EP3256253A1

EP3256253A1 - Paper device for genetic diagnosis

Info

Publication number: EP3256253A1
Application number: EP16705099.6A
Authority: EP
Inventors: Laura MAGRO; Pierre Lafaye; Fabrice Monti; Patrick Tabeling; Jean-Claude Manuguerra; Jessica VANHOMWEGEN; Béatrice JACQUELIN; Anavaj SAKUNTHABHAI
Original assignee: Centre National de la Recherche Scientifique CNRS; Institut Pasteur de Lille; Ecole Superieure de Physique et Chimie Industrielles de Ville Paris
Current assignee: Centre National de la Recherche Scientifique CNRS; Institut Pasteur de Lille; Ecole Superieure de Physique et Chimie Industrielles de Ville Paris
Priority date: 2015-02-13
Filing date: 2016-02-12
Publication date: 2017-12-20
Also published as: WO2016128570A1; US20180245144A1

Abstract

The present invention concerns devices for diagnosis by DNA amplification and more particularly a device characterised in that it comprises: - a porous substrate comprising at least: • an area for depositing a sample, said sample comprising at least one target compound; • a plurality of channels positioned in the thickness of said porous substrate; • an area, referred to as the "diagnostic area", comprising at least one reactive compound suitable for reacting with a so-called target compound; • an area for depositing a carrier fluid suitable for being transported by capillarity into all of said areas and said channels: each of said areas being linked to the others by at least one element chosen from a channel and an area, - a means for locally conditioning the temperature of the diagnostic area.

Description

Paper device for genetic diagnosis

The invention relates to diagnostic devices by amplification of DNA. It applies, in particular, to the diagnosis of microorganisms, from a biological sample such as drops of blood, urine, saliva and sweat.

In the field of medical diagnosis, there are, among other things, two families of biological tests. On the one hand, immunoassay (immunoassay), which includes "enzyme immunoassay" and abbreviated enzyme-linked immunosorbent assay (ELISA), translated as "bound enzyme immunoadsorption assay", have been for the purpose of detecting the presence of an antibody or an antigen in a sample. The formation and spatial localization of the antibody-antigen complex is detectable by several techniques: grafting of colored or fluorescent species, nanoparticles and enzymes, for example. The signal characterizing the presence of the desired species can be detected in the eye or by spectroscopy. This family includes dipstick, dipstick or lateral flow test (translated as "lateral flow test") tests. These Point-of-Care tests (translated as "at the bedside") are very suitable for field situations with little material available. But the diagnosis by immunological tests is limited to detect species involved in antibody-antigen complexes. For example, in the case of a microorganism, the detection is indirect: the immunological tests make it possible to detect the presence or absence of characteristic proteins or antibodies produced by the immunocompetent cells of the host infected with the microorganism (s). .

On the other hand, DNA amplification tests make it possible to recognize and multiply a specific DNA or RNA sequence. In the case of a microorganism, the DNA amplification test is more direct: we recognize the genetic material of the desired species. But these tests require expensive equipment and know-how to be implemented. These tests do not allow for bedside tests, particularly in remote geographical areas. For all these reasons, these DNA amplification tests do not make it possible to quickly and inexpensively carry out diagnostics outside the laboratories.

The subject of the present invention is a diagnosis device by amplification of DNA, characterized in that it comprises:

a porous substrate comprising at least:

A sample deposition zone, said sample comprising at least one target compound;

A plurality of channels positioned in the thickness of said porous substrate;

• an area, called "diagnostic zone", comprising at least one reactive compound adapted to react with a said target compound;

A deposition zone of a vector fluid adapted to be transported by capillarity in all of said zones and said channels: each of said zones being connected to the others by at least one element chosen from a channel and a zone,

a means of local conditioning of the temperature of the diagnostic zone.

Advantageously, the reactive compounds of said device comprise at least primers, recombinases, polymerases and proteins fixing and maintaining the single-stranded DNA, said reactive compounds being arranged in the pores of said zones of said porous substrate.

Advantageously, said primers of the device are adapted to detect the presence of a pathogen by RT-RPA.

Advantageously, said pathogen is the Ebola virus. Advantageously, at least one said reactive compound is arranged in or on said porous substrate in freeze-dried form.

Advantageously, said porous substrate of the device comprises a stack of at least two primary porous substrates, each said primary porous substrate comprising at least one element chosen from a channel, a channel part and a zone.

Advantageously, said stack of said primary porous substrates of the device is obtained by folding.

Advantageously, the device comprises at least one additional zone comprising at least one reactive compound of the diagnostic zone connected to the deposition zone of a vector fluid by a succession of at least one element chosen from a channel and a different zone of a sample deposit area.

Advantageously, a said compound of the device chosen from a reactive compound and a target compound is arranged in or on said porous substrate in freeze-dried form.

Advantageously, the device comprises at least one additional zone comprising at least one said reactive compound, and at least one target compound, connected to the deposition zone of a vector fluid by a succession of at least one element chosen from a channel and a different zone from a sample deposit area.

Advantageously, the device comprises means for locally conditioning the temperature of the sample deposition zone.

Advantageously, said porous substrate of the device comprises at least one sheet of paper. Advantageously, said local temperature conditioning means of the device comprises a conductive electrical circuit facing said porous substrate.

Advantageously, the device comprises:

a support layer of the conductive electrical circuit and

a sealed layer, the impervious layer being positioned in an intermediate manner between the porous substrate and the support layer.

Advantageously, said conductive electrical circuit of the device is supported by a sheet of paper distinct from said porous substrate.

Advantageously, at least one channel of the device is delimited by regions of said porous substrate impregnated with solid wax.

Advantageously, at least one channel of the device is formed by a hydrophilic-hydrophobic contrast in the thickness of said porous substrate.

Advantageously, said local temperature conditioning means of the device is configured to set the temperature of at least one zone between 20 ° C and 120 ° C and preferably between 30 ° C and 40 ° C.

Advantageously, at least one said reactive compound of the device is adapted to change color in contact with a said target compound.

Advantageously, at least one said reactive compound of the device is adapted to emit a fluorescence signal in contact with a said target compound.

Advantageously, said reactive compounds of the device comprise at least one pair of said primers selected from the group consisting of SEQ ID NO: 1-2; SEQ ID NO: 4-5; and SEQ ID NO: 7-8. Advantageously, said reactive compounds of the device comprise at least one nucleotide probe selected from the group consisting of SEQ ID NO: 3, 6, 9, 13, 14 and 15. Advantageously, said reactive compounds of the device comprise at least one oligonucleotide composition comprising a pair of primers and a probe, selected from the group consisting of a pair of primers of sequence SEQ ID NO: 1-2 and a nucleotide probe of sequence SEQ ID NO: 3; a pair of primers of sequence SEQ ID NO: 4-5 and a nucleotide probe of sequence SEQ ID NO: 6; and a pair of sequence primers of SEQ ID NO: 7-8 and a nucleotide probe of sequence SEQ ID NO: 9.

Another object of the invention is an RNA detection method comprising at least the steps of:

depositing a said sample on at least one said sample deposition zone of a said device;

bringing into contact a said vector fluid with said vector fluid deposition zone of said device;

conditioning a stationary temperature of at least one said diagnostic zone so as to initiate a reverse transcription of RNA and to amplify a previously selected nucleotide sequence, and in an isothermal manner;

- examining said diagnostic areas to determine the presence or absence of a said target compound.

Advantageously, the third step of the method comprises an amplification of nucleotide sequence by RT-RPA (reverse transcription and amplification by polymerase assisted recombinases). Another object of the invention is a primer pair selected from the group consisting of SEQ ID NO: 1-2; SEQ ID NO: 4-5; and SEQ ID NO: 7-8.

Another object of the invention is a nucleotide probe selected from the group consisting of SEQ ID NO: 3, 6, 9, 13, 14 and 15. Another subject of the invention is an oligonucleotide composition comprising a pair of primers and a probe, selected from the group consisting of a pair of primers of sequence SEQ ID NO: 1-2 and a nucleotide probe of sequence SEQ ID NO: 3; a pair of primers of sequence SEQ ID NO: 4-5 and a nucleotide probe of sequence SEQ ID NO: 6; and a pair of sequence primers of SEQ ID NO: 7-8 and a nucleotide probe of sequence SEQ ID NO: 9. Another object of the invention is a method of manufacturing a device comprising at least the steps of at :

forming zones and channels in a said porous substrate by heating said porous substrate for at least one minute at a temperature greater than or equal to 100 ° C. and preferably greater than or equal to 150 ° C .;

depositing on an area of said porous substrate at least one element selected from reactive compounds and target compounds diluted in an aqueous solution conditioned at a temperature of between 0 ° C. and 10 ° C., and freeze-drying them;

sealing said porous substrate in a plastic sheet.

The invention will be better understood and other advantages, details and characteristics thereof will become apparent in the following explanatory description, given by way of example with reference to the accompanying drawings, in which: FIG. 1 schematically illustrates and illustrates perspective an embodiment of the device according to the invention;

FIG. 2 illustrates a particular embodiment of the local temperature conditioning means and the support layer according to the invention;

FIG. 3 illustrates a device according to the invention assembled to perform a diagnosis; FIG. 4 illustrates a logic diagram of steps of the method which is the subject of the invention;

FIG. 5 illustrates an embodiment of the device according to the invention; FIG. 6 illustrates a particular embodiment of the device according to the invention;

FIG. 7 illustrates a particular embodiment of the device 60 according to the invention;

FIG. 8 illustrates a particular embodiment of the device 50 according to the invention;

Figure 9 illustrates several embodiments of the device according to the invention;

FIG. 10 illustrates an embodiment of the device according to the invention; Figure 11 illustrates a general method of amplifying DNA on a paper substrate;

FIG. 12 illustrates a paper device adapted to perform an RT-RPA type amplification reaction according to one embodiment of the invention;

FIG. 13 illustrates a different paper device of the invention and local temperature conditioning means according to one embodiment of the invention;

FIG. 14 illustrates the dependence of the material of the zones or channels in contact with the reactive compounds of the RT-RPA on the result of an amplification reaction;

Figure 15 illustrates the influence of a paper substrate on fluorescence signal kinetics emitted during RT-RPA;

FIG. 16 illustrates the influence of wax or PDMS barriers, serum and lyophilization of the RNA target compound on the fluorescence signal kinetics emitted during RT-RPA on paper;

Figure 17 illustrates the preservation of a RT-RPA amplification device on paper;

Figure 18 illustrates the dependence between the amount of reactive compounds deposited on the paper substrate and the geometry of the substrates considered;

FIG. 19 illustrates the flows in a device according to the invention; FIG. 20 illustrates the flows in a device according to the invention; Figure 21 illustrates an RNA detection of an Ebola virus; FIG. 22 illustrates the dependence of the conditioning of the reactive compounds and the target compounds 920 on the fluorescence emission kinetics of an RT-RPA;

FIG. 23 illustrates the dependence of the conditioning of the reactive compounds and the target compounds 920 on the fluorescence emission kinetics of an RT-RPA;

Figure 24 illustrates tests leading to the choice of primers; FIG. 25 illustrates tests leading to the choice of the primers;

Figure 26 illustrates the effect of lyophilization of target compounds 920 and an RNAse inhibitor on a RT-RPA reaction on paper.

The following description presents several embodiments of the device of the invention: these examples are non-limiting of the scope of the invention. These exemplary embodiments have both the essential characteristics of the invention as well as additional features related to the embodiments considered. For the sake of clarity, the same elements will bear the same references in the different figures.

Figure 1 illustrates schematically and in perspective an embodiment of the device 10 object of the present invention. This diagnostic amplification device 10 comprises:

a porous substrate 105 comprising:

Zone 1 comprising at least one reactive compound 1 reacting with a target compound 120 of a sample, called the "diagnostic zone";

A region 125 for deposition of vector fluid transported, by capillarity, in a zone 130 of sample deposition and in the zone 1 of diagnosis;

The sample deposition zone 130, positioned between the vector fluid deposition zone 125 and the diagnostic zone 1, which comprises a compound 145 for preparing the sample by chemical lysis of the cells;

two channels, 135 and 140, positioned in the thickness of the porous substrate, respectively between, on the one hand, the vector fluid deposition zone 125 and the sample deposition zone 130, on the other hand, the zone 130 sample deposition and diagnostic zone 1;

an additional zone 155 comprising at least one reactive compound of the diagnostic zone 1 connected via a channel 160 to the deposition zone 125 of a vector fluid, and

an additional zone 165 comprising at least one reactive compound 1 of the diagnostic zone 1, and at least one target compound 120 connected via a channel 170 to the zone 125 for depositing a vector fluid;

means 205 for local conditioning of the temperature of the diagnostic zone 1 10 and additional zones 155 and 165 of additional control;

means 150 for locally conditioning the temperature of the sample deposit zone 130;

a layer 210 for supporting the conductive electrical circuit; and

a sealed layer 215, the sealed layer 215 being positioned between the porous substrate 105 and the support layer 210.

In particular, FIG. 1 shows the porous substrate 105 implemented by the device 10. This porous substrate 105 is, for example, a sheet of paper made from cellulose fibers, nitrocellulose membranes or filter paper. constituting a porous medium capable of allowing the passage of a vector fluid. In contact with the porous substrate 105, a droplet (for example of water, blood or buffer solution) diffuses on the surface and in the thickness of the porous substrate 105 around the point of contact between the droplet and the porous substrate 105. to channel the flow of the drops in this porous substrate 105, a set of zones and channels is defined in the porous substrate 105. These zones and channels are delimited by barriers passing through the porous substrate 105 in thickness. These barriers are formed, for example: by depositing molten wax penetrating into the thickness of the porous substrate and then solidified (the solid wax impregnating portions of a porous substrate 105 may delimit one or more channels);

by a hydrophilic-hydrophobic contrast in the thickness of the porous substrate

105;

- by laser cutting;

by crosslinking of polymers and / or

by photolithography in the thickness of the porous substrate 105.

A "zone" is a closed volume of the porous substrate 105 having at least one opening and "channel" a conduit connecting at least two zone openings.

The device 10 implements several zones in the porous substrate 105: a zone, called diagnostic zone 1 10, comprises at least one reactive compound 1 that reacts with a target compound 120. For example, a mixture of reactive compounds 1 15 is formed of an enzyme, a mixture of the four deoxyribonucleotides and a selection of primers allowing the realization of a DNA amplification technique among:

- PCR ("Polymerase Chain Reaction", translated into French by "Polymerase Chain Amplification" or PCR), RT-PCR ("Reverse Transcriptase - PCR", translated into French as "PCR after reverse transcription") and its derivatives;

- LAMP ("Loop-mediated isothermal amplification", translated in French by "Isothermal amplification by loop structures") and RT-LAMP ("Reverse transcription - LAMP", translated into French by "LAMP after reverse transcription");

- RPA ("Recombinase polymerase amplification", translated in French by "polymerase amplification, assisted by recombinases") and RT-RPA ("Reverse transcription - RPA", translated into French by "RPA after reverse transcription"); SDA ("Strand displacement amplification") and RT-SDA ("Reverse transcription-SDA", translated into French as "SDA after reverse transcription")

^" );

- HDA ("Helicase dependent amplification", translated into French by "amplification assisted by helicases") and RT-HDA ("Reverse transcription - HDA", translated into French by "HDA after reverse transcription") and

- NEAR ("Nicking Enzyme Amplification Reaction", translated into French by "cleavage enzyme amplification reaction") and RT-NEAR ("Reverse transcription - NEAR", translated into French as "NEAR after reverse transcription").

An exemplary embodiment of RPA is described by Piepenburg et al., "DNA detection using recombination proteins", PLoS biology, 4 (7), 2006. In other embodiments of the invention, the reagent compounds 1 used allow at least one amplification technique described in Yan, L. et al., "Isothermal amplified detection of DNA and RNA", Molecular BioSystems, 70 (5), 970-1003, 2014. At least one reactive compound is present in freeze-dried form in the diagnostic zone 1 10: it can be arranged on the surface of the porous substrate 105, and / or in the pores of the porous substrate 105 (that is to say in the porous substrate 105). In variants, at least one reactive compound is present in dried form and / or in the form of a hydrogel. In other embodiments, at least one reactive compound is present in a wet form. In these variants, the diagnostic zone 1 10 is isolated from the external environment by plastic sheets, for example.

When at least one reactive compound is in freeze-dried form, each said reactive compound is rehydrated by the vector fluid deposited in the vector fluid deposition zone 125.

When at least one reactive compound comes into contact with the target compound 120, subject to the appropriate thermal conditions, the primers hybridize to the DNA strand that is complementary to them, the enzyme can then attach to the primers and replicate the DNA strand (use available deoxyribonucleotides to create the complement of the DNA strand). During this replication, a colorimetric or fluorescent intercalator is generally integrated and is at the origin of the detection signal.

In the case of colorimetric detection, at least one reactive compound 1 changes color in contact with the target compound 120, which makes it possible to detect the presence of the target compound. If a target compound is detected, a user of the device 10 can deduce the presence or absence of a microorganism and deduce the infection of an individual by said microorganism whose DNA is the target compound 120 of the reagent compounds 1 15 of the device 10.

In variants, at least one reactive compound 1 emits a fluorescence signal in contact with the target compound 120.

This diagnostic zone 1 10 is connected to the sample deposition zone 130 by a preferably rectilinear channel 135. The sample deposition zone 130 may comprise a sample preparation compound 145 by lysis of the cells present in dried or lyophilized form in the thickness of the porous substrate 105. In the case of a chemical lysis, this compound 145 is, for example, a detergent agent destroying the plasma membrane of the cells present in the sample, which makes it possible to extract the genetic material from the cells. The sample deposition zone 130 is connected to the deposition zone of a vector fluid 125 by a channel 140. The deposition zone of a vector fluid 125 is configured to receive a vector fluid, for example. This vector fluid deposition zone 125 is connected by a channel 160, different from the channel 140, to an additional zone 155 comprising at least one reactive compound 1 (for example of the same composition as the reactive compounds 1 15 of zone 1). diagnosis). This zone 155 called "additional verification zone 155" has the function of verifying that the vector fluid deposited in the vector fluid deposition zone 125 does not have the target compound 120, which would lead to an erroneous diagnosis with respect to the sample deposited in the sample deposit area 130. In other configurations of the channels and zones of a device according to one embodiment of the invention, a verification of the absence of a target compound in the vector fluid may be performed in a device in which an area 125 and a zone 155 are connected indirectly: these two zones can for example be connected by combinations of zone (s) and / or channel (aux), so that the flow of vector fluid 125 does not pass through a zone 130 , 410, 910 sample deposit to join an additional 155 area. This combination may be a succession of at least one element selected from a channel and a different zone from a sample deposition zone 130, 410, 910.

The deposition zone of a vector fluid 125 is also connected, by a channel 170 different from the channel 140 and the channel 160, to an additional zone 165 comprising the reactive compound 1 and at least one target compound 120 in freeze-dried form. When the carrier fluid hydrates the additional area 165, the reactive compound 1 reacts with the target compound 120. Generally, in devices according to embodiments of the invention, an additional area 165, comprising a reactive compound 1 and a target compound may be connected to the zone 125 for depositing a vector fluid indirectly, for example by a succession of at least one element chosen from a channel and a zone different from an area 130, 410, 910 sample deposit. This zone 165 called "additional verification area 165" has the function of verifying the operation of the device 10.

In variants, the deposition zone of a vector fluid 125 has an area substantially greater than the areas of the other zones of the device 10. Thus, the deposition of a sample in the deposition zone of a sample 130 and the deposition of a sample. a vector fluid in the deposition zone of a vector fluid 125 causes, by a capillary pump mechanism, a displacement of the water in the additional and supplementary checking zones 155 and in the deposition zone of A sample 130. The vector fluid thus transports the sample into the sample deposition zone 130 and the diagnostic zone 1 10. The zones and channels of the porous substrate 105 act as a microfluidic system. The porous substrate 105 is, for example, wrapped in a plastic sheet covering all the surfaces of the porous substrate 105 with the exception of the deposition zones 125 and 130. In this way, the porous substrate 105 is protected and each Reactant 1 is isolated to prevent contamination.

FIG. 2 illustrates a particular embodiment of the means 205 for locally conditioning the temperature and the support layer 210. The support layer 210 is, for example, a sheet of paper or cellulose fibers similar to the material used to make the porous substrate 105. This support layer 210 has dimensions that are preferentially identical to those of the porous substrate 105.

A thermal conditioning means 205 may comprise a conductive electrical circuit 205 positioned on this support layer 210 so that, when a current flows through the circuit, this circuit locally heats the porous substrate 105 by Joule effect. The positioning of the conductive electrical circuit 205 is carried out so that, when the support layer 210 and the porous substrate 105 are brought into contact, the local temperature conditioning means 205 is placed opposite the diagnostic zones 10. and additional check zones 155 and additional 165. The local temperature conditioning means 205 is configured to heat the diagnostic zone 1 10 and the additional and additional control zones 155 to a temperature of between 20 ° C and 120 ° C. Preferably, this temperature is between 35 ° C and 70 ° C and preferably between 45 ° C and 65 ° C. Other means of thermal conditioning can be used alternatively or in addition such as a Peltier effect device.

A secondary electrical conductor circuit 150 is positioned so as to face the sample deposition zone 130 of the porous substrate 105 in order to act as a means 150 for local conditioning of the sample preparation temperature by thermal denaturation of the sample. the sample. In general, a conductive electrical circuit 150 may be positioned so as to face the other zones of the device 10, 40, 50, 90. These electrical circuits, 205 and 150, are powered by a battery 220 for example. This battery 220 has, for example, a voltage of 9 volts, which allows the substrate system 105, layer 205 and battery 220 to be portable. In variants, the local temperature conditioning means 205 is configured to perform a set of thermal cycles in order to perform a PCR reaction. In these variants, at least one reactive compound 1 is suitable for carrying out this reaction. In variants, an electrical circuit 150 may consist of an electrically conductive ink traced, deposited or printed on a sheet of paper. This sheet of paper is in this case a sheet distinct from the porous substrate 105.

FIG. 3 shows the device 10 assembled to perform a diagnosis. In this embodiment, a sealed layer 215 is positioned between the porous substrate 105 and the support layer 210. The local temperature conditioning means 205 is positioned under the additional diagnostic zones 10 and zones 155 and 165 while the local temperature conditioning means 150 is positioned below the sample deposition zone 130. In this manner, the sample transported into the sample deposition zone 130 and diagnostic zone 1 is heated, allowing the enzymes to function and the isothermal amplification function of DNA to take place. . On the other hand, local isothermal warming of the additional zone 165 makes it possible to check the operation of each reactive compound 1 15.

The thermal preparation means 150 makes it possible to purify and inactivate the sample deposited in the sample deposition zone 130.

The device 10, illustrated for example in Figures 1 to 3, can be manufactured in a controlled manner, standardized in the laboratory or by industrial processes. After manufacture, the device 10 is stored in an airtight plastic bag and can be stored away from heat, light and moisture to allow the devices 10 to be kept. FIG. 4 illustrates a logic diagram of steps of the method that is the subject of the present invention. This process comprises:

a sampling step 305 of a sample;

a deposition step 310 of the sample in a sample deposition zone of the device 10 as described with reference to FIGS. 1 to 3;

a preparation step 315 of the sample;

a transport step 320 of the sample prepared;

an isothermal amplification step 325 of the sample and

a detection step 330 of the presence of a target compound in the sample.

The sampling step 305 is performed, for example, by a syringe or a needle pricking an individual at the end of the finger to extract a drop of blood. In variants, a drop of urine, saliva or any other biological fluid is removed. In preferred embodiments, a drop of blood drawn from a blood test is used. For simplicity of use, a drop of blood taken at the fingertip of the individual is often used. The deposition step 310 is carried out, for example, by contacting the sample with the sample deposition zone of the device as described with reference to FIGS. 1 to 3.

The preparation step 315 is carried out by lysis of the cells of the sample and / or by thermal denaturation of the sample. The chemical lysis is carried out by a detergent agent, for example, while the thermal denaturation is carried out by local isothermal heating of the sample deposition zone by a conductive electrical circuit positioned opposite said zone. This preparation step 315 aims to extract the DNA or RNA material from the cells of the sample and to decontaminate the sample by deactivating the microorganism (s), for example. The transport step 320 is carried out, for example, by deposition of a standardized amount of sterile vector fluid on the deposition zone of a vector fluid of the device 10. This vector fluid, by a pump mechanism capillary, transports the sample to the sample deposition zone and the diagnostic zone of the device 10.

The volume of deposited vector fluid is, for example, thirty times greater and preferably one hundred times greater than the deposited volume of aqueous solution in which the sample is diluted.

The isothermal amplification step 325 may be carried out by conditioning the temperature of the reagent medium, comprising the prepared sample and each reactive compound, in the diagnostic zone. This heating allows the enzymes, initially present in dried form and then rehydrated, to amplify the DNA of the target compound.

The isothermal amplification 325 is less restrictive than the PCR methods and the thermal cycles associated with these methods.

The local temperature conditioning means 205 is supported by a layer which, associated with the porous substrate of the device 10 forms a chip with three thicknesses:

a porous substrate layer comprising the microfluidic system of channels and zones;

an adhesive waterproof layer attached to the porous substrate and

a layer supporting the electric heating circuit. The detection step 330 is performed, for example, by detecting the color or fluorescence of the porous substrate at the diagnostic zone. This spectrometry is performed directly by the user or, for example, by a communicating portable terminal, such as a mobile phone having an image sensor for example. An image processing software embedded in said terminal or in a remote computer server determines the color of the porous substrate and derives diagnostic information therefrom.

In variants, the method comprises a step of verifying the purity of the vector fluid by detecting the color in an area of the substrate porous in connection with the deposition zone of a vector fluid. If this zone, provided only with each reactive compound, has a color or a fluorescence characteristic of the presence of the target compound in said zone, the vector fluid used is infectious and the diagnosis established by the device 10 can not be exact.

In variants, the method comprises a step of verifying the operation of the device 10 by detecting the color or the fluorescence in an area of the substrate comprising, in freeze-dried forms, each reactive compound and the target compound. When the deposited vector fluid hydrates this zone, the compounds are brought into contact and the color of said zone becomes representative of the detection of the target compound. If this zone does not take this color, then the diagnosis made can not be considered correct.

Once the diagnosis is made, the device can be burned to avoid generating infectious waste. The local temperature conditioning means 205 may be extracted for reuse in connection with another porous substrate.

Figure 5 illustrates a particular embodiment of the device 40 object of the present invention. This device 40 differs from the device 10 as described with reference to FIG. 1 in that:

the sample deposition zone 410 and the diagnostic zone 455 are combined and in that

the two channels are merged into a single channel 430.

Thus, this device 40 comprises a porous substrate 405 similar to the porous substrate 105 described with reference to FIG. 1, a set of channels 430, 440 and 450, and zones 410, 425, 435, 445 and 455 being delimited. on and in this porous substrate 405.

Zone 410 corresponds to a sample deposit area. This sample deposition zone 410 is connected to a deposition zone 425 of vector fluid similar to the deposition zone 125 of vector fluid described with reference to FIG. In this embodiment, the vector fluid is used primarily to hydrate the area sample deposition 410 and diagnostic 455 to prevent drying of the compounds before a diagnosis is made.

The additional areas 435 and 445 respectively correspond to the areas 155 and 165, described with reference to FIG. 1, and provide similar functions. In alternative embodiments, the sample and diagnostic 455 deposition zones 410 comprise a sample preparation compound similar to the sample preparation compound 165 described with respect to FIG.

Figure 6 illustrates a particular embodiment of the device 50 object of the present invention. This device 50 comprises:

a porous substrate 505;

an area 525 for deposition of vector fluid connected to a channel 530 carrying the carrier fluid by capillarity to a zone 560 comprising at least one reactive compound 515;

three channels, 535, 545 and 555, for transporting the vector fluid and each reactive compound 515 by capillarity respectively from zone 560 to:

A sample deposition zone 510 acting as a diagnostic zone during the contact between the sample and each reactive compound 515 under the action of a local temperature conditioning means 205 (not shown);

An additional zone 540 comprising no reactive compound 515 or target compound 520, making it possible to verify that the vector fluid has no target compound 520 and

An additional zone 550 comprising the target compound 520 to check the operating capacity of the device 50.

Figure 7 illustrates a particular embodiment of the device 60 object of the present invention. In this Figure 7, there are three components of the reactive compounds described above. These reactive compounds comprise:

primers, that is, small strands of DNA that specifically recognize a desired DNA or RNA sequence in a sample, this sequence being nicknamed "target compound" in the figures above;

deoxyribonucleic bases, ie the elementary bricks which form the DNA and

at least one type of enzyme capable of assembling the deoxyribonucleic bases to form the DNA strand complementary to the desired target. The enzyme only works if the primer has found a complementary sequence. This device 60 comprises a porous substrate 605 comprising a zone

610 vector fluid deposition connected to three channels, 615, 620 and 625, for conveying the vector fluid by capillarity.

Via channel 615, this vector fluid is transported to a zone 685 comprising a pair of primers 665, deoxyribonucleic bases and 645 enzymes, in freeze-dried form, for example, to verify that the vector fluid does not contain the target compound 630. If target compound 630 is present, primers 665 and enzymes 645 react with target compound 630 and indicate to a user, for example, through a fluorescent probe, that target compound 630 is present in the vector fluid.

Via channel 625, the carrier fluid is transported to an area 680 having a pair of primers 665, deoxyribonucleic bases, 645 enzymes, target compound 630 in lyophilized form, for example. In contact with the vector fluid, the primers 665, the enzymes 645 and the target compound 630 react, indicating to a user, by means of a fluorescent probe, for example, that the device 60 functions properly in the presence of the target compound 630. the channel 620, the vector fluid is transported to a sample deposition zone 625, this sample here comprising the target compound 630. This sample deposition zone 625 is connected via a channel 635 to a storage area 640 of 645 enzymes in freeze-dried form. The vector fluid transports the stored sample and enzymes 645 into three distinct zones, 650, 660 and 670, each connected to the storage zone 640 by a separate channel. "Connected" elements are understood to mean that there is an arrangement of zone (s) and / or channel (s) capable of transporting a vector fluid from one element to another or to the other elements, by capillarity and / or by another mode of fluid flow in / on a porous substrate 105 between said elements. In each zone, 650, 660 and 670, a pair of primers, 655, 665 and 675, different is placed. Each primer pair, 655, 665, and 675, corresponds to a different diagnosis, with each pair of primers, 655, 665, and 675, reacting with a different target compound 630 or with a different part of a target compound 630.

Figure 8 illustrates a particular embodiment of the device 70 object of the present invention. In this figure 8, there are three components of the reactive compounds described above. These reactive compounds are formed:

primers, ie small strands of DNA, called "oligonucleotides", which specifically recognize a desired sequence in a sample, this sequence being named "target compound" in the figures above. These primers can be adapted to detect the presence of a pathogen, for example by RT-RPA;

deoxyribonucleotides (dNTPs);

enzymes capable of assembling the deoxyribonucleotides to form the complementary DNA strand of the target compound. These enzymes may be polymerases, the operation of which requires, among other things, that the primer finds a complementary sequence. Other enzymes may be necessary, in particular when carrying out an isothermal amplification reaction with RT-RPA in the device 10, 40, 90. When carrying out a RT-RPA, the enzymes may be single-stranded binding protein (or SSB) and / or recombinases whose function is to hybridize primers with homologous DNA sequences. Reverse transcriptases are used to detect a pathogen from RNA, particularly an RNA genome pathogen. This device 70 comprises a porous substrate 705 comprising a vector fluid deposition zone 710 connected to a channel 720 for conveying the vector fluid by capillarity. Via channel 720, the carrier fluid is transported to an enzyme storage area 725 745 in dried form. This storage area 725 is connected to three channels, 715, 725 and 735.

Via channel 715, the vector fluid comprising enzymes 745 is transported to a zone 785 comprising a pair of primers 765 and deoxyribonucleotides (dNTPs), in freeze-dried form for example, to verify that the vector fluid does not contain the target compound 730. If target compound 730 is present, primers 765 and enzymes 745 react and indicate to a user, through fluorescence for example, that target compound 730 is present in the vector fluid. Via channel 725, the enzyme-containing vector fluid 745 is transported to an area 780 having a pair of primers 765, deoxyribonucleotide bases and target compound 730 in lyophilized form, for example. In contact with the carrier fluid, primers 765 and enzymes 745 react and fluoresce to indicate to a user that device 70 is functioning properly in the presence of target compound 730.

Via channel 735, the enzyme-containing vector fluid 745 is transported to a sample deposition zone 740, which sample here comprises target compound 730.

The carrier fluid transports the stored sample and enzymes 745 into three distinct areas, 750, 760 and 770, each connected to the storage area 740 by a separate channel. In each zone, 750, 760 and 770, a pair of primers, 755, 765 and 775, different is placed. Each primer pair, 755, 765 and 775, corresponds to a different diagnosis, with each pair of primers, 755, 765 and 775, reacting with a different target compound 730 or with a different part of a target compound 730. Figure 9 illustrates several embodiments of the device according to the invention. Panel A of FIG. 9 illustrates a top view geometry of patterns used for producing a device according to the invention. In this exemplary embodiment, the porous substrate comprises a stack 3 of four primary porous substrates 906, each said primary porous substrate 906 comprising at least one element chosen from a channel and a zone. More generally, the porous substrate comprises a stack 3 of at least two primary porous substrates 906, each primary porous substrate 906 comprising a channel and / or a channel portion and / or a zone. This exemplary embodiment is suitable for carrying out the test of a sample comprising a negative control, that is to say a control making it possible to verify that the vector fluid does not comprise a target compound 920 and a positive control, that is to say, a control to verify the operation of the device 90 and the DNA amplification reaction. The porous substrate 905 used in this embodiment is made from Whatman (Trade Mark) grade 1 paper for chromatography. Wax patterns (108R0090 / 108R0091 / 108R0092 / 108R0093, Xerox, registered trademark) are printed (Xerox 8570 ColorQube printer) on the paper and then for example heated for one minute at 150 ° C on a hot plate (Ika, registered trademark, RCT basic). The wax can thus penetrate the pores of the porous substrate 905. This manufacturing step advantageously allows the inactivation of enzymes such as RNAses possibly present in the paper. In this embodiment of the invention, the device is made by aligning the patterns followed by folding the paper. The folding of the paper allows the stack 3 of several primary porous substrates 906 whose patterns are made by printing. In general, the stack 3 or part of the stack 3 of primary porous substrates 906 of a device according to one embodiment of the invention can be obtained by folding an initial porous substrate. Each primary porous substrate 906 can be joined to another with good contact by applying a piece of double-sided adhesive roll (Tesa, registered trademark) around the flow patterns. Plastic sheets (RT2RR, Sigma, registered trademark) are used to close and isolate the device. Holes are pierced using a punch having a diameter of 5 mm in the plastic coating to allow access to the inputs and outputs of the device 90, for example for the deposition of vector fluid. A reservoir can be made for depositing vector fluid by coating the stack 3 with several layers of plastic film and then piercing them at an inlet or an outlet. Subsequently, the reservoir or tanks made may be covered with a layer of plastic film, for example to prevent evaporation of a vector fluid deposited on the device.

In other embodiments of the invention, materials other than wax can be used to make the barriers of the channels or zones. For example, it is possible to use known biocompatible materials, such as PDMS (polydimethylsiloxane) for example. Obtaining barriers in PDMS is less simple than printing wax and can lead to lower spatial resolution. It will sometimes be used in the following examples implemented to check the compatibility of different materials with the biological reactions performed in the device.

The dashed lines of the panel A of FIG. 9 indicate the fold directions during the implementation of the device as described previously. The four primary porous substrates 906 are aligned during folding to allow vertical openings related to the areas defined by the patterns. The components of the various fluid flows in the device can thus be directed in the main plane of a primary porous substrate 906 as well as in the plane normal to the main plane of a said primary porous substrate 906.

Advantageously, the geometry of the vector fluid deposition zone is adapted to be soaked in said vector fluid.

The device 90 comprises:

a zone 925 of vector fluid deposition, adapted to be in contact, after stacking 3 of the primary substrate of said zone 925, to

an area 915 comprising at least one reactive compound; three channels 935, 945 and 955 adapted to transport a vector fluid and reactive compounds from zone 915 to:

A sample deposition zone 910;

An additional zone 940 comprising no compound before carrying out a test, making it possible to verify that the vector fluid does not comprise a target compound 920 (so-called negative control zone);

An additional zone 950 comprising target compounds 920 (for example a short fragment of RNA comprising an Ebola virus RNA sequence) adapted to verify the operation of the device 90 and the DNA amplification reaction (so-called positive control area).

Panel B of FIG. 9 schematically illustrates the arrangement of the different primary porous substrates 906 of a device according to the invention, after folding of the pattern described in panel A of FIG. 9. The various primary porous substrates 906 are separated in the diagram for the understanding of the flows, differently from their arrangement in the device. The gray arrows illustrate the flow in a primary porous substrate 906 and the white arrows illustrate the flow from one primary porous substrate to another. According to this embodiment of the invention, the two zones 910 and 940 are in contact by the stack 3 of the primary porous substrates 906. A vector fluid brought into contact with the vector fluid deposition zone 925 follows a flow through of all the primary porous substrates 906 from bottom to top. The flow of a vector fluid in the device can dispense the reactive compounds present in the zone 915 in the three channels 935, 945 and 955 then in the zone 910 of the sample deposit, in the zone 940 additional negative control and in the additional zone 950 positive control comprising target compounds 920. In general, each of the zones of a device according to the invention is connected to the other zones by at least one element selected from a channel and a zone: this characteristic allows a vector fluid deposited on a vector fluid deposition zone 125,525,925 to be transported in each of the zones of the device from a single localized deposit. Advantageously, the presence of several zones (according to this embodiment, zones 910, 940 and 950) for testing on the same device makes it possible to carry out several experiments in parallel under identical conditions of temperature, hygrometry, etc., and thus to make a significant comparison of the detection results.

Advantageously, at least one said compound (for example a reactive compound and / or a target compound 920) is present in at least one of said zones in freeze-dried form. The lyophilization of the various compounds can be carried out for example for 2 hours at -80 ° C. in a lyophilizer. After the deposition of the reactive compounds and their lyophilization, the stack 3 can be made by folding, and the device can be covered with an impermeable sheet, for example plastic. The device thus packaged can be stored at room temperature, protected from moisture and light for several days or weeks. During the experiment, the experiment consists in depositing the sample in the sample deposition zone 910, closing the openings with an impermeable sheet and plunging the vector fluid deposition zone into said vector fluid (ie, more generally, contacting a vector fluid with the vector fluid deposition area 125, 425, 925), for example a buffer solution. After carrying out the biological reactions, the experimenter or the user may examine diagnostic areas 110, 410 to determine the presence or absence of a said target compound 120, 420, 920 in the sample. In some cases, direct visualization by the user may be impossible due to device configuration. The visualization of the result can then be indirect, by displaying colored or fluorescent markers on other areas of the device, coming from a diagnostic zone.

In this embodiment of the invention, a vector fluid having markers has been used to visualize the flow in the device. This method makes it possible to check the flow of the reactive compounds to the test zones, the absence of mixing between the sample test flow lines, the positive and negative controls as well as the trajectories of the different compounds. Fluorescein (RAL reagents, registered trademark), Brilliant Blue G (Sigma Aldrich) and Allura Red AC (Sigma Aldrich) are used as markers at a mass concentration of 10 ^{~ 3} g.mL ^"1. For each marker, a drop of 5 μl is deposited on the surface to be marked, then dried.A vector fluid, such as water, leads to desorption of the markers and allows their Figure 10 illustrates an embodiment of the device according to the invention.

Panel A of FIG. 10 illustrates a top view geometry of patterns used for producing a device according to the invention. In this exemplary embodiment, the porous substrate comprises a stack 3 of five primary porous substrates 906, each said primary porous substrate 906 comprising at least one element chosen from a channel and a zone. This exemplary embodiment is suitable for carrying out multiplexed tests of a sample, each of the tests comprising a negative control and a positive control. The dotted lines of the panel A of FIG. 9 indicate the directions of folding during the production of the device. The crosses indicate pierced areas (absence of substrate) before the folding of the primary porous substrate 906.

In this embodiment, the device comprises:

an area 925 for deposition of vector fluid;

an area 915 comprising at least one reactive compound;

- nine areas comprising:

Three zones 916 comprising primers specific for the detection of a first DNA sequence,

Three zones 917 comprising primers specific to the detection of a second DNA sequence, and

Three zones 918 comprising primers specific for the detection of a third DNA sequence.

A pair of primers may for example be adapted to detect the Ebola virus;

a sample deposition zone 910;

three additional zones 950 comprising at least one target compound 920 (for example a short fragment of RNA comprising an RNA sequence of an Ebola virus in this embodiment) adapted to verify the operation of the device 90 (so-called control zone positive). Panel B of FIG. 10 schematically illustrates the arrangement of the various primary porous substrates 906 of a device according to the invention, after a folding of the primary porous substrate 906 described in panel A of FIG. Primary porous substrates 906 are separated in the scheme for the understanding of flows, differently from their arrangement in the device. The solid arrows schematically represent different flows when using the device. The dotted arrow indicates the area where the sample is deposited during the test. In this embodiment, a carrier fluid is pumped through the vector fluid deposition area 925. It routes and dispenses the reactive compounds present in area 915 in a control line and in a sample line. By line is meant a series of at least one channel and / or a zone. These two lines distribute the flow to three test zones, three positive control zones and three negative control zones. The sample line contains a sample deposition area 910 and three areas 916, 917 and 918 with different primers. In this way, the test of a sample can be multiplexed. In the same way, the negative and positive control lines each comprise three zones 916, 917 and 918.

Panel C of FIG. 10 illustrates two photographs of the device according to embodiments of the invention described in panels A and B of FIG. 10. The photograph on the left is a top view of the device. Different visible areas allow the observation, for example in fluorescence, of different sample tests, positive controls and negative controls. The photograph on the right is a bottom view of the device. It illustrates some of the positive and negative control lines.

Figure 11 illustrates a general method of amplifying DNA on a paper substrate. Panel A illustrates the deposition of reactive compounds on circular areas of the paper substrate. The device can then be lyophilized. Panel B illustrates the preservation of the device. Said device may for example be kept at room temperature for several weeks. Panel C illustrates the initiation of the test step. A vector fluid, for example water or a buffer solution, can be deposited in the presence or in the absence of target compounds 920 of RNA (respectively positive or negative control), or in the presence of an unknown sample. Panel D of FIG. 11 illustrates the fluorescence detection of the amplification reactions on paper. A temperature conditioning means, for example a Peltier element conditions the temperature of the substrate between 20 ° C and 120 ° C, preferably between 25 ° C and 65 ° C, and most preferably between 30 and 40 ° C. The result of a test of the sample, a positive or negative control can be advantageously detected by fluorescence. A quantitative measurement of the fluorescence of the visible areas (located in a primary substrate 906 at the end of the stack 3) is carried out and described in the results illustrated in the following figures using an external light source for the excitation in fluorescence (Leica EL 6000), a macroscope (Leica Z16 APO, 0.57X magnification) and a GFP filter (Leica). The filter comprises an excitation filter centered on a wavelength of 470 nm +/- 20 nm, a dichroic mirror centered on a wavelength of 500 nm and a suppression filter centered on a wavelength of 525 nm +/- 25 nm. This optical arrangement is suitable for the detection of FAM type optical probes (495 nm wavelength and 520 nm emission wavelength). The images are detected by an EM-CCD camera (Hamamatsu C900-13), recorded at the rate of one image every ten seconds for 30 minutes and 75 ms exposure. A synchronization between the shutter opening and the camera acquisition (EG R & D Vision Delays generator) prevents bleaching of the probes in interaction with the sample. The data is normalized by subtracting the first image at each sequence. The signal as a function of time corresponds to the measurement of an average of the signal on the surface of a test zone, for each image.

In other embodiments of the invention, the amplification can be detected by colorimetry, electrical measurement, capacitive or by measurement of the pH.

FIG. 12 illustrates a paper device adapted to perform an RT-RPA type amplification reaction according to one embodiment of the invention. In embodiments of the invention, the device comprises the reagent compounds 1 to perform an amplification reaction by RT-RPA adapted to test the sample. A Example of amplification of RNA by RT-RPA is described in the literature in Piepenburg, O., Williams, CH, Stemple, D. L, & Armes, NA, DNA detection using recombination proteins. PLoS biology, 4 (7), 2006. The RT-RPA amplification technique can be adapted for the detection of a microorganism in a sample by performing a reverse transcription of a region of a specific RNA of said microorganism in order to obtain a cDNA (complementary DNA). For example, a diagnostic zone 105, 405 of the device may be conditioned at a stationary or constant temperature so as to initiate a reverse transcription of RNA. The cDNA obtained is then amplified by RPA (isothermally). For example, the detection of amplified cDNA sequences can be performed by measuring the fluorescence associated with the hybridization of a fluorescent nucleotide probe specific for the amplified region.

In order to illustrate an embodiment of the invention, the inventors of the present application have developed primers and nucleotide probes to specifically detect an Ebola virus. For this, the inventors have based on the genomic sequences of 145 Ebola Zaire viruses (EBOV) available in the sequence databases (Gire, SK et al., Scheiffelin, JS (2014).) Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak, Science, 345 (6202), 1369-1372). Based on the alignment of these sequences, they determined which regions were conserved within these sequences. From the consensus sequences, they then designed six pairs of primers targeting conserved regions. For each pair of primers, different fluorescent probes were created. In total, the inventors tested twenty-four couples composed of a pair of primers and a fluorescent probe. The inventors have also tested another pair of probe primers known in the literature to allow the detection of Ebola virus by RT-RPA from a small amount of RNA (Euler, M et al (2013). of a Panel of Recombinase Polymerase Amplification Assays for Detection of Biothreat Agents J Clin Microbiol, 2013 Apr, 51 (4): 1170-7) Three sets of primers and probes associated with them are described subsequently in the sequence listing (sets consisting of primers SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 8). These three sets correspond to two targeted regions of the RNA of an Ebola virus.

In preferred embodiments of the invention, the primers for amplifying a target region of an Ebola virus whose sequence is bounded by positions 8661 and 8820 may include:

A pair of primers of sequence SEQ ID NO: 1 and 2, or a pair of primers hybridizing specifically to the target region, and whose position of each primer differs by ± 5 nucleotides (in particular ± 4 nucleotides, of ± 3 nucleotides, ± 2 nucleotides, ± 1 nucleotide or 0 nucleotide) of the position of the primers of sequence SEQ ID NO: 1 and 2, or

A pair of primers specifically amplifying the target region, and whose size of the region amplified by these primers differs by ± 10 nucleotides (in particular by ± 9 nucleotides, ± 8 nucleotides, ± 7 nucleotides, ± 6 nucleotides , ± 5 nucleotides, ± 4 nucleotides, ± 3 nucleotides, ± 2 nucleotides, ± 1 nucleotide or 0 nucleotide) of the size of the target region, or

A pair of primers specifically amplifying the target region, and whose sequence of each primer is at least 95% identical (more particularly at least 96%, at least 97%, at least 98%, at least 99% or 100%) to the sequence of each primer of sequence SEQ ID NO: 1 and 2, or

A pair of primers of sequence SEQ ID NO: 4 and 5, or

A pair of primers that hybridise specifically to the target region, and whose position of each primer differs by ± 5 nucleotides (in particular by ± 4 nucleotides, ± 3 nucleotides, ± 2 nucleotides, ± 1 nucleotide or 0 nucleotide) of the position of the primers of sequence SEQ ID NO: 4 and 5, or

A pair of primers specifically amplifying the target region, and whose sequence of each primer is at least 95% identical (more particularly at least 96%, at least 97%, at least 98%, at least 99% or 100%) to the sequence of each primer of SEQ ID NO: 4 and 5 sequence.

In particular embodiments of the invention, the primers for amplifying a target region of Ebola virus whose sequence is bounded by positions 17158 and 17274 may include:

A pair of primers of sequence SEQ ID NO: 7 and 8, or

A pair of primers that hybridise specifically to the target region, and whose position of each primer differs by ± 5 nucleotides (in particular by ± 4 nucleotides, ± 3 nucleotides, ± 2 nucleotides, ± 1 nucleotide or 0 nucleotide) of the position of the primers of sequence SEQ ID NO: 7 and 8, or

A pair of primers specifically amplifying the target region, and whose sequence of each primer is at least 95% identical (more particularly at least 96%, at least 97%, at least 98%, at least 99% or 100%) to the sequence of each primer of SEQ ID NO: 7 and 8.

In preferred embodiments of the invention the primers are selected from the group consisting of SEQ ID NO: 1-2, 4-5 and 7-8. In particular embodiments of the invention, the target regions amplified by the primer pairs are detected, simultaneously or sequentially, by nucleotide probes.

In preferred embodiments of the invention, a nucleotide probe for detecting a target region of an Ebola virus whose sequence is bounded by positions 8661 and 8820 may include:

A nucleotide probe of sequence SEQ ID NO: 13, or

A nucleotide probe of sequence SEQ ID NO: 3, or A nucleotide probe whose sequence is complementary to the sequence SEQ ID NO: 13, or

A nucleotide probe of sequence SEQ ID NO: 14, or

A nucleotide probe of sequence SEQ ID NO: 6, or a nucleotide probe whose sequence is complementary to the sequence SEQ ID NO: 14.

In preferred embodiments of the invention, a nucleotide probe for detecting a target region of an Ebola virus whose sequence is bounded by positions 17158 and 17274 may include:

A nucleotide probe of sequence SEQ ID NO: 15, or

A nucleotide probe of sequence SEQ ID NO: 9, or

A nucleotide probe whose sequence is complementary to the sequence SEQ ID NO: 15.

Preferably, the nucleotide probes are labeled with at least one fluorochrome.

In particular embodiments of the invention, a composition comprising a pair of primers and a nucleotide probe is selected from the group consisting of: a pair of primers of sequence SEQ ID NO: 1-2 and a nucleotide probe of SEQ sequence ID NO: 3; a pair of primers of sequence SEQ ID NO: 1-2 and a nucleotide probe of sequence SEQ ID NO: 13, a pair of primers of sequence SEQ ID NO: 4-5 and a nucleotide probe of sequence SEQ ID NO: 6; a pair of primers of sequence SEQ ID NO: 4-5 and a nucleotide probe of sequence SEQ ID NO: 14; a pair of primers of sequence SEQ ID NO: 7-8 and a nucleotide probe of sequence SEQ ID NO: 9; a pair of primers of sequence SEQ ID NO: 7-8 and a nucleotide probe of sequence SEQ ID NO: 15. According to the invention, the nucleotide probes refer to the sequences described by their SEQ ID NOs and to their complementary strands .

In order to validate the diagnostic device, RNA fragments of an Ebola virus are synthesized in vitro. For this purpose, the inventors have synthesized a DNA corresponding to each of the target regions of the genome of an amplified Ebola virus. by the primer pairs described above. Each of these DNA sequences was cloned into a pRSET vector downstream of a T7 promoter (GeneArt, Life Technologies) to enable in vitro transcription of the cloned sequence (MEGAscript kit, Ambion technologies). Previously known amounts of each of these RNAs are used to determine the sensitivity and / or the detection threshold of the test.

The amplification by RT-RPA is carried out using the reagents of the kit TwistAmp RT-Exo kit, TwistDX, registered trademark). In one embodiment of the RT-RPA paper, reactive compounds are mixed in aqueous solution, deposited on paper at -20 ° C and lyophilized at -20 ° C for 1 hour and 30 minutes.

Advantageously, the aqueous solution, comprising a mixture of the various reactive compounds and / or target compounds, is conditioned at the temperature of 4 ° C. before being deposited on the porous substrate before lyophilization. An object of the invention is a method comprising a step of forming the channels and zones in a porous substrate 105, as described above, followed by a step of depositing on an area of said porous substrate 105, 405, 905 at least a member selected from reactive compounds 1, 15, 415 and target compounds 120, 420, 920 diluted in an aqueous solution conditioned at a temperature between 0 ° C and 10 ° C, and then freeze-dried. The inventors have discovered that these last two steps are particularly advantageous for successfully storing or preserving biological compounds on a porous substrate, for a reaction adapted to an RNA or DNA detection. A final step may be to seal said porous substrate in a plastic sheet, to prevent entry of any compound likely to degrade freeze-dried biological species during storage of the device. Advantageously, the reactive compounds comprise inhibitors of

RNase.

Advantageously, the reactive compounds comprise cryoprotectants. The use of cryoprotectants can help to maintain normal activity of the different enzymes of the reactive compounds after rehydration.

The inventors have also tested the influence of blood serum on the efficiency of RT-RPA amplification in the device. In the experiments of the subsequent figures, the inventors also describe the use of human sera in the various tests, comprising dilutions of 920 RNA target compounds. The different sera are heated at 95 ° C for 5 minutes and cooled on ice for two minutes. The heating step and the deionized water in which it is diluted are intended to destroy the viral envelope to make accessible the genomic material. The inventors have also found that the temperature must be at least 95 ° C if the heating time is 5 min. If the temperature is lower than 95 ° C then the heating time must be extended to achieve the same result.

The inventors have also validated a device and method for detecting an Ebola virus according to embodiments of the invention by analyzing samples of viral RNA from an Ebola virus from patients' plasma. Samples are collected during the 2014 outbreak in Macenta, Guinea, and field tested. The 120 samples collected were tested in parallel with the device of the present application and with a known RT-PCR method (RealStar® Ebolavirus RT-PCR Kit 1 .0, Altona Diagnostics) in order to be able to compare the results obtained with the device. diagnosis to those of a reference method.

Panel A of Figure 12 illustrates a device for testing RT-RPA reactions on paper. This device comprises three rectangular test zones (each zone having dimensions of 3 mm by 5 mm) and two circular openings for fixing the device for fluorescence detection.

