EP3625338A1

EP3625338A1 - Engineering of a minimal sacas9 crispr/cas system for gene editing and transcriptional regulation optimized by enhanced guide rna

Info

Publication number: EP3625338A1
Application number: EP17910146.4A
Authority: EP
Inventors: Zhen XIE; Dacheng Ma; Shuguang PENG
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2017-05-19
Filing date: 2017-05-19
Publication date: 2020-03-25
Also published as: WO2018209712A1; EP3625338A4; CN110662835A; CN110662835B

Abstract

Programmable and precise regulation of Cas9 functions by utilizing a set of compact Cas9 derivatives created by deleting conserved HNH and/or REC-C domains based on the structural information across variant class 2 CRISPR effectors is provided. A novel strategy for engineering the dimeric gRNA-guided nuclease by splitting the mini-dSaCas9 and fusing the FokI domain right after the split point to increase the on-target DNA cleavage efficiency and potentially reduce the off-target effect because of a closer proximity of dimeric FokI nuclease to the target sequence is also provided. By combining the optimized and compact gRNA expression cassette and the downsized SaCas9 derivatives, the entire CRISPR/Cas system with different effector domains for transactivation, DNA cleavage and base editing is loaded into a single AAV virus. Such an all-in-one AAV-CRISPR/Cas9 system will be particularly appealing in biomedical applications that require safe and efficient delivery in vivo.

Description

Engineering of a minimal SaCas9 CRISPR/Cas system for gene editing and transcriptional regulation optimized by enhanced guide RNA

Technical Field

The instant application is related to the biological arts, in particular the directed modification of genetic material. With greater particularity, the claimed invention is related to improvements upon the Cas9 CRISPR-associated protein and related products thereof.
Background Art
The CRISPR-associated protein 9 (Cas9) discovered from Streptococcus pyogenes is a multi-domain protein, which has been widely used in genome editing and transcriptional control in mammalian cells due to its superior modularity and versatility. Delivering synthetic gene circuits in vivo has been limited due to size constraints particularly with smaller delivery systems with a payload capacity nearly equal to an entire Cas9 complex.
Summary of Invention

