EP3630160A1 - Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequence - Google Patents
Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequenceInfo
- Publication number
- EP3630160A1 EP3630160A1 EP18731359.8A EP18731359A EP3630160A1 EP 3630160 A1 EP3630160 A1 EP 3630160A1 EP 18731359 A EP18731359 A EP 18731359A EP 3630160 A1 EP3630160 A1 EP 3630160A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- fgf21
- promoter
- nucleotide sequence
- mofgf21
- aav8
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/50—Fibroblast growth factor [FGF]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
- A61K38/1825—Fibroblast growth factor [FGF]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/761—Adenovirus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/25—Animals on a special diet
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
- A01K2267/0362—Animal model for lipid/glucose metabolism, e.g. obesity, type-2 diabetes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
- C12N2015/8518—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic expressing industrially exogenous proteins, e.g. for pharmaceutical use, human insulin, blood factors, immunoglobulins, pseudoparticles
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
Definitions
- Viral expression construct comprising a Fibroblast Growth Factor 21 (FGF21) coding sequence
- the invention pertains to the medical field, comprising gene therapy compositions for use in the treatment of a metabolic disorder, use in the treatment of liver inflammation and/or fibrosis, use in the treatment of cancer and/or use in extending healthy lifespan in mammals, particularly in human beings. Background of the invention
- liver fibrosis is an excessive accumulation of extracellular matrix proteins, e.g. collagen, resulting predominantly from chronic liver inflammation. Advanced liver fibrosis will lead to liver cirrhosis, portal hypertension and liver failure. Thus, novel and safe antifibrotic therapeutics are required.
- Fibroblast growth factor 21 (FGF21 ), a growth factor predominantly secreted by the liver, but also by adipose tissue and pancreas (Muise, E. S. et al, 2008. Mol. Pharmacol. 74:403-412), has been shown to increase brown adipose tissue (BAT) growth and expression of thermogenic genes in BAT and white adipose tissue (WAT), stimulating energy expenditure (Coskun, T. et al, 2008. Endocrinology 149:6018-6027; Fisher, F. M. et al., 2012. Genes Dev. 26:271-281; Kharitonenkov, A. et al., 2005. J. Clin.
- Native FGF21 protein exhibits poor pharmacokinetic characteristics. It has a short half- life, and it is susceptible to in vivo proteolytic degradation and in vitro aggregation (Huang, J. et al, 2013. J Pharmacol Exp Ther. 346(2 :270-80; So, W. Y. and Leung, P.S. 2016. Med Res Rev. 36(4 :672-704; Zhang, J. and Li, Y. 2015. Front Endocrinol (Lausanne). 6: 168).
- Various engineering approaches have been developed to extend the half-life and to improve the stability and solubility of FGF21.
- two engineered FGF21 mimetics LY2405319 and PF-05231023 are being tested in humans.
- FGF21 mimetics require multiple administrations, which poses a significant burden to the patients.
- engineered FGF21 mimetics/analogs may exhibit a higher risk of immunogenicity than native FGF21, e.g. patients treated with LY2405319 developed injection site reactions, anti-drug antibodies and a serious hypersensitivity reaction (Gaich, G. et al, 2013. Cell Metab. 18 ⁇ 3):333-40).
- the inventors designed improved gene therapy strategies based on adeno-associated viral (AAV) vector-mediated FGF21 gene transfer to liver, adipose tissue and/or skeletal muscle to counteract metabolic disorders, preferably diabetes and/or obesity.
- AAV adeno-associated viral
- the gene therapy of the invention may also be used to counteract liver inflammation and/or fibrosis. Additionally, the gene therapy of the invention may also be used for the extension of healthy lifespan by counteracting metabolic disorders associated with aging, preferably diabetes and/or obesity. Additionally, the gene therapy of the invention may also be used to counteract cancer, preferably liver cancer.
- a viral expression construct suitable for expression in a mammal and comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) to be expressed in liver, adipose tissue and/or skeletal muscle.
- FGF21 Fibroblast growth factor 21
- a preferred nucleotide sequence encoding a FGF21 present in the viral expression construct of the invention has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 4, 5, 6, 7, 8, 9, 10 or 11. Identity may be assessed over the whole SEQ ID NO or over part thereof as explained in the part of the description entitled "general definitions".
- a more preferred nucleotide sequence encoding a human FGF21 present in the viral expression construct of the invention has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 4, 5, 6 or 7.
- SEQ ID NO: 4 is a nucleotide sequence encoding human FGF21.
- SEQ ID NO: 5 is a codon optimized nucleotide sequence encoding human FGF21, variant 1.
- SEQ ID NO: 6 is a codon optimized nucleotide sequence encoding human FGF21, variant 2.
- SEQ ID NO: 7 is a codon optimized nucleotide sequence encoding human FGF21, variant 3.
- Variant 1, variant 2 and variant 3 encode for the same human FGF21 protein and were obtained by different algorithms of codon optimization.
- nucleotide sequence encoding canine FGF21 present in the viral expression construct of the invention has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 10 or 11. Identity may be assessed over the whole SEQ ID NO or over part thereof as explained in the part of the description entitled "general definitions".
- SEQ ID NO: 10 is a nucleotide sequence encoding canine FGF21.
- SEQ ID NO: 11 is a codon optimized nucleotide sequence encoding canine FGF21.
- nucleotide sequence that has at least 60% sequence identity with the nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, 8, 9, 10 or 11.
- a preferred nucleotide sequence encoding a FGF21 suitable for expression in a mammal encodes a polypeptide comprising an amino acid sequence that has at least 60%>, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 1, 2 or 3. Identity may be assessed over the whole SEQ ID NO or over part thereof as explained in the part of the description entitled "general definitions".
- SEQ ID NO: 1 is an amino acid sequence of human FGF21.
- SEQ ID NO: 2 is an amino acid sequence of murine FGF21.
- SEQ ID NO: 3 is an amino acid sequence of canine FGF21.
- a viral expression construct as described above comprising a nucleotide sequence encoding a FGF21 suitable for expression in a mammal and at least one of elements a), b), c), d) and e):
- a "target sequence of a microRNA expressed in the heart” or “target sequence of a miRNA expressed in the heart” or “binding site of a microRNA expressed in the heart” refers to a nucleotide sequence which is complementary or partially complementary to at least a portion of a microRNA expressed in the heart.
- a portion of a microRNA expressed in the liver or a portion of a microRNA expressed in the heart, as defined herein, means a nucleotide sequence of at least five or at least six consecutive nucleotides of said microRNA.
- the binding site sequence can have perfect complementarity to at least a portion of an expressed microRNA, meaning that the sequences can be a perfect match, no mismatch may occur.
- the binding site sequence can be partially complementary to at least a portion of an expressed microRNA, meaning that one mismatch/five, six consecutive nucleotides may occur.
- Partially complementary binding sites preferably contain perfect or near perfect complementarity to the seed region of the microRNA, meaning that no mismatch (perfect complementarity) or one mismatch/five, six consecutive nucleotides (near perfect complementarity) may occur between the seed region of the microRNA and its binding site.
- the seed region of the microRNA consists of the 5' region of the microRNA from about nucleotide 2 to about nucleotide 8 of the microRNA (i.e. 6 nucleotides).
- the portion as defined herein is preferably the seed region of said microRNA.
- Degradation of the messenger RNA (mRNA) containing the target sequence for a microRNA expressed in the liver or a microRNA expressed in the heart may be through the RNA interference pathway or via direct translational control (inhibition) of the mRNA.
- the invention is not limited by the pathway ultimately utilized by the miRNA in inhibiting expression of the transgene or encoded protein.
- the nucleotide sequence encoding a target sequence of a microRNA expressed in the liver may be replaced by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with SEQ ID NO: 12.
- a more preferred nucleotide sequence has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 12.
- at least one copy of a nucleotide sequence encoding a target sequence of a microRNA expressed in the liver, as defined in SEQ ID NO: 12 or 14-23, is present in the viral expression construct of the invention.
- two, three, four, five, six, seven or eight copies of a nucleotide sequence encoding a target sequence of a liver-specific microRNA, as defined in SEQ ID NO: 12 or 14-23, are present in the viral expression construct of the invention.
- one, two, three, four, five, six, seven or eight copies of a nucleotide sequence encoding miRT122a (SEQ ID NO: 12) are present in the viral expression construct of the invention.
- a target sequence of a microRNA expressed in the liver as used herein exerts at least a detectable level of activity of a target sequence of a microRNA expressed in the liver as known to the skilled person.
- An activity of a target sequence of a microRNA expressed in the liver is to bind to its cognate, microRNA expressed in the liver and, when operatively linked to a transgene, to mediate detargeting of transgene expression in the liver. This activity may be assessed by measuring the levels of transgene expression in the liver by qPCR, as described in the experimental part.
- the nucleotide sequence encoding a target sequence of a microRNA expressed in the heart may be replaced by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with SEQ ID NO: 13.
- a preferred nucleotide sequence has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 13.
- two, three, four, five, six, seven or eight copies of a nucleotide sequence encoding a target sequence of a heart-specific microRNA, as defined in SEQ ID NO: 13 or 23-30 are present in the viral expression construct of the invention.
- one, two, three, four, five, six, seven or eight copies of a nucleotide sequence encoding miRTl (SEQ ID NO: 13) are present in the viral expression construct of the invention.
- An activity of a target sequence of a microRNA expressed in the heart is to bind to its cognate, microRNA expressed in the heart and, when operatively linked to a transgene, to mediate detargeting of transgene expression in the heart. This activity may be assessed by measuring the levels of transgene expression in the heart by qPCR, as described in the experimental part.
- nucleotide sequence encoding a target sequence of a microRNA expressed in the liver and the nucleotide sequence encoding a target sequence of a microRNA expressed in the heart is selected from a group consisting of sequences SEQ ID NO: 12 to 30 and/or combinations thereof.
- At least one copy of a nucleotide sequence encoding a target sequence of a microRNA expressed in the liver, as defined in SEQ ID NO: 12 or 14-23, and at least one copy of a nucleotide sequence encoding a target sequence of a microRNA expressed in the heart, as defined in SEQ ID NO: 13 or 23-30, are present in the viral expression construct of the invention.
- one, two, three, four, five, six, seven or eight copies of a nucleotide sequence encoding miRTl 22a (SEQ ID NO: 12) and one, two, three, four, five, six, seven or eight copies nucleotide sequence encoding miRTl (SEQ ID NO: 13) are combined in the viral expression construct of the invention.
- four copies of a nucleotide sequence encoding miRTl 22a (SEQ ID NO: 12) and four copies of nucleotide sequence encoding miRTl (SEQ ID NO: 13) are combined in the viral expression construct of the invention.
- promoter liver-specific promoter
- adipose tissue-specific promoter ubiquitous promoter
- skeletal muscle promoter skeletal muscle promoter
- a nucleotide sequence of a CAG promoter may be replaced by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with SEQ ID NO: 44.
- a preferred nucleotide sequence has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 44. Identity may be assessed over the whole SEQ ID NO or over part thereof as explained in the part of the description entitled "general definitions".
- CMV cytomegalovirus
- a nucleotide sequence of a CMV promoter may be replaced by a nucleotide sequence comprising a nucleotide sequence that has at least 60%> sequence identity or similarity with SEQ ID NO: 45.
- a preferred nucleotide sequence has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 45. Identity may be assessed over the whole SEQ ID NO or over part thereof as explained in the part of the description entitled "general definitions".
- an intronic sequence may be replaced by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with SEQ ID NO: 43.
- a preferred nucleotide sequence has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 43. Identity may be assessed over the whole SEQ ID NO or over part thereof as explained in the part of the description entitled "general definitions".
- a preferred liver-specific promoter is a human a 1 -antitrypsin (hAAT) promoter.
- a nucleotide sequence of a hAAT promoter may be replaced by a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with SEQ ID NO: 47.
- a preferred nucleotide sequence has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 47. Identity may be assessed over the whole SEQ ID NO or over part thereof as explained in the part of the description entitled "general definitions".
- hAAT promoter is used together with an intronic sequence.
- a preferred intronic sequence is a hepatocyte control region (HCR) enhancer from apo lipoprotein E.
- HCR hepatocyte control region
- a most preferred intronic sequence is the HCR enhancer from apolipoprotein E as defined in SEQ ID NO: 53.
- an intronic sequence may be replaced by a nucleotide sequence comprising a nucleotide sequence that has at least 60%> sequence identity or similarity with SEQ ID NO: 53.
- a preferred nucleotide sequence has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 53.
- said hAAT promoter is used together with one, two, three, four or five copies of an intronic sequence.
- said hAAT promoter is used together with one, two, three, four or five copies of the HCR enhancer from apolipoprotein E as defined in SEQ ID NO: 53.
- liver-specific promoters are the albumin promoter, the major urinary protein promoter, the phosphoenolpyruvate carboxykinase (PEPCK) promoter, the liver- enriched protein activator promoter, the transthyretin promoter, the thyroxine binding globulin promoter, the apolipoprotein Al promoter, the liver fatty acid binding protein promoter and the phenylalanine hydroxylase promoter .
- PPCK phosphoenolpyruvate carboxykinase
- Adipose tissue-specific promoters are the adipocyte protein 2 (aP2, also known as fatty acid binding protein 4 (FABP4)) promoter, the PPARy promoter, the adiponectin promoter, the phosphoenolpyruvate carboxykinase (PEPCK) promoter, the promoter derived from human aromatase cytochrome p450 (p450arom) the mini/aP2 promoter (composed of the adipose-specific aP2 enhancer and the basal aP2 promoter), the uncoupling protein 1 (UCP1) promoter, the mini/UCPl promoter (composed of the adipose-specific UCP1 enhancer and the basal UCP1 promoter), the adipsin promoter, the leptin promoter, or the Foxa-2 promoter.
- ABP2 fatty acid binding protein 4
- PPCK phosphoenolpyruvate carboxykinase
- Preferred skeletal muscle promoters are the myosin light-chain promoter, the myosin heavy-chain promoter, the desmin promoter, the muscle creatine kinase (MCK) promoter, the smooth muscle alpha-actin promoter, the CK6 promoter, the Unc-45 Myosin Chaperone B promoter, the basal MCK promoter in combination with copies of the MCK enhancer, the Enh358MCK promoter (combination of the MCK enhancer with the 358 bp proximal promoter of the MCK gene).
- a most preferred skeletal muscle promoter is the C5-12 promoter as defined in SEQ ID NO: 56.
- a viral expression construct comprising a nucleotide sequence encoding a FGF21 suitable for expression in a mammal and comprising element a),
- a viral expression construct comprising a nucleotide sequence encoding a FGF21 suitable for expression in a mammal and comprising element b),
- a viral expression construct comprising a nucleotide sequence encoding a FGF21 suitable for expression in a mammal and comprising element d),
- a viral expression construct comprising a nucleotide sequence encoding a FGF21 suitable for expression in a mammal and comprising element e),
- a viral expression construct comprising a nucleotide sequence encoding a FGF21 suitable for expression in a mammal and comprising element b) and a nucleotide sequence of element c),
- a viral expression construct comprising a nucleotide sequence encoding a FGF21 suitable for expression in a mammal and comprising element e) and a nucleotide sequence of element c).
- liver-specific promoter is the human a 1 -antitrypsin (hAAT) promoter and/or the adipose tissue-specific promoter is the mini/ap2 promoter and/or the mini/UCPl promoter and/or the skeletal muscle promoter is the C5-12 promoter and/or the ubiquitous promoter is the cytomegalovirus (CMV) promoter and/or the CAG promoter.
- hAAT human a 1 -antitrypsin
- adipose tissue-specific promoter is the mini/ap2 promoter and/or the mini/UCPl promoter
- the skeletal muscle promoter is the C5-12 promoter and/or the ubiquitous promoter is the cytomegalovirus (CMV) promoter and/or the CAG promoter.
- CMV cytomegalovirus
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element a) wherein said construct is AAV8-hAAT-moFGF21.
- This construct for example contains a viral expression construct as depicted in Figure 6A: ITR2-hAAT-moFGF21- polyA-ITR2; the sequence of this expression construct is comprised in SEQ ID NO:34.
- Example 3 surprisingly reveals high and stable liver-specific expression after intravenous administration. Expression was shown to be stable for up to 1 year (Example 12).
- Examples 3 and 11 Extensive beneficial therapeutic effects for the reversion and treatment of obesity and diabetes are shown in ob/ob mice (Examples 3 and 11), high fat diet (HFD)-fed mice (Examples 4, 12-14) and old HFD-fed mice (Examples 5, 12-14).
- Examples 11 and 16 also reveal marked improvement of hepatic steatosis, hepatic inflammation and hepatic fibrosis.
- Example 15 shows improvement of the inflammation of WAT associated to obesity.
- Example 17 indicates the long-term safety of the therapy.
- Example 18 reveals a beneficial effect in preventing liver tumors.
- Example 19 shows therapeutic potential in a model for type I diabetes.