Panel B of FIG. 12 illustrates a fluorescence measurement of a test area during RT-RPA adapted for amplification of a target compound 920 RNA from an Ebola virus. Curve (a) corresponds to the amplification of a sample, curve (b) corresponds to the amplification of a target compound 920 of RNA previously lyophilized with all the other reactive compounds (positive control) and the curve (c) corresponds to a negative control (absence of RNA target compound 920). These measurements are made using the device described in panel A of FIG. 12.

Panel C and panel D illustrate the fluorescence emission during RT-RPA, corresponding to a series of primers, probes and RNA target compounds 920 of an Ebola virus according to the invention. The amplifications are carried out on a device described in panel A of FIG. 12. Three signals are measured, after 30 minutes, for different sets of four elements consisting of a target compound 920 of RNA corresponding to a target region. RNA of an Ebola virus, a first primer, a second primer and a probe. In these embodiments of RT-RPA on paper, all of the reactive compounds are lyophilized beforehand on or in the paper. The fluorescence emission of the positive control zone and the test zone is greater than that of the negative control zone (arranged between the two other zones in the device described in panel A of FIG. 12). The negative control makes it possible to verify that the buffer solution used is not contaminated with a target compound 920 of RNA and to verify the absence of leakage between the different zones.

A comparison between five target compounds 920 of an Ebola virus RNA is performed on a series of devices such as those described in panel A of FIG. 12. For each of the sequences of a target compound 920, several combinations of the primers and probes are tested. In the test zone (ST) and in the positive control zone (PC) respectively, dilutions of target compounds 920 at ^10- copy concentrations are deposited. mL ^"1 and 10 ⁸ copies, mL ^{" 1} . These tests make it possible to compare several reactive compounds involved in RT-RPA. The results were compared to the results obtained using primers used in the literature.

The inventors have demonstrated that the pairs of RT-RPA probe primers that operate in tubes are not those that work on paper. For example, primer pairs known in the literature for amplifying small amounts of virus RNA are not suitable for paper amplification. The choice of primers and probes is therefore not arbitrary. Advantageously, the porous substrate is made from untreated cellulose paper such as Whatman paper. The inventors have demonstrated that acid-treated papers and cotton-based papers may be incompatible with isothermal amplification reactions of DNA. FIG. 13 illustrates a different paper device of the invention and means 205 for local temperature conditioning according to one embodiment of the invention. Panel A of FIG. 13 is a photograph of the local temperature conditioning means 205 according to the invention. A different device of the invention 206 is placed in contact with the means 205. Advantageously, the means 205 of local temperature conditioning is compact is integrated in the device according to the invention. 207 is a conductive material line, in this nickel embodiment, drawn on paper and connected to a 9 volt battery 208. In this embodiment of the invention, said local temperature conditioning means 205 is a circuit electrical conductor placed opposite a porous substrate of the device. The conductive material line is brought into electrical contact with connectors 209.

Panel B of Figure 13 illustrates experimental results of temperature conditioning. The temperature measured on three lines 207 of conductive material, and measured according to the applied voltage. Each line of conductive material is characterized by a different electrical resistance: the triangles correspond to an electrical resistance of 30 Ω, the discs correspond to an electrical resistance of 80 Ω and the diamonds correspond to an electrical resistance of 2500 Ω. The local temperature conditioning means 205 is configured to set the temperature of said deposition regions 130 and diagnostic zones 1 to between 20 ° C and 120 ° C, preferably 25 ° C to 65 ° C, and most preferably 30 ° C to 65 ° C. ° C and 40 ° C. Experimental measurements are in agreement with the theoretical behaviors (black lines). Panel C of Figure 13 illustrates experimental results of temperature conditioning. The temperature of the conductive material lines is measured as a function of the electrical resistance of said constant voltage lines. The measurements are in agreement with the theoretical behavior (black line).

Panel D of Figure 13 illustrates experimental results of temperature conditioning. The kinetics of the temperature of a conductive material line is measured by imposing a voltage transition from 0 V to 4.4 V (triangles) and from 0 V to 2.7 V (round).

Panel E of Figure 13 illustrates experimental results of temperature conditioning. The kinetics of the temperature of a conductive material line is measured by imposing a voltage transition of 4.4 V at 0 V (triangles) and 2.7 V at 0 V (round).

In an exemplary embodiment of the invention, the device 10 is heated to 40 ° C. This conditioning of the temperature can be performed by a Peltier element (MJ Research PTC 200) for 30 minutes. In one embodiment of the invention, use is made of local temperature conditioning means 205 integrated in the device, such as the means described above. The resistance of the conductive material line is determined by its geometry (thickness, length, width, etc.) and the conductivity of the nickel. The major characteristics are verified experimentally. For example, the thermal Ohm law can be given by the formula (1):

T = T _amb + ^ U ² (1) where T is the temperature in Kelvin, T _amb is the ambient temperature in Kelvin, R _th is the thermal resistance in Kelvin.Watt ^"1 and R _e i _ec is the electrical resistance in Ohm: For a line of conductive material given the thermal Ohm's law becomes: (7 - T _amb ) oc U ² . (2)

This relationship is illustrated in panel B of FIG. 13. For a given voltage, the temperature increases with electrical conductance, as shown in panel C of FIG. 13. Experimentally, a change in conditioning from one temperature to another takes place in a time of about one minute as shown in panels D and E of Figure 13. The stability of the temperature depends on external conditions. Figure 14 illustrates the dependence of the material of the zones or channels in contact with the reactive compounds of RT-RPA on the result of an amplification reaction. Indeed, the influence of the interfaces and materials constituting the interfaces of a container can have dramatic consequences on the progress of a DNA amplification reaction. Panel A of FIG. 14 illustrates the kinetics of a fluorescence signal emitted during RT-RPA in tubes for a positive (h) and negative (i) control. The panel B of FIG. 14 illustrates the kinetics of a fluorescence signal emitted during an RT-RPA for a positive control in the presence of paper (k), plastic (j) and wax (I). The panel C of FIG. 14 illustrates the kinetics of a fluorescence signal emitted during an RT-RPA for a negative control in the presence of paper, plastic and wax.

The influence of different materials of the device according to the invention such as paper, wax and a plastic sheet were tested by adding each of these tube materials with the reactive compounds of RT-RPA. In the presence of a target compound 920 of RNA, this test makes it possible to detect the inhibitory effects of a material. In the absence of a target compound 920 of RNA of an Ebola virus, this test makes it possible to verify that a material is not responsible for an undesirable increase in the fluorescence noise. The results shown in Figure 14 illustrate RT-RPA DNA amplifications in which a 920 RNA target compound was used at a concentration of ¹⁰ copies. mL ^"1. The positive (h) and negative (i) controls shown in panel A of Figure 14 are compared to experiments involving one of the plastics, paper, and wax materials. FIG. 14 does not make it possible to determine the influence of paper or wax on the transcription of RNA and amplification of the DNA. The presence of wax seems to slightly decrease the detection signal of the amplification. The inhibition illustrated by the curve (I) is small compared to the amplitude of the signal. The kinetics of panel C of FIG. 14 illustrate the absence of modification of the background signal in the case of negative controls.

Figure 15 illustrates the influence of a paper substrate on the fluorescence signal kinetics emitted during RT-RPA. RT-RPAs are made on paper in the kinetics illustrated in FIG. 15, without lyophilization of the reactive compounds. The different reactions are carried out on a square paper substrate comprising four circular zones making it possible to carry out several simultaneous reactions. A mixture of all the reactive compounds is deposited on the paper substrate. In a positive control reaction, the reactive compounds comprise a target compound 920 of RNA at a concentration of ¹⁰ copies. ml ^"1. Paper substrates are heated to 40 ° C. A fluorescence detection used to monitor the amplification of the DNA transcript and discriminate positive and negative samples. paper reactions The results were compared with reactions identical in tube The curve (m) illustrates the fluorescence signal emitted during RT-RPA in the presence of a target compound RNA (positive control) on paper The curve (n) illustrates the fluorescence signal emitted during RT-RPA in the presence of a target compound 920 of RNA (positive control) on a tube The curve (o) illustrates the fluorescence signal emitted during RT-RPA in the absence of a compound Target 920 of RNA (negative control) on paper The curve (p) illustrates the fluorescence signal emitted during RT-RPA in the absence of a target compound 920 of RNA (negative control) in tube. curves (m) and (n) have similar profiles and show the good compatibility of the RT-RPA on a paper substrate.

Figure 16 illustrates the influence of wax or PDMS barriers, serum and lyophilization of RNA target compound 920 on the fluorescence signal kinetics emitted during paper RT-RPA. The experiments illustrated in FIG. 16 are carried out on a square paper substrate comprising four circular or rectangular zones making it possible to carry out several simultaneous reactions. The reactive compounds are lyophilized on the paper substrate, according to the protocol described above. They can be kept for several days, at room temperature, protected from light and moisture. The sample is then deposited, diluted in a buffer or in an aqueous solution on the substrate which allows to rehydrate the substrate. The substrate is then heated to 40 ° C. The fluorescence emission is then recorded.

Panel A of Figure 16 illustrates the effect of varying concentration of RNA reactive compound on RT-RPA on paper when using wax for barrier construction. The curve (neg) illustrates the fluorescence emission for the negative control (no target compound copy 920 RNA), the curve (C ₀ ) illustrates the fluorescence emission for a concentration of 10 ⁸ copies. mL ^"1 target RNA compound 920, the curve (C) shows the fluorescence emission to a concentration of 10 ¹⁰ copies. ^{ml" 1} of compound 920 target RNA, the curve (C ₂₎ illustrates the fluorescence emission for a concentration of 10 ¹² copies. mL ^"1 of RNA target compound 920.

Panel B of FIG. 16 illustrates the effect of varying concentration of RNA reactive compound on paper RT-RPA when using PDMS for barrier construction. The curve (neg) illustrates the fluorescence emission for the negative control (no target compound copy 920 RNA), the curve (C ₀ ) illustrates the fluorescence emission for a concentration of 10 ⁸ copies. mL ^"1 target RNA compound, the curve (C) shows the fluorescence emission to a concentration of 10 ¹⁰ copies. ^{ml" 1} of compound 920 target RNA, the curve (C ₂₎ shows the emission in fluorescence for a concentration of 10 ¹² copies. mL ^"1 of RNA target compound 920.

Panel C of Figure 16 illustrates the inhibition by human serum of fluorescence emission on paper RT-RPA. Curve (q) illustrates a positive control without serum and curve (v) illustrates a negative control without serum. Curve (u) illustrates a negative control in the presence of serum diluted 5 times in deionized water. Curve (t) illustrates a positive control in the presence of serum diluted 5 times. Curve (r) illustrates a positive control in the presence of serum diluted 10 times. The curve (s) illustrates a positive control in the presence of serum diluted 20 times. Panel D of FIG. 16 illustrates the influence of lyophilization of RNA target compound 920 on the fluorescent emission of RT-RPA on paper. The curve (IRNA) illustrates a positive control in the case of the use of freeze-dried RNA target compound 920 and the (fRNA) curve illustrates a positive control in the case of the use of fresh RNA target compound 920. The black curve shows a negative control.

