EP3483268A1 - Identification et affichage de ligands peptidiques - Google Patents

Identification et affichage de ligands peptidiques Download PDF

Info

Publication number
EP3483268A1
EP3483268A1 EP18213767.9A EP18213767A EP3483268A1 EP 3483268 A1 EP3483268 A1 EP 3483268A1 EP 18213767 A EP18213767 A EP 18213767A EP 3483268 A1 EP3483268 A1 EP 3483268A1
Authority
EP
European Patent Office
Prior art keywords
peptide
carrier
microglobulin
peptides
binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP18213767.9A
Other languages
German (de)
English (en)
Inventor
Graham Ogg
Li-Chieh Huang
Terence Rabbitts
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oxford University Innovation Ltd
Original Assignee
Oxford University Innovation Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford University Innovation Ltd filed Critical Oxford University Innovation Ltd
Publication of EP3483268A1 publication Critical patent/EP3483268A1/fr
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1075—Isolating an individual clone by screening libraries by coupling phenotype to genotype, not provided for in other groups of this subclass
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1036—Retroviridae, e.g. leukemia viruses
    • C07K16/1045—Lentiviridae, e.g. HIV, FIV, SIV
    • C07K16/1063—Lentiviridae, e.g. HIV, FIV, SIV env, e.g. gp41, gp110/120, gp160, V3, PND, CD4 binding site
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes

Definitions

  • This invention relates to the identification of peptide ligands and the DNA encoding the peptide ligands.
  • the invention also relates to carriers for use in the identification of peptide ligands and for the display of peptide ligands.
  • Peptides ligands represent important biological molecules in vivo and indeed several peptides have been taken forward into therapeutic use.
  • uptake of therapeutic peptide technology has been slow compared to antibody therapeutics despite advantages in cost, tissue penetration and possible non-parenteral route of administration (e.g. inhaled).
  • This is related to a number of problems including the difficulty of screening for peptides of interest from libraries because of their relative low affinity in linear conformation.
  • conventional peptide libraries generated using F-moc chemistry are prohibitively expensive for the library sizes required for drug discovery.
  • problems have included peptide stability in vivo. Stability problems may be improved by the use of non-natural/unnatural amino acids or structured/stapled peptides e.g. ciclosporin, or other conjugations e.g. pegylation.
  • the mechanism of probing protein interactions or probing for potential ligands will directly link any identified protein or peptide to its encoding DNA.
  • the advantage of linking the peptide to the encoding DNA is that methods available to sequence the DNA are far more sophisticated than those available to sequence protein.
  • DNA sequencing is much more rapid and is cheaper than protein sequencing.
  • DNA sequencing can be successful on very small samples - small in both length and molar amounts.
  • DNA samples can be easily amplified to provide more DNA if needed.
  • DNA sequencing can be undertaken by traditional Sanger based methodology or by various high throughput sequencing approaches (Sequencing technologies - the next generation. Metzker ML. Nat Rev Genet.
  • protein sequencing can be via Edman degradation or through mass spectrometry approaches ( Hanno Steen & Dr Mann. The abc's (and xyz's) of peptide sequencing. Nature Reviews Molecular Cell Biology, 5:699-711, 2004 , the contents of which is hereby incorporated by reference in its entirety).
  • these methods commonly use coat fusion proteins which can alter the conformation of both interacting partners and influence binding.
  • the produced proteins may be toxic to the yeast or the phage or influence their replication which can select out library bias.
  • the use of unnatural amino acids and post-translational modifications may provide significant affinity and stability advantages and these are difficult to achieve using phage or yeast during the selection step.
  • in vivo systems have associated limitations in library size that can be overcome using in vitro expression systems.
  • Tawfik and Griffiths and colleagues established emulsion micro-compartments as a means to isolate reactions ( Tawfik, D.S. and A.D. Griffiths, Man-made cell-like compartments for molecular evolution. Nat Biotechnol, 1998. 16(7): p. 652-6 , the contents of which is incorporated by reference). It was reported that in a 1 ml reaction volume, more than 10 10 water-in-oil emulsion micro-compartments can be created, with each having a mean diameter in the range of 2-3 ⁇ m and mean volume of 5 femtolitres.
  • a single molecule achieves a concentration of approximately 0.5 nM, thus enabling a single DNA molecule to be transcribed and translated.
  • DNA molecules With appropriate dilution of DNA molecules, it is possible to create individual water-in-oil emulsions in which only one DNA molecule is present in a microcompartment, and the protein expressed is trapped in a single confined physical space, i.e. creating 10 10 unique directed evolution reactions.
  • emulsions provide the convenience of a cell-free environment, preventing the interference of toxic substrates or unwanted cellular interactions ( Lu, W.C. and A.D. Ellington, In vitro selection of proteins via emulsion compartments.
  • An aim of the present invention is therefore to provide an improved system to screen for and select peptide ligands, in particular to screen for and select low affinity ligands, and/or to screen for and select ligands containing non-natural or modified amino acids, and/or to screen or select for ligands having a constrained secondary structure.
  • the invention provides a carrier to which is attached a peptide and DNA encoding the peptide.
  • the peptide includes at least one non-natural amino acid, and/or has a constrained secondary structure.
  • non-natural amino acids any amino acid that is not considered by those skilled in the art as a proteinogenic or 'natural' amino acid, normally encoded by the genetic code.
  • the natural amino acids excluded by the term 'non-natural amino acids are: L-alanine, L-arginine, L-asparagine, L-aspartic acid, L-cysteine, L-glutamic acid, L-glutamine, L-glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tyrptophan, L-tyrosine and L-valine.
  • Any non-natural amino acid may be incorporated into the peptide.
  • Peptides attached to carriers of the invention which incorporate non-natural amino acids may be synthesised by in vitro translation, and preferably by in vitro transcription/translation (IVTT) from the DNA carried on the carrier. Most preferably, the peptides are synthesised by emulsion IVTT.
  • IVTT in vitro transcription/translation
  • In vitro translation allows for the use of modified tRNA species carrying modified or non-natural amino acids, and may take advantage of, for example, known amber, ochre or opal stop codon suppressor tRNA technologies.
  • Alternative technologies for incorporation of non-natural amino acids include engineered amino acid-tRNAs that recognise four-base codons. Other technologies will be apparent to those skilled in the art.
  • the peptide conformation is restricted by the formation of a linkage at at least two different amino acid sites.
  • the conformation is restricted by the formation of at least one internal bond within the peptide.
  • the internal bond comprises an SS-bridge and/or an alternative linkage.
  • the constrained conformation may be created by binding the peptide to a scaffold and/or a carrier.
  • the peptide may be attached to a scaffold and/or carrier via at least two linkages.
  • the internal bond preferably comprises a disulphide bond.
  • Disulphide bonds are selectively formed between free cysteine residues without the need to protect other amino acid side chains. Furthermore, disulphide bonds are easily formed by incubating in a basic environment. Preferably a disulphide bond is formed between two cysteine residues, since their sulfhydryl groups are readily available for binding.
  • the location of an SS-bridge within an amino acid sequence is easily regulated by regulating the location of free cysteine residues.
  • said cysteines are located around the first and last amino acid position of the amino acid sequence, in order to optimally restrict the conformation of the amino acid sequence.
  • ⁇ bonds are also suitable for restricting the conformation of the peptides.
  • Se-Se diselenium bonds may be used.
  • An advantage of diselenium bonds is that these bonds are reduction insensitive. Peptides comprising a diselenium bond are better capable of maintaining their conformation under reducing circumstances.
  • a metathese reaction is used in order to form an internal bond. In a metathese reaction two terminal CC-double bonds or triple bonds are connected by means of a Ru-catalysed rearrangement reaction.
  • Such terminal CC-double or CC-triple bonds are for instance introduced into a peptide either via alkylation of the peptide NH-groups, for instance with allyl bromide or propargyl bromide, or via incorporating a non-natural amino acid with an alkenyl- or alkynyl-containing side chain into the peptide.
  • a metathese reaction is performed with a Grubbs-catalyst.
  • an internal bond is formed using Br-SH cyclisation.
  • an SH moiety of a free cysteine is coupled to a BrAc-moiety which is preferably present at the N-terminus of the peptide or at a lysine (RNH 2 ) side chain.
  • a COOH-side chain of an aspartate or glutamate residue is coupled to the NH 2 -side chain of a lysine residue. This way an amide bond is formed. It is also possible to form an internal bond by coupling the free COOH-end of a peptide to the free NH 2 -end of the peptide, thereby forming an amide-bond.
  • Alternative methods for forming an internal bond within an amino acid sequence are available, which methods are known in the art.
  • the peptides are constrained by binding to a scaffold.
  • Various procedures to obtain monocyclic peptides are known.
  • Various efficient synthetic routes to scaffolds for preparing monocyclic peptides have been developed, along with methods for their incorporation into peptidomimetics using solid-phase peptide synthesis.
  • peptides containing pairs of cysteine residues allowing subsequent cyclization via disulfide bond formation (see e.g.
  • a preferred example peptides with two free cysteine thiols that react rapidly with a variety of scaffold molecules are bound to the carrier.
  • a synthetic scaffold comprising at least two identical reactive groups is used to couple one or more potential binding site molecules, e.g. peptides or peptide fragments, to said scaffold.
  • Suitable peptides comprise all possible peptides capable of reacting with at least two reactive groups on a scaffold to form at least two linkages or bonds between the peptide and the scaffold
  • the scaffold may comprise a (hetero) aromatic molecule with at least a first and a second reactive group as disclosed in WO 2004/077062 , preferably a (hetero)aromatic molecule comprising at least two benzylic halogen substitutents.
  • the two benzylic halogen substitutents are preferably used as first and second reactive group for coupling an amino acid sequence.
  • An amino acid sequence is preferably coupled to a scaffold using a method according to WO 2004/077062 .
  • a scaffold with at least a first and a second reactive group is provided.
  • An amino acid sequence capable of reacting with said at least first and second reactive group is contacted with said scaffold under conditions allowing said amino acid sequence to react with said at least first and second reactive group to form at least two linkages between said scaffold and said amino acid sequence, wherein the formation of a first linkage accelerates the formation of a consecutive linkage.
  • This way, conformationally constrained loop constructs are formed.
  • the coupling reaction using a scaffold as disclosed in WO 2004/077062 is suitable for being performed in solution.
  • An amino acid sequence is preferably coupled to a scaffold using a method according to WO 2004/077062 in an aqueous solution, thereby limiting or even avoiding the use of (toxic) organic solvents.
  • first linkage accelerates the formation of a second linkage
  • attachment of an amino acid sequence to a scaffold according to WO 2004/077062 takes place in a rapid, concerted process comprising a cascade of reactions.
  • the formation of a first linkage via a first reactive group increases the reactivity of a second reactive group, and so on, such that the activating effect is being 'handed over' from one reactive group to the next one.