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element b), wherein the adipose tissue-specific promoter is a mini/aP2 promoter (SEQ ID NO: 54) and/or a mini/UCPl promoter (SEQ ID NO 55).
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element c), wherein the ubiquitous promoter is a CAG Promoter (SEQ ID NO: 44) and wherein the at least one nucleotide sequence encoding a target sequence of a microRNA expressed in the liver is selected from the group consisting of SEQ ID NO: 12 or 14-23 and the at least one nucleotide sequence encoding a target sequence of a microRNA expressed in the heart is selected from the group consisting of SEQ ID NO: 13 or 23-30.
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element c) wherein said construct is AAV9-CAG-moFGF21 -dmiRT or AAV8-CAG-moFGF21- dmiRT.
- the notations dmiRT and doublemiRT are equivalent.
- These constructs for example contain a viral expression construct as depicted in Figure 1A: ITR2-CAG- moFGF21-4x miRT122a-4x miRTl-polyA-ITR2; the sequence of this expression construct is comprised in SEQ ID NO:32.
- Examples 1 -2 surprisingly reveal high and stable adipose-specific expression after intra-eWAT administration. Extensive beneficial therapeutic effects for the prevention, reversion and treatment of obesity and diabetes are shown in normal mice (Example 1) and ob/ob mice (Examples 2 and 10). Example 10 also reveals improvement of hepatic steatosis.
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element d), wherein the skeletal muscle promoter is a C5-12 promoter (SEQ ID NO: 56).
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element e), wherein the ubiquitous promoter is a CMV promoter (SEQ ID NO: 45) and the AAV serotype is AAV1.
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element e) wherein said construct is AAV 1 -CMV-moFGF21.
- This construct for example contains a viral expression construct as depicted in Figure 11 A: ITR2-CMV-moFGF21-polyA- ITR2; the sequence of this expression construct is comprised in SEQ ID NO:36.
- Example 20 reveals high and stable skeletal muscle-specific expression after intramuscular administration. Extensive beneficial therapeutic effects for the prevention, reversion and treatment of obesity and diabetes are shown in HFD- fed mice (Examples 6 and 21). Example 20 reveals a beneficial effect in extending healthy lifespan by preventing obesity and diabetes.
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element b) and a nucleotide sequence of element c), wherein the adipose tissue-specific promoter is a mini/aP2 promoter (SEQ ID NO : 54) and/or the mini/UCP 1 promoter (SEQ ID NO 55).
- a viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and element e) and a nucleotide sequence of element c), wherein the ubiquitous promoter is a CMV promoter (SEQ ID NO: 45) and the AAV serotype is AAV1.
- Zhang et al. discloses wild type murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (EFla-mFGF21) (Zhang et al, EBioMedicine 15 (2017) 173-183). This construct was compared with constructs of the invention in Examples 23 and 24. In all the in vitro and in vivo experiments, all expression cassettes and AAV vectors of the invention mediated higher expression of FGF21 in the target tissue or cell type and lower expression of FGF21 in off-target tissues, demonstrating higher efficiency of the expression cassettes and AAV vectors of the invention as well as higher tissue-specificity.
- EFla elongation factor la
- constructs CMV-moFGF21 and C AG-moFGF21 -double miRT also mediated higher protein production and secretion to the culture media in HEK293 cells in comparison to EFla-mFGF21.
- hAAT-moFGF21 and AAV8-hAAT-moFGF21 also mediated higher secretion of FGF21 to the bloodstream than EF 1 a-mFGF21 and AAV8-EF 1 a-mFGF21.
- Additional sequences may be present in the viral expression construct of the invention as explained in detail in the part of the description entitled "general definitions".
- Preferred additional sequences include inverted terminal repeats (ITRs), a SV40 polyadenylation signal (SEQ ID NO: 50), a rabbit ⁇ -globin polyadenylation signal (SEQ ID NO: 51), a CMV enhancer sequence (SEQ ID NO: 46) and a HCR enhancer from apolipoprotein E (SEQ ID NO: 53).
- ITRs is intended to encompass one 5'ITR and one 3'ITR, each being derived from the genome of an AAV.
- Preferred ITRs are from AAV2 and are represented by SEQ ID NO: 48 (5' ITR) and SEQ ID NO: 49 (3' ITR). Within the context of the invention, it is encompassed to use the CMV enhancer sequence (SEQ ID NO: 46) and the CMV promoter sequence (SEQ ID NO: 45) as two separate sequences or as a single sequence (SEQ ID NO: 52).
- the viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and at least one of elements a) and/or b) and/or c) and/or d) and/or e) as earlier defined further comprises:
- the viral expression construct comprising a nucleotide sequence encoding FGF21 suitable for expression in a mammal and at least one of elements a) and/or b) and/or c) and/or d) and/or e) as earlier defined further comprises ITRs that flank the expression cassette of said construct and optionally
- an additional sequence may be present selected from the group consisting of: ITRs, SV40 polyadenylation signal, rabbit ⁇ -globin polyadenylation signal, CMV enhancer sequence, HCR enhancer sequence from apolipoprotein E.
- the viral expression construct comprises a nucleotide sequence encoding FGF21 suitable for expression in a mammal and at least one of elements a) and/or b) and/or c) and/or d) and/or e), wherein an additional sequence is present which is selected from the group consisting of: ITRs, SV40 polyadenylation signal, rabbit ⁇ -globin polyadenylation signal, CMV enhancer sequence, HCR enhancer sequence.
- ITRs are those of AAV2 which are represented by SEQ ID NO: 48 (5' ITR) and SEQ ID NO: 49 (3' ITR).
- Preferred viral expression constructs comprise elements a) and/or b) and/or c) and/or d) and/or e) and are such that the expression cassette is flanked by a 5'ITR and a 3 'ITR.
- Other preferred viral expression constructs comprise elements a) and/or b) and/or c) and/or d) and/or e) and are such that the expression cassette is flanked by a 5'ITR and a 3 'ITR.
- SV40 polyadenylation signals are present.
- kits comprise elements a) and/or b) and/or c) and/or d) and/or e) and are such that the expression cassette is flanked by a 5'ITR and a 3 'ITR.
- rabbit ⁇ -globin polyadenylation signals are present.
- kits comprise elements a) and/or b) and/or c) and/or d) and/or e) and are such that the expression cassette is flanked by a 5'ITR and a 3 'ITR.
- CMV enhancer sequence is present.
- kits comprise elements a) and/or b) and/or c) and/or d) and/or e) and are such that the expression cassette is flanked by a 5'ITR and a 3 'ITR.
- HCR enhancer sequence from apolipoprotein E is present.
- Construct B (represented by a nucleotide sequence comprising SEQ ID NO: 32), Construct D (represented by a nucleotide sequence comprising SEQ ID NO: 34), Construct F (represented by a nucleotide sequence comprising SEQ ID NO: 36), Construct G (represented by a nucleotide sequence comprising SEQ ID NO: 37), Construct H (represented by a nucleotide sequence comprising SEQ ID NO: 38), Construct I (represented by a nucleotide sequence comprising SEQ ID NO: 39), Construct J (represented by a nucleotide sequence comprising SEQ ID NO: 40), Construct K (represented by a nucleotide sequence comprising SEQ ID NO: 41).
- Construct L (represented by a nucleotide sequence comprising SEQ ID NO: 42).
- each of these viral expression constructs already comprise two ITRs from AAV2 (i.e. SEQ ID NO: 48 (5' ITR) and SEQ ID NO: 49 (3' ITR)).
- Constructs B and G comprise a rabbit ⁇ -globin polyadenylation signal.
- Construct F comprises a SV40 polyadenylation signal, a CMV enhancer sequence and a nucleotide sequence of a chimeric intron (composed of introns from human ⁇ -globin and immunoglobulin heavy chain genes).
- Constructs D, H-L comprise a SV40 polyadenylation signal, a HCR enhancer sequence and a nucleotide sequence of chimeric intron (composed of introns from human ⁇ -globin and immunoglobulin heavy chain genes).
- nucleotide sequence the sequence of which differs from the sequence of a nucleic acid molecule of (i) due to the degeneracy of the genetic code.
- sequence identity is determined by comparing the whole length of the sequences as identified herein. Unless otherwise indicated herein, identity with a given SEQ ID NO means identity or similarity based on the full length of said sequence (i.e. over its whole length or as a whole).
- a construct defined by its minimum identity (i.e. at least 60%) to a given SEQ ID NO as identified above is encompassed within the scope of the invention when this construct or a viral expression construct or a viral vector comprising this construct or a composition comprising this construct or vector is able to induce the expression of FGF21 in a cell, preferably in a liver cell, cell of adipose tissue or in a cell of skeletal muscle.
- the expression of FGF21 could be assessed using techniques known to the skilled person. In a preferred embodiment, said expression is assessed as carried out in the experimental part.
- a viral expression construct is such that the construct is represented by a nucleotide sequence comprising SEQ ID NO: 4, 5, 6, 7, 8, 9, 10 or 11 or a sequence having at least 60% identity with SEQ ID NO: 4, 5, 6, 7, 8, 9, 10 or 11 or a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: 4, 5, 6, 7, 8, 9, 10 or 11.
- a viral vector comprising a viral expression construct as defined above, wherein said viral vector is an adenovirus vector, an adeno-associated virus vector, a retrovirus vector or a lentivirus vector, preferably an adeno-associated virus vector selected from the group consisting of an adeno-associated virus 1 (AAV1) vector, an adeno-associated virus 8 (AAV8) vector, and an adeno-associated virus 9 (AAV9) vector.
- AAV1 adeno-associated virus 1
- AAV8 adeno-associated virus 8
- AAV9 adeno-associated virus 9
- an AAV vector comprising each of the elements defined earlier herein and a recombinant AAV (rAAV) based genome comprising a ITR or a part thereof.
- Preferred ITRs are those of AAV2 which are represented by SEQ ID NO: 48 (5 ' ITR) and SEQ ID NO: 49 (3' ITR).
- the subject treated may be a higher mammal, e.g. cats, rodents, (preferably mice, rats, gerbils and guinea pigs, and more preferably mice and rats), or dogs, or human beings.
- rodents preferably mice, rats, gerbils and guinea pigs, and more preferably mice and rats
- dogs or human beings.
- composition comprising a viral expression construct as defined above and/or a viral vector as defined above and/or a nucleic acid molecule as defined above, together with one or more pharmaceutically acceptable excipients or vehicles.
- Such pharmaceutically acceptable carrier, filler, preservative, solubilizer, diluent and/or excipient may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000.
- said composition is for use as a medicament, preferably for preventing, delaying, curing, reverting and/or treating a metabolic disorder, preferably a diabetes and/or obesity.
- Diabetes may be Type 1 Diabetes, Type 2 Diabetes or Monogenic Diabetes.
- the medicament is for preventing, delaying, curing, reverting and/or treating liver inflammation and/or fibrosis.
- the medicament is for extending healthy lifespan, preferably by preventing, delaying, curing, reverting and/or treating a metabolic disorder associated with aging, preferably a diabetes and/or obesity.
- the medicament is for preventing, delaying, curing, reverting and/or treating cancer, preferably liver cancer.
- the subject treated may be a higher mammal, e.g. cats, rodent, (preferably mice, rats, gerbils and guinea pigs, and more preferably mice and rats), or dogs, or a human being.
- Said viral expression construct, viral vector and/or nucleic acid molecule and/or composition are preferably said to be able to be used for preventing, delaying, reverting, curing and/or treating a metabolic disorder, preferably a diabetes and/or obesity, when said viral expression construct, viral vector and/or nucleic acid molecule and/or composition are able to exhibit an anti-diabetes effect and/or an anti-obesity effect.
- Said viral expression construct, viral vector and/or nucleic acid molecule and/or composition are preferably said to be able to be used for preventing, delaying, curing, reverting and/or treating liver inflammation and/or fibrosis, when said viral expression construct, viral vector and/or nucleic acid molecule and/or composition are able to exhibit an anti-fibrotic effect.
- Said viral expression construct, viral vector and/or nucleic acid molecule and/or composition are preferably said to be able to be used for extending healthy lifespan, preferably by preventing, delaying, curing, reverting and/or treating a metabolic disorder associated with aging, preferably a diabetes and/or obesity, when said viral expression construct, viral vector and/or nucleic acid molecule and/or composition are able to exhibit an anti-diabetes effect and/or an anti-obesity effect during aging.
- Said viral expression construct, viral vector and/or nucleic acid molecule and/or composition are preferably said to be able to be used for preventing, delaying, curing, reverting and/or treating cancer, preferably liver cancer, when said viral expression construct, viral vector and/or nucleic acid molecule and/or composition are able to exhibit an anti-cancer effect.
- An anti-diabetes effect may be reached when glucose disposal in blood is increased and/or when glucose tolerance is improved and/or when insulin sensitivity is increased. This could be assessed using techniques known to the skilled person or as done in the experimental part, preferably as assessed in example 8 or 9.
- increase means at least a detectable increase (respectively a detectable improvement) using an assay known to the skilled person or using assays as carried out in the experimental part, such as measurement of glycaemia, insulinemia and/or performance of an insulin tolerance test and/or of a glucose tolerance test.
- the increase may be an increase of at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100%) using assays such as the measurement of glycaemia, insulinemia and/or performance of an insulin tolerance test and/or of a glucose tolerance test.
- An anti-obesity effect may be reached when body weight, body weight gain and/or body fat percentage is decreased.
- An anti-obesity effect may also be reached when body mass index (BMI), waist circumference, waist-to-hip ratio (WHR) and/or waist-to-height ratio (WHtR) is decreased. This could be assessed using techniques known to the skilled person or as done in the experimental part.
- “decrease” means at least a detectable decrease (respectively a detectable improvement) using an assay known to the skilled person or using assays as carried out in the experimental part.
- Anti-obesity effects include both prevention of obesity and reversion of obesity, as evaluated by measurement of body weight of the individual, the BMI and/or weight of the tissues.
- an anti-inflammatory effect in the liver may be reached by a decrease in macrophage infiltration, decreased pro-inflammatory cytokines. This could be assessed using techniques known to the skilled person or as done in the experimental part.
- “decrease” means at least a detectable decrease (respectively a detectable improvement) using an assay known to the skilled person or using assays as carried out in the experimental part.
- a healthy lifespan-extending effect may be reached when an anti-diabetes and/or anti- obesity effect as defined earlier herein is used to prevent, delay, cure, reverse or treat the onset or progression of a metabolic disorder associated with aging, preferably of a diabetes and/or obesity.
- a healthy lifespan-extending effect may also be reached by an increase in the healthy lifespan, wherein symptoms associated with metabolic disorders, preferably of a diabetes and/or obesity, are absent or reduced.
- a healthy-lifespan extending effect may also be reached by improved coordination and balance (assessed by Rota-Rod test), memory (assessed by Object Recognition Test), and/or neuromuscular coordination (assessed by Tightrope Test), decreased mitochondrial and metabolic deterioration (assessed by measurement of expression levels of genes involved in metabolism and mitochondrial function such as PGC-1 alpha, ATP synthase and ERRalpha). This could be assessed using techniques known to the skilled person or as done in the experimental part.
- “increase” means at least a detectable increase (respectively a detectable improvement) using an assay known to the skilled person or using assays as carried out in the experimental part.
- an anti-cancer effect may be reached by a decrease in the cumulative incidence of cancer over the lifetime. This could be assessed using techniques known to the skilled person or as done in the experimental part.
- “decrease” means at least a detectable decrease (respectively a detectable improvement) using an assay known to the skilled person or using assays as carried out in the experimental part.
- An anti-fibrotic effect in the liver may also be observed when the progression of a typical symptom (e.g. liver stifness, jaundice, appetite loss, difficulty thinking clearly, fluid buildup in the legs or stomach, nausea, unexplained weight loss, weakness) has been slowed down as assessed by a physician.
- a decrease of a typical symptom may mean a slow down in progression of symptom development or a complete disappearance of symptoms.
- Symptoms, and thus also a decrease in symptoms can be assessed using a variety of methods, to a large extent the same methods as used in diagnosis of liver fibrosis, including clinical examination and routine laboratory tests. Such methods include both macroscopic and microscopic methods, as well as molecular methods, imaging methods (elastography, X-rays, MRI, CT, ultrasonography, angiography), biochemical, immunohistochemical and others.
- An healthy lifespan-extending effect may also be observed when the progression of a typical symptom of metabolic disorders associated with aging (e.g. insulin resistance, glucose intolerance, increase of body weight) has been slowed down as assessed by a physician.
- a decrease of a typical symptom may mean a slow down in progression of symptom development or a complete disappearance of symptoms.
- Symptoms, and thus also a decrease in symptoms can be assessed using a variety of methods, to a large extent the same methods as used in diagnosis of diabetes and/or obesity, including clinical examination and routine laboratory tests. Such methods include both macroscopic and microscopic methods, as well as molecular methods, X-rays, biochemical, immunohistochemical and others.
