EP3298128A1 - Collections de cellules rénales primaires, procédé d'isolement et utilisations associées - Google Patents

Collections de cellules rénales primaires, procédé d'isolement et utilisations associées

Info

Publication number
EP3298128A1
EP3298128A1 EP16744562.6A EP16744562A EP3298128A1 EP 3298128 A1 EP3298128 A1 EP 3298128A1 EP 16744562 A EP16744562 A EP 16744562A EP 3298128 A1 EP3298128 A1 EP 3298128A1
Authority
EP
European Patent Office
Prior art keywords
cells
kidney
medium
cell
suspension
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP16744562.6A
Other languages
German (de)
English (en)
Inventor
Daniëlle Greanne LEUNING
Antonius Johannes RABELINK
Marten Alexander Engelse
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Leids Universitair Medisch Centrum LUMC
Original Assignee
Leids Universitair Medisch Centrum LUMC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Leids Universitair Medisch Centrum LUMC filed Critical Leids Universitair Medisch Centrum LUMC
Publication of EP3298128A1 publication Critical patent/EP3298128A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells

Definitions

  • the invention relates to isolated fractionated kidney cells and in vitro cultured progeny thereof.
  • the invention also relates to methods for isolating the cells and to medical and non-medical uses of the cells.
  • the present invention provides a novel type of cells suited for transplantation.
  • Cells of the invention have favorable properties in among others wound healing, blood vessel stabilization and in dampening immune responses against the individuals own cells or transplanted foreign organs and cells.
  • cells of the invention resemble mesenchymal stromal cells (MSCs).
  • MSCs are immune modulatory and anti-fibrotic cells originally isolated from the bone marrow (bmMSCs) and are characterized by their spindle shaped morphology and ability to adhere to plastic.
  • bmMSC are able to differentiate into fat, bone and cartilage and express the stromal markers CD73, CD90 and CD 105 while being negative for CD34 and CD45 (Pittenger, Mackay et al. 1999, Dominici, Le Blanc et al. 2006).
  • MSC treatment enhanced tissue repair and reduced fibroses (Morigi, Introna et al. 2008, Wang, He et al. 2013)
  • MSC therapy could prolong graft survival and a T-reg dependent tolerance was observed (Casiraghi, Azzollini et al. 2008).
  • perivascular stromal cells from different solid organs express various markers among which there are NG2, PDGFR- ⁇ and
  • CD 146 These perivascular stromal cells exhibit MSC-like characteristics (Crisan, Yap et al. 2008). The perivascular location of these cells allows for close interaction with several cell types including endothelial cells, epithelial cells, resident macrophages and dendritic cells. Recruitment of inflammatory cells is possible and these cells are likely to have a role in tissue homeostasis (Rabelink and Little 2013).
  • MSC like cells can be isolated from murine kidneys (kCFU-F). Although these kCFU-F have a comparable stromal marker expression and trilineage
  • Li et al. showed that these cells are indeed different compared to bmMSCs as kidney MSC-like cells, in particular the HoxB7 positive fraction isolated from the collecting duct, were able to integrate into the collecting duct in neonatal mice while bmMSCs did not have this capacity (Li, Ariunbold et al. 2015).
  • kPSCs human kidneys have perivascular stromal cells and that these cells can be isolated from the human kidney (kPSCs) and propagated in vitro.
  • the propagated cells actively support kidney repair and that these cells are more potent than perivascular cells derived from other organs. Without being bound by theory it is believed that this is due to tissue specific imprinting.
  • the present invention shows that kPSCs can be isolated and propagated in a clinical grade manner and in sufficient quantities for in vivo application.
  • the invention therefore provides a cell source for cell therapy which compares well with the currently most studied stromal cell population for cell therapy, bmMSCs and even outperforms these cells in at least some aspects.
  • Human kPSCs of the present invention do not fulfill the ISSCT criteria for MSCs. They, for instance, do not differentiate into adipocytes.
  • the cells of the invention exhibit a distinct mRNA expression profile and show tissue homeostatic capacities as they have immune modulatory functions, are able to stabilize endothelial cells and can enhance kidney epithelial repair.
  • the human kPSCs of the invention are therefore a distinct cell population and are a promising new cell therapy candidate for kidney diseases and transplantation.
  • the invention provides a method for culturing human kidney cells comprising
  • step b) culturing cells of the suspension of step a) on a cell culture surface for
  • the invention further provides a collection of kidney- derived cells obtainable by a method according to invention.
  • the invention also provides a collection of kidney- derived cells that exhibits multilineage differentiation capacity as exemplified by the formation of osteocytes and chondrocytes from a culture of 10e5 of said cells and the lack of formation of adipocytes from a culture of 10e5 of said cells.
  • the invention further provides a collection of kidney- derived cells that is positive for expression of cell surface marker CD73, CD90, CD 105, CD 146, NG2,
  • PDGFRbeta or HLA-class I or a combination thereof and negative for CD31, CD34, CD45, or CD 133 or HLA-DR or a combination thereof.
  • a method for the treatment of an individual having or at risk of having an undesired immune response comprising administering a collection of cells according to the invention to the individual in need thereof.
  • a method for stabilizing a blood vessel comprising providing a system comprising or forming said blood vessel with a collection of cells according to the invention.
  • the invention also provides a collection of cells of the invention for use in the treatment of an individual having or at risk of having: kidney damage; an undesired immune response or a vascular disease, preferably a microvascular disease.
  • the invention further provides a medium conditioned by cultured perivascular stromal cells wherein the medium is obtained by preparing a suspension of a mammalian kidney or part thereof; culturing cells of the suspension in the presence of a cell culture surface for adherent cells; producing a single cell suspension from cells that adhered to the cell culture surface; collecting
  • CSPG4 Chondroitin Sulfate Proteoglycan 4
  • the invention further provides a method of improving donor organ quality ex vivo or epithelial repair of an organ ex vivo comprising perfusing the organ with perfusion fluid comprising medium that is conditioned by cultured perivascular stromal cells.
  • the invention further provides use of HGF for improving donor organ quality ex vivo or epithelial repair of an organ ex vivo.
  • the kidney is a primate or a Sus scrofa domesticus or Sus domesticus (domestic pig) kidney.
  • the primate is preferably a human.
  • the term adult when used in the context of a human refers to an individual of 18 years of age or older.
  • the cells of the invention can also be collected from kidneys of post-natal individuals.
  • the cells are preferably obtained from human individuals that are at least 12 years of age, preferably at least 15, more preferably at least 18 years of age. Organs typically deteriorate in quality with increasing age. Cells can also be collected from older individuals, for instance older than 65, as long as the quality of the kidney is sufficient for transplantation.
  • Cell suspensions of a kidney can suitably be obtained from transplant grade kidneys, preferably human transplant grade kidneys.
  • the kidneys used for the present invention were obtained from transplant grade kidneys that were not used for surgical reasons.
  • Transplant grade kidneys are kidneys from individuals with no known renal disease and which have been surgically harvested at a time point when ischemic damage is minimal.
  • the cells of the invention can be obtained by flushing the kidney after surgery with a physiological salt solution that contains heparin.
  • a cell suspension of kidney cells can be obtained by perfusion of the kidney with a collagenase or other protease that can digest extracellular matrix proteins.
  • a DNAse is often added to reduce aggregation due to lysis of cells. It is preferred to use the perfusion solution described in the example section.
  • Perfusion is preferably done via a renal artery cannula. Collected cells can be cultured directed or frozen for later use. It is preferred that perirenal fat and kidney capsule are removed prior to initiation of the perfusion with the enzyme solution(s).