Technical Problem

Several strategies have been developed to engineer modular and layered gene circuits in mammalian cells by regulating dCas9 and gRNA expression. Transcriptional controls in mammalian cells can be achieved by directly fusing a transcriptional regulatory domain to the nuclease deactivated Cas9 (dCas9) . Alternatively, multiple transcriptional regulatory domains can be recruited to the dCas9 by tagging the dCas9 with a repeating peptide scaffold, or by fusing repeating RNA motifs to the cognate gRNA. However, biomedical applications of the CRISPR/Cas system require the exploration of new platforms for engineering mammalian synthetic circuits that integrate and process multiple endogenous inputs. In addition, the application of CRISPR/Cas therapeutic circuits is also challenging due to the restrictive cargo size of existing viral delivery vehicles.
Solution to Problem
The split Cas9 system can be used in general to bypass the packing limit of the viral delivery vehicles and in the claimed invention dCas9 is split and reconstituted in human cells. One of the challenges of therapeutic applications is to find an optimal delivery system that can carry all CRISPR/Cas9 components to the desired organ or cell population for genetic manipulation. Using the CRISPR/Cas system to greatest potential has been greatly limited by its physical size when incorporated into a viral delivery system. When used for synthetic biology purposes in high value delivery systems with site specific integration such as the Adeno-Associated Virus/AAV, the entire cas9 complex is akin to a computer operating system taking up 95％of available memory leaving only a small portion for synthetic biology programming purposes. By splitting the CRISPR/CAS9 into smaller regions and delivering the regions in separate viral delivery vectors, the powerful genetic manipulation functionality is retained alongside substantial increases in space for cellular programming purposes. The claimed invention represents a substantial improvement over existing CAS9 delivery techniques and includes additional enhancements for genetic control and programming.
While a variety of viral delivery systems have been employed with mixed success, implementation of systems relying on alternate virus systems can lead to an undesired strong immune response. Using the recombinant adeno-associated virus (rAAV) offers high gene transfer efficiency and very low immune response. Unfortunately packaging capacity is confined to 4.7kb to 5kb which is problematic when compared with human optimized Cas9 size at over 4.2 kb with promoter sequences reaching over 5kb. With intein-mediated split Cas9, inteins function as protein introns and are excised out of a sequence and join the remaining flaking regions (exteins) with a peptide bond without leaving a scar. In terms of split site selection particular attention is given to split sites which are surface exposed due to the sterical need for protein splicing. This system allows the coding sequence of Cas9 to be distributed on a dual-vector or multi-vector system and reconstituted post-translationally.
The claimed invention expands the reach of synthetic biology by targeting specific diagnostic and therapeutic applications through improvements in genetic circuitry and higher level genetic circuit delivery enhancements. The claimed embodiments of the invention overcome existing size limitations through optimal splitting of Cas9 allowing for higher level synthetic gene circuitry to be accommodated by smaller delivery systems.
The presently claimed invention utilizes downsized Staphylococcus aureus Cas9 variants (mini-SaCas9) which retain DNA binding activity by deleting conserved functional domains. In a preferred illustrative embodiment, FokI nuclease domain is fused to the middle of the split mini-SaCas9 to trigger efficient DNA cleavage. In another illustrative embodiment the genetic editing system is small enough to be housed within a single AAV containing the mini-SaCas9 fused with a downsized transactivation domain along with an optimized and compact gRNA expression cassette with an efficient transactivation activity. The claimed invention highlights a practical approach to generate an all in one AAV-CRISPR/Cas9 system with different effector domains for in-vivo applications.
To bypass the AAV payload limit, the 4.2-kb Cas9 from Streptococcus pyogenes (SpCas9) is split and packaged into two separate AAVs along with the guide RNA (gRNA) expression unit, which allows functional reconstitution of full-length SpCas9 in vivo. Another strategy is to search for natural class 2 CRISPR effectors with a diminished size, such as the 3.2-kb SaCas9 and ～3-kb CasX identified in uncultivated organisms by using metagenomic datasets. To further reduced the transgene size, the ～70-bp glutamine tRNA can be used to replace the ～250-bp RNA polymerase III promoter to drive expression of the tRNA: gRNA fusion transcript that is cleaved by endogenous tRNase Z to produce the active gRNA. These efforts facilitate the construction of an all-in-one AAV delivery vector for in vivo applications of the CRISPR/Cas technology.