The results of panel A of FIG. 16 make it possible to conclude at a target compound detection threshold 920 of at most 10 ⁸ copies. mL ^"1 (ie the detection threshold is at least less than or equal to) in the case of a paper device with wax barriers.The study illustrated in panel B of Figure 16 allows to conclude a similar result: the target compound detection limit 920 is at most 10 ⁸ copies.ml ^-1 (ie the detection threshold is at least less than or equal to) in the case of a paper device having PDMS barriers. The dilution experiment of RNA target compounds 920 in serum makes it possible to measure the importance of a possible inhibition in the case of a more realistic sample. For the most diluted cases (curves (r) and (s)) a slight inhibition is present: the signal in fluorescence is weaker than in the case without serum. Curve (t) illustrates that lower dilution of serum implies stronger inhibition.

In one embodiment, a device according to the invention comprises a positive control line and a negative control line. The positive control and the negative control make it possible to solve problems of the prior art such as the problem of controlling the good quality of the reagent compounds of the device after storage, and the control of external contamination, of the vector fluid, for example. To achieve a positive control, the RNA target compound 920 of the device can be lyophilized to allow transport and preservation of the device. Panel D of FIG. 16 illustrates that the same results can be obtained using a fresh or freeze-dried RNA target compound 920. The device according to the invention thus makes it possible to carry out a positive and negative control.

Figure 17 illustrates the preservation of a RT-RPA amplification device on paper. Positive controls are performed using a target compound 920 RNA of an Ebola virus at a concentration of ¹⁰ copies. mL ^"1 . Panel A of Figure 17 illustrates several amplifications after different device and room temperature storage times. The curve (x) illustrates a positive control after two days of storage of the device, the curve (w) illustrates a positive control after 6 days of storage of the device, The curve (y) illustrates a positive control after 30 days of storage of the device . The black curves illustrate the different negative controls.

The panel B of FIG. 17 illustrates several amplifications carried out after two days storage, at different temperatures, of devices comprising lyophilized reactive compounds. The curve (z) and (ac) respectively illustrate a positive control and a negative control for a prior conservation of the device at ambient temperature, curve (ab) and (ae) respectively illustrate a positive control and a negative control for a prior storage of the device at 4 ° C and the curve (aa) and (ad) respectively illustrate a positive control and a negative control for a prior storage of the -20 ° C device.

Panel C of FIG. 17 illustrates the influence of lyophilization of all of the reactive compounds and the carrier fluid on the amplification. Curve (af) illustrates a positive control for a device comprising lyophilized reactive compounds and whose amplification is carried out using a fresh buffer solution as a carrier fluid and the curve (ag) illustrates a positive control for a device comprising reactive compounds. lyophilized and whose amplification is carried out using a buffer solution which has been lyophilized as a vector fluid. The curve (ah) is a negative control.

In the various examples of FIG. 17, the storage of the reactive compounds is tested by carrying out three devices at the same time. Each device is kept either two days, a week, or a month before performing amplification by RT-RPA. The results of panel A illustrate the possibility of keeping the devices at least for a week without observing degradation of the amplification results. They also illustrate the possibility of performing the detection of a target compound 920 (RNA of an Ebola virus at a concentration of 10.sup.- ¹⁰ ml ^-1 ) after one month of storage of the device, despite a slight alteration of the amplification signal. The results of panel B of Fig. 17 illustrate the possibility of keeping the devices independently at -20 ° C, 4 ° C and at room temperature to detect a target compound 920. The variation of the positive signal is, in this example, stronger in the case of storage at -20 ° C. Panel C of FIG. 17 illustrates that the use of a fresh buffer solution has no positive effect on the detection of a target compound 920.

Figure 18 illustrates the dependence between the amount of reactive compounds deposited on the paper substrate and the geometry of the substrates considered. Panel A of FIG. 18 illustrates kinetics of fluorescence emission on paper RT-RPA for different amounts of reactive compounds deposited on the paper substrate. The curve (ai) corresponds to a condition of deposit before the reaction of a volume equivalent to half the standard volume (a standard volume can be between 40 μ \ - and 50 μί), the curve (aj) corresponds to at a pre-reaction condition of a volume equivalent to a quarter of the standard volume and the curve (ak) corresponds to a pre-reaction deposition condition of a volume equivalent to one eighth of the standard volume. The black curves correspond to the negative controls for the different conditions of volumes deposited.

The panel B of FIG. 18 illustrates the amplitude of the signal at the end of the reaction as a function of the volume of solution used for the rehydration of the reactive compounds. The experimental points marked by triangles correspond to a target compound concentration 920 of 10 ⁸ copies. ml ^"1, the data points marked by squares correspond to a concentration of target compound 920 10 ¹⁰ copies. ^{ml" 1} and the experimental points marked by triangles correspond to a concentration of target compound 920 10 ¹² screens. mL ^"1. The black line corresponds to the average signal of the negative controls and the lines dashed to its standard error.

The amount of reactive compounds of the device is adapted to the geometry of the device. The deposited volume comprising the reactive compounds as well as the concentration of the solution comprising the reactive compounds have an effect on the detection. A low concentration of reagent tends to increase the value of the detection threshold and to decrease the sensitivity. A high concentration of reactive compounds tends to inhibit the RT-RPA amplification reaction. The reactions corresponding to FIG. 18 are performed on paper devices whose barriers are made of PDMS. The experiments described in panel A of FIG. 18 correspond to a device comprising an RNA target compound 920 of an Ebola virus deposited at a concentration of ¹² copies. ml ^"1. For a substrate geometry corresponding to a disc area of 10 mm in diameter, half the standard volume of which corresponds to an optimum result. The volume of carrier fluid used for the rehydration of reactive compounds also alters the concentration of reactants during a RT-PCR amplification reaction A different optimal volume is observed for each target compound concentration 920. The volume condition V = 7.5 μ \ - allows the substrate geometry to obtain good conditions. for detection of 10 ⁸ copies, ¹ mL, ¹⁰ copies. mL ^"1 and ¹² copies, mL ^{" 1} .

Figure 19 illustrates the flows in a device according to the invention. Panel A of the figure illustrates the flow in the different zones and channels of the device. The photograph at the top of panel A of Figure 20 illustrates a primary porous substrate unfolded during the manufacture of a device. A device described in Figure 20 allows for a sample test that may contain RNA sequences of an Ebola virus, a negative control and a positive control. Prior to this test, some of the reactive compounds are lyophilized and reactive compounds of said device are arranged in pores of a primary porous substrate 906 protected by two primary porous substrates 906 located at the ends of the stack 3 necessary to produce the porous substrate as described in Figure 9.

Experiments involving markers make it possible to visualize the flows and to check the functions of a device. For example, 5 μl of fluorescein are deposited and dried in zone 915 of said device. The photographs of the bottom of the panel A of FIG. 20 illustrate a view from above of the device before and after the deposition of a vector fluid and a flow of said fluid in all the zones and channels. The photograph at the bottom right of Panel A of Figure 20 confirms that the deposited markers are well deposited in the three areas of interest. Panel B of Fig. 20 illustrates a similar experiment, with the difference that the markers are deposited before flow in a channel connecting area 915 and area 950 (gray portion of the top photograph of panel B of Fig. 20). The photograph at the bottom right of panel B of Figure 20 confirms the transport of the markers in area 950 without mixing after the flow.

Figure 20 illustrates the flows in a device according to the invention. A device described in FIG. 20 makes it possible to carry out three test samples capable of containing RNA sequences of an Ebola virus, three negative controls and three positive controls. Prior to this test, a part of the reactive compounds are lyophilized and reactive compounds of said device are arranged in pores of a primary porous substrate 906 and protected by two primary porous substrates 906 located at the ends of the stack 3 necessary to produce the porous substrate, as described in FIG. 9. Panel A of FIG. 20 comprises two photographs. The left-hand photograph illustrates a fluorescent marker deposit on the 915 area. The right-hand photograph illustrates the transport of the fluorescent markers in all of the reading areas 919. Panel B of Figure 20 includes two photographs. The photograph on the left illustrates several deposits of fluorescent markers of different colors (Allura Red AC and Brillant Blue G) on areas belonging to two different lines. The right-hand photograph illustrates the transport of the fluorescent markers in all the reading areas 919. No mixing is observed and the markers are well transported in their line to the reading areas 919. Panel C of FIG. 20 includes two photographs. The left-hand photograph depicts a fluorescent marker deposit on the sample deposition area 915. The right-hand photograph illustrates the transport of the fluorescent markers across all the reading areas 919. Fluorescent markers are well transported only to the reading areas 919 included in the test lines of the sample.

Figure 21 illustrates an RNA detection of an Ebola virus. Panel A of Figure 21 illustrates the fluorescence emissions of the reading areas 919 of a device according to the invention, described for example in Figure 9. Several RT-RPA are made in each of the lines of the device.

The curve (a1) corresponds to the fluorescence of the reading zone 919 of the test line of the sample, the curve (am) corresponds to the fluorescence of the reading zone of the positive control line and the curve ( ) corresponds to the fluorescence of the reading zone of the negative control line. The sample tested corresponds to a sample collected during the 2014 Ebola outbreak in Macenta. The primers used correspond to the pair of primers of sequence SEQ ID NO: 5 and SEQ ID NO: 6. This result shows the possibility of discriminating a sample comprising RNA from an Ebola virus with a device comprising the primers of the virus. 'invention.

The panel B of FIG. 21 illustrates the fluorescence emissions of the reading zones 919 of a device according to the invention, described for example in FIG. 9. Several RT-RPAs are produced in each of the lines of the device. The curve (a1) corresponds to the fluorescence of the reading zone 919 of the test line of the sample, the curve (am) corresponds to the fluorescence of the positive control line reading zone and the curve (an) corresponds to the fluorescence of the negative control line reading zone. The sample tested corresponds to a sample collected during the 2014 Ebola outbreak in Macenta. The primers used correspond to the pair of primers of sequence SEQ ID NO: 1 and SEQ ID NO: 2. This result shows the possibility of discriminating a sample comprising RNA from an Ebola virus with a device comprising the primers of the virus. 'invention.

Figure 22 illustrates the dependence of conditioning reactive compounds and target compounds 920 on the fluorescence emission kinetics of RT-RPA. Reactive compounds of RT-RPA are dried (not lyophilized) on a device such as that described in FIG. 11, for 1 h at 4 ° C., and then stored for two days at -20 ° C. The reagents contain the primers adapted for a target compound 920 of Ebola virus RNA (black symbols at a concentration of ¹⁰ copies / ml). The crosses represent the negative controls for which the reaction medium on paper is rehydrated with water. The circles represent the fluorescence monitoring when the target compound 920 is supplied to the reaction medium. Figure 23 illustrates the dependence of the conditioning of the reactive compounds and target compounds 920 on the fluorescence emission kinetics of an RT-RPA. The experimental conditions corresponding to the curves of FIG. 23 are the same as those described in FIG. 22, with the difference that panel A corresponds to a preservation of the dried compounds overnight at -20 ° C., panel B corresponds to a storage of the dried compounds overnight at -4 ° C and panel C corresponds to a storage of the dried compounds overnight at 25 ° C. The distinction between positive and negative is possible when the device is stored at -20 ° C.