  • Said chemical reactions involve changes at functional groups while the molecular skeleton of the scaffold remains essentially unchanged.
  • a scaffold molecule as used in WO 2004/077062 comprising at least two reactive groups is capable of reacting with an amino acid sequence such that the reactive groups of the scaffold become involved in the new linkages with the amino acid sequence while the core structure or skeleton of the scaffold does not participate directly in the coupling.
  • the scaffold comprises: a halogenoalkane, preferably a dihaloalkane, a trihaloalkane or a tetrahaloalkane; and/or an allylic system, preferably a scaffold comprising two allylic halogen atoms; and/or a scaffold comprising at least two halomethyl groups; and/or a (hetero)aromatic molecule, preferably a (hetero)aromatic molecule comprising at least two benzylic halogen substitutents.
  • a halogenoalkane preferably a dihaloalkane, a trihaloalkane or a tetrahaloalkane
  • an allylic system preferably a scaffold comprising two allylic halogen atoms; and/or a scaffold comprising at least two halomethyl groups
  • a (hetero)aromatic molecule preferably a (hetero)aromatic molecule comprising at least two
  • a scaffold comprises a conjugated polyene, also known as aromatic compound, or arene, which is provided with at least two reactive groups.
  • a molecular scaffold is used which comprises at least two benzylic halogen substituents, such as halomethyl groups. Suitable examples include, but are not limited, to di (halomethyl) benzene, tri (halomethyl) benzene or tetra (halomethyl) benzene and derivatives thereof.
  • the scaffold comprises a halogenoalkane.
  • Halogenoalkanes also known as haloalkanes or alkyl halides
  • halogenoalkanes are compounds containing a halogen atom (fluorine, chlorine, bromine or iodine) joined to one or more carbon atoms in a chain.
  • dihaloscaffolds comprising two halogen atoms, and tri- and tetrahaloscaffolds for the synthesis of conformationally constraint compounds, like for example peptide constructs consisting of one or more looped peptide segments.
  • halomethylarene preferably selected from the group consisting of bis(bromomethyl)benzene, tris(bromomethyl)benzene and tetra(bromomethyl)benzene, or a derivative thereof. More preferably said scaffold is selected from the group consisting of ortho-, meta- and para- dihaloxyleen and 1,2,4,5 tetra halodurene.
  • Said scaffold most preferably comprises meta- 1,3- bis(bromomethyl)benzene (m-T2), ortho- 1,2-bis(bromomethyl)benzene (o-T2), para- 1,4-bis(bromomethyl)benzene (p-T2), meta-1,3-bis(bromomethyl)pyridine (m-P2), 2,4,6-tris(bromomethyl)mesitylene (T3), meta-1,3-bis(bromomethyl)-5-azidobenzene (m-T3-N3) and/or 1,2,4,5 tetrabromodurene (T4).
  • m-T2 meta- 1,3- bis(bromomethyl)benzene
  • o-T2 ortho- 1,2-bis(bromomethyl)benzene
  • p-T2 para- 1,4-bis(bromomethyl)benzene
  • T3 meta-1,3-bis(bromomethyl)pyridine
  • T3-N3 meta-1,3-bis(bro
  • the scaffold is for example selected from the group consisting of bis-; tris-; or tetra(halomethyl)benzene; bis-; tris-; or tetra(halomethyl)pyridine; bis-; tris-; or tetra (halomethyl)pyridazine; bis-; tris-; or tetra(halomethyl)pyrimidine; bis-;tris-; or tetra(halomethyl)pyrazine; bis-; tris-; or tetra(halomethyl)-1,2,3-triazine; bis-; tris-; or tetra(halomethyl)-1,2,4-triazine; bis-; tris-; or tetra(halomethyl)pyrrole ,-furan, -thiophene; bis-; tris-; or tetra(halomethyl)imidazole, -oxazole, -thiazol; bis-; tris-; or tetra
  • Embodiments in which a non-natural amino acid is incorporated into the peptide, and/or in which the peptide has a constrained secondary structure may further include any of the features described herein with reference to a second aspect of the invention.
  • linkers and the incorporation of binding pair members and ⁇ 2 microglobulin, as described herein may be employed equally for this first aspect of the invention as for the second aspect described below.
  • the invention provides a carrier to which is attached ⁇ 2 microglobulin, a peptide and DNA encoding the peptide, said carrier not bearing an MHC or MHC-like molecule.
  • the carrier may further include a flexible linker attached to the peptide, e.g. a flexible peptide linker.
  • a flexible peptide linker is series of amino acids which connects two defined regions, such as the peptide and the ⁇ 2 microglobulin, and allows the two defined regions to move.
  • the linker allows the two regions to have locational freedom.
  • the linker allows the regions it links to form their preferred configuration whilst still being linked.
  • the carrier further comprises ⁇ 2 microglobulin attached to the peptide.
  • the ⁇ 2 microglobulin provides the flexible peptide linker function.
  • the carrier further comprises, a tag e.g. a His tag, a hapten, an epitope, a binding fragment of an antibody or another member of a binding pair, such as a streptavidin binding protein.
  • a tag e.g. a His tag, a hapten, an epitope, a binding fragment of an antibody or another member of a binding pair, such as a streptavidin binding protein.
  • such further peptide sequences provide the flexible peptide linker function.
  • One or more such peptide sequences may be provided.
  • the ⁇ 2 microglobulin may be attached to the carrier, either directly or via the peptide, or may be located at the carrier surface but not physically attached.
  • the ⁇ 2 microglobulin is provided on the carrier in the absence of an MHC or MHC-like molecule, which, surprisingly, is not required for the presentation of the peptide in the invention. Accordingly, the carrier does not bear or carry an MHC or MHC-like molecule.
  • the ⁇ 2 microglobulin is attached to the carrier via the peptide, it may be constructed as a fusion with the peptide, and the DNA may encode the ⁇ 2 microglobulin-peptide fusion. Alternatively the ⁇ 2 microglobulin may be provided exogenously.
  • the peptide, or the ⁇ 2 microglobulin-peptide fusion may be attached to the carrier by means of an interaction between members of a binding pair of molecules.
  • one of the members of a binding pair is attached to the peptide or fusion and the second member is attached directly or indirectly (e.g. via a linker) to the carrier.
  • binding pairs are known to the skilled person, and any may be used in order to immobilise the peptide on the carrier.
  • the binding pair member attached to the peptide or fusion is a proteinaceous member that can be expressed as a fusion protein with the peptide or as a fusion with the ⁇ 2 microglobulin-peptide fusion.
  • the binding member attached to the peptide or fusion may be a streptavidin binding protein.
  • the peptide may therefore be configured to be expressed from the DNA on the carrier as a streptavidin binding protein-peptide fusion, or in other embodiments as a streptavidin binding protein- ⁇ 2 microglobulin-peptide fusion.
  • the ⁇ 2 microglobulin will be adjacent to the peptide and will separate the peptide from the streptavidin binding protein.
  • One or more flexible linkers may be provided between any of the components of the fusion.
  • the fusion may comprise, in order: streptavidin binding protein-flexible linker- ⁇ 2 microglobulin-flexible linker-peptide.
  • Other arrangements of fusion proteins containing the desired components will be apparent to the skilled person.
  • the binding partner attached to the peptide or ⁇ 2 microglobulin-peptide fusion may be a binding fragment of an antibody, such as a scFv, a dAb, VL or VH domain.
  • the binding fragment may be arranged as a fusion protein with the peptide or ⁇ 2 microglobulin-peptide fusion in the same ways as discussed above in relation to streptavidin binding protein.
  • streptavidin binding protein is attached to the peptide or ⁇ 2 microglobulin-peptide fusion
  • streptavidin is attached to the carrier either directly or indirectly (e.g. via a linker).
  • Expression of the peptide or ⁇ 2 microglobulin-peptide fusion, attached (e.g. as a further fusion) to streptavidin binding protein will result in binding of the streptavidin binding protein to the streptavidin and consequent immobilisation of the peptide on the carrier.
  • the binding fragment of an antibody is attached to the peptide or ⁇ 2 microglobulin-peptide fusion
  • the cognate antigen or hapten is attached to the carrier either directly or indirectly (e.g. via a linker).
  • Expression of the peptide or ⁇ 2 microglobulin-peptide fusion, attached (e.g. as a further fusion) to binding fragment of an antibody will result in binding of that binding fragment to the antigen or hapten, and consequent immobilisation of the peptide on the carrier.
  • a binding fragment of an antibody (including fragments having more than one chain, such as F(ab), F(ab') 2 , F(ab')) or a whole antibody may be immobilized on the carrier and the antigen or hapten may be attached to the peptide or ⁇ 2 microglobulin-peptide fusion.
  • the antigen or hapten is a peptide it may be expressed as part of a fusion with the peptide or ⁇ 2 microglobulin-peptide fusion in multiple configurations, as discussed above for streptavidin binding protein.
  • the carrier is multivalent.
  • multiple copies of both the peptide and the encoding DNA are attached, preferably at least 10, 100, 1000 or more copies of either the peptide and/or the DNA are attached.
  • the peptide attached to the carrier in any of the embodiments described herein may be between about 4 and about 50 amino acids in length, preferably the peptide is between about 4 and 20 amino acids, preferably between about 7 and about 15 amino acids, preferably the peptide is between about 7 and about 12 amino acids, preferably the peptide is between about 8 and about 12 amino acids, preferably the peptide is between about 8 and about 10 amino acids, preferably the peptide is about 9 amino acids, preferably the peptide is 9 amino acids.
  • the peptide may be randomly generated or derived from a source library, for example, from a particular human or non-human cell type.
  • the invention further provides a library containing a plurality of carriers as described herein, wherein the library contains at least two different peptides borne on separate carriers.
  • the set of peptides in the library contains peptides including variable amino acids in order to provide a range of peptides that differ at one or more amino acid positions.
  • the library contains a set of peptides in which at least one amino acid position is variable. In some embodiments the variation at the at least one amino acid position is limited and determined by the user of the invention.
  • variation is random, allowing for the creation of a random library.
  • Variation or randomisation of an amino acid position can be comprehensive to include all possible natural amino acids at that position within the set, or may be less comprehensive so that within the set only a subset of possible amino acids are present at the variable or randomised position or positions.
  • variability or randomisation may be extended to include non-natural amino acids at the variable or randomised position or positions.