  • the kidney is preferably an intact kidney. Parts of the kidney can also be used. In such case it is preferred that the part contains the renal artery.
  • a part preferably comprises one or more large arteries, one or more afferent arterioles, one or more efferent arterioles or a combination thereof.
  • the cells of step e) can be cultured in vitro for a number of passages. Cultures from freshly isolated cells typically exhibit a first crisis after initiation of the culture and a second crises when the cells remaining reach senescence.
  • the first crisis particularly occurs when the culture conditions are not suited for the propagation of endothelial cells. This is for instance the case when the cells are cultured on a plastic surface. Endothelial cells do not easily adhere not such surfaces and do not noticeably grow thereon..
  • Cells collected in step d) are preferably subjected to further purification, for instance to remove endothelial cells and/or epithelial cells if needed, in such case the first crisis can be reduced or be absent entirely.
  • Epithelial cells are typically not NG2 positive.
  • Cell suspensions are typically suspensions of single cells but may contain cell aggregates. Cell suspensions can contain debris such as cell debris or matrix material.
  • a single cell suspension typically contains at least 90.% single cells (based on the number of single cells and the total number of single cells and aggregates containing more than 1 cell).
  • Single cell suspensions are easily made by mild proteolytic treatment of adherent cells. In cell culture trypsin is usually used for such purposes. In harvesting the cells from organs typically other proteolytic enzymes are used (see elsewhere herein). The single cell suspension is preferred for use in purifying cells by means of cellular markers. Single cell suspensions are typically also made for routine culturing and passaging of the cell culture, but this is not critical.
  • the cell culture surface for adherent cells is typically a surface of a culture dish for adherent cells.
  • the culture surface is preferably a culture dish for adherent cell culture.
  • Such dishes are typically made from plastic that is charged. Suitable dishes can also be made by coating a surface with a protein, typically gelatin, laminin, fibronectin or the like.
  • the cell culture surface can also be a bead (or carrier) that is suitable for adherent cell growth. Such beads are typically referred to as microcarriers; a support matrix allowing for the growth of adherent cells in for instance biore actors.
  • An adherent cell culture dish or cell culture surface can also be a dish that contains a carrier to which the cells can adhere. Suitable carriers are known in the art and include but are not limited to microcarriers.
  • Chondroitin Sulfate Proteoglycan 4 (CSPG4; also known as NG2) positive cells are preferably collected by incubating the cells with an antibody that binds to CSPG4 on the surface of CSPG4 expressing cells.
  • the antibody preferably specifically binds CSPG4 in that it does not bind cells in the suspension that do not express CSPG4.
  • the cells multiply during culture and are very suited for a number of different purposes as detailed elsewhere herein.
  • the invention therefore provides a collection of kidney- derived cells obtainable by a method according to invention.
  • kidney- derived cells exhibits multilineage differentiation capacity as exemplified by the formation of osteocytes and chondrocytes from a culture of 10e5 of said cells and the lack of formation of adipocytes from a culture of 10e5 of said cells.
  • the inability to differentiate into adipocytes as indicated herein sets the collection of cells of the invention aside from mesenchymal stromal cells (MSC).
  • MSC mesenchymal stromal cells
  • a hallmark of MSC is that such cells can differentiate into the adipocyte lineage.
  • the cells of the invention lack this ability from the onset of the culture. I.e. immediately upon conclusion of step e) of the method of the invention.
  • composition of the culture medium for the cells of the invention is not very critical although some media perform better (yield a higher division rate; or higher number of cells) than others.
  • Suitable media are normal AMEM or DMEM supplemented with 10% normal human serum or 5% human platelet lysates.
  • hMSC Adipogenic Differentiation BulletKitTM Medium (Lonza) provides both an induction medium and a maintenance medium guaranteed to induce adipogenic differentiation of human bone marrow derived mesenchymal stem cells into mature, functionally active adipocytes; Each bottle of the hMSC Adipogenic Differentiation BulletKitTM Medium contains enough induction medium and maintenance medium to fully differentiate approximately 3 million human bone marrow derived mesenchymal stem cells [approximately 15 wells in a 6-well plate format] into mature, functionally active adipocytes.
  • TGF-B3 provides a differentiation medium appropriate to induce chondrogenic differentiation of human adipose derived mesenchymal stem cells into mature, functionally active chondrocytes;
  • TGF-B3 contains enough differentiation medium to fully differentiate approximately 12.5 million human adipose derived mesenchymal stem cells [approximately 25 micropellets] into mature, functionally active chondrocytes).
  • hMSC Osteogenic Differentiation BulletKitTM Medium (Lonza) provides a differentiation medium appropriate to induce osteogenic
  • Differentiation BulletKitTM Medium contains enough differentiation medium to fully differentiate approximately 200,000 human adipose derived mesenchymal stem cells [approximately 20 wells in a 24-well plate format] into mature, functionally active osteoblasts.
  • a collection of kidney- derived cells of the invention is positive for expression of cell surface marker CD73, CD90, CD 105, CD 146, NG2, PDGFRbeta, or HLA-class I or a combination thereof and negative for CD31, CD34, CD45, CD 133 or HLA-DR or a combination thereof.
  • Chondroitin Sulfate Proteoglycan 4 or CSPG4 is also known under a number of aliases such as MSK16; Melanoma-Associated Chondroitin Sulfate Proteoglycan; NG2; Chondroitin Sulfate Proteoglycan 4 (Melanoma-Associated); HMW-MAA; chondroitin Sulfate Proteoglycan NG2; MEL-CSPG; Melanoma Chondroitin Sulfate Proteoglycan; EC 2.7.8; MCSP; EC 3.6.3; MCSPG.
  • the invention further provides a method for the treatment of an individual having or at risk of having kidney damage.
  • the method comprises administering a collection of cells according to the invention to the individual in need thereof.
  • An individual with kidney damage has an Estimated Glomerular Filtration Rate (eGFR) ⁇ 60; proteinuria >0,3 g/L or a combination thereof.
  • the individual at risk is at risk of developing these values.
  • the invention further provides a method for the treatment of an individual having a kidney biopsy inflammation, fibrosis, vascular damage, glomerular damage, tubular damage the method comprising
  • the undesired immune response is an auto-immune disease or a host versus graft disease.
  • the auto-immune disease preferably affects renal function.
  • the graft in the host versus graft disease is preferably a kidney or a fraction thereof.
  • the fraction is preferably a cell fraction.
  • the invention further provides a method for the treatment of an individual having a vascular disease, preferably a microvascular disease comprising administering a collection of cells according to the invention to the individual in need thereof.
  • the vascular disease is a renal vascular disease, preferably a renal microvascular disease.
  • a method for stabilizing a blood vessel comprising providing a system comprising or forming said blood vessel with a collection of cells according to the invention. Suitable systems are in vivo conditions preferably in a kidney.
  • the invention also provides a collection of cells of the invention for use in the treatment of an individual having or at risk of having: kidney damage; an undesired immune response, an unstable blood vessel or (micro)vascular disease.
  • a collection of cells of the invention that is used in transplantation settings preferably comprises at least 10e5 cells/kg body weight, more preferably at least 2,5xl0e5, more preferably at least 10e6 and in a particularly preferred embodiment l-2xl0e6 cells/kg body weight.
  • a collection of cells of the invention can be administered in various ways.
  • the cells are administered intravenously, intra-renally, via the renal artery or underneath the kidney capsule.
