EP3321365B1 - New plant-derived cis regulatory elements for developing pathogen-responsive chimeric promoters - Google Patents

Description

The present invention relates to cis-regulatory elements and chimeric promoters produced from these cis-regulatory elements and having a pathogen- or elicitor-induced activity in plants. In addition, the present invention relates to a host cell, a transgenic plant cell, a transgenic plant tissue and a transgenic plant and its seeds. The present invention further relates to a method for producing a transgenic plant which is in particular resistant to a pathogen.

Plant diseases caused by fungi, viruses, nematodes and bacteria cause major crop losses worldwide, impair the quality of the harvested products and make the costly use of chemical pesticides necessary because the natural defense measures of plants, with the help of which they fight off the majority of potential pathogens or delay their spread, and can often not be enough. Genetic engineering approaches can be used to produce plants that are resistant to the named pathogens. These plants show an increased resistance in that they produce an expression of proteins (effectors) that take place specifically at the infection site (contact point between pathogen and plant), which trigger a strong resistance reaction of the plant, or of molecules that are themselves toxic to pathogens or their Inhibit growth or virulence.

Effectors that trigger a strong resistance reaction in the plant are, for example, proteins from auto-activated resistance genes (R genes) or avirulence genes, which lead to the activation of endogenous resistance genes in the plant. The strong resistance reaction includes the hypersensitive reaction (HR), the controlled cell death of the host tissue at the infection site, the strengthening of the plant cell wall through lignification and callose formation, the formation of phytoalexins and the production of PR (pathogenesis-related) proteins.

Since these resistance reactions represent a high energy requirement and can lead to the death of plant cells (necrosis), their triggering must be subject to strict controls. The same also applies to the expression of proteins or peptides that are toxic to pathogens, provided that constitutive expression of these proteins or peptides has an adverse effect on the plant or its agronomic properties such as yield. In a transgenic approach, this control is possible by using promoters with the desired specificity.

Pathogen-induced expression of transgenes such as effectors can thus be achieved by using various known, natural pathogen-inducible promoters, such as, for example, the PR1 promoter (Rushton et al., 1996). In particular, the development of microarray technology has led to the identification of a large number of pathogen-inducible promoters ( WO 03/00898 , WO 02/50293 or JP 2003284566 ).

Such natural pathogen-inducible promoters can, however, show very unspecific activities, since they can be activated by numerous different stimuli. This can be traced back to a modular structure of the promoter made up of several different cis-regulatory elements which integrate a wide variety of different signals into a complex expression profile. Consequently, natural pathogen-inducible promoters are also characterized by undesired activities such as in certain tissues or by a high background activity.

For example, pathogen-inducible promoters of defensin genes from wheat are also active during seed development and seed germination (Kovalchuk et al., 2010). The already mentioned PR1 promoter is induced not only by pathogens, but also by senescence (Morris et al. 2000)

Other studies showed that the natural rust-inducible Fis1 promoter from flax after transformation was not suitable for regulating the expression of autoactive forms of the L6 rust resistance gene in Linum usitatissimum so specifically that no negative agronomic properties such as short stature in addition to rust resistance occurred (Howles et al., 2005).

One possibility of increasing the desired specificity of a promoter is to identify the cis-regulatory elements responsible for the desired induction and to construct chimeric promoters from these cis-regulatory elements (Venter, 2007). Sequence motifs for other stimuli, however, are removed.

The promoters of many pathogen-induced genes have been examined in more detail, with several cis-regulatory elements that can mediate pathogen-specific induction being identified (Strittmatter et al., 1996; Eulgem et al., 2000; Kirsch et al., 2000, 2001; Himmelbach et al., 2010). Further examples are the cis-regulatory elements D-box, S-box or W-box identified by stepwise mutation of natural pathogen-inducible promoters ( WO 00/29592 ) or the left scanning regions LS10 or LS7 (Lebel et al., 1998). The W-box in particular has been well studied and its core sequence TTGAC (C / T) can be used to find additional variants of the W-box in natural pathogen-inducible promoters.

Furthermore, new cis-regulatory elements can be identified bioinformatically with the help of programs such as MEME (Bailey and Elkan, 1994; Humphry et al., 2010) or BEST (Che et al., 2005). One advantage here is that a cis-regulatory element is not identified as a short individual sequence, but as a precisely defined sequence motif, via which several variants of a cis-regulatory element, i.e. several variants of a binding site of a transcription factor, are recorded. However, such bioinformatic approaches are also highly susceptible to the determination of false-positive sequences, so that they only lead to a preselection of potential sequences or sequence motifs. However, proof and verification of the functionality as a cis-regulatory element in general and as a cis-regulatory element that mediates pathogen inducibility in particular remain imperative and essential. Such experimental analyzes are also associated with considerable effort.

A further increase in the specificity of a promoter is possible by using combinations of different cis-regulatory elements (Rushton et al., 2002). The combination itself does not lead to an increase in activity (synergism), but such a synergism only occurs with specific individual, non-predictable combinations and must be determined empirically in each case. For example, chimeric promoters with combinations of the cis-regulatory elements D-Box and S-Box ( WO 00/29592 ). The number of element repeats modulates the promoter strength and background activity. Another problem with the development of pathogen-inducible chimeric promoters is their functionality in different plant species. In general, pathogen inducibility by the known, pathogen-inducible chimeric promoters can be established in almost all plant species investigated to date, but these continue to show background activity even under non-infestation conditions by a pathogen. This background activity will vary depending on the species of plant in which the chimeric promoters are used. The same applies to the induction rate (quotient of the promoter activity in the infected tissue and the promoter activity in the non-infected tissue) and the absolute activity of the promoters (promoter strength). For example, if the background activity is too high in non-infected tissue, then only a low pathogen inducibility can be determined in the infected tissue.

According to current knowledge, the cis-regulatory elements of a promoter used are responsible for the fluctuations described with regard to background activity, induction rate, promoter strength, induction kinetics and the spatial extent of promoter activation (Rushton et al., 2002, Venter, 2007). Even if the known chimeric promoters are superior to the natural promoters, there is still a need to optimize these chimeric promoters, in particular with regard to the cis-regulatory elements and / or to the combinations of cis-regulatory elements. There is still a lack of well-characterized cis-regulatory elements and suitable combinations of such cis-regulatory elements, with the help of which chimeric promoters can be constructed, which ensure a highly specific and controlled, needs-based pathogen-induced expression of transgenes per se and also in various plant species , whereby the expression should take place only as a result of a pathogen attack and almost exclusively at the infection site (Gurr & Rushton, 2005). It is therefore the object of the present invention to provide such new pathogen inducibility-mediating cis-regulatory elements and combinations thereof.

Some of the terms used in this application are initially explained in more detail below:
An "elicitor" in the sense of the present invention represents an inducer or messenger substance which induces defense measures against plant pathogens such as the synthesis of phytoalexins. Elicitors can be either endogenous or exogenous in origin. An elicitor (exogenous) is preferably derived from a pathogen and is recognized by the plant. These elicitors also include the PAMPs (pathogen associated molucular pattern) such as flagelin, PEP25 and chitin. Elicitors can be used to mimic pathogen infection or contact with a pathogen by artificially applying the elicitor in the absence of the pathogen. In connection with the present invention, elicitors are used in particular to check the inducibility of promoters.

A “single sequence” is a sequence of nucleotides or bases (pairs), each position in the single sequence being determined only by a single, firmly defined base (a, c, g or t). A single sequence is isolated from a natural promoter and is the result of a bioinformatic analysis. A single sequence is composed of a core sequence and flanking sequence areas. The term “individual sequence” also means a nucleic acid molecule whose nucleotide or base (pair) sequence corresponds to the individual sequence.

A “core sequence” is the sequence of nucleotides or bases (pairs) in a specific section of a cis-regulatory element, this section being essential for the functionality of the cis-regulatory element. The core sequence represents part of the individual sequence. The term “core sequence” also means a nucleic acid molecule whose nucleotide or base (pair) sequence corresponds to the core sequence.

A "promoter" means an untranslated DNA sequence, typically upstream of a coding region, which contains the binding site for the RNA polymerase and which initiates the transcription of the DNA. A promoter often also contains other elements that function as regulators of gene expression (eg cis-regulatory elements).
A “minimal promoter” is a promoter which only has the basic elements that are needed for the initiation of transcription (eg TATA box and / or initiator).
A “chimeric promoter” is a promoter which does not occur in nature and is composed of several elements. It contains a minimal promoter and upstream of the minimal promoter comprises at least one cis-regulatory element, which serves as a binding site for specific trans -acting factors (trans-acting factors, such as transcription factors). A chimeric promoter is designed according to the desired requirements and induced or repressed by various factors. The choice of the cis-regulatory element or a combination of cis-regulatory elements is decisive, for example for the specificity or the level of activity of a promoter. A cis-regulatory element in a chimeric promoter is either heterologous to the minimal promoter used, ie the cis-regulatory element comes from a different organism or a different species than the minimal promoter used (for example in Figures 15A-C shown), or a cis-regulatory element in a chimeric promoter is homologous to the minimal promoter used, ie the cis-regulatory element and the minimal promoter are also combined in a natural promoter, but the cis-regulatory element is on its own or as an additional Element within the chimeric promoter in a different genetic environment compared to the natural promoter localized. A chimeric promoter therefore also means a (natural) promoter which has been modified by multimerizing at least one cis-regulatory element (for example in Figure 15D shown).

A "complementary" nucleotide sequence means, based on a double-stranded DNA, that the second DNA strand, which is complementary to the first DNA strand, has the nucleotide bases corresponding to the bases of the first strand in accordance with the base pairing rules and taking into account the orientation (Ex: 5'-gcat- 3 'is complementary to 5'-atgc-3').

A "pathogen" means an organism which, in interactions with a plant, leads to symptoms of disease in one or more organs in the plant. These pathogens include, for example, animal, fungal, bacterial or viral organisms or oomycetes.

A “pathogen infection” is to be understood as the earliest point in time at which the metabolism of a pathogen is prepared for penetration of the plant host tissue. In the case of fungi or oomycetes, for example, this includes the outgrowth of hyphae or the formation of specific infection structures such as penetration hyphae and appressorias.

For the purposes of the invention, “pathogen / elicitor inducibility” or “pathogen / elicitor inducible” means the specific property of a promoter which, after pathogen infection or elicitor application, causes an at least twofold increased transcription of an operatively linked gene. Furthermore, “pathogen / elicitor inducibility” or “pathogen / elicitor inducible” in the context of the invention is to be understood as meaning the property of genes which are transcribed at least twice more after pathogen infection or elicitor application.

1. a) SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 oder SEQ ID NO: 23, oder
2. b) mit einer Nukleotidsequenz komplementär zu einer Nukleotidsequenz aus a).

According to the invention, the object set is achieved by means of cis-regulatory elements which impart new pathogen and / or elicitor inducibility. These differ significantly from already known elements, in particular within the core sequence, and thus do not represent any variations of the known elements. Accordingly, the cis-regulatory elements according to the invention should serve as recognition and / or binding sites for new transcription factors, which has the consequence that the mediated pathogen and / or elicitor inducibility has novel specificity. The cis-regulatory elements according to the invention were identified by bioinformatic approaches in promoters of pathogen- or PAMP (elicitor) -induced genes from Arabidopsis thaliana . The isolated individual sequences of the cis-regulatory elements could be assigned to eight motif groups (motif groups 1, 5, 11, 12, 18, 21, 27 and 32) as a result of various analysis steps. Furthermore, several isolated individual sequences could also be assigned to a motif group 21n. In a motif group, those individual sequences are summarized which show a high degree of conservation when the identified motifs are compared. Individual sequences of a motif group therefore all agree in a characteristic core sequence motif. The object set is thus achieved by an isolated cis-regulatory element which comprises a nucleic acid molecule, the nucleic acid molecule being selected from the group consisting of:

1. a) SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 or SEQ ID NO: 23, or
2. b) with a nucleotide sequence complementary to a nucleotide sequence from a).

Also disclosed are isolated cis-regulatory elements which comprise a nucleic acid molecule whose nucleotide sequence is from one of the core sequence motifs
vaaagtm,
aaacca,
scaaam,
acrcg,
sktgkact,
mrtsack,
ccaccaa,
tcgtctcttc or
wwkgwc
corresponds.

Less strongly conserved base positions within the characteristic core sequence motifs a) to i) are indicated as follows: 'r' stands for guanine (g) or adenine (a), i.e. a purine base, 'k' stands for guanine (g) or thymine (t ) / Uracil (u), 's' stands for guanine (g) or cytosine (c), 'm' stands for adenine (a) or cytosine (c) and 'w' stands for adenine (a) or thymine (t ) / Uracil (u). A specific core sequence motif reproduces at least one partial sequence of the core sequence of each individual sequence of the group of motifs belonging to the core sequence motif, the partial sequence at least 30% of the total core sequence of a single sequence can make up. For the motif groups with the core sequence motifs g) and h), the core sequence motif corresponds to the entire core sequence of the individual sequences. The invention also includes an isolated cis-regulatory element which comprises a nucleic acid molecule whose nucleotide sequence corresponds to a core sequence motif complementary to a) to i). A characteristic core sequence motif of a certain group of motifs can also occur several times in the core sequence of an individual sequence, the core sequence motifs also appearing overlapping in the core sequence and / or each showing a different orientation.

1. a) SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 oder SEQ ID NO: 23, oder
2. b) mit einer Nukleotidsequenz komplementär zu einer Nukleotidsequenz aus a).

For motif groups 1, 5, 11, 12, 21, 21n and 27, a family motif could be defined based on the experimental data on functionality, in which the characteristic core sequence motif is embedded. The family motif represents a derived identifier for a transcription factor or a transcription factor family. The advantage of a family motif is that it combines possible variants of a recognition / binding region. A family motif of a motif group preferably comprises all core sequences of the individual sequences combined in the motif group. For this, the complementary strand of the cis-regulatory element was taken into account for some of the individual sequences; Such complementary sequences of identified cis-regulatory sequences according to the invention are, insofar as it is necessary for understanding, marked below with '(inv)'. A family motif defined in this way has a length of at least 15 nucleotides, preferably at least 13 nucleotides, particularly preferably at least 11 nucleotides. In addition to the corresponding core sequence motif, the family motif has flanking regions which, when a cis-regulatory element according to the invention is used in a chimeric promoter, have a significant quantitative influence on its properties such as background activity and level of expression. As the distance between a certain base of the flanking regions and the core sequence in an individual sequence increases, its quantitative influence decreases. To define the family motif, additional highly conserved individual bases from the flanking areas that go beyond the core sequences of the individual sequences can also be taken into account, which then expand the family motif. The family motifs for motif groups 1, 5, 11, 12, 21, 21n and 27 are shown in column 2 of table 1. The invention accordingly also includes an isolated cis-regulatory element included, which comprises a nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of:

1. a) SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 or SEQ ID NO: 23, or
2. b) with a nucleotide sequence complementary to a nucleotide sequence from a).

