EP3308169A1 - Methode de pronostic d'hemopathies lymphoïdes - Google Patents
Methode de pronostic d'hemopathies lymphoïdesInfo
- Publication number
- EP3308169A1 EP3308169A1 EP16734438.1A EP16734438A EP3308169A1 EP 3308169 A1 EP3308169 A1 EP 3308169A1 EP 16734438 A EP16734438 A EP 16734438A EP 3308169 A1 EP3308169 A1 EP 3308169A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- cells
- secreting
- antibody
- represented
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57505—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the blood, e.g. leukaemia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
- G01N33/6869—Interleukin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/52—Assays involving cytokines
- G01N2333/54—Interleukins [IL]
- G01N2333/5428—IL-10
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- the present invention relates to a prognostic method for lymphoid hemopathies, including lymphoid leukemias and lymphomas.
- rituximab (MabThera®) has improved the survival of patients with lymphoma or chronic lymphocytic leukemia and the quality of life of patients with dysimmune disease.
- Rituximab is a chimeric lgG1 immunoglobulin recognizing CD20 expressed by B cells of the pro-lymphocyte stage at the plasma cell stage. Different mechanisms of action of rituximab have been described in vitro, some dependent on its variable portion Fv (apoptosis), the others of its constant portion Fc (ADCC, CDC, phagocytosis). Fc ⁇ RIIIa is expressed by natural killer cells (NK cells) and macrophages, effector cells of antibody-dependent cell-mediated cytotoxicity (ADCC).
- NK cells natural killer cells
- ADCC antibody-dependent cell-mediated cytotoxicity
- FCGR3A gene leading to a substitution of amino acid 158 on the receptor makes it possible to distinguish good responder patients (homozygous 158-V) from rituximab of patients with poorer responders ( homozygous 158-F and heterozygous).
- FCGR3A genotype of a subject can be used for patients suffering from malignant tumors, in particular lymphoma, and is suitable for the selection of the best responders and / or the treatment condition or protocol adjustment for low response profile responders.
- Interleukin-10 (IL-10) secreting B cells are immunocompromising cytokines that have the function, inter alia, of limiting the cytotoxic T response. These cells are present in mice and in humans. Tumor B cells can have a function B10, namely to secrete IL-10.
- One of the aims of the invention is to overcome these disadvantages.
- Another object of the invention is to provide a prognostic method allowing simply and rapidly to determine which therapeutic protocol to apply in a given pathological situation, taking into account the chances of success and in order to limit the costs related to therapeutic failures.
- Yet another object of the invention is to provide a kit or a prognostic kit for implementing said method.
- the invention relates to an in vitro prognostic method for therapeutic antibody-mediated therapeutic response in a tumor sample from a patient with hematology,
- said antibody being an antibody depleting the cells of said hemopathy
- the method comprising determining in vitro the amount of Interleukin-secreting L cell B in said tumor sample, such that a patient from which the sample is derived tumor, having a quantity of IL-10 secreting B cells less than 5% of the total amount of said sample cell will have more than 50% chance of depletion of more than 90% of the cells of said hematopathy after treatment with said therapeutic antibody.
- the invention is based on the surprising finding made by the inventors, on the one hand, that the aforementioned hemopathies have a population of B cells secreting IL-10, and on the other hand that the quantity of these cells influences the prognosis of the patient if treated with a therapeutic antibody.
- the inventors have found that the lower the amount of cells secreting IL-10 before treatment, the better the response to treatment, and therefore the better the patient's prognosis.
- the inventors have been able to show that if the amount of cells secreting IL-10 is less than 5% of the total number of circulating cells of the hematology, the prognosis of the patient after treatment will be favorable in more than half cases.
- tumor sample from a patient suffering from hemopathy a blood sample, or a biopsy of which all or part of the sample or biopsy comprises tumor cells.
- the aforementioned tumor sample is obtained from the patient before the start of treatment to eradicate the hematological disorder.
- Red blood cells, anucleate cells, are not taken into consideration.
- the prognostic method of the invention relates to therapeutic antibodies or more generally "antibodies". Both appellations will be used below, unless specifically specified.
- the term "therapeutic antibody” is intended to mean an antibody whose function is to eliminate specific target cells in an individual or a patient. Examples of target cells are tumor cells, cells infected with one or more viruses, pathological immunocompetent cells (for example B or T lymphocytes, antigen-presenting cells, etc.) involved in allergies, autoimmune diseases. ... or even normal cells (endothelial cells in an anti-angiogenic therapeutic strategy). Preferred target cells are tumor cells and infected cells.
- IgG1 isotype therapeutic antibodies such as rituximab can mediate antibody-dependent cellular cytotoxicity or ADCC, but also antibody-dependent cellular phagocytosis or ADPC and complement-dependent cell lysis or CDC.
- the therapeutic antibodies according to the invention may be produced by hybridomas or by genetic engineering, and are advantageously of IgG1 or IgG3 isotype.
- the preferred therapeutic antibodies in the invention are antibodies, of the aforementioned isotype, directed against tumor antigens (molecules expressed on the surface of tumors) such as CD20, CD22, CD25, CD38, or more generally the hematopoietic tumor antigens, preferably lymphoid.
- depleting antibody in the invention an antibody that is capable of inducing the depletion of the target cells, that is to say their reduction or depletion.
- the prognosis of the invention is based on the determination of the amount of tumor B cells that are capable of secreting interleukin 10 or IL-10.
- IL-10 has an inhibitory effect on the immune response, by inhibiting the production of certain cytokines, such as interleukin 2, interleukin 3, TNF and some interferons.
- IL-10 also acts on immunity by modulating the number of different cells involved in the immune system (mast cells, lymphocytes, etc.).
- the inventors By quantifying the number of IL-10 secreting B cells in hemopathies, the inventors found that tumors with less than 5% of these cells prior to treatment had a better response to therapy with a therapeutic antibody. leads to a better prognosis for the patient. It is then possible to envisage for the patient a therapy based on this single therapeutic antibody, or in combination with other protocols (chemotherapy, radiotherapy, etc.). Beyond the 5% threshold of IL-10 secreting B cells, the prognosis of the patient treated with a single therapeutic antibody is unlikely to be very good, and it is therefore recommended to consider a different, more appropriate treatment regimen. .
- the prognosis of the invention makes it possible to determine the chance of success of a treatment with the aid of a therapeutic antibody, and to determine the best therapy to offer the patient, while rationalizing the costs, avoiding giving heavy and expensive treatments to patients who will not respond well, if at all.
- the invention relates to the abovementioned prognostic method, which furthermore comprises the determination of the amino acid at position 176 of the Fc ⁇ RIIIa receptor sequence, as represented by the sequence SEQ ID NO: 1, or in position 158 of the FcYRIIIa receptor sequence, as represented by the sequence SEQ ID NO: 2,
- FcYRIIIa as represented by the sequence SEQ ID NO: 1, or at position 158 of the sequence of the FcYRIIIa receptor as represented by the sequence SEQ
- the invention relates to a method for in vitro prognosis of the therapeutic response mediated by a therapeutic antibody in a tumor sample from a patient suffering from hemopathy, said antibody being an antibody depleting the cells of said hemopathy, the method comprising determining in vitro in the cells of said sample:
- the inventors made a second surprising observation: if the determination of the amount of IL-10 secreting B lymphocytes is combined with the determination of a particular polymorphism of the Fc ⁇ RIIIa receptor, the patient's prognosis will be significantly improved.
- the determination of the single polymorphism of the Fc ⁇ RIIIa receptor does not provide sufficient information to predict a correct response of patients to treatment with a therapeutic antibody.
- the polymorphism of the Fc ⁇ RIIIa receptor has already been described in the state of the art and in particular in the international application WO2003035904. Depending on whether the amino acid at position 176 of the protein, or at position 158 of the modified mature protein, is phenylalanine (F) or valine (V), the therapeutic response to a therapeutic antibody will be different.
- the protein consisting of the sequence SEQ ID NO: 1 corresponds to the FcYRIIIa protein
- the protein consisting of the sequence SEQ ID NO: 2 corresponds to the mature FcYRIIIa protein
- 176V / V (or 158V / V), 176V / F (or 158V / F) and 176F / F (or 158F / F).
- the level of IL-10-secreting B cells is less than 5% of the total amount of cells in the tumor. This means that rates of 4.9%, 4.8%, 4.7%, 4.6%, 4.5%, 4.4%, 4.3%, 4.2%, 4.1% , 4%, 3.9%, 3.8%, 3.7%, 3.6%, 3.5%, 3.4%, 3.3%, 3.2%, 3.1%, 3% %, 2.9%, 2.8%, 2.7%, 2.6%, 2.5%, 2.4%, 2.3%, 2.2%, 2.1%, 2%, 1, 9%, 1, 8%, 1, 7%, 1, 6%, 1, 5%, 1, 4%, 1, 3%, 1, 2%, 1, 1%, 1%, 1%, 0, 9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2% or 0.1% of cells secreting IL-1 10 are particularly advantageous.