  • Cells of the invention refers to a kidney-derived cell population that can be obtained using a method for culturing kidney cells as described herein.
  • a collection of the invention comprises cells of the invention.
  • “Differentiation” is the process by which an unspecialized ("uncommitted") or less specialized cell acquires the features of a specialized cell, such as a kidney cell, for example.
  • a “differentiated or differentiation-induced cell” is one that has taken on a more specialized ("committed") position within the lineage of a cell.
  • the term “committed,” when applied to the process of differentiation, refers to a cell that has proceeded in the differentiation pathway to a point where, under normal circumstances, it will continue to differentiate into a specific cell type or subset of cell types, and cannot, under normal circumstances, differentiate into a different cell type or revert to a less differentiated cell type.
  • the "lineage" of a cell defines the heredity of the cell, i.e., which cells it came from and what cells it can give rise to.
  • the lineage of a cell places the cell within a hereditary scheme of development and differentiation.
  • a "lineage- specific marker” refers to a characteristic specifically associated with the phenotype of cells of a lineage of interest and can be used to assess the
  • Osteocytes, chondrocytes and adipocytes are different mesoderm derived cell types with distinct molecular and morphological phenotypes. Osteocytes are involved in bone restructuring, chondrocytes are involved in cartilage formation and adipocytes are fat cells.
  • Cell of the invention as used herein are mammalian kidney- derived cells that can give rise to cells such as osteocytes or can give rise to one or more types of tissue, for example, renal tissue.
  • the cells of the invention can also produce cells of similar differentiation potential as itself (i.e. it can self-renew) under the appropriate culture conditions.
  • the term proliferation is sometimes also used to refer to the generation of two or more daughter cells that are essentially similar in function as the mother cell they originate from.
  • the isolated or purified mammalian kidney- derived cell population of the invention is stable and capable of expansion in cell culture.
  • the mammalian kidney- derived cell population has been identified phenotypically as cells that are positive for expression of at least one of CD73, CD90, CD105, CD146, NG2, PDGFRbeta, or HLA-class I or a combination thereof and negative for CD31, CD34, CD45, CD133 or HLA-DR or a combination thereof.
  • the cells of the invention express HoxDIO, HoxDl l or a combination thereof. In a preferred embodiment the cells express HoxDl l.
  • HoxDIO or homeobox D10 is also known under various other names, i.e. Homeobox Protein Hox-4E; HOX4D; HOX4E; HOX4; Hox-4.4; Homeo Box D10; Homeo Box 4D; Homeobox Protein Hox-4D and Homeobox Protein Hox-D10.
  • External Ids are: HGNC: 51331; Entrez Gene: 32362; Ensembl: ENSG000001287107; OMIM:
  • HoxDl l or Homeobox Dl l is also known under various other names, i.e. Homeobox Protein Hox-4F; HOX4F; Homeo Box 4F; HOX4; Homeobox Protein Hox-Dl l; Homeo Box Dl l; or Hox-4.6, Mouse, Homolog Of. External Ids are: HGNC: 51341; Entrez Gene: 32372; Ensembl: ENSG000001287137; OMIM: 1429865; UniProtKB: P312773.
  • Collections of cells or cells of the invention that express HoxDIO, HoxDl l or a combination thereof preferably express more HoxDIO, HoxDl l or a combination thereof than bmMCS of the same species and under otherwise similar conditions. In a preferred embodiment it is HoxDll that is expressed more.
  • Cultures, and collections of cells of the invention are so-called primary cell cultures and collections of primary cells.
  • the term "primary" in this context refers to the usual meaning in the art of tissue culture. It typically is used to identify "normal” untransformed cells that are taken from an individual and untransformed progeny thereof.
  • the primary cell is typically restricted in the number of cell divisions it can undergo. At the end of this number the cells stop dividing and eventually die, leading to what is generally referred to as a crisis of a culture. This is also referred to as primary cells reaching senescence. Sometimes a number of cells survive the crises and have acquired unlimited cell division potential. Such cells are typically not referred to as primary cells. Also tumor cells are not considered primary cells, also not when just in culture.
  • Transplanting “Transplanting”, “implanting”, “transplantation”, “grafting” and “graft” are used to describe the process by which cells, preparations, and collections of the invention are delivered to the site within the patient where the cells are intended to exhibit a favorable effect, such as repairing damage to a patient's tissues, treating a disease, injury or trauma, or genetic damage or environmental insult to an organ or tissue caused by, for example an accident or other activity.
  • Cells, preparations, and compositions can also be delivered in a remote area of the body by any mode of administration relying on cellular migration to the appropriate area in the body to effect transplantation.
  • isolated or “purified” refers to altered “by the hand of man” from the natural state i.e. anything that occurs in nature is defined as isolated when it has been removed from its original environment, or both. "Isolated” also defines a
  • composition for example, a mammalian kidney- derived cell population, that is separated from contaminants (i.e. substances that differ from the cell).
  • a population or composition of cells is substantially free of cells and materials with which it may be associated in nature.
  • isolated or purified or substantially pure with respect to mammalian kidney- derived cells, refers to a population of mammalian kidney- derived cells that is at least about 50%, at least about 75%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% pure, with respect to mammalian kidney- derived cells making up a total cell population.
  • the term "substantially pure” refers to a population of mammalian kidney- derived cells of the present invention that contain fewer than about 50%, preferably fewer than about 30%, preferably fewer than about 20%, more preferably fewer than about 10%, most preferably fewer than about 5%, of lineage committed kidney cells in the original unamplified and isolated population prior to subsequent culturing and
  • the present invention also provides a method of treatment, which uses mammalian kidney- derived cells of the invention or specifically differentiated mammalian kidney- derived cell populations derived from cells of the invention for therapy comprising administering the cells to an individual in need thereof.
  • Cells of the invention or differentiated cells derived from mammalian kidney- derived cells of the invention can be used to treat disorders involving tubular, vascular, interstitial, or glomerular structures of the kidney.
  • the cells can be used to treat diseases of the glomerular basement membrane such as Alports Syndrome; tubular transport disorders such as Bartter syndrome, cystinuria or nephrogenic diabetes insipidus; progressive kidney diseases of varied etiologies such as diabetic nephropathy or glomerulonephritis; Fabry disease, hyperoxaluria, and to accelerate recovery from acute tubular necrosis.
  • diseases of the glomerular basement membrane such as Alports Syndrome
  • tubular transport disorders such as Bartter syndrome, cystinuria or nephrogenic diabetes insipidus
  • progressive kidney diseases of varied etiologies such as diabetic nephropathy or glomerulonephritis
  • Fabry disease hyperoxaluria
  • the cells can also be used to treat disorders such as acute kidney failure, acute nephritic syndrome, analgesic nephropathy, atheroembolic renal disease, chronic kidney failure, chronic nephritis, congenital nephrotic syndrome, end-stage renal disease, Goodpasture's syndrome, IgM mesangial proliferative glomerulonephritis, interstitial nephritis, kidney cancer, renal cancer, hypernephroma; adenocarcinoma of renal cells, kidney damage, kidney infection, kidney injury, kidney stones, lupus nephritis, membranoproliferative GN I, membranoproliferative GN II, membranous nephro athy, minimal change disease, necrotizing glomerulonephritis,
  • disorders such as acute kidney failure, acute nephritic syndrome, analgesic nephropathy, atheroembolic renal disease, chronic kidney failure