  • the peptide ligands within the library include peptides having a constrained secondary structure, the nature and extent of the constraint may also be varied or randomised within the library.
  • more than one amino acid position in the peptide is variable to some degree. Accordingly, in some embodiments at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid positions, or all amino acid positions of the peptide are varied or randomised.
  • the number of varied or randomised positions and the degree of variation or randomisation has an impact on the size of the resultant library and the skilled person will be aware of the theoretical maximum size of the library, calculated from these factors. In some instances, theoretical maximum sizes of libraries may not be achievable where such library sizes exceed the practical capabilities of manufacture or handling.
  • the carrier may be a solid support.
  • the solid support may be a column, a plate surface (such as the surface of a tissue culture plate or the surface of a multiwell plate), a bead or any other suitable support.
  • the carrier is a bead, the bead may be of any polymeric material, such as polystyrene, although non-polymeric materials, such as silica, may also be used.
  • Other materials which may be used include styrene copolymers, methyl methacrylate, functionalised polystyrene, glass, silicon, and carboxylate.
  • the beads may be magnetic, which facilitates their isolation after being used in reactions.
  • the beads are microspheres with a diameter from about 0.1 to about 10 microns.
  • the beads may alternatively be any small discrete particle they need not be spherical in shape. Preferably they will be similar in size to a sphere of about 0.1 to about 10 microns, but different sized structures including nanometre sized particles may also be used.
  • the beads may be selected from Dynabead C1, M270 or MACS.
  • each bead carries multiple copies of the same peptide and the same DNA encoding the peptide.
  • the number of copies may range from about 2 to a million or more.
  • Preferably only one peptide species and only one DNA species is found on each bead.
  • the method of the invention may use multiple beads wherein different beads have different peptides and DNA sequences attached.
  • IVTT in vitro transcription/translation
  • peptide and/or the ⁇ 2 microglobulin which is bound to the carrier surface.
  • the peptide and ⁇ 2 microglobulin may be synthesised by IVTT as a single linked product.
  • the peptide is fused via a peptide bond to a terminal amino acid of the ⁇ 2 microglobulin to create a fusion protein.
  • the peptide may be fused at the C-terminal or N-terminal end of the ⁇ 2 microglobulin.
  • the peptide can be fused at an internal site in the ⁇ 2 microglobulin, in particular within an external loop.
  • the positions of external loops can be predicted by in-silico processing and imaging (see Figure 8 ).
  • the peptide is fused to the ⁇ 2 microglobulin in loop 1 between about amino acids 10 and 20. In other embodiments, the peptide is fused to the ⁇ 2 microglobulin in loop 2 between about amino acids 30 and 35. In other embodiments the peptide is fused to the ⁇ 2 microglobulin in loop 3 between about amino acids 70 and 78. In other embodiments the peptide is fused to the ⁇ 2 microglobulin in loop 4 between about amino acids 83 and 91 (reference to amino acid numbering is to the sequence of the mature ⁇ 2 microglobulin protein as provided in Figure 8 ).
  • Loops 1 and 4 are ⁇ -hairpins whilst loops 2 and 3 are ⁇ -links.
  • the ⁇ -hairpins are more stable than the ⁇ -links and may therefore be more appropriate for fusion to longer peptide sequences.
  • the ⁇ -links may be more suitable for fusion to peptides with extended conformation inserts.
  • the ⁇ 2 microglobulin may be fused to a single peptide, or the ⁇ 2 microglobulin may be fused to two or more peptides. Where two or more peptides are fused to the ⁇ 2 microglobulin they may be located at one or more of the C-terminal end, N-terminal end or with one or more external loops of the ⁇ 2 microglobulin.
  • IVTT may be emulsion IVTT ( Directed Evolution of Proteins In Vitro Using Compartmentalization in Emulsions Davidson, Dlugosz, Levy, Ellington, Current Protocols in Molecular Biology 24.6.1-24.6.12, July 2009 )
  • the peptide, and if applicable the ⁇ 2 microglobulin may be synthesised from DNA attached to the carrier. Preferably this is achieved using IVTT.
  • the peptide, and if applicable the ⁇ 2 microglobulin may then be attached to the carrier.
  • the peptide, and if applicable the ⁇ 2 microglobulin could be produced remote from the carrier and then attached to the carrier.
  • the attachment may be covalent or non-covalent.
  • the peptide construct may also comprise a tag which attaches the peptide to the carrier.
  • the tag may be a streptavidin binding protein, which when used in combination with a streptavidin coated/treated carrier attaches the peptide construct to the carrier.
  • a his-tag or HA-tag may be used. The skilled man will appreciate that these are merely examples and that other tags may be used.
  • a peptide construct is intended to refer to the product of the translation of a DNA molecule attached to the carrier, the construct may comprise the peptide and ⁇ 2 microglobulin, a tag and a linker.
  • the peptide construct may be attached to the carrier following emulsion PCR and emulsion IVTT.
  • the DNA encoding the peptide and any other necessary components for example one or more of a tag, ⁇ 2 microglobulin, a linker, a promoter and a terminator, is first attached to the carrier by PCR.
  • a primer for the DNA encoding the peptide and any other necessary components is first attached to the carrier, and PCR is then used to amplify the template DNA encoding the peptide and any other necessary components using the primer attached to the carrier.
  • the DNA encoding the peptide may be randomly generated or derived from a source library for example a peptide human or non-human cell type.
  • the primer may be attached to the carrier by any means known in the art. It may be bound covalently or non-covalently. DNA amplified by the PCR may be captured on the carrier.
  • the tag may be a biotin moiety and which would allow the amplified DNA to be captured on a streptavidin carrier.
  • the primer carrying the tag may be the primer which is not bound to the carrier prior to PCR.
  • the PCR and/or the IVTT is carried out in an emulsion (as described in Directed Evolution of Proteins In Vitro Using Compartmentalization in Emulsions Davidson, Dlugosz, Levy, Ellington, Current Protocols in Molecular Biology 24.6.1-24.6.12, July 2009 ; Miniaturizing chemistry and biology in microdroplets.
  • Kelly BT, Baret JC, Taly V, Griffiths AD. Chem Commun 2007 May 14; (18) : 1773-88 , the contents of which are hereby incorporated by reference The emulsions may be made by stirring or agitating an oil and aqueous mixture to form small droplets of water in the oil.
  • the emulsion may be stabilised by including a surfactant.
  • a surfactant Preferably where emulsion PCR and/or emulsion IVTT is carried out the carrier is a bead.
  • each droplet in the emulsion contains only one bead.
  • the aqueous phase of the emulsion carries all the reagents and enzymes necessary to carry out the PCR or the IVTT.
  • the aqueous phase preferably contains a DNA polymerase and nucleotides.
  • each bead has multiple copies of the encoding DNA attached to the bead.
  • an individual bead has DNA of only one sequence attached.
  • each bead has multiple copies of the same DNA and the same peptide/protein product encoded by the DNA.
  • the invention provides the use of a carrier according to the invention to identify a peptide ligand of a molecule, e.g. a receptor.
  • the invention provides a method to identify a peptide ligand for a molecule, and/or the peptide ligand's encoding DNA, the method comprising providing a carrier or a library as described herein, and exposing the carrier or library to the molecule.
  • the configuration adopted on the carrier by the peptide and the ⁇ 2 microglobulin preferably means that the peptide is presented in such a manner that it will be recognised by molecules of interest, e.g. receptors.
  • the method of the invention is performed in vitro.
  • the DNA which encodes the peptide ligand recognised by the molecule can be readily recovered, amplified and sequenced. From the sequence of the DNA the protein from which the peptide is derived may be deduced.
  • the method of the invention has the advantage that it is very simple. Preferably it also has the advantage that it is free from interference by unwanted proteins, this is in contrast to phage display and the yeast two hybrid system where host proteins can interfere with the binding of the expressed peptide.
  • the peptide, and the ⁇ 2 microglobulin are the only proteins present on the carrier in the subject invention.
  • a further advantage of the invention is that the carrier may be multivalent, that is it may carry multiple copies of each peptide and its encoding DNA. This will increase the chance of interaction and also improve the rate of recovery.
  • Biological in vivo based systems e.g. yeast or phage
  • yeast or phage can be limited in terms of library size because of limitations in handling large numbers of biological particles and efficient take up of library components.
  • the in vitro system of the invention is not dependent on expression by yeast or phage and therefore can offer greater library sizes.
  • the method of the invention may further include the step of recovering the peptide, and/or its encoding DNA, which bound to a molecule.
  • the DNA encoding the peptide which bound to the molecule is recovered.
  • the peptide may be sequenced. The sequence may then be analysed to determine which protein the peptide is derived from, typically this is achieved using sequence databases.
  • the nucleic acid encoding the peptide may be sequenced.
  • the sequence may than be analysed to determine the peptide it encodes and/or to determine the gene from which it is derived and/or to determine the protein from which the peptide it encodes is derived.
  • the nucleic acid sequence may be determined through conventional Sanger based methodology or by using high throughput screening approaches. The advantage of high throughput screening approaches is that large numbers of sequences can be rapidly sequenced. Having obtained the sequence, either of the DNA encoding the peptide or the peptide itself, of one or more of the peptides that bind to a molecule, the sequences can then be compared to protein and DNA sequence databases to identify possible proteins or genes from which the peptide ligand is derived. Preferably the method will allow multiple different ligands to be identified which together will allow the protein from which they are derived to be identified.
  • the molecules may first be probed with a carrier carrying peptide with a fixed sequence before probing with a peptide library. Bioinformatics could then be used to calculate a cut-off (based on the fixed sequence) above which non-fixed sequences may be relevant. The identified sequences could then be applied to database searches to examine common patterns that emerge. This system may be amenable to subsequent rounds of selection to enrich for sequences of interest. In addition the sequences generated in one round of selection can be used to derive a refined library for subsequent rounds of selection.