1. a) einem Familienmotiv gemäß SEQ ID NO: 1, umfassend das Kernsequenzmotiv vaaagtm, entspricht,
2. b) einem Familienmotiv gemäß SEQ ID NO: 2, umfassend das Kernsequenzmotiv aaacca, entspricht,
3. c) einem Familienmotiv gemäß SEQ ID NO: 3, umfassend das Kernsequenzmotiv scaaam, entspricht,
4. d) einem Familienmotiv gemäß SEQ ID NO: 4, umfassend das Kernsequenzmotiv acrcg, entspricht,
5. e) einem Familienmotiv gemäß SEQ ID NO: 5, umfassend das Kernsequenzmotiv sktgkact, entspricht,
6. f) einem Familienmotiv gemäß SEQ ID NO: 6, umfassend das Kernsequenzmotiv mrtsack, entspricht,
7. g) einem Familienmotiv gemäß SEQ ID NO: 41, umfassend das Kernsequenzmotiv wwkgwc, entspricht,

oder dessen Nukleotidsequenz einem zu a) bis g) komplementären Familienmotiv entspricht.Also disclosed is an isolated cis-regulatory element which comprises a nucleic acid molecule, its nucleotide sequence

1. a) corresponds to a family motif according to SEQ ID NO: 1, comprising the core sequence motif vaaagtm,
2. b) corresponds to a family motif according to SEQ ID NO: 2, comprising the core sequence motif aaacca,
3. c) a family motif according to SEQ ID NO: 3, comprising the core sequence motif scaaam, corresponds,
4. d) corresponds to a family motif according to SEQ ID NO: 4, comprising the core sequence motif acrcg,
5. e) corresponds to a family motif according to SEQ ID NO: 5, comprising the core sequence motif sktgkact,
6. f) a family motif according to SEQ ID NO: 6, comprising the core sequence motif mrtsack, corresponds,
7. g) corresponds to a family motif according to SEQ ID NO: 41, comprising the core sequence motif wwkgwc,

or whose nucleotide sequence corresponds to a family motif which is complementary to a) to g).

1. a) Die Erfindung betrifft zudem auch identifizierte und isolierte Einzelsequenzen von erfindungsgemäßen cis-regulatorischen Elementen und deren Kernsequenzen (Tabelle 1 und 2). Die gestellte Aufgabe wird somit auch gelöst durch ein isoliertes cis-regulatorisches Element, umfassend ein Nukleinsäuremolekül a) mit einer Nukleotidsequenz gemäß SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 oder SEQ ID NO: 24, oder
2. b) ein Nukleinsäuremolekül mit einer Nukleotidsequenz komplementär zu einer der Nukleotidsequenzen aus a).
   Ein cis-regulatorisches Element, umfassend ein Nukleinsäuremolekül mit einer Nukleotidsequenz gemäß SEQ ID NO: 24, SEQ ID NO: 25 oder SEQ ID NO: 26 ist der Motivgruppe 1, ein solches mit einer Nukleotidsequenz gemäß SEQ ID NO: 30, SEQ ID NO: 31 oder SEQ ID NO: 32 der Motivgruppe 5, ein solches mit einer Nukleotidsequenz gemäß SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 oder SEQ ID NO: 19 der Motivgruppe 11, ein solches mit einer Nukleotidsequenz gemäß SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 oder SEQ ID NO: 23 der Motivgruppe 12, ein solches mit einer Nukleotidsequenz gemäß SEQ ID NO: 33 der Motivgruppe 18, ein solches mit einer Nukleotidsequenz gemäß SEQ ID NO: 27 oder SEQ ID NO: 28 der Motivgruppe 21, ein solches mit einer Nukleotidsequenz gemäß SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 42 oder SEQ ID NO: 43 der Motivgruppe 21n, ein solches mit einer Nukleotidsequenz gemäß SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 44 oder SEQ ID NO: 15 der Motivgruppe 27 und ein solches mit der Nukleotidsequenz gemäß SEQ ID NO: 34 der Motivgruppe 32 zugeordnet.
   Ein erfindungsgemäßes cis-regulatorisches Element kann eine Länge von weniger als 50 Nukleotiden, bevorzugt von weniger als 40 Nukleotiden und besonders bevorzugt
   von weniger als 30 Nukleotiden aufweisen. Die Kernsequenz eines erfindungsgemäßen cis-regulatorischen Elementes kann eine Länge von weniger als 20 Nukleotiden, bevorzugt von weniger als 15 Nukleotiden und besonders bevorzugt von weniger als 10 Nukleotiden aufweisen, jedoch sollte die Kernsequenz nicht kürzer sein als 6 Nukleotide.

The family motif can also be shorter. In its shortest form, it is defined as a minimal family motif which, after aligning the individual sequences according to the common core sequence motif, only includes those base positions which are found in the core sequences of all individual sequences of a motif group. In some cases the minimal family motif corresponds to the core sequence motif. Table 1 shows in column 2, headed family motif, underlined the minimal family motifs of motif groups 1, 5, 11, 12, 21, 21n and 27. <b> Table 1: </b> Representation of the motif groups 1, 5, 11, 12, 18, 21, 21n, 27 and 32, the core sequence motifs (1) on which the groups are based, family motifs (2) and the individual sequences assigned to the motif groups (3); The minimal family motif is underlined, the core sequence motif within the family motif is printed in bold. ('n' stands for any base; 'h' stands for a, c or t / u; 'd' stands for a, g or t / u; 'v' stands for a, g or c; 'r' stands for g or a, “k” stands for g or t / u, “s” stands for g or c and “m” stands for a or c; “y” stands for t / u or c; “w” stands for for a or t / u) 1 2 3 Core sequence motif Family motif Single sequence designation Motif group 27 vaaagtm nnhkdnn vaaagtm ndhy (SEQ ID NO: 1) 30I-8_M1_S1 (SEQ ID NO: 7) 30I-8_M1_S2 (SEQ ID NO: 8) GG13_M1_S2 (SEQ ID NO: 9) 14S_M1_S1 (SEQ ID NO: 10) 21S_M3_S1 (SEQ ID NO: 11) 30I-8_M1_S3 (SEQ ID NO: 12) Cis02 (SEQ ID NO: 13) Cis05 (SEQ ID NO: 14) sCis05 (SEQ ID NO: 44) Cis13 (SEQ ID NO: 15) Motif group 11 aaacca yn amcn aaacca wwny (SEQ ID NO: 2) GG11_M1_S1 (SEQ ID NO: 16) 22DDD_M1_S1 (SEQ ID NO: 17) 21G-2_M1_S2 (SEQ ID NO: 18) GG6_M1_S1 (SEQ ID NO: 19) Motif group 12 scaaam wnrm scaaam smw (SEQ ID NO: 3) 18H_M2_S1 (SEQ ID NO: 20) 18H_M2_S3 (SEQ ID NO: 21) 38M_M1_S1 (SEQ ID NO: 22) 26LLL_M1_S2 (SEQ ID NO: 23) Motif group 1 acrcg nnms acrcg ynwm (SEQ ID NO: 4) C sharp09 (SEQ ID NO: 24) C # 12 (SEQ ID NO: 25) 12i_M1_S1 (SEQ ID NO: 26) Motif group 21 sktgkact a sktgkact wkgwm (SEQ ID NO: 5) GG8_M1_S1 (SEQ ID NO: 27) 27G-8_M1_S1 (SEQ ID NO: 28) Motif group 21 n wwkgwc snsnnn wwkgwc nnnsnm (SEQ ID NO: 41) GG8_M1_S1 (SEQ ID NO: 27) 27G-8_M1_S1 (SEQ ID NO: 28) 26WW_M2_S1 (SEQ ID NO: 42) 27B-10_M1_S3 (SEQ ID NO: 43) Motif group 5 mrtsack knwym mrtsack wmn (SEQ ID NO: 6) 20u_M1_S1 (SEQ ID NO: 30) 20u_M1_S2 (SEQ ID NO: 31) 28M-1_M1_S1 (SEQ ID NO: 32) Motif group 18 ccaccaa 12G_M2_S1 (SEQ ID NO: 33) Motif group 32 tcgtctcttc (SEQ ID NO: 35) 12r_M1_S1 (SEQ ID NO: 34)

1. a) The invention also relates to identified and isolated individual sequences of cis-regulatory elements according to the invention and their core sequences (Tables 1 and 2). The object set is thus also achieved by an isolated cis-regulatory element, comprising a nucleic acid molecule a) with a nucleotide sequence according to SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24, or
2. b) a nucleic acid molecule with a nucleotide sequence complementary to one of the nucleotide sequences from a).
   A cis-regulatory element comprising a nucleic acid molecule with a nucleotide sequence according to SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26 is motif group 1, one with a nucleotide sequence according to SEQ ID NO: 30, SEQ ID NO : 31 or SEQ ID NO: 32 of motif group 5, one with a nucleotide sequence according to SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 or SEQ ID NO: 19 of motif group 11, one with a nucleotide sequence according to SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 or SEQ ID NO: 23 of motif group 12, one with a nucleotide sequence according to SEQ ID NO: 33 of motif group 18, one with a nucleotide sequence according to SEQ ID NO: 27 or SEQ ID NO: 28 of motif group 21, one with a nucleotide sequence according to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 42 or SEQ ID NO: 43 of motif group 21n, one with a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID N O: 14, SEQ ID NO: 44 or SEQ ID NO: 15 are assigned to motif group 27 and one with the nucleotide sequence according to SEQ ID NO: 34 is assigned to motif group 32.
   A cis-regulatory element according to the invention can have a length of less than 50 nucleotides, preferably less than 40 nucleotides and particularly preferred
   of less than 30 nucleotides. The core sequence of a cis-regulatory element according to the invention can be less than 20 nucleotides, preferably less than 15 nucleotides and particularly preferably less than 10 nucleotides, but the core sequence should not be shorter than 6 nucleotides.

In addition to the identified new core sequence, some individual sequences of the cis-regulatory elements according to the invention can also additionally have the core sequence of a known pathogen / elicitor inducibility mediating cis-regulatory element, which may also influence the specificity of the newly identified core sequence and / or the identified individual sequence . One example is the cis-regulatory element Cis05 (SEQ ID NO: 14) that, in addition to the identified core sequence between nucleotide positions 14 and 20, also has a W-box core sequence between nucleotide positions 29 and 35. For this purpose, extensive mutation analyzes were carried out (see Figure 5A , 5B and 11 ).

A cis-regulatory element according to the invention can be used in a chimeric promoter, the cis-regulatory element imparting a specific pathogen and / or elicitor inducibility to the chimeric promoter. The present invention thus also includes a chimeric promoter which is suitable, induced by a pathogen infection or a treatment with a pathogenic elicitor, to bring about and expression of an operatively linked nucleic acid molecule of interest, for example a heterologous DNA sequence, in a plant cell which comprises a minimal promoter and at least one cis-regulatory element according to the invention. A single cis-regulatory element according to the invention in such a chimeric promoter alone is already able to convey a significant pathogen and / or elicitor inducibility. So this one cis-regulatory element is already sufficient to construct a pathogen / elicitor-responsive chimeric promoter in combination with a minimal promoter.

Such a chimeric promoter, containing as cis-regulatory elements only one or more cis-regulatory elements according to the invention, is only pathogen and / or elicitor-responsive, ie this promoter is not or only to a small extent inducible by other stimuli such as abiotic stress . The induction of such a chimeric promoter comprising one or more cis-regulatory elements according to the invention after pathogen / elicitor contact is at least 2 times, preferably at least 10 times or particularly preferably at least 25 times higher than the induction without pathogen / elicitor contact ( Background activity).

In a preferred embodiment, the induced expression takes place only locally limited to the infection site, ie in a comparable or in a lower one The extent to which this takes place in the controlled expression of natural PR genes. Particularly preferably, the transcription activation takes place controlled by a chimeric promoter of the present invention only in the cells that come into contact with the pathogen or the pathogenic elicitor. However, due to cell-cell interactions, transcription activation can also take place in cells surrounding the infection site (s).

However, chimeric promoters of the present invention are not limited to those that are solely pathogen-responsive. The induced expression can be specified further by combining it with further regulatory elements, for example by combining it with a cis-regulatory element which, for example, has tissue specificity, storage inducibility, cold or heat inducibility or a specific activity in certain developmental stages. Chimeric promoters of the invention can also comprise at least one combination of at least two cis-regulatory elements, this at least one combination comprising at least one cis-regulatory element according to the invention. As further cis-regulatory elements in the combination, known pathogen / elicitor inducibility-mediating cis-regulatory elements such as W-box, S-box or D-box (see WO 00/29592 ) can be used to construct a chimeric promoter.

In addition, the invention also includes a chimeric promoter which comprises one or more monomers and / or one or more multimers of the cis-regulatory elements according to the invention. Preferred multimeric forms are dimers and tetramers. Monomers alone or individual monomers within a mutimer can have different orientations, ie they can be arranged in a complementary manner, for example. Cis-regulatory elements according to the invention of a multimeric form can be functionally linked to one another, ie in multimeric form they show a synergistic or antagonistic effect, for example on the binding capacity of the transcription factor, which, among other things, recognizes the characteristic core sequence motif of a certain group of motifs. Thus, the invention also includes a chimeric promoter which is suitable, induced by a pathogen infection or a treatment with a pathogenic elicitor, to bring about an expression of an operatively linked nucleic acid molecule of interest in a plant cell and which has a minimal promoter and at least two cis- comprises regulatory elements, it being possible for the at least two cis-regulatory elements to be functionally linked in homo- and / or heteromeric form.

The induction of a chimeric promoter comprising at least one multimer of the cis-regulatory elements according to the invention after pathogen / elicitor contact is at least 2 times, preferably at least 10 times or particularly preferably at least 25 times higher than the induction without pathogen / elicitor contact ( Background activity).