  • nephroblastoma nephrocalcinosis, nephrogenic diabetes insipidus, nephropathy - IgA, nephrosis (nephrotic syndrome), polycystic kidney disease, poststreptococcal GN, reflux nephropathy, renal artery embolism, renal artery stenosis, renal disorders, renal papillary necrosis, renal tubular acidosis type I, renal tubular acidosis type II, renal underperfusion, renal vein thrombosis, focal segmental glomerulosclerosis (FSGS), ANCA vasculitis with renal involvement, renal limited vasculitis, ANCA glomerulonephritis, renal trombotic microangiopathy (TMA), and kidney transplantation related: hyper acute rejection, acute rejection, subacute rejection or chronic allograft nephropathy/IFTA (interstitial fibrosis and tubular atrophy).
  • IFTA interstitial fibrosis and tubular atrophy
  • Ex-vivo perfusion is an emerging technology that holds the potential for organ resuscitation and reconditioning, potentially increasing the quality and number of organs available for transplantation.
  • the present invention provides improved means and methods for perfusing organs. The means and methods allow for improved quality of transplantation organs subsequent to perfusion and even render at least some organs that would otherwise have been discarded for quality reasons suitable for transplantation.
  • Flow and pressure-based machine perfusion has shown improved kidney graft function and survival, especially among expanded criteria donors.
  • Perfusion and in particular pressure-based machine transfusion is demonstrating promising results in preservation and resuscitation of kidney, liver, pancreas, heart, and also lung grafts.
  • the Food and Drug Administration approved of XPS XVIVO Perfusion System (XVIVO Perfusion Inc., Englewood, Colorado, USA), a device for preserving and resuscitating lung allografts initially considered unsuitable for
  • the perfusion fluid is changed to conditioned medium (defined elsewhere herein), or conditioned medium is added to the perfusion fluid. This improves preservation of the organ. This also improves the quality of the organ for transplantation, at least in part by facilitating epithelial repair in the organ..
  • the invention provides a medium conditioned by cultured perivascular stromal cells (conditioned medium) wherein the medium is obtained by preparing a suspension of a mammalian kidney or part thereof; culturing cells of the suspension in the presence of a cell culture surface for adherent cells; producing a single cell suspension from cells that adhered to the cell culture surface; collecting Chondroitin Sulfate Proteoglycan 4 (CSPG4) positive cells from said single cells suspension and culturing collected CSPG4 positive cells in the presence of a cell culture surface for adherent cells and a medium and harvesting the medium of the culture to obtain the conditioned medium.
  • the conditioned medium is preferably a medium conditioned by kidney- derived cells according to the invention.
  • the medium preferably comprises hepatocyte growth factor (HGF).
  • the medium to be conditioned by the perivascular stromal cells can be AMEM or DMEM supplemented with 10% normal human serum or 5% human platelet lysates. Synthetic, Xeno-free or serum-free media are also available.
  • An example of a suitable medium is StemMACSTM MSC Expansion Medium from Milteyni.
  • the medium is preferably placed over confluent or semi-confluent cultures of perivascular stromal cells and incubated. The incubation is typically 24 hours or less. A suitable incubation period is 4-6 hours.
  • the medium is typically collected by filtration of the supernatant of the cells (suitable a 0,45 uM or 0,22 uM filter). The collected medium can be processed to remove nutrients and waste if needed.
  • Hepatocyte growth factor/scatter factor is a paracrine cellular growth, motility and morphogenic factor. It is secreted by mesenchymal cells and targets and acts primarily upon epithelial cells and endothelial cells, but also acts on haemopoietic progenitor cells and T cells. It has been shown to have a major role in embryonic organ development, specifically in myogenesis, in adult organ regeneration and in wound healing.
  • Medium of the present invention can be, (ultra)-filtered, concentrated or diluted to arrive at the conditioned medium of the invention.
  • Conditioned medium of the invention is preferably used to perfuse organs ex-vivo.
  • the medium performs better than standard perfusion fluids.
  • the invention further provides a method of perfusion of an organ with a perfusion fluid wherein the perfusion fluid comprises medium that is conditioned by cultured perivascular stromal cells.
  • the organ is preferably a human organ.
  • the organ is a kidney, liver, pancreas, heart, or lung (or a transplantable part thereof).
  • the heart is herein a muscular organ.
  • the invention further provides a method of improving donor organ quality ex vivo or epithelial repair of an organ ex vivo comprising perfusing the organ with perfusion fluid comprising medium that is conditioned by cultured perivascular stromal cells.
  • the medium is a preferably a conditioned medium of the invention.
  • the invention further provides the use of HGF for improving donor organ quality ex vivo or epithelial repair of an organ ex vivo.
  • Ex-vivo (machine) perfusion of solid organs using a method of the invention provides the opportunity for resuscitation and reconditioning of suboptimal grafts, and expanding the number and quality of donor organs.
  • NG2 is expressed in the human kidney mainly around the arteries, arterioles and afferent and efferent arterioles of the glomerulus.
  • CD271 (B) and PDGFR- ⁇ (C) are also expressed within the glomeruli and around the peritubular capillaries.
  • human kidneys are continuously perfused with digestive enzymes to single kidney cells. Afterwards crude kidney cell suspensions were cultured on plastic for selection on plastic adherence and subsequently sorted for NG2 positivity resulting in the appearance of spindle shaped cells.
  • hkPSCs Characterization of human kPSCs.
  • hkPSCs express type I HLA (H LA-ABC) and are negative for type II HLA (HLA-DR).
  • E) Mean fluorescent intensity of the different markers (n 3 donors.)
  • Fig 3. Transcriptome analysis of human kPSCs compared to bmMSCs.
  • Fig 4. Immunomodulatory and vascular stabilization function of hkPSCs
  • PBMCs peripheral blood mononuclear cells
  • ratio is number of activated PBMCs vs number of MSCs
  • C When HUVECs are cocultured with either hkPSCs and bmMSCs endothelial networks were formed, which was not observed in monoculture. There were no significant differences in vascular plexus formation comparing coculture with bmMSCs or hkPSCs (D).
  • Fig. 5 hkPSCs are able to enhance epithelial repair in a wound scratch assay.
  • A) Brightfield images showing representative images of the wound scratch assay in control medium or conditioned medium of hkPSCs and bmMSCs across a time period of 14 hours.
  • C)Excretion of growth factors in the conditioned medium. HGF is excreted by hkPSCs but not by bmMSCs. n 3 biological triplicates. * p ⁇ 0.05, ** pO.001, *** pO.0001
  • hkPSCs are able to survive and integrate into the kidney interstitium in a neonatal injection method.
  • D) No bmMSCs could be found in the kidney 4 days after injection.
  • NG2 is increased in kPSCs compared to bmMSCs while pax2 and CD24 are negative.
  • CD24 is also not observed on protein level as shown by facs histogram (b). This, in combination with the lack of adipocyte differentiation, suggests that kPSCs are a different cell type compared to previously described kidney pericytes and kidney MSC.
  • Fig. 8 HGF-receptor blocking.
  • HGF-R When the HGF-R is blocked when conditioned medium of kPSC is added to a wound scratch assay, a decrease in wound closure is observed, suggesting that HGF in the conditioned medium of kPSCs is one of the more prominent factors for wound closure in the conditioned medium.
  • Kidneys were flushed with UW cold storage solution (Bridge to life, Elkhorn, Wisconsin, US)) containing heparin (Leo Pharma, Ballerup, Denmark) directly after surgery and stored on ice. Within 30 hours kidneys were flushed again with UW and the perirenal fat and kidney capsule were removed. The renal artery was cannulated and the kidney was perfused via a pump driven (Masterflex Applikon, Schiedam, the Netherlands) recirculation system at 37 degrees with DMEM-F12 (Lonza) at 300ml/min. .
  • kidney was perfused with collagenase (2500 units, NB1, Serva) and DNAse (2,5 ml Pulmozyme, Genentech) at 37°C with a flow of 300ml/min. After approximately 30 minutes, the tissue was digested and the cell suspension was washed in DMEM-F12 containing 10% fetal calf serum. Afterwards the cells were either directly put into culture or frozen in liquid nitrogen.
  • collagenase 2500 units, NB1, Serva
  • DNAse 2,5 ml Pulmozyme, Genentech