  • the ⁇ 2 microglobulin is included to allow the peptide to be presented in the correct configuration such that it may be recognised by a molecule.
  • ⁇ 2 microglobulin is also known as B2M, and is present on virtually all nucleated cells. In humans, the ⁇ 2 microglobulin protein is encoded by the B2M gene.
  • the ⁇ 2 microglobulin interacts with the peptide attached to the carrier to put the peptide into a confirmation such that it can be recognised by a molecule.
  • the carrier is a bead
  • the beads bound to a molecule e.g. a receptor may be readily recovered by removing any unbound beads using size based exclusion or magnetic or fluorescence based cell sorting.
  • the molecules, e.g. receptors, used in the method of the invention may be provided as isolated proteins/receptors, and/or in membrane fragments, and/or on cells in mono culture, and/or in a mixed culture of cells, and/or in a mixed population of cells, such as found in a tissue sample.
  • the tissue sample may have been homogenised to allow access to the component cells.
  • the tissue sample may be a sample of normal or diseased or infected tissue.
  • each bead has multiple copies of the peptide and the DNA encoding the peptide attached.
  • the invention provides the use of peptide ligands, and/or the proteins from which they are derived, identified by the method of the invention, as a target for diagnostic, prognostic, therapeutic or preventative agents.
  • the invention provides a kit for screening for a peptide ligand for a molecule, e.g. a receptor, wherein the kit comprises a carrier to which is attached a peptide, DNA encoding the peptide, and ⁇ 2 microglobulin.
  • the kit may also include instructions to expose the carrier to a molecule, e.g. a receptor and to isolate peptides, or the DNA encoding the peptides, that bind to the molecule.
  • the ⁇ 2 microglobulin may be provided attached to the carrier, or may be located at or near the carrier surface.
  • the invention provides a method to identify a nucleotide sequence encoding a peptide that binds to a molecule, e.g. a receptor, comprising amplifying and sequencing the DNA attached to carrier carrying a peptide which binds to the molecule.
  • the invention provides a novel multiplexed peptide expression and selection system ( Figure 1 ).
  • the inventors have hypothesized that the use of a protein scaffold ( ⁇ 2-microglobulin) with known ability to deliver peptides to a tertiary molecule (HLA) would allow the presentation and screening of peptides that bind to target molecules of interest, even in the absence of HLA or HLA like molecules.
  • Beta-2-microglobulin has a number of advantages as a carrier molecule including survival at the relatively low endosomal pH which may be important for screening peptides that might modify protein:protein interactions that occur in vivo at low pH.
  • the carrier of the invention is preferably a bead, and the bead system has a number of further advantages which have been found to be of value, including the ability to easily handle the beads for transfer to sequential binding steps with different conditions and requirements (e.g. positive/negative selection). For example, beads can be transferred sequentially to binding cells with different targets or conditions to select for beads with multiple characteristics without the need for bead re-derivation between each round of selection.
  • HIV-1 gp120 Using HIV-1 gp120 as a model system, a small peptide library was screened for low affinity interactions with gp120. Peptides that despite low affinity could inhibit HIV-1 replication through blocking protein:protein interaction between gp120 and the co-receptor CCR5 were found.
  • Gp120 was produced by transient transfection of 293T cells using the JRFL gp120 - pLex construct. HIV-1 JRFL gp120 protein was captured from the supernatant by Co 2+ affinity chromatography to the C-terminal his 6 tag. The protein was further purified by size exclusion chromatography on a SD200 16/60 column and the protein purity was verified to be >98% pure by SDSPAGE. Conformation and binding function was confirmed by binding with recombinant human CD4 and a panel of HIV-1 Env-specific monoclonal antibodies in ELISA assays.
  • Gp120 at a concentration of 100 ⁇ g/ml was coated to an immuno 96 micro-well plate (Nunc, UK) at 4°C overnight. After washing in PBST (0.05% Tween 20) 6 times, 50 ⁇ l PBS containing approximately 10 million beads collected after IVTT was added and incubated at 4°C for 1 hr. After the incubation, the supernatant was collected and the wells were washed with PBST for 6 times. The beads which remained on the plate were then collected in TE buffer for subsequent PCR to pull down the DNA fragment containing the random nucleotide region.
  • the sequence of 9 amino acids or 15 amino acids was translated from DNA sequencing data.
  • the sequence analysis is performed with software R to characterise the frequency of different amino acids in each position and the frequency of 3 or longer amino-acid fragments.
  • the sequences containing a high frequency of certain amino acids or fragments were chosen for synthesis.
  • a GS-linker (GGGGSGG) and a biotin were added at the C terminal of the peptides.
  • the purity was established by high-pressure liquid chromatography, and the individual peptides were dissolved at 20mg/ml in dimethyl sulfoxide and diluted at 1 mg/ml with PBS.
  • the 9mer peptides were broken into 3mer fragments and the frequency of these 3mers was analysed with scripts written in R software.
  • the peptides contain higher-frequency 3mers appeared in independent replicates were chosen to synthesis.
  • GP16 LWCRRLNLL was the peptide containing the NLL repeated for 6 times in 4 replicates and LWC repeated 2 times in 2 replicates.
  • ELISA plate (Greiner, 655061) was coated with 1 ⁇ g / ml purified gp120 in PBS and incubated at 4°C overnight. The plate was washed with ELISA wash buffer (PBS, 0.05% Tween20, VWR) followed by 100 ⁇ l blocking buffer (PBS, 0.05% Tween20, 2% BSA powder, Sigma) for 1 hr at room temperature.
  • ELISA wash buffer PBS, 0.05% Tween20, VWR
  • 100 ⁇ l blocking buffer PBS, 0.05% Tween20, 2% BSA powder, Sigma
  • V3/VRC01/F105 antibodies (NIBSC, CFAR3219/3291/3115) were used in 1 ⁇ g / ml for 1 hr at room temperature.
  • the plates were washed and peptides were added at different concentrations and incubate for 1 hr at room temperature. After washes, the detection of the binding was done by the addition of streptavidin conjugated peroxidase (Sigma, at 1:2500 dilution in PBS for 1 hr at room temperature and developed by TMB substrate (Thermo, 8008743723). After colour change was observed, stop buffer (0.16 M sulphuric acid, Sigma) was added to stop the reaction, and the absorbance was read at OD 450 with ELISA plate reader.
  • streptavidin conjugated peroxidase Sigma, at 1:2500 dilution in PBS for 1 hr at room temperature and developed by TMB substrate (Thermo, 8008743723). After colour change was observed, stop buffer (0.16 M sulphuric acid, Sigma) was added to stop the reaction, and the absorbance was read at OD 450 with ELISA plate reader.
  • JRFL gp120 protein was coated on ELISA plate at 1 ⁇ g / ml 4°C overnight and blocking with BSA as described above.
  • Peptides were prepared in 4 dilutions and added to the plate and incubated for 1 hr at room temperature.
  • the plates were washed and recombinant CCR5 GST tag (H00001234-P01, ABNOVA) was added to the plate at 0.1 ⁇ g / ml and incubated for 1 hr at room temperature.
  • the plates were washed and the detection antibody anti-GST HRP conjugated was added at 1:2000, 1 hr, room temperature.
  • Paired t-test was used to compare between different concentrations of peptides (GP1-22) and the negative control peptide (hemagglutinin-binding peptide, 9 amino acids) in the ELISA absorbance reading, 95% confidence level.
  • Immobilisation of purified gp120 protein (1 mg/ml) and purified HLA-A2 heavy chain (reference control, 1 mg/ml) onto the surface of individual flow-cells (Fc1 and Fc2 respectively) of CM5 sensor chip (GE Healthcare) was performed under conditions of 20 ⁇ l/min flow rate and 25°C, with HBS-EP buffer (0.01 M HEPES pH 7.4, 0.15 M NaCl, 0.005% v/v Surfactant P20; GE Healthcare) as the running buffer.
  • the affinity analyses of the interaction between 9-amino-acid predicted peptides and purified gp120 were performed using the BIAcore T200 (GE Healthcare), under conditions of 10 ⁇ l/min flow rate and 25°C and using HBS-EP buffer (0.01 M HEPES pH 7.4, 0.15 M NaCl, 0.005% v/v Surfactant P20; GE Healthcare) as the running buffer.
  • HBS-EP buffer 0.01 M HEPES pH 7.4, 0.15 M NaCl, 0.005% v/v Surfactant P20; GE Healthcare
  • the 9-amino-acid peptides were diluted to 1 mg/ml with HBS-EP buffer.
  • a 2-fold serial dilution of totally 8 concentrations was used to pass through the immobilised peptides.
  • the data were analysed using Microcal Origin version 7.5 (Microcal Software Limited).
  • Intracellular p24 antigen expression in CD4 + cells were used to quantify HIV-1 infection. Viral inhibition was assessed by the HIV-1 infection rate after the peptide incubation. Cryopreserved PBMCs were thawed and stimulated with PHA (5 ⁇ g/mL) in RPMI 1640 medium (Sigma, UK) supplemented with 10% fetal calf serum (R10) for 3 days. Biotinylated peptides were incubated with streptavidin for 10 min in room temperature.
  • HIV-1-infected PBMC (2 ⁇ 10 5 ) were cultured in triplicate in R10 with interleukin 2 (20 IU/mL) in 96-well round-bottomed plates.
  • Cells were harvested at day 3, stained with Aqua Live/Dead Fixable stain (Invitrogen), fixed with 1% paraformaldehyde/20 ⁇ g/mL lysolecithin at RT, permeabilized with cold 50% methanol followed by 0.1% Nonidet P-40, finally stained with p24 antibody (KC-57-FITC; Beckman Coulter) and antibodies to CD3, CD4, and CD8 (conjugated to APC-Cy7, PE and APC, respectively; BD Biosciences) and analyzed by flow cytometry.
  • Aqua Live/Dead Fixable stain Invitrogen
  • KC-57-FITC Beckman Coulter
  • CD3, CD4, and CD8 conjuggated to APC-Cy7, PE and APC, respectively; BD Biosciences
  • HIV-1 infection rate was expressed as percentage of HIV-1-infected CD4+ T cells (identified by gating on CD3+ CD8- cells, to allow for HIV-induced CD4 downregulation) and determined as follows: [(p24+, CD4 + T cells) + (p24+, CD4- T cells)] / [(p24+, CD4 + T cells) + (p24+, CD4- T cells) + (P24-, CD4+ T cells)] x 100.
  • the protocols were described previously by Dorrell et al., Yang, H., et al., Antiviral inhibitory capacity of CD8+ T cells predicts the rate of CD4+ T-cell decline in HIV-1 infection. J Infect Dis, 2012. 206(4): p. 552-61 .
  • FIG. 1a shows a schematic of the bead structure and selection approach. Multiple DNA constructs with variant sizes of T7 promoter regions, peptide, linkers, ⁇ 2-microglobulin and SBP (streptavidin - binding peptide) tag were tested (data not shown) but the positive control ("BZLF1" RAKFKQLL) and the corresponding random construct in figure 1b proved to be optimal in terms of consistent expression. We used random peptide libraries containing nine and fifteen amino acids.