In a preferred embodiment of the chimeric promoters of the present invention, the distance from the minimal promoter and the first upstream cis-regulatory element according to the invention is between 0 and 300 base pairs, preferably between 0 and 70 base pairs and particularly preferably less than 10 base pairs. Additionally or alternatively, the distance between two identical monomers of the cis-regulatory elements according to the invention in a multimeric form is preferably 0 to 10 base pairs. Preferably, two separate multimers in a chimeric promoter of the invention are separated by about 0 to 50 base pairs.
Specific combinations of cis-regulatory elements according to the invention with other cis-regulatory elements according to the invention or with other known regulatory elements or fragments such as S-Box, D-Box or Gst1 showed in the experimental analyzes an advantageous and surprising effect with regard to promoter properties such as a minor one Background activity or a particularly specific or particularly strong inducibility (up to 183-fold 2xCis13-2xCis05). Some combinations showed a synergistic effect with regard to a certain promoter property such as with regard to the induction factor (compare e.g. 2xCis13-2xCis05 in parsley, Figures 12 and 13 ), while some combinations had an antagonistic effect, for example with regard to the induction factor, but developed a particularly low background activity (e.g. 4xCis05-2xD in sugar beet). The invention also includes all combinations and possible combinations of the cis-regulatory elements according to the invention with themselves and with known cis-regulatory elements which have an advantageous synergistic or antagonistic effect on the inducibility of the promoter. Advantageous combinations are those that can be selected from the following group: 4x sCis05, 4x 20u_M1_S1, 4x 27G-8_M1_S1, 4x 38M_M1_S1, 4x 18H_M2_S3, 4x 18H_M2_S1, 4x GG13_M1_S2, 4x 21S_M3_S1, 4x 30I02 - 2x_M3_S1, 4x 30I02 2x Cis02 - 2x Cis05, 2x Cis02 - 2x Cis12, 2x Cis02 - 2x Cis13, 2x Cis02 - 2x D, 2x Cis02 - 2x S, 2x Cis02 - Gst1, 2x Cis02 - 2x 30I-8_M1_S2, 2x Cis05 - 2x Cis02, 2x Cis05 - 2x Cis05, 2x Cis05 - 2x Cis12, 2x Cis05 - 2x Cis13, 2x Cis05 - 2x D, 2x Cis05 - 2x S, 2x Cis05 - Gst1, 2x Cis05 - 2x 30I-8_M1_S2, 2x Cis12 - 2x Cis02, 2x Cis12 - 2x Cis05, 2x Cis12 - 2x Cis12, 2x Cis12 - 2x Cis13, 2x Cis12 - 2x D, 2x Cis12 - 2x S, 2x Cis12 - Gst1, 2x Cis12 - 2x 30I-8_M1_S2, 2x Cis13 - 2x Cis02, 2x Cis13 - 2x Cis05, 2x Cis13 - 2x Cis12, 2x Cis13 - 2x Cis13, 2x Cis13 - 2x D, 2x Cis13 - 2x S, 2x Cis13 - Gst1, 2x Cis13 - 2x 30I-8_M1_S2, 2x D - 2x Cis02, 2x D - 2x Cis05, 2x D - 2x Cis12, 2x D - 2x Cis13, 2x D - 2x 30I-8_M1_S2, 2x S - 2x Cis02, 2x S - 2x Cis05, 2x S - 2x Cis12, 2x S - 2x Cis13, 2x S - 2x 30I-8_M1_S2, Gst1 - 2x Cis02, Gst1 - 2x Cis05, Gst1 - 2x Cis12, Gst1 - 2x Cis13, Gst1 - 2x 30I-8_M1_S2, 2x 30I-8_M1_S2 - 2x Cis02, 2x 30I-8_M1_S2 - 2x Cis05, 2x 30I-8_M1_S2 - 2x Cis12, 2x 30I-8_M1_S2 - 2x Cis13, 2x 30I- 30_M1_S2 - 2x 30I-8_M1_S2 - 8_M1_S2 - 2x S, 2x 30I-8_M1_S2 - Gst1 and 2x 30I-8_M1_S2 - 2x 30I-8_M1_S2. Particularly advantageous combinations with a surprising effect with regard to induction factor and activity are listed in Table 3.
Furthermore, the present invention also relates to chimeric promoters which comprise at least one of the above-mentioned combinations of cis-regulatory elements.

In a preferred embodiment of the chimeric promoters of the present invention, the minimal promoter originates, for example, from a CaMV35S promoter, for monocotyledonous plants, for example, from the wheat TaPal promoter (SEQ ID NO: 39), the maize ZmUbiquitin promoter (SEQ ID NO: 40) or the rice OsGns1 promoter (SEQ ID NO: 38), or for dicotyledonous plants from known minimal promoters ( WO 07/147395 ). In addition, minimal promoters from other sources can also be used to construct a chimeric promoter for the purposes of the present invention.

In any case, a chimeric promoter of the present invention fulfills the essential requirements that are placed on the stringent regulation of the expression of a transgene in a genetic engineering approach, for example for the production of a pathogen / disease-resistant plant. The transgene is a nucleic acid molecule of interest operatively linked to the chimeric promoter, for example a heterologous DNA sequence which, for example, for a resistance gene (R gene), an auto-activated resistance gene, an avirulence gene, another effector, a protein that is toxic to at least a pathogen, signal transduction components, a protein which is involved in the synthesis of phytoalexins, a double-stranded RNA for the formation of siRNAs directed against a pathogen or an antimicrobial peptide. In addition, numerous Tests on parsley (Petroselinum erispum), Arabidopsis thaliana, wheat (Triticum sp.) And sugar beet (Beta vulgaris) that a chimeric promoter of the present invention can be worked across species and used (see, for example 4xCis05 in parsley, sugar beet and wheat).

The definition of a family motif for each motif group 1, 5, 11, 12, 21, 21n and 27 opens up new possibilities for a person skilled in the art in the construction of chimeric promoters. The observed activities of the various members of motive groups 27 and 12 ( Fig. 8 ) show that the flanking sequence areas can be used to fine-tune the desired expression level as required. This also applies to a species-dependent adjustment of the expression level. The family motif reflects the possible variations of individual bases in these flanking areas and thus teaches the person skilled in the art to what extent the flanking areas can be modified. In addition, the specialist receives information from the family motif about how strongly individual base positions are conserved within the family motif. It can be assumed that the modification of a strongly conserved base has a more pronounced effect on the resulting properties of the chimeric promoter than a weakly conserved base.

Furthermore, the invention also relates to a recombinant gene which comprises a chimeric promoter of the present invention. The recombinant gene is preferably designed in such a way that the chimeric promoter is operatively linked to a nucleic acid molecule, for example a heterologous DNA sequence. Such a heterologous DNA sequence codes in particular for a (poly) petid, a cytotoxic protein (such as Bt toxin, avirulence protein or enzymes such as glucose oxidases, which generate reactive oxygen species), an antibody, an antisense RNA, a sense RNA, a Transcription factor, a protease, a nuclease, a lipase, an enzyme inhibitor or a measurable marker (such as luciferase, GFP or β-galactosidase). The latter markers and other markers known from the prior art can be used in test systems in order to determine the pathogen specificity of a chimeric promoter of the present invention or to identify effectors which cause or inhibit induction of the chimeric promoter.
Chimeric promoters of the invention can also be used in RNAi-based methods for “gene silencing”, the operatively linked nucleic acid molecule of interest, for example, an antisense RNA, a sense RNA or a encodes double-stranded RNA (dsRNA). The RNA molecule can then be a short nucleotide sequence (generally at least 10 nucleotides, preferably at least 14 nucleotides and optionally up to 100 or more nucleotides long) which is essentially complementary to a specific mRNA sequence and / or a DNA sequence of a gene of interest. Standard methods of RNAi technology are described in the prior art.
In principle, it is possible to modify the operatively linked coding sequence in such a way that the product of translation is localized in a desired cell compartment such as nucleus, endoplasmic reticulum, mitochondrion, cytoplasm or vacuole or also extracellularly (apoplastic). Modification methods suitable for this are known to those skilled in the art from the prior art ( Gorlich, Science 271 (1996), 1513-1518 ; Hicks, Plant Physiol. 107: 1055-1058 (1995) ; Rachubinski (1995) Cell 83: 525-528 ; Schatz (1996) Science 271: 1519-1526 ; Schnell (1995) Cell 83: 521-524 ; Verner, Science 241: 1307-1313 (1988) ; Vitale, BioEssays 14: 151-160 (1992) ).

A recombinant gene of the present invention can be used alone or as part of a vector. Accordingly, the present invention also relates to a vector which comprises the chimeric promoter of this invention or the recombinant gene of this invention. The vector is preferably a plant expression vector, which preferably also comprises a selection marker for plants. Examples of suitable markers are already listed above. Methods for constructing such vectors are known to the person skilled in the art from the prior art, for example described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) NY . other Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NV (1989 ).

The present invention also relates to a prokaryotic or a eukaryotic host cell which comprises a chimeric promoter, a recombinant gene or a vector according to the invention, the chimeric promoter per se or as part of the recombinant gene or as part of the vector or in each case a part of the chimeric promoter such as a cis-regulatory element is heterologous to the prokaryotic or eukaryotic host cell, for example originates from a cell or an organism with a different genetic background, or is homologous to the prokaryotic or eukaryotic host cell, but then localized in a different genetic environment and so differs from the naturally present chimeric promoter or part thereof.

The chimeric promoter, the recombinant gene or the vector according to the invention can either be integrated into the genome of the prokaryotic or eukaryotic host cell, preferably stably integrated, or can remain in the cell in an extrachromosomal form such as a plasmid.

Furthermore, the invention provides a method for producing a transgenic plant, comprising the introduction of a chimeric promoter, a recombinant gene or a vector according to the present invention in at least one cell of the plant or comprising the introduction of a chimeric promoter, a recombinant gene or a Vector according to the present invention in at least one plant cell in a cell culture, from which the transformed or transgenic plant is then regenerated. The chimeric promoter, the recombinant gene or the vector is preferably integrated into the genome of the plant, particularly preferably stably integrated. For the expression of the nucleic acid molecule of interest under the control of a chimeric promoter according to the present invention in plant cells, the nucleic acid molecule can be linked to further regulatory sequences such as at the 3 'end of a poly A tail. Methods for introducing genes or genetic material into a plant or into a plant cell and methods for the regeneration of transformed plant cells are known from the prior art, for example Agrobacterium tumefaciens or Agrobacterium rhizogenes -mediated transformation of plant cells or tissues with T- DNA, protoplast fusion, injection, electroporation, vacuum infiltration or biolistic methods. Processes for the preparation of suitable vectors for introducing genes or genetic material into a plant or into a plant cell are also familiar to the person skilled in the art ( Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) NY . other Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NV (1989 )).

In an alternative embodiment, a plant cell can be modified such that this plant cell expresses an endogenous gene under the control of a chimeric promoter according to the present invention or under the control of a native promoter of the endogenous gene modified by cis-regulatory elements according to the invention. The introduction of such a chimeric promoter, which naturally does not regulate the expression of a specific gene or a specific genomic sequence, at the desired location in the Plant genome or the introduction of cis-regulatory elements according to the invention into a native promoter can be carried out using known standard methods, for example by targeted integration ('gene targeting') using zinc finger nucleases ( Urnov et al., Nature Reviews 2010_Genome editing with engineered zinc finger nucleases ; Townsend et al., Nature 2009_ High-frequency modification of plant genes using engineered zinc-finger nucleases ) or TAL effector nucleases ( WO 2010/079430 ; WO 2011/072246 ) respectively. The modification of a native promoter of an endogenous gene also means the additional introduction of a cis-regulatory element according to the invention into the native promoter, which already naturally has a cis-regulatory element according to the invention, i.e. a multimerization of existing cis-regulatory elements. Such a modified promoter can have changed properties in comparison to the native version with regard to, for example, specificity, expression level or background activity.
Modified plants can be regenerated from the modified plant cells with the aid of known methods.

The invention thus further relates to described transgenic (transformed) plants which have been transformed with a chimeric promoter, a recombinant gene, a vector according to the present invention, and described plants, modified by the introduction of at least one cis-regulatory element according to the invention or by a chimeric promoter according to the invention. Transgenic or modified plants can originate from any desired plant species. They can be monocotyledonous, dicotyledonous or angiospermic plants, preferably they belong to plant species of agricultural or horticultural interest, for example maize, rice, wheat, rye, barley, oats, sorghum, potatoes, oilseed rape, sunflower, soybean, cotton or sugar beet. In a preferred embodiment of the invention, a transgenic or modified plant is resistant or shows an increased resistance to one or a plurality of pathogens compared to a non-transgenic or unmodified plant of the same species (wild type).

The present invention also includes a plant part, a plant tissue, a plant cell or a seed of the transgenic and the modified plant of the present invention, this plant part, this plant tissue, this plant cell or this seed also being the transgene introduced into the plant or the have introduced modification.