Recent structural studies of SpCas9, SaCas9 and Acidaminococcus sp. Cpf1 (AsCpf1) have elucidated functions of conserved domains among these class 2 CRISPR effectors, including HNH/NUC and RuvC nuclease domains that respectively cleave complementary and non-complementary DNA strands, a recognition (REC) domain, and a protospacer adjacent motif (PAM) interacting (PI) domain. Interestingly, truncated SpCas9 mutant by deleting either the HNH or the REC2 domain retain nearly intact DNA binding activity or half of cleavage activity. These results highlight the possibility to further downsize the wild-type Cas9 to a minimal Cas9 (mini-Cas9) that has only DNA binding activity but no DNA cleavage activity, which allows accommodating additional DNA template, effector domains and control elements in a single AAV vector.
Advantageous Effects of Invention
Such a CRISPR/Cas9 system has particular utility in biomedical applications in which viral delivery vehicles with a restrictive cargo size are preferred. Foreseen variants include combination of the split Cas9/dCas9 system with rAAV delivery systems, Cas9/dCas9 activity can be controlled to edit and regulate endogenous genes in vivo.
Brief Description of Drawings
The accompanying drawings are included to better illustrate exemplary embodiments of the claimed invention.
Figure 1 is a diagram of EBFP2 transcription activation assay for the compact Cas9 derivatives fused with the VPR domain.
Figure 2 is a diagram of dSpCas9, mini-dSpCas9-1 and mini-dSpCas9-2 domain organization and corresponding gene activation efficiency.
Figure 3 is a schematic diagram of domain organization of dSaCas9 and its derivatives and results gene activation efficiency.
Figure 4 is a diagram of dAsCpf1 and mini-AsCpf1-1 domain organization and corresponding gene activation efficiency.
Figure 5 is a schematic representation of optimized gRNAs and the corresponding gene activation efficiency.
Figure 6 is a diagram of Glutamine (Glu) tRNA used as the promoter to express the optimized gRNA-2.
Figure 7 is a diagram of domain organization of dSaCas9 variants including split dSaCas9 and split mini-dSaCas9-4 fused with the FokI domain.
Figure 8 is a diagram of the EYFP reconstitution assay to demonstrate the DNA cleavage efficiency and illustration of DNA cleavage by the dimeric FokI nuclease fused to split dSaCas9 and split minidSaCas9-4.
Figure 9 is a graphical representation of DNA cleavage efficiency by the split dSaCas9 variants with a spacer length ranging from 12-bp to 24-bp.
Figure 10 is a schematic representation of VPR, VTR1, VTR2 and VTR3 transcription activation domain and their corresponding gene activation efficiency evaluated by using the EBFP2 reporting system.
Figure 11 is a schematic representation of the SpyTag and MoonTag repeating array for transcription activation with corresponding gene activation efficiency data.
Figure 12 is a schematic representation of transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system with a graphical illustration of an activation efficiency of EBFP2.
Figure 13 is a schematic representation of packaging mini-Cas9, effector domain, gRNA expression cassette and additional parts in a single AAV vector for transcription activation, DNA cleavage and base editing.
Figure 14 is a schematic representation of miniSaCas9-3 and Split SaCas9 and the corresponding miniSaCas9-3 and Split SaCas9 activation efficiency.
Figure 15 is a genetic sequence illustration of CCR5 gene illustrating spacer region and corresponding gel agarose graphical data.
Description of Embodiments
In the following embodiments as detailed further in the corresponding figures, rational design of the compact CRISPR/Cas9 system is further detailed.
Figure 1 is a diagram of EBFP2 transcription activation assay for the compact Cas9 derivatives (101) fused with the VPR domain. The constitutively expressed mKate2 is used as a transfection control. In the first illustrative example, the reporting system is utilized in cultured human embryonic kidney 293 (HEK293) cells. Two mini-dSpCas9 are created by respectively deleting the Cterminal region of REC1 domain (REC-C, △501-710) and the HNH domain (△777-891) that may be dispensable for DNA binding activity of the nuclease deactivated Cas9 (dCas9) and respectively fused to the VP64-p65-Rta (VPR) transactivation domain.
Figure 2 is a diagram of dSpCas9, mini-dSpCas9-1 and mini-dSpCas9-2 domain organization (201) and graphical illustration of corresponding gene activation efficiency (203) . In the illustrative example, the two mini-dSpCas9: VPR variants retain more than 50％of transactivation capacity compared to the dSpCas9: VPR.