  • Emulsion PCR was undertaken using streptavidin magnetic beads labelled with biotinylated primers (forward primer: 5'- biotin -GATCTCGATCCCGCGAAATT; reverse primer: unmodified, 5'- TCCGGATATAGTTCCTCCTT -3').
  • the emulsion oil for each PCR reaction was prepared in a universal tube using ABIL EM90 and mineral oil. To equilibrate the emulsion oil, a magnetic stirrer (VWR UK) was used.
  • Each aqueous PCR reaction (150 ⁇ l) was prepared as follows: 6 ⁇ l of primer-coupled beads, 3 ⁇ l of complement unmodified primers (400 ⁇ M), 3 ⁇ l of unmodified primer (2.5 ⁇ M), 3 ⁇ l of 10mM PCR grade dNTPs, 4.5 ⁇ l of 50 mM MgCl 2 , 10 ⁇ l of 20 pM DNA template, 15 ⁇ l 10X PCR buffer, and 9 ⁇ l of Taq DNA polymerase (5 U/ ⁇ l).
  • the water-in-oil emulsion was prepared by slow addition of the aqueous PCR mixture into the spinning emulsion oil.
  • the emulsions were then aliquoted into 100 ⁇ l each, and PCR initiated.
  • the emulsion was broken by adding 1 ml breaking buffer (10 mM Tris-HCI pH7.5, 1% Triton-X100, 1% SDS, 100 mM NaCl, 1 mM EDTA).
  • Bead bound DNA could be detected by using magnetic bead separation from the supernatant and then PCR directly from the surface of the beads.
  • Figure 2 shows DNA product from 8 independent emulsion PCR products with Dynabead C1.
  • DNA-bound beads were then transferred to a new emulsion for in vitro transcription translation.
  • Emulsion oils were prepared for a single reaction using mineral oil, Span-80, Tween-80, Triton X-100.
  • Each in vitro transcription/translation reaction (IVTT) was prepared (RTS 100 E. coli, Roche) and the beads were added and mixed thoroughly before adding to the spinning emulsions as described above. The reaction was incubated at 30°C for 4 hours and the emulsions broken as described above. The integrity of the translated proteins was examined by Western blot ( figure 3a ).
  • Beta-2-microglobulin is correctly folded on the bead surface and presents peptides for tertiary interactions
  • Peptide sequences for 22 GP120-binding peptides selected by the method of the invention. All peptides have glycine-serine repeats (GGGGGGSGGSG) at C-terminals for flexibility, followed by a lysine K residue for biotinylation.
  • GGGGGGSGGSG glycine-serine repeats
  • FIG. 5a showed the result of ELISA tests of the twenty two peptides. An irrelevant peptide was used as a reference for the peptides which has no binding to gp120. As shown in Figure 5a , GP2, GP3, GP11 and GP16 had significantly higher binding to gp120 than the control hemagglutinin-binding peptide HA2 in a dose-dependent manner.
  • ELISA is susceptible to detection of non-specific and low affinity binding. We therefore proceeded to determine specific binding affinities using surface plasmon resonance.
  • FIG. 5b shows an illustrated example of the K D calculation for GP16 peptide and the K D for different peptides is shown in Figure 5b .
  • the peptides with positive binding on ELISA had a K D value ranging from approximately 20 to 80 ⁇ M, indicating that these peptides had the ability to bind gp120 protein, but with relative weak affinity.
  • the BIAcore experiment acted as a second confirmation that the randomised peptide library had successfully captured peptides which bind to gp120 in a single round of selection, and that the sequence information coding the binding peptides was correctly preserved and sequenced.
  • binding affinity was in the micromolar range, we were aware that this was also the case of Enfuvirtide T20 which is a licensed therapeutic for HIV-1, and so proceeded to determine whether the peptides had HIV-1 replication inhibition activity either as monomers or as multimeric complexes.
  • Figure 6 shows the HIV-1 replication assay using biotinylated forms of the four peptides of highest affinity, with or without multiplexing using streptavidin conjugation (GP3, GP5, GP11, and GP16).
  • streptavidin conjugation GP3, GP5, GP11, and GP16.
  • peptides administered directly without streptavidin conjugation had a very low inhibitory effect on HIV-1 replication, e.g. GP16 inhibited HIV-1 BaL infection by less than 1% at 50 and 100 ⁇ M, and 50% at 250 ⁇ M; GP3 had no inhibitory effect at 50 ⁇ M, and 34.5% and 54.7% inhibition at 100 ⁇ M and 250 ⁇ M respectively.
  • HIV-1 neutralising antibodies are an invaluable tool to assess binding sites within the GP120 molecule.
  • Three commercially available HIV-1 broadly neutralising antibodies V3 (anti-V3 447-52D, CCR5/CXCR4 binding sites), VRC01 (discontinuous CD4 binding site) and F105 (CD4 binding site) were prepared to test the binding sites of GP3 and GP16 peptides as these showed the greatest inhibition of HIV-1 replication.
  • non-natural amino acids can be incorporated into a peptide displayed on bead
  • kit "Clover Direct” was used.
  • This kit uses non-natural amino-acyl tRNA to recognize UAG codons and insert an non-natural amino acid conjugated to the fluorophore Hilyte Fluor 488 (which is similar to FITC).
  • Hilyte Fluor 488 can be readily viusalised.
  • a peptide can be produced incorporating a non-natural amino acid by IVTT and displayed on a bead the following method was performed.
  • the non-natural fluorescent aminoacyl-tRNA was centrifuged and then 10 ⁇ L of tRNA buffer was added to the non-natural aminoacyl-tRNA tube, and vortexed to dissolve completely.
  • RNase-free water, template bound DNA beads, amino acids, methionine, and reaction mix were then mixed in a new 1.5mL microcentrifuge tube.
  • 10 ⁇ L of non-natural aminoacyl-tRNA solution and 100 ⁇ L of E.coli lysate was then added to the reaction mix. This was incubated at 30°C for 0.5 to 2 hours to allow the IVTT reaction to proceed. The reaction was then stopped by placing the tube on ice, and fluorescent gel analysis was run at 488nm as shown in Figure 9.
  • Figure 9 shows in lane 3 that the fluorescent non-natural amino acid was incorporated into the peptide to produce a fluorescent band at the expected 18kDa size.
  • the IVTT reaction was performed using the 5 Prime RTS E coli disulphide kit. 15 ⁇ L of 4 mM cystamine working solution was added to each tube containing an IVTT reaction. A 0.6 mg/mL papain-SSCH 3 working solution was prepared and 0.5 mL was added to each assay tube and mixed well. The reactions were then incubated at room temperature for one hour. 0.5 mL of 4.9 mM L-BAPNA solution was then added to each assay tube and mixed well. To determine the presence of disulphide bonds the absorbance at 410 nm was measured. Experimental tubes were compared with the absorbance of standard curve solutions. The presence and amount of disulphide bonds was quantified using the Thiol and Sulfide Quantitation Kit (Molecular Probes) as described in the manufacturers' instructions. Figure 10 illustrates that 1 or 2 disulphide bonds can be readily incorporated.
  • the invention provides in an aspect a novel in vitro bead display approach for displaying peptides using ⁇ 2m as a scaffold structure.
  • the use of ⁇ 2m as a scaffold allows effective translation and delivery of linked peptides to tertiary molecules.
  • the invention also provides a novel in vitro bead display approach for displaying peptides containing non-natural amino acids and/or constrained amino acids.
  • an in vitro system includes the possibility of using extremely large library sizes that are not limited by cloning efficiency into organisms.
  • In vitro expression does not risk bias away from variants that confer growth disadvantage to particular phage or advantage to non-recombined phage.
  • the beads may be simple, containing just peptide/protein and the encoding DNA; this means that there are fewer opportunities for non-specific interactions and that selection rounds can be reduced.
  • selection against a target can be undertaken in specific milieu that may not be possible using in vivo presentation, e.g. low pH that may be relevant for viral membrane fusion inhibitors or gastric environments for oral absorption.
  • beads are amenable to binding to targets on cells which adds further applications.
  • a binding system based on molecular interactions has been used to retain the selected beads. This has many advantages, as small numbers of beads can be selected from large libraries without dependence on threshold levels of fluorescence for detection which will be low for individual peptide:ligand interactions. Furthermore the beads can be readily isolated after each round of selection and transferred to sequential flow cells with different targets or conditions (e.g. target concentration, temperature, pH, buffer constituents) in order to undertake serial positive and/or negative selection to define multiple characteristics. Beads do not have to be re-derived between each sequential step and so even multiple selections can be undertaken quickly.
  • targets or conditions e.g. target concentration, temperature, pH, buffer constituents
  • the peptides may be of value themselves, but in addition, they may provide structural data that is of value to the design of small drugs or other peptide mimetics. It is possible to use multiple rounds of selection to pick out peptides with higher affinity. Peptides (and peptide drug precursors) offer potential advantages over antibody approaches, as the inclusion of certain sequence and structural components can allow the absorption from the gut or lungs and the targeting of intracellular proteins as shown by ciclosporin. Lastly, peptides are readily amenable to multimerisation and modulation of pharmacokinetics such as through the use of pegylation with multiple peptide binding sites.
  • bead display of peptides using ⁇ 2m as a scaffold base in accordance with the invention is a powerful approach to the identification of peptide ligands of disease relevant targets.
  • the multiplex in vitro translation system is able to pick up low affinity peptides in a cost-effective approach.
  • these peptides may be of value themselves, they can form the basis of further modifications or structural studies to inform the development of small drugs and other peptide mimetics for use to probe protein:protein interactions to understand biological process and for future therapeutic development.
  • peptides containing non-natural amino acids and/or having constrained structures may allow the production of more stable peptides and/or of peptides with higher binding affinities.
  • the peptides may be of value themselves, they may also form the basis of further modifications or structural studies to inform the development of small drugs and other peptide mimetics for use to probe protein:protein interactions to understand biological process and for future therapeutic development.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • AIDS & HIV (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
EP18213767.9A 2013-07-26 2014-07-23 Identification et affichage de ligands peptidiques Withdrawn EP3483268A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB1313352.5A GB201313352D0 (en) 2013-07-26 2013-07-26 Identification of peptide ligands
EP14761675.9A EP3024932B1 (fr) 2013-07-26 2014-07-23 Identification et affichage de ligands peptidiques
PCT/GB2014/052242 WO2015011467A1 (fr) 2013-07-26 2014-07-23 Identification et affichage de ligands peptidiques

