EP3244920B1 - Foot-and-mouth disease vaccine - Google Patents

Foot-and-mouth disease vaccine Download PDF

Info

Publication number
EP3244920B1
EP3244920B1 EP16704959.2A EP16704959A EP3244920B1 EP 3244920 B1 EP3244920 B1 EP 3244920B1 EP 16704959 A EP16704959 A EP 16704959A EP 3244920 B1 EP3244920 B1 EP 3244920B1
Authority
EP
European Patent Office
Prior art keywords
immunogenic composition
fmd
virus
antigen
per dose
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
EP16704959.2A
Other languages
German (de)
French (fr)
Other versions
EP3244920A1 (en
Inventor
Paul Joseph Dominowski
John Morgan Hardham
James Alan JACKSON
Cyril Gerard GAY
Luis Leandro RODRIGUEZ
Peter William KRUG
Aida Elizabeth Rieder
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Agriculture USDA
Zoetis Services LLC
Original Assignee
US Department of Agriculture USDA
Zoetis Services LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Agriculture USDA, Zoetis Services LLC filed Critical US Department of Agriculture USDA
Priority to SI201631724T priority Critical patent/SI3244920T1/en
Priority to EP23177533.9A priority patent/EP4248992A3/en
Priority to HRP20230752TT priority patent/HRP20230752T1/en
Publication of EP3244920A1 publication Critical patent/EP3244920A1/en
Application granted granted Critical
Publication of EP3244920B1 publication Critical patent/EP3244920B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/06Aluminium, calcium or magnesium; Compounds thereof, e.g. clay
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/125Picornaviridae, e.g. calicivirus
    • A61K39/135Foot- and mouth-disease virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5252Virus inactivated (killed)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505Inorganic adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55555Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55566Emulsions, e.g. Freund's adjuvant, MF59
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55583Polysaccharides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32111Aphthovirus, e.g. footandmouth disease virus
    • C12N2770/32122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32111Aphthovirus, e.g. footandmouth disease virus
    • C12N2770/32134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • Foot and mouth disease is an extremely contagious viral disease of cloven-hoofed ungulates which include domestic animals (cattle, pigs, sheep, goats, and others) and a variety of wild animals.
  • the most prominent disease symptoms in FMDV-infected cattle include vesicular lesions of the epithelium of the mouth, tongue, teats and feet.
  • FMDV-infected cattle include vesicular lesions of the epithelium of the mouth, tongue, teats and feet.
  • some countries, among them United States, Canada, Mexico, Australia and most of Europe, are considered to be free of FMD, the disease is distributed worldwide and has a great economic impact on the export industry. Indeed, several economically devastating outbreaks have occurred over the past decade on almost every continent.
  • FMD control is further exacerbated by the phenomenon of virus persistence.
  • inactivated FMD vaccines have been unable to prevent persistence or carrier state (defined as virus shedding past 28 days following infection and/or exposure). Shedding animals, while not exhibiting any FMD symptoms, could remain a source of FMD infection to other animals. As such, commonly accepted disease control practices require slaughter of all animals in a vaccinated herd even if they do not have clinical signs of disease.
  • references in the description to methods of treatment refer to the compounds, pharmaceutical compositions and medicaments of the present invention for use in a method for treatment of the human or animal body by therapy or for diagnosis.
  • the invention provides an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing oil, an immunostimulatory oligonucleotide comprising CpG, and diethylaminoethyl (DEAE) Dextran; and the antigen component comprises 0.5 - 10 ⁇ g of an inactivated FMD (Foot-and-Mouth Disease) Cruzeiro strain virus composition per dose.
  • the adjuvant component comprises an emulsion containing oil, an immunostimulatory oligonucleotide comprising CpG, and diethylaminoethyl (DEAE) Dextran
  • the antigen component comprises 0.5 - 10 ⁇ g of an inactivated FMD (Foot-and-Mouth Disease) Cruzeiro strain virus composition per dose.
  • the immunostimulatory oligonucleotide is a CpG containing oligonucleotide.
  • the antigen is an FMD Cruzeiro strain virus composition, and may be present in the amount of 0.5-4 ⁇ g per dose, or 0.5 - 2 ⁇ g per dose, or 0.5 - 1 ⁇ g per dose, or in the amount of about 0.5 ⁇ g per dose.
  • the FMD Cruzeiro strain virus is inactivated.
  • the inactivated FMD Cruzeiro strain virus is an inactivated FMD A24 Cruzeiro strain.
  • the inactivated strain is a genetically engineered strain which contains a deletion of the leader coding region (LL) and optionally, contains negative antigenic markers.
  • the genetically engineered virus contains capsid proteins from a heterologous strain.
  • the invention provides the immunogenic composition according to the present invention for use in a method of preventing FMD in an animal in need thereof, the method comprising administering the immunogenic composition according to the embodiments of the previous aspect to said animal.
  • the animal is selected from bovines, ovines, porcines, and caprines.
  • a method of reducing frequency of FMD persistence in a ruminant infected with FMD comprising administering to said ruminant prior to the infection an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 ⁇ g per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to 6 - 10 ⁇ g of FMD virus per dose.
  • a method of herd management comprising administering to animals in said herd an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 ⁇ g per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to 6 - 10 ⁇ g of FMD virus per dose, wherein, upon suspected contact with FMD infection, the vaccinated members of the herd are not slaughtered.
  • the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 ⁇ g per dose, and a polycationic polymer in the amount of 75
  • a method of herd management comprising administering to animals in said herd an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 ⁇ g per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to 6 - 10 ⁇ g of FMD virus per dose, wherein, upon suspected contact with FMD infection, the vaccinated members of the herd are quarantined for 0-62 days.
  • the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 ⁇ g per dose, and a polycationic polymer in
  • a method of herd management comprising administering to animals in said herd an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 ⁇ g per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to 6 - 10 ⁇ g of FMD virus per dose, wherein, upon suspected contact with FMD infection, the vaccinated members of the herd are moved beyond the infected zone.
  • the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 ⁇ g per dose, and a polycationic polymer in the
  • Figure 1 illustrates the difference in quality between the PEG precipitated and hollow fiber concentrated antigens.
  • Adjuvant means any substance that increases the humoral or cellular immune response to an antigen. Adjuvants are generally used to accomplish two objectives: the controlled release of antigens from the injection site, and the stimulation of the immune system.
  • Antibody refers to an immunoglobulin molecule that can bind to a specific antigen as the result of an immune response to that antigen.
  • Immunoglobulins are serum proteins composed of "light” and “heavy” polypeptide chains having "constant” and “variable” regions and are divided into classes (e.g., IgA, IgD, IgE, IgG, and IgM) based on the composition of the constant regions.
  • Antigen refers to any substance that is recognized by the animal's immune system and generates an immune response.
  • the term includes killed, inactivated, attenuated, or modified live bacteria, viruses, or parasites.
  • antigen also includes polynucleotides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, or lipids, or fragments thereof, individually or in any combination thereof.
  • antigen also includes antibodies, such as anti-idiotype antibodies or fragments thereof, and to synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope).
  • Buffer means a chemical system that prevents change in the concentration of another chemical substance, e.g., proton donor and acceptor systems serve as buffers preventing marked changes in hydrogen ion concentration (pH).
  • a further example of a buffer is a solution containing a mixture of a weak acid and its salt (conjugate base) or a weak base and its salt (conjugate acid).
  • Consisting essentially as applied to the adjuvant formulations refers to formulation which does not contain unrecited additional adjuvanting or immunomodulating agents in the amounts at which said agent exert measurable adjuvanting or immunomodulating effects.
  • Dose refers to a vaccine or immunogenic composition given to a subject.
  • a “first dose” or “priming vaccine” refers to the dose of such a composition given on Day 0.
  • a “second dose” or a “third dose” or an “annual dose” refers to an amount of such composition given subsequent to the first dose, which may or may not be the same vaccine or immunogenic composition as the first dose.
  • emulsifier is used broadly in the instant disclosure. It includes substances generally accepted as emulsