated Antifolate is a hexaglutamated Antifolate.
  • a gamma polyglutamated Antifolate composition provided herein has lower toxic side effects than Antifolate. In some embodiments, the gamma polyglutamated Antifolate composition provided herein is less toxic to non-hyperproliferative cells than Antifolate. In some embodiments, the gamma polyglutamated Antifolate composition provided herein is less toxic to neutrophils, liver cells, or to colon epithelium cells than Antifolate. In some embodiments, the neutrophils human neutrophils, differentiating human neutrophils, or neutrophils differentiated from CD34+ cells. In some embodiments, the liver cells are AML12 liver cells.
  • the colon epithelium cells are CCD841 colon epithelium cells.
  • the toxicity is measured in an in vitro assay.
  • the gamma polyglutamated Antifolate is a hexaglutamated Antifolate.
  • a gamma polyglutamated Antifolate composition provided herein has lower toxic side effects than to Antifolate.
  • a gamma polyglutamated Antifolate composition provided herein causes fewer or less severe toxic side effects in an vivo assay than Antifolate.
  • the in vivo assay is an in vivo murine model.
  • a gamma polyglutamated Antifolate composition provided herein causes fewer or less severe hematological or hepatic toxic side effects than Antifolate.
  • hematological side effects are assessed by measuring mean neutrophil, mean white blood cell or mean platelet counts.
  • hepatic toxic side effects are assessed by measuring serum aspartate transaminase (AST), serum alanine transaminase (ALT), and/or serum albumin levels.
  • the in vivo assay comprises administering 40 mg/kg or 80 mg/kg of the gamma polyglutamated Antifolate composition once weekly for 4 weeks.
  • the gamma polyglutamated Antifolate is a hexaglutamated Antifolate.
  • treatment with a gamma polyglutamated Antifolate composition provided herein does not induce significant hematological or hepatic toxic side effects in an in vivo murine model.
  • hematological side effects are assessed by measuring mean neutrophil, mean white blood cell or mean platelet counts.
  • hepatic toxic side effects are assessed by measuring semm aspartate transaminase (AST), serum alanine transaminase (ALT), and/or serum albumin levels.
  • AST semm aspartate transaminase
  • ALT serum alanine transaminase
  • a gamma polyglutamated Antifolate composition provided herein does not significantly decrease mean neutrophil, mean white blood cell or mean platelet counts.
  • a gamma polyglutamated Antifolate composition provided herein does not significantly increase serum aspartate transaminase (AST) and serum alanine transaminase (ALT) levels. In some embodiments, a gamma polyglutamated Antifolate composition provided herein does not significantly decrease serum albumin levels. In some embodiments, the in vivo assay comprises administering 40 mg/kg or 80 mg/kg of the gamma polyglutamated Antifolate composition once weekly for 4 weeks. In some embodiments, the gamma polyglutamated Antifolate is a hexaglutamated Antifolate.
  • the gamma polyglutamated Antifolate compositions do not contain a fluorine atom. In some embodiments, the gamma polyglutamated Antifolate compositions do not contain a 4-fluoroglutamyl group.
  • g PANTIFOL Gamma polyglutamated Antifolate compositions and their uses may further be described in Intl. Appl. No. PCT/US2017/046667, and U.S. Patent Appl. Nos. 62/630,824, 62/630,613, 62/630,713, 62/630,620, 62/627,733, 62/630,625, 62/630,652, 62/627,732, 62/636,289, 62/630,751, 62/630,821, 62/627,741, and 62/583,432, the disclosure of each of which is herein incorporated by reference in its entirety.
  • the disclosure also encompasses gamma polyglutamated Antifolate derivatives and analogs.
  • the compositions and methods disclosed herein are envisioned to apply to any and every known derivative or analog the Antifolate that is polyglutamated.
  • the analog corresponds to a modified form of an Antifolate wherein the glutamyl group of the Antifolate is not linked to the remainder of the Antifolate molecule through a gamma peptide linkage.
  • the analog is a variant form of the Antifolate wherein the glutamyl group in the Antifolate is in the D-form.
  • the polyglutamated form of the Antifolate, or polyglutamated Antifolate analog or derivative is not fluorinated.
  • the Antifolate is selected from: an indoline ring and modified ornithine-bearing methotrexate derivative, an indoline ring and modified glutamic acid-bearing methotrexate derivative, an alkyl- substituted benzene ring C bearing methotrexate derivative, a benzoxazine moiety-bearing methotrexate derivative, a benzothiazine moiety-bearing methotrexate derivative, a 10-deazaminopterin analog, a 5-deazaminopterin methotrexate analog, a 5,l0-dideazaminopterin methotrexate analog, a indoline moiety-bearing methotrexate derivative, a lipophilic amide methotrexate derivative, a L-threo-(2S,4S)-4- fluoro-glutamic acid containing methotrexate analog, a DL-3,3-difluoroglutamic
  • an N delta-acyl- N a-(4-amino-4-deoxypteroyl)-L-omithine derivative a 8-deaza methotrexate analogue, an acivicin methotrexate analog, a polymeric platinol methotrexate derivative, a methotrexate-y- dimyristoylphophatidylethanolamine, a methotrexate polyglutamate analog, a poly-y-glutamyl methotrexate derivative, a deoxyuridylate methotrexate derivative, a iodoacetyl lysine methotrexate analog, a 2,omega.-diaminoalkanoid acid-containing methotrexate analog, a polyglutamate methotrexate derivative, a 5-methyl-5-deaza
  • a y-tert-butyl methotrexate ester a fluorinated methotrexate analog, a folate methotrexate analog, a phosphonoglutamic acid analog, a poly (L-lysine) methotrexate conjugate, a dilysine or trilysine methotrexate derivate, a 7- hydroxymethotrexate, a poly-y-glutamyl methotrexate analog, a 3',5'-dichloromethotrexate, a diazoketone or chloromethylketone methotrexate analog, a lO-propargylaminopterin, an alkyl methotrexate homologs, a lectin derivative of methotrexate, a polyglutamate methotrexate derivative, a halogentated
  • the gamma polyglutamated Antifolate derivative or analog has a variant polyglutamate chain.
  • the polyglutamate chain contains one or more natural or synthetic residues other than glutamate.
  • the polyglutamate chain contains one or more glutamyl groups that do not contain an amide linkage.
  • one or more of the glutamyl groups of the polyglutamate chain is derivatized.
  • the Antifolate polyglutamate compositions provided herein may be obtained by following synthetic procedures known in the art. Procedures for synthesizing Antifolate (including different pharmaceutically acceptable salts or acids (e.g., Antifolate disodium) and crystalline and amorphous forms) and intermediates for synthesizing Antifolate include but are not limited to those described in U.S. Pat. Nos. U.S. Patent Nos.
  • the Antifolate polyglutamate compositions provided herein may be obtained by following synthetic procedures using available reagents and synthetic intermediates.
  • the addition of glutamyl residues to the glutamyl residues of the Antifolate can be accomplished using synthetic procedures known in the art.
  • glutamyl residues are added serially to the glutamyl residue of the Antifolate.
  • polyglutamates are added to the glutamyl reside of the Antifolate using“click chemistry” methods or other bioconjugate chemistries known to those in the art.
  • a peptide of glutamyl residues can be generated of the desired length and added to a precursor of pemetrexed which does not have a glutamyl residue.
  • the peptide can be produced using synthetic procedures known in the art.
  • an initial glutamyl residue is bonded to wang resin and additional glutamyl residues are added serially via solid phase peptide synthesis using F-moc chemistry. After the final glutamyl residue is added the pemetrexed precursor is coupled to the peptide and the molecule is cleaved from the resin.
  • the disclosure provides a complex of a yPANTIFOL (e.g., a yPANTIFOL disclosed herein) and a therapeutic agent or a salt or acid thereof.
  • a yPANTIFOL e.g., a yPANTIFOL disclosed herein
  • a therapeutic agent or a salt or acid thereof e.g., a yPANTIFOL disclosed herein
  • the disclosure provides a complex of a yPANTIFOL according to any of [1]- [11] of the Detailed Description Section and a therapeutic agent or a salt or acid thereof.
  • the yPANTIFOL/complex comprise yPANTIFOL and a therapeutic agent.
  • the therapeutic agent is a cytotoxic compound such as a chemotherapeutic agent.
  • the yPANTIFOL/complex contains a platinum-based drug such as platinum-based chemotherapeutic agent (e.g., carboplatin and cisplatin).
  • the yPANTIFOL/complex contains a taxane-based chemotherapeutic agent (e.g., carboplatin and cisplatin).
  • the yPANTIFOL/complex contains a cyclodextrin.
  • the yPANTIFOL/complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [12] [67].
  • the yPANTIFOL/therapeutic agent complex comprises one or more yPANTIFOL containing 2-150, 2-100, 2-75, 2-50, 2-24, 2-30, 2-20, 2-19, 2-15, 2-10, or 2-5, glutamyl groups.
  • the yPANTIFOL/therapeutic agent complex comprises one or more yPANTIFOL containing 3-10, 3-9, 3-8, or 3-7, glutamyl groups, or any range therein between.
  • the yPANTIFOL/therapeutic agent complex comprises one or more yPANTIFOL containing 4-10, 4-9, 4-8, 4-7, 4-6, or 4-5, glutamyl groups, or any range therein between.
  • the complex comprises one or more yPANTIFOL containing 3-10 glutamyl groups. In further embodiments, the yPANTIFOL/therapeutic agent complex comprises one or more yPANTIFOL containing 3-7 glutamyl groups. In another embodiment, the yPANTIFOL/therapeutic agent complex comprises one or more yPANTIFOL containing 5 glutamyl groups. In another embodiment, the yPANTIFOL/therapeutic agent complex comprises one or more yPANTIFOL containing 6 glutamyl groups.
  • the therapeutic agent is a cytotoxic compound or a salt or acid thereof. In a further embodiment, the therapeutic agent is a chemotherapeutic agent or a salt or acid thereof.
  • the therapeutic agent is a platinum-based drug. In another embodiment, the therapeutic agent is a taxane-based drug. In additional embodiments, the molar ratio of yPANTIFOL/therapeutic agent in the complex is in the range 1-10:1. In some embodiments, the molar ratio of yPANTIFOL/therapeutic agent in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7: 1, or 10:1. In some embodiments, the yPANTIFOL/therapeutic agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the molar ratio of yPANTIFOL/therapeutic agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1: 17, 1:18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the molar ratio of yPANTIFOL/therapeutic agent in the complex is: 1:1, 2:1, 3:1, 4: 1, 5: 1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11:1, 12:1, 13: 1, 14: 1, 15:1, 16:1, 17: 1, 18: 1, 19:1, 20:1, (21-50): 1, or >50: 1.
  • the yPANTIFOL/therapeutic agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the liposome is a Lp-aPANTIFOL according to any of [12]-[67] of the Detailed Description Section.
  • the yPANTIFOL complex comprises yPANTIFOL and cyclodextrin.
  • the yPANTIFOL complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed Description Section.
  • the yPANTIFOL complex comprises an Antifolate described in Section I.
  • the molar ratio of yPANTIFOL (e.g., yPANTIFOL salt)/cyclodextrin in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPANTIFOL/cyclodextrin in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/cyclodextrin in the complex is in the range 2-8: 1, or any range therein between. In some embodiments, the molar ratio of yPANTIFOL/cyclodextrin in the complex is: 1, 2:1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12:1, 13:1, 14: 1, 15: 1, 16: 1, 17:1, 18:1, 19: 1, or 20: 1.
  • the molar ratio of yPANTIFOL/cyclodextrin in the complex is: 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10: 1, 11:1, 12: 1, 13: 1, 14:1, 15:1, 16: 1, 17:1, 18:1, 19: 1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPANTIFOL/cyclodextrin in the complex is in the range 1: 1- 20, 1: 1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPANTIFOL/cyclodextrin in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of yPANTIFOL/cyclodextrin in the complex is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1: 17, 1:18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the yPANTIFOL/ cyclodextrin complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the liposome is a Lp- aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a composition comprising a g P A N T I F O L/p 1 a t i n u m - b a s ed chemotherapeutic agent complex.
  • the complex comprises a yPANTIFOL according to any of [l]-[ 11] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the platinum-based chemotherapeutic agent is selected from: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof.
  • the yPANTIFOL/platinum-based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the molar ratio of yPANTIFOL/platinum-based agent in the complex is in the range 1-20:1, or any range therein between. In some embodiments, the molar ratio of yPANTIFOL/platinum- based agent in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/platinum-based agent in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPANTIFOL/platinum-based agent in the complex is 11: 1, 2:1, 3: 1, 4:1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11:1, 12: 1, 13: 1, 14: 1, 15:1, 16:1, 17:1, 18: 1, 19: 1, or 20:1.
  • the molar ratio of yPANTIFOL/platinum-based agent in the complex is 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7:1, 8:1, 9: 1, 10:1, 11: 1, 12:1, 13: 1, 14: 1, 15:1, 16: 1, 17:1, 18: 1, 19:1, 20: 1, (21-50):1, or >50:1.
  • the molar ratio of yPANTIFOL/ platinum-based chemotherapeutic agent in the complex is in the range 1:1-20, 1: 1-10, or 1:2-8, or any range therein between. In some embodiments, the molar ratio of yPANTIFOL/ platinum-based agent in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1: 12, 1:13, 1: 14, 1: 15, 1:16, 1: 17, 1:18, 1:19, or 1:20.
  • the molar ratio of yPANTIFOL/ platinum-based agent in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(21-50), or 1 :>50.
  • the yPANTIFOL//platinum- based agent complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [12]-[67] of the Detailed Description Section.
  • the yPANTIFOL/platinum-based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the molar ratio of yPANTIFOL/platinum-based analog in the complex is in the range 1-20: 1, or any range therein between.
  • the molar ratio of yPANTIFOL/platinum-based analog in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/platinum-based agent in the complex is in the range 2-8: 1, or any range therein between. In some embodiments, the molar ratio of yPANTIFOL/platinum-based analog in the complex is 11:1, 2: 1, 3:1, 4: 1, 5: 1, 6:1, 7: 1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20: 1.
  • the molar ratio of yPANTIFOL/platinum-based analog in the complex is 11 :1, 2:1, 3: 1, 4:1, 5:1, 6: 1, 7:1, 8:1, 9:1, 10: 1, 11:1, 12: 1, 13:1, 14: 1, 15: 1, 16:1, 17: 1, 18:1, 19: 1, 20:1, (21-50):1, or >50: 1.
  • the molar ratio of yPANTIFOL/ platinum-based agent in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of yPANTIFOL/ platinum-based agent in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(21-50), or 1 :>50.
  • the yPANTIFOL//platinum- based analog complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [12]-[67] of the Detailed Description Section.
  • the disclosure provides a complex containing yPANTIFOL and cisplatin or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section.
  • the yPANTIFOL complex comprises an Antifolate described in Section I.
  • the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is in the range 1-20: 1, or any range therein between.
  • the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of yPANTIFOL/ cisplatin (or cisplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1:19, or 1:20.
  • the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5: 1, 6:1, 7: 1, 8: 1, 9:1, 10:1, 11:1, 12:1, 13: 1, 14: 1, 15:1, 16: 1, 17: 1, 18:1, 19: 1, 20:1, (2l-50):l, or >50: 1.
  • the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1:17, 1:18, 1: 19, or 1:20.
  • the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(21-50), or l:>50.
  • the yPANTIFOL//cisplatin (or cisplatin salt or acid) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a complex containing yPANTIFOL and carboplatin or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I, herein.
  • the molar ratio of yPANTIFOL/carboplatin (or carboplatin salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPANTIFOL/carboplatin (or carboplatin salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/carboplatin (or carboplatin salt or acid) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of yPANTIFOL/ carboplatin (or carboplatin salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5: 1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12:1, 13:1, 14:1, 15: 1, 16: 1, 17: 1, 18: 1, 19:1, or 20:1.
  • the molar ratio of yPANTIFOL/ carboplatin (or carboplatin salt or acid) in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19:1, 20: 1, (2l-50):l, or >50:1.
  • the molar ratio of yPANTIFOL/carboplatin in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1: 14, 1:15, 1:16, 1:17, 1: 18, 1: 19, or 1:20.
  • the molar ratio of yPANTIFOL/carboplatin in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1:12, 1:13, 1: 14, 1:15, 1: 16, 1:17, 1: 18, 1: 19, 1:20, l:(2l-50), or 1:>50.
  • the yPANTIFOL/carboplatin (or carboplatin salt or acid) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a complex containing yPANTIFOL and oxaliplatin, or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the molar ratio of yPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/ oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of yPANTIFOL/ oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1: 12, 1:13, 1:14, 1:15, 1: 16, 1: 17, 1: 18, 1:19, or 1:20.
  • the molar ratio of yPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19:1, 20: 1, (2l-50):l, or >50:1.
  • the molar ratio of yPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1: 12, 1:13, 1:14, 1:15, 1: 16, 1: 17, 1: 18, 1:19, or 1:20.
  • the molar ratio of yPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(21-50), or 1:>50.
  • the yPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a complex comprising yPANTIFOL and a platinum-based chemotherapeutic agent (platinum) selected from: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • platinum-based chemotherapeutic agent platinum-based chemotherapeutic agent selected from: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin
  • the yPANTIFOL/platinum-based chemotherapeutic agent complex comprises an analog of nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, or dedaplatin, or a salt or acid thereof.
  • the molar ratio of yPANTIFOL/platinum-based chemotherapeutic agent (“platinum”)(or platinum-based chemotherapeutic agent salt or acid) in the complex is in the range 1-20: 1, or any range therein between.
  • the complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the molar ratio of yPANTIFOL/platinum (or platinum salt or acid) in the complex is in the range 1-10:1, or any range therein between.
  • the molar ratio of yPANTIFOL/platinum (or platinum salt or acid) in the complex is in the range 2-8: 1, or any range therein between. In some embodiments, the molar ratio of yPANTIFOL/platinum (or platinum salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9:1, 10:1, 11: 1, 12:1, 13: 1, 14:1, 15: 1, 16: 1, 17:1, 18: 1, 19:1, or 20: 1.
  • the molar ratio of yPANTIFOL/platinum (or platinum salt or acid) in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19:1, 20: 1, (21-50): 1, or >50:1.
  • the molar ratio of yP ANT I FO L/p 1 at i n u m (or platinum salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1:12, 1: 13, 1:14, 1: 15, 1:16, 1: 17, 1:18, 1: 19, or 1:20.
  • the molar ratio of yPANTIFOL/platinum (or platinum salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(21-50), or 1:>50.
  • the yPANTIFOL/platinum (or salt or acid or analog thereof) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a composition comprising a yPANTIFOL/taxane-based chemotherapeutic agent (taxane) complex.
  • the complex comprises a yPANTIFOL according to any of [l]-[l 1] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the taxane -based chemotherapeutic agent is selected from: paclitaxel (PTX), docetaxel (DTX), larotaxel (LTX), and cabazitaxel (CTX), or a salt or acid thereof.
  • the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in the complex in the complex is in the range 1-20:1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, 8:1, 9:1, 10: 1, 11:1, 12: 1, 13:1, 14: 1, 15:1, 16:1, 17:1, 18:1, 19: 1, or 20: 1.
  • the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5: 1, 6:1, 7: 1, 8:1, 9:1, 10: 1, 11: 1, 12: 1, 13: 1, 14: 1, 15:1, 16:1, 17:1, 18:1, 19:1, 20: 1, (21-50): 1, or >50: 1.
  • the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.
  • the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1: 12, 1:13, 1: 14, 1: 15, 1: 16, 1: 17, 1: 18, 1: 19, 1:20, l:(2l-50), or l:>50.
  • the yPANTIFOL/taxane (or taxane salt or acid) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a complex comprising yPANTIFOL and paclitaxel (PTX), or a salt or acid thereof.
  • the yPANTIFOL/paclitaxel (or paclitaxel salt or acid) chemotherapeutic agent complex comprises an analog of paclitaxel (PTX), or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1-20: 1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7:1, 8: 1, 9: 1, 10: 1, 11:1, 12:1, 13:1, 14: 1, 15: 1, 16: 1, 17: 1, 18:1, 19:1, or 20: 1.
  • the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19:1, 20: 1, (2l-50):l, or >50:1.
  • the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1:12, 1: 13, 1:14, 1: 15, 1:16, 1: 17, 1:18, 1: 19, or 1:20.
  • the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(2l-50), or 1:>50.
  • the yPANTIFOL/paclitaxel (or paclitaxel salt or acid) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a complex comprising yPANTIFOL and docetaxel (DTX), or a salt or acid thereof.
  • the yPANTIFOL/docetaxel complex comprises an analog of docetaxel (DTX), or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [1]- [11] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the molar ratio of yPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is in the range 1- 20:1, or any range therein between. In some embodiments, the molar ratio of yPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of yPANTIFOL/ docetaxel (or docetaxel salt or acid) in the complex is 1:1, 2: 1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, 8:1, 9:1, 10:1, 11: 1, 12:1, 13: 1, 14: 1, 15:1, 16:1, 17:1, 18: 1, 19: 1, or 20:1.
  • the molar ratio of yPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5:1, 6: 1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13: 1, 14: 1, 15:1, 16: 1, 17: 1, 18:1, 19: 1, 20:1, (2l-50):l, or >50: 1.
  • the molar ratio of yPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1:13, 1: 14, 1: 15, 1:16, 1: 17, 1: 18, 1:19, or 1:20.
  • the molar ratio of yPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(2l-50), or 1 :>50.
  • the yPANTIFOL/docetaxel (or docetaxel salt or acid) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a complex comprising yPANTIFOL and larotaxel (LTX), or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the molar ratio of yPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/ larotaxel (or larotaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5: 1, 6:1, 7:1, 8: 1, 9: 1, 10: 1, 11:1, 12:1, 13:1, 14: 1, 15: 1, 16: 1, 17: 1, 18:1, 19:1, or 20: 1.
  • the molar ratio of yPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is 1: 1, 2: 1, 3:1, 4: 1, 5:1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19: 1, 20:1, (2l-50): l, or >50: 1.
  • the molar ratio of yPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1:12, 1: 13, 1:14, 1: 15, 1:16, 1: 17, 1:18, 1: 19, or 1:20.
  • the molar ratio of g P A N T I F O L/ 1 a r o t a x e 1 (or larotaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1: 19, 1:20, l:(21-50), or l:>50.
  • the yPANTIFOL/larotaxel (or larotaxel salt or acid) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a complex comprising yPANTIFOL and cabazitaxel (CTX), or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [l]-[ 11] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • the molar ratio of yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is 1:1, 2: 1, 3:1, 4:1, 5: 1, 6:1, 7: 1, 8: 1, 9:1, 10:1, 11:1, 12:1, 13: 1, 14: 1, 15:1, 16:1, 17: 1, 18: 1, 19: 1, or 20:1.
  • the molar ratio of yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is 1: 1, 2:1, 3:1, 4:1, 5: 1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11: 1, 12:1, 13:1, 14: 1, 15: 1, 16:1, 17:1, 18:1, 19: 1, 20:1, (21- 50):l, or >50:1.
  • the molar ratio of yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.
  • the molar ratio of yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1:14, 1: 15, 1:16, 1: 17, 1: 18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [l2]-[67] of the Detailed Description Section.
  • the disclosure provides a complex comprising yPANTIFOL and another anti-metabolite, or a salt or acid thereof.
  • the complex comprises a yPANTIFOL according to any of [l]-[ 11] of the Detailed Description Section.
  • the yPANTIFOL complex comprises a polyglutamated Antifolate described in Section I.
  • An anti-metabolite is a chemical with a structure that is similar to a metabolite required for normal biochemical reactions, yet different enough to interfere with one or more normal functions of cells, such as cell division.
  • the disclosure provides a complex comprising yPANTIFOL and Antifolate (ANTIFOL), or a salt or acid thereof.
  • the disclosure provides a complex comprising yPANTIFOL and an anti-metabolite selected from, gemcitabine, fluorouracil, capecitabine, an antifolate (e.g., Antifolate, raltitrexed), tegafur, cytosine arabinoside, thioguanine, 5-azacytidine, 6-mercaptopurine, azathioprine, 6-thioguanine, pentostatin, fludarabine phosphate, and cladribine, as well as pharmaceutically acceptable salt or acids, acids, or derivatives of any of these.
  • an anti-metabolite selected from, gemcitabine, fluorouracil, capecitabine, an antifolate (e.g., Antifolate, raltitrexed), tegafur, cytosine arabinoside, thioguanine, 5-azacytidine, 6-mercaptopurine, azathioprine, 6-thioguanine, pentostat
  • the molar ratio of yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the complex is in the range 1-20: 1, or any range therein between. In further embodiments, the molar ratio of yP ANT IFO L/ant i - rnctabo 1 i tc (or anti-metabolite salt or acid, or prodrug) in the complex is in the range 1-10: 1, or any range therein between. In further embodiments, the molar ratio of yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the complex is in the range 2-8: 1, or any range therein between.
  • the molar ratio of yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the complex is 1:1, 2:1, 3:1, 4: 1, 5:1, 6: 1, 7:1, 8:1, 9: 1, 10:1, 11:1, 12: 1, 13:1, 14:1, 15: 1, 16:1, 17:1, 18: 1, 19:1, or 20:1.
  • the molar ratio of yPANTIFOL/anti-metabolite (or anti metabolite salt or acid, or prodrug) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11:1, 12:1, 13: 1, 14: 1, 15: 1, 16: 1, 17:1, 18:1, 19:1, 20:1, (21-50): 1, or >50:1.
  • the molar ratio of yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1:13, 1: 14, 1:15, 1: 16, 1: 17, 1:18, 1:19, or 1:20.
  • the molar ratio of yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1 : 13, 1:14, 1:15, 1: 16, 1: 17, 1:18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the yPANTIFOL/anti-metabolite (or anti metabolite salt or acid, or prodrug) complex is encapsulated in a liposome.
  • the liposome is a Lp-aPANTIFOL according to any of [12]-[67] of the Detailed Description Section.
  • the disclosure provides a complex of yPANTIFOL (e.g., a yPANTIFOL disclosed herein) and a cyclodextrin.
  • Cyclodextrins are groups of cyclic oligosaccharides which have been shown to improve physicochemical properties of many drugs through formation of complexes.
  • CDs are cyclic oligosaccharides composed of several D-glucose units linked by a-(l,4) bonds. This cyclic configuration provides a hydrophobic internal cavity and gives the CDs a truncated cone shape. Many hydroxyl groups are situated on the edges of the ring which make the CDs both lipophilic and soluble in water.
  • the complex comprises a yPANTIFOL according to any of [l]-[ 11] of the Detailed Description Section.
  • cyclodextrin refer generally to a parent or derivatized cyclic oligosaccharide containing a variable number of (a- l,4)-linked D-glucopyranoside units that is able to form a complex with a Antifolate-PG.
  • Each cyclodextrin glucopyranoside subunit has secondary hydroxyl groups at the 2 and 3 positions and a primary hydroxyl group at the 6-position.
  • cyclodextrin refer to a cyclodextrin containing D-glucopyranoside units having the basic formula C6H1206 and a glucose structure without any additional chemical substitutions (e.g ., a-cyclodextrin consisting of 6 D-glucopyranoside units, a b-cyclodextrin consisting of 7 D- glucopyranoside units, and a g-cyclodextrin cyclodextrin consisting of 8 D-glucopyranoside units).
  • the physical and chemical properties of a parent cyclodextrin can be modified by derivatizing the hydroxyl groups with other functional groups. Any substance located within the cyclodextrin internal phase is said to be "complexed" with the cyclodextrin, or to have formed a complex (inclusion complex) with the cyclodextrin.
  • the cyclodextrin component of the gR A NT I F O L/c yc 1 odcx t ri n complexes so long as the cyclodextrins can form complexes with the yPANTIFOL.
  • the cyclodextrins have been derivatized to bear ionizable (e.g. , weakly basic and/or weakly acidic) functional groups to facilitate complex formation with yPANTIFOL and/or liposome encapsulation.
  • cyclodextrins such as those facing away from the cyclodextrin interior phase, with ionizable chemical groups is known to facilitate the loading of cyclodextrins and therapeutic agents complexed with the cyclodextrins.
  • the cyclodextrin of the yPANTIFOL/cyclodextrin complex has at least 2, 3, 4, 5, 6, 6, 7, 8, 9, or 10, hydroxyl group substituted with an ionizable chemical group.
  • charged cyclodextrin refers to a cyclodextrin having one or more of its hydroxyl groups substituted with a charged moiety.
  • Such a moiety can itself be a charged group or it can comprise an organic moiety (e.g., a C1-C6 alkyl or C1-C6 alkyl ether moiety) substituted with one or more charged moieties.
  • the "ionizable" or “charged" moieties of a CD derivative are weakly ionizable.
  • Weakly ionizable moieties are those that are either weakly basic or weakly acidic.
  • Weakly basic functional groups (W) have a pKa of between about 6.0-9.0, 6.5-8.5, 7.0- 8.0, 7.5-8.0, and any range in between inclusive according to CH3-W.
  • weakly acidic functional groups (X) have a log dissociation constant (pKa) of between about 3.0-7.0, 4.0- 6.5, 4.5-6.5, 5.0-6.0, 5.0-5.5, and any range in between inclusive according to CH3-X.
  • anionic moieties include, without limitation, carboxylate, carboxymethyl, succinyl, sulfonyl, phosphate, sulfoalkyl ether, sulphate carbonate, thiocarbonate, dithiocarbonate, phosphate, phosphonate, sulfonate, nitrate, and borate groups.
  • Representative cationic moieties include, without limitation, amino, guanidine, and quartemary ammonium groups.
  • the derivatized cyclodextrin is a "polyanion” or "polycation.”
  • a polyanion is a derivatized cyclodextrin having more than one negatively charged group resulting in net a negative ionic charge of more than two units.
  • a polycation is a derivatized cyclodextrin having more than one positively charged group resulting in net positive ionic charger of more than two units.
  • the derivatized cyclodextrin is a "chargeable amphiphile.”
  • chargeable is meant that the amphiphile has a pK in the range pH 4 to pH 8 or 8.5.
  • a chargeable amphiphile may therefore be a weak acid or base.
  • amphoteric herein is meant a derivatized cyclodextrin having a ionizable groups of both anionic and cationic character wherein: (a) at least one, and optionally both, of the cation and anionic amphiphiles is chargeable, having at least one charged group with a pK between 4 and 8 to 8.5, (b) the cationic charge prevails at pH 4, and (c) the anionic charge prevails at pH 8 to 8.5.
  • the "ionizable" or “charged” derivatized cyclodextrin as a whole, whether polyionic, amphiphilic, or otherwise, are weakly ionizable (i.e., have a pKai of between about 4.0-8.5, 4.5-8.0, 5.0-7.5, 5.5-7.0, 6.0-6.5, and any range in between inclusive).
  • Any one, some, or all hydroxyl groups of any one, some or all a-D-glucopyranoside units of a cyclodextrin can be modified to an ionizable chemical group as described herein. Since each cyclodextrin hydroxyl group differs in chemical reactivity, reaction with a modifying moiety can produce an amorphous mixture of positional and optical isomers. Alternatively, certain chemistry can allow for pre-modified a-D-glucopyranoside units to be reacted to form uniform products.
  • the aggregate substitution that occurs for cyclodextrin derivatives in a mixture is described by a term referred to as the degree of substitution.
  • a 6-ethylenediamino- b-cyclodextrin with a degree of substitution of seven would be composed of a distribution of isomers of 6-ethylenediamino-p-cyclodextrin in which the average number of ethylenediamino groups per 6-cthylcncdiamino-p-cyclodcxtrin molecule is seven.
  • the degree of substitution for a cyclodextrin derivative mixture can routinely be determined using mass spectrometry or nuclear magnetic resonance spectroscopy.
  • At least one hydroxyl moieties facing away from the cyclodextrin interior is substituted with an ionizable chemical group.
  • the C2, C3, C6, C2 and C3, C2 and C6, C3 and C6, and all three of C2-C3-C6 hydroxyls of at least one a-D- glucopyranoside unit are substituted with an ionizable chemical group.
  • Any such combination of hydroxyls can similarly be combined with at least two, three, four, five, six, seven, eight, nine, ten, eleven, up to all of the alpha-D-glucopyranoside units in the modified cyclodextrin as well as in combination with any degree of substitution described herein.
  • SAE-CD sulfoalkyl ether cyclodextrin
  • SBE-P-CD beta cyclodextrin
  • Additional cyclodextrin derivatives that may be complexed with therapeutic agents in the disclosed liposome compositions include sugammadex or Org-25969, in which the 6- hydroxy groups on g-CD have been replaced by carboxythio acetate ether linkages, and h y n x y b u t c n y 1 - b - C D .
  • cyclodextrin examples include: 2,6-Di-O-methyl-P-CD (DIMEB), 2-hydroxylpropyl-3-cyclodextrin (HR-b-CD), randomly methylated-P-cyclodextrin (RAMEB), sulfobutyl ether b -cyclodextrin (SBE-P-CD), and sulfobutylether-y-cyclodextrin (SBEyCD), sulfobutylated beta-cyclodextrin sodium salt, (2-Hydroxypropyl)-alpha- cyclodextrin, (2-Hydroxypropyl)-beta-cyclodextrin, (2-Hydroxy-propyl)-y-cyclodextrin, 2,6- di-0-methyl)-beta-cyclodextrin (DIMEB-50 Heptakis), 2,3,6-tri-0-methyl)-beta-cyclodext
  • the cyclodextrin(s) has a high solubility in water in order to facilitate entrapment of a larger amount of the cyclodextrin in the liposome internal phase.
  • the water solubility of the cyclodextrin is at least 10 mg/mL, 20 mg/mL, 30 mg/mL, 40 mg/mL, 50 mg/mL, 60 mg/mL, 70 mg/mL, 80 mg/mL, 90 mg/mL, 100 mg/mL or higher.
  • the water solubility of the cyclodextrin(s) is within a range of 10-150 mg/mL, 20-100 mg/mL 20-75 mg/mL, and any range in between inclusive.
  • a large association constant between the cyclodextrin and the yPANTIFOL and/or other therapeutic agent complexed with cyclodextrin is preferable and can be obtained by selecting the number of glucose units in the cyclodextrin based on the size of the therapeutic agent (see, for example, Albers et al., Crit. Rev. Therap. Drug Carrier Syst. 12:311-337 (1995); Stella et al., Toxicol. Pathol. 36:30-42 (2008).
  • the association constant depends on pH
  • the cyclodextrin can be selected such that the association constant becomes large at the pH of the liposome internal phase.
  • the solubility (nominal solubility) of the therapeutic agent in the presence of cyclodextrin can be further improved.
  • the association constant of the cyclodextrin with the therapeutic agent is 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, or higher.
  • the association constant of the cyclodextrin with the therapeutic agent is in the range 100-1, 200, 200-1,000, 300-750, and any range therein between.
  • the cyclodextrin of the g P A N T I F O L/c y c 1 o dextrin complex and/or cyclodextrin/therapeutic agent complex is underivatized.
  • the cyclodextrin of the g P A N T I F O L/c y c 1 o dc x t r i n complex and/or cyclodextrin/therapeutic agent complex is derivatized.
  • the cyclodextrin derivative of the complex has the structure of Formula I:
  • n 4, 5, or 6; wherein Ri, R 2 , R 3 , R4, R5, R6, R7, Rs, and R9 are each, independently, -H, a straight chain or branched Ci-Cs- alkylene group, or an optionally substituted straight-chain or branched Ci- Co group, wherein at least one of Ri, R 2 , R3, R4, Rs, R 6 , R7, Rs and R9 is a straight-chain or branched Ci-C 8- alkylene (e.g., Ci-C 8- (alkylene)-S0 3 group);