- the invention relates to the above-mentioned prognostic method, in which the hematopathy is a hematology whose cells express the CD20 surface marker, that is to say whose tumor cells express the CD20 surface marker.
- CD20 is the first human B-cell differentiation antigen to have been identified using monoclonal antibodies. It is a specific marker of B cells during their development from the pre-B stage to the mature B cell stage. It is nevertheless absent from the surface of the plasma cells.
- the coding gene is located in chromosome 11.
- CD20 belongs to a family of molecules comprising CD20, the ⁇ chain of the high affinity IgE receptor and the HTm4 molecule present on the surface of lymphoid and myeloid hematopoietic cells and whose function is unknown.
- the invention relates to the aforementioned prognostic method, in which the hematopathy is selected from chronic lymphocytic leukemia B (CLL), diffuse large B cell lymphoma and all these histological variants expressing CD20, follicular lymphomas and mantle lymphomas, marginal zone lymphomas, MALT lymphoma (MALT) lymphoma, Burkitt lymphoma, lymphoplasmocytic lymphoma, Waldenstrom's disease, prolymphocytic leukemia B, and all unclassifiable CD20 + B lymphomas
- CLL chronic lymphocytic leukemia B
- MALT lymphoma (MALT) lymphoma Burkitt lymphoma
- lymphoplasmocytic lymphoma Waldenstrom's disease
- prolymphocytic leukemia B and all unclassifiable CD20 + B lymphomas
- the invention relates to a method of in vitro prognostic above the therapeutic response mediated by a therapeutic antibody in a tumor sample from a patient with chronic lymphocytic leukemia.
- the invention relates to a prognostic method as defined above, in which the amount of IL-10 secreting B cells in the sample is measured by flow cytometry, after activation of secretion of IL10, or by measuring the circulating level of IL-10 in the serum.
- the advantageous method of the invention is flow cytometric detection.
- the nucleated cells isolated from a patient are cultured and treated with compounds stimulating the secretion of IL-10. It is then possible either to determine the amount of IL-10 secreted in the culture medium, which is not good quantitative information insofar as the stimulation is artificial, or to proceed to a step of blocking the secretion, so that the IL-10 produced is sequestered in the secretory B cells.
- the cells can then be labeled with an anti-IL-10 antibody, and quantified by flow cytometry. Experimental details are given in the example below.
- the inventors have also shown that there is a correlation between the amount of IL-10 secreting B cells in the tumor of a patient suffering from hemopathy as defined above and the amount of circulating IL-10. in the plasma of said patients (see also example below). Also, by a simple assay of IL-10 in the serum, it is possible to determine, certainly more approximately, the proportion of IL-10 secreting B cells in the patient.
- the invention relates to the abovementioned prognostic method, in which the in vitro determination of the amino acid at position 176 of the FcvRIIIa receptor sequence, as represented by the sequence SEQ ID NO: 1 , or in position 158 of the FcvRIIIa receptor sequence as represented by the sequence SEQ ID NO: 2 is carried out by polymerase chain reaction (PCR), such as PCR, reverse transcription-coupled PCR (RT-PCR) ) or nested PCR, using conventional methods and specific oligonucleotides (primers).
- PCR polymerase chain reaction
- RT-PCR reverse transcription-coupled PCR
- primers specific oligonucleotides
- Genotyping of the gene encoding the FCYRI IIA receptor can be accomplished by a variety of techniques including nucleic acid or protein analysis. Assays can be performed by specific digestion with restriction enzymes, hybridizations, or advantageously amplification / separation / sequencing. It may even be possible to determine and identify polymorphism from RNAs.
- the techniques described in the application WO2003035904 apply mutatis mutandis.
- the oligonucleotides used as primers will preferably be single-stranded oligonucleotides comprising 50 nucleotides, advantageously about 30 nucleotides, preferably from 17 to 25 nucleotides. It is preferable that the oligonucleotides have at least 5 or even at least 8 nucleotides strictly complementary to the target sequence to be amplified, and in particular the nucleotide at the 3 'position of said oligonucleotide.
- one skilled in the art can use the sequence of the human FCGR3A gene, accessible in the databases, in particular under the number AL590385 in the GenBank database, or else the sequence of the complementary DNA accessible in the GenBank database under the number NM_000569.
- oligonucleotides for determining the prognosis are the oligonucleotides represented by the sequences SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5.
- the invention is not limited to these specific oligonucleotides, and the person skilled in the art is capable of designing other specific oligonucleotides.
- the invention relates to the aforementioned method, wherein said therapeutic antibody is a IgG1 or IgG3 immunoglobulin, in particular an anti-CD20 antibody, in particular rituximab.
- the therapeutic antibody which is used in the context of the method of the invention is therefore advantageously an anti-CD20 antibody, and in particular rituximab.
- the method of the invention is advantageously intended to provide a prognosis of response for patients treated with this antibody for chronic lymphocytic leukemia B or B-cell lymphoma.
- Rituximab is a chimeric monoclonal antibody directed against the CD20 surface molecule.
- the variable Fab part of rituximab binds to the CD20 antigen of B lymphocytes, and its constant Fc portion can generate immune effector functions that cause lysis of these lymphocytes.
- the possible mechanisms of effector-mediated cell lysis are complement-dependent cytotoxicity (CDC), involving the binding of the C1q fragment, an antibody-dependent cellular cytotoxicity (ADCC), through one or more of the Fc ⁇ receptors on the surface.
- granulocytes, macrophages and NK cells and phagocytosis (or ADPC) also passing through the interaction with Fc ⁇ receptors on the surface of granulocytes, macrophages. It has also been shown that rituximab, by binding to the CD20 antigen of B cells, induces cell death by apoptosis.
- the invention relates to a method for in vitro prognosis of the therapeutic response mediated by an anti-CD20 therapeutic antibody of lgG1 or IgG3 isotype in a tumor sample from a patient suffering from chronic lymphocytic leukemia. or a B-cell lymphoma, the method comprising determining in vitro in the cells of said sample:
- FcYRIIIa as represented by the sequence SEQ ID NO: 1, or in position 158 of the FcYRIIIa receptor sequence as represented by the sequence SEQ ID NO: 2, and
- the invention relates to a kit for the in vitro prognosis of a patient suffering from a hematological disorder that can be treated with a therapeutic antibody, particularly for the prognosis of chronic lymphocytic leukemia or B-cell lymphoma. , comprising:
- the kit or prognostic kit of the invention provides the means for measuring the two parameters which are essential for the above-mentioned method: the polymorphism of the receptor and the amount of IL-10 secreting B cells.
- the kit or kit also contains control samples that correspond to samples from healthy individuals (negative controls) and / or individuals with poor prognosis (positive controls) and / or individuals have been diagnosed with poor prognosis (positive controls).
- control samples may also be indications or computer data on a physical medium allowing calibration of a flow cytometer to determine the amount of IL-10 secreting B cells.
- the means for detecting the amount of IL-10 secreting B cells may be antibodies for cytometric evaluation of flow of cells, but also drugs to stimulate and / or inhibit the production of IL-10. It may also be antibodies for measuring the level of IL-10 circulating in the plasma.
- the invention relates to a kit for the prognosis as defined above, wherein the means for detecting the amino acid at position 176 of the Fc ⁇ RIIIa receptor as represented by the sequence SEQ ID NO: 1, or in position 158 of the FcYRIIIa receptor sequence, as represented by the sequence SEQ ID NO: 2, comprise the oligonucleotides of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 sequences.
- oligonucleotides to PCR amplify the region corresponding to the polymorphism, and determine which are the alleles carried by the patient who is tested.
- the invention relates to a computer program product on a carrier suitable for the in vitro detection of IL-10 secreting B cells in a sample of a patient with hematology.
- Another aspect of the invention is a software or computer program product designed to implement the detection of IL-10 secreting B cells by flow cytometry and / or comprising portions / means / instructions of program code for executing said detection when said program is executed on a computer, in particular connected to a flow cytometer.
- said program is included in a computer-readable data recording medium.
- a medium is not limited to a portable recording medium such as a CD-ROM but may also be part of a device comprising an internal memory in a computer (for example RAMs and / or ROMs), or external memory device such as hard disks or USB keys, or a server nearby or remotely.
- the invention relates to a computer program product on a suitable support for the implementation of the prognostic method as defined above, said computer program product for determining the amount of B cells secreting IL-1.
- the invention relates to a method for improving the treatment of hematological diseases by therapeutic antibodies comprising the use of at least one inhibitor of secretion or activity of IL-10 by lymphocytes.