- An anti-cancer effect may also be observed when the progression of a typical symptom (e.g. tumor size, unexplained weight loss, loss of appetite, feeling very full after a small meal, nausea or vomiting, enlarged liver, enlarged spleen, pain in the abdomen or near the right shoulder blade, swelling or fluid build-up in the abdomen, itching, jaundice) has been slowed down as assessed by a physician.
- a decrease of a typical symptom may mean a slow down in progression of symptom development or a complete disappearance of symptoms.
- Symptoms, and thus also a decrease in symptoms can be assessed using a variety of methods, to a large extent the same methods as used in diagnosis of cancer, including clinical examination and routine laboratory tests. Such methods include both macroscopic and microscopic methods, as well as molecular methods, imaging methods (X-rays, MRI, CT, ultrasonography, angiography), biochemical, immunohistochemical and others.
- a medicament as defined herein is preferably able to alleviate one symptom or one characteristic of a patient or of a cell, tissue or organ of said patient if after at least one week, one month, six months, one year or more of treatment using a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition of the invention, said symptom or characteristic has decreased (e.g. is no longer detectable or has slowed down), as defined above.
- a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition as defined herein for use according to the invention may be suitable for administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing a metabolic disorder, such as a diabetes and/or obesity, liver inflammation and/or fibrosis, a metabolic disorder associated with aging, and/or cancer, and may be administered in vivo, ex vivo or in vitro.
- a metabolic disorder such as a diabetes and/or obesity, liver inflammation and/or fibrosis, a metabolic disorder associated with aging, and/or cancer
- An administration mode may be intravenous, subcutaneous, intramuscular, intrathecal, intraarticular, intraventricular, intraperitoneal, intra-adipose tissue, via inhalation, oral, intranasal, intrahepatic, intrasplanchnic, intra-ocular, intra-ear, topic administration and/or via retrograde intraductal pancreatic administration.
- a preferred administration mode is intramuscular, intravenous or intra-adipose tissue, as described in the "General procedures to the Examples" as part of this application.
- a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition of the invention may be directly or indirectly administered using suitable means known in the art. Improvements in means for providing an individual or a cell, tissue, organ of said individual with a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition of the invention are anticipated, considering the progress that has already thus far been achieved. Such future improvements may of course be incorporated to achieve the mentioned effect of the invention.
- a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition can be delivered as is to an individual, a cell, tissue or organ of said individual.
- a cell, tissue or organ of said individual may be as earlier defined herein.
- a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition of the invention it is preferred that such viral expression construct and/or vector and/or nucleic acid and/or composition is dissolved in a solution that is compatible with the delivery method.
- a therapeutically effective dose of a viral expression construct, vector, nucleic acid molecule and/or composition as mentioned above is preferably administered in a single and unique dose hence avoiding repeated periodical administration. More preferably, the single dose is administered to skeletal muscle, to adipose tissue or intravenously.
- a further compound may be present in a composition of the invention.
- Said compound may help in delivery of the composition.
- suitable compounds compounds capable of forming complexes, nanoparticles, micelles and/or liposomes that deliver each constituent as defined herein, complexed or trapped in a vesicle or liposome through a cell membrane. Many of these compounds are known in the art.
- Suitable compounds comprise polyethylenimine (PEI), or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, synthetic amphiphiles (SAINT-18), lipofectinTM, DOTAP.
- a viral expression construct as defined above and/or a viral vector as defined above and/or a nucleic acid molecule as defined above and/or a composition as defined above, for use as a medicament.
- said viral expression construct and/or viral vector and/or nucleic acid molecule and/or composition is provided for use in the treatment and/or prevention of liver inflammation and/or fibrosis. Complications of liver inflammation and/or fibrosis may also be encompassed.
- said viral expression construct and/or viral vector and/or nucleic acid molecule and/or composition is provided for use in extending healthy lifespan, preferably by preventing, delaying, curing, reverting and/or treating a metabolic disorder associated with aging, preferably a diabetes and/or obesity.
- said viral expression construct and/or viral vector and/or nucleic acid molecule and/or composition is provided for use in the treatment and/or prevention of cancer, preferably liver cancer. Complications of a cancer may also be encompassed.
- a method for preventing, delaying, reverting, curing and/or treating a metabolic disorder comprising the use of a viral expression construct as defined above and/or a viral vector as defined above and/or a nucleic acid molecule as defined above and/or a composition as defined above.
- Such a method is preferably for alleviating one or more symptom(s) of a metabolic disorder, such as a diabetes and/or obesity, in an individual, in a cell, tissue or organ of said individual or alleviate one or more characteristic(s) or symptom(s) of a cell, tissue or organ of said individual, the method comprising administering to said individual a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition as defined herein.
- a metabolic disorder such as a diabetes and/or obesity
- a method for preventing, delaying, reverting, curing and/or treating liver inflammation and/or fibrosis and its complications comprising the use of a viral expression construct as defined above and/or a viral vector as defined above and/or a nucleic acid molecule as defined above and/or a composition as defined above.
- Such a method is preferably for alleviating one or more symptom(s) of liver inflammation and/or fibrosis, in an individual, in a cell, tissue or organ of said individual or alleviate one or more characteristic(s) or symptom(s) of a cell, tissue or organ of said individual, the method comprising administering to said individual a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition as defined herein.
- a method for extending healthy lifespan preferably by preventing, delaying, curing, reverting and/or treating a metabolic disorder associated with aging, preferably a diabetes and/or obesity, comprising the use of a viral expression construct as defined above and/or a viral vector as defined above and/or a nucleic acid molecule as defined above and/or a composition as defined above.
- a method for preventing, delaying, reverting, curing and/or treating cancer, preferably liver cancer and its complications comprising the use of a viral expression construct as defined above and/or a viral vector as defined above and/or a nucleic acid molecule as defined above and/or a composition as defined above.
- Such a method is preferably for alleviating one or more symptom(s) of cancer, such as liver cancer, in an individual, in a cell, tissue or organ of said individual or alleviate one or more characteristic(s) or symptom(s) of a cell, tissue or organ of said individual, the method comprising administering to said individual a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition as defined herein.
- a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition as defined herein for the manufacture of a medicament for preventing, delaying, reverting, curing and/or treating a metabolic disorder, preferably a diabetes and/or obesity.
- a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition as defined herein for the manufacture of a medicament for preventing, delaying, curing, reverting and/or treating liver inflammation and/or fibrosis.
- a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition as defined herein for the manufacture of a medicament for extending healthy lifespan, preferably by preventing, delaying, curing, reverting and/or treating a metabolic disorder associated with aging, preferably a diabetes and/or obesity.
- a viral expression construct and/or a viral vector and/or a nucleic acid molecule and/or a composition as defined herein for the manufacture of a medicament for preventing, delaying, reverting, curing and/or treating cancer, preferably liver cancer.
- Metabolic disorders include metabolic syndrome, diabetes, obesity, obesity-related comorbidities, diabetes-related comorbidities, hyperglycaemia, insulin resistance, glucose intolerance, hepatic steatosis, alcoholic liver diseases (ALD), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), coronary heart disease (CHD), hyperlipidemia, atherosclerosis, endocrinophaties, osteosarcopenic obesity syndrome (OSO), diabetic nephropaty, chronic kidney disease (CKD), cardiac hypertrophy, diabetic retinopathy, diabetic nephropathy, diabetic neuropathy, arthritis, sepsis, ocular neovascularization, neurodegeneration, dementia, and may also include depression, adenoma, carcinoma.
- ALD alcoholic liver diseases
- NAFLD non-alcoholic fatty liver disease
- NASH non-alcoholic steatohepatitis
- CVD coronary heart disease
- CHD hyperlipidemia
- Diabetes includes prediabetes, hyperglycaemia, Type 1 diabetes, Type 2 diabetes, maturity-onset diabetes of the young (MODY), monogenic diabetes, neonatal diabetes, gestational diabetes, brittle diabetes, idiopathic diabetes, drug- or chemical-induced diabetes, Stiff-man syndrome, lipoatrophic diabetes, latent autoimmune diabetes in adults (LADA).
- MODY maturity-onset diabetes of the young
- monogenic diabetes neonatal diabetes
- gestational diabetes gestational diabetes
- brittle diabetes idiopathic diabetes
- drug- or chemical-induced diabetes Stiff-man syndrome
- lipoatrophic diabetes latent autoimmune diabetes in adults
- Obesity includes overweight, central/upper body obesity, peripheral/lower body obesity, morbid obesity, osteosarcopenic obesity syndrome (OSO), pediatric obesity, Mendelian (monogenic) syndromic obesity, Mendelian non-syndromic obesity, polygenic obesity. Metabolic disorders, diabetes, obesity and the type of subject treated have been earlier defined herein.
- Liver inflammation and/or fibrosis includes automimmune hepatitis, viral hepatitis including hepatitis A, B, C, D and E, alcoholic hepatitis, non-alcoholic steatohepatitis (NASH) and liver cirrhosis.
- Cancer includes astrocytoma, glioma, leukemia, lymphoma, melanoma, myeloma, neuroblastoma, sarcoma (including chondrosarcoma, fibrosarcoma, rhabdomyoscaroma, and osteosarcoma), schwannoma, seminoma, and carcinomas of the bladder, breast, cervix, colon, endometrium, esophagus, gallbladder, kidney, liver, lung, ovary, prostate, pancreas, rectum, skin, stomach and thyroid.
- a preferred cancer is liver cancer, preferably hepatocellular carcinoma.
- said method or use is performed in vitro, for instance using a cell culture.
- said method or use is in vivo.
- a viral expression construct and/or a vector and/or a nucleic acid molecule and/or a composition may be combined with an additional compound known to be used for treating liver inflammation and/or fibrosis.
- a viral expression construct and/or a vector and/or a nucleic acid molecule and/or a composition may be combined with an additional compound known to be used for extending healthy lifespan.
- a viral expression construct and/or a vector and/or a nucleic acid molecule and/or a composition may be combined with an additional compound known to be used for treating cancer, preferably liver cancer.
- a treatment in a use or in a method according to the invention does not have to be repeated.
- said administration of the viral expression construct or of said composition may be repeated each year or each 2, 3, 4, 5, 6 years.
- a protein fragment or a polypeptide or a peptide or a derived peptide as Fibroblast growth factor 21 is represented by an amino acid sequence.
- nucleic acid molecule as a nucleic acid molecule encoding a FGF21 is represented by a nucleic acid or nucleotide sequence which encodes a protein fragment or a polypeptide or a peptide or a derived peptide.
- a nucleic acid molecule may comprise a regulatory region.
- each nucleic acid molecule or protein fragment or polypeptide or peptide or derived peptide or construct as identified herein by a given Sequence Identity Number is not limited to this specific sequence as disclosed.
- Each coding sequence as identified herein encodes a given protein fragment or polypeptide or peptide or derived peptide or construct or is itself a protein fragment or polypeptide or construct or peptide or derived peptide.
- SEQ ID NO see SEQ ID NO: X as example
- nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with SEQ ID NO: X;
- nucleotide sequence the sequence of which differs from the sequence of a nucleic acid molecule of (i) due to the degeneracy of the genetic code;
- nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: X.
- each nucleotide sequence or amino acid sequence described herein by virtue of its identity or similarity percentage (at least 60%) with a given nucleotide sequence or amino acid sequence respectively has in a further preferred embodiment an identity or a similarity of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more identity or similarity with the given nucleotide or amino acid sequence respectively.
- sequence identity or similarity is determined by comparing the whole length of the sequences as identified herein. Unless otherwise indicated herein, identity or similarity with a given SEQ ID NO means identity or similarity based on the full length of said sequence (i.e. over its whole length or as a whole).
- Each non-coding nucleotide sequence i.e. of a promoter or of another regulatory region
- a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with a specific nucleotide sequence SEQ ID NO (take SEQ ID NO: A as example).
- a preferred nucleotide sequence has at least 60%>, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% identity with SEQ ID NO: A. Identity may be assessed over the whole SEQ ID NO or over part thereof as explained herein.
- such non-coding nucleotide sequence such as a promoter exhibits or exerts at least an activity of such a non-coding nucleotide sequence such as an activity of a promoter as known to the skilled person.
- Similarity between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
- Identity and “similarity” can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H.
- Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the GCG program package (Devereux, J., et al, Nucleic Acids Research 12 (1): 387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al, J. Mol. Biol. 215:403-410 (1990).
- Preferred conservative amino acids substitution groups are: valine - leucine-isoleucine, phenylalanine -tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine.
- Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place.
- the amino acid change is conservative.
- Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gin or His; Asp to Glu; Cys to Ser or Ala; Gin to Asn; Glu to Asp; Gly to Pro; His to Asn or Gin; He to Leu or Val; Leu to He or Val; Lys to Arg; Gin or Glu; Met to Leu or He; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and, Val to He or Leu.
- promoter refers to a nucleic acid fragment that functions to control the transcription of one or more genes (or coding sequence), located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent R A polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter.
- a "constitutive" promoter is a promoter that is active under most physiological and developmental conditions.
- an “inducible” promoter is a promoter that is regulated depending on physiological or developmental conditions.
- a “organ-specific” or “tissue-specific” promoter is a promoter that is active in a specific type of organ or tissue, respectively.
- Organ-specific and tissue-specific promoters regulate expression of one or more genes (or coding sequence) primarily in one organ or tissue, but can allow detectable level (“leaky”) expression in other organs or tissues as well.
- Leaky expression in other organs or tissues means at least one-fold, at least two-fold, at least three-fold, at least four-fold or at least five-fold lower, but still detectable expression as compared to the organ- specific or tissue-specific expression, as evaluated by standard assays known to the skilled person (e.g.
- adipose tissue-specific promoter is a promoter that is capable of initiating transcription in the adipose tissue, whilst still allowing for any leaky expression in other (maximum five, six, seven or eight) organs and parts of the body. Transcription in the adipose tissue can be detected in adipose tissue and adipose cells, such as white adipocytes, brown adipocytes, beige adipocytes, preadipocytes, stromal vascular cells.
- a “liver-specific promoter” is a promoter that is capable of initiating transcription in the liver, whilst still allowing for any leaky expression in other (maximum five, six, seven or eight) organs and parts of the body. Transcription in the liver can be detected in liver tissue and liver cells, such as hepatocytes, Kupffer cells and/or oval cells.
- a “skeletal muscle promoter” is a promoter that is capable of initiating transcription in skeletal muscle, whilst still allowing for any leaky expression in other (maximum five, six, seven or eight) organs and parts of the body. Transcription in the skeletal muscle can be detected in skeletal muscle cells, such as myocytes, myoblasts, satellite cells.
- a "ubiquitous promoter” is active in substantially all tissues, organs and cells of an organism.
- operably linked is defined herein as a configuration in which a control sequence such as a promoter sequence or regulating sequence is appropriately placed at a position relative to the nucleotide sequence of interest, preferably coding for a FGF21 such that the promoter or control or regulating sequence directs or affects the transcription and/or production or expression of the nucleotide sequence of interest, preferably encoding a FGF21 in a cell and/or in a subject.
- a promoter is operably linked to a coding sequence if the promoter is able to initiate or regulate the transcription or expression of a coding sequence, in which case the coding sequence should be understood as being "under the control of the promoter.
- An expression construct carries a genome that is able to stabilize and remain episomal in a cell.
- a cell may mean to encompass a cell used to make the construct or a cell wherein the construct will be administered.
- a construct is capable of integrating into a cell's genome, e.g. through homologous recombination or otherwise.
- a particularly preferred expression construct is one wherein a nucleotide sequence encoding a FGF21 as defined herein is operably linked to a promoter as defined herein wherein said promoter is capable of directing expression of said nucleotide sequence ⁇ i.e. coding sequence) in a cell.
- a FGF21 to be expressed in the liver, adipose tissue or skeletal muscle refers to the preferential or predominant (at least 10% higher, at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher or more) expression of FGF21 in the liver, adipose tissue or skeletal muscle as compared to other organs or tissues.
- the viral expression constructs of the invention comprise a nucleotide sequence in a form "suitable for expression in a mammal", which means that the viral expression constructs include one or more regulatory sequences, selected on the basis of the mammalian host cells to be used for expression, that is operatively linked to the nucleotide sequence to be expressed.
- said mammalian host cells to be used for expression are human, murine or canine cells.
- the viral expression constructs of the invention comprise a nucleotide sequence to be expressed in liver, adipose tissue and/or skeletal muscle.
- adipose tissue refers to tissue composed of mature adipocytes (i.e. fat cells) and a combination of small blood vessels, nerve tissue, lymph nodes and the stromal vascular fraction (SVF).
- SVF is composed of endothelial cells, fibroblasts, adipocyte precursor cells (i.e. preadipocytes), and immune cells such as macrophages and T cells.
- WAT white adipose tissue
- BAT brown adipose tissue
- the adipose tissue is contained in a multi-depot organ.