  • the cyclodextrin derivative of the yPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex has the structure of Formula II:
  • n 4, 5, or 6;
  • Ri, R 2 , R 3 , R4, Rs, R 6 , R7, Rs, and R9 are each, independently, -O- or a -0-(C 2 -C 6 alkylene)-S0 3 - group; wherein at least one of Ri and R 2 is independently a -0-(C 2 -C 6 alkylene)- S0 3 group; and Si, S 2 , S 3 , S4, S 5 , S 6 , S7, Ss, and S9 are each, independently, a pharmaceutically acceptable cation.
  • the pharmaceutically acceptable cation is selected from: an alkali metal such as Li + , Na + , or K + ; an alkaline earth metal such as Ca +2 , or Mg +2 and ammonium ions and amine cations such as the cations of (C1-C6)- alkylamines, piperidine, pyrazine, (Cl-C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • an alkali metal such as Li + , Na + , or K +
  • an alkaline earth metal such as Ca +2 , or Mg +2
  • ammonium ions and amine cations such as the cations of (C1-C6)- alkylamines, piperidine, pyrazine, (Cl-C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • At least one of Rl and R2 is independently a -0-(C2-C6 alkylene)-S03- group that is a -0-(CH 2 ) m S03- group, wherein m is 2 to 6, preferably 2 to 4, (e.g., -O- CH2CH2CH2S03- or -O-CH2CH2CH2CH2S03 -); and Si, S 2 , S 3 , S 4 , Ss, S 6 , S 7 , Ss, and S 9 are each, independently, H or a pharmaceutically cation which includes for example, alkali metals (e.g., Li + , Na + , K + ) alkaline earth metals (e.g., Ca +2 , Mg +2 ), ammonium ions and amine cations such as the cations of (Cl-C6)-alkylamines, piperidine, pyrazine, (Ci-C 6 )-alkanol
  • a cyclodextrin derivative of the g PA NT I FO L/c y c I ode x t ri n complex and/or cyclodextrin/therapeutic agent complex is a cyclodextrin disclosed in U.S. Pat. Nos. 6,133,248, 5,874,418, 6,046,177, 5,376,645, 5,134,127, 7,034,013, 6,869,939; and Inti. Appl. Publ. No. WO 02005/117911, the contents each of which is herein incorporated by reference in its priority.
  • the cyclodextrin derivative of the yPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is a sulfoalkyl ether cyclodextrin.
  • the cyclodextrin derivative of complex is a sulfobutyl ether-3 -cyclodextrin such as CAPTISOL® (CyDex Pharma. Inc., Lenexa, Kansas). Methods for preparing sulfobutyl ether-3- cyclodextrin and other sulfoalkyl ether cyclodextrins are known in the art.
  • the cyclodextrin derivative in of the gR A NT I FO L/c y c 1 odex t ri n complex and/or cyclodextrin/therapeutic agent complex is a compound of Formula III:
  • the yPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides yPANTIFOL delivery systems and their use to deliver a payload of yPANTIFOL to a cell or cells in vitro or in vivo.
  • yPANTIFOL is complexed with or incorporated into a delivery vehicle.
  • Such delivery vehicles include, but are not limited to, liposomes, lipospheres, polymers, peptides, proteins, antibodies (e.g., ADCs such as Antibody- yPANTIFOL conjugates), cellular components, cyclic oligosaccharides (e.g., cyclodextrins), nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles), lipoprotein particles, and combinations thereof.
  • the delivery vehicle is a liposome.
  • the delivery vehicle is an antibody or an antigen binding antibody fragment.
  • the yPANTIFOL delivery system comprises a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section.
  • the disclosure provides liposomal compositions that comprise a liposome encapsulating ⁇ i.e., filled with) a gamma polyglutamated Antifolate (e.g., a yPANTIFOL disclosed herein).
  • a gamma polyglutamated Antifolate e.g., a yPANTIFOL disclosed herein.
  • the liposomal composition comprises a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section.
  • the liposomal composition comprises a polyglutamated Antifolate described in Section I.
  • the liposome is a liposome according to any of [l2]-[67] of the Detailed Description Section.
  • a liposome in the liposomal composition comprises a yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups (including the glutamyl group of the Antifolate).
  • the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate in the Lp- yPANTIFOL comprises a glutamyl group in the D-form.
  • the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In additional embodiments, the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl groups that have a gamma carboxyl linkage. In some embodiments, the liposomal composition comprises a liposome comprising a y pentaglutamated Antifolate.
  • the liposome comprises an L-g pentaglutamated Antifolate, a D-g pentaglutamated Antifolate, or an L- and D-g pentaglutamated Antifolate.
  • the liposomal composition comprises a liposome comprising a y hexaglutamated Antifolate (Lp-yPANTIFOL).
  • the liposome comprises an L-g hexaglutamated Antifolate, a D-y hexaglutamated Antifolate, or an L- and D-g hexaglutamated Antifolate.
  • the liposomal composition comprises a liposome that is anionic or neutral.
  • the liposomal composition comprises a liposome that is cationic. In some embodiments, the Lp-yPANTIFOL composition is not pegylated. In some embodiments, the Lp-yPANTIFOL composition is non-targeted (NTLp-yPANTIFOL). In other embodiments, the Lp-yPANTIFOL composition comprises a targeting moiety (TLp-yPANTIFOL). In some embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 500 nm, or any range therein between.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 400 nm, or any range therein between. In some embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 200 nm, or any range therein between. In further embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 150 nm, or any range therein between. In further embodiments, the liposomal composition comprises a liposome having a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the Lp-yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma polyglutamated Antifolate.
  • the provided liposomes further comprise an immuno stimulatory agent, a detectable marker, or both disposed on its exterior.
  • the immuno stimulatory agent or detectable marker can be ionically bonded or covalently bonded to an exterior of the liposome, including, for example, optionally to a steric stabilizer component of the liposome.
  • immuno stimulatory agents also known as“immunostimulants”, and “immunostimulators”, refer to substances that stimulate an immune (including a preexisting immune response) by inducing activation or increasing activity of any of the components of the immune system.
  • immuno stimulatory agents can include one or more of a hapten, an adjuvant, a protein immunostimulating agent, a nucleic acid immunostimulating agent, and a chemical immunostimulating agent.
  • Many adjuvants contain a substance designed to stimulate immune responses, such as lipid A, Bortadella pertussis or Mycobacterium tuberculosis derived proteins.
  • adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.); AS-2 (SmithKline Beecham, Philadelphia, Pa.); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and quil A; IFN-alpha, IFN-gamma, FLT3-ligand; and immunostimulatory antibodies (e.g., anti-CTLA-4, anti-CD28, anti-CD3).
  • adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laborator
  • Cytokines such as GM-CSF, interleukin-2, -7, -12, and -15, and other like growth factors, can also be used as adjuvants.
  • the immuno stimulant can be at least one selected from fluorescein, DNP, beta glucan, beta-l,3-glucan, beta-l,6-glucan.
  • the immunostimulant is a Toll-like receptor (TLR) modulating agent.
  • TLR Toll-like receptor
  • the Toll-like receptor (TLR) modulating agent is one or more of: OXPAC, PGPC, an eritoran lipid (e.g., E5564), and a resolvin.
  • the provided liposomes further comprise an agent, that increase uptake of liposomes into a cellular compartment of interest including the cytosol.
  • the agent provides the liposome contents with the ability to bypass lysosomes (e.g., chloroquine).
  • the agent improves the update of the liposome contents by mitochondria (e.g., sphingomyelin and a component of mitoport).
  • a detectable marker may, for example, include, at least, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator, an enzyme, a dye, an ink, a magnetic compound, a biocatalyst or a pigment that is detectable by any suitable means known in the art, e.g., magnetic resonance imaging (MRI), optical imaging, fluorescent/luminescent imaging, or nuclear imaging techniques.
  • MRI magnetic resonance imaging
  • the immunostimulatory agent and/or detectable marker is attached to the exterior by co-incubating it with the liposome.
  • the immunostimulatory agent and/or detectable marker may be associated with the liposomal membrane by hydrophobic interactions or by an ionic bond such as an avidin/biotin bond or a metal chelation bond (e.g., Ni-NTA).
  • the immunostimulatory agent or detectable marker may be covalently bonded to the exterior of the liposome such as, for example, by being covalently bonded to a liposomal component or to the steric stabilizer which is the PEG.
  • FITC fluorescein isothiocyanate
  • the liposomes further comprise an agent that increases the uptake of liposomes into a cellular compartment of interest including the cytosol.
  • the liposomes comprise a mitochondrial-targeting agent.
  • the liposomes comprise triphenylphosphonium (TPP).
  • TPP triphenylphosphonium
  • Methods and mechanisms for surface functionalizing liposomes with TPP are known in the art (e.g., attaching TPP to the lipid anchor via a peg spacer group and modifying TPP with a stearyl group (stearyl triphenylphosphonium (STPP)).
  • STPP stearyl triphenylphosphonium
  • the liposomes comprise high-density octa-arginine.
  • the liposomes comprise sphingomyelin and/or a sphingomyelin metabolite.
  • Sphingomyelin metabolite used to formulate the liposomes of the present invention can include, for example ceramide, sphingosine or sphingosine l-phosphate.
  • the liposomes comprise Rhodamine 123.
  • the liposomes comprise, a mitochondria penetrating peptide.
  • the liposomes comprise, a mitochondria penetrating agent selected from: a mitofusin peptide, a mitochondrial targeting signal peptide, and Antennapedia helix III homeodomain cell-penetrating peptide (ANT) (e.g., comprising RQIKIWFQNRRMK WKKRKKRRQRRR, RKKRRXRRRGC) , or a mitochondrial penetrating fragment thereof.
  • ANT Antennapedia helix III homeodomain cell-penetrating peptide
  • the liposomes comprise, a mitochondria penetrating polynucleotide sequence selected from: RQIKIWFQNRRMKWKKRKKRRQR RR (SEQ ID NO:l), RKKRRXR RRGC where X is any natural or non-natural amino acid (SEQ ID NO:2), CCGCCAAGAAGCG (SEQ ID NOG), GCGTGCACACGCGCGTA GACTTCCCCCGCAAGTCACTCGTTAGCCCGCCAAGAAGCGACCCCTCCGGGG CGAGCTGAGCGGCGTGGCGCGGGGGCGTCAT (SEQ ID NO:4), ACGTGCAT ACGCACGTAGACATTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATC CCGCTGAG CGGCGTGGCGCGGGGGCGTCATCCGTCAGCTC (SEQ ID NO:5), or ACTTCCCCCGCAAGTCACTCGTTAGCCCGCCAAGAAGCGACCCCTCCGGGGCG AGCTG (SEQ ID NO:6)),
  • liposomes in the provided liposome compositions comprise a mitochondria penetrating agent selected from the group: a guanidine-rich peptoid, tetraguanidinium, triguanidinium, diguanidinium, monoguanidinium, a guanidine-rich polycarbamate, a beta-oligoarginine, a proline-rich dendrimer, and a phosphonium salt (e.g., methyltriphenyl-phosphonium and/or tetraphenylphosphonium).
  • a mitochondria penetrating agent selected from the group: a guanidine-rich peptoid, tetraguanidinium, triguanidinium, diguanidinium, monoguanidinium, a guanidine-rich polycarbamate, a beta-oligoarginine, a proline-rich dendrimer, and a phosphonium salt (e.g., methyltriphenyl-phosphonium and
  • liposomes in the provided liposome compositions comprise sphingomyelin and/or stearyl-octa-arginine. In some embodiments, the liposomes comprise sphingomyelin and/or stearyl-octa-arginine. In some embodiments, the liposomes comprise DOPE, sphingomyelin, stearyl-octa-arginine sphingomyelin and stearyl-octa-arginine.
  • the liposomes comprise DOPE, sphingomyelin, stearyl-octa-arginine sphingomyelin and stearyl-octa-arginine at a molar ratio of 9:2: 1.
  • the liposomes comprise the MGGO-porter® system or a variant thereof.
  • liposomes in the provided liposome compositions comprise an agent such as a cell penetrating agent that that facilitates delivery of the liposome across a cell membrane and provides the liposome with the ability to bypass the endocytic pathway and the harsh environment of lysosomes.
  • Cell penetrating agents are known in the art and can routinely be used and adapted for manufacture and use of the provided liposome compositions.
  • the cell penetrating/lysosome bypassing agent is chloroquine.
  • the cell penetrating agent is a cell penetrating peptide.
  • liposomes in the provided liposome compositions comprise a cell penetrating agent selected from the group: RKKRRQRRR (SEQ ID NO:7), GRKKRRQRRRTPQ (SEQ ID NO:8), Y GRKKRRQRRR (SEQ ID NO:9), A AVAL LPAVLLALLA (SEQ ID NO: 10), MGLGLHLLVLAAALQ (SEQ ID NO: 11), GALFL GFLGAAGSTM (SEQ ID NO: 12), AGYLLGKINLKALAALAKKIL (SEQ ID NO: 13), RVIRVWFQNKRCKDKK (SEQ ID NO: 14), RQIKIWF QNRRMKWKK (SEQ ID NO: 15), GLFEAIAGFIENGWEGMIDG (SEQ ID NO: 16), GWTLN S AG YLLGKIN (SEQ ID NO: 17), RSQSRSRYYRQRQRS (SEQ ID NO:l8), LAIPEQEY (SEQ ID NO: 10
  • the liposomes may comprise a steric stabilizer that increase their longevity in circulation.
  • the steric stabilizer may be at least one member selected from polyethylene glycol (PEG), poly-L-lysine (PLL), monosialoganglioside (GM1), poly(vinyl pyrrolidone) (PVP), poly(acrylamide) (PAA), poly(2-methyl-2-oxazoline), poly(2-ethyl-2-oxazoline), phosphatidyl polyglycerol, poly[N-(2-hydroxypropyl) methacrylamide], amphiphilic poly-N-vinylpyrrolidones, L-amino- acid-based polymer, oligoglycerol, copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol.
  • PEG polyethylene glycol
  • PLL poly-L-lysine
  • GM1 monosialoganglioside
  • PVP poly
  • the steric stabilizer or the population of steric stabilizer is PEG.
  • the steric stabilizer is a PEG.
  • the PEG has a number average molecular weight (Mn) of 200 to 5000 daltons.
  • Mn number average molecular weight
  • These PEG(s) can be of any structure such as linear, branched, star or comb structure and are commercially available.
  • the disclosure provides liposomal compositions that comprise a pegylated liposome (PLp-yPANTIFOL).
  • the pegylated liposome comprises a yPANTIFOL according to any of [l]-[l 1] of the Detailed Description Section.
  • the pegylated liposome comprises a polyglutamated Antifolate described in Section I.
  • a pegylated liposome in the liposomal composition comprises a yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises a glutamyl group in the D-form.
  • the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the liposomal composition comprises a pegylated liposome that comprises a g tetraglutamated Antifolate.
  • the liposome comprises an L-g tetraglutamated Antifolate, a D-g tetraglutamated Antifolate, or an L- and D-g tetraglutamated Antifolate.
  • the liposomal composition comprises a pegylated liposome that comprises a g pentaglutamated Antifolate.
  • the liposome comprises an L-g pentaglutamated Antifolate, a D-g pentaglutamated Antifolate, or an L- and D-g pentaglutamated Antifolate.
  • the liposomal composition comprises a pegylated liposome comprising a g hexaglutamated Antifolate.
  • the liposome comprises an L-g hexaglutamated Antifolate, a D-g hexaglutamated Antifolate, or an L- and D-g hexaglutamated Antifolate.
  • the liposomal composition comprises a pegylated liposome according any of [23], and [25] -[64] of the Detailed Description.
  • the liposomal composition comprises a pegylated liposome that is anionic or neutral.
  • the liposomal composition comprises a pegylated liposome that is cationic.
  • the PLp-yPANTIFOL composition is non-targeted (NTPLp-yPANTIFOL).
  • the PLp- yPANTIFOL composition comprises a targeting moiety (TPLp-yPANTIFOL).
  • the liposomal composition comprises a pegylated liposome that comprises 30- 70%, 30-60%, or 30-50% liposome entrapped gamma polyglutamated Antifolate, or any range therein between.
  • the liposomal composition comprises a pegylated liposome that comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma polyglutamated Antifolate.
  • the liposomal composition comprises a pegylated liposome having a diameter in the range of 20 nm to 200 nm.
  • the liposomal composition comprises a pegylated liposome having a diameter in the range of 80 nm to 120 nm.
  • greater than 70%, 80% or 90% of the polyglutamated Antifolate in a provided liposomal composition is pentaglutamated. In some embodiments, greater than 70%, 80% or 90% of the polyglutamated Antifolate in a provided composition is hexaglutamated. In some embodiments, greater than 70%, 80% or 90% of the polyglutamated Antifolate in the composition has 4-10, 4-6, or more than 5, g-glutamyl groups.
  • greater than 30%, 40%, 50%, 60%, 70%, 80% or 90%, of the polyglutamated Antifolate in a provided liposomal composition is tetraglutamated. In some embodiments, greater than 30%, 40%, 50%, 60%, 70%, 80% or 90%, of the polyglutamated Antifolate in a provided liposomal composition is pentaglutamated. In some embodiments, greater than 30%, 40%, 50%, 60%, 70%, 80% or 90%, of the polyglutamated Antifolate in a provided liposomal composition is hexaglutamated.
  • the gamma polyglutamated Antifolate compositions are in an aqueous solution.
  • the polyglutamated Antifolate composition is administered in a liposomal composition at between about 0.005 and about 5000 mg/M2 (meter of body surface area squared), or between about 0.1 and about 1000 mg/M2, or any range therein between.
  • the yPANTIFOL composition is administered in a liposomal composition at about 1 mg/kg to about 500 mg/kg, 1 mg/kg to about 250 mg/kg, 1 mg/kg to about 200 mg/kg, 1 mg/kg to about 150 mg/kg, 1 mg/kg to about 100 mg/kg, 1 mg/kg to about 50 mg/kg, about 1 mg/kg to about 25 mg/kg, about 1 mg/kg to about 20 mg/kg, about 1 mg/kg to about 15 mg/kg, about 1 mg/kg to about 10 mg/kg, or about 1 mg/kg to about 5 mg/kg, or any range therein between.
  • Liposome composition [00225]
  • the lipids and other components of the liposomes contained in the liposomal compositions can be any lipid, lipid combination and ratio, or combination of lipids and other liposome components and their respective ratios known in the art.
  • liposomal encapsulation of any particular drug such as, and without limitation, the gamma polyglutamated Antifolate discussed herein, may involve substantial routine experimentation to achieve a useful and functional liposomal formulation.