Figure 3 is a schematic diagram of domain organization of dSaCas9 and its derivatives (301) and graphical illustration (303) depicting gene activation efficiency. Recently, the wildtype SaCas9 has been engineered to recognize an altered PAM ( “NNNRRT” ) . Based on this mutant SaCas9, the disclosed embodiment constructs the mini-SaCas9-1: VPR by replacing the conserved REC-C domain (△234-444) with a “GGGGSGGGG” linker (GS-linker) , which only retained ～ 2.5％transactivation activity of the dSaCas9: VPR. Although the GS-linker is widely used as a flexible linker, it may still distort the SaCas9 structure. Inspired by a recent computational protocol called SEWING, an adjacent residue searching (ARS) protocol is used to search for existing structures between discontinued Cas9 fragments. Replacement of the GS-linker with a “KRRRRHR” (R-linker) from the SaCas9 BH domain that appropriately filled in the REC-C deletion gap by using the ARS protocol, results in a 11-fold increase in the transactivation capacity of mini-SaCas9-2. As an enhanced embodiment of the claimed invention, a “GSK” linker is used, derived from a putative gene (Accession number, O67859) in Aquifex aeolicus by using the SAR protocol, which fit the deletion gap of the HNH domain (△479-649) . The 2-kb mini-SaCas9-3 is created by deleting both the REC-C domain and the HNH domain only retained 0.6％transactivation activity over the control.
Figure 4 is a diagram of dAsCpf1 and mini-AsCpf1-1 domain organization (401) and graphical illustration (403) of corresponding gene activation efficiency. To evaluate the DNA cleavage efficiency of mini-SaCas9 variants in this illustrative embodiment, a reporter reconstitution assay is used where DNA cleavage can trigger the reconstitution of the active enhanced yellow fluorescent protein (EYFP) reporter gene from the inactive form. Either deleting the REC-C or deleting both the REC-C and HNH domains resulted in a background EYFP expression, suggesting that the domain deletion abolished the DNA cleavage activity of mini-SaCas9 variants. In this illustrative embodiment, by deleting REC2 domain (△324-525) retained 46％transactivation capacity of dAsCpf1: VPR, suggesting that this deletion strategy is applicable for distinct class 2 CRISPR effectors.
Figure 5 is a schematic representation of optimized gRNAs (501) and the corresponding graphical illustration (503) of gene activation efficiency. An A-U flip or a U-G conversion can be introduced to disrupt the putative RNA Pol III terminator sequences in the first stem loop of the gRNA scaffold to enhance the efficiency of the dCas9-mediated DNA labeling. The putative RNA Pol III terminator sequences are shown in the box, and the A-U and G-C mutations are labeled in shading at the third and fourth positions. Representative scatter plots of the flow cytometry data are also shown on the right. The constitutively expressed mKate2 is used as a transfection control. In a preferred illustrative embodiment, the transactivation efficiency of miniSaCas9-3 is increased ～100-fold by introducing either one or two point mutations in the putative RNA Pol III terminator sequences.
Figure 6 is a diagram of Glutamine (Glu) tRNA (601) used as the promoter to express the optimized gRNA-2. In this illustrative example, HEK293 cells are cotransfected with plasmids expressing the mini-SaCas9-3: VPR and gRNA-2 driven by either the Glu RNA or the U6 promoter. Representative flow cytometry scatter plots (603) are shown on the right. The constitutively expressed iRFP is used as a transfection control. Data are shown as the mean ± SEM fold change of EBFP2 fluorescence from three independent replicates measured by using flow cytometer 48 h after transfection into HEK293 cells. In this illustrative embodiment, ～50％transactivation activity is obtained when using glutamine tRNA instead of the U6 promoter to drive gRNA expression.
Improving the DNA cleavage specificity of the CRISPR/Cas9 system is essential for future clinical applications. Dimerization of a hybrid protein in which FokI nuclease domain is fused to the N-terminal but not to the C-terminal of dSpCas9 improves the DNA cleavage specificity in the PAM-out orientation. Furthermore, truncated gRNAs with shorter regions of target complementarity decrease the off-target cleavage efficiency.
In the following illustrative embodiments, the effect of the compact SaCas9 derivatives on DNA cleavage and base editing is further disclosed.
Figure 7 is a diagram of domain organization of dSaCas9 variants (701) including split dSaCas9 and split mini-dSaCas9-4 fused with the FokI domain and additionally includes Fok1 fused to the N terminal of dSaCas9 and mini-dSaCas9-4.