• Fig 1: Als Beispiel für Klonierung der Einzelsequenzen als chimäre Promotoren sind die Plasmide mit 2xCis05 Element und dem multimerisierten 4xCis05 Element gezeigt. Die Plasmide leiten sich von pBT10-GUS ( Sprenger and Weisshaar (2000): The Plant Journal 22, 1-8 ) ab. Der Aufbau der anderen Plasmide ist entsprechend. Amp: Ampicilin-Resistenz; WRKY30-Cis05: Doppelte Einzelsequenz Cis05. 35S-minimal: 35S-Minmalpromotor; Luc-m3: Luziferase-Reportergen; pAnos: Nos-terminator. Fig 1 dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 2: Spezies-übergreifend Pathogen-induzierbare Einzelsequenzen (A - X). In den oberen Zeilen sind jeweils die Bezeichnung der Einzelsequenz, die Motivgruppe, und die Einzelsequenzen selbst wiedergegeben. Die Kernsequenzen des Motivs, das zur Auswahl der Einzelsequenz geführt hat, ist fett geschrieben und unterstrichen. Darunter ist jeweils das Motivlogo des zugrundeliegenden bioinformatorisch identifizierten Motivs sowie dessen Matrize wiedergegeben. Sind mehrere Einzelsequenzen von einem Motiv getestet worden, so sind diese zusammengefasst.
• Figuren 2 A-I und M-X dienen dem besseren Verständnis und sind nicht Teil der vorliegenden Erfindung.
• Fig 3: Zusammenfassung aller positiv getesteten Einzelsequenzen einer Motivgruppe und Darstellung der daraus abgeleiteten Sequenz- und Familienmotive (Fig. 3 A - G). In der obersten Zeile ist die jeweilige Motivgruppe genannt. Darunter ist eine Alignment aller positiv getesteter Einzelsequenzen gezeigt, das mindestens die Kernsequenzen und, falls vorhanden, weitere konservierte Basen umfasst. Die Basen, aus denen sich das Kernsequenzmotiv ableitet, sind mit einem Rahmen versehen. Figuren 3 A-C und E-G dienen dem besseren Verständnis und sind nicht Teil der vorliegenden Erfindung.
• Fig 4: Phylogenetischer Stammbaum der identifizierten Motivgruppen. Der Stammbaum wurde durch eine Clusteranalyse mithilfe des Webservers STAMP erstellt. Hinter der Nummer der Motivgruppe ist in Klammern die Zahl der in der Motivgruppe enthaltenen Motive wiedergegeben.
• Fig 5: A) Mutagenese der Cis05-Einzelsequenz. Die verwendete Sequenz enthält neben dem Cis05-Motive (Fett, unterstrichen) eine W-Box (fett und umrahmt). In beide Motive wurden Mutationen eingeführt. Mit den tetramerisierten mutierten Derivaten wurden wie beschrieben Petersilien-Assays auf Induktion durch das PAMP PEP25 durchgeführt. Die PAMP-induzierte Aktivität der chimären Promotoren wurde nach 4, 8 und 24 Stunden gemessen (rechte Seite). Mutationen in dem Cis05-Motiv (Cis05mut1) sowie in der W-Box (Cis05mut2) führen zu einem deutlichen Rückgang der induzierten Aktivität. Nur wenn beide Motive mutiert sind (Cis05mut1+2) kommt es zu einem vollständigen Verlust der Induzierbarkeit. B) sCis05 ist eine verkürzte Variante von Cis05, die nur das Cis05-Motiv, aber nicht mehr die W-Box enthält. Die PEP25-Induzierbarkeit von sCis05 und mutierten Derivaten wurde, wie in 5A beschrieben, getestet. Die beiden Balken stehen für zwei biologische Replikate (unabhängige Transformationen). Zur Orientierung ist unter sCis05-Derivaten der W-Box Konsensus dargestellt. Figuren 5A und B dienen dem besseren Verständnis und sind nicht Teil der vorliegenden Erfindung.
• Fig 6 A: Elizitor-responsive Reportergenexpression der chimären Promotoren 4x30I-8_M1_S2 und 4x18H_M2_S1 mit Mutationen in den Einzelsequenzen. Die mutierten Basen sind unterstrichen. Die Elizitierung erfolgte durch PEP25 in Petersilienprotoplasten. Die Nukleotid-Sequenzen der mutierten Derivate der Einzelsequenzen sind unter den Diagrammen wiedergegeben. +, mit Elizitor PEP25; -, ohne Elizitor. 2S2D: Positivkontrolle; MS23GUS: Negativkontrolle (Leervektor). Figur 6A dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 6 B: Elizitor-responsive Reportergenexpression der chimären Promotoren 4x20u_M1_S1 und 4x27G-8_M1_S1 mit Mutationen in den Einzelsequenzen. Die mutierten Basen sind unterstrichen. Die Elizitierung erfolgte durch PEP25 in Petersilienprotoplasten. Die Nukleotid-Sequenzen der mutierten Derivate der Einzelsequenzen sind unter den Diagrammen wiedergegeben. Figur 6B dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 7: Binärer Vektor für die Transformation des Luziferase-Reportergens unter Kontrolle der chimären Promotoren in Zuckerrübe. Als Beispiel ist der Vektor mit dem chimären Promotor 4xCis05 gezeigt. nptll: Kanamycin-Resistenz; WRKY30-Cis05: Doppelte Einzelsequenz Cis05. 35S-minimal: 35S-Minmalpromotor; luc-m3: Luziferase-Reportergen; Anos: Nos-terminator. Figur 7 dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 8 A: Cercospora beticola induzierte Promotoraktivität in stabil transformierten Zuckerrüben. Von den angegebenen Konstrukten wurde für mehrere unabhängige Transformanten die Luziferase-Aktivität nach C. beticola Infektion von in vitro-Pflanzen bestimmt (4 Replikate pro Transformante und Zeitpunkt). Aus den erhaltenen Messwerten wurde der Median berechnet. In dem oberen Diagramm sind die Ergebnisse für Einzelsequenzen aus der Motivgruppe 12 zusammengefasst, in dem unteren Diagramm die Ergebnisse für Elemente aus der Motivgruppe 27. Ko: Kontrolle (Mock-Infektion); inf; Infektion mit C. beticola; 1d -4d: Tage nach Inokulation (d.p.i.). Kontrolle: Nicht transgene Pflanzen.
• Fig 8 B: Cercospora beticola induzierte Promotoraktivität von 4xCis05 und seinen Derivaten in stabil transformierten Zuckerrüben. Für 4xCis05 und seine Derivate wurde die Luziferase-Aktivität nach C. beticola Infektion jeweils in mehreren unabhängige Transformanten bestimmt (4 Replikate pro Transformante und Zeitpunkt). Aus den erhaltenen Messwerten wurde der Median berechnet. Die Sequenz der verschiedenen Derivate ist in Fig. 5A und 5B wiedergegeben. Unter dem Diagramm ist zusätzlich für jedes der verschiedenen Derivate angegeben, ob es das Cis05-Motiv oder die W-Box enthält. Ko: Kontrolle (Mock-Infektion); inf; Infektion mit C. beticola; 1d -4d: Tage nach Inokulation (d.p.i.). non transgenic: Nicht transgene Kontrolle. Figur 8AB dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 9: Cercospora beticola induzierte Promotoraktivität des chimären Promotors 4xGG6_M1_S1 in stabil transformierten Zuckerrüben. Für 10 unabhängige Transformanten mit dem Konstrukt 4xGG6_M1_S1-luc wurde die Luziferase-Aktivität nach C. beticola Infektion von in vitro-Pflanzen bestimmt (4 Replikate pro Transformante und Zeitpunkt). Ko: Kontrolle (Mock-Infektion); inf; Infektion mit C. beticola; 2d, 3d, 4d und 7d: Tage nach Inokulation (d.p.i.). 3DC4156: Nicht transgene Kontroll-Pflanzen. Diese Figur dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 10: Plasmidkarte des für die transienten Tests in Weizen verwendeten Plasmids. Als Beispiel wird das Plasmid mit dem chimären 4xCis05-Promotor gezeigt. Ruc: Renilla-Luziferase Reportergen. AMP: Ampicilin-Resistenz. WRKY30-Cis05: Doppelte Einzelsequenz Cis05. Diese Figur dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 11: Test der Induktion des chimären Promotors 4xCis05 und seiner mutierten Derivate mit Mutationen in dem Cis05-Motiv (Cis05mut1), in der W-Box (Cis05mut2) oder in beiden Motiven (Cis05mut1+2) durch Fusarium. Die entsprechenden Konstrukte wurde transient in Weizen transformiert, und die Luziferase-Aktivität 20 Stunden nach Inkubation mit Fusarium gemessen. 4xCis05-dam/dcm bezeichnet einen Versuch, bei dem Plasmid-DNA einem nicht methylierenden E.Coli-Stamm verwendet wurde um eine Induktion durch dam/dcm-methylierte DNA (ebenfalls ein potentielles PAMP) auszuschließen. Wird die Kernsequenz von Cis05 mutiert, so geht die Induzierbarkeit vollständig verloren. Die Mutation in der W-Box hingegen hat keinen Effekt. Die Sequenzen von Cis05 und seinen mutierten Derivaten sind rechts wiedergegeben. Mutierte Basen sind rot unterlegt. Diese Figur dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 12: Induzierte und nicht-induzierte Aktivität der chimären Kombinatorik-Promotoren nach PEP25-Induktion in Petersilie. Die Tests wurden in drei biologischen Replikaten durchgeführt, die blaue Linie gibt den Induktionsfaktor wieder. Unter dem Diagramm sind in unteren Reihe die Elemente in 5' Position und in der oberen Reihe die Elemente in 3' Position angegeben. 30I8b ist eine andere Bezeichnung für die Einzelsequenz 30I-8_M1_S2. Diese Figur dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 13: Synergistische und antagonistische Interaktionen von Einzelsequenzen in den chimären Kombinatorik-Promotoren nach PEP25-Induktion in Petersilie. In Violet ist der tatsächlich gemessene Induktionsfaktor wiedergegeben, in Blau der auf Grund der Induktionsfaktoren der Einzelelemente erwartete Induktionsfaktor. Das Verhältnis beider Werte ist durch die gelbe Linie dargestellt. Liegen die Punkte der gelben Linie über dem Wert 1, so zeigen die Einzelelemente eine synergistische Interaktion. Diese Figur dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 14: Transgene Zuckerrüben mit 4xCis05-RFP Konstrukt wurden mit Cercospora beticola infiziert. Die Infektion führt zur Aktivierung des chimären 4xCis05-Promotors, was zur Bildung des rot fluoreszierenden RFP-Proteins führt. Das Protein ist unter dem Mikroskop als rote Fluoreszenz zu sehen. Wie zu erkennen ist, ist die Induktion und damit die Fluoreszenz auf den Bereich um die Penetrationsstelle bzw. den Infektionsort beschränkt. Diese Figur dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.
• Fig 15: Beispielhafte schematische Darstellungen eines chimären Promotors im Sinne der Erfindung. Der chimäre Promotor ist operativ mit einem Nukleinsäuremolekül von Interesse verknüpft und umfasst (A) neben einem Minimalpromotor ein heterologes cis-regulatorisches Element, (B) neben einem Minimalpromotor ein Dimer/Multimer eines heterologen cis-regulatorisches Elements oder (C) neben einem Minimalpromotor zwei Dimere/Multimere mit jeweils unterschiedlichen heterologen cis-regulatorischen Elementen. Zudem zeigt (D) beispielhaft als chimären Promotor einen natürlichen Promotor, umfassend einen endogenen Minimalpromotor und ein endogenes cis-regulatorisches Element, wobei dieser Promotor durch Integration eines zusätzlichen homologen cis-regulatorischen Elements modifiziert wurde.
• Fig 16: Transgene Arabidopsis-Pflanzen mit einem Tetramer des cis-regulatorischen Elements Cis05 in einem chimäre Promotoren, der die Expression des GUS-Reportergens kontrolliert, um die Pathogen-induzierte, Wund-induzierte und Gewebespezifische Aktivität des Elements zu untersuchen. Für den Promotor wurden 10 unabhängige Transformanten untersucht. Gezeigt ist jeweils eine repräsentative Linie. Das linke Bild (5 d.p.i. with H. arabidopsidis) zeigt jeweils die Aktivität des Promotors nach Infektion mit dem kompatiblen Pathogen Hyaloperonospora arabidopsidis, das rechte Bild (Mock control) ist die entsprechende Kontrolle. Der Promotor zeigt eine klare Induktion durch Hyaloperonospora arabidopsidis (Dunkelfärbung des pflanzlichen Gewebes).
  Zudem ist auf dem rechten Bild ein Blatt eingeschnitten. Eine Blaufärbung an dieser Schnittstelle würde eine Wundinduzierbarkeit des Promotors mit dem Tetramer des cis-regulatorischen Elements Cis05 anzeigen. Diese Figur dient dem besseren Verständnis und ist nicht Teil der vorliegenden Erfindung.

Embodiments of the present invention are described by way of example with reference to the attached figures and sequences:

• Fig 1 : The plasmids with 2xCis05 element and the multimerized 4xCis05 element are shown as an example of cloning the individual sequences as chimeric promoters. The plasmids are derived from pBT10-GUS ( Sprenger and Weisshaar (2000): The Plant Journal 22, 1-8 ) from. The structure of the other plasmids is similar. Amp: ampicilin resistance; WRKY30-Cis05: Double single sequence Cis05. 35S minimal: 35S minimal promoter; Luc-m3: luciferase reporter gene; pAnos: Nos terminator. Fig 1 serves for a better understanding and is not part of the present invention.
• Fig 2 : Cross-species pathogen-inducible single sequences (A - X). The designation of the individual sequence, the group of motifs and the individual sequences themselves are shown in the top lines. The core sequences of the motif that led to the selection of the individual sequence are written in bold and underlined. The motif logo of the underlying bioinformative identified motif as well as its matrix are shown below. Are several Individual sequences of a motif have been tested, so these are summarized.
• Figures 2 AI and MX serve for better understanding and are not part of the present invention.
• Fig 3 : Summary of all positively tested individual sequences of a motif group and presentation of the sequence and family motifs derived from them ( Figures 3 A-G ). The respective group of motifs is named in the top line. Underneath, an alignment of all positively tested individual sequences is shown, which comprises at least the core sequences and, if available, further conserved bases. The bases from which the core sequence motif is derived are framed. Figures 3 AC and EG serve for better understanding and are not part of the present invention.
• Fig 4 : Phylogenetic family tree of the identified motif groups. The family tree was created through a cluster analysis using the STAMP web server. After the number of the motif group, the number of motifs contained in the motif group is given in brackets.
• Fig 5 : A) Mutagenesis of the Cis05 single sequence. In addition to the CIS05 motif (bold, underlined), the sequence used contains a W-box (bold and framed). Mutations were introduced into both motifs. With the tetramerized mutated derivatives, parsley assays for induction by the PAMP PEP25 were carried out as described. The PAMP-induced activity of the chimeric promoters was measured after 4, 8 and 24 hours (right side). Mutations in the Cis05 motif (Cis05mut1) and in the W box (Cis05mut2) lead to a significant decrease in the induced activity. Only when both motifs are mutated (Cis05mut1 + 2) does a complete loss of inducibility occur. B) sCis05 is a shortened version of Cis05, which only contains the Cis05 motif, but no longer the W-Box. The PEP25 inducibility of sCis05 and mutated derivatives was tested as described in Figure 5A. The two bars represent two biological replicates (independent transformations). For orientation purposes, the W-Box consensus is shown under sCis05 derivatives. Figures 5A and B. serve for better understanding and are not part of the present invention.
• Fig 6 A: Elizitor-responsive reporter gene expression of the chimeric promoters 4x30I-8_M1_S2 and 4x18H_M2_S1 with mutations in the individual sequences. The mutated bases are underlined. The elicitation was carried out by PEP25 in parsley protoplasts. The nucleotide sequences of the mutated derivatives of the individual sequences are shown below the diagrams. +, with elicitor PEP25; - without an elicitor. 2S2D: positive control; MS23GUS: negative control (blank vector). Figure 6A serves for a better understanding and is not part of the present invention.
• Fig 6 B: Elizitor-responsive reporter gene expression of the chimeric promoters 4x20u_M1_S1 and 4x27G-8_M1_S1 with mutations in the individual sequences. The mutated bases are underlined. The elicitation was carried out by PEP25 in Parsley protoplasts. The nucleotide sequences of the mutated derivatives of the individual sequences are shown below the diagrams. Figure 6B serves for a better understanding and is not part of the present invention.
• Fig 7 : Binary vector for the transformation of the luciferase reporter gene under the control of the chimeric promoters in sugar beet. The vector with the chimeric promoter 4xCis05 is shown as an example. nptll: kanamycin resistance; WRKY30-Cis05: Double single sequence Cis05. 35S minimal: 35S minimal promoter; luc-m3: luciferase reporter gene; Anos: Nos terminator. Figure 7 serves for a better understanding and is not part of the present invention.
• Fig 8 A: Cercospora beticola induced promoter activity in stably transformed sugar beets. For several independent transformants, the luciferase activity according to C. beticola infection of in vitro plants determined (4 replicates per transformant and point in time). The median was calculated from the measured values obtained. The upper diagram summarizes the results for individual sequences from motif group 12, and the lower diagram shows the results for elements from motif group 27. Ko: control (mock infection); inf; Infection with C. beticola; 1d -4d: days after inoculation (dpi). Control: non-transgenic plants.
• Fig 8 B: Cercospora beticola induced promoter activity of 4xCis05 and its derivatives in stably transformed sugar beets. For 4xCis05 and its derivatives, the luciferase activity according to C. beticola infection was determined in several independent transformants (4 replicates per transformant and time point). The median was calculated from the measured values obtained. The sequence of the various derivatives is in Figure 5A and 5B reproduced. Below the diagram it is also indicated for each of the different derivatives whether it contains the Cis05 motif or the W box. Ko: control (mock infection); inf; Infection with C. beticola; 1d -4d: days after inoculation (dpi). non transgenic: non-transgenic control. Figure 8AB serves for a better understanding and is not part of the present invention.
• Fig 9 : Cercospora beticola induced promoter activity of the chimeric promoter 4xGG6_M1_S1 in stably transformed sugar beets. The luciferase activity after C. beticola infection of in vitro plants was determined for 10 independent transformants with the construct 4xGG6_M1_S1-luc (4 replicates per Transformant and point in time). Ko: control (mock infection); inf; Infection with C. beticola; 2d, 3d, 4d and 7d: days after inoculation (dpi). 3DC4156: Non-transgenic control plants. This figure is for better understanding and does not form part of the present invention.
• Fig 10 : Plasmid map of the plasmid used for the transient tests in wheat. The plasmid with the 4xCis05 chimeric promoter is shown as an example. Ruc: Renilla luciferase reporter gene. AMP: ampicilin resistance. WRKY30-Cis05: Double single sequence Cis05. This figure is for better understanding and does not form part of the present invention.
• Fig 11 : Test of the induction of the chimeric promoter 4xCis05 and its mutated derivatives with mutations in the Cis05 motif (Cis05mut1), in the W box (Cis05mut2) or in both motifs (Cis05mut1 + 2) by Fusarium. The corresponding constructs were transiently transformed into wheat, and the luciferase activity was measured 20 hours after incubation with Fusarium. 4xCis05-dam / dcm refers to an experiment in which plasmid DNA from a non-methylating E. Coli strain was used in order to rule out induction by dam / dcm-methylated DNA (also a potential PAMP). If the core sequence of Cis05 is mutated, the inducibility is completely lost. The mutation in the W-box, however, has no effect. The sequences of Cis05 and its mutated derivatives are shown on the right. Mutated bases are highlighted in red. This figure is for better understanding and does not form part of the present invention.
• Fig 12 : Induced and non-induced activity of the chimeric combinatorial promoters after PEP25 induction in parsley. The tests were carried out in three biological replicates, the blue line shows the induction factor. Below the diagram, the elements in the 5 'position are indicated in the lower row and the elements in the 3' position in the upper row. 30I8b is another name for the single sequence 30I-8_M1_S2. This figure is for better understanding and does not form part of the present invention.
• Fig 13 : Synergistic and antagonistic interactions of individual sequences in the chimeric combinatorial promoters after PEP25 induction in parsley. In violet the actually measured induction factor is shown, in blue the expected induction factor based on the induction factors of the individual elements. The relationship between the two values is shown by the yellow line. Are the points of the yellow line above the value 1, the individual elements show a synergistic interaction. This figure is for better understanding and does not form part of the present invention.
• Fig 14 : Transgenic sugar beets with 4xCis05-RFP construct were infected with Cercospora beticola . The infection leads to the activation of the 4xCis05 chimeric promoter, which leads to the formation of the red fluorescent RFP protein. The protein can be seen under the microscope as red fluorescence. As can be seen, the induction and thus the fluorescence is limited to the area around the penetration site or the site of infection. This figure is for better understanding and does not form part of the present invention.
• Fig 15 : Exemplary schematic representations of a chimeric promoter within the meaning of the invention. The chimeric promoter is operatively linked to a nucleic acid molecule of interest and comprises (A) in addition to a minimal promoter a heterologous cis-regulatory element, (B) in addition to a minimal promoter a dimer / multimer of a heterologous cis-regulatory element or (C) in addition to a minimal promoter two Dimers / multimers each with different heterologous cis-regulatory elements. In addition, (D) shows, for example, as a chimeric promoter a natural promoter comprising an endogenous minimal promoter and an endogenous cis-regulatory element, this promoter having been modified by integrating an additional homologous cis-regulatory element.
• Fig 16 : Transgenic Arabidopsis plants with a tetramer of the cis-regulatory element Cis05 in a chimeric promoter that controls the expression of the GUS reporter gene in order to study the pathogen-induced, wound-induced and tissue-specific activity of the element. 10 independent transformants were examined for the promoter. A representative line is shown in each case. The left picture (5 dpi with H. arabidopsidis ) shows the activity of the promoter after infection with the compatible pathogen Hyaloperonospora arabidopsidis, the right picture (mock control) is the corresponding control. The promoter shows a clear induction by Hyaloperonospora arabidopsidis (dark color of the plant tissue).
  In addition, a leaf has been cut into the picture on the right. A blue color at this interface would indicate that the promoter was wound-inducible to the tetramer of the cis-regulatory element Cis05. This figure is for better understanding and does not form part of the present invention.

Bioinformatic identification of the cis-regulatory elements according to the invention:

Publicly available microarray expression data form the basis for bioinformative identification of the new cis-regulatory elements. These expression data are stored in databases such as TAIR, NASCArrays, Geo or ArrayExpress or can be obtained directly from corresponding publications of microarray experiments (e.g. Rhee et al., 2003; Craigon et al., 2004; Barret and Edgar, 2006; Brazma et al., 2006, Zipfel et al., 2004, 2006; Bülow et al., 2007; Wan et al., 2008). For the bioinformatic identification of new cis-regulatory elements, groups of genes from the plant Arabidopsis thaliana were defined based on the publicly available microarray expression data, the expression of which by pathogens such as P. syringae or B. cinerea or PAMPs such as flg22 or chitin is induced. The sequences of the promoters of these gene groups were then extracted from the genome sequence of Arabidopsis thaliana (TAIR; http://www.arabidopsis.org). Using different known algorithms (MEME, Bioprospector, Alignace, BEST and the like) the promoter sequences were examined for enriched motifs.

Database queries

A software tool was written for the database query to identify coregulated genes, which enables genes to be identified that are upregulated or induced together with up to six different stimuli. More than 700 database queries were performed to identify coregulated genes. This query process provided more than 400 groups of jointly induced genes that are suitable for identifying common cis-regulatory motifs with the BEST software package (Che et al., 2005). In 77 groups, the number of mutually regulated genes was reduced to 120 genes by increasing the necessary induction factor. The total number of gene groups of co-regulated genes (2-120) was then 510.

From these 510 gene groups, 500 bp or 1000 bp long promoter sequences were extracted upstream of the transcription start (TSS) of the co-regulated genes whose TSS was known. With the programs BEST, Cismodule, MD-Scan, BioProspector or MEME, the promoter sequences of the coregulated gene groups were examined for conserved sequence motifs. Motif lengths of 5-10nt, 10-15nt and 15-20nt were chosen. So around 500 x 3 (motif lengths) = 1500 queries were carried out. In most cases, lengthening the length of the motif did not identify any further motifs that were not identified in the shorter ones Motif lengths occurred. A motif was always classified in the BEST analyzes if it was found by at least two of the 4 BEST programs.

The same co-regulated genes and therefore the same motifs were obtained for certain different stimuli. This was followed by a summary of the identical motifs of redundant gene groups (GG) to form new motifs (table gene groups) so that only unique motifs were compared with each other in the comparative, systematic analysis of all motifs.

A catalog was created, which contains all the identified motifs plus the evaluation file and the sequence logos of the individual motifs. The sequence logos (Crooks et al., 2004), created at http://weblogo.berkeley.edu/, reflect the conservation of the nucleotides at the individual positions of the motif. The matrix was created from the sequences forming the motif, the sequences of which and the associated genes are also shown.

Using the STAMP program (Mahony and Benos, 2007), which can be accessed at the Internet address http://www.benoslab.pitt.edu/stamp, the identified motifs were combined with known cis regulatory elements (PLACE, Agris , Athamap). In addition, similar motifs can be grouped into a motif group using the STAMP web server. The program publishes a phylogenetic family tree in which the similarities of the groups of motifs are summarized ( Fig. 4 ).

Proof of pathogen inducibility of the identified cis-regulatory elements

Since bioinformatic approaches are susceptible to the determination of false-positive sequences, the pathogen inducibility must be confirmed experimentally. For experimental confirmation, the bioinformationally identified sequences were cloned as tetramer in front of a luciferase reporter gene using standard DNA cloning techniques and tested for their inducibility by the PAMP PEP25 in a transient expression system in parsley.

For the experimental investigation, elements were selected that are new and do not show any similarity to known cis-regulatory elements of pathogen-mediated induction. The individual sequences listed in Table 2 were synthesized in vitro with Spel and XbaI or with Spel and Sall linkers and cloned into the plasmid MS23. MS23 carries either a β-glucuronidase (GUS) reporter gene or a luciferase reporter gene with a 35S minimal promoter. All elements were tetramerized and sequenced for verification. As an example for Cloning of the individual sequences as chimeric promoters are in Fig. 1 the plasmids with 2xCis05 element and the multimerized 4xCis05 element are shown. Table 2: Individual sequences examined. The table shows the new names and sequences of the potentially investigated cis-regulatory elements. The bioinformatically identified core sequences are highlighted (bold and underlined). In the last column the result of the PEP25 / parsley test is given (-: no induction; +: inducible). Single sequence designation Motif group AGI Single sequence Inducibility 12i_M1_S1 1 At5g04340 TCTCATCT CTCGACACG CAACTTCC + C sharp09 1 At1g27730 TGCACACACAC ACACGTGT ACTAGGTCAAACCAAACGT + C # 12 1 At2g33580 CAAAAAGTCAACACATACG ACGCGT TTCCATTGACTAAATA + 12c_M1_S1 4th At1 g211 00 TCTACTAG AGGCCCATTAGG ACCGGCAT - 20u_M1_S1 5 At1g13990 TGTTGAGTCGTTTA CGTCACG TCGAGAATTTTCTC + 20u_M1_S2 5 At4g05020 TGTCATTATTAATA CGTGACG AAACTGTAGCTCTG + 28M-1_M1_S1 5 At1g09080 TTACGTGTCA AGAAGTGATTGGAGA GGACACTCTAC + 28M-1_M1_S2 5 At4g17500 AAGACAAGTT GAGAGAGACGAGACC AATCACAACA - 28M-8_M1_S1 6th At3g21520 ATCCAACATCTC GGACCGGATCA ATGATTTATCAT - 24F_M1_S1 7th At2g40750 TCATCAAT GTGACATAA GCAAAGCT - 3C_M1_S1 11 At3g51440 TTTGATA CGGTTACGGTTA ATTAACG - GG6_M1_S1 11 At2g40140 GACTTTT GACCTAAACCA TTTCCAT + GG11_M1_S1 11 At2g40140 GTTTTGACTTTTG ACCTAAACCA TTTCCATGTAGAA + GG6_M1_S2 11 At5g59820 AAGATTCTCATCC AACCGAAACGA CTCTTTCGTTTT - GG11_M1_S2 11 At5g59820 AGATTCTCATCCA ACCGAAACGAC TCTTTCGTTTTT - GG11_M1_S3 11 At1g27730 TCTTCTTCATTTT ACCAACACCA CTTGCACACACAC - 22DDD_M1_S1 11 At3g14990 CCGTCTTAGTTT ACCGAAACCAAA GTGGCTTTTTCT + 21 G-2_M1_S1 11 At1g01560 AGTTGAATTA GTTCGGTTCGGTTCG GTTGATATTG - 21 G-2_M1_S2 11 At3g55470 CGTAATAATG GTTTGGTTTGGTTTG ATCAAGTCTT + 37E_M1_S1 12 At2g39200 CGATA AACTTGCGAAACCC TAAAA - 18H_M2_S1 12 At1g70170 CAACACAA AACGCAAAC GCAGACCTC + 18H_M2_S2 12 At2g35980 TATTGGAA GTTTGGGGC AACATCAC - 16MM_M1_S1 12 At5g05340 TTCAACCCTATAA ACCAAAACA AATAACAGAATGC - 38M_M1_S1 12 At4g23810 AAATAATTATTTA TGGTTTGGT CATTTGGTCAAAT + 3I_M3_S1 12 At1g26390 CGCCTCAAT CATGAAAACGAATCCTCTG TAGTAGTG - 18H_M2_S3 12 At1g70170 AATTGACAAAAGA CACGCAAAC GATTCCAACGACC + 26LLL_M1_S1 12 At1g67920 TTACCGACACGTAA CCAAAAC TCACCGAACACCGT - 38M_M1_S2 12 At2g29460 GTTTCGAACGGGA ACCAAACCA TAATATGCGATGC - 38M_M1_S3 12 At3g54960 ACACTATTGGTCT TGGTTTGGT TTATATGCACGAC - 23LLL_M1_S1 12 At2g30770 GAAAACGATGGGTT CCAAAACT GTCGCTAATAAACT - 37D_M1_S1 12 At1g32940 TCTCCACTCGTTGT GATTTGGT CTGCAAGAAAACTA - 23LLL_M1_S2 12 At1g01480 ACGTTTTGAAATAT TGTTTTGG ATGGAGATTTTTTC - 34G-4_M1_S1 12 At3g28740 ATTTTTCATTTCGC CCAAAACA ATTATCCTAACGTT - 26LLL_M1_S2 12 At4g01700 AGTCAAAACGTAGA CCAAAAC AAAAACATGTAACT + 27H-8_M1_S1 12 At4g18430 TTTTATAACACTA CCAAAACCAA TAAGCCCTTTCGT - 26KKK_M1_S1 12 At2g43510 TCATCAAACCAATC GGTTTGG TCCTAAAGATAATT - 19Q_M1_S1 13 At4g35180 GTCAATATACAC AGCCACCGAAC AAATTACTCTAT - 21S_M1_S1 14th At2g14610 AAGCGATGT TTACGAACC CCAAAATC - 28H-9_M1_S1 14th At1g19020 AGATTT GTTCGAGAACCTT GAGAAA - 28H-9_M1_S2 14th At4g37370 TTGCTA CTTCGAGAACATT GGTCAA - 20a_M1_S1 15th At5g04340 TTAGAAGT GGCTCGAGTG TTCTACTT - 20a_M1_S2 15th At5g20230 AAGAAAGA CAATCGAGCC TAGAAATT - 12G_M2_S1 18th At1g61800 CCATACAATATAAA CCACCAA ACCATAACCACAAA + 3D_M1_S1 18th At4g39950 AATAATGTTCAAC GTTGGTGGTG GTACTCAAGATGG - 41J_M1_S1 19th At3g09940 TCAAATACAGGCA ACCAAGACTC GAGATCCTCATCG - 37C_M1_S1 20th At3g51440 AGAAAAATA TTGGGCC TACTGGGAA - 3M_M3_S1 20th At3g02800 AGATTCCTGAAGTGA GGTCCA CCCTAAAATCCATTT - GG8_M1_S1 21 / 21n At1g27730 CACACA CGTGTACTAGGTC AAACCA + 27G-8_M1_S1 21 / 21n At2g38860 AGGACTTTTCACC AGTTGGACT TTGAAGCCACCAA + 27G-8_M1_S2 21st At1g72060 GGTTT AGTCAAAGT AAACAAG ACTTTGACT GTTCA - 27B-10_M1_S1 21st At1g22890 TGAACTTAAT CACTGTCATTGTTTTC GTAACAATTT - 26WW_M2_S1 21n At4g02380 CTCA AAGGCCAGAATTGACGCAGCC GTTT + 27B-10_M1_S3 21n At1g21120 CCTTGG CCCAGTCCTTGGTCGT CGTATC + GG4_M2_S1 22nd At3g14990 GAAAAA TGTGTGTGTTTGTG TTAATT - GG4_M2_S2 22nd At5g59820 ATAGTT CCCAAACGGACACG AACACA - 30A-8_M1_S1 24 At3g49620 GCAAACTA ACGCCGGCGG CCGTCTTG - 30I-8_M1_S1 27 At5g12930 ACAACAGAC GACTTTT CATAATTCA + 30I-8_M1_S2 27 At1g26390 CTATATGAC AAAAGTC AAACATAAA + GG13_M1_S2 27 At3g26830 TGTTCA CTTTGAAAAGTATTC TTTGAG + 30H-8_M1_S1 27 At1g35230 TAGCTGTT GAAATTTCC AAGAAAAT - 14S_M1_S1 27 At1g76960 CGATCA GACTTTTCTACGCA AGAGAA + 21 S_M3_S1 27 At1g76960 TAATTTCTCTT GCGTAGAAAAGTC TGATCGGGAAG + 30I-8_M1_S3 27 At5g24110 TCGTTCTTCAGTC AAAAAGTC AAACTATCTCTCTC + Cis02 27 At5g64905 GAGCGTGAATT GACTTTG ACCAAAACCAAA + Cis05 27 At5g24110 GGTCAGCATGTTG GACTTTC CAAATTCATTGACCAAAG + Cis13 27 At1g26380 AAAATAAACAGCTACTTGA CGAAAAGTCA AACCAAATTC + 22AAA_M1_S1 31 At2g40000 TTTTT CTCGTCCCCATCCTC TATCC - 12r_M1_S1 32 At1g73480 CAATCTAC TCGTCTCTTC TCTTACAT + GG3_M1_S1 32 At5g44420 TAGGTT CCTGCCCTCTCCGT TCCTCC - GG3_M1_S2 32 At4g39980 TCGAAA CCAACCCTCTCCCT TATAAA - 20EE_M1_S1 32 At4g39980 GAAACCAA CCCTCTCCCT TATAAATA - 24P_M1_S1 32 At1g30135 TGTTTTGTTTCCA CCGTCTCTCC CGTGTCCTCTCTC -