  • the provided liposomes may have any liposome structure, e.g., structures having an inner space sequestered from the outer medium by one or more lipid bilayers, or any microcapsule that has a semi-permeable membrane with a lipophilic central part where the membrane sequesters an interior.
  • the lipid bilayer can be any arrangement of amphiphilic molecules characterized by a hydrophilic part (hydrophilic moiety) and a hydrophobic part (hydrophobic moiety).
  • amphiphilic molecules in a bilayer are arranged into two dimensional sheets in which hydrophobic moieties are oriented inward the sheet while hydrophilic moieties are oriented outward.
  • Amphiphilic molecules forming the provided liposomes can be any known or later discovered amphiphilic molecules, e.g., lipids of synthetic or natural origin or biocompatible lipids.
  • the liposomes can also be formed by amphiphilic polymers and surfactants, e.g., polymerosomes and niosomes.
  • these liposome-forming materials also are referred to as "lipids".
  • the liposome composition formulations provided herein can be in liquid or dry form such as a dry powder or dry cake.
  • the dry powder or dry cake may have undergone primary drying under, for example, lyophilization conditions or optionally, the dry cake or dry powder may have undergone both primary drying only or both primary drying and secondary drying.
  • the powder or cake may, for example, have between 1% to 6% moisture, for example, such as between 2% to 5% moisture or between 2% to 4% moisture.
  • One example method of drying is lyophilization (also called freeze-drying, or cyrodessication).
  • compositions and methods of the disclosure may include liposomes, lyophilized liposomes or liposomes reconstituted from lyophilized liposomes.
  • the disclosed compositions and methods include one or more lyoprotectants or cryoprotectants. These protectants are typically polyhydroxy compounds such as sugars (mono-, di-, and polysaccharides), polyalcohols, and their derivatives, glycerol, or polyethyleneglycol, trehalose, maltose, sucrose, glucose, lactose, dextran, glycerol, or aminoglycosides.
  • the lyoprotectants or cryoprotectants comprise up to 10% or up to 20% of a solution outside the liposome, inside the liposome, or both outside and inside the liposome.
  • the liposomes include a steric stabilizer that increases their longevity in circulation.
  • a steric stabilizer such as a hydrophilic polymer (Polyethylene glycol (PEG)), a glycolipid (monosialoganglioside (GM1)) or others occupies the space immediately adjacent to the liposome surface and excludes other macromolecules from this space. Consequently, access and binding of blood plasma opsonins to the liposome surface are hindered, and thus interactions of macrophages with such liposomes, or any other clearing mechanism, are inhibited and longevity of the liposome in circulation is enhanced.
  • PEG Polyethylene glycol
  • GM1 glycolipid
  • the steric stabilizer or the population of steric stabilizers is a PEG or a combination comprising PEG.
  • the steric stabilizer is a PEG or a combination comprising PEG with a number average molecular weight (Mn) of 200 to 5000 daltons.
  • Mn number average molecular weight
  • These PEG(s) can be of any structure such as linear, branched, star or comb structure and are commercially available.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 150 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a yPANTIFOL according to any of [ 1 ] - [ 11] of the Detailed Description Section and has a diameter in the range of 20 nm to 150 nm.
  • the liposome is a liposome composition according to any of [12]- [67] of the Detailed Description Section and has a diameter in the range of 20 nm to 150 nm.
  • the liposomal composition comprises a liposome having a diameter in the range of 30 nm to 150 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section and has a diameter in the range of 30 nm to 150 nm.
  • the liposome is a liposome composition according to any of [12]- [67] of the Detailed Description Section and has a diameter in the range of 30 nm to 150 nm, or any range therein between.
  • the liposomal composition comprises a liposome having a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the liposomal composition comprises a liposome that contains a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section and has a diameter in the range of 80 nm to 120 nm.
  • the liposome is a liposome composition according to any of [l2]-[67] of the Detailed Description Section and has a diameter in the range of 80 nm to 120 nm.
  • the liposomal composition comprises a liposome having a diameter in the range of 40 nm to 70 nm, or any range therein between.
  • liposomes comprise a yPANTIFOL according to any of [1]- [11] of the Detailed Description Section and have a diameter in the range of 40nm-70 nm.
  • the liposome is a liposome composition according to any of [l2]-[67] of the Detailed Description Section and has a diameter in the range of 40nm-70 nm.
  • the properties of liposomes are influenced by the nature of lipids used to make the liposomes.
  • lipids have been used to make liposomes. These include cationic, anionic and neutral lipids.
  • the liposomes comprising the gamma polyglutamated Antifolate are anionic or neutral.
  • the provided liposomes are cationic.
  • the determination of the charge e.g ., anionic, neutral or cationic
  • the determination of the charge can routinely be determined by measuring the zeta potential of the liposome.
  • the zeta potential of the liposome can be positive, zero or negative.
  • the zeta potential of the liposome is less than or equal to zero. In some embodiments, the zeta potential of the liposome is in a range of 0 to -150 mV. In another embodiment, the zeta potential of the liposome is in the range of -30 to -50 mV.
  • cationic lipids are used to make cationic liposomes which are commonly used as gene transfection agents.
  • the positive charge on cationic liposomes enables interaction with the negative charge on cell surfaces. Following binding of the cationic liposomes to the cell, the liposome is transported inside the cell through endocytosis.
  • a neutral to anionic liposome is used.
  • an anionic liposome is used.
  • Using a mixture of, for example, neutral lipids such as HSPC and anionic lipids such as PEG-DSPE results in the formation of anionic liposomes which are less likely to non- specifically bind to normal cells.
  • Specific binding to tumor cells can be achieved by using a tumor targeting antibody such as, for example, a folate receptor antibody, including, for example, folate receptor alpha antibody, folate receptor beta antibody and/or folate receptor delta antibody.
  • At least one (or some) of the lipids is/are amphipathic lipids, defined as having a hydrophilic and a hydrophobic portions (typically a hydrophilic head and a hydrophobic tail).
  • the hydrophobic portion typically orients into a hydrophobic phase (e.g., within the bilayer), while the hydrophilic portion typically orients toward the aqueous phase (e.g., outside the bilayer).
  • the hydrophilic portion can comprise polar or charged groups such as carbohydrates, phosphate, carboxylic, sulfato, amino, sulfhydryl, nitro, hydroxy and other like groups.
  • the hydrophobic portion can comprise apolar groups that include without limitation long chain saturated and unsaturated aliphatic hydrocarbon groups and groups substituted by one or more aromatic, cyclo-aliphatic or heterocyclic group(s).
  • amphipathic compounds include, but are not limited to, phospholipids, aminolipids and sphingolipids.
  • the lipids are phospholipids.
  • Phospholipids include without limitation phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, and the like. It is to be understood that other lipid membrane components, such as cholesterol, sphingomyelin, and cardiolipin, can be used.
  • the lipids comprising the liposomes provided herein can be anionic and neutral (including zwitterionic and polar) lipids including anionic and neutral phospholipids.
  • Neutral lipids exist in an uncharged or neutral zwitterionic form at a selected pH.
  • such lipids include, for example, dioleoylphosphatidylglycerol (DOPG), diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides and diacylglycerols.
  • DOPG dioleoylphosphatidylglycerol
  • zwitterionic lipids include without limitation dioleoylphosphatidylcholine (DOPC), dimyristoylphos-phatidylcholine (DMPC), and dioleoylphosphatidylserine (DOPS).
  • DOPC dioleoylphosphatidylcholine
  • DMPC dimyristoylphos-phatidylcholine
  • DOPS dioleoylphosphatidylserine
  • Anionic lipids are negatively charged at physiological pH.
  • lipids include without limitation phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dode- canoyl phosphatidylethanolamines, N-succinyl phosphatidylethanolamines, N- glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphos- phatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids.
  • POPG palmitoyloleyolphos- phatidylglycerol
  • anionic and neutral lipids are referred to herein as non-cationic lipids.
  • Such lipids may contain phosphorus but they are not so limited.
  • non-cationic lipids include lecithin, lysolecithin, phosphatidylethanolamine, lysophosphatidylethan- olamine, dioleoylphosphati- dylethanolamine (DOPE), dipalmitoyl phosphatidyl ethanol- amine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidy l-ethan- olamine (DSPE), palmitoyloleoyl-phosphatidylethanolamine (POPE) palmitoyl- oleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), distearoylphosphat- idylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphospha-tidylcholine (DPPC), di
  • the liposomes may be assembled using any liposomal assembly method using liposomal components (also referred to as liposome components) known in the art.
  • Liposomal components include, for example, lipids such as DSPE, HSPC, cholesterol and derivatives of these components.
  • Other suitable lipids are commercially available for example, by Avanti Polar Lipids, Inc. (Alabaster, Alabama, USA).
  • a partial listing of available negatively or neutrally charged lipids suitable for making anionic liposomes can be, for example, at least one of the following: DLPC, DMPC, DPPC, DSPC, DOPC, DMPE, DPPE, DOPE, DMPA-Na, DPPA*Na, DOPA*Na, DMPG'Na, DPPG-Na, DOPG'Na, DMPS'Na, DPPS'Na, DOPS*Na, DOPE-Glutaryl « (Na)2, Tetramyristoyl Cardiolipin » (Na)2, DSPE-mPEG-2000Na, DSPE- mPEG-5000-Na, and DSPE-Maleimide PEG-2000-Na.
  • the yPANTIFOL compositions provided herein are formulated in a liposome comprising a cationic lipid.
  • the cationic lipid is selected from, but not limited to, a cationic lipid described in Intl. Appl. Publ. Nos. WO2012/040184, WO2011/153120, WO2011/149733, WO2011/090965, WO2011/043913, WO2011/022460, WO2012/061259, WO2012/054365, WO2012/044638, W02010/080724, W02010/21865 and W02008/103276, U.S. Pat. Nos.
  • the cationic lipid may be selected from, but not limited to, Formula A described in Intl. Appl. Publ. Nos. W02012/040184, WO2011/153120, WO201/1149733, WO2011/090965, WO2011/043913, WO2011/022460, WO2012/061259, WO2012/054365 and WO2012/044638; each of which is herein incorporated by reference in their entirety.
  • the cationic lipid may be selected from, but not limited to, Formula CLI-CLXXIX of International Publication No. W02008103276, Formula CLI-CLXXIX of U.S. Pat. No. 7,893,302, Formula CLI-CLXXXXII of U.S. Pat. No. 7,404,969 and Formula I- VI of US Patent Publication No. US20100036115; each of which is herein incorporated by reference in their entirety.
  • the cationic lipid may be selected from (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-l0-amine, (17Z,20Z)- N,N-dimemyl-hexacosa-l7,20-dien-9-amine, (lZ,l9Z)-N5N-dimethylpenta cosa-16, l9-dien- 8-amine, (l3Z,l6Z)-N,N-dimethyldocosa-l3,l6-dien-5-amine, (12Z, 15Z)-N,N- dimethylhenicosa-l2,15-dien-4-amine, (14Z,l7Z)-N,N-dimethyltricosa-l4,17-dien-6-amine, (15Z,18Z)-N,N- dimethyltetracosa-l5,l8-dien-7-amine, (l8Z,2lZ)-N,N-N-
  • the lipid may be a cleavable lipid such as those described in in Intl. Publ. No. WO2012/170889, which is herein incorporated by reference in its entirety
  • the cationic lipid can routinely be synthesized using methods known in the art and/or as described in Inti. Publ. Nos. WO2012/040184, WO2011/153120, WO2011/149733, WO2011/090965, W0201/1043913, WO2011/022460, WO2012/061259, WO2012/054365, WO2012/044638, W02010/080724 and W02010/21865; each of which is herein incorporated by reference in its entirety.
  • Lipid derivatives can include, for example, at least, the bonding (preferably covalent bonding) of one or more steric stabilizers and/or functional groups to the liposomal component after which the steric stabilizers and/or functional groups should be considered part of the liposomal components.
  • Functional groups comprises groups that can be used to attach a liposomal component to another moiety such as a protein. Such functional groups include, at least, maleimide.
  • steric stabilizers include at least one from polyethylene glycol (PEG); poly-L-lysine (PLL); monosialoganglioside (GM1); poly(vinyl pyrrolidone) (PVP); poly(acrylamide) (PAA); poly(2-methyl-2-oxazoline); poly(2-ethyl-2-oxazoline); phosphatidyl polyglycerol; poly[N-(2-hydroxy-propyl) methacrylamide]; amphiphilic poly-N- vinylpyrrolidones; L-amino-acid-based polymer; and polyvinyl alcohol.
  • PEG polyethylene glycol
  • PLL poly-L-lysine
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2-oxazoline)
  • poly(2-ethyl-2-oxazoline) poly(2-ethy
  • the yPANTIFOL compositions are formulated in a lipid- polycation complex.
  • the formation of the lipid-polycation complex may be accomplished using methods known in the art and/or as described in U.S. Pub. No. 20120178702, herein incorporated by reference in its entirety.
  • the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyornithine and/or polyarginine and the cationic peptides described in International Pub. No. WO2012/013326; herein incorporated by reference in its entirety.
  • the yPANTIFOL is formulated in a lipid-polycation complex which further includes a neutral lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).
  • DOPE dioleoyl phosphatidylethanolamine
  • the components of a liposome can include any molecule(s) (e.g ., chemical/reagent/protein) that is bound to it
  • the components of the provided liposomes include, at least, a member selected from the group DSPE, DSPE-PEG, DSPE-maleimide, HSPC; HSPC-PEG; HSPC-maleimide; cholesterol; cholesterol-PEG; and cholesterol-maleimide.
  • the components of the provided liposomes include DSPE, DSPE-PEG, DSPE-maleimide, HSPC; HSPC-PEG; HSPC-maleimide; cholesterol; cholesterol-PEG; and cholesterol-maleimide.
  • the liposomal components that make up the liposome comprises DSPE; DSPE-FITC; DSPE- maleimide; cholesterol; and HSPC.
  • the liposomes of the liposome compositions provided herein comprise oxidized phospholipids.
  • the liposomes comprise an oxidize phospholipid of a member selected from phosphatidylserines, phosphatidylinositols, phosphatidylethanolamines, phosphatidyl-cholines and l-palmytoyl-2-arachidonoyl-sn- glycero-2-phosphate.
  • the phospholipids have unsaturated bonds.
  • the phospholipids are arachidonic acid containing phospholipids.
  • the phospholipids are sn-2-oxygenated.
  • the phospholipids are not fragmented.
  • the liposomes of the disclosed liposome compositions comprise oxidized l-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine (OxPAPC).
  • OxPAPC oxidized l-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine
  • oxPAPC refers to lipids generated by the oxidation of 1-palmitoyl- 2-arachidonyl-sn-glycero-3-phosphorylcholine (PAPC), which results in a mixture of oxidized phospholipids containing either fragmented or full length oxygenated sn-2 residues.
  • Well- characterized oxidatively fragmented species contain a five- carbon sn-2 residue bearing omega- aldehyde or omega-carboxyl groups.
  • Oxidation of arachidonic acid residue also produces phospholipids containing esterified isoprostanes.
  • the oxPAPC includes HOdiA-PC, KOdiA-PC, HOOA-PC and KOOA-PC species, among other oxidized products present in oxPAPC.
  • the oxPAPCs are epoxyisoprostane- containing phospholipids.
  • the oxPAPC is l-palmitoyl-2-(5,6- epoxyisoprostane E2)-sn-glycero-3-phosphocholine (5,6-PEIPC), l-palmitoyl-2-(epoxy- cyclo-pentenone)-sn-glycero-3-phosphorylcholine (PECPC) and/or l-palmitoyl-2-(epoxy- isoprostane E2)-sn-glycero-4-phosphocholine (PEIPC).
  • the phospholipids have unsaturated bonds.
  • the phospholipids are arachidonic acid containing phospholipids.
  • the phospholipids are sn-2-oxygenated.
  • the phospholipids are not fragmented.
  • the liposomal gamma polyglutamated Antifolate composition is pegylated (i.e., a pegylated liposomal gamma polyglutamated (e.g., pentaglutamated or hexaglutamated) antifolate (PLp-yPANTIFOL or TPLp-yPANTIFOL).
  • PLp-yPANTIFOL or TPLp-yPANTIFOL a pegylated liposomal gamma polyglutamated (e.g., pentaglutamated or hexaglutamated) antifolate
  • the PLp-yPANTIFOL or TP Lp-gR A NT I FO L is water soluble. That is, the PLp-yPANTIFOL or TPLp-yPANTIFOL is in the form an aqueous solution.
  • the liposomes of the disclosed liposome compositions comprise a lipid selected from: l-palmitoyl-2-glutaroyl-sn-glycero-3-phosphocholine (PGPC); l-palmitoyl-2-(9'oxo-nonanoyl)-sn-glycero-3-phosphocholine; l-palmitoyl-2-arachinodoyl- sn-glycero-3-phosphocholine; l-palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine; 1- palmitoyl-2-hexadecyl-sn-glycero-3-phosphocholine; l-palmitoyl-2-azelaoyl-sn-glycero-3- phosphocholine; and l-palmitoyl-2-acetoyl-sn-glycero-3-phospho-choline.
  • PGPC l-palmitoyl-2
  • the pH of solutions comprising the liposome composition is from pH 2 to 8, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from pH 5 to 8 or from pH 2 to 6, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from pH 5 to 8, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from pH 6 to 7, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • At least one component of the liposome lipid bilayer is functionalized (or reactive).
  • a functionalized component is a component that comprises a reactive group that can be used to crosslink reagents and moieties to the lipid. If the lipid is functionalized, any liposome that it forms is also functionalized.
  • the reactive group is one that will react with a crosslinker (or other moiety) to form crosslinks.
  • the reactive group in the liposome lipid bilayer is located anywhere on the lipid that allows it to contact a crosslinker and be crosslinked to another moiety (e.g., a steric stabilizer or targeting moiety).
  • the reactive group is in the head group of the lipid, including for example a phospholipid.
  • the reactive group is a maleimide group.
  • Maleimide groups can be crosslinked to each other in the presence of dithiol crosslinkers including but not limited to dithiolthrietol (DTT).