Figure 8 is a diagram (801) of the EYFP reconstitution assay to demonstrate the DNA cleavage efficiency and illustration (803) of DNA cleavage by the dimeric FokI nuclease fused to split dSaCas9 or split minidSaCas9-4. EYFP reconstitution assay to evaluate the DNA cleavage efficiency of dSaCas9 derivatives fused with FokI along with two truncated gRNAs that respectively containing 18-nt sequences complementary to the target. In one illustrative embodiment, DNA cleavage activity is not detected when FokI is fused to the N-terminal of mini-SaCas9-2. One possible reason is that the FokI in this protein architecture may be distal to the target DNA. However, as the predicted distance between the N-terminal and the C-terminal of the FokI nuclease domain is which makes challenging to find an appropriate insertion position in the middle of the dSaCas9. In an alternate embodiment, dSaCas9 is split at residue 733 and fused the FokI after the splitting point with a triplicate G-linker ( “GGGGS” ) . In an alternative illustrative embodiment the first four residues of the C-terminal fragment (△734-737) that might interfere with the reconstitution of two split fragments is removed. The split dSaCas9 or split mini-dSaCas9-4 without the HNH domain results in ～8％to 30％of the EYFP expression level induced by the wild-type SaCas9, with a spacer ranging from 12 bp to 24 bp in the PAM-out orientation.
Figure 9 is a graphical representation (901) of DNA cleavage efficiency by the split dSaCas9 variants with a spacer length ranging from 12-bp to 24-bp. DNA cleavage efficiency by the split dSaCas9: FokI, the split mini-dSaCas9-4: FokI and Fok1 fused to the N terminal of dSaCas9 and mini-dSacas9-4 with a spacer length ranging from 12-bp to 24-bp. Each bar shows mean fold changes (mean ± SEM； n ＝ 3) of EYFP fluorescence measured by using flow cytometer 48 h after transfection in HEK293 cells.
In the next illustrative embodiments, construction of the compact CRISPR/Cas system for transcription activation is further detailed.
Figure 10 is a schematic representation (1001) of VPR, VTR1, VTR2 and VTR3 transcription activation domain and graphical representation (1003) of the corresponding gene activation efficiency evaluated by using the EBFP2 reporting system. In the illustrative embodiment, compact transcription activators based on dCas9-VPR are engineered. The entire P65 contains a DNA binding domain in the N-terminal, and two transactivation domains (TA1 and TA2) in the C-terminal. However, only the TA2 and the partial TA1 are included in the tripartite VPR domain. To reduce the size of dCas9-VPR, mini-SaCas9-3: VTR1 is constructed by replacing the P65 domain in the VPR with the TA1 and TA2 domains. In a further illustrative embodiment, the P65 domain in the VPR with two repeats of the TA1 domain is constructed and termed VTR2. The VTR1 and VTR2 domains retain 45％and 21％transactivation efficiency of the VPR domain respectively. VTR3 is additionally depicted and is approximately 200 bp shorter than VTR2 and VTR1 making it an optimal illustrative embodiment.
Figure 11 is a schematic representation (1101) of the SpyTag and MoonTag repeating array for transcription activation with graphical representation (1103) for corresponding gene activation efficiency data. The corresponding gene activation efficiency was evaluated by using the EBFP2 reporting system utilizing optimized gRNA-2 in the illustrative embodiments. Data are shown as the mean fold change (mean ± SEM； n ＝ 3) of EBFP2 fluorescence measured by using flow cytometer 72 h after transfection into HEK293 cells.
Recently, a 13-residue peptide tag (SpyTag) derived from Streptococcus pyogenes fibronectin-binding protein (FbaB) has been shown to form a covalent bond with its 116-residue binding partner, called SpyCatcher.
In the illustrative embodiment, a repeating peptide array with a smaller size than the SunTag system is constructed by fusing four tandem repeats of SpyTag to the C-terminal of mini-SaCas9-3 and fusing the SpyCatcher with the VPR domain, allowing spontaneous assembly of a VPR transactivation scaffold in cells. The SpyTag system induces the expression of the enhanced blue fluorescent protein 2 (EBFP2) reporter gene to 100-fold compared to the negative control. In the illustrative embodiment, by searching for the homologue of SpyTag and SpyCatcher, a putative protein is found (accession No. WP_054278706) from Streptococcus phocae with 60％sequence similarity to the FbaB. In the illustrative embodiment, this protein is split similarly to SpyTag and SpyCatcher. As a direct and intended consequence of the illustrative embodiment, a similar scaffold system called the MoonTag system is hereby disclosed and implemented by fusing four tandem repeats of the 13-residue MoonTag to the mini-SaCas9-3 and making a hybrid of the MoonCatcher and VPR domains. Although the MoonTag system was not orthogonal to the SpyTag system, the MoonTag system is 5-fold more efficient to activate the EBFP2 expression.