- Adipose depots include but are not limited to epidydymal WAT (eWAT), inguinal WAT (iWAT), retroperitoneal WAT (rWAT), mesenteric WAT (mWAT), interscapular BAT (iBAT).
- liver refers to the tissue composed of hepatocytes. Hepatocytes represent about 50-70% of the cells in the liver. In addition to hepatocytes, the liver is composed of endothelial cells, perisinusoidal cells, oval cells, Kupffer cells and stellate cells (Ito cells). When activated by Kupffer cells, the stellate cells transform into myofibroblasts.
- Central veins and portal tracks (portal triads) that contain preterminal branches of the hepatic artery, the hepatic portal vein, bile ductules and lymphatic vessels are also found in the liver.
- An expression cassette as used herein comprises or consists of a nucleotide sequence encoding a FGF21 , being operably linked to a promoter wherein said promoter is capable of directing expression of said nucleotide sequence.
- an expression cassette as used herein comprises or consists of a nucleotide sequence encoding a FGF21 , a promoter and at least one nucleotide sequence encoding a target sequence of a microRNA expressed in the liver and at least one nucleotide sequence encoding a target sequence of a microRNA expressed in the heart.
- the described expression cassettes contain nucleotide sequences encoding target sequences for a microRNA expressed in the liver and/or a microRNA expressed in the heart with perfect complementarity to their cognate microRNAs.
- the described expression cassettes contain one or more nucleotide sequence(s) encoding microRNA binding sites with imperfect complementarity (one mismatch/five consecutive nucleotides).
- the expression cassettes may contain both nucleotide sequences encoding perfect and imperfect microRNA binding sites. Expression cassettes can therefore be tailored to result in varying levels of regulation by using nucleotide sequences encoding single perfect, multiple perfect, single imperfect, multiple imperfect or a combination of perfect and imperfect target sites for microRNAs.
- nucleotide sequence encoding target sites for different microRNAs may be used, therefore permitting a gene to be regulated by multiple microRNAs.
- a preferred location for the nucleotide sequence encoding a target sequence of a microRNA is the 3'UTR.
- nucleotide sequences (encoding target sequences) inserted into either a coding sequence or 5 'UTR sequences may also be used.
- nucleotide sequence encoding a target sequence of a microRNA is determined by the desired expression pattern.
- the presence of an endogenous microRNA in a cell will inhibit expression of a gene or coding sequence from an expression construct which contains a nucleotide sequence encoding a target sequence for said microRNA.
- a nucleotide sequence encoding a target sequence that is recognized by a microRNA present in that cell-type is chosen.
- a nucleic acid or nucleotide sequence encoding a FGF21 is used in an expression construct or expression vector.
- expression vector or “vector” generally refers to a nucleotide sequence that is capable of effecting expression of a gene or a coding sequence in a host compatible with such sequences.
- These expression vectors typically include at least suitable promoter sequences and optionally, transcription termination signals. An additional factor necessary or helpful in effecting expression can also be used as described herein.
- a nucleic acid or DNA or nucleotide sequence encoding a FGF21 is incorporated into a DNA construct capable of introduction into and expression in an in vitro cell culture.
- a DNA construct is suitable for replication in a prokaryotic host, such as bacteria, e.g., E. coli, or can be introduced into a cultured mammalian, plant, insect, (e.g., Sf9), yeast, fungi or other eukaryotic cell lines.
- a DNA construct prepared for introduction into a particular host may include a replication system recognized by the host, an intended DNA segment encoding a desired polypeptide, and transcriptional and translational initiation and termination regulatory sequences operably linked to the polypeptide-encoding segment.
- operably linked has already been defined herein.
- a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence.
- DNA for a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of a polypeptide.
- a DNA sequence that is operably linked are contiguous, and, in the case of a signal sequence, both contiguous and in reading frame.
- enhancers need not be contiguous with a coding sequence whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof, or by gene synthesis.
- an appropriate promoter sequence generally depends upon the host cell selected for the expression of a DNA segment.
- suitable promoter sequences include prokaryotic, and eukaryotic promoters well known in the art (see, e.g. Sambrook and Russell, 2001, supra).
- a transcriptional regulatory sequence typically includes a heterologous enhancer or promoter that is recognised by the host.
- the selection of an appropriate promoter depends upon the host, but promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters are known and available (see, e.g. Sambrook and Russell, 2001, supra).
- An expression vector includes the replication system and transcriptional and translational regulatory sequences together with the insertion site for the polypeptide encoding segment.
- suitable expression vectors can be expressed in, yeast, e.g. S.cerevisiae, e.g., insect cells, e.g., Sf9 cells, mammalian cells, e.g., CHO cells and bacterial cells, e.g., E. coli.
- yeast e.g. S.cerevisiae
- insect cells e.g., Sf9 cells
- mammalian cells e.g., CHO cells
- bacterial cells e.g., E. coli.
- a cell may thus be a prokaryotic or eukaryotic host cell.
- a cell may be a cell that is suitable for culture in liquid or on solid media.
- a host cell is a cell that is part of a multicellular organism such as a transgenic plant or animal.
- a viral vector or a viral gene therapy vector is a vector that comprises a viral expression construct as defined above.
- a viral vector or a viral gene therapy vector is a vector that is suitable for gene therapy.
- Vectors that are suitable for gene therapy are described in Anderson 1998, Nature 392: 25-30; Walther and Stein, 2000, Drugs 60: 249-71; Kay et al, 2001, Nat. Med. 7: 33-40; Russell, 2000, J. Gen. Virol. 81 : 2573-604; Amado and Chen, 1999, Science 285: 674- 6; Federico, 1999, Curr. Opin. Biotechnol.10: 448-53; Vigna and Naldini, 2000, J. Gene Med. 2: 308-16; Marin et al, 1997, Mol. Med. Today 3: 396-403; Peng and Russell, 1999, Curr. Opin. Biotechnol. 10: 454-7; Sommerfelt, 1999, J. Gen. Virol. 80: 3049-64; Reiser, 2000, Gene Ther. 7: 910-3; and references cited therein.
- adenoviral vectors are modified to reduce the host response as reviewed by Russell (2000, supra).
- Method for gene therapy using AAV vectors are described by Wang et al, 2005, J Gene Med. March 9 (Epub ahead of print), Mandel et al, 2004, Curr Opin Mol Ther. 6(5):482-90, and Martin et al, 2004, Eye 18(11): 1049-55, Nathwani et al, N Engl J Med. 2011 Dec 22;365(25):2357- 65, Apparailly et al, Hum Gene Ther. 2005 Apr;16(4):426-34.
- a suitable gene therapy vector includes a retroviral vector.
- a preferred retroviral vector for application in the present invention is a lentiviral based expression construct. Lentiviral vectors have the ability to infect and to stably integrate into the genome of dividing and non-dividing cells (Amado and Chen, 1999 Science 285: 674-6). Methods for the construction and use of lentiviral based expression constructs are described in U.S. Patent No.'s 6,165,782, 6,207,455, 6,218,181, 6,277,633 and 6,323,031 and in Federico (1999, Curr Opin Biotechnol 10: 448-53) and Vigna et al (2000, J Gene Med 2000; 2: 308-16).
- Suitable gene therapy vectors include an adenovirus vector, a herpes virus vector, a polyoma virus vector or a vaccinia virus vector.
- a gene therapy vector comprises a nucleotide sequence encoding a FGF21 to be expressed, whereby said nucleotide sequence is operably linked to the appropriate regulatory sequences.
- Such regulatory sequence will at least comprise a promoter sequence.
- Suitable promoters for expression of a nucleotide sequence encoding a FGF21 from a gene therapy vector include e.g.
- CMV promoter viral long terminal repeat promoters (LTRs), such as those from murine moloney leukaemia virus (MMLV) rous sarcoma virus, or HTLV-1, the simian virus 40 (SV 40) early promoter, the CAG promoter, the a 1 -antitrypsin promoter, the mini/aP2 promoter, the mini/UCPl promoter, the C5-12 promoter and the herpes simplex virus thymidine kinase promoter.
- LTRs viral long terminal repeat promoters
- MMLV murine moloney leukaemia virus
- HTLV-1 HTLV-1
- SV 40 simian virus 40
- tTAER system that is based on the multi-chimeric transactivator composed of a tetR polypeptide, as activation domain of VP 16, and a ligand binding domain of an estrogen receptor (Yee et al, 2002, US 6,432,705).
- a gene therapy vector may optionally comprise a further nucleotide sequence coding for a further polypeptide.
- a gene therapy vector is preferably formulated in a composition or pharmaceutical composition as defined herein.
- a composition or pharmaceutical composition may comprise a suitable pharmaceutical carrier as earlier defined herein.
- Adeno-associated virus vector AAV vector
- Preferred ITRs are those of AAV2 which are represented by sequences comprising or consisting of SEQ ID NO: 48 (5 ' ITR) and SEQ ID NO: 49 (3' ITR).
- the invention also preferably encompasses the use of a sequence having at least 80% (or at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with SEQ ID NO: 48 as 5 'ITR and a sequence having at least 80% identity with SEQ ID NO: 49 as 3 'ITR.
- Protein shell comprised of capsid protein may be derived from an AAV serotype such as AAV1 , 2, 3, 4, 5 and others.
- a preferred AAV capsid is an AAV1 , AAV3, AAV8, AAV9 capsid.
- a preferred ITR is from the AAV2.
- a protein shell may also be named a capsid protein shell.
- rAAV vector may have one or preferably all wild type AAV genes deleted, but may still comprise functional ITR nucleic acid sequences. Functional ITR sequences are necessary for the replication, rescue and packaging of AAV virions.
- the ITR sequences may be wild type sequences or may have at least 80%>, 85%, 90%>, 95%, 97%, 98%), 99% or 100% sequence identity with wild type sequences or may be altered by for example in insertion, mutation, deletion or substitution of nucleotides, as long as they remain functional.
- functionality refers to the ability to direct packaging of the genome into the capsid shell and then allow for expression in the host cell to be infected or target cell.
- a capsid protein shell may be of a different serotype than the rAAV vector genome ITR.
- AAV helper functions generally refers to the corresponding AAV functions required for rAAV replication and packaging supplied to the rAAV vector in trans.
- AAV helper functions complement the AAV functions which are missing in the rAAV vector, but they lack AAV ITRs (which are provided by the rAAV vector genome).
- AAV helper functions include the two major ORFs of AAV, namely the rep coding region and the cap coding region or functional substantially identical sequences thereof. Rep and Cap regions are well known in the art, see e.g. Chiorini et al. (1999, J. of Virology, Vol 73(2): 1309-1319) or US 5,139,941, incorporated herein by reference.
- a “transgene” is herein defined as a gene or a coding sequence or a nucleic acid molecule (i.e. a molecule encoding a FGF21) that has been newly introduced into a cell, i.e. a gene that may be present but may normally not be expressed or expressed at an insufficient level in a cell.
- "insufficient” means that although said FGF21 is expressed in a cell, a condition and/or disease as defined herein could still be developed.
- the invention allows the over-expression of a FGF21.
- the transgene may comprise sequences that are native to the cell, sequences that naturally do not occur in the cell and it may comprise combinations of both.
- a transgene may contain sequences coding for a FGF21 and/or additional proteins as earlier identified herein that may be operably linked to appropriate regulatory sequences for expression of the sequences coding for a FGF21 in the cell.
- the transgene is not integrated into the host cell's genome.
- Transduction refers to the delivery of a FGF21 into a recipient host cell by a viral vector.
- transduction of a target cell by a rAAV vector of the invention leads to transfer of the rAAV genome contained in that vector into the transduced cell.
- Home cell or “target cell” refers to the cell into which the DNA delivery takes place, such as the muscle cells of a subject.
- AAV vectors are able to transduce both dividing and non- dividing cells.
- the rAAV genome present in a rAAV vector comprises at least the nucleotide sequences of the inverted terminal repeat regions (ITRs) of one of the AAV serotypes (preferably the ones of serotype AAV2 as disclosed earlier herein), or nucleotide sequences substantially identical thereto or nucleotide sequences having at least 60% identity thereto, and nucleotide sequence encoding a FGF21 (under control of a suitable regulatory element) inserted between the two ITRs.
- ITRs inverted terminal repeat regions
- the complete genome of several AAV serotypes and corresponding ITR has been sequenced (Chiorini et al. 1999, J. of Virology Vol. 73, No.2, pl309-1319). They can be either cloned or made by chemical synthesis as known in the art, using for example an oligonucleotide synthesizer as supplied e.g. by Applied Biosystems Inc. (Fosters, CA, USA) or by standard molecular biology techniques.
- the ITRs can be cloned from the AAV viral genome or excised from a vector comprising the AAV ITRs.
- the ITR nucleotide sequences can be either ligated at either end to the nucleotide sequence encoding one or more therapeutic proteins using standard molecular biology techniques, or the AAV sequence between the ITRs can be replaced with the desired nucleotide sequence.
- the rAAV genome as present in a rAAV vector does not comprise any nucleotide sequences encoding viral proteins, such as the rep (replication) or cap (capsid) genes of AAV.
- This rAAV genome may further comprise a marker or reporter gene, such as a gene for example encoding an antibiotic resistance gene, a fluorescent protein ⁇ e.g. gfp) or a gene encoding a chemically, enzymatically or otherwise detectable and/or selectable product ⁇ e.g. lacZ, aph, etc.) known in the art.
- the rAAV genome as present in said rAAV vector further comprises a promoter sequence operably linked to the nucleotide sequence encoding a FGF21.
- Preferred promoter sequences are promoters which confer expression in skeletal muscle cells and/or skeletal muscle, in liver cells and/or liver and in adipose cells and /or adipose tissue. Examples of such promoters include a CMV, a CAG, a mini/aP2, a mini/UCPl, a C5-12 and a hAAT promoter as earlier defined herein.
- Codon optimization refers to the processes employed to modify an existing coding sequence, or to design a coding sequence, for example, to improve translation in an expression host cell or organism of a transcript RNA molecule transcribed from the coding sequence, or to improve transcription of a coding sequence.
- Codon optimization includes, but is not limited to, processes including selecting codons for the coding sequence to suit the codon preference of the expression host organism. For example, to suit the codon preference of mammalians, preferably of murine, canine or human expression hosts. Codon optimization also eliminates elements that potentially impact negatively RNA stability and/or translation (e. g. termination sequences, TATA boxes, splice sites, ribosomal entry sites, repetitive and/or GC rich sequences and RNA secondary structures or instability motifs).
- indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements.
- the indefinite article “a” or “an” thus usually means “at least one”.
- FIG. 1 Prevention of obesity by intra-eWAT administration of AAV9-CAG- moFGF21-dmiRT vectors in C57B16 mice.
- A Schematic representation of the AAV- CAG-moFGF21-doublemiRT vectors.
- the expression cassette contained the CAG promoter, a murine codon-optimized FGF21 coding sequence and four tandem repeats of the miRT122a sequence and four tandems repeats of the miRTl sequence cloned in the 3' untranslated region of the expression cassette. ITRs from AAV2 flanked the expression cassette.
- the schematic representation is not to scale.
- CAG chicken ⁇ -actin promoter/CMV enhancer; pA: polyA.
- B Expression levels of FGF21 in metabolic tissues.
- D-E Expression levels of FGF21R1 (D) and ⁇ -Klotho (E) in metabolic tissues.
- (F) Body weight evolution. Body weight was measured weekly (n 8-11 animals/group). (G) Representative image of animals.
- FIG. 1 Histological analysis of adipose tissue and liver of C57B16 mice treated intra-eWAT with AAV9-CAG-moFGF21-doublemiRT vectors.
- A Representative images of sections stained with hematoxylin and eosin of epididymal white adipose tissue (eWAT), inguinal white adipose tissue (iWAT) interscapular brown adipose tissue (iBAT) and liver of chow- and HFD-fed C57B16 mice treated intra-eWAT with AAV9- CAG-moFGF21-doublemiRT or AAV9-CAG-null vectors.
- Original magnification XI 00 Original magnification XI 00.
- UCP1 UCP1
- Dio2 B.
- the expression levels of the murine codon-optimized FGF21 coding sequence were measured by RTqPCR in eWAT, iWAT, iBAT and liver of ob/ob mice, and normalized with RplpO values
- B Circulating levels of FGF21.
- C-D Body weight
- D body weight gain
- Body weight was measured weekly.
- E Weight of tissues. Weight of eWAT, iWAT, rWAT, mWAT, iBAT and liver of ob/ob mice treated intra-eWAT with AAV vectors.
- eWAT epididymal white adipose tissue.
- iWAT inguinal white adipose tissue.
- rWAT retroperitoneal white adipose tissue.
- mWAT mesenteric white adipose tissue.
- FIG. 5 Improved insulin sensitivity in ob/ob mice treated intra-eWAT with AAV8-CAG-moFGF21-doublemiRT vectors.
- A Intraperitoneal insulin tolerance test. Ob/ob mice were given an intraperitoneal injection of 0.75 U insulin/kg body weight and blood glucose levels were measured at the indicated time points. The test was performed 9 weeks post-AAV administration.
- FIG. 1 Schematic representation of AAV-hAAT-moFGF21 vectors.
- the expression cassette contained the human a 1 -antitrypsin (hAAT) promoter and a murine codon-optimized FGF21 coding sequence. ITRs from AAV2 flanked the expression cassette. The schematic representation is not to scale.
- pA polyA.
- B Expression levels of FGF21. The expression levels of the murine codon-optimized FGF21 coding sequence were measured by RTqPCR in the liver of ob/ob mice, and normalized with RplpO values.
- C Circulating levels of FGF21.
- D-E Body weight (C) and body weight gain (D) evolution. Body weight was measured weekly.
- H Intraperitoneal insulin tolerance test. Ob/ob mice were given an intraperitoneal injection of 0.75 U insulin/kg body weight and blood glucose levels were measured at the indicated time points. The test was performed 9 weeks post-AAV administration.
- FIG. 7 Long-term reversion of obesity by intravenous administration of AAV- h AAT-moFGF21 vectors in HFD-fed C57bl6 mice.
- A Circulating levels of FGF21.
- FIG. 8 Long-term increased energy expenditure and insulin sensitivity by intravenous administration of AAV-hAAT-moFGF21 vectors in HFD-fed C57B16 mice.
- A Energy metabolism. The energy expenditure (EE) was measured with indirect open circuit calorimeter. Oxygen consumption and carbon dioxide production were monitored simultaneously. Data were taken 4 weeks post-AAV administration during the light cycle (basal state) and dark cycle (activity phase) and adjusted for body weight.
- B Intraperitoneal insulin tolerance test. C57B16 mice were given an intraperitoneal injection of 0.75 U insulin/kg body weight and blood glucose levels were measured at the indicated time points. The test was performed 7 weeks post-AAV administration.
- C Fasted and fed insulin circulating levels.
- FIG. 9 Reversion of obesity by intravenous administration of AAV-hAAT- moFGF21 vectors in old HFD-fed mice.
- A Circulating levels of FGF21.
- FIG. 10 Increased energy expenditure and insulin sensitivity by intravenous administration of AAV-hAAT-moFGF21 vectors in old HFD-fed mice.
- A Energy metabolism. The energy expenditure (EE) was measured with indirect open circuit calorimeter. Oxygen consumption and carbon dioxide production were monitored simultaneously. Data were taken 6 weeks post-AAV administration during the light cycle (basal state) and dark cycle (activity phase) and adjusted for body weight.
- B Intraperitoneal insulin tolerance test. Old C57B16 mice were given an intraperitoneal injection of 0.75 U insulin/kg body weight and blood glucose levels were measured at the indicated time points. The test was performed 9 weeks post-AAV administration.
- C Fasted and fed insulin circulating levels.
- FIG. 11 Body weight loss by intramuscular administration of AAV-CMV- moFGF21 vectors in C57B16 mice.
- A Schematic representation of the AAV-CMV- moFGF21 vectors. The expression cassette contained the cytomegalovirus (CMV) promoter and a murine codon-optimized FGF21 coding sequence. ITRs from AAV2 flanked the expression cassette. The schematic representation is not to scale.
- pA polyA.
- B Circulating FGF21 levels.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- FIG. 12 Increased FGF21 protein production by codon-optimization of nucleotide sequences encoding human FGF21.
- A,B Representative images of the hematoxylin-eosin staining of (A) eWAT and (B) liver tissue sections obtained from ob/ob animals injected intra-eWAT either null or FGF21 -encoding AAV8 vectors at all doses tested. Scale bars: 100 ⁇ for eWAT and 200 ⁇ for liver.
- FGF21 labels in the figure refer to moFGF21.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- Data information: All values are expressed as mean ⁇ SEM. In (A, B, D) n 4-8 animals/group. *P ⁇ 0.05, **P ⁇ 0.01 and ***P ⁇ 0.001 versus null-injected ob/ob group.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- Data information: All data represent the mean ⁇ SEM. In (A-C, E, G-H) n 9-10 animals/group. *P ⁇ 0.05, **P ⁇ 0.01 and ***P ⁇ 0.001 versus null-injected ob/ob group.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- AAV8-hAAT-moFGF21 treatment increases the expression of genes involved in glucose uptake and thermogenesis in adipose tissue of ob/ob mice.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- FIG. 1 AAV8-mediated liver gene transfer of FGF21 counteracts HFD-induced obesity.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- Data information: All values are expressed as mean ⁇ SEM. In (A-D) « 7-10 animals/group. *P ⁇ 0.05, **P ⁇ 0.01 and ***P ⁇ 0.001 versus the chow-fed Null-injected group. ⁇ 0.05, ⁇ 0.01 and ⁇ 0.001 versus the HFD-fed Null-injected group. HFD, High-fat diet.
- FIG. 19 FGF21 gene transfer to the liver counteracts HFD-induced obesity.
- A B Representative images of animals belonging to all experimental groups of the studies performed in young adults (A) or in adults (B).
- the qPCR was performed with primers that specifically detected the codon-optimized murine FGF21 (coFGF21) coding sequence.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- Figure 21 Energy expenditure 10 months after gene transfer to the liver.
- a Energy expenditure was measured 10 months after AAV8-hAAT-null or AAV8- hAAT-moFGF21 vector delivery in the cohort of animals that initiated HFD- feeding at 2 months of age. Data were taken during the light and dark cycles.
- a representative immunoblot is shown ⁇ left).
- the graph shows the densitometric analysis of two different immunoblots ⁇ right).
- Figure 22 AAV8-hAAT-moFGF21 -mediated reversal of islet hyperplasia.
- FGF21 vectors as adults are the FGF21 vectors as adults.
- FIG. 23 Treatment with AAV8-hAAT-moFGF21 improves glucose tolerance.
- a Glucose tolerance was studied in the group of mice that initiated the HFD feeding and received FGF21 vectors as young adults after an intraperitoneal injection of glucose (2 g/kg body weight).
- FIG. 24 Reversal of WAT hypertrophy and inflammation by AAV8-hAAT- moFGF21 treatment.
- FIG. 26 Treatment with FGF21-encoding vectors reverses hepatic steatosis and inflammation.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- Figure 27 AAV8-hAAT-moFGF21 -mediated amelioration of liver fibrosis.
- FIG. 28 AAV8-hAAT-moFGF21 treatment improves liver fibrosis.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- FIG. 29 No bone abnormalities were observed in AAV8-hAAT-moFGF21-treated animals.
- the long-term effects of FGF21 gene transfer on bones were studied by comparison of HFD-fed mice treated with the highest dose (5xl0 10 vg/mouse) of AAV8- hAAT-moFGF21 vectors as young adults or adults with null-injected, chow or HFD-fed animals.
- C-0 Micro-computed tomography ⁇ CT) analysis of the epiphysis (C-J) and the diaphysis (K-O) of tibiae obtained at the time of sacrifice, i.e. when animals were 18 months of age, from HFD-fed mice administered with either null or FGF21- encoding AAV vectors.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- A, P-Q) n 7- 10 animals/group.
- HFD High-fat diet
- BMD bone mineral density
- BMC bone mineral content
- BV bone volume
- BV/TV bone volume/tissue volume ratio
- BS/BV bone surface/bone volume ratio
- Tb.N trabecular number
- Tb.Th trabecular thickness
- Tb.Sp trabecular separation.
- FIG. 30 Analysis of glycaemic profiles in C57B16 mice treated with AAV8-hAAT- moFGF21 vectors. Blood glucose levels were evaluated under fed conditions.
- STZ treatment with streptozotocin (5x50mg/kg). Results shown are means + SEM. * p ⁇ 0.05; *** p ⁇ 0.001 vs AAV8-hAAT-Null.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- Figure 31 Gene transfer of FGF21 to the skeletal muscle of healthy animals.
- a Circulating levels of FGF21 measured 40 weeks after injection of 3xl0 n vg/mouse of either AAVl-CMV-Null or AAVl-CMV-moFGF21 vectors to the skeletal muscle of healthy animals fed a chow diet.
- Insulin sensitivity assessed through intraperitoneal injection of insulin (0.75 units/kg body weight) and represented as percentage of initial blood glucose.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- Figure 32 AAVl-mediated skeletal muscle gene transfer of FGF21 counteracts HFD-induced obesity and insulin resistance.
- A B Evolution of body weight (A) and body weight gain (B) in animals treated with AAVl-CMV-moFGF21.
- C57B16 mice were fed a HFD for -12 weeks and then administered with 3xl0 u vg/mouse of AAVl -CMV-moFGF21 vectors.
- Control obese mice and control chow-fed mice received 3xl0 u vg of AAVl-CMV-null.
- C Circulating levels of FGF21 at different time-points after vector administration.
- D E Fasted blood glucose (D) and fed serum insulin (E) levels in the same groups of animals as in (A, B).
- Insulin sensitivity was determined in all experimental groups after an intraperitoneal injection of insulin (0.75 units/kg body weight). Results were calculated as the percentage of initial blood glucose levels.
- FGF21 labels in the figure refer to moFGF21 in accordance with this Figure legend.
- Data information All values are expressed as mean ⁇ SEM.
- FIG. 34 In vitro increased FGF21 expression levels by hAAT-moFGF21, CAG- moFGF21-doublemiRT and CMV-moFGF21 expression cassettes.
- A Expression levels of FGF21 in HEK293 cells transfected with plasmids encoding the WT murine FGF21 coding sequence under the control of the EFla promoter (EFla-mFGF21) or a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter (CMV-moFGF21) or of the CAG promoter in conjunction with four tandem repeats of the miRT122a sequence and four tandems repeats of the miRTl sequence (CAG-moFGF21 -doublemiRT).
- B and C Intracellular FGF21 protein content (B) and FGF21 protein levels in the culture medium (C) in the same cells as in (A).
- D Expression levels of FGF21 in C2C12 cells transfected with plasmids encoding the WT murine FGF21 coding sequence under the control of the EF 1 a promoter (EF 1 a-mFGF21 ) or a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter (CMV-moFGF21).
- FIG. 35 In vivo increased hepatic FGF21 expression and FGF21 circulating levels by hAAT-moFGF21 and CMV-moFGF21 expression cassettes.
- A Expression levels of FGF21 in the liver of C57B16 mice hydrodynamically administered with plasmids encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (EFla-mFGF21) or a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter (CMV-moFGF21) or the hAAT promoter (hAAT-moFGF21).
- EFla elongation factor la
- CMV-moFGF21 CMV promoter
- hAAT-moFGF21 hAAT-moFGF21
- FIG. 36 In vivo increased hepatic FGF21 expression and FGF21 circulating levels by AAV8-h AAT-moFGF21.
- A Expression levels of FGF21 in the liver of C57B16 mice intravenously administered with lxlO 10 vg, 2xl0 10 vg or 5xl0 10 vg of AAV8 vectors encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (AAV8-EFla-mFGF21) or a codon-optimized murine FGF21 coding sequence under the control of the hAAT promoter (AAV8-fiAAT- moFGF21).
- EFla elongation factor la
- AAV8-fiAAT- moFGF21 a codon-optimized murine FGF21 coding sequence under the control of the hAAT promoter
- FIG. 37 In vivo increased adipose FGF21 expression by AAV8-CAG-moFGF21- dmiRT.
- A-B Expression levels of FGF21 in the eWAT (A) or the liver (B) of C57B16 mice administered intra-eWAT with 2x10 10 vg, 5xl0 10 vg or lxlO 11 vg of either AAV8 vectors encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (AAV8-EFla-mFGF21) or AAV8 vectors encoding a codon-optimized murine FGF21 coding sequence under the control of the CAG promoter in conjunction with four tandem repeats of the miRT122a sequence and four tandems repeats of the miRTl sequence (AAV8-CAG-moFGF21-doublemiRT).
- EFla elongation factor la
- FIG 38 In vivo increased FGF21 expression in the skeletal muscle by AAV1- CMV-moFGF21.
- A-B Expression levels of FGF21 in the quadriceps (A) or the liver (B) of C57B16 mice administered intramuscularly with 5xl0 10 vg, lxlO 11 vg or 3xl0 n vg of either AAV8 vectors encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (AAV8-EFla-mFGF21) or AAV1 vectors encoding a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter (AAV1-CMV-FGF21).
- EFla elongation factor la
- AAV8-EFla-mFGF21 AAV1 vectors encoding a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter
- mice Male C57B1/6J mice and B6.V-Zep°*/01aHsd (ob/ob) mice were used. Mice were fed ad libitum with a standard diet (2018S Teklad Global Diets®, Harlan Labs., Inc., Madison, WI, US) or a high fat diet (TD.88137 Harlan Teklad Madison, WI, US ) and kept under a light-dark cycle of 12 h (lights on at 8:00 a.m.) and stable temperature (22°C ⁇ 2).
- a standard diet 2018S Teklad Global Diets®, Harlan Labs., Inc., Madison, WI, US
- TD.88137 Harlan Teklad Madison, WI, US high fat diet
- mice were anesthetized by means of inhalational anesthetic isoflurane (IsoFlo®, Abbott Laboratories, Abbott Park, IL, US) and decapitated. Tissues of interest were excised and kept at -80°C or with formalin until analysis. All experimental procedures were approved by the Ethics Committee for Animal and Human Experimentation of the Universitat Autonoma de Barcelona. Recombinant AAV vectors
- Single-stranded AAV vectors of serotype 1 , 8 or 9 were produced by triple transfection of HEK293 cells according to standard methods (Ayuso, E. et al, 2010. Curr Gene Ther. 10(6 ⁇ :423-36).
- Cells were cultured in 10 roller bottles (850 cm 2 , flat; CorningTM, Sigma- Aldrich Co., Saint Louis, MO, US) in DMEM 10% FBS to 80% confluence and co- transfected by calcium phosphate method with a plasmid carrying the expression cassette flanked by the AAV2 ITRs, a helper plasmid carrying the AAV2 rep gene and the AAV of serotypes 1, 8 or 9 cap gene, and a plasmid carrying the adenovirus helper functions.
- Transgenes used were: murine, canine or human codon-optimized or wt FGF21 coding- sequence driven by 1) the cytomegalovirus (CMV) early enhancer/chicken beta actin (CAG) promoter with the addition of four tandem repeats of the miRT122a sequence (5 'CAAACACCATTGTCACACTCCA3 ') (SEQ ID NO: 12) and four tandems repeats of the miRTl sequence (5 'TTACATACTTCTTTACATTCCA3 ') (SEQ ID NO: 13) cloned in the 3 ' untranslated region of the expression cassette; 2) the CMV promoter; or 3) the human a 1 -antitrypsin promoter (hAAT).
- CMV cytomegalovirus
- CAAG cytomegalovirus
- Noncoding plasmids carrying the CAG, hAAT or CMV promoters were used to produce null vectors.
- AAV were purified with an optimized method based on a polyethylene glycol precipitation step and two consecutive cesium chloride (CsCl) gradients. This second-generation CsCl-based protocol reduced empty AAV capsids and DNA and protein impurities dramatically (Ayuso, E. et al, 2010. Curr Gene Ther. 10(6):423-36).
- Purified AAV vectors were dialyzed against PBS, filtered and stored at -80°C.
- Titers of viral genomes were determined by quantitative PCR following the protocol described for the AAV2 reference standard material using linearized plasmid DNA as standard curve (Lock M, et al, Hum. Gene Ther. 2010; 21 : 1273-1285).
- the vectors were constructed according to molecular biology techniques well known in the art.
- mice were anesthetized with an intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg).
- a laparotomy was performed in order to expose the epididymal white adipose tissue.
- AAV vectors were resuspended in PBS with 0.001% Pluronic® F68 (Gibco) and injected directly into the epididymal fat pad.
- Each epididymal fat pad was injected twice with 50 ⁇ of the AAV solution (one injection close to the testicle and the other one in the middle of the fat pad).
- the abdomen was rinsed with sterile saline solution and closed with a two-layer approach.
- the appropriate amount of the AAV solution was diluted in 200 of PBS with 0.001% Pluronic® and was manually injected into the lateral tail vein without exerting pressure at the moment of delivery.
- the animals were put under a 250 W infrared heat lamp (Philips NV, Amsterdam, NL) for a few minutes to dilate the blood vessels and facilitate viewing and easier access to the tail vein.
- a plastic restrainer Harvard Apparatus, Holliston, MA, US was used to secure the animal for injection. No anesthesia was used since an appropriate restraining device was employed.
- a 30-gauge needle was utilized to inject the animals.
- mice were anesthetized with an intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg).
- Hind limbs were shaved and vectors were administered by intramuscular injection in a total volume of 180 ⁇ divided into six injection sites distributed in the quadriceps, gastrocnemius, and tibialis cranealis of each hind limb.