- the invention relates to a method for improving the treatment of hemopathies with an anti-CD20 antibody, including rituximab comprising the use of at least one inhibitor of the secretion or activity of IL-10 by lymphocytes.
- the invention in another aspect, relates to a method for improving the treatment of hematological disorders with therapeutic antibodies comprising the use of at least one IL-10 secreting lymphocyte inhibitor.
- the invention relates to a method for improving the treatment of hematological diseases by an anti-CD20 antibody, including rituximab comprising the use of at least one inhibitor of B cells secreting IL-10.
- IL-10 secreting B-cell inhibitor or IL-10 secreting lymphocytes
- IL-10 secreting lymphocytes is meant in the invention compounds or molecules, or mixtures thereof, capable of interfering with the activity of IL-10 secreting cells.
- B10 lymphocytes either by inhibiting their ability to secrete IL-10, by inhibiting their proliferation, or by inducing their death, in particular by apoptosis.
- Secretion inhibitors such as Brefeldin A can be used.
- IL-10 inhibitors such as antibodies directed against NL10, or the use of mimetic peptides which will saturate the targets of interleukin and thus inhibit the action of the native protein.
- the invention also relates to the use of inhibitors of the activity or secretion of IL-10 for the preparation of a medicament for promoting the treatment of hematological diseases by therapeutic antibodies, in particular an anti-CD20 or rituximab.
- the invention relates to an inhibitor of the activity or secretion of IL-10 for use in the treatment of blood disorders treated with at least one therapeutic antibody, especially an anti-CD20 antibody or rituximab.
- the invention relates to a composition
- a composition comprising at least one inhibitor of the activity or secretion of IL-10 and at least one antibody therapeutic, in particular an anti-CD20 antibody or rituximab, for the treatment of hematological diseases in which the tumor cells have a valine at position 176 of the FcvRIIIa receptor sequence, as represented by the sequence SEQ ID NO: 1, or position 158 of the FcvRIIIa receptor sequence as represented by the sequence SEQ ID NO: 2.
- the x-axis represents the amount of IL-10 in the plasma in ⁇ g / mL and the y-axis represents the percentage of B10 cells expressed in%.
- the abscissa axis represents the% lymphodepletion percentage and the ordinate axis represents the percentage of B10 cells expressed in%.
- Figure 3 is a graph showing that lymphocyte depletion is statistically greater for patients carrying the FcYRIIIa-158V allele
- ROC receiver operating curve
- FIG. 5 represents a graph comparing the number of regulatory B cells (listed by cytometry - abscissa axis) with the IL-10 secretion assay (rapid method - ordinate axis).
- the broken line rectangle corresponds to individuals with a low risk of suboptimal response with an anti-CD20 antibody.
- the rectangle with solid lines corresponds to individuals with a high risk of suboptimal response with an anti-CD20 antibody.
- R 0.79.
- rituximab (marketed under the brand names MabThera®, Rituxan®) remain unknown and could be different depending on the subtype lymphoproliferative disorder B.
- Rituximab is known to induce in vitro apoptosis, complement-mediated lysis (CDC), antibody-mediated cellular cytotoxicity (ADCC) and antibody-dependent phagocytosis (ADPC), and some outcomes. tend to involve these mechanisms in vivo.
- the inventors had previously observed that the Fc ⁇ RIIIa V / F receptor polymorphism affects the clinical response to rituximab treatment. Since this polymorphism modifies the affinity of the constant portion of IgG1 for the Fc ⁇ RIIIa receptor, (expressed on the surface of NK cells and macrophages), the inventors hypothesized that the mechanism of ADCC should be important in the treatment of follicular lymphoma treated with rituximab.
- B10 or B10 cells are characterized by their ability to modulate inflammation, autoimmunity, and the innate or adaptive immune response due to IL-10 production.
- B10 cells would be able to inhibit anti-CD20 antibody-induced lymphoma cell removal by acting on the monocytic functions mediated by the constant parts of immunoglobulins (Fc parts).
- CLL chronic lymphocytic leukemia
- the inventors then considered that competent IL-10 cells of CLL could have an influence on the efficacy of rituximab treatment of patients suffering from this type of leukemia.