Figure 12 is a schematic representation (1201) of transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system with a graphical illustration (1203) of an activation efficiency of EBFP2. In the illustrative example, transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system that contains the mini-SaCas9-3: VTR1 and U6-driven optimized gRNA-2 is depicted. The plasmid DNAs that encode the EBFP2 reporter gene and the mKate2 control gene are introduced into HEK293 cells by transient transfection, following by the AAV infection. The lower panel shows the activation efficiency of EBFP2 after infection of the AAV encoding the mini-SaCas9-3: VTR1 and the representative microscopic images (1205) . Scale bar in images represents 200 μm. Data are shown as the mean fold change (mean ± SEM； n ＝ 3) of EBFP2 fluorescence measured by using flow cytometer 72 hours after transfection and AAV infection. In this illustrative embodiment, a single AAV virus is produced that encoded the constitutively expressed mini-SaCas9-3: VTR1 and the optimized gRNA that targeted the TRE promoter. A TREdriven EBFP2 reporter gene is introduced into HEK293 cells by transient transfection. In the illustrative embodiment, the AAV infection activated the EBFP2 expression up to ～130-fold over the negative control in the HEK293 cells, which was also more efficient than AAV virus loaded with the mini-SaCas9-3: VP64.
Figure 13 is a schematic representation (1301) of packaging mini-Cas9, effector domain, gRNA expression cassette and additional parts in a single AAV vector for transcription activation, DNA cleavage and base editing. By combining the illustrative embodiments to a broad working example, a set of compact Cas9 derivatives are engineered by deleting conserved HNH and/or REC-C domains based on the structural information across variant class 2 CRISPR effectors. In addition, a novel strategy to engineer the dimeric gRNA-guided nuclease by splitting the mini-dSaCas9 and fusing the FokI domain right after the split point is disclosed, which can increase the on-target DNA cleavage efficiency and potentially reduce the off-target effect because of a closer proximity of dimeric FokI nuclease to the target sequence. By combining the optimized and compact gRNA expression cassette and the downsized SaCas9 derivatives, a practical approach is disclosed to load the entire CRISPR/Cas system with different effector domains for transactivation, DNA cleavage and base editing into a single AAV virus. Such an all-in-one AAV-CRISPR/Cas9 system will be particularly appealing in biomedical applications that require safe and efficient delivery in vivo.
Figure 14 is a schematic representation (1401) of miniSaCas9-3 and Split SaCas9 and graphical data (1403) of the corresponding miniSaCas9-3 and Split SaCas9 activation efficiency.
Figure 15 is a genetic sequence illustration (1501) of CCR5 gene illustrating spacer region and gel electrophoresis graphical data (1503) illustrating CCR5 gene relative percentage of cleavage.
In the description, numerous specific details are set forth in order to provide a thorough understanding of the present embodiments. It will be apparent, however, to one having ordinary skill in the art that the specific detail need not be employed to practice the present embodiments. In other instances, well-known materials or methods have not been described in detail in order to avoid obscuring the present embodiments.
Reference throughout this specification to “one embodiment” , “an embodiment” , “one example” or “an example” means that a particular feature, structure or characteristic described in connection with the embodiment or example is included in at least one embodiment of the present embodiments. Thus, appearances of the phrases “in one embodiment” , “in an embodiment” , “one example” or “an example” in various places throughout this specification are not necessarily all referring to the same embodiment or example. Furthermore, the particular features, structures or characteristics may be combined in any suitable combinations and/or sub-combinations in one or more embodiments or examples. In addition, it is appreciated that the figures provided herewith are for explanation purposes to persons ordinarily skilled in the art and that the drawings are not necessarily drawn to scale.
As used herein, the terms “comprises, ” “comprising, ” “includes, ” “including, ” “has, ” “having, ” or any other variation thereof, are intended to cover a non-exclusive inclusion. For example, a process, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such process, article, or apparatus.
Additionally, any examples or illustrations given herein are not to be regarded in any way as restrictions on, limits to, or express definitions of any term or terms with which they are utilized. Instead, these examples or illustrations are to be regarded as being described with respect to one particular embodiment and as being illustrative only. Those of ordinary skill in the art will appreciate that any term or terms with which these examples or illustrations are utilized will encompass other embodiments which may or may not be given therewith or elsewhere in the specification and all such embodiments are intended to be included within the scope of that term or terms. Language designating such nonlimiting examples and illustrations includes, but is not limited to: “for example, ” “for instance, ” “e.g., ” and “in one embodiment. ”