- Tissues were fixed for 24 h in formalin (Panreac Quimica), embedded in paraffin, and sectioned. Tissue samples were stained with hematoxylin-eosin. Adipocyte area was determined in 12 hematoxylin/eosin WAT images per animal taken at 10 X with the Nikon Eclipse E800 microscope (Nikon, Tokyo, Japan) connected to a videocamera with a monitor with an image analysis software (analySIS 3.0; Soft Imaging System, Center Valley, PA, EEUU) and each adipocyte area was quantified in ⁇ 2 . Mean adipocyte area was calculated for each experimental group and distribution of adipocytes according to size categories was represented in a histogram. Four animals per group were used and at least 250 adipocytes per animal were analyzed.
- ThermoFisher goat anti-guinea pig IgG (Alexa Fluor 488-conjugated) (1 :300; Al 1073;
- ThermoFisher or rabbit anti-guinea pig coupled to peroxidase (1 :300; P0141; Dako) were used as secondary antibodies.
- the ABC peroxidase kit (Pierce) was used for immunodetection, and sections were counterstained in Mayer's hematoxylin. Hoechst
- PicroSirius Red staining and Masson's trichrome staining were used to evaluate fibrosis.
- RNA analysis The percentage of ⁇ -cell area in the pancreas was analyzed in two insulin-stained sections 200 ⁇ apart, by dividing the area of all insulin+ cells in one section by the total pancreas area of that section, ⁇ -cell mass was calculated by multiplying pancreas weight by percentage of ⁇ -cell area, as previously described (Jimenez et al, 2011).
- Qiagen NV agen NV
- Tripure isolation reagent Roche Diagnostics Corp., Indianapolis, IN, US
- RNeasy Lipid Tissue Minikit Qiagen NV, Venlo, NL
- DNAsel Qiagen NV, Venlo, NL
- the aqueous superior phase was eliminated using a Pasteur pipet and 1 ml of the inferior lipid phase was recuperated in a glass tube.
- 1 ml of a chloroform and Triton X- 100 at 1 % solution was added to the glass tube and it was incubated at 90° C in a bath, to evaporate the chloroform.
- chloroform and Triton X-100 mix any remaining aquous particle was eliminated from the lipid phase.
- chloroform was rinsed to the walls of the tube to concentrate the sample and, it was warmed again at 90° C to evaporate the chloroform.
- Glycemia was determined using a Glucometer EliteTM (Bayer). Glucagon levels were measured using a glucagon Radioimmunoassay (#GL-32K, EMD Millipore). Adiponectin, leptin, IGFBP1 and IGF1 were determined using the Mouse Adiponectin ELISA kit (80569, Crystal Chem), the Mouse Leptin ELISA kit (90030, Crystal Chem), the IGFBP1 (Mouse) ELISA kit (KA3054, Abnova) and the m/r IGF-I-ELISA kit (E25, Mediagnost), respectively.
- Glucose tolerance test For insulin tolerance tests, insulin (0.75 IU/kg body wt; Humulin Regular; Eli Lilly, Indianapolis, IN) was injected intraperitoneally into awake fed mice. Glucose concentration was determined in blood samples obtained from the tail vein at the indicated time points after the insulin injection. Glucose tolerance test
- mice were fasted overnight (16 h) and administered with an intraperitoneal injection of glucose (2 g/kg body weight). Glycemia was measured in tail vein blood samples at the indicated time points. Venous blood was collected from tail vein in tubes (Microvette® CB 300, SARSTEDT) at the same time points and immediately centrifuged to separate serum, which was used to measure insulin levels.
- An indirect open circuit calorimeter (Oxylet, Panlab, Cornelia, Spain) was used to monitor oxygen consumption, carbon dioxide production in eight metabolic chambers simultaneously. Mice were individualized and acclimated to the metabolic chambers for 24h, and data were collected every 15min for 3min in each cage for other 24h. Data were taken from the light and dark cycle and adjusted for body weight. To calculate energy expenditure the Metabolism software provided by the manufacturer was used. Transfection of HEK293, C2C12 and HepG2 cells
- Cells were cultured in a 24-well plate and transfected with 0.8 ⁇ g of DNA per well using Lipofectamine 2000 following the manufacturer's instructions (Thermo Fisher Scientific).
- Bone volume and architecture were evaluated by ⁇ Mouse tibiae were fixed in neutral buffered formalin (10%) and scanned using the explore Locus CT scanner (General Electric) at 27-micron resolution. Trabeculae were analyzed in 1 mm3 of proximal tibial epiphysis and 1.8 mm3 of cortical tibial diaphysis in 4 mice/group. Bone parameters were calculated with the Micro View 3D Image Viewer & Analysis Tool. The length of the tibia was measured from the intercondilar eminence to the medial malleolus. Western blot analysis
- iWAT and iBAT were homogenized in QIAzol Lysis Reagent (Qiagen) and the protein fraction was isolated from the organic phase following the manufacturer's instructions. Proteins were separated by 12% SDS-PAGE, and analyzed by immunob lotting with rabbit polyclonal anti-UCPl (ab 10983; Abeam) and rabbit polyclonal anti-a-tubulin (ab4074; Abeam) antibodies. Detection was performed using ECL Plus detection reagent (Amersham Biosciences).
- the open field test was performed between 9:00 am and 1 :00 pm as previously reported(Haurigot et al, 2013). Briefly, animals were placed in the center of a brightly lit chamber (41x41x30 cm) crossed by 2 bundles of photobeams (LE 8811; Panlab) that detect horizontal and vertical movements. Motor and exploratory activities were evaluated during the first 6 minutes. The total distance covered was evaluated using a video tracking system (SMART Junior; Panlab).
- Example 1 Prevention of obesity and diabetes by intra-eWAT administration of AAV-CAG-moFGF21-dmiRT vectors in C57B16 mice
- Intra-eWAT eWAT: epididymal white adipose tissue
- AAV9-CAG-moFGF21-doublemiRT-treated mice also showed overexpression of the FGF21 receptorl (FGF21R1) in eWAT (FIG ID) and ⁇ -Klotho (a FGF21 co-receptor) in adipose tissue and liver (FIG IE) in comparison with AAV9-CAG-null vectors (vectors that retain equal infectivity but do not encode any transgene).
- FGF21R1 FGF21 receptorl
- ⁇ -Klotho a FGF21 co-receptor
- mice fed a chow diet showed loss of body weight (FIGs IF and 1G).
- FFD high fat diet
- animals overexpressing FGF21 in adipose tissue remained lean for the duration of the experiment whereas AAV9-CAG-null treated mice became progressively obese (FIGs IF and 1G).
- FFD high fat diet
- mice overexpressing FGF21 in adipose tissue remained lean for the duration of the experiment whereas AAV9-CAG-null treated mice became progressively obese (FIGs IF and 1G).
- both chow- and HFD-fed AAV9-CAG-moFGF21 -doublemiRT -treated mice showed decreased weight of adipose depots and liver (FIG 1H).
- Liver histologic sections showed decreased lipid accumulation in hepatocytes of mice overexpressing FGF21 compared with AAV9-C AG-null-treated mice both under chow or HFD (FIG 2A). Accordingly, HFD-fed AAV9-CAG-moFGF21 -doublemiRT-treated mice normalized their hepatic content of tryglycerides (TG) (FIG 3D). In parallel, circulating levels of TG, total cholesterol, HDL-cholesterol and LDL-cholesterol were normalized in HFD-fed mice overexpressing FGF21 (FIGs 3E and 3F).
- TG tryglycerides
- HFD-fed mice overexpressing FGF21 were more insulin sensitive than HFD-fed AAV9- null treated mice (FIG 3G) and both chow- and HFD-fed AAV9-CAG-moFGF21- doublemiRT-treated mice showed decreased insulin circulating levels in comparison with their AAV9-CAG-null treated counterparts (FIG 3H).
- Example 2 Reversion of obesity and improvement of glucose metabolism by intra- eWAT administration of AAV-CAG-moFGF21-dmiRT vectors in ob/ob mice
- Intra-eWAT administration of AAV8-CAG-moFGF21-doublemiRT vectors mediated specific overexpression of FGF21 in white adipose tissue as well as high secretion of the protein into the bloodstream in a dose-dependent manner (FIGs 4 A and 4B).
- the dose of 10 12 vg of AAV8-CAG-moFGF21-doublemiRT vectors mediated a very robust overexpression of FGF21 in eWAT and iWAT (FIG 4 A) and achieved the highest circulating FGF21 levels (FIG 4B).
- Example 3 Reversion of obesity and improvement of glucose metabolism by intravenous administration of AAV-hAAT-moFGF21 vectors in ob/ob mice
- ob/ob animals were administered IV with 5xlO u vg of AAV8-hAAT-null vectors.
- the hAAT-moFGF21 construct is comprised in SEQ ID NO: 34 and the hAAT -null construct is comprised in SEQ ID NO:33.
- Intravenous administration of AAV8-hAAT-moFGF21 vectors mediated specific overexpression of FGF21 in the liver as well as high secretion of the protein into the bloodstream in a dose-dependent manner (FIGs 6B and 6C).
- the dose of 5xlO u vg of AAV8-hAAT-moFGF21 vectors mediated a very robust overexpression of FGF21 in the liver (FIG 6B) and achieved the highest circulating FGF21 levels (FIG 6C).
- mice treated with this dose of AAV8-hAAT-moFGF21 vectors decreased approximately 7% during the two first weeks after AAV administration and afterwards slightly increased whereas AAV8-fiAAT-null-treated mice progressively put on weight (FIGs 6D, 6E and 6F).
- Mice administered with 10 11 vg of AAV8-hAAT- moFGF21 vectors gained markedly much less weight than AAV8 -hAAT -null-treated animals (FIGs 6D, 6E and 6F).
- AAV8 -hAAT -null animals showed a 50% increase in their body weight at the end of the experiment in comparison with the 10% weight gain of animals treated with 10 11 vg of AAV8-hAAT-moFGF21 vectors (FIG 6E).
- animals overexpressing FGF21 in the liver showed significant decreased adiposity, particularly in those animals treated with the highest dose of vectors, and approximately a 60% reduction of the liver weight (FIG 6G).
- iBAT weight was similarly increased in both groups of AAV8-hAAT-moFGF21 -treated mice (FIG 6G), probably due to higher thermogenic activity in these animals in comparison with mice administered with AAV8-hAAT-null vectors.
- Animals treated with AAV8-hAAT-moFGF21 vectors showed improved insulin sensitivity and decreased insulin circulating levels in comparison with AAV8-hAAT- null-treated mice (FIGs 6H and 61)
- Example 4 Long-term reversion of obesity and diabetes by intravenous administration of AAV-hAAT-moFGF21 vectors in HFD-fed mice
- mice Nine -week-old male C57B16 mice (young adults) were fed a HFD for 9 weeks and then administered IV with 10 10 vg or 5xl0 10 vg of AAV8-hAAT-moFGF21 vectors (FIG 6A). After AAV administration, AAV8-hAAT- moFGF21 -treated mice were maintained on HFD for 52 weeks. As controls, 5xl0 10 vg of AAV8-hAAT-null were administered IV to chow- and HFD-fed C57B16 mice. These two latter cohorts of mice were maintained either on chow diet or HFD thereafter.
- Intravenous administration of AAV8-hAAT-moFGF21 vectors in HFD-fed mice mediated high secretion of FGF21 into the bloodstream in a dose-dependent manner (FIGs 7A).
- FIGs 7B and 7C No differences in body weight were observed between HFD-fed AAV8 -null-treated mice and HFD-fed animals administered with 10 10 vg of AAV8-hAAT-moFGF21 vectors.
- mice treated with 5xl0 10 vg of AAV8-hAAT- moFGF21 vectors during the light and dark cycles was higher than that of chow- and HFD-fed AAV8-hAAT-null mice (FIG 8A).
- No differences in energy expenditure were observed among chow- and HFD-fed AAV8-hAAT -null-treated animals and mice administered with 10 10 vg of AAV8-hAAT-moFGF21 vectors (FIG 8 A).
- mice treated with 5x10 10 vg of AAV8-hAAT-moFGF21 have increased thermogenic activity.
- mice were maintained either on chow diet or HFD thereafter.
- Intravenous administration of AAV8-hAAT-moFGF21 vectors in old HFD-fed mice mediated high secretion of FGF21 into the bloodstream in a dose-dependent manner (FIGs 9A).
- No differences in body weight were observed between HFD-fed AAV8 -null-treated mice and HFD-fed animals administered with 10 10 vg of AAV8-hAAT-moFGF21 vectors (FIGs 9B and 9C).
- HFD-fed animals treated with either 2x10 10 vg or 5x10 10 vg of AAV8-hAAT-moFGF21 vectors initially lost 15 and 20%, respectively, of body weight after AAV administration (FIGs 9B and 9C).
- animals treated with 2xl0 10 vg of AAV8-hAAT-moFGF21 vectors progressively gained weight similarly to chow-fed AAV8-fiAAT-null-treated mice whereas no significant changes in body weight of animals treated with 5xl0 10 vg of AAV8-hAAT-moFGF21 vectors were observed (FIGs 9B and 9C).
- HEK293 cells were transfected with plasmids encoding three different codon-optimized human FGF21 nucleotide sequences (SEQ ID NO's: 40-42). As control, non-transfected cells and cells transduced with wild-type hFGF21 coding sequence were used. Expression of the three codon-optimized human FGF21 sequences and the WT human FGF21 sequence was under the control of the hAAT promoter (SEQ ID NO:47).
- HFD-fed mice are treated with AAV vectors encoding human FGF21. As controls, the same dose of AAV-null vectors is administered to chow- and HFD-fed mice.
- serum metabolic parameters such as free fatty acids, glycerol, triglycerides, cholesterol and ketone bodies
- Example 9 In vitro assay for assessing FGF21 activity FGF21 is expected to increase glucose uptake and GLUT1 expression in 3T3-L1 cells (Kharitonenkov, A. et al., 2005. J. Clin. Invest 115:1627-1635).
- Example 10 Reversion of obesity and improvement of glucose metabolism by intra- eWAT administration of AAV8-CAG-moFGF21-dmiRT vectors in ob/ob mice: further observations
- Ob/ob mice that received intra-eWAT injections of AAV8-CAG-moFGF21-dmirT vectors showed a reduction in the size of white adipocytes of the epididymal pad (FIG 13A). Circulating adiponectin levels also increased with dose (FIG 14A). eWAT inflammation, evaluated through Mac2 staining, was also reduced as a function of the dose of vector, as did the expression of the macrophage marker F4/80 (FIG 14B and C).
- the liver of ob/ob mice injected with null vectors or the lowest dose of AAV8-CAG- moFGF21-dmirT showed accumulation of lipid droplets in hepatocytes (FIG 13B).
- Example 11 Reversion of obesity and improvement of glucose metabolism by intravenous administration of AAV8-hAAT-moFGF21 vectors in ob/ob mice: further observations
- ob/ob animals overexpressing FGF21 in the liver showed significantly decreased size of white adipocytes, particularly those animals treated with 5xlO u vg (FIG 15A). This was parallel with a dose-dependent increase in circulating adiponectin levels (FIG 15B) and decreased WAT inflammation, as evidenced by decreased staining for Mac2 and expression of F4/80 and TNF-a in eWAT (FIG 16A-C). Noticeably, ob/ob mice treated with 5x10 11 vg showed a remarkable reduction in "crown-like" structures in eWAT (FIG 16A).
- Example 12 Long-term reversion of obesity and diabetes by intravenous administration of AAV8-hAAT-moFGF21 vectors in HFD-fed mice and HFD-fed old mice: decreased tissue weight and stable expression up to 1 year
- FIG 19A-B Representative images of animals belonging to all experimental groups of the studies performed in young adults or in adults (see Examples 4 and 5) are shown in FIG 19A-B.
- the reversion of obesity by AAV8-bAAT-moFGF21 treatment was parallel to a dose- dependent decrease in the weight of the main white adipose tissue (WAT) depots, such as the epididymal (eWAT), inguinal (iWAT) and retroperitoneal (rWAT) fat pads, both in animals treated as young adults or as adults (FIG 18A and FIG 19C).
- WAT white adipose tissue
- FIG 20A 1 year after AAV8- hAAT-moFGF21 delivery, treated animals travelled more distance, rested less time, and spent more time doing slow and fast movements than untreated HFD-fed controls.
- the creatine-driven substrate cycle and sarco/endoplasmic reticulum Ca2+-ATPase 2b (Serca2b)-mediated calcium cycling can increase thermogenesis in iWAT independently of UCP1 (Kazak L. et al, 2015. Cell 163:643-655; Ikeda K. et al, 2017. Nat. Med. 23: 1454-1465).