In the following, the tetramerized individual sequences in transiently transformed parsley cells from a cell culture were tested for their inducibility by the PAMP PEP25. In addition to a general validation, it should be ensured that the elements can be induced in different plant species and by different elicitors.

For the test in parsley, protoplasts were isolated from a 5-day-old parsley cell culture. To this end, 35 ml of cell culture were centrifuged off and resuspended in 90 ml of a sterile-filtered solution containing 0.5% cellulase, 0.2% Macerozyme R-10 and 0.24 M CaCl ₂ and incubated overnight at 26 ° C. while swirling. After that were the released protoplasts are pelleted by centrifugation, washed with 40 ml of 0.24 M CaCl ₂ and then in 50 ml of P5 medium (1 bag of Gamborgs B-5 ready-to-use medium, 1 mg of 2.4 D, 96.9 g of sucrose, pH 5, 7 resuspended with 1M KOH, sterile filter). After centrifugation, the protoplasts float on the surface of the P5 medium and can be removed. The purification with P5 medium was repeated twice.

For the transformation, 5 µg of the promoter construct to be tested, 2.5 µg of a constitutively Renilla luciferase-expressing normalization vector and 200 µl of PEG were placed in 10 ml screw-cap tubes. 200 μl protoplasts were added, then carefully mixed and incubated for 20 min at room temperature in the dark. The reaction was then stopped by adding 5 ml of 0.275M CaNO ₃ solution. The transformed protoplasts were centrifuged off, taken up in 6 ml P5 medium and divided into 2 aliquots. One aliquot was elicited with Pep25 (final concentration: 300ng / ml; sequence: VTAGAEVWNQPVRGFKVYEQTEMT), the other serves as a control. After overnight incubation, the protoplasts were harvested by centrifugation. The luciferase activity was determined with the Dual Luciferase Kit (Promega, Mannheim, Germany) in a Sirius Luminometer (Berthold Detection System GmbH, Pforzheim, Germany). For this purpose, the parsley cells were pelleted by centrifugation and lysed for 20 minutes at 4 ° C. in 150 μl of PLB buffer (Passive Lysis Buffer; Promega, Mannheim, Germany). The cell residues are centrifuged off for 20 minutes at 13,000 rpm and 4 ° C. in a table centrifuge.

The lysate was handled differently depending on whether the luciferase reporter gene or the GUS reporter gene was used. If the luciferase reporter gene was used, 5 μl sample of the supernatant with the released luciferase were mixed in 5 ml tubes (Sarstedt, Art.No. 55.476) with 50 μl LARII buffer (Promega, Mannheim, Germany). The buffer contains the substrate of the luciferase so that the activity of the enzyme and thus of the promoter can be measured with the luminometer. The measurement takes place with a pre-measurement time of 2 seconds and a luciferase measurement time of 10 seconds. Then 50 μl Stop & Glo buffer (Promega, Mannheim, Germany) are added and carefully mixed by drawing up. This buffer stops the luciferase activity and makes the constitutive Renilla luciferase activity of the normalization vector measurable. This measured value is used to normalize the different transformation efficiencies. The measurement is also carried out with a pre-measurement time of 2 seconds and a luciferase measurement time of 10 seconds.

If the β-glucuronidase (GUS) reporter gene from E. coli was used (Jefferson et al., 1987), detection was carried out in an enzyme reaction in which the substrate MUG is hydrolyzed to 4-MU. Then 4-MU is detected and quantified by its fluorescence.

According to these methods, the activity with and without the PAMP PEP25 was measured for all individual sequences examined.

Table 2 lists all the individual sequences tested. It is also indicated whether they could be induced in parsley by the PAMP PEP25. The cis-regulatory elements (individual sequences) identified as pathogen-inducible and their motifs are in Fig. 2 summarized.

Mutation analyzes of the identified core sequences

In order to prove that the identified core sequence is responsible for the PAMP and pathogen inducibility of the individual sequences, mutation analyzes were carried out for selected individual sequences. For this purpose, mutated derivatives of the individual sequences were created. The mutated individual sequences were synthesized as oligonucleotides. The cloning of the plasmids was carried out in accordance with the constructs with chimeric promoters without mutations. The constructs were then tested for their PEP25 inducibility in parsley as described above. The results of the mutation analyzes are in the Figure 5A , Figure 5B , Figure 6A and Figure 6B reproduced. For all five investigated elements it could be shown that the identified core sequence is responsible for the inducibility.

This is of particular importance for the individual sequences Cis05 and 30I-8 M1 S2 of group 27. The core sequence of 30I-8_M1_S2 partially overlaps with a sequence (GTCAA) which is complementary to the W box (TTGAC; Rushton et al., 1996). An overlapping W-box sequence was also found in the individual sequences 30I-8_M1_S3, Cis02 and Cis13.

However, the mutation analyzes, in particular the variant 30I-8_M1_S2_mut2, showed that bases outside the W-box are decisive for PAMP inducibility ( Figure 6A ). In addition, other members of group 27 do not show an overlapping W-box sequence. Correspondingly, the core sequence TGAC, which is essential for the W-Box, is not part of the sequence or family motif of group 27 ( Figure 3F ). The motifs or the individual sequences of group 27 are therefore not variants of the W-box.

In the single sequence Cis05 there is a W-box sequence outside the core sequence. The mutation analyzes showed that this W-Box although mediated PAMP inducibility. However, mutating only the Cis05 core sequence or only the W-box leads to a decrease in inducibility, and only by mutating both elements does a complete loss of inducibility occur. Thus, it is a single sequence with two functional, PAMP- and pathogen-inducible cis-regulatory elements, the well-known W-box and the new Cis05 motif ( Figure 2T ). The combination of both elements shows a significantly higher activity than the individual elements alone.

To the sequence area of the element C # 05 motif ( Figure 2T ), which mediates the inducibility, this was tetramerized separately from the W box (sCis05) and four further mutated derivatives of the Cis05 motif were created. The derivatives were tested for their inducibility by the PAMP PEP25 in parsley as described above ( Figure 5B ). In addition to the crucial importance of the core sequence for inducibility, it could be shown that the two bases lying in front of the core sequence in the 5 'direction are also essential for the inducibility of Cis05, which further confirms that this is not a W-box- Variant acts.

The core sequences of the elements 20u_M1_S1 and 27G-8_M1_S1 could also be confirmed by further mutation analyzes. The tests were carried out as described above. The results of these mutation analyzes are in Figure 6B (above: 20u_M1_S1; below: 27G-8_M1_S1).

Derivation of family motives

Because the cis-regulatory elements identified in Arabidopsis promoters were tested in parsley, a biological functionality of the identified cis-regulatory elements across plant species was ensured. As expected, the experiments showed that not all of the bioinformatic identified sequences are functional. About one third of the DNA sequences tested were inducible by PEP25 in parsley. The other sequences were false-positive sequences from the bioinformatic analysis or did not show the desired cross-species biological functionality. These important results could be used to identify the family motifs of motif groups 1, 5, 11, 12, 21, 21n and 27 as well as the associated strongly conserved, characteristic core sequences on the basis of the functionally effective individual sequences ( Fig. 3 ). For this purpose, all functionally effective individual sequences belonging to a motif group were combined and a consensus and a motif were derived from them. As a characteristic core sequence motif of the Family motifs, the area was initially defined that is part of the core sequence in all underlying individual sequences.

The core sequence of motif group 27 can also be found in the sequence LS10 (Lebel et al., 1998). There, a 10-base mutation was generated in this sequence region in the native PR-1 promoter, which led to a strong decrease in the inducibility of the native promoter for SA or INA. However, the results shown there do not allow the derivation of a motif or a core sequence. In addition, the utility of LS10 for chimeric promoters is not shown. Furthermore, the family motif of motif group 27 separates the motif group from the LS10 sequence. The family motif excludes a C at position 5, while in LS10 a C is present at this position. Furthermore, it excludes a G at position 17, while a G is present in LS10 at this position. Finally, it requires a T or C in position 18, while in LS10 there is an A in this position.

Evidence of inducibility by the pathogenic fungus Cercospora beticola in stably transformed sugar beets

The new cis-regulatory elements should be characterized by the fact that they can be induced in different plant species by different PAMPs and pathogens. In order to show the inducibility in an agronomically important plant by an agronomically important pathogen, the individual sequences that tested positive in parsley were transformed stably in sugar beet. For this purpose, the chimeric promoters with the tetramerized individual sequences including the luc gene were recloned via the Ascl and Sacl interfaces into the binary vector 1xW1-luc-kan, a plasmid based on the binary vector pGPTV. As an example, in Fig. 7 the vector 4xCis05-luc-kan shown. Corresponding vectors were created for all examined elements. The plasmid DNA of the binary vectors were isolated from E. Coli and transformed into the Agrobacterium tumefaciens strain GV3101 using a Gene Pulser® II. Electroporation System with the settings 25 mF and 2.5 kV. The selection of recombinant A. tumefaciens clones were carried out using the antibiotic kanamycin (50 mg / l). The transformation of the sugar beet took place according to Lindsey et al. (1991) using the antibiotic kanamycin.

The transgenicity of the plants was checked by PCR. The use of the primers GTGGAGAGGCTATTCGGTA (SEQ ID NO: 36) and

CCACCATGATATTCGGCAAG (SEQ ID NO: 37) resulted in the amplification of a 553 bp DNA fragment from the npt II gene. The PCR was carried out using 10 ng of genomic DNA, a primer concentration of 0.2 μM at a Annealing temperature of 55 ° C carried out in a Multicycler PTC-200 (MJ Research, Watertown, USA).

10 to 20 independent transgenic lines were clonally propagated in in vitro culture and infected with Cercospora beticola (isolate Ahlburg). After 1, 2, 3 and 4 days, 4 plants / line were harvested and their luciferase activity was determined using the Promega Luciferase Assay System, 100 assays, Cat. E1500 (LAR) measured. For this purpose, the samples were taken up in 4 volumes of CCLR buffer (Cell Culture Lysis Reagent, 5x) and processed using a Heidolph (RZR 2020). The plant residues were centrifuged off for 10 minutes at 4 ° C. and 14,000 rpm and the supernatant used for the luciferase measurement. For the measurement, 10 μl of the sample were pipetted into a 5 ml tube (Sarstedt, Art.No. 55.476) and 100 μl of Luciferase Assay Reagent (LAR; Promega, Mannheim, Germany) were added. It was then carefully mixed and the luciferase activity was determined in a Sirius Luminometer (Berthold Detection System GmbH, Pforzheim, Germany).