Industrial Applicability

The claimed invention has industrial applicability in biomedical and industrial biotechnology applications. With greater particularity, the improved Cas9 system provides greater gene editing and regulatory control capabilities over traditional Cas9 systems.
Sequence Listing Free Text
The instant application contains a Sequence Listing which has been submitted in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on April 28, 2017, is named ZX2seqlist_ST25. txt and is 225kbytes in size.
The sequence involved in the patent is as follows.
Sequence Listing
Seq ID 1 gRNAa TACGTTCTCTATCACTGATA
Seq ID 2 gRNAb TACGTTCTCTATCACTGATA
Seq ID 3 crRNAa CTCCCTATCAGTGATAGAGAACG
Seq ID 4 gRNAc CGTTCTCTATCACTGATA
Seq ID 5 gRNAd ACTAGAAATTCACCGAGC
Seq ID 6 gRNA-15bp CTCACTCAACAGTGATAGAGA
Seq ID 7 gRNA-12bp TTGCTCACTCAACAGTGATAG
Seq ID 8
dSpCas9: VPR
Seq ID 9
mini-dSpCas9-1: VPR
Seq ID 10
mini-dSpCas9-2: VPR
Seq ID 11
dSaCas9: VPR
Seq ID 12
mini-SaCas9-1: VPR
Seq ID 13
mini-SaCas9-2: VPR
Seq ID 14
mini-SaCas9-3: VPR
Seq ID 15
dAsCpf1: VPR
Seq ID 16
mini-AsCpf1-1: VPR
Seq ID 17
dSaCas9N: FokI
Seq ID 18
dSaCas9C
Seq ID 19
mini-dSaCas9-4N: FokI
Seq ID 20
AID: dSaCas9: UGI
Seq ID 21
AID: mini-dSaCas9-5: UGI
Seq ID 22
mini-dSaCas9-6N: AID
Seq ID 23
mini-dSaCas9-6C: UGI
Seq ID 24
VTR1
Seq ID 25
VTR2
Seq ID 26
SpyCatcher: VPR
Seq ID 27
4x SpyTag
Seq ID 28
MoonCatcher: VPR
Seq ID 29
4x MoonTag
Seq ID 30
VTR3 SEQUENCE
Seq ID 31
gRNA-ccr5-1
Seq ID 32
gRNA-ccr5-2
Seq ID 33
Mini-saCas9-4: VPR
Seq ID 34
Mini-saCas9-5: VPR
Seq ID 35
GSK Linker