- a prospective and randomized phase II study was conducted in 59 French centers including 140 patients between June 2012 and January 2013. Patients who received no prior treatment (aged 18 to 65 years) and whose diagnosis of lymphoid leukemia Chronic was confirmed by immunophenotyping according to the criteria IWCLL 2008 (Binet of stage C, or binet of stage A or B with an active disease), were enrolled in this test. An additional inclusion criterion was taken into account: the absence of deletion 17p, evaluated by FISH ( ⁇ 10% positive nuclei). All patients provided informed written consent prior to inclusion.
- Patients are stratified according to their IGVH mutational status after FISH analysis (deletion 11q) and are randomly assigned with a ratio of 1: 1 to receive either the standard dose of FCR chemotherapy (fludarabine, cyclophosphamide, and rituximab) for arm A or Dense-FCR with a prephase of rituximab prior to standard FCR treatment for arm B.
- FCR chemotherapy fludarabine, cyclophosphamide, and rituximab
- the standard FCR treatment consists of 6 courses spaced 28 days of rituximab (375 mg / m 2 for the first treatment, J1 and 500 mg / m2 for the other courses), fludarabine (40 mg / m2 / day J2-4) cyclophosphamide (250 mg / m2 / day).
- the FCR treatment is preceded by a rituximab prephase composed of 4 successive infusions, distributed as follows: 500 mg on day 0, and 2000 mg on day 1, day 8 and day 15.
- Treatment 1 begins at D22 for the patients and the following courses are spaced 28 days apart.
- IL-10 competent CLL cells are identified by flow cytometry from purified mononuclear blood cells after polyclonal stimulation.
- PBMC Peripheral blood mononuclear cells
- PBMC peripheral blood mononuclear cells
- medium RPMI 1640 - Biotech GmbH, Aidenbach, Germany
- 10% fetal calf serum EUROPEAN, Courtaboeuf, France
- 2 mM L-glutamine Eurobio, Courtaboeuf, France
- 100 U / mL penicillin 100 ⁇ g / mL streptomycin
- 2.5 ⁇ g / mL amphotericin All antibiotics are obtained from Tebu-bio, Le Perray-en-Yvelines, France).
- CpG ODN 2006, 10 g / mL, InvivoGen, San Diego, USA
- CD40L 50 ng / mL, R & D Systems, Minneapolis, MN, USA
- anti-polyHistidine 500 ng / mL, R & D Systems, Minneapolis, MN, USA
- Phorbol acetate and myristate PMA, 50 ng / mL, Sigma-Aldrich, St. Louis, MO, USA
- ionomycin (1 g / mL, Sigma-Aldrich, St.
- the cells were labeled with the following antibodies: anti CD19 BV421 (HIB 19), anti CD69 PE / Cy7 (FN 50), anti CD38 APC (HIT 2), anti IL-10 PE (JES3-9D7) at BioLegend (San Diego, CA, USA), and anti CD45 KO (J.33) and anti CD5 FITC (BL1a) from Beckman Coulter (Brea, CA, USA).
- Clonal LLC cells were identified as lymphocytes CD19 + CD5 + CD20int. Assays were performed using a CyAnTM ADP flow cytometer (Beckman Coulter, Brea, CA, USA).
- Plasma IL-10 levels were determined using Luminex® magnetic bead technology, using a dual laser reading system, as recommended by the manufacturer (R & D Systems, Minneapolis, USA). The plasma of the 68 patients was incubated with superparamagnetic beads coated with anti-IL-10 antibody for 2h, at room temperature, diluted to 1 ⁇ 2. Plasma IL-10 is quantified by the combination of two antibodies for detection: a biotinylated IL-10 antibody and a streptavidin antibody conjugated to phycoerythrin.
- FCYRI I IA-158VF polymorphism is determined by nested PCR. Briefly, single-stage allele-specific multiplex PCR assays were performed as described in DallOzzo et al. (Dallozzo et al J Immunol Methods, 2003, 277 (1-2): 185-192) with some modifications.
- the 25 ⁇ l of the reaction mixture comprises genomic DNA, 400 nM sense primer (5'-TCCAAA AGCCACACTCAAAGTC-3 '(SEQ ID NO: 3)), 400 nM antisense primer specific for the V allele (5' - AGACACATTTTTACTCCCATC -3 '(SEQ ID NO: 4)) and 200nM of antisense primer specific for the F allele (5 -
- the PCR conditions are: 3.5 min at 95 ° C followed by 35 cycles, each cycle consisting of 95 ° C for 20 sec, 56 ° C for 20 sec, 72 ° C for 30 sec.