Figure 24 illustrates tests leading to the choice of primers. Paper devices such as that described in panel A of Figure 12 are prepared for four different primer sets (identified Ref / 5.2 / 4.3 / 4.4 in Table 1 at the end of the description). The curves below show a fluorescence measurement over time, from each zone (the sample test corresponds to the gray circles, the negative control corresponds to the black dashes and the positive control to the black crosses in all the panels A, B, C and D in Fig. 24) for each batch of primers, in response to the same test sample.

Primer lots 4.4 and Ref (see the corresponding sequences in Table 1 at the end of the description) are not chosen for the rest of the experiments because they correspond to a nonspecific signal from 10-15 minutes in the zone of negative control. An additional experiment on another sample makes it possible to choose between the primers 4.3 and 5.2.

Figure 25 illustrates tests leading to the choice of primers. The primer set 4.3 appears to be more effective for the detection of the test and in the operation of the positive controls. We choose this batch of primers for the next experiments.

Figure 26 illustrates the effect of lyophilization of target compounds 920 and an RNAse inhibitor on a paper RT-RPA reaction. On a paper device as described in FIG. 11, the reactive compounds of RT-RPA are lyophilized. Fluorescence measurements make it possible to follow the reaction when the paper is rehydrated and heated. In panels A, B, and C in Figure 26, square symbols show positive controls, dashes illustrate negative controls.

The positive control curve of panel A of FIG. 26 illustrates a fluorescence measurement when the reagents are rehydrated with a solution containing RNA target compounds 920. In panel B of FIG. 26, target compound 920 of RNA is freeze-dried together with reactive RT-RPA compounds. The addition of water makes it possible to rehydrate the reaction medium. The signal is slightly weaker than in the case where the target compound 920 is not lyophilized but brought into solution at the time of the experiment. The curves of panel C of Fig. 24 illustrate a fluorescence measurement when the reactive compounds, the RNA target compounds 920 are lyophilized on the paper before the addition of water.

Size of

Region SEQ ID

Segment name

targeted NO:

amplified

Primer 1

CTACTGTATTTCATAAGAAGAGAGTTGAACC

meaning

bait

8661 - ATTAGTAGGAGTAATTCCCTATCAGTTAAA 2

4.3 160 antisense

8820

ATATGTCCGACCTTGAAAAAAGGATTTTTG [FAM

Probe dT] [THF] [BHQ, -dT] GACAGTAGTTTTTGC [3'-3 phosphate]

bait

CTACTGTATTTCATAAGAAGAGAGTTGAACC 4 senses

bait

8661 - ATTAGTAGGAGTAATTCCCTATCAGTTAAA 5

4.4 160 antisense

8820

AATCCTTTTTTCAAGGTCGGACATATGTC [FAM

Probe dT] [THF] [BHQ, -dT] AGGTGCTGGAGGAAC [3'-6 phosphate]

bait

CTACTGAGTCCAGTATAGAGTCAGAAATAGTA 7 meaning

bait

17158- CTGAGTTGTTAAGAATAATCTCAATTTGGT 8

5.2 117 antisense

17274

AATGACTACTCCTAGGATGCTTCTACCTGT [FAM

Probe dT] [THF] [BHQrdT] GTCAAAATTCCATAA [3 '- 9 phosphate]

bait

GACGACAATCCTGGCCATCAAGATGATGATCC 10 meaning

bait

1775- 169 (Euler, M CGTCCTCGTCTAGATCGAATAGGACCAAGTC 11

Ref. antisense

1943 et al. (2013))

GATGATGGAAGCTACGGCGAATACCAGAG [FAM

DTlCGGAAAACGGCATGIS'-12 Phosphate Probe]

Table 1 - Sequence Match

Claims

DNA amplification diagnostic device (10, 40, 90), characterized in that it comprises: a porous substrate (105, 405, 905) comprising at least:

A sample deposition zone (130, 410, 910), said sample comprising at least one target compound (120, 420, 920);

A plurality of channels (135, 140, 430, 935, 945, 955) positioned in the thickness of said porous substrate;

• a zone (1 10, 410, 915), called "diagnostic zone", comprising at least one reactive compound (1, 15, 415) adapted to react with a said target compound;

A deposition zone of a vector fluid (125, 425, 925) adapted to be transported by capillarity in all of said zones and said channels: each of said zones being connected to the others by at least one element chosen from a channel and a zone,

means (205) for locally conditioning the temperature of the diagnostic zone.

The device of claim 1 wherein said reactive compounds comprise at least primers (655, 665, 675), recombinases, polymerases, and proteins that bind to and maintain single-stranded DNA, wherein said reactive compounds are arranged in the pores said zones of said porous substrate (105, 405, 905).

3. Device according to claim 2 wherein said primers are adapted to detect the presence of a pathogen by RT-RPA.

4. Device according to claim 3 wherein said pathogen is the Ebola virus.

Device according to one of claims 1 to 3, wherein at least one said reactive compound (1 15) is arranged in or on said porous substrate (105, 405, 905) in freeze-dried form.

The device of claim 5 wherein said porous substrate (105, 405, 905) comprises a stack (3) of at least two primary porous substrates (906), each said primary porous substrate (906) having at least one member selected from a channel, a channel part and an area.

Device according to claim 6 wherein said stack (3) of said primary porous substrates is obtained by folding

Device according to one of claims 1 to 7 comprising at least one additional zone (155) comprising at least one compound (1 15) reactive diagnostic zone (1 10) connected to the zone (125) of deposition of a vector fluid by a succession of at least one member selected from a channel and a different area of a sample deposit area (130, 410, 910).

The device of claim 8 wherein at least one said compound selected from a reactive compound (1 15) and a target compound (120, 420, 920) is arranged in or on said porous substrate (105, 405, 905) in lyophilized form .

10. Device according to one of claims 1 to 9 comprising at least one additional zone (165) comprising at least one said compound (1 15) reagent, and at least one target compound (120, 420, 920), connected to the zone (125) for depositing a vector fluid by a succession of at least one element selected from a channel and a different zone from a sample deposition zone (130, 410, 910).

1 1. Device according to one of claims 1 to 10 comprising means (150, 205) for local conditioning of the temperature of the sample deposition zone.

12. Device according to one of claims 1 to 1 1, wherein said porous substrate (105) comprises at least one sheet of paper.

13. Device according to one of claims 1 to 12, wherein said means (150, 205) local temperature conditioning comprises a conductive electrical circuit facing said substrate (105) porous.

14. Device according to claim 13, comprising:

a layer (210) for supporting the conductive electrical circuit and

- A layer (215) sealed, the sealed layer being positioned in an intermediate manner between the substrate (105) porous and the support layer.

15. Device according to one of claims 13 to 14, wherein said conductive electrical circuit is supported by a sheet of paper separate from said porous substrate (105, 405, 905).

16. Device according to one of claims 1 to 15, wherein at least one channel (135, 140) is delimited by regions of said porous substrate (105, 405, 905) impregnated with solid wax.

17. Device according to one of claims 1 to 16, wherein at least one channel (135, 140) is formed by a hydrophilic-hydrophobic contrast in the thickness of said porous substrate (105).

18. Device according to one of claims 1 to 17, wherein said means (205) for local temperature conditioning is configured to set the temperature of at least one zone between 20 ° C and 120 ° C and preferably between 30 ° C and 120 ° C. ° C and 40 ° C.

19. Device according to one of claims 1 to 18, wherein at least one said compound (1 15) reagent is adapted to change color in contact with a said target compound (120, 420, 920).

20. Device according to one of claims 1 to 19, wherein at least one said reactive compound (1 15) is adapted to emit a fluorescence signal in contact with a said target compound (120, 420, 920).

21. The device of one of claims 1 to 20 wherein said reactive compounds (1155, 415) comprise at least one pair of said primers (655, 665, 675) selected from the group consisting of SEQ ID NO: 1-2; SEQ ID NO: 4-5; and SEQ ID NO: 7-8.

22. The device according to one of claims 1 to 21 wherein said reactive compounds (1, 15, 415) comprise at least one nucleotide probe selected from the group consisting of SEQ ID NO: 3, 6, 9, 13, 14 and 15 .

The device of one of claims 1 to 22 wherein said reactive compounds (1, 15, 415) comprise at least one oligonucleotide composition comprising a pair of primers and a probe, selected from the group consisting of a pair of primers of sequence SEQ ID NO: 1-2 and a nucleotide probe of sequence SEQ ID NO: 3; a primer pair of sequence SEQ ID NO: 4-5 and a nucleotide probe of sequence SEQ ID NO: 6; and a pair of primers of sequence SEQ ID NO: 7-8 and a nucleotide probe of sequence SEQ ID NO: 9.

24. A method for detecting RNA comprising at least the steps of:

depositing a said sample on at least one said sample deposition zone (130, 410, 910) of a said device according to one of claims 1 to 23; bringing into contact a said vector fluid with said vector fluid deposition zone (125, 425, 925) of said device;

conditioning a stationary temperature of at least one said diagnostic zone (105, 405) so as to initiate a reverse transcription of RNA and to amplify a previously selected nucleotide sequence, and isothermally;

- examining said diagnostic zones (1 10, 410) to determine the presence or absence of a said target compound (120, 420, 920).

25. The method of claim 24, the third step comprises an amplification of nucleotide sequences by RT-RPA (reverse transcription and amplification by polymerase assisted recombinases).

26. A primer pair selected from the group consisting of SEQ ID NO: 1-2; SEQ ID NO: 4-5; and SEQ ID NO: 7-8.

27. A probe selected from the group consisting of SEQ ID NO: 3, 6, 9, 13, 14 and 15.

An oligonucleotide composition comprising a primer pair and a probe selected from the group consisting of a primer pair of SEQ ID NO: 1-2 and a nucleotide probe of SEQ ID NO: 3; a pair of primers of sequence SEQ ID NO: 4-5 and a nucleotide probe of sequence SEQ ID NO: 6; and a pair of primers of sequence SEQ ID NO: 7-8 and a nucleotide probe of sequence SEQ ID NO: 9.

29. A method of manufacturing a device according to one of claims 1 to 23 comprising at least the steps of:

forming zones and channels in a said porous substrate (105, 405, 905) by heating said porous substrate (105, 405, 905) for at least one minute at a temperature greater than or equal to 100 ° C. and preferentially greater or equal to 150 ° C; depositing on an area of said porous substrate (105, 405, 905) at least one element selected from reactive compounds (1, 15, 415) and target compounds (120, 420, 920) diluted in an aqueous solution conditioned at a temperature between 0 ° C and 10 ° C, and lyophilize them;

sealing said porous substrate in a plastic sheet.