Claims

A non-naturally occurring rationally designed reduced Cas9 comprising a downsized Staphylococcus aureus mini-SaCas9 which retains DNA binding activity by deleting conserved functional domains.
The non-naturally occurring mini-SaCas9 protein system of claim 1 wherein said mini-SaCas9 conserved functional domains are removed between the RuvC2 and RuvC3 regions and connected with a GSK linker.
The non-naturally occurring mini-SaCas9 protein system of claim 2 wherein said mini-SaCas9 conserved functional domains are removed at amino acid locations 479-649 between the RuvC2 and RuvC3 regions and connected with a GSK linker.
The non-naturally occurring mini-SaCas9 protein system of claim 1 wherein said mini-SaCas9 conserved functional domains are removed between the RuvC2 and RuvC3 regions, connected with a GSK linker and split into two or more portions.
The non-naturally occurring mini-SaCas9 protein system of claim 4 wherein said mini-SaCas9 conserved functional domains are removed at residue locations 479-649 between the RuvC2 and RuvC3 regions, connected with a GSK linker and split into two or more portions at residue 738.
The non-naturally occurring split mini-SaCas9 protein system of claim 4 additionally comprising split Cas9 portions across different split pairs to yield combinations that provided the complete polypeptide sequence activate gene expression even when fragments are partially redundant.
The non-naturally occurring mini-SaCas9 protein system of claim 3 additionally comprising a FokI domain.
The non-naturally occurring split mini-SaCas9 protein system of claim 5 additionally comprising a FokI domain.
The non-naturally occurring mini-SaCas9 protein system of claim 7 wherein said miniSaCas9 is mini-dSaCas9 and additionally comprises a plurality of genetic regulatory components to form a FokI dimer configuration upon hybridization.
The non-naturally occurring mini-SaCas9 protein system of claim 9 wherein said FokI dimer hybridization creates a space between the dimerized mini-dSaCas9 ranging from 4-40 base pairs.
The non-naturally occurring mini-dSaCas9 protein system of claim 9 wherein said FokI dimer configuration creates a space between the dimerized mini-dSaCas9 which is 14 base pairs.
The non-naturally occurring split mini-SaCas9 protein system of claim 8 wherein said split miniSaCas9 is split mini-dSaCas9 additionally comprises a plurality of genetic regulatory components to form a dimer configuration upon hybridization.
The non-naturally occurring split mini-dSaCas9 protein system of claim 12 wherein said FokI dimer configuration creates a space between the dimerized mini-dSaCas9 ranging from 12-24 base pairs.
The non-naturally occurring mini-SaCas9 protein system of claim 12 wherein said FokI dimer configuration restores nuclease activity when in dimer configuration.
A non-naturally occurring rationally designed downsized Staphylococcus aureus mini-SaCas9 of claim 2 additionally comprising repeating peptide Moontag array with four tandem repeats of 13-residue MoonTag fused to the C-terminal of mini-SaCas9-3 and making a hybrid of the MoonCatcher the VPR domain.
A non-naturally occurring rationally designed downsized Staphylococcus aureus mini-SaCas9 with repeating peptide Moontag array of claim 15 wherein said Moontag corresponds to Sequence ID number 29 and said MoonCatcher VPR corresponds to Sequence ID number 28.
A non-naturally occurring rationally designed guide RNA comprising an optimized guide RNA wherein said four repeat U-A regions are optimized with a A-U codon flip at the third position and a G-C replacement at the fourth position.
A non-naturally occurring rationally designed guide RNA of claim 17 additionally comprising Glu tRNA coupled to said optimized guide RNA.
A non-naturally occurring rationally designed reduced Cas9 comprising a downsized Staphylococcus aureus mini-SaCas9 which retains DNA binding activity by deleting conserved functional domains between REC and HNH regions and connected to incorporate effector domain, gRNA expression cassette and additional parts in a single AAV vector for transcription activation, DNA cleavage and base editing.
The non-naturally occurring rationally designed reduced mini-SaCas9 of claim 19 wherein said gRNA expression cassette is optimized at the four repeat U-A region with a A-U codon flip at the third position and a G-C replacement at the fourth position and additionally incorporates Glu tRNA coupled to the optimized guide RNA.