- phosphatase orphan 1 an enzyme involved in the creatine-driven substrate cycle, were observed in iWAT of HFD- fed mice treated with 5xl0 10 vg of AAV8-hAAT-moFGF21 when compared with age- matched, chow- and HFD-fed control groups (FIG 20E), suggesting that the activity of the creatine-driven cycle was probably increased as a result of FGF21 gene transfer.
- Example 14 Long-term reversion of obesity and diabetes by intravenous administration of AAV8-hAAT-moFGF21 vectors in HFD-fed mice and HFD-fed old mice: glucagon levels, islet hyperplasia and glucose tolerance
- HFD-fed animals treated as young adults with AAV8-hAAT-moFGF21 vectors showed decreased circulating levels of glucagon compared with HFD-fed null- treated mice (FIG 22A).
- mice While AAV8-null-treated mice developed islet hyperplasia as a consequence of HFD feeding, the ⁇ -cell mass of animals treated with AAV8-hAAT-FGF21 vectors (at the doses of 2xl0 10 or 5xl0 10 vg/mouse) was similar to that of control mice fed a chow diet (FIG 22B and C). Double immunostaining for insulin and glucagon of pancreatic sections from HFD-fed AAV8-hAAT-moFGF21 -treated mice showed normal distribution of a and ⁇ cells in the islets of these animals, with localization of glucagon-expressing cells in the periphery of the islet and of insulin-expressing cells in the core (FIG 22D).
- GTT intraperitoneal glucose tolerance test
- Example 15 Reversion of HFD-associated WAT hypertrophy and inflammation by intravenous administration of AAV8-hAAT-moFGF21 vectors HFD-feeding induces an increase in the size of WAT adipocytes (Sattar N. & Gill J.M.R., 2014. BMC Med. 12: 123). Administration of FGF21 -encoding vectors counteracted this increase (FIG 24 A). Morphometric analysis of WAT revealed that the area of white adipocytes of animals treated as young adults with lxlO 10 or 5xl0 10 vg of vector, and of mice treated as adults with 2xl0 10 or 5xl0 10 vg of vector was similar to that of animals fed a chow diet (FIG 24B).
- Example 16 Reversal of hepatic steatosis, inflammation and fibrosis by intravenous administration of AAV8-h AAT-moFGF21 vectors
- BMD bone mineral density
- BMC bone mineral content
- BV bone volume
- BV/TV bone volume/tissue volume ratio
- BS/BV bone surface/bone volume ratio
- Tb.N trabecular number
- Tb.Th trabecular thickness
- Tb.Sp trabecular separation
- Example 18 Prevention of HFD-induced liver tumours by intravenous administration of AAV8-hAAT-moFGF21 vectors Long-term feeding (>60 weeks) with a HFD has been associated with increased incidence of liver neoplasms in C57BL/6J mice (Hill-Baskin A.E. et al., 2009. Hum. Mol. Genet. 18:2975-2988; Nakagawa H., 2015. World J. Hepatol. 7:2110). In our study in animals that initiated the HFD as young adults and maintained it for 60 weeks we found liver tumours in 66.7% (6/9) of animals injected with null-vectors.
- Example 19 Amelioration of STZ-induced hyperglycemia by liver-specific AAV8- mediated FGF21 over expression
- mice had free access to a standard diet and were kept under a 12 h light-dark cycle (lights on at 08:00 hours).
- mice received five intraperitoneal injections, on consecutive days, of streptozotocin (50 mg/kg) dissolved in 0.1 mol/1 citrate buffer (pH 4.5). Blood glucose levels were assessed using an analyser (Glucometer Elite; Bayer, Leverkusen, Germany). Animal care and experimental procedures were approved by the Ethics Committee in Animal and Human Experimentation of the Universitat Autonoma de Barcelona.
- AAV vectors AAV vectors
- AAV vectors were diluted in 200 ⁇ of 0.001% F68 Pluronic® (Gibco) in PBS and injected via the tail vein.
- AAV8-hAAT-moFGF21 5xl0 10 vg or 2xlO n vg of AAV8 vectors encoding a codon-optimized murine FGF21 coding sequence under the control of the hAAT promoter (AAV8-hAAT-moFGF21) were administered IV to male 9-week-old C57B16 mice. Control mice received 2xlO u vg of AAV8-hAAT-Null vectors. Two weeks post- AAV administration, all animals were treated with streptozotocin (STZ) (5 doses of 50 mg/kg; 1 dose per day) to trigger the diabetic process.
- STZ streptozotocin
- Example 20 Extension of healthy lifespan by intramuscular administration of AAV-CMV-moFGF21 vectors in C57B16 mice due to the prevention of weight gain and insulin resistance associated with aging.
- Skeletal muscle (Skm) is a readily accessible tissue and has been used to produce secretable therapeutic proteins (Haurigot V. et al, 2010. J. Clin. Invest. 123:3254-3271; Callejas D. et al, 2013. Diabetes 62: 1718-1729; Jaen M . et al, 2017. Mol. Ther. Methods Clin. Dev. 6: 1-7).
- AAV vectors of serotype 1 which show a high tropism for Skm (Chao L. et al, 2000. J. Clin. Invest. 106: 1221-1228; Wu Z. et al, 2006. J. Virol.
- mice injected intramuscularly with AAVl-CMV-moFGF21 maintained the body weight they had at the initiation of the study and were ⁇ 38% slimmer than controls, which steady increased their weight as animals aged (FIG 31C). While the weight of the muscles was barely affected by FGF21 gene transfer, the weight of the white and brown depots as well as the liver were considerably reduced (FIG 3 ID). Indeed, the weight of the WAT pads analysed was reduced by >50% (FIG 3 ID). Moreover, mice treated with AAVl-CMV-moFGF21 showed a marked reduction in the hepatic total triglyceride content (FIG 3 IE).
- mice As controls, another cohort of obese mice and the cohort of chow-fed mice received 3x10 11 vg of non-coding null vectors (AAVl-CMV-null). Following AAV delivery, mice were maintained on chow or HFD feeding. Animals treated with AAVl-CMV-moFGF21 experienced progressive loss of body weight (FIG 32A and B). The reversion of obesity by AAV 1 -CM V-FGF21 treatment was parallel to an increase in the circulating levels of FGF21 (FIG 32C). Null-treated mice fed a HFD showed normal fed glycemia (FIG 32D), but were hyperinsulinemic (FIG 32E), suggesting that these mice had developed insulin resistance.
- AAVl-CMV-null non-coding null vectors
- HFD-fed mice treated with AAVl-CMV-moFGF21 were, by the end of the study, normoglycemic and normoinsulinemic (FIG 32D and E).
- animals administered with AAVl-CMV-moFGF21 showed greater insulin sensitivity than their HFD-fed controls (FIG 32F).
- Example 22 Increased FGF21 circulating levels by codon-optimized human FGF21 nucleotide sequences.
- 8-week-old male C57B16 mice were hydrodynamically injected with plasmids encoding three different codon-optimized human FGF21 nucleotide sequences (SEQ ID NO's:40-42) under the control of the hAAT promoter.
- SEQ ID NO's:40-42 codon-optimized human FGF21 nucleotide sequences
- Plasmid DNA was diluted in saline in a volume (ml) equal to -10% of the animals' average body weight (grams) and was manually injected into the lateral tail vein in less tan 5 seconds. Before the injection, the animals were put under a 250W infrared heat lamp (Philips) for a few minutes to dilate the blood vessels and facilitate viewing and easier access to the tail vein. A plastic restrainer (Harvard Apparatus) was used to secure the animal for injection. No anaesthesia was used as it is not necessary so long as an appropriate restraining device is employed. We used 26G 3/8 in. gauge hypodermic needles (BD), the largest feasible needle gauge that fit snugly into the access vein, to inject the animals. Results
- BD gauge hypodermic needles
- mice treated with either codon-optimized human FGF21 version 2 or 3 were able to secrete higher human FGF21 levels into the circulation in comparison with wild-type or codon-optimized FGF21 variant 1 (FIG 33, thus demonstrating increased FGF21 protein production by codon-optimization of variants 2 and 3.
- Example 23 In vitro and in vivo increased FGF21 expression and protein production levels by h AAT-moFGF21 , C AG-moFGF21 -doublemiRT and CMV- moFGF21 expression cassettes
- Plasmid DNA was diluted in saline in a volume (ml) equal to -10% of the animals' average body weight (grams) and was manually injected into the lateral tail vein in less tan 5 seconds. Before the injection, the animals were put under a 25 OW infrared heat lamp (Philips) for a few minutes to dilate the blood vessels and facilitate viewing and easier access to the tail vein. A plastic restrainer (Harvard Apparatus) was used to secure the animal for injection. No anaesthesia was used as it is not necessary so long as an appropriate restraining device is employed. We used 26G 3/8 in. gauge hypodermic needles (BD), the largest feasible needle gauge that fit snugly into the access vein, to inject the animals. Results
- BD gauge hypodermic needles
- HEK293 cells were transfected with plasmids encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (EFla-mFGF21) (Zhang et al, EBioMedicine 15 (2017) 173-183) (SEQ ID NO:57) or a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter (CMV- moFGF21) or the CAG promoter in conjunction with four tandem repeats of the miPvT122a sequence and four tandems repeats of the miRTl sequence (CAG-moFGF21- doublemiRT). As control, non-transfected cells were used.
- EFla elongation factor la
- CMV- moFGF21 CMV promoter
- CAG promoter in conjunction with four tandem repeats of the miPvT122a sequence and four tandems repeats of the miRTl sequence
- CAG-moFGF21- doublemiRT a
- HEK293 cells transduced with CAG-moFGF21 -doublemiRT expressed higher levels of FGF21 in comparison with cells transduced with EFla-mFGF21 or non-transduced cells (FIG 34A). Moreover, HEK293 cells transduced with CAG-moFGF21 -doublemiRT also showed higher intracellular FGF21 protein content and higher FGF21 protein levels in the culture medium ( Figure 34B and C).
- HEK293 cells transduced with EFla-mFGF21 or CMV-moFGF21 expressed similar levels of FGF21 ( Figure 34A)
- HEK293 cells transduced with CMV-moFGF21 showed higher intracellular FGF21 protein content and higher FGF21 protein levels in the culture medium ( Figure 34B and C).
- C2C12 cells were transfected with plasmids encoding the WT murine FGF21 coding sequence under the control of the EFla promoter (EFla-mFGF21) (Zhang et al, EBioMedicine 15 (2017) 173-183) or a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter (CMV-moFGF21).
- EFla-mFGF21 EFla-mFGF21
- CMV-moFGF21 codon-optimized murine FGF21 coding sequence under the control of the CMV promoter
- non- transfected cells were used.
- C2C12 cells transduced with CMV-moFGF21 expressed higher levels of FGF21 in comparison with cells transduced with EFla-mFGF21 or non- transduced cells (FIG 34D).
- HepG2 cells were transfected with plasmids encoding the WT murine FGF21 coding sequence under the control of the EFla promoter (EFla-mFGF21) (Zhang et al, EBioMedicine 15 (2017) 173-183) or a codon-optimized murine FGF21 coding sequence under the control of the hAAT promoter (hAAT-moFGF21).
- EFla-mFGF21 EFla-mFGF21
- hAAT-moFGF21 a codon-optimized murine FGF21 coding sequence under the control of the hAAT promoter
- non- transfected cells were used.
- HepG2 cells transduced with hAAT-moFGF21 expressed higher levels of FGF21 in comparison with cells transduced with EFla-mFGF21 or non- transduced cells (FIG 34E).
- mice 8-week-old male C57B16 mice were hydrodynamically administered with 5 ⁇ g of plasmids encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (EFla-mFGF21) (Zhang et al., EBioMedicine 15 (2017) 173-183) or a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter (CMV-moFGF21) or the hAAT promoter (hAAT-moFGF21).
- EFla elongation factor la
- CMV-moFGF21 CMV promoter
- hAAT-moFGF21 hAAT-moFGF21
- Example 24 In vivo increased FGF21 expression in target tissues and FGF21 circulating levels by AAV8-h AAT-moFGF21 , AAV8-CAG-moFGF21-doublemiRT and AAVl-CMC-moFGF21 in comparison with AAV8-Efla-mFGF21 Hepatic expression
- mice Male C57B16 mice were intravenously administered with lxlO 10 vg, 2xl0 10 vg or 5xl0 10 vg of AAV8 vectors encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (AAV8-EFla-mFGF21) or a codon- optimized murine FGF21 coding sequence under the control of the liver-specific hAAT promoter (AAV8-hAAT-moFGF21).
- EFla elongation factor la
- AAV8-hAAT-moFGF21 codon- optimized murine FGF21 coding sequence under the control of the liver-specific hAAT promoter
- mice Male C57B16 mice were administered intra-eWAT with 2x10 10 vg, 5xl0 10 vg or lxlO 11 vg of either AAV8 vectors encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (AAV8-EFla-mFGF21) or AAV8 vectors encoding a codon-optimized murine FGF21 coding sequence under the control of the C AG promoter in conjunction with four tandem repeats of the miRT 122a sequence and four tandems repeats of the miRTl sequence (AAV8-CAG-moFGF21-doublemiRT).
- EFla elongation factor la
- AAV8 vectors encoding a codon-optimized murine FGF21 coding sequence under the control of the C AG promoter in conjunction with four tandem repeats of the miRT 122a sequence and four tandems repeats of the miRTl sequence (AAV8-CAG-m
- mice Male C57B16 mice were administered intramuscularly with 5xl0 10 vg, lxlO 11 vg or 3xl0 u vg of either AAV8 vectors encoding the WT murine FGF21 coding sequence under the control of the elongation factor la (EFla) promoter (AAV8-EFla-mFGF21) or AAV1 vectors encoding a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter (AAV 1 -CM V-FGF21 ).