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
EP14761675.9A Division EP3024932B1 (fr) 2013-07-26 2014-07-23 Identification et affichage de ligands peptidiques

Publications (1)

Publication Number Publication Date
EP3483268A1 true EP3483268A1 (fr) 2019-05-15

Family

ID=49166976

Family Applications (2)

Application Number Title Priority Date Filing Date
EP14761675.9A Active EP3024932B1 (fr) 2013-07-26 2014-07-23 Identification et affichage de ligands peptidiques
EP18213767.9A Withdrawn EP3483268A1 (fr) 2013-07-26 2014-07-23 Identification et affichage de ligands peptidiques

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP14761675.9A Active EP3024932B1 (fr) 2013-07-26 2014-07-23 Identification et affichage de ligands peptidiques

Country Status (5)

Country Link
US (2) US10351847B2 (fr)
EP (2) EP3024932B1 (fr)
DK (1) DK3024932T3 (fr)
GB (1) GB201313352D0 (fr)
WO (1) WO2015011467A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017013170A1 (fr) * 2015-07-22 2017-01-26 F. Hoffmann-La Roche Ag Identification d'épitopes antigéniques et séquences immunitaires reconnaissant les antigènes
US10539564B2 (en) 2015-07-22 2020-01-21 Roche Sequencing Solutions, Inc. Identification of antigen epitopes and immune sequences recognizing the antigens

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US526124A (en) 1894-09-18 Peter l
US3929758A (en) 1974-09-12 1975-12-30 Armour Pharma Cyclization of cysteine-containing peptides
US4518711A (en) 1983-05-16 1985-05-21 Gibson-Stephens Institute Conformationally constrained cyclic enkephalin analogs with delta receptor specificity
WO1991008759A1 (fr) 1989-12-15 1991-06-27 G.D. Searle & Co. Pentapeptides d'acide penicillanique cycliques substitues par un alkyle
WO1991009051A1 (fr) 1989-12-15 1991-06-27 G.D. Searle & Co. Tetrapeptides cycliques substitues d'acide penicillanique
US5169833A (en) 1989-12-15 1992-12-08 G. D. Searle & Co. Substituted cyclic pentapeptides
EP1452868A2 (fr) 2003-02-27 2004-09-01 Pepscan Systems B.V. Procédé pour sélectionner un médicament d'intérêt potentiel
WO2008013454A2 (fr) 2006-07-26 2008-01-31 Pepscan Systems B.V. Composés immunogènes et mimiques moléculaires
WO2012022975A1 (fr) * 2010-08-17 2012-02-23 Isis Innovation Limited Identification de ligands et leur utilisation
WO2012057624A1 (fr) 2010-10-25 2012-05-03 Pepscan Systems B.V. Nouveaux mimétiques peptidiques bicycliques

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5216124A (en) 1989-12-15 1993-06-01 G. D. Searle & Co. Substituted cyclic tetrapeptides
US5869270A (en) 1996-01-31 1999-02-09 Sunol Molecular Corporation Single chain MHC complexes and uses thereof
US7902121B2 (en) 2001-07-02 2011-03-08 The Board Of Trustees Of The Leland Stanford Junior University MHC-antigen arrays for detection and characterization of immune responses
FR2828679B1 (fr) * 2001-08-17 2003-10-24 Cebal Tube souple a tete distributrice sans retour d'air
US20040072262A1 (en) 2002-10-11 2004-04-15 Montero-Julian Felix A. Methods and systems for detecting MHC class I binding peptides
WO2006009838A2 (fr) 2004-06-17 2006-01-26 Beckman Coulter, Inc. Epitopes de mycobacterium tuberculosis et leurs procedes d'utilisation
US20060228758A1 (en) 2004-09-13 2006-10-12 Xencor, Inc. Analysis of MHC-peptide binding interactions
EP1848812A4 (fr) 2004-10-01 2011-11-09 Life Technologies Corp Tampons d'alimentation, systemes et methodes de synthese<i>in</i><i>vitro</i>de biomolecules
CN102065868A (zh) 2008-06-16 2011-05-18 中央研究院 诱发对于Globo H及SSEA3的特异免疫反应的组合物以及其在癌症治疗中的用途
EP2810069A4 (fr) * 2012-02-03 2015-08-12 Univ Alberta Procédé de quantification de bibliothèques de dérivés peptidiques utilisant l'exposition sur phage