  • Kidney cell suspension was cultured in alphaMEM (Lonza, Verviers, Belgium) containing 5% platelet lysates, glutamine (Lonza, Basel, Switzerland) and penicillin/streptomyzine (Lonza) and cells were cultured in tissue culture flasks until confluency was reached. At passage 1 cells were trypsinized and NG2 cell enrichment was performed using MACS according to manufacturer's protocol (Miltenyi Biotech, Gladbach, Germany). Afterwards the NG2 positive selection was cultured in aMEM containing 5% platelet lysate. The cultures were maintained at 37°C and 5% carbon dioxide. Half of the medium was refreshed twice a week.
  • the expanded cell populations were characterized by morphology (spindle shaped cells) which was imaged with an inverted bright-field microscope (Leica DFC 295).
  • morphology spindle shaped cells
  • Leica DFC 295 The expanded cell populations were characterized by morphology (spindle shaped cells) which was imaged with an inverted bright-field microscope (Leica DFC 295).
  • the cells were stained for NG2, PDGFR- ⁇ , CD146, CD73, CD90, CD 105, CD31, CD34, CD45, CD56, HLA class I (ABC) and HLA class II (DR).
  • All specific fluorochrome-labeled antibodies and isotype controls were purchased from BD Bioscience (BD Bioscience, Franklin Lakes, NJ, USA) except for CD 105 (Ancell Corporation, Bayport, MN, USA).
  • GenomeStudio Software (Illumina Inc, San Diego, USA) Genes with a detection p- value of >0.05 for all samples were excluded. Subsequent data was quantile normalized and the Pearsons correlation coefficient was calculated (r 2 ). Differential expression was analyzed using the gene expression module of Genome Studio (Illumina). For the table of the top differential expressed genes, genes with the highest diff. score were sorted on highest fold increase. Average signals>200 in either the bmMSCs or hKPSCs were taken and predicted values and open reading frames were excluded. False discovery rates (FDR) were calculated according to Benjamini and Hochberg for a total number of 8462 transcripts. All genes in the top 5 up- and down- regulated genes showed significant differential expression.
  • FDR False discovery rates
  • the delta average signal of bmMSCs vs hkPSCs was set to 200 (which is the threshold of the measurement) and 2600 genes selected were analysed for clustering in R software. Clustering in R software was also performed for 27 homeobox genes. Expression of HoxDIO and HoxDl l was confirmed by Quantitative real-time polymerase chain reaction (PCR) in duplo of the same biological triplicates by using iQ SYBR Green Supermix on iCycler realtime detection system (BioRad, Veenendaal, the Netherlands). The real-time PCR primers of HoxDIO are AG AC AGTT GG AC AG AT C C G AA(fw) and
  • TCGACCAGTTCTACGAGGCA fw
  • AAAAACT CGCGTTCCAGTTCG rev
  • the amplification reaction volume was 12.5 in total, consisting of 6.25 iQ SYBR Green PCR master mix, 0.5 primers, 2.5 cDNA and 3.25 ⁇ water.
  • the messenger RNA (mRNA) level was normalized to the housekeeping gene glycerine aldehyde-3-phosphate dehydrogenase (GAPDH).
  • hkPSCs and bmMSCs were cultured in adipogenic, osteogenic and chondrogenic medium according to the manufactures protocols (Lonza). After 3 weeks of culture, in the adipogenic differentiation assay lipid droplets were stained using Oil Red O and in the osteogenic differentiation assay calcium depositions were stained with Alizarin Red. For chondrogenic differentiation cell pellets were formalin-fixed (4% PFA O/N) and embedded in paraffin. Subsequently 5 ⁇ sections were de- paraffinized, rehydrated and stained with 1% toluidine blue for 20 min. All differentiation assays were analysed with an inverted bright-field microscope (Leica DFC 295).
  • hkPSCs and bmMSCs of 3 different donors were plated in flat-bottom 96-well plates and after 5 days of culture supernatants were harvested and cytokine expression profiles were determined in the supernatant with the Bio-Plex Human Cytokine 17-Plex Panel following the manufacturer's instructions (Bio-Rad
  • Cytokines in culture medium were also measured as a negative control.
  • PBMCs Peripheral blood mononuclear cells
  • PBMCs Peripheral blood mononuclear cells
  • Cultured hkPSCs and bmMSCs (passage 6-8) of 3 different donors were plated in flat-bottom 96-well plates (Costar, Sigma- Aldrich) and allowed to attach overnight in DMEM-F12 with 10% normal human serum (NHS). Culture in 10% NHS was chosen as platelet lysates are able to suppress PBMC proliferation on their own (data not shown).
  • PBMCs were stimulated with anti-CD3/antiCD28 Dynabeads (Invitrogen) and were seeded in triplicate at a concentration of lxlO 5 cells/well. Stromal cells were added to the PBMC
  • HUVECs Human umbilical vein endothelial cells
  • HUVECs were used at passage 2-3.
  • hkPSCs and bmMSCs of 3 different donors were plated in a density of 200.000 cells/well in a 6 well culture plate (Costar, Sigma-Aldrich) and cultured for 48 hours.
  • HK2 cells were seeded in PTEC medium consisting of a 1: 1 ratio of
  • Dulbecco's modified Eagle's medium and Ham's F-12 (Seromed Biochem, Berlin, Germany) supplemented with insulin (5 ⁇ g/ml), transferrin (5 ⁇ g/ml), selenium (5ng/ml), hydrocortisone (36 ng/ml), tr-iodothyrinine (40 pg/ml) and epidermal growth factor (10 ng/ml) (Sigma-Aldrich) in a density of 500.000 cells/well in a 6 wells cell culture plate (Costar) and cultured until confluent.
  • a scratch wound was created in the monolayer of HK2 cells using a 200 ⁇ 1 pipette tip. After the scratch, cells were washed with PBS and provided either with fresh medium (aMEM 5% PL) or with complete conditioned medium from either hkPSCs or bmMSCs.
  • Neonatal injection model Growth factors in the conditioned medium of kPSCs were measured using a custom made growth factor panel following manufacturer's instruction. (R&D systems, Minneapolis, USA). Neonatal injection model
  • Neonates of outbred CD1 mice were used for neonatal injection.
  • hkPSCs and bmMSCs of resp. 3 and 2 different donors were injected into the neonatal kidneys at postnatal day 1 (PND1) using a microinjection pipet in a protocol adapted from the protocol previously described [13].
  • PND1 postnatal day 1
  • neonates were anesthetized and a small incision in the skin was made.
  • Cells were re-suspended in PBS and mixed with Fluoresbrite Yellow Green microspheres (2.0 ⁇ ; Polyscience) in a ratio of 1:50 for identification of injection sites in the neonatal kidney.
  • kidneys were injected into the kidney through the muscle layer in a volume of 300nl, corresponding with 3000-5000 cells. Kidneys were harvested at 4 days post-injection. In total 7 mice were analyzed; 3 different mice with hkPSCs from 3 different donors; 3 mice with bmMSCs from 2 different donors and 1 sham operated mouse. In all mice, injection into the kidney was confirmed by fluorescence of the co-injected microspheres.
  • kidney samples were fixed in 4% PFA followed by 30% sucrose overnight and embedded in TissueTek OCT compound (Sakura).
  • Finetek, Torrance, CA Finetek, Torrance, CA. Samples were frozen in liquid nitrogen and stored at -80°C. Ten micrometer thick sections were cut and post-fixed with 4% PFA for 10 minutes at room temperature. Stainings were performed using manufacturer's protocol of the Mouse on Mouse (MOM) kit (Vector labs, Brunswig Chemie, Amsterdam, the Netherlands). Samples were stained with antibodies against human mitochondria and nuclei (Abeam, Cambridge, UK).
  • MOM Mouse on Mouse
  • NG2 Perivascular stromal cells were isolated based on NG2 expression.
  • NG2 is an integral membrane proteoglycan which is associated with perivascular cells during vascular morphogenesis.
  • Fig la Within the human kidney, NG2 is mainly expressed around the large arteries and the afferent and efferent arteriole (Fig la). NG2 expression differs from and is more restricted compared to the expression of CD271, an enrichment marker for bmMSCs [18] (Fig lb) or PDGFR- ⁇ positive perivascular cells (Fig lc). These markers are in the kidney also expressed within the glomeruli and around the peritubular capillaries. NG2 positive cells were isolated from a pool of ten transplant-grade kidneys discarded for surgical reasons.
  • NG2 positive hkPSCs showed a bright field morphology similar to bmMSCs (Fig 2a) and, like bmMSCs, were positive for the pericyte markers NG2 and PDGFR- ⁇ as shown with confocal microscopy (Fig 2b).
  • Fig 2c Population doublings are shown from flow cytometry confirmed NG2 homogeneous populations, at around passage 9 hkPSCs reached senescence (Fig 2c).
  • NG2 hkPSCs were positive for the surface markers PDGFR- ⁇ , CD 146, CD73, CD90, CD 105 while being negative for CD31, CD34, CD45 and CD56, as determined by FACS (Fig 2d).