  • contemplated reactive groups include but are not limited to other thiol reactive groups, amino groups such as primary and secondary amines, carboxyl groups, hydroxyl groups, aldehyde groups, alkyne groups, azide groups, carbonyls, halo acetyl (e.g., iodoacetyl) groups, imidoester groups, N-hydroxysuccinimide esters, sulfhydryl groups, and pyridyl disulfide groups.
  • thiol reactive groups amino groups such as primary and secondary amines, carboxyl groups, hydroxyl groups, aldehyde groups, alkyne groups, azide groups, carbonyls, halo acetyl (e.g., iodoacetyl) groups, imidoester groups, N-hydroxysuccinimide esters, sulfhydryl groups, and pyridyl disulfide groups.
  • lipids are available from a number of commercial sources including Avanti Polar Lipids (Alabaster, AL) and Lipoid LLC (Newark, NJ).
  • the provided liposomes enclose an interior space.
  • the interior space comprises, but is not limited to, an aqueous solution.
  • the interior space comprises a gamma polyglutamated Antifolate as provided herein.
  • the interior space of the liposome comprises a tonicity agent.
  • the concentration (weight percent) of the tonicity agent is 0.1-20%, 1-20%, 0.5-15%, 1-15%, or 1-50%, or any range therein between.
  • the interior space of the liposome includes a sugar (e.g., trehalose, maltose, sucrose, lactose, mannose, mannitol, glycerol, dextrose, fructose, etc.).
  • the concentration (weight percent) of the sugar is 0.1-20%, 1-20%, 0.5-15%, 1%-15%, or 1-50%, or any range therein between.
  • the pH of the interior space of the liposome is from pH 2 to 8, or any range therein between.
  • the pH of solutions comprising the liposome composition is from pH 5 to 8, or any range therein between.
  • the pH of solutions comprising the liposome composition is from pH 6 to 7, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer a buffer selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is HEPES. In some embodiments, the buffer is citrate. In some embodiments, the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between. In further embodiments, the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between. In some embodiments, the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between. In some embodiments, the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
  • the interior space of the liposome includes glutamine, glutamate, and/or polyglutamate (e.g., diglutamate, triglutamate, tetraglutamate, and/or pentaglutamate, containing one or more gamma glutamyl group linkages, or 1 or more alpha glutamyl linkages).
  • the concentration weight percent of the glutamine, glutamate, and/or polyglutamate is 0.1-20%, 1-20%, 0.5-15%, l%- 15%, 5-20%, or 1-50%, or any range therein between.
  • the interior space of the liposome includes glutamine.
  • the interior space of the liposome includes glutamate.
  • the interior space of the liposome includes polyglutamate.
  • the concentration (weight percent) of glutamine, glutamate, and/or polyglutamate is 1-15%, or any range therein between.
  • the glutamine, glutamate, and/or polyglutamate is present at about 5% to 20% weight percent of the glutamine, glutamate, and/or polyglutamate or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the interior space comprises buffer.
  • the buffer is HEPES buffer or citrate buffer.
  • the citrate buffer is at a concentration of between 5 to 200 mM.
  • the interior space has a pH of between 2.8 to 6. In some embodiments, the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is HEPES. In some embodiments, the buffer is citrate. In some embodiments, the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between. In further embodiments, the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between. In some embodiments, the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between. In some embodiments, the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises sodium acetate and/or calcium acetate.
  • the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
  • the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM.
  • the interior space of the liposome includes glutamine.
  • the concentration weight percent of the glutamine is 0.1-20%, 1-20%, 0.5-15%, 1%-15%, 5-20%, or 1-50%, or any range therein between.
  • the concentration (weight percent) of glutamine is 1-15%, or any range therein between.
  • the glutamine is present at about 5% to 20% weight percent of glutamine or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the interior space comprises buffer.
  • the buffer is HEPES buffer or citrate buffer.
  • the citrate buffer is at a concentration of between 5 to 200 mM.
  • the interior space has a pH of between 2.8 to 6.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is at a concentration of 15 to 200 mM, or any range therein between. In further embodiments, the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between. In some embodiments, the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between. In some embodiments, the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM.
  • the interior space of the liposome includes trehalose.
  • the concentration weight percent of trehalose is 0.1-20%, 1-20%, 0.5-15%, 1%- 15%, 5-20%, or 1-50%, or any range therein between.
  • the concentration (weight percent) of trehalose is 1-15%, or any range therein between.
  • the trehalose is present at about 5% to 20% weight percent of trehalose or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the interior space comprises buffer.
  • the buffer is HEPES buffer or citrate buffer.
  • the citrate buffer is at a concentration of between 5 to 200 mM.
  • the interior space has a pH of between 2.8 to 6.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate ( e.g ., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is at a concentration of 15 to 200 mM, or any range therein between. In further embodiments, the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between. In some embodiments, the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between. In some embodiments, the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM.
  • the interior space of the liposome includes dextrose.
  • the concentration weight percent of dextrose is 0.1-20%, 1-20%, 0.5-15%, 1- 15%, 5-20%, or 1-50%, or any range therein between.
  • the concentration (weight percent) of dextrose is 1-15%, or any range therein between.
  • the dextrose is present at about 5% to 20% weight percent of dextrose or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate ( e.g ., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between.
  • the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between. [00256] In additional embodiments, the disclosure provides liposomal compositions that comprise a liposome encapsulating (i.e., filled with) a gamma polyglutamated Antifolate (e.g., a yPANTIFOL disclosed herein).
  • a gamma polyglutamated Antifolate e.g., a yPANTIFOL disclosed herein.
  • the liposomal composition comprises a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section.
  • the liposome comprises a polyglutamated Antifolate described in Section I.
  • the liposomal composition comprises a liposome according to any of [12]- [67] of the Detailed Description Section.
  • a liposome in the liposomal composition comprises a yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, y-glutamyl groups (including the glutamyl group of the Antifolate).
  • the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma polyglutamated Antifolate in the Lp- yPANTIFOL comprises a glutamyl group in the D-form. In further embodiments, the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl groups that have a gamma carboxyl linkage.
  • the liposomal composition comprises a liposome comprising a y pentaglutamated Antifolate.
  • the liposome comprises an L-g pentaglutamated Antifolate, a D-g pentaglutamated Antifolate, or an L- and D-g pentaglutamated Antifolate.
  • the liposomal composition comprises a liposome comprising a y hexaglutamated Antifolate (Lp-yPANTIFOL).
  • the liposome comprises an L-g hexaglutamated Antifolate, a D-y hexaglutamated Antifolate, or an L- and D-g hexaglutamated Antifolate.
  • the disclosure provides a liposomal composition comprising a targeted and pegylated liposome that comprises a gamma polyglutamated Antifolate (TPLp- yPANTIFOL).
  • the liposomal composition comprises a yPANTIFOL according to any of [l]-[l l] of the Detailed Description Section.
  • the liposomal composition comprises a polyglutamate of an Antifolate disclosed in Section I, herein.
  • the liposomal composition is a targeted pegylated liposomal composition according to any of [50]-[69] of the Detailed Decsription.
  • the targeted pegylated liposomal gamma polyglutamated (e.g., pentaglutamated or hexaglutamated) Antifolate comprises a medium comprising a liposome including an interior space; an aqueous gamma polyglutamated Antifolate disposed within the interior space; and a targeting moiety comprising a protein with specific affinity for at least one folate receptor, and wherein the targeting moiety disposed at the exterior of the liposome.
  • the medium is an aqueous solution.
  • the interior space, the exterior space (e.g., the medium), or both the interior space and the medium contains one or more lyoprotectants or cryoprotectants which are listed above.
  • the cryoprotectant is mannitol, trehalose, sorbitol, or sucrose.
  • the liposome encapsulating gamma polyglutamated Antifolate i.e., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-gR ANTIF OL, and NTLp-yPANTIFOL
  • Lp-yPANTIFOL including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-gR ANTIF OL, and NTLp-yPANTIFOL
  • the liposome interior space contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate, or any range therein between.
  • the liposome interior space contains between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate, or any range therein between. In some embodiments, the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma polyglutamated Antifolate. In some embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate, or any range therein between. In further embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp-yPANTIFOL), and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma polyglutamated Antifolate.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate, or any range therein between.
  • the liposome does not comprise a targeting moiety, is not pegylated, (NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma polyglutamated Antifolate.
  • the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate, or any range therein between.
  • the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate, or any range therein between.
  • the liposome encapsulates gamma polyglutamated containing 2-10 glutamyl groups (i.e., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp- yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • Lp-yPANTIFOL including PLp-yPANTIFOL, TPLp- yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL
  • the liposome interior space contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate containing 2-10 glut
  • the liposome interior space contains between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups.
  • the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate containing 2- 10 glutamyl groups, or any range therein between.
  • the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups.
  • the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl groups, or any range therein between.
  • the liposome encapsulates gamma tetraglutamated Antifolate (i.e., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-gR ANTIF OL, and NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma tetraglutamated Antifolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between.
  • Lp-yPANTIFOL including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-gR ANTIF OL, and NTLp-yPANTIFOL
  • the liposome interior space contains between 10 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between.
  • the liposome interior space contains between 10,000 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between. In some embodiments, the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma tetraglutamated Antifolate. In some embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between.
  • the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma tetraglutamated Antifolate.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between.
  • the liposome does not comprise a targeting moiety, is not pegylated, (NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma tetraglutamated Antifolate.
  • the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between. In further embodiments, the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma tetraglutamated Antifolate, or any range therein between.
  • the liposome encapsulates gamma pentaglutamated Antifolate (e.g., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma pentaglutamated Antifolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of gamma pentaglutamated Antifolate, or any range therein between.
  • gamma pentaglutamated Antifolate e.g., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL
  • the liposome interior space contains between 10,000 to 100,000 molecules of gamma pentaglutamated Antifolate, or any range therein between. In some embodiments, the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma pentaglutamated Antifolate. In some embodiments, the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma pentaglutamated Antifolate, or any range therein between.
  • the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma pentaglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp- yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma pentaglutamated Antifolate.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma pentaglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma pentaglutamated Antifolate, or any range therein between.
  • the liposome is non-targeted and unpegylated ( NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma pentaglutamated Antifolate.
  • the liposome does not contain a targeting moiety and it not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma pentaglutamated Antifolate, or any range therein between.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma pentaglutamated Antifolate, or any range therein between.
  • the liposome encapsulates gamma hexaglutamated Antifolate (i.e., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-gR ANTIF OL, and NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma hexaglutamated Antifolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between.
  • Lp-yPANTIFOL including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-gR ANTIF OL, and NTLp-yPANTIFOL
  • the liposome interior space contains between 10 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between.
  • the liposome interior space contains between 10,000 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between.
  • the liposome is not pegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma hexaglutamated Antifolate.
  • the liposome is not pegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between.
  • the liposome is not pegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated (TLp-yPANTILOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma hexaglutamated Antifolate.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between.
  • the liposome comprises a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp-yPANTIEOL) and has an interior space that contains less than 500,000 or less than 200,000 molecules of gamma hexaglutamated Antifolate.
  • the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between. In further embodiments, the liposome does not comprise a targeting moiety, is not pegylated, and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma hexaglutamated Antifolate, or any range therein between.
  • the disclosure provides a liposomal gamma polyglutamated Antifolate composition wherein the liposome encapsulates gamma polyglutamated Antifolate or a salt or acid thereof, and one or more aqueous pharmaceutically acceptable carriers.
  • the liposome interior space contains trehalose. In some embodiments, the liposome interior space contains 5% to 20% weight of trehalose. In some embodiments, the liposome interior space contains HBS at a concentration of between 1 to 200 mM and a pH of between 2 to 8. In some embodiments, liposome interior space has a pH 5-8, or any range therein between.
  • liposome interior space has a pH 6-7, or any range therein between. In some embodiments, the liposome interior space has a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM, or any range therein between.
  • the liposome gamma polyglutamated Antifolate e.g., Lp- yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL
  • compositions comprise gamma polyglutamated Antifolate e.g., a yPANTIFOL disclosed herein) and one or more non-polyglutamated, polyglutamatable antifolate compositions.
  • the Lp-yPANTIFOL (e.g., PLp-yPANTIFOL, TPLp- yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL) comprises gamma polyglutamated Antifolate (e.g., a yPANTIFOL disclosed herein and the Antifolate (ANTIFOL).
  • gamma polyglutamated Antifolate e.g., a yPANTIFOL disclosed herein and the Antifolate (ANTIFOL).
  • the Lp-yPANTIFOL (i.e., liposome gamma polyglutamated Antifolate) comprises gamma polyglutamated Antifolate and a polyglutamatable antifolate selected from the group consisting of: methotrexate (MTX), pemetrexed (PMX), lometrexol (LMX), raltitrexed (RTX), pralatrexate, AG2034, GW1843, aminopterin, and LY309887.
  • the Lp-yPANTIFOL comprises gamma polyglutamated Antifolate and lometrexol.
  • the Lp-yPANTIFOL comprises gamma polyglutamated Antifolate and pemetrexed. In some embodiments, the Lp- yPANTIFOL comprises gamma polyglutamated Antifolate and leucovorin. In some embodiments, the Lp-yPANTIFOL comprises gamma polyglutamated Antifolate and a triazine antifolate derivative (e.g., a sulphonyl fluoride triazine such as NSC 127755). In some embodiments, the Lp-yPANTIFOL comprises gamma polyglutamated Antifolate and a serine hydroxymethyltransferase (SHMT2) inhibitor. In some embodiments, the SHMT2 inhibitor is an antifolate (e.g., a polyglutamatable or nonpolyglutamatable antifolate). In some embodiments, the SHMT2 inhibitor is an antifolate.
  • SHMT2 inhibitor is an antifolate (e.g.,
  • the Lp-yPANTIFOL (e.g., PLp-yPANTIFOL, TPLp- yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL) comprises a gamma polyglutamated Antifolate (e.g., a yPANTIFOL disclosed herein) and a so-called“non polyglutamatable” antifolate.
  • the liposome comprises a yPANTIFOL according to any of [l]-[l 1] of the Detailed Description Section.
  • the liposome comprises a polyglutamated Antifolate described in Section I.
  • the liposome comprises a gamma polyglutamated Antifolate and a non-polyglutamatable antifolate that inhibits one or more enzymes in the folate cycle metabolic pathway.
  • the non-polyglutamatable antifolate inhibits one or more enzymes selected from: thymidylate synthase (TS), dihydrofolate reductase (DHFR), glycinamide ribonucleotide (GAR) transformylase, and aminoimidazole carboxamide ribonucleotide (AICAR) transformylase.
  • the liposome comprises a gamma polyglutamated Antifolate and a non-polyglutamatable antifolate that inhibits DHFR. In some embodiments, the liposome comprises a gamma polyglutamated Antifolate and a non-polyglutamatable antifolate that inhibits TS. In some embodiments, the liposome comprises a gamma polyglutamated Antifolate and a non-polyglutamatable antifolate that inhibits GAR or AICAR transformylase.
  • the non-polyglutamatable antifolate is selected from: trimetrexate (TMQ), piritrexim (BW301U), and talotrexin (PT523).
  • the non-polyglutamatable antifolate is selected from: nolatrexed (AG337), plevitrexed (ZD9331, BGC9331), and BGC 945 (ONX 0801), or a pharmaceutically acceptable salt thereof.
  • the liposome comprises a gamma polyglutamated Antifolate
  • Lp-yPANTIFOL such as e.g., PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-gR ANTIF OL, and NTLp-yPANTIFOL
  • a gamma polyglutamated Antifolate e.g., a yPANTIFOL disclosed herein
  • a platinum-based chemotherapeutic agent or a salt or acid thereof.
  • the alpha polyglutamated Antifolate/platinum-based agent complex comprises a yPANTIFOL according to any of [l]-[l 1] of the Detailed Description Section.
  • the complex comprises a polyglutamated Antifolate described in Section I.
  • the Lp-yPANTIFOL comprises a platinum-based chemotherapeutic agent selected from: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof. In other embodiments, the Lp-yPANTIFOL comprises an analog of a platinum-based chemotherapeutic agent selected from: cisplatin, carboplatin, or oxaliplatin, or a salt or acid thereof. [00269] In some embodiments, the Lp-yPANTIFOL comprises a gamma polyglutamated Antifolate and cisplatin or a salt or acid thereof. In some embodiments, the Lp-yPANTIFOL comprises a gamma polyglutamated Antifolate and a cisplatin analog, or a salt or acid thereof.
  • the Lp-yPANTIFOL comprises a gamma polyglutamated Antifolate and carboplatin, or a salt or acid thereof.
  • the liposome comprises a gamma polyglutamated Antifolate and carboplatin analog, or a salt or acid thereof.
  • the Lp-yPANTIFOL comprises a gamma polyglutamated Antifolate and oxaliplatin, or a salt or acid thereof.
  • the liposome comprises a gamma polyglutamated Antifolate and an oxaliplatin analog, or a salt or acid thereof.
  • the liposome comprises a gamma polyglutamated Antifolate (. e.g ., a yPANTIFOL disclosed herein) and a platinum-based chemotherapeutic agent selected from: nedaplatin, heptaplatin, and lobaplatin, nedaplatin, heptaplatin, and lobaplatin or a salt or acid thereof.
  • the Lp-yPANTIFOL comprises a gamma polyglutamated Antifolate and an analog of a platinum-based chemotherapeutic agent selected from: nedaplatin, heptaplatin, and lobaplatin, or a salt or acid thereof.
  • the Lp-yPANTIFOL comprises a gamma polyglutamated Antifolate and a platinum-based chemotherapeutic agent selected from: stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM-216, 254-S, NK 121, CI-973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • a platinum-based chemotherapeutic agent selected from: stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM-216, 254-S,
  • the Lp-yPANTIFOL comprises a gamma polyglutamated Antifolate and an analog of a platinum-based chemotherapeutic agent selected from: stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM-216, 254-S, NK 121, CI- 973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • a platinum-based chemotherapeutic agent selected from: stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM-216, 25
  • the liposome composition comprises liposomes that further contain one or more of an immunostimulatory agent, a detectable marker and a maleimide disposed on at least one of the PEG and the exterior of the liposome.
  • the liposome comprise a yPANTIFOL (e.g., a yPANTIFOL disclosed herein) and a cyclodextrin (e.g., a cyclodextrin in Section IB, herein).
  • the liposome comprises a yPANTIFOL according to any of [l]-[l 1] of the Detailed Description Section.
  • the liposome comprises a polyglutamated Antifolate described in Section I.
  • the liposome is a liposomal composition according to any of [l2]-[67] of the Detailed Description Section.
  • the yPANTIFOL liposome is a targeted liposomal composition according to any of [l2]-[67] of the Detailed Description Section.
  • the yPANTIFOL liposome comprises a complex formed by a cyclodextrin and a therapeutic agent.
  • the therapeutic agent is a cytotoxic compound or a salt or acid thereof.
  • the therapeutic agent is a chemotherapeutic agent or a salt or acid thereof.
  • the therapeutic agent is a platinum-based drug.
  • the therapeutic agent is a taxane-based drug.
  • the therapeutic agent of the cyclodextrin/therapeutic agent complex is selected from: gemcitabine, a gemcitabine-based therapeutic agent, doxorubicin, an antifolate, an antifolate-based chemotherapeutic, or a salt or acid, acid or free base form thereof.
  • the yPANTIFOL liposome comprises a yPANTIFOL according to any of [1]- [11] of the Detailed Description Section.
  • the liposome comprises a polyglutamated Antifolate described in Section I.
  • the yPANTIFOL liposome is a liposomal composition according to any of [l2]-[67] of the Detailed Description Section.
  • the yPANTIFOL liposome is a targeted liposomal composition according to any of [l2]-[67] of the Detailed Description Section.
  • the molar ratio of cyclodextrin/therapeutic agent in the complex is in the range 1-10: 1. In some embodiments, the molar ratio of yPANTIFOL/therapeutic agent in the complex is 1:1, 2: 1, 3:1, 4:1, 5: 1, 6:1, 7: 1, or 10:1.
  • the molar ratio of yPANTIFOL/therapeutic agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1:12, 1: 13, 1: 14, 1:15, 1: 16, 1: 17, 1:18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the molar ratio of cyclodextrin/therapeutic agent in the complex is: 1:1, 2: 1, 3:1, 4:1, 5: 1, 6:1, 7: 1, 8:1, 9:1, 10:1, 11: 1, 12:1, 13: 1, 14: 1, 15:1, 16: 1, 17:1, 18: 1, 19:1, 20: 1, (21-50): 1, or >50: 1.
  • the cyclodextrin//platinum-based agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the yPANTIFOL liposome comprises yPANTIFOL and a cyclodextrin/platinum-based chemotherapeutic agent complex.
  • the platinum-based chemotherapeutic agent is selected from: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof.
  • the cyclodextrin/platinum-based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the liposome comprises a yPANTIFOL according to any of [1]-[11] of the Detailed Description Section.
  • the liposome comprises a polyglutamated Antifolate described in Section I.
  • the yPANTIFOL liposome is a liposomal composition according to any of [12]-[67] of the Detailed Description Section.
  • the yPANTIFOL liposome is a targeted liposomal composition according to any of [l2]-[67] of the Detailed Description Section.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is 1:1, 2: 1, 3:1, 4: 1, 5: 1, 6:1, 7: 1, or 10: 1. In some embodiments, the molar ratio of cyclodextrin/platinum-based agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1: 11, 1: 12, 1: 13, 1: 14, 1:15, 1:16, 1:17, 1:18, 1: 19, 1:20, l:(21-50), or 1:>50.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is : 1 : 1 , 2: 1 , 3:1, 4: 1, 5: 1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11:1, 12:1, 13: 1, 14: 1, 15:1, 16:1, 17: 1, 18: 1, 19:1, 20:1, (21-50): 1, or >50: 1.
  • the cyclodextrin//platinum-based agent complex is encapsulated in a liposome.
  • the platinum-based chemotherapeutic agent is selected from: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof.
  • the cyclodextrin/platinum-based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is in the range 1-10: 1.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is 1: 1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments, the molar ratio of cyclodextrin/platinum- based agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1.
  • the disclosure provides a complex containing cyclodextrin and cisplatin or a salt or acid thereof.
  • the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1.
  • the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1.
  • the cyclodextrin//cisplatin (or cisplatin salt or acid) complex is encapsulated in a liposome.
  • the disclosure provides a complex containing cyclodextrin and carboplatin or a salt or acid thereof.
  • the molar ratio of cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1.
  • the molar ratio of cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(21-50),or 1:>50.
  • the molar ratio of cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1.
  • the cyclodextrin/carboplatin (or carboplatin salt or acid) complex is encapsulated in a liposome (e.g ., as described herein or otherwise known in the art).
  • the disclosure provides a complex containing cyclodextrin and oxaliplatin, or a salt or acid thereof.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, or 10: 1.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1:13, 1: 14, 1: 15, 1:16, 1:17, 1: 18, 1: 19, 1:20, l:(2l-50), or l:>50.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, 8: 1, 9:1, 10: 1, 11:1, 12:1, 13:1, 14:1, 15:1, 16: 1, 17:1, 18:1, 19: 1, 20:1, (2l-50):l, or >50: 1.
  • the cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and a platinum-based chemotherapeutic agent selected from: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum- triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • a platinum-based chemotherapeutic agent selected from: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin,
  • the cyclodextrin/platinum-based chemotherapeutic agent complex comprises an analog of nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, or dedaplatin, or a salt or acid thereof.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-10:1. In some embodiments, the molar ratio of cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog thereof) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, or 10:1.
  • the molar ratio of cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog thereof) in the complex is 1: 1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1:12, 1:13, 1:14, 1: 15, 1: 16, 1:17, 1:18, 1: 19, 1:20, l:(2l-50), or 1 :>50.
  • the molar ratio of cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog thereof) in the complex is: 2:1, 3: 1, 4:1, 5: 1, 6:1, 7: 1, 8:1, 9: 1, 10: 1, 11:1, 12:1, 13: 1, 14: 1, 15: 1, 16:1, 17:1, 18:1, 19:1, 20: 1, (21-50): 1 , or >50: 1.
  • the cyclodextrin/platinum- based chemotherapeutic agent (or salt or acid or analog thereof) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a composition comprising a cyclodextrin/taxane-based chemotherapeutic agent complex.
  • the taxane -based chemotherapeutic agent is selected from: paclitaxel (PTX), docetaxel (DTX), larotaxel (LTX), and cabazitaxel (CTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/taxane-based agent in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/taxane -based agent in the complex is 1:1, 2:1, 3:1, 4: 1, 5:1, 6: 1, 7: 1, or 10:1. In some embodiments, the molar ratio of cyclodextrin/taxane - based agent in the complex is 1: 1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1: 12, 1: 13, 1:14, 1: 15, 1: 16, 1:17, 1: 18, 1: 19, 1:20, l:(21-50), or 1 :>50.
  • the molar ratio of cyclodextrin/taxane-based agent in the complex is: 2:1, 3: 1, 4: 1, 5:1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11: 1, 12:1, 13: 1, 14: 1, 15:1, 16: 1, 17:1, 18: 1, 19:1, 20: 1, (21-50): 1, or >50: 1.
  • the cyclodextrin/taxane-based agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and paclitaxel (PTX), or a salt or acid thereof.
  • PTX cyclodextrin and paclitaxel
  • the cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog of paclitaxel (PTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1- 10: 1.
  • the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5:1, 6: 1, 7:1, or 10: 1.
  • the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is 1: 1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1:14, 1: 15, 1:16, 1: 17, 1: 18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is: 2:1, 3:1, 4: 1, 5:1, 6: 1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19: 1, 20:1, (21-50): 1, or >50: 1.
  • the cyclodextrin/paclitaxel (or paclitaxel salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and docetaxel (DTX), or a salt or acid thereof.
  • the cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog of docetaxel (DTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is in the range 1-10: 1.
  • the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is 1: 1, 2:1, 3: 1, 4:1, 5:1, 6: 1, 7:1, or 10: 1.
  • the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is 1: 1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1:14, 1: 15, 1:16, 1: 17, 1: 18, 1:19, 1:20, l:(21-50), or 1:>50.
  • the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is: 2:1, 3:1, 4: 1, 5:1, 6: 1, 7: 1, 8:1, 9: 1, 10: 1, 11: 1, 12: 1, 13:1, 14:1, 15:1, 16:1, 17:1, 18: 1, 19: 1, 20:1, (21-50): 1, or >50: 1.
  • the cyclodextrin/docetaxel (or docetaxel salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and larotaxel (LTX), or a salt or acid thereof.
  • the cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog of larotaxel (LTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the complex is in the range 1-10: 1.
  • the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the complex is 1:1, 2: 1, 3:1, 4:1, 5: 1, 6:1, 7: 1, or 10:1.
  • the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1: 13, 1:14, 1: 15, 1: 16, 1:17, 1: 18, 1: 19, 1:20, l:(21-50), or 1:>50.
  • the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the complex is: 2: 1, 3:1, 4:1, 5: 1, 6: 1, 7:1, 8: 1, 9:1, 10:1, 11: 1, 12:1, 13:1, 14: 1, 15: 1, 16:1, 17:1, 18:1, 19: 1, 20:1, (21- 50): 1, or >50: 1.
  • the cyclodextrin/larotaxel (or larotaxel salt or acid) complex is encapsulated in a liposome (e.g ., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and cabazitaxel (CTX), or a salt or acid thereof.
  • CTX cyclodextrin and cabazitaxel
  • the cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog of cabazitaxel (CTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is 1:1, 2: 1, 3:1, 4: 1, 5:1, 6: 1, 7:1, or 10: 1.
  • the molar ratio of cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is 1: 1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1: 11, 1:12, 1:13, 1: 14, 1: 15, 1:16, 1:17, 1: 18, 1: 19, 1:20, l:(2l-50), or 1:>50.
  • the molar ratio of a cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is: 2:1, 3: 1, 4:1, 5: 1, 6: 1, 7:1, 8: 1, 9: 1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16: 1, 17:1, 18:1, 19: 1, 20:1, (2l-50):l, or >50: 1.
  • the cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex can be derivatized or underivatized.
  • the cyclodextrin is derivatized.
  • the cyclodextrin is a derivatized beta-cyclodextrin (e.g., a hydroxypropyl beta-cyclodextrin (HP-beta-CD), and a sulfobutyl ether beta-CD (SBE)-beta-cyclodextrin)).
  • a derivatized beta-cyclodextrin e.g., a hydroxypropyl beta-cyclodextrin (HP-beta-CD), and a sulfobutyl ether beta-CD (SBE)-beta-cyclodextrin
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex is a derivatized beta-cyclodextrin comprising: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more 2-hydroxylpropyl-3 -group substitutions of hydroxy groups; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more sulfoalkyl ether group substitutions of hydroxy groups.
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex is a derivatized beta-cyclodextrin comprising: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more sulfobutyl ether group substitutions of hydroxy groups.
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex contained in the yPANTIFOL liposome composition is a derivatized cyclodextrin of Formula I:
  • n 4, 5, or 6; and wherein Rl, R2, R3, R4, R5, R6, R7, R8, and R9 are each, independently, -H, a straight chain or branched C1-C8- alkylene group, a 2-hydroxylpropyl- 3- group; or an optionally substituted straight-chain or branched C1-C6 group, wherein at least one of Rl, R2, R3, R4, R5, R6, R7, R8 and R9 is a straight-chain or branched C1-C8- alkylene group or a 2-hydroxylpropyl-3- group.
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex contained in the yPANTIFOL liposome composition is a derivatized cyclodextrin of Formula II:
  • n 4, 5, or 6; and wherein Rl, R2, R3, R4, R5, R6, R7, R8, and R9 are each, independently, -O- or a -0-(C2-C6 alkylene)-S03- group; wherein at least one of Rl and R2 is independently a -0-(C2-C6 alkylene)-S03- group; and S l, S2, S3, S4, S5, S6, S7, S8, and S9 are each, independently, a -H or a H or a pharmaceutically acceptable cation.
  • the wherein the pharmaceutically acceptable cation is selected from: an alkali metal such as Li+, Na+, or K+; an alkaline earth metal such as Ca+2, or Mg+2, and ammonium ions and amine cations such as the cations of (Cl-C6)-alkylamines, piperidine, pyrazine, (Cl- C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • an alkali metal such as Li+, Na+, or K+
  • an alkaline earth metal such as Ca+2, or Mg+2
  • ammonium ions and amine cations such as the cations of (Cl-C6)-alkylamines, piperidine, pyrazine, (Cl- C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • the yPANTIFOL liposome comprises between 100 to 100,000 of the cyclodextrin/therapeutic agent complexes.
  • a cyclodextrin derivative of the yPANTIFOL/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is a cyclodextrin disclosed in U.S. Pat. Nos. 6,133,248, 5,874,418, 6,046,177, 5,376,645, 5,134,127, 7,034,013, 6,869,939; and Intl. Appl. Publ. No. WO 02005/117911, the contents each of which is herein incorporated by reference in its priority.
  • the cyclodextrin derivative of the cyclodextrin/therapeutic agent complex is a sulfoalkyl ether cyclodextrin.
  • the cyclodextrin derivative of complex is a sulfobutyl ether-3 -cyclodextrin such as CAPTISOL® (CyDex Pharma. Inc., Lenexa, Kansas. Methods for preparing sulfobutyl ether-3- cyclodextrin and other sulfoalkyl ether cyclodextrins are known in the art.
  • the cyclodextrin derivative of the cyclodextrin/therapeutic agent complex is a compound of Formula III:

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Dispersion Chemistry (AREA)
  • Communicable Diseases (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Inorganic Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Peptides Or Proteins (AREA)
EP19752055.4A 2018-02-07 2019-02-07 Gamma-polyglutamatierte antifolate und verwendungen davon Pending EP3749321A4 (de)

Applications Claiming Priority (15)

Application Number Priority Date Filing Date Title
US201862627733P 2018-02-07 2018-02-07
US201862627732P 2018-02-07 2018-02-07
US201862630613P 2018-02-14 2018-02-14
US201862630620P 2018-02-14 2018-02-14
US201862630824P 2018-02-14 2018-02-14
US201862630751P 2018-02-14 2018-02-14
US201862630625P 2018-02-14 2018-02-14
US201862630652P 2018-02-14 2018-02-14
US201862636289P 2018-02-28 2018-02-28
US201862662372P 2018-04-25 2018-04-25
US201862702774P 2018-07-24 2018-07-24
US201862702779P 2018-07-24 2018-07-24
US201862764945P 2018-08-17 2018-08-17
US201862764951P 2018-08-17 2018-08-17
PCT/US2019/017004 WO2019157148A1 (en) 2018-02-07 2019-02-07 Gamma polyglutamated antifolates and uses thereof

Publications (2)

Publication Number Publication Date
EP3749321A1 true EP3749321A1 (de) 2020-12-16
EP3749321A4 EP3749321A4 (de) 2022-03-09