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US526124A (en) 1894-09-18 Peter l
US3929758A (en) 1974-09-12 1975-12-30 Armour Pharma Cyclization of cysteine-containing peptides
US4518711A (en) 1983-05-16 1985-05-21 Gibson-Stephens Institute Conformationally constrained cyclic enkephalin analogs with delta receptor specificity
WO1991008759A1 (fr) 1989-12-15 1991-06-27 G.D. Searle & Co. Pentapeptides d'acide penicillanique cycliques substitues par un alkyle
WO1991009051A1 (fr) 1989-12-15 1991-06-27 G.D. Searle & Co. Tetrapeptides cycliques substitues d'acide penicillanique
US5169833A (en) 1989-12-15 1992-12-08 G. D. Searle & Co. Substituted cyclic pentapeptides
EP1452868A2 (fr) 2003-02-27 2004-09-01 Pepscan Systems B.V. Procédé pour sélectionner un médicament d'intérêt potentiel
WO2004077062A2 (fr) 2003-02-27 2004-09-10 Pepscan Systems B.V. Procede pour selectionner un compose medicamenteux d’interet potentiel
WO2008013454A2 (fr) 2006-07-26 2008-01-31 Pepscan Systems B.V. Composés immunogènes et mimiques moléculaires
WO2012022975A1 (fr) * 2010-08-17 2012-02-23 Isis Innovation Limited Identification de ligands et leur utilisation
WO2012057624A1 (fr) 2010-10-25 2012-05-03 Pepscan Systems B.V. Nouveaux mimétiques peptidiques bicycliques

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
DAVIDSON; DLUGOSZ; LEVY; ELLINGTON: "Directed Evolution of Proteins In Vitro Using Compartmentalization in Emulsions", CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, July 2009 (2009-07-01)
DLUGOSZ; LEVY; ELLINGTON: "Directed Evolution of Proteins In Vitro Using Compartmentalization in Emulsions Davidson", CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, July 2009 (2009-07-01)
GAN, R. ET AL.: "Microbeads display of proteins using emulsion PCR and cell-free protein synthesis", BIOTECHNOL PROG, vol. 24, no. 5, 2008, pages 1107 - 14, XP055014985, DOI: doi:10.1002/btpr.43
HANNO STEEN; MATTHIAS MANN: "The abc's (and xyz' s) of peptide sequencing", NATURE REVIEWS MOLECULAR CELL BIOLOGY, vol. 5, 2004, pages 699 - 711, XP009091770
KELLY BT; BARET JC; TALY V; GRIFFITHS AD: "Miniaturizing chemistry and biology in microdroplets", CHEM COMMUN, vol. 18, 14 May 2007 (2007-05-14), pages 1773 - 88, XP002540154, DOI: doi:10.1039/b616252e
KOJIMA, T. ET AL.: "PCR amplification from single DNA molecules on magnetic beads in emulsion: application for high-throughput screening of transcription factor targets", NUCLEIC ACIDS RES, vol. 33, no. 17, 2005, pages e150, XP008164954, DOI: doi:10.1093/nar/gni143
LI-CHIEH HUANG ET AL: "Linking genotype to phenotype on beads: high throughput selection of peptides with biological function", SCIENTIFIC REPORTS, vol. 3, 23 October 2013 (2013-10-23), XP055159037, DOI: 10.1038/srep03030 *
LU, W.C.; A.D. ELLINGTON: "In vitro selection of proteins via emulsion compartments", METHODS, 2012
MARC FERRER ET AL: "Peptide Ligands to Human Immunodeficiency Virus Type 1 gp120 Identified from Phage Display Libraries", JOURNAL OF VIROLOGY, 1 July 1999 (1999-07-01), UNITED STATES, pages 5795 - 5802, XP055159043, Retrieved from the Internet <URL:http://jvi.asm.org/content/73/7/5795.abstract> *
METZKER ML: "Sequencing technologies - the next generation", NAT REV GENET., vol. II, no. I, January 2010 (2010-01-01), pages 31 - 46
PAUL, S. ET AL.: "Selection of a T7 promoter mutant with enhanced in vitro activity by a novel multi-copy bead display approach for in vitro evolution", NUCLEIC ACIDS RES, 2012
RUI GAN ET AL: "Microbeads display of proteins using emulsion PCR and cell-free protein synthesis", BIOTECHNOLOGY PROGRESS, vol. 24, no. 5, 1 September 2008 (2008-09-01), pages 1107 - 1114, XP055014985, ISSN: 8756-7938, DOI: 10.1002/btpr.43 *
S. PAUL ET AL: "Selection of a T7 promoter mutant with enhanced in vitro activity by a novel multi-copy bead display approach for in vitro evolution", NUCLEIC ACIDS RESEARCH, vol. 41, no. 1, 15 October 2012 (2012-10-15), pages e29 - e29, XP055159046, ISSN: 0305-1048, DOI: 10.1093/nar/gks940 *
TAWFIK, D.S.; A.D. GRIFFITHS: "Man-made cell-like compartments for molecular evolution", NAT BIOTECHNOL, vol. 16, no. 7, 1998, pages 652 - 6, XP002669764, DOI: doi:10.1038/nbt0798-652
YANG, H. ET AL.: "Antiviral inhibitory capacity of CD8+ T cells predicts the rate of CD4+ T-cell decline in HIV-1 infection", J INFECT DIS, vol. 206, no. 4, 2012, pages 552 - 61

Also Published As

Publication number Publication date
US10351847B2 (en) 2019-07-16
GB201313352D0 (en) 2013-09-11
WO2015011467A1 (fr) 2015-01-29
US20160298109A1 (en) 2016-10-13
US20190323004A1 (en) 2019-10-24
DK3024932T3 (en) 2019-04-01
EP3024932B1 (fr) 2019-01-02
EP3024932A1 (fr) 2016-06-01

Similar Documents

Publication Publication Date Title
JP6454394B2 (ja) Ｔ細胞受容体の操作
Stratmann et al. The I-Ag7 MHC class II molecule linked to murine diabetes is a promiscuous peptide binder
EP2474613B2 (fr) Procédés et compositions
US20240125793A1 (en) Ligand discovery for t cell receptors
JP6437468B2 (ja) ポリペプチドの修飾
US20200088726A1 (en) Method for high throughput peptide-mhc affinity screening for tcr ligands
EP3817757A1 (fr) Compositions de protéine chaperone/cmh de classe i déficient en peptides et procédés
US7442773B2 (en) Universal peptide-binding scaffolds and protein chips
US20220033460A1 (en) Identification and use of t cell epitopes in designing diagnostic and therapeutic approaches for covid-19
US20190323004A1 (en) Identification and display of peptide ligands
US11814420B2 (en) Peptide deficient-MHC class I/chaperone compositions and methods
US20210371499A1 (en) Peptide-receptive mhc-i complex compositions and methods
WO2021212085A1 (fr) Compositions de complexe majeur d&#39;histocompatibilité (cmh-i) réceptive aux peptides et procédés associés
Huang et al. Linking genotype to phenotype on beads: high throughput selection of peptides with biological function
US20210371498A1 (en) Mhc class i compositions and methods
JP2021536578A (ja) Ｔｃｒリガンドの高スループットペプチド−ｍｈｃ親和性スクリーニングのための方法
Sgourakis High Throughput pMHC-I Tetramer Library Production Using Chaperone Mediated Peptide Exchange
WO2024072958A1 (fr) Systèmes, formulations et procédés de génération de complexes peptide/cmh universels avec disulfure modifié reliant les chaînes lourdes et légères
Sgourakis High Throughput pMHC-I Tetramer Library Production Using Chaperone Mediated Peptide
Huang Development of a novel bead display technology to identify protein ligands: application to identification of viral entry inhibitors and T-cell epitopes
Bowerman The use of high-affinity T cell receptors to study specificity in the 2C T cell system

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20181218

AC Divisional application: reference to earlier application

Ref document number: 3024932

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20200508

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20211208