Among other things, new elements from groups 12 and 27 have been added (for grouping see Fig. 3 D and F. ) tested. The median was calculated from the measured luciferase activities of the approximately 10 to 20 independent transgenic lines with a chimeric promoter. The tests of the various promoters are grouped according to the groups from which the elements originate. The results are in Fig. 8 A. shown. The direct comparison shows that the individual sequences of a group of motifs have clearly different activities despite the high homology of the motifs they contain. The nucleotides of the family motif adjoining the core sequence can therefore strongly influence the promoter strength and the background activity. The different sequences of a group of motifs are therefore not identical in their function but allow the development of chimeric promoters with quantitative differences in the regulation of gene expression. In order to test a further group of motifs, the element GG6_M1 (single sequence GG6_M1_S1) was transformed stably into sugar beet according to the information above and tested for inducibility by Cercospora, the element GG6_M1 (single sequence GG6_M1_S1) merely serving for better understanding and not part of the invention . For this purpose, 10 independent transgenic sugar beets were clonally propagated in in vitro culture and infected with Cercospora beticola (isolate Ahlburg). After 2, 3, 4 and 7 days, 4 plants / line each were harvested and their luciferase activity was determined using the Promega Luciferase Assay System, 100 assays, Cat. E1500 (LAR) measured. The results are in Fig. 9 and show a clear inducibility of the individual sequence GG6_M1_S1 in sugar beet by Cercospora beticola. Furthermore, a histochemical analysis showed that the induction occurs largely in the conductive tissue.

In order to examine the influence of the W-Box sequence in the individual sequence Cis05 in stably transformed plants, the mutated derivatives Cis05mut1 and Cis05mut2 as well as the shortened individual sequence sCis05 from the parsley tests were stably transformed into sugar beet. Construct creation and transformation were carried out as described above. In each case 18 independent transgenic lines were clonally propagated in vitro and infected with Cercospora beticola (isolate Ahlburg). After 1, 2, 3 and 4 days, 4 plants / line were harvested and their luciferase activity was measured as described above ( Fig. 8 B) .

The mutation analysis in stably transformed plants shows that this W-box alone, ie with the mutated Cis05 motif, only conveys a weak pathogen inducibility by Cercospora . The Cis05 motif alone (mutated W-box or shortened element without W-box), on the other hand, is clearly inducible. The complete Cis05 single sequence with a W box can also be inducible, but shows an increased background activity relative to the derivatives without a W box. Thus, in stably transformed sugar beets, the Cis05 motif alone is equivalent or even superior to the combination with the W-Box.

Another important feature of the chimeric promoters of the invention is that the pathogen-induced activity is limited to the area of the infection site. This is done in Fig. 14 shown using the example of the promoter according to the invention 4xCis05. This promoter was fused with the red fluorescent reporter gene RFP, and the construct obtained in this way was stably transformed into sugar beet. The activity can be observed as red fluorescence under the laser scanning microscope. In Fig. 14 shows the local induction of the 4xCis05 promoter around the penetration point of a Cercospora hypha.

Extended cross-species pathogen inducibility

As a further example of the broad applicability of the cis-regulatory elements in different plant species, the inducibility of Cis05 in the monocotyledon plant wheat by the fungus Fusarium culmorum was shown in transient experiments. Since the 35S minimal promoter in wheat does not give sufficient activity, the Cis05 elements had to be recloned. For this purpose, they were cut out from the plasmids used for the parsley tests with the enzymes Eco31I and Xbal and cloned into the vector pubiTATARucll opened with Eco31I and BcuI ( Fig. 10 ). Corresponding constructs were created for Cis05 and the mutated Cis05 individual sequences Cis05mut1 and Cis05mut2, in which either the Cis05 motif or the W box is mutated. These constructs were biolistically in with Fusarium graminearum infected primary leaves of the wheat variety "Taifun" and non-infected control leaves were transformed.

For the infection, Fusarium graminearum mycelium was scraped off the overgrown mushroom plate with a slide and briefly comminuted and suspended in 200 ml of water with an Ultraturrax. Then 200 μl of 2% Triton were added and the wheat primary leaves were swirled in the suspension for 1 minute. The infected leaf pieces and uninfected control leaf pieces were then placed on H ₂ O agar plates and transiently transformed with a Biorad particle gun according to the manufacturer's instructions using 1100 psi bursting discs. A constitutive luciferase expressing vector was used as the normalization vector.

The wheat leaves were then incubated at 25 ° C. overnight. To determine the luciferase activities, the leaves are ground up in 1 ml PLB buffer each with sea sand. After centrifugation for 20 minutes at 4 ° C., 5 μl of the supernatant with the released luciferase are mixed in 5 ml tubes (Sarstedt, Art.No. 55.476) with 50 μl of LARII buffer (Promega, Mannheim, Germany). The buffer contains the substrate of the luciferase so that the activity of the normalization vector can be measured. This measured value is used to normalize the different transformation efficiencies. The measurement takes place with a pre-measurement time of 2 seconds and a luciferase measurement time of 10 seconds. Then 50 μl Stop & Glo buffer (Promega, Mannheim, Germany) are added and carefully mixed by drawing up. This buffer stops the luciferase activity and makes the Renilla luciferase activity, which corresponds to the activity of the Cis05 promoters, measurable. The measurement is also carried out with a pre-measurement time of 2 seconds and a luciferase measurement time of 10 seconds.

The induced and non-induced activities of the 4xCis05 promoter and its mutated derivatives were measured in 5 biological repetitions ( Fig. 11 ). The entire experiment was then repeated once more. Both replicates show that the pathogen-induced activity in wheat originates from the Cis05 motif, while the W-box motif does not mediate any activity induced by Fusarium graminearum .

Analysis of the pathogen- or wound-induced and the tissue-specific activity of the elements Cis02, Cis05, Cis09, Cis12 or Cis13 in Arabidopsis

The new cis-regulatory elements should be characterized by the fact that they can be induced in different plant species by different PAMPs and pathogens. As a further control for the activity of the chimeric Promoters, 6 promoters with tetramerized individual sequences were stably transformed into Arabidopsis. For this purpose, the tetramerized elements Cis02, Cis05, Cis09, Cis12 or Cis13 with 35S minimal promoter were cloned in front of the GUS reporter gene into the transformation vector pBIN-GUS. Said elements are provided for better understanding and are not part of the present invention. The finished construct was transformed into agrobacteria. A floral-dip transformation (Clough and Bent, 1998) of Arabidopsis plants was then carried out in order to stably integrate the promoter-GUS constructs into the plant genome. The selection of transgenic plants was carried out using the antibiotic kanamycin.

Ten independent transforms were examined for each element.

The activity of the GUS reporter gene and thus of the promoters can be made visible by GUS staining (Jefferson et al., 1987). The activation of the respective chimeric promoters leads to the expression of an enzyme (GUS), which forms a blue dye. The coloration thus indicates the activity of the respective chimeric promoter.

To test the pathogen inducibility of the promoters, the transgenic Arabidopsis plants were infected with the compatible pathogen Hyaloperonospora arabidopsidis . 5 days after infection, the activity of the promoters was demonstrated by GUS staining. In addition, individual leaves were wounded by cutting with scissors in order to test the wound inducibility of the promoters ( Fig. 16 ). The element Cis02 showed good pathogen inducibility and only low wound inducibility. The element Cis05 showed a generally strong activity and is also strongly induced by H. Arabidopsidis . The element Cis09 showed good induction of the promoter after infection and hardly any undesirable activity after wounding. The element Cis12, like element Cis09, showed hardly any undesirable activity after wounding in any of the lines investigated, while a clear induction by the pathogen H. arabidopsidis was observed. The elements Cis12 and Cis09 share a common family motif. The element Cis13 is also strongly induced by infection with H. arabidopsidis . However, no clear wound inducibility can be observed. An example is in Fig. 16 the GUS staining of transgenic A. thaliana plants was shown which express the GUS reporter gene under the control of a chimeric promoter with 4x Cis05.

Combinatorics of the cis-regulatory elements

Through a synergistic interaction or through the integration of different signal paths (a promoter would be conceivable that signals "EF-Tu" AND "flg22" perceive and integrate in order to be activated), chimeric combinatorial promoters, which are composed of various cis-regulatory elements, can show a higher specificity and / or activity than the individual elements present in them (Rushton et al., 2002) . In order to determine optimal combinations of the new cis-regulatory elements for chimeric combinatorial promoters, using standard DNA cloning techniques, chimeric combinatorial promoters with all possible 2x2 combinations of the cis-regulatory elements Cis02, Cis05, Cis12, Cis13 and 30I -8_M1_S2 as well as the already published elements D-Box (Rushton et al., 2002), S-Box (Kirsch et al., 2000) and Gst1-Box (Strittmatter et al., 1996). The procedure was as described for the tetramerization of the individual sequences, only that not two identical dimers (e.g. 2x30I-8_M1_S2 and 2x30I-8_M1_S2), but two different dimers (e.g. 2xCis05 and 2x30I-8_M1_S2) are cloned together, whereby these elements are for better understanding and not part of the present invention. The resulting chimeric combinatorial promoters were tested in the transient expression system in parsley for their inducibility by the PAMP PEP25. The results (absolute non-induced and induced activity of the chimeric combinatorial promoters and the induction factor) are in Fig. 12 reproduced. It was possible to identify chimeric combinatorial promoters with particularly strong and specific inducibility, the induction factor and activity of which is higher than with chimeric promoters that are only built up from repetitions of the individual cis-regulatory elements ( Fig. 13 ). The chimeric combinatorial promoters with the highest induction factors and the strongest activities are summarized in Table 3. Table 3: Combinations of pathogen-inducible individual sequences with the highest induction factors and induced activities. Combinations with the highest induction factor MW stabw Coefficient of variance induction 2xCis05-2xCis05 - 3.23 2.06 0.64 149.58 2xCis05-2xCis05 + 482.53 398.05 0.82 2xCis05-2xS - 2.00 1.51 0.76 115.63 2xCis05-2xS + 231.82 48.39 0.21 2xCis05-2x30I8b - 2.47 1.42 0.58 123.16 2xCis05-2x30I8b + 304.21 45.38 0.15 2xCis13-2xCis02 - 2.50 0.50 0.20 124.53 2xCis13-2xCis02 + 311.48 37.76 0.12 2xCis13-2xCis05 - 2.33 0.41 0.18 182.59 2xCis13-2xCis05 + 425.23 258.29 0.61 2xCis13-2xS - 4.55 0.65 0.14 139.85 2xCis13-2xS + 636.85 364.80 0.57 2xS-2xCis02 - 5.28 3.36 0.64 106.32 2xS-2xCis02 + 561.76 440.81 0.78 2xS-2xS - 2.76 0.49 0.18 138.80 2xS-2xS + 382.69 92.20 0.24 Gst1-2xS - 2.41 0.87 0.36 258.83 Gst1-2xS + 624.18 274.19 0.44 2x30I8b-2xCis05 - 0.90 0.30 0.34 135.12 2x30I8b-2xCis05 + 121.20 88.90 0.73 Combinations with the highest activity (induced) MW stabw Coefficient of variance induction 2xD-2xCis05 - 84.57 49.56 0.59 17.88 2xD-2xCis05 + 1511.90 580.33 0.38 2xD-2xS - 23.96 17.66 0.74 57.72 2xD-2xS + 1382.94 1180.84 0.85 2xD-Gst1 - 19.25 20.18 1.05 62.10 2xD-Gst1 + 1195.21 486.92 0.41 2xS-2xCis12 - 36.84 19.34 0.53 29.05 2xS-2xCis12 + 1070.08 1043.46 0.98 2xS-2xD - 22.13 23.38 1.06 65.56 2xS-2xD + 1450.50 1085.69 0.75