- the PCR products (137bp for the F allele and 81bp for the "allele B") are separated on 8% acrylamide gel (Invitrogen, Carlsbad, USA) and visualized by ethidium bromide labeling.
- the median number of leukemia lymphocytes before the four doses of rituximab (J0) was 91.13 G / L (range: 3.74-497.40) and was 2.60 G / L (range: 0.14- 189.40) at the end of the prephase treatment rituximab alone (J22).
- the median lymphocyte depletion after prephase treatment with rituximab alone (J22) was 95.1% (range 77.0-99.9), of which 66% achieved a depletion of more than 90%.
- B10 (not shown).
- the frequency of B10 cells does not vary according to the characteristics of patients, nor is it significantly different in patients with CLL with or without IGVH mutation (median: 6.29%, range: 0.12 to 15.83 versus median: 1.85% , range: 0.23 to 20.81, respectively).
- such frequencies of B10 cells do not correlate with cytogenetic alterations (del11q, del13q, trisomy 12) either.
- VN true negatives
- the double detection makes it possible to obtain, for thresholds lower than 5% of B10, a good sensitivity (approximately 86%).
- the inventors have therefore determined a B10 population in patients with chronic lymphocytic leukemia and receiving rituximab. At the same time they determined the FcYRIIIa-158VF phenotype of these patients. They showed that the frequency of B10 cells and the FcgYRIIIa-158VF polymorphism influenced the response to rituximab in patients with chronic lymphocytic leukemia. Analysis of these two factors combined improves the sensitivity and specificity of predicting the prognostic response. Lymphodepletion Lymphodepletion ⁇ 90% Analysis
- Table 1 Parameters influencing rituximab-induced lymphocytosis monotherapy in 68 patients with chronic lymphocytic leukemia (CLL). The group of patients with lymphocyte inhibition of less than 90% was used as a reference for odds ratios.
- the inventors have also proposed a simple and rapid method for analyzing the frequency of regulatory B cells. This method was compared to the reference method which is based on intracytoplasmic detection of IL-10 synthesis in flow cytometry.
- the method consists of a first step of enriching the population of B lymphocytes that are normally very minor among the leucocytes by negative selection from a peripheral blood sample.
- the blood is collected on a phase separation tube (BD type vacutainaer CPT).
- the blood can be transferred from a primary tube containing an anticoagulant into the phase separation tube.
- a RosetteSep StemCell depletion cocktail is added to the blood sample in order to enrich the leukocyte phase in the B lymphocyte.
- a separation by centrifugation and two cell washing centrifugations a population containing more 90% of B lymphocytes is obtained.
- the cells are enumerated by visual counting (cells under a microscope) or by cytometry to prepare a concentration of 6 million cells per ml and cultured in a medium containing RPMI + 10% fetal calf serum.
- the cells are stimulated by a cocktail of polyclonal activators such as a mixture of CPG motifs and CD40 lignant-histidine + antibodies.
- An unstimulated well is made in parallel.
- the culture is kept 18h to 48h at 37 ° C without intervention.
- the cell culture is centrifuged and the culture supernatant collected and stored at -20 ° C or tested immediately by an enzyme immunoassay (EIA) technique to determine the secreted IL-10 concentration.