  • Illumina microarray expression profiling was performed on biological triplicates of different donors. Analysis of expression levels of 35000 transcripts showed that most genes have a similar expression level as depicted by the Pearson correlation coefficient of 0,9625 representing a high similarity between the cell types (Fig 3a). However, 2600 genes were differentially expressed and hierarchical clustering showed clustering of the biological triplicates according to cell source (Fig 3b). Table 1 shows the top 5 up and down regulated genes comparing bmMSCs and hkPSCs based on differential p- value. Interestingly, homeobox factor HoxDl l is in the top 5 most upregulated genes in hkPSCs.
  • MSCs are able to regulate proliferation and cytotoxicity of T cells, macrophages and B-cells which are also major players in kidney disease and transplantation as reviewed elsewhere. [21] Therefore, we evaluated the immunomodulatory potential of hkPSCs in comparison to bmMSCs. Unstimulated human kPSCs and bmMSCs showed a similar expression profile for all major cytokines (Fig. 4a). We also evaluated the immunosuppressive capacity of hkPSCs.
  • PBMC peripheral blood mononuclear cell
  • HUVECs human umbilical vein endothelial cells
  • hkPSCs In order to evaluate the effect of hkPSCs on renal tubular epitheliar repair, a scratch in a monolayer of human kidney proximal tubular epithelial cells (HK2) was made. Under control culture conditions, at least 28 hours was necessary for 80% wound closure. Interestingly, when conditioned media from hkPSCs was added, significant closure was already observed after 4 hours with 80% of the wound closed after 7 hours (mean of duplicate experiments from three different donors). Importantly, 14 hours was required to reach an 80% wound closure in parallel experiments with the conditioned media from bmMSCs, (Fig 5a,b).
  • hkPSCs can produce factors able to better support renal epithelial repair of which HGF is most likely an important factor as HGF was secreted in high levels by hkPSCs but not by bmMSCs while no differences were observed in other growth factors as PDGF-AA, PDGF-BB, endothelinl, FGF-a and FGF-B (Fig 5c).
  • PDGF-AA, PDGF-BB, endothelinl, FGF-a and FGF-B Fig 5c.
  • hkPSCs were injected into neonatal mice at postnatal day 1 using a microinjection technique (Fig 6a,b).
  • human kPSCS were able to integrate and survive the cortical, but not the medullary, interstitium of the mouse kidney with no evidence for rejection as shown with human specific antibodies (Fig. 6c).
  • Fig. 6d No such persistence was observed when human bmMSCs were injected (Fig 6d), as is consistent with our previous studies examining the fate of murine bmMSCs after neonatal injection into the kidney.
  • No integration into tubular structures was seen with either human bmMSCs or hkPSCs upon injection.
  • the persistence of viable human hkPSCs for 4 days within the renal interstitium suggests a differential capacity for this stromal cell type in terms of tissue damage and repair.
  • MSCs Mesenchymal stromal cells
  • bmMSCs are immune modulatory and anti-fibrotic cells originally isolated from the bone marrow (bmMSCs) and are characterized by their spindle shaped morphology and ability to adhere to plastic.
  • bmMSCs are able to differentiate into fat, bone and cartilage and express the stromal markers CD 73, CD90 and CD 105 while being negative for CD34 and CD45.
  • perivascular stromal cells with characteristics similar to bmMSCs exist within many different solid organs, including skeletal muscle, pancreas, adipose tissue and placenta. They are characterized by their expression of NG2, PDGFR- ⁇ and CD 146 exhibit MSC-like cell surface and functional characteristics. [10] Due to the perivascular location of these cells, close interaction is possible with several cell types, including endothelial cells, epithelial cells, resident macrophages, dendritic cells and recruited inflammatory cells.
  • MSC-like cells could also be isolated from murine kidneys (kCFU-F). Although these kCFU-F have a comparable stromal marker expression and trilineage differentiation potential compared to bmMSCs, there is a distinct gene and protein expression profile. [12] This suggests that although kCFU-F and bmMSCs may look similar, functionally there may be differences. Li et al. showed that these cells are indeed different from bmMSCs. In particular the cell fraction isolated based on HoxB7, a collecting duct marker, was able to integrate into the collecting duct in neonatal mice upon delivery while bmMSCs lacked this capacity. [13]
  • perivascular stromal cells from several different human organs share features with MSCs.[10] More recently it has been shown that organ derived perivascular cells may exhibit tissue-specific functions. Human myocardial perivascular cells, for example, could stimulate angiogenic responses under hypoxia and differentiate into cardiomyocytes in vivo;
  • the ISCT has proposed criteria to define MSC's. These include plastic adherence, the marker expression of CD73, CD90 and CD 105 while being negative for CD 14, CD34 and CD45 and the capacity to differentiate into bone, cartilage and fat in vitro [1].
  • the hkPSCs we isolated did not fulfill these criteria as there was no adipocyte differentiation. However, these criteria are based on bone marrow-derived MSCs and the lack of this capacity might actually be beneficial as it has previously been shown that MSCs injected into the renal artery in a glomerulonephritis model can turn into adipocytes in the glomeruli accompanied by glomerular sclerosis around these adipocytes. [23]
  • MSCs are important for tissue homeostasis most likely via the secretion of several soluble factors and microvesicles containing amongst others mRNAs and miRNAs.[24, 25] Indeed, bmMSC-conditioned medium is able to accelerate wound healing in vitro. [26, 27] In a mouse model of acute kidney injury the enhanced recovery in kidney function was similar when MSCs or MSC-derived microvesicles were injected. [24] The same is most likely true for organ-derived perivascular stromal cells. Conditioned medium from murine kidney MSC-like cells was able to enhance kidney epithelial wound healing in an in vitro wound scratch assay.
  • HGF hepatic growth factor
  • HGF has a beneficial effect on renal epithelial cells as it can prevent tubular epithelial cell death both in vitro and in vivo, in the latter resulting in an improved renal function after acute kidney injury.
  • HGF is most likely also important in human kidney regeneration as a high expression of HGF in protocol biopsies after kidney transplantation correlated with lower levels of fibrosis.
  • the differences between the human kPSCs of the present invention and bmMSCs mentioned above may reflect differences in memory of tissue origin or even differences in location within a tissue. Tissue origin differences were previously also observed for fibroblasts isolated from different organs. [33] In the current study, the expression profile of homeobox genes, which are important for
  • HoxlO and Hoxll are crucial for nephrogenesis.
  • HoxlO genes function in the differentiation and integration of the FoxDl+ renal cortical stroma while Hoxl l genes are expressed in the metanephric mesenchyme. Loss of either HoxlO or Hoxl l gene function results in the loss of ureteric bud induction, reduced branching and decreased nephrogenesis; phenotypes only described for HoxlO and 11 mutants and not for other Hox mutants.
  • This potential tissue 'memory of origin' may relate to the observed differences in potential to integrate back into the kidney when injected into the renal parenchyma.
  • Such integration was never observed for the bone marrow MSCs, while the hkPSCs of the present invention migrated into the renal interstitium and survived. While we observed integration into the cortical interstitial compartment, we did not observe any integration into the epithelium.
  • murine kidney-derived MSC like cells can integrate into the developing collecting duct.
  • the human kPSCs were isolated from the perivascular fraction based on NG2 expression, while Li. et al isolated murine MSC-like cells based on HoxB7 expression thus the collecting duct epithelial compartment.
  • the kPSCs of the present invention are more suitable for cell therapy for at least kidney diseases compared to bmMSCs, which are currently studied in clinical trials. Their capacity to reintegrate into the renal stroma and to improve tubular epithelial wound repair would suggest that they may have a specific role in maintaining and restoring renal interstitial homeostasis.
  • SOP standard operation procedure
  • fibronectin type III FNDC1 12278 189 (50) -65, 1 -256,5 domain containing 1 (1828)
  • Table 1 Top 5 differentially expressed genes comparing bmMSCs to hkPSCs.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

L'invention concerne entre autres des moyens et des procédés de culture de cellules rénales de mammifère. Selon certains aspects, le procédé consiste à utiliser une suspension de cellules d'un rein de mammifère ou d'une partie de celui-ci ; à cultiver les cellules de ladite suspension dans une surface de culture de cellules adhérentes ; à produire une suspension de cellules isolées à partir des cellules adhérentes à ladite surface de culture de cellules et à collecter les cellules positives au protéoglycane 4 à base de sulfate de chondroïtine (CSPG4) à partir de ladite suspension de cellules isolées. Ces cellules peuvent ensuite être cultivées dans une boîte de Pétri pour cellules adhérentes. Les cellules présentent des propriétés analogues à celles des cellules stromales mésenchymateuses mais sont distinctes en ce qu'elles ne partagent pas toutes ces propriétés. L'invention concerne également des utilisations et des procédés avec lesdites cellules.
EP16744562.6A 2015-05-20 2016-05-20 Collections de cellules rénales primaires, procédé d'isolement et utilisations associées Withdrawn EP3298128A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP15168500 2015-05-20
EP15168450 2015-05-20
PCT/NL2016/050364 WO2016186506A1 (fr) 2015-05-20 2016-05-20 Collections de cellules rénales primaires, procédé d'isolement et utilisations associées