Family

ID=67548055

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19752055.4A Pending EP3749321A4 (de) 2018-02-07 2019-02-07 Gamma-polyglutamatierte antifolate und verwendungen davon

Country Status (5)

Country Link
EP (1) EP3749321A4 (de)
JP (2) JP7490240B2 (de)
CN (1) CN111936147A (de)
CA (1) CA3090505A1 (de)
WO (1) WO2019157148A1 (de)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112019002495A2 (pt) 2016-08-12 2019-05-14 L.E.A.F. Holdings Group Llc antifolatos poliglutamatados e seus usos
WO2018031968A1 (en) 2016-08-12 2018-02-15 L.E.A.F. Holdings Group Llc Alpha and gamma-d polyglutamated antifolates and uses thereof
EP3749316A4 (de) 2018-02-07 2021-10-27 L.E.A.F Holdings Group LLC Alpha-polyglutamatiertes pralatrexat und verwendungen davon
CA3090500A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
US11779584B2 (en) 2018-02-07 2023-10-10 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
WO2019160736A1 (en) 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated pralatrexate and uses thereof
WO2019160734A1 (en) 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated lometrexol and uses thereof
WO2019160735A1 (en) * 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated tetrahydrofolates and uses thereof
JP7462950B2 (ja) * 2018-02-14 2024-04-08 エル．イー．エー．エフ． ホールディングス グループ エルエルシー ガンマポリグルタミン酸化メトトレキセートおよびその使用
WO2019160732A1 (en) * 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated aminopterin and uses thereof
CA3149914A1 (en) * 2019-08-06 2021-02-11 L.E.A.F. Holdings Group Llc Processes of preparing polyglutamated antifolates and uses of their compositions

Family Cites Families (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6569432B1 (en) * 1995-02-24 2003-05-27 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen and uses thereof
WO2001053331A2 (en) * 2000-01-24 2001-07-26 Adherex Technologies, Inc. Peptidomimetic modulators of cell adhesion
US7612071B2 (en) * 2004-03-12 2009-11-03 Syntrix Biosystems, Inc. Compositions and methods employing aminopterin
CA2579096C (en) * 2004-09-08 2012-11-13 Chelsea Therapeutics, Inc. Quinazoline derivatives as metabolically inert antifolate compounds
WO2006074416A1 (en) * 2005-01-07 2006-07-13 Health Research Inc. 5-amino-4-imidazolecarboxamide riboside and its nucleobase as potentiators of antifolate transport and metabolism
US8073630B2 (en) * 2006-08-30 2011-12-06 Exagen Diagnostics, Inc. Pharacogenetic method for prediction of the efficacy of methotrexate monotherapy in recent-onset arthritis
ES2688938T3 (es) * 2006-12-29 2018-11-07 Tracon Pharmaceuticals, Inc. Combinaciones de agente antifolato y metoxiamina en el tratamiento del cáncer
CA2674698A1 (en) * 2007-01-19 2008-07-24 Chelsea Therapeutics, Inc. New classical antifolates
EP2437596B1 (de) * 2009-06-03 2017-05-03 Ex-Tek, LLC Zusammensetzungen zur hautbehandlung
US9770414B2 (en) * 2010-05-13 2017-09-26 Pacira Pharmaceuticals, Inc. Sustained release formulation of methotrexate as a disease-modifying antirheumatic drug (DMARD) and an anti-cancer agent
CN103040748B (zh) * 2012-12-18 2014-07-02 海南圣欣医药科技有限公司 一种培美曲塞二钠脂质体注射剂
KR102505508B1 (ko) * 2014-08-14 2023-03-03 엘.이.에이.에프. 홀딩스 그룹 엘엘씨. 리포솜 캡슐화 친화 약제
WO2018031979A1 (en) * 2016-08-12 2018-02-15 L.E.A.F. Holdings Group Llc Alpha and gamma-d polyglutamated antifolates and uses thereof
BR112019002495A2 (pt) * 2016-08-12 2019-05-14 L.E.A.F. Holdings Group Llc antifolatos poliglutamatados e seus usos
WO2018031968A1 (en) * 2016-08-12 2018-02-15 L.E.A.F. Holdings Group Llc Alpha and gamma-d polyglutamated antifolates and uses thereof
WO2019094648A1 (en) * 2017-11-08 2019-05-16 L.E.A.F. Holdings Group Llc Platinum complexes and uses thereof
US20210346381A1 (en) * 2018-02-07 2021-11-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated tetrahydrofolates and uses thereof
EP3749320A4 (de) * 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC Alpha-polyglutamatiertes aminopterin und dessen verwendungen
EP3749312A4 (de) * 2018-02-07 2022-02-23 L.E.A.F Holdings Group LLC Alpha-polyglutamatiertes lometrexol und verwendungen davon
US11779584B2 (en) * 2018-02-07 2023-10-10 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
WO2019157133A1 (en) * 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated raltitrexed and uses thereof
US20210023006A1 (en) * 2018-02-07 2021-01-28 L.E.A.F. Holdings Group Llc Gamma polyglutamated raltitrexed and uses thereof
EP3749314A4 (de) * 2018-02-07 2022-02-23 L.E.A.F Holdings Group LLC Alpha-polyglutamatiertes methotrexat und dessen verwendungen
CA3090483A1 (en) * 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Gamma polyglutamated pemetrexed and uses thereof
CA3090500A1 (en) * 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
EP3749316A4 (de) * 2018-02-07 2021-10-27 L.E.A.F Holdings Group LLC Alpha-polyglutamatiertes pralatrexat und verwendungen davon
WO2019160735A1 (en) * 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated tetrahydrofolates and uses thereof
WO2019160732A1 (en) * 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated aminopterin and uses thereof
WO2019160734A1 (en) * 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated lometrexol and uses thereof
JP7462950B2 (ja) * 2018-02-14 2024-04-08 エル．イー．エー．エフ． ホールディングス グループ エルエルシー ガンマポリグルタミン酸化メトトレキセートおよびその使用
WO2019160736A1 (en) * 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated pralatrexate and uses thereof

Also Published As

Publication number Publication date
JP2021513533A (ja) 2021-05-27
CA3090505A1 (en) 2019-08-15
EP3749321A4 (de) 2022-03-09
CN111936147A (zh) 2020-11-13
JP2024097894A (ja) 2024-07-19
JP7490240B2 (ja) 2024-05-27
WO2019157148A1 (en) 2019-08-15

Similar Documents

Publication Publication Date Title
US12076402B2 (en) Alpha polyglutamated antifolates and uses thereof
US11779584B2 (en) Alpha polyglutamated pemetrexed and uses thereof
US12048766B2 (en) Gamma polyglutamated tetrahydrofolates and uses thereof
EP3749321A1 (de) Gamma-polyglutamatierte antifolate und verwendungen davon
EP3749311A1 (de) Gamma-polyglutamatiertes pemetrexed und verwendungen davon
US20210169887A1 (en) Alpha polyglutamated methotrexate and uses thereof
US20210052592A1 (en) Alpha polyglutamated aminopterin and uses thereof
US20210346381A1 (en) Alpha polyglutamated tetrahydrofolates and uses thereof
WO2019160733A1 (en) Gamma polyglutamated methotrexate and uses thereof
WO2019157140A1 (en) Gamma polyglutamated raltitrexed and uses thereof
EP3749315A1 (de) Alpha-polyglutamatiertes raltitrexed und verwendungen davon
EP3749312A1 (de) Alpha-polyglutamatiertes lometrexol und verwendungen davon
EP3749316A1 (de) Alpha-polyglutamatiertes pralatrexat und verwendungen davon
WO2019160732A1 (en) Gamma polyglutamated aminopterin and uses thereof
WO2019160734A1 (en) Gamma polyglutamated lometrexol and uses thereof
US20200360389A1 (en) Gamma polyglutamated antifolates and uses thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20200715

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40037571

Country of ref document: HK

A4 Supplementary search report drawn up and despatched

Effective date: 20220208

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 47/69 20170101ALI20220202BHEP

Ipc: A61K 47/64 20170101ALI20220202BHEP

Ipc: A61P 35/00 20060101ALI20220202BHEP

Ipc: C07K 16/28 20060101ALI20220202BHEP

Ipc: C07D 475/04 20060101ALI20220202BHEP

Ipc: A61K 31/519 20060101AFI20220202BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20230818