- EFla elongation factor la
- AAV1 vectors encoding a codon-optimized murine FGF21 coding sequence under the control of the CMV promoter
- SV40 polyadenylation signal Rabbit ⁇ -Globin polyadenylation signal CMV promoter and CMV enhancer sequence Hepatocyte control region (HCR) enhancer from apolipoprotein E mini/aP2 promoter
- Nuleotide sequence oi homo sapiens FGF21 (SEQ ID NO: 4)
- Codon optimized nucleotide sequence of homo sapiens FGF21 - variant 1 (SEQ ID NO: 5)
- Codon optimized nucleotide sequence of homo sapiens FGF21 - variant 2 (SEQ ID NO: 6)
- Codon optimized nucleotide sequence of homo sapiens FGF21 - variant 3 (SEQ ID NO: 7)
- nucleotide sequence encoding miRT122a (target sequence of microRNA 122a) (SEQ ID NO: 12)
- nucleotide sequence encoding miRTl (target sequence of microRNA 1) (SEQ ID NO: 13)
- nucleotide sequence encoding miRT152 (target sequence of microRNA 152) (SEQ ID NO: 14)
- Nucleotide sequence encoding miRTl 99a-5p (target sequence of microRNA 199a) (SEQ ID NO: 15)
- nucleotide sequence encoding miRT148a (target sequence of microRNA 148a) (SEQ ID NO: 19)
- Nucleotide sequence encoding miRT194 (target sequence of microRNA 194) (SEQ ID NO: 20)
- nucleotide sequence encoding miRT124 (target sequence of microRNA 124) (SEQ ID NO: 21)
- nucleotide sequence encoding miRT216 (target sequence of microRNA 216) (SEQ ID NO: 22)
- nucleotide sequence encoding miRT133a (target sequence of microRNA 133a) (SEQ ID NO: 24)
- nucleotide sequence encoding miRT206 (target sequence of microRNA 206) (SEQ ID NO: 25)
- nucleotide sequence encoding miRT130 (target sequence of microRNA 130) (SEQ ID NO: 26) 5' ATGCCCTTTTAACATTGCACTG 3'
- nucleotide sequence encoding miRT99 (target sequence of microRNA 99) (SEQ ID NO: 27)
- Nucleotide sequence encoding miRT208-5p (target sequence of microRNA 208a) (SEQ ID NO: 28)
- Nucleotide sequence encoding miRT208a-3p (target sequence of microRNA 208a) (SEQ ID NO: 29)
- Nucleotide sequence encoding miRT499-5p (target sequence of heart-specific microRNA 499) (SEQ ID NO: 30)
- Hepatocyte control region (HCR) enhancer from apolipoprotein E SEQ ID NO: 53
- Elongation factor 1 alpha promoter from 150 to 1327 (1178bp)
- SEQ ID NO: 57 also contains the truncated AAV2 5' and 3' ITR and the SV40 polyA (already included in sequence listing, SEQ ID NO: 48, 49 and 50)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Environmental Sciences (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Public Health (AREA)
- Mycology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP17172818 | 2017-05-24 | ||
| ES201700615 | 2017-05-24 | ||
| PCT/EP2018/063707 WO2018215613A1 (en) | 2017-05-24 | 2018-05-24 | Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP3630160A1 true EP3630160A1 (en) | 2020-04-08 |
Family
ID=62620819
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP18731359.8A Pending EP3630160A1 (en) | 2017-05-24 | 2018-05-24 | Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequence |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20200102361A1 (https=) |
| EP (1) | EP3630160A1 (https=) |
| JP (2) | JP7778469B2 (https=) |
| CN (1) | CN110913886A (https=) |
| AU (2) | AU2018274655B2 (https=) |
| BR (1) | BR112019024608A2 (https=) |
| MX (1) | MX2019013982A (https=) |
| WO (1) | WO2018215613A1 (https=) |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3630160A1 (en) * | 2017-05-24 | 2020-04-08 | Universitat Autònoma De Barcelona | Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequence |
| IL270882B2 (en) | 2017-05-24 | 2024-02-01 | Univ Barcelona Autonoma | Viral expression vectors containing the coding sequence for FIBROBLAST GROWTH FACTOR 21 (FGF21 |
| GB201818816D0 (en) * | 2018-11-19 | 2019-01-02 | Synpromics Ltd | Regulatory nucleic acid sequences |
| CA3120923A1 (en) * | 2018-11-26 | 2020-06-04 | Universitat Autonoma De Barcelona | Fibroblast growth factor 21 (fgf21) gene therapy |
| ES2948620T3 (es) | 2019-07-10 | 2023-09-14 | Masonic Medical Res Laboratory | Vgll4 con elemento regulador CIS de UCP-1 y método de uso del mismo |
| US12611436B2 (en) | 2019-10-17 | 2026-04-28 | Sarepta Therapeutics, Inc. | AAV transfer cassette |
| KR20230017845A (ko) * | 2020-05-26 | 2023-02-06 | 유니버시타트 아우토노마 데 바르셀로나 | 중추 신경계 장애에 대한 섬유아세포 성장 인자 21(fgf21) 유전자 요법 |
| CN113956344A (zh) * | 2021-10-14 | 2022-01-21 | 江南大学 | 一种新型治疗肝癌的fgf类似物及其应用 |
| CN114010666B (zh) * | 2021-10-22 | 2024-05-07 | 上海交通大学 | 溶瘤病毒、parp抑制剂及pd-1抗体在制备抗肿瘤药物中的应用 |
| CN114316018A (zh) * | 2021-11-26 | 2022-04-12 | 江南大学 | 一种fgf21蛋白类似物及其应用 |
| CN118460618A (zh) * | 2022-04-19 | 2024-08-09 | 康霖生物科技(杭州)有限公司 | 一种用于遗传性凝血因子缺乏病治疗的核酸构建体 |
| EP4598590A1 (en) * | 2022-10-08 | 2025-08-13 | Lingyi Biotech Co., Ltd. | Construct for enhancing gene expression |
| WO2025158406A1 (en) * | 2024-01-26 | 2025-07-31 | Source Bio, Inc. | Compositions for adipose tissue targeting and uses thereof |
| CN118389554A (zh) * | 2024-05-10 | 2024-07-26 | 三峡大学 | 一种提高fgf-21持续表达水平和稳定性的aav重组病毒及其应用 |
| WO2026028137A1 (en) * | 2024-07-31 | 2026-02-05 | Universitat Autònoma De Barcelona | Fibroblast growth factor 21 (fgf21) gene therapy |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002024234A2 (en) * | 2000-09-20 | 2002-03-28 | The Regents Of The University Of California | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| WO2013006486A2 (en) * | 2011-07-01 | 2013-01-10 | Ngm Biopharmaceuticals, Inc. | Compositions, uses and methods for treatment of metabolic disorders and diseases |
| WO2013033452A2 (en) * | 2011-08-31 | 2013-03-07 | Amgen Inc. | Method of treating or ameliorating type 1 diabetes using fgf21 |
| WO2014085365A2 (en) * | 2012-11-28 | 2014-06-05 | Ngm Biopharmaceuticals, Inc. | Compositions and methods for treatment of metabolic disorders and diseases |
| US20140194352A1 (en) * | 2012-11-28 | 2014-07-10 | Ngm Biopharmaceuticals, Inc. | Compositions and Methods for Treatment of Metabolic Disorders and Diseases |
| WO2017201527A2 (en) * | 2016-05-20 | 2017-11-23 | President And Fellows Of Harvard College | Gene therapy methods for age-related diseases and conditions |
Family Cites Families (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5139941A (en) | 1985-10-31 | 1992-08-18 | University Of Florida Research Foundation, Inc. | AAV transduction vectors |
| US5436146A (en) | 1989-09-07 | 1995-07-25 | The Trustees Of Princeton University | Helper-free stocks of recombinant adeno-associated virus vectors |
| US6268213B1 (en) | 1992-06-03 | 2001-07-31 | Richard Jude Samulski | Adeno-associated virus vector and cis-acting regulatory and promoter elements capable of expressing at least one gene and method of using same for gene therapy |
| US5869305A (en) | 1992-12-04 | 1999-02-09 | The University Of Pittsburgh | Recombinant viral vector system |
| US5464758A (en) | 1993-06-14 | 1995-11-07 | Gossen; Manfred | Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters |
| US6204059B1 (en) | 1994-06-30 | 2001-03-20 | University Of Pittsburgh | AAV capsid vehicles for molecular transfer |
| US6093570A (en) | 1995-06-07 | 2000-07-25 | The University Of North Carolina At Chapel Hill | Helper virus-free AAV production |
| US5741683A (en) | 1995-06-07 | 1998-04-21 | The Research Foundation Of State University Of New York | In vitro packaging of adeno-associated virus DNA |
| US5952221A (en) | 1996-03-06 | 1999-09-14 | Avigen, Inc. | Adeno-associated virus vectors comprising a first and second nucleic acid sequence |
| US6133027A (en) | 1996-08-07 | 2000-10-17 | City Of Hope | Inducible expression system |
| US6548286B1 (en) | 1997-04-14 | 2003-04-15 | Cell Genesys, Inc. | Methods for increasing the efficiency of recombinant AAV product |
| US6207455B1 (en) | 1997-05-01 | 2001-03-27 | Lung-Ji Chang | Lentiviral vectors |
| IL132463A0 (en) | 1997-05-13 | 2001-03-19 | Univ North Carolina | Lentivirus - based gene transfer vectors |
| US5994136A (en) | 1997-12-12 | 1999-11-30 | Cell Genesys, Inc. | Method and means for producing high titer, safe, recombinant lentivirus vectors |
| US6218181B1 (en) | 1998-03-18 | 2001-04-17 | The Salk Institute For Biological Studies | Retroviral packaging cell line |
| US6146874A (en) | 1998-05-27 | 2000-11-14 | University Of Florida | Method of preparing recombinant adeno-associated virus compositions |
| AU780231B2 (en) | 1998-11-10 | 2005-03-10 | University Of North Carolina At Chapel Hill, The | Virus vectors and methods of making and administering the same |
| DE19909769A1 (de) | 1999-03-05 | 2000-09-07 | Bundesrepublik Deutschland Let | Von SIVagm abgeleitete lentivirale Vektoren, Verfahren zu ihrer Herstellung und ihre Verwendung zur Genübertragung in Säugerzellen |
| US7201898B2 (en) | 2000-06-01 | 2007-04-10 | The University Of North Carolina At Chapel Hill | Methods and compounds for controlled release of recombinant parvovirus vectors |
| AU2003274397A1 (en) | 2002-06-05 | 2003-12-22 | University Of Florida | Production of pseudotyped recombinant aav virions |
| EP2692868A1 (en) * | 2012-08-02 | 2014-02-05 | Universitat Autònoma De Barcelona | Adeno-associated viral (AAV) vectors useful for transducing adipose tissue |
| CN105916990B (zh) * | 2013-08-02 | 2020-02-04 | 巴塞罗那自治大学 | 用于转导脂肪组织的腺相关病毒载体 |
| EP3630160A1 (en) * | 2017-05-24 | 2020-04-08 | Universitat Autònoma De Barcelona | Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequence |
| CA3120923A1 (en) * | 2018-11-26 | 2020-06-04 | Universitat Autonoma De Barcelona | Fibroblast growth factor 21 (fgf21) gene therapy |
-
2018
- 2018-05-24 EP EP18731359.8A patent/EP3630160A1/en active Pending
- 2018-05-24 WO PCT/EP2018/063707 patent/WO2018215613A1/en not_active Ceased
- 2018-05-24 BR BR112019024608-8A patent/BR112019024608A2/pt unknown
- 2018-05-24 US US16/615,854 patent/US20200102361A1/en not_active Abandoned
- 2018-05-24 AU AU2018274655A patent/AU2018274655B2/en active Active
- 2018-05-24 JP JP2019565341A patent/JP7778469B2/ja active Active
- 2018-05-24 CN CN201880047871.5A patent/CN110913886A/zh active Pending
- 2018-05-24 MX MX2019013982A patent/MX2019013982A/es unknown
-
2023
- 2023-05-30 JP JP2023089121A patent/JP2023109992A/ja active Pending
-
2025
- 2025-04-29 AU AU2025203001A patent/AU2025203001A1/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002024234A2 (en) * | 2000-09-20 | 2002-03-28 | The Regents Of The University Of California | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| WO2013006486A2 (en) * | 2011-07-01 | 2013-01-10 | Ngm Biopharmaceuticals, Inc. | Compositions, uses and methods for treatment of metabolic disorders and diseases |
| WO2013033452A2 (en) * | 2011-08-31 | 2013-03-07 | Amgen Inc. | Method of treating or ameliorating type 1 diabetes using fgf21 |
| WO2014085365A2 (en) * | 2012-11-28 | 2014-06-05 | Ngm Biopharmaceuticals, Inc. | Compositions and methods for treatment of metabolic disorders and diseases |
| US20140194352A1 (en) * | 2012-11-28 | 2014-07-10 | Ngm Biopharmaceuticals, Inc. | Compositions and Methods for Treatment of Metabolic Disorders and Diseases |
| WO2017201527A2 (en) * | 2016-05-20 | 2017-11-23 | President And Fellows Of Harvard College | Gene therapy methods for age-related diseases and conditions |
Non-Patent Citations (10)
| Title |
|---|
| ALEX MAS ET AL: "Reversal of Type 1 Diabetes by Engineering a Glucose Sensor in Skeletal Muscle", DIABETES, AMERICAN DIABETES ASSOCIATION, US, vol. 55, no. 6, 1 June 2006 (2006-06-01), pages 1546 - 1553, XP002659438, ISSN: 0012-1797, DOI: 10.2337/DB05-1615 * |
| COSKUN TAMER ET AL: "Fibroblast Growth Factor 21 Corrects Obesity in Mice", ENDOCRINOLOGY, THE ENDOCRINE SOCIETY, US, vol. 149, no. 12, 1 December 2008 (2008-12-01), pages 6018 - 6027, XP009122247, ISSN: 0013-7227, DOI: 10.1210/EN.2008-0816 * |
| F. M. FISHER ET AL: "FGF21 regulates PGC-1 and browning of white adipose tissues in adaptive thermogenesis", GENES & DEVELOPMENT, vol. 26, no. 3, 1 February 2012 (2012-02-01), pages 271 - 281, XP055160186, ISSN: 0890-9369, DOI: 10.1101/gad.177857.111 * |
| HUANG XINQIANG ET AL: "Forced expression of hepatocyte-specific fibroblast growth factor 21 delays initiation of chemically induced hepatocarcinogenesis", MOLECULAR CARCINOGENESIS, JOHN WILEY & SONS, INC, US, vol. 45, no. 12, 1 December 2006 (2006-12-01), pages 934 - 942, XP002496728, ISSN: 0899-1987, DOI: 10.1002/MC.20241 * |
| JUN ZHANG ET AL: "Chronic Over-expression of Fibroblast Growth Factor 21 Increases Bile Acid Biosynthesis by Opposing FGF15/19 Action", EBIOMEDICINE, vol. 15, 1 February 2017 (2017-02-01), NL, pages 173 - 183, XP055423138, ISSN: 2352-3964, DOI: 10.1016/j.ebiom.2016.12.016 * |
| KHARITONENKOV A ET AL: "FGF-21 as a novel metabolic regulator", THE JOURNAL OF CLINICAL INVESTIGATION, B M J GROUP, GB, vol. 115, no. 6, 1 June 2005 (2005-06-01), pages 1627 - 1635, XP002362553, ISSN: 0021-9738, DOI: 10.1172/JCI23606 * |
| N/A: "Abstracts of 17th Annual Meeting of the American-Society-of-Gene-and-Cell-Therapy (ASGCT),", MOLECULAR THERAPY, vol. 22, no. Suppl.1., 1 June 2014 (2014-06-01), US, pages S1 - S306, XP055310541, ISSN: 1525-0016, DOI: 10.1038/mt.2014.64 * |
| RAYMOND NG ET AL: "miRNA-32 Drives Brown Fat Thermogenesis and Trans-activates Subcutaneous White Fat Browning in Mice", CELL REPORTS, vol. 19, no. 6, 1 May 2017 (2017-05-01), US, pages 1229 - 1246, XP055423161, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2017.04.035 * |
| See also references of WO2018215613A1 * |
| TAKESHI INAGAKI ET AL: "Endocrine Regulation of the Fasting Response by PPAR-alpha--Mediated Induction of Fibroblast Growth Factor 21", CELL METABOLISM, CELL PRESS, UNITED STATES, vol. 5, no. 6, 6 June 2007 (2007-06-06), pages 415 - 425, XP008151942, ISSN: 1550-4131, [retrieved on 20070605], DOI: 10.1016/J.CMET.2007.05.003 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2025203001A1 (en) | 2025-05-22 |
| MX2019013982A (es) | 2020-07-22 |
| RU2019142845A3 (https=) | 2021-09-20 |
| AU2025203001A9 (en) | 2026-03-05 |
| JP2023109992A (ja) | 2023-08-08 |
| US20200102361A1 (en) | 2020-04-02 |
| WO2018215613A1 (en) | 2018-11-29 |
| CN110913886A (zh) | 2020-03-24 |
| JP2020530977A (ja) | 2020-11-05 |
| RU2019142845A (ru) | 2021-06-24 |
| AU2018274655A1 (en) | 2019-12-19 |
| AU2018274655B2 (en) | 2025-01-30 |
| BR112019024608A2 (pt) | 2020-06-23 |
| JP7778469B2 (ja) | 2025-12-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200102361A1 (en) | Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequence | |
| Jimenez et al. | FGF21 gene therapy as treatment for obesity and insulin resistance | |
| Pozsgai et al. | Systemic AAV-mediated β-sarcoglycan delivery targeting cardiac and skeletal muscle ameliorates histological and functional deficits in LGMD2E mice | |
| US20220186251A1 (en) | Viral vectors for the treatment of diabetes | |
| JP2022088645A (ja) | 高ビリルビン血症の処置 | |
| O'Neill et al. | Targeting adipose tissue via systemic gene therapy | |
| US11207361B2 (en) | AAV mediated exendin-4 gene transfer to salivary glands to protect subjects from diabetes or obesity | |
| US20200289673A1 (en) | Treatment of glycogen storage disease iii | |
| JP7061067B2 (ja) | クリグラー・ナジャー症候群の処置のための組成物 | |
| Galon-Tilleman et al. | Apelin-36 modulates blood glucose and body weight independently of canonical APJ receptor signaling | |
| JP2022513127A (ja) | 線維芽細胞増殖因子21(fgf21)遺伝子療法 | |
| JP2026034616A (ja) | 糖尿病を処置するための修飾型インスリンおよびグルコキナーゼ核酸 | |
| EP3390623B1 (en) | Wilson's disease gene therapy | |
| US12559533B2 (en) | Viral expression construct comprising a fibroblast growth factor 21 (FGF21) coding sequence | |
| CA3179874A1 (en) | Fibroblast growth factor 21 (fgf21) gene therapy for central nervous system disorders | |
| CA3063979A1 (en) | Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequence | |
| BR122025000954A2 (pt) | Construto de expressão viral que compreende uma sequência de codificação do fator de crescimento de fibroblastos 21 (fgf21) | |
| US20260022402A1 (en) | Recombinant adeno-associated viral vector for gene delivery | |
| US20250288693A1 (en) | Insulin and glucokinase gene therapy compositions and its use for treating diabetes | |
| Rajendiran et al. | Combination Gene Therapy with AAV-Based Vectors Ameliorates the Phenotype of Type 2 Diabetes in Diet-Induced Obese and db/db Mice | |
| CA2969599C (en) | Viral vectors for the treatment of diabetes | |
| EP4284440A1 (en) | Gene therapy for monogenic diabetes | |
| Muñoz et al. | Research Article FGF21 gene therapy as treatment for obesity and insulin resistance Veronica Jimenez1, 2, 3,†, Claudia Jambrina1, 2, 3,†, Estefania Casana1, 2, 3, Victor Sacristan1, 2, 3 | |
| CA2974235A1 (en) | Single-vector gene construct comprising insulin and glucokinase genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20191209 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 40027095 Country of ref document: HK |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20220512 |