credentials

• Bailey, TL, C. Elkan (1994). "Fitting a mixture model by expectation maximization to discover motifs in biopolymers." Proc Int Conf Intell Syst Mol Biol. 2: 28-36 .
• Bulow, L., M. Schindler, et al. (2007). "PathoPlant: a platform for microarray expression data to analyze co-regulated genes involved in plant defense responses." Nucleic Acids Res 35 (Database issue): D841-845 .
• Che, D., S. Jensen, et al. (2005). "BEST: binding-site estimation suite of tools." Bioinformatics 21 (12): 2909-2911 .
• Clough, SJ and Bent, AF (1998). "Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana." Plant J. 16 (6): 735-43 .
• Eulgem, T., PJ Rushton, et al. (2000). "The WRKY superfamily of plant transcription factors." Trends Plant Sci 5 (5): 199-206 .
• Gorlich, D. and IW Mattaj (1996). "Nucleocytoplasmic transport." Science 271 (5255): 1513-1518 .
• Gurr, SJ and PJ Rushton (2005). "Engineering plants with increased disease resistance: how are we going to express it?" Trends Biotechnol 23 (6): 283-290 .
• Hahlbrock, K., D. Scheel, et al. (1995). "Oligopeptide elicitor-mediated defense gene activation in cultured parsley cells." Proc Natl Acad Sci U S A 92 (10): 4150-4157 .
• Hicks, GR, HM Smith, et al. (1995). "Three classes of nuclear import signals bind to plant nuclei." Plant Physiol 107 (4): 1055-1058 .
• Himmelbach, A., L. Liu, et al. (2010). "Promoters of the Barley Germin-Like GER4 Gene Cluster Enable Strong Transgene Expression in Response to Pathogen Attack" The Plant Cell 22 (3): 937-952 .
• Howles, P., G. Lawrence, et al. (2005). "Autoactive Alleles of the Flax L6 Rust Resistance Gene Induce Non-Race-Specific Rust Resistance Associated with the Hypersensitive Response." Molecular Plant-Microbe Interactions 18 (6): 570-582 .
• Humphry, M., P. Bednarek, et al. (2010). "A regulon conserved in monocot and dicot plants defines a functional module in antifungal plant immunity." Proc Natl Acad Sci USA 107 (50): 21896-21901 .
• Jefferson, RA, Kavanagh, T. A & Bevan, MW (1987). "GUS fusions, 8-glucuronidase as a sensitive and versatile gene fusion marker in higher plants." EMBO J 6 (13): 3901-3907 .
• Kirsch, C., M. Takamiya-Wik, et al. (2000) "A novel regulatory element involved in rapid activation of parsley ELI7 gene family members by fungal elicitor or pathogen infection." Mol Plant Pathol. 1 (4): 243-51 .
• Kirsch, C., E. Logemann, et al. (2001) "A highly specific pathogen-responsive promoter element from the immediate-early activated CMPG1 gene in Petroselinum crispum." Plant J. 26 (2): 217-27 .
• Kovalchuk, N., M. Li, et al. (2010). "Defensin promoters as potential tools for engineering disease resistance in cereal grains." Plant Biotechnol J 8 (1): 47-64 .
• Lebel, E., P. Heifetz, et al. (1998). "Functional analysis of regulatory sequences controlling PR-1 gene expression in Arabidopsis." Plant J 16 (2): 223-233 .
• Liu, X., DL Brutlag, et al. (2001). "BioProspector: discovering conserved DNA motifs in upstream regulatory regions of co-expressed genes." Pac Symp Biocomput: 127-138 .
• Morris, K., SA MacKerness, et al. (2000). "Salicylic acid has a role in regulating gene expression during leaf senescence." Plant J 23 (5): 677-685 .
• Rushton, PJ, A. Reinstadler, et al. (2002). "Synthetic plant promoters containing defined regulatory elements provide novel insights into pathogen- and wound-induced signaling." Plant Cell 14 (4): 749-762 .
• Rushton, PJ, JT Torres, et al. (1996). "Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes." EMBO J 15 (20): 5690-5700 .
• Schatz, G. and B. Dobberstein (1996). "Common principles of protein translocation across membranes." Science 271 (5255): 1519-1526 .
• Schumacher, SB, O. Van den Hauwe, et al. (2003). "Development of a dual luciferase reporter screening assay for the detection of synthetic glucocorticoids in animal tissues." Analyst 128 (12): 1406-1412 .
• Strittmatter, G., G. Gheysen, et al. (1996). "Infections with various types of organisms stimulate transcription from a short promoter fragment of the potato gst1 gene." Mol Plant Microbe Interact 9 (1): 68-73 .
• Venter, M. (2007). "Synthetic promoters: genetic control through cis engineering." Trends Plant Sci 12 (3): 118-124 .
• Verner, K. and G. Schatz (1988). "Protein translocation across membranes." Science 241 (4871): 1307-1313 .
• Wan, J., XC Zhang, et al. (2008). "A LysM receptor-like kinase plays a critical role in chitin signaling and fungal resistance in Arabidopsis." Plant Cell 20 (2): 471-481 .
• Zipfel, C., G. Kunze, et al. (2006). "Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation." Cell 125 (4): 749-760 .
• Zipfel, C., S. Robatzek, et al. (2004). "Bacterial disease resistance in Arabidopsis through flagellin perception." Nature 428 (6984): 764-767 .
• WO 00/29592 (Max Planck Society for the Advancement of Science eV). Chimeric promoters capable of mediating gene expression in plants upon pathogen infection and uses thereof.
• WO 02/50293 (Max Planck Society for the Advancement of Science eV). Plants with improved resistance.
• WO 03/00898 (Syngenta Participations AG). Plant genes involved in defense against pathogens.
• WO 07/147395 (KWS SAAT AG). Pathogen Inducible Synthetic Promoter
• WO 10/079430 (U. Bonas et al. ). Modular DNA-binding domains and methods of use.
• WO 11/072246 (Regents of the University of Minnesota; Iowa State University Research Foundation Inc.). TAL effector-mediated DNA modification.

SEQUENCE LISTING

• <110> KWS SAAT SE
• <120> New plant-derived cis-regulatory elements for the development of pathogen-responsive chimeric promoters
• <130> KWS0200PCT / EPD1
• <150> DE 102011122267.0
  <151> 2011-12-23
• <160> 44
• <170> Patent In version 3.5
• <210> 1
  <211> 18
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> Family motif group 27
• <220>
  <221> misc_feature
  <222> (1) .. (2)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (6) .. (7)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (9) .. (14)
  <223> core sequence motif
• <220>
  <221> misc_feature
  <222> (15) .. (15)
  <223> n is a, c, g, or t
• <400> 1
  nnhkdnnvaa agtmndhy 18
• <210> 2
  <211> 16
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> Family motif group 11
• <220>
  <221> misc_feature
  <222> (2) .. (2)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (6) .. (6)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (7) .. (12)
  <223> core sequence motif
• <220>
  <221> misc_feature
  <222> (15) .. (15)
  <223> n is a, c, g, or t
• <400> 2
  ynamcnaaac cawwny 16
• <210> 3
  <211> 13
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> Family motif group 12
• <220>
  <221> misc_feature
  <222> (2) .. (2)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (5) .. (10)
  <223> core sequence motif
• <400> 3
  wnrmscaaam smw 13
• <210> 4
  <211> 13
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> Family motif group 1
• <220>
  <221> misc_feature
  <222> (1) .. (2)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (5) .. (9)
  <223> core sequence motif
• <220>
  <221> misc_feature
  <222> (11) .. (11)
  <223> n is a, c, g, or t
• <400> 4
  nnmsacrcgy nwm 13
• <210> 5
  <211> 14
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> Family motif group 21
• <220>
  <221> misc_feature
  <222> (2) .. (9)
  <223> core sequence motif
• <400> 5
  asktgkactw kgwm 14
• <210> 6
  <211> 15
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> Family motif group 5
• <220>
  <221> misc_feature
  <222> (2) .. (2)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (6) .. (12)
  <223> core sequence motif
• <220>
  <221> misc_feature
  <222> (15) .. (15)
  <223> n is a, c, g, or t
• <400> 6
  knwymmrtsa ckwmn 15
• <210> 7
  <211> 25
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (10) .. (16)
  <223> core sequence
• <400> 7
  acaacagacg acttttcata attca 25
• <210> 8
  <211> 25
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (10) .. (16)
  <223> core sequence
• <400> 8
  ctatatgaca aaagtcaaac ataaa 25
• <210> 9
  <211> 27
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (7) .. (21)
  <223> core sequence
• <400> 9
  tgttcacttt gaaaagtatt ctttgag 27
• <210> 10
  <211> 26
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (7) .. (20)
  <223> core sequence
• <400> 10
  cgatcagact tttctacgca agagaa 26
• <210> 11
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (12) .. (24)
  <223> core sequence
• <400> 11
  taatttctct tgcgtagaaa agtctgatcg ggaag 35
• <210> 12
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (15) .. (21)
  <223> core sequence
• <400> 12
  tcgttcttca gtcaaaaagt caaactatct ctctc 35
• <210> 13
  <211> 30
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (12) .. (18)
  <223> core sequence
• <400> 13
  gagcgtgaat tgactttgac caaaaccaaa 30
• <210> 14
  <211> 38
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (14) .. (20)
  <223> core sequence
• <400> 14
  ggtcagcatg ttggactttc caaattcatt gaccaaag 38
• <210> 15
  <211> 39
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (20) .. (29)
  <223> core sequence
• <400> 15
  aaaataaaca gctacttgac gaaaagtcaa accaaattc 39
• <210> 16
  <211> 36
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (14) .. (23)
  <223> core sequence
• <400> 16
  gttttgactt ttgacctaaa ccatttccat gtagaa 36
• <210> 17
  <211> 36
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (13) .. (24)
  <223> core sequence
• <400> 17
  ccgtcttagt ttaccgaaac caaagtggct ttttct 36
• <210> 18
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (11) .. (25)
  <223> core sequence
• <400> 18
  cgtaataatg gtttggtttg gtttgatcaa gtctt 35
• <210> 19
  <211> 25
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (8) .. (18)
  <223> core sequence
• <400> 19
  gacttttgac ctaaaccatt tccat 25
• <210> 20
  <211> 26
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (9) .. (17)
  <223> core sequence
• <400> 20
  caacacaaaa cgcaaacgca gacctc 26
• <210> 21
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (14) .. (22)
  <223> core sequence
• <400> 21
  aattgacaaa agacacgcaa acgattccaa cgacc 35
• <210> 22
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (14) .. (22)
  <223> core sequence
• <400> 22
  aaataattat ttatggtttg gtcatttggt caaat 35
• <210> 23
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (15) .. (21)
  <223> core sequence
• <400> 23
  agtcaaaacg tagaccaaaa caaaaacatg taact 35
• <210> 24
  <211> 38
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (12) .. (19)
  <223> core sequence
• <400> 24
  tgcacacaca cacacgtgta ctaggtcaaa ccaaacgt 38
• <210> 25
  <211> 41
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (20) .. (25)
  <223> core sequence
• <400> 25
  caaaaagtca acacatacga cgcgtttcca ttgactaaat a 41
• <210> 26
  <211> 25
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (9) .. (17)
  <223> core sequence
• <400> 26
  tctcatctct cgacacgcaa cttcc 25
• <210> 27
  <211> 25
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (7) .. (19)
  <223> core sequence
• <400> 27
  cacacacgtg tactaggtca aacca 25
• <210> 28
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (14) .. (22)
  <223> core sequence
• <400> 28
  aggacttttc accagttgga ctttgaagcc accaa 35
• <210> 29
  <211> 34
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (11) .. (19)
  <223> core sequence
• <400> 29
  aagtctaaat ctttgacccc aaaaaagaga gcaa 34
• <210> 30
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (15) .. (21)
  <223> core sequence
• <400> 30
  tgttgagtcg tttacgtcac gtcgagaatt ttctc 35
• <210> 31
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (15) .. (21)
  <223> core sequence
• <400> 31
  tgtcattatt aatacgtgac gaaactgtag ctctg 35
• <210> 32
  <211> 36
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (11) .. (25)
  <223> core sequence
• <400> 32
  ttacgtgtca agaagtgatt ggagaggaca ctctac 36
• <210> 33
  <211> 35
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (15) .. (21)
  <223> core sequence
• <400> 33
  ccatacaata taaaccacca aaccataacc acaaa 35
• <210> 34
  <211> 26
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (9) .. (18)
  <223> core sequence
• <400> 34
  caatctactc gtctcttctc ttacat 26
• <210> 35
  <211> 10
  <212> DNA
  <213> Arabidopsis thaliana
• <400> 35
  tcgtctcttc 10
• <210> 36
  <211> 19
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> PCR primer
• <400> 36
  gtggagaggc tattcggta 19
• <210> 37
  <211> 20
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> PCR primer
• <400> 37
  ccaccatgat attcggcaag 20
• <210> 38
  <211> 182
  <212> DNA
  <213> Oryza sativa
• <400> 38
  
• <210> 39
  <211> 149
  <212> DNA
  <213> Triticum aestivum
• <400> 39
  
• <210> 40
  <211> 1133
  <212> DNA
  <213> Zea mays
• <220>
  <221> intron
  <222> (129) .. (1133)
• <400> 40
  
  
• <210> 41
  <211> 18
  <212> DNA
  <213> Artificial Sequence
• <220>
  <223> Family motif group 21n
• <220>
  <221> misc_feature
  <222> (2) .. (2)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (4) .. (6)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (7) .. (12)
  <223> core sequence motif
• <220>
  <221> misc_feature
  <222> (13) .. (15)
  <223> n is a, c, g, or t
• <220>
  <221> misc_feature
  <222> (17) .. (17)
  <223> n is a, c, g, or t
• <400> 41
  snsnnnwwkg wcnnnsnm 18
• <210> 42
  <211> 29
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (5) .. (25)
  <223> core sequence motif
• <400> 42
  ctcaaaggcc agaattgacg cagccgttt 29
• <210> 43
  <211> 28
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (7) .. (22)
  <223> core sequence motif
• <400> 43
  ccttggccca gtccttggtc gtcgtatc 28
• <210> 44
  <211> 11
  <212> DNA
  <213> Arabidopsis thaliana
• <220>
  <221> misc_feature
  <222> (5) .. (11)
  <223> core sequence motif
• <400> 44
  gttggacttt c 11

Claims (10)

1. A chimeric promoter which, when induced by a pathogenic infection or a treatment with a pathogenic elicitor, is suitable for bringing about an expression of an operatively linked nucleic acid molecule in a plant cell and which comprises a minimal promoter and at least one cis-regulatory element, characterized in that the cis-regulatory element comprises a nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of:

   a) SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NO: 23, or

   b) a nucleotide sequence which is complementary to a nucleotide sequence from a).
2. The chimeric promoter as claimed in one of the preceding claims, characterized in that the chimeric promoter comprises at least one multimer of cis-regulatory elements, wherein at least one of the cis-regulatory elements is a cis-regulatory element as claimed in claim 1.
3. The chimeric promoter as claimed in claim 2, characterized in that the multimer is a dimer or tetramer.
4. A recombinant gene which comprises the chimeric promoter as claimed in one of the preceding claims.
5. A vector which comprises the chimeric promoter as claimed in one of claims 1 to 3 or the recombinant gene as claimed in claim 4.
6. A transgenic plant transformed with the chimeric promoter as claimed in one of claims 1 to 3, with the recombinant gene as claimed in claim 4 or with the vector as claimed in claim 5.
7. Seeds, cells, tissues or portions of plants as claimed in claim 6, containing the chimeric promoter as claimed in one of claims 1 to 3, the recombinant gene as claimed in claim 4 or the vector as claimed in claim 5.
8. A method for producing a plant as claimed in claim 6, comprising

   a) introducing the chimeric promoter as claimed in one of claims 1 to 3, the recombinant gene as claimed in claim 4 or the vector as claimed in claim 5 into at least one cell of the plant, and

   b) regenerating the plant.
9. A method for the pathogen inducibility-mediated or elicitor inducibility-mediated expression of an endogenous gene under the control of a native promoter modified by means of a cis-regulatory element, comprising introducing a cis-regulatory element into the native promoter of the endogenous gene, wherein the cis-regulatory element comprises a nucleic acid molecule wherein the nucleic acid molecule is selected from the group consisting of:

   a) SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 or SEQ ID NO: 23, or

   b) a nucleotide sequence which is complementary to a nucleotide sequence from a).
10. A plant cell which expresses an endogenous gene under the control of a chimeric promoter as claimed in one of claims 1 to 3, or under the control of the native promoter of the endogenous gene, which is modified by the introduction of a cis-regulatory element, wherein the cis-regulatory element comprises a nucleic acid molecule wherein the nucleic acid molecule is selected from the group consisting of:

    a) SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 or SEQ ID NO: 23, or

    b) a nucleotide sequence which is complementary to a nucleotide sequence from a).

Images