- EIA enzyme immunoassay
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Urology & Nephrology (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- General Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Food Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR1555253A FR3037340A1 (fr) | 2015-06-09 | 2015-06-09 | Methode de pronostic d'hemopathies lymphoides |
| PCT/FR2016/051388 WO2016198795A1 (fr) | 2015-06-09 | 2016-06-09 | Methode de pronostic d'hemopathies lymphoïdes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP3308169A1 true EP3308169A1 (fr) | 2018-04-18 |
Family
ID=54260877
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP16734438.1A Withdrawn EP3308169A1 (fr) | 2015-06-09 | 2016-06-09 | Methode de pronostic d'hemopathies lymphoïdes |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20180246109A1 (fr) |
| EP (1) | EP3308169A1 (fr) |
| JP (1) | JP2018518198A (fr) |
| CN (1) | CN107850598A (fr) |
| CA (1) | CA2988781A1 (fr) |
| FR (1) | FR3037340A1 (fr) |
| WO (1) | WO2016198795A1 (fr) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108676875B (zh) * | 2018-04-10 | 2022-01-18 | 哈尔滨医科大学 | Cd20、fcgriia及fcgriiia基因在弥漫大b细胞淋巴瘤预后中的用途 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE02782887T1 (de) * | 2001-10-19 | 2005-01-13 | Centre Hospitalier Regional et Universitair de Tours | Methoden und kompositionen, antikörper behandlung zu bewerten |
-
2015
- 2015-06-09 FR FR1555253A patent/FR3037340A1/fr active Pending
-
2016
- 2016-06-09 CA CA2988781A patent/CA2988781A1/fr not_active Abandoned
- 2016-06-09 EP EP16734438.1A patent/EP3308169A1/fr not_active Withdrawn
- 2016-06-09 JP JP2018516637A patent/JP2018518198A/ja active Pending
- 2016-06-09 WO PCT/FR2016/051388 patent/WO2016198795A1/fr not_active Ceased
- 2016-06-09 US US15/735,433 patent/US20180246109A1/en not_active Abandoned
- 2016-06-09 CN CN201680042378.5A patent/CN107850598A/zh active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016198795A1 (fr) | 2016-12-15 |
| US20180246109A1 (en) | 2018-08-30 |
| FR3037340A1 (fr) | 2016-12-16 |
| CA2988781A1 (fr) | 2016-12-15 |
| CN107850598A (zh) | 2018-03-27 |
| JP2018518198A (ja) | 2018-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Harvey et al. | Clinical diagnostics and treatment strategies for Philadelphia chromosome–like acute lymphoblastic leukemia | |
| Rauch et al. | Rapid progression of adult T-cell leukemia/lymphoma as tumor-infiltrating Tregs after PD-1 blockade | |
| Eluard et al. | The alternative RelB NF-κB subunit is a novel critical player in diffuse large B-cell lymphoma | |
| Xu-Monette et al. | Assessment of CD37 B-cell antigen and cell of origin significantly improves risk prediction in diffuse large B-cell lymphoma | |
| Chen et al. | Dysregulated CXCR4 expression promotes lymphoma cell survival and independently predicts disease progression in germinal center B-cell-like diffuse large B-cell lymphoma | |
| Quartuccio et al. | The 158VV Fcgamma receptor 3A genotype is associated with response to rituximab in rheumatoid arthritis: results of an Italian multicentre study | |
| Ruminy et al. | The isotype of the BCR as a surrogate for the GCB and ABC molecular subtypes in diffuse large B-cell lymphoma | |
| Emery et al. | Optimising treatment in rheumatoid arthritis: a review of potential biological markers of response | |
| De Winde et al. | Tetraspanin CD37 protects against the development of B cell lymphoma | |
| EP2412825B1 (fr) | Marqueurs de cellules souches leucémiques | |
| Costantino et al. | ERAP1 gene expression is influenced by nonsynonymous polymorphisms associated with predisposition to spondyloarthritis | |
| US20070092519A1 (en) | Method for diagnosing chronic myeloid leukemia | |
| CN107530431B (zh) | 生物标志物 | |
| Ortonne et al. | Significance of circulating T-cell clones in Sezary syndrome | |
| CN103502472A (zh) | 生物标记物和用于预测对b-细胞拮抗剂的响应的方法 | |
| US20080234138A1 (en) | TP53 gene expression and uses thereof | |
| CN103930785B (zh) | 用于癌症治疗的预测物 | |
| Dornan et al. | Effect of FCGR2A and FCGR3A variants on CLL outcome | |
| ES3005230T3 (en) | Diagnostic and therapeutic methods for the treatment of rheumatoid arthritis (ra) | |
| JP2013526845A (ja) | サイトカイン標的薬(CyTD)に対する、炎症性疾患に罹患している対象の初期応答または非応答を予測する遺伝子および遺伝子の組み合わせ | |
| US20070020660A1 (en) | Expression profiles of peripheral blood mononuclear cells for inflammatory bowel diseases | |
| Li et al. | Impact of T-cell immunity on chemotherapy response in childhood acute lymphoblastic leukemia | |
| Jin et al. | Fc gamma receptor IIb in tumor-associated macrophages and dendritic cells drives poor prognosis of recurrent glioblastoma through immune-associated signaling pathways | |
| WO2020256868A9 (fr) | Modulateurs du système immunitaire pour le traitement de la prémalignité du poumon squameux | |
| Fang et al. | CTLA-4 methylation regulates the pathogenesis of myasthenia gravis and the expression of related cytokines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20171212 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: GAGEZ, ANNE-LAURE Inventor name: CEZAR, RENAUD Inventor name: CARTRON, GUILLAUME Inventor name: TUAILLON, EDOUARD |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20190207 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20190618 |