Publications (1)

Publication Number Publication Date
EP3298128A1 true EP3298128A1 (fr) 2018-03-28

Family

ID=56550945

Family Applications (1)

Application Number Title Priority Date Filing Date
EP16744562.6A Withdrawn EP3298128A1 (fr) 2015-05-20 2016-05-20 Collections de cellules rénales primaires, procédé d'isolement et utilisations associées

Country Status (2)

Country Link
EP (1) EP3298128A1 (fr)
WO (1) WO2016186506A1 (fr)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113274411A (zh) * 2021-04-21 2021-08-20 西安市第一医院 经基因修饰的骨髓间充质干细胞来源的微囊泡在制备治疗肾损伤药物中的应用
CN113265371B (zh) * 2021-05-17 2023-09-15 山西省人民医院 一种高效人肾脏单细胞悬液制备方法
CN116814543A (zh) * 2023-07-10 2023-09-29 中国人民解放军陆军军医大学第一附属医院 一种从间充质干细胞中分离纯化得到的高活性亚群细胞及其方法和应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014018230A2 (fr) * 2012-07-25 2014-01-30 Albert Einstein College Of Medicine Of Yeshiva University Procédés pour isoler des cellules souches mésenchymateuses humaines

Also Published As

Publication number Publication date
WO2016186506A1 (fr) 2016-11-24

Similar Documents

Publication Publication Date Title
US11926848B2 (en) Stromal stem cells
Raynaud et al. Comprehensive characterization of mesenchymal stem cells from human placenta and fetal membrane and their response to osteoactivin stimulation
EP2994528B1 (fr) Organoïdes comprenant des cellules rénales isolées et leurs utilisations
Leuning et al. Clinical-grade isolated human kidney perivascular stromal cells as an organotypic cell source for kidney regenerative medicine
US20120107413A1 (en) Pre-natal mesenchymal stem cells
AU2018200619B9 (en) Improved stem cell composition
Dromard et al. Human adipose derived stroma/stem cells grow in serum-free medium as floating spheres
JP2022527998A (ja) 高機能な製造されたａｂｃｂ５＋間葉系幹細胞
US8771677B2 (en) Colony-forming unit cell of human chorion and method to obtain and use thereof
CN111019894A (zh) 用于治疗血液病症的富集和扩增的人脐带血干细胞
Antoninus et al. Human platelet lysate enhances the proliferation of Wharton's jelly-derived mesenchymal stem cells
WO2018187439A1 (fr) Procédé de cryoconservation
WO2016186506A1 (fr) Collections de cellules rénales primaires, procédé d'isolement et utilisations associées
Borkar et al. Human ESC-derived MSCs enhance fat engraftment by promoting adipocyte reaggregation, secreting CCL2 and mobilizing macrophages
Maerz et al. Bone marrow-derived mesenchymal stromal cells differ in their attachment to fibronectin-derived peptides from term placenta-derived mesenchymal stromal cells
US20150093447A1 (en) Stem cell identification and purification method
WO2017094879A1 (fr) Procédé de production de cellules souches mésenchymateuses
Ishii et al. Technical advantage of recombinant collagenase for isolation of muscle stem cells
US20150258147A1 (en) Isolated cardiac stem cells and methods of their use
Semenova et al. Banking of AT-MSC and its influence on their application to clinical procedures
WO2021067421A1 (fr) Préparation de cellules souches mésenchymateuses humaines thérapeutiquement améliorées et leurs utilisations
LEUNING et al. TISSUE-SPECIFIC PROGENITOR AND STEM CELLS
Juntunen Development of Adipose-Derived Stromal/stem Cell–Based Therapies: Effects of donor weight and culture conditions on cell characteristics and testing the efficacy in stroke models
Farrar Characterisation and Analysis of Human Umbilical Cord Perivascular Cells
Pellegrini Myoblast Transplantation: Murine Studies

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20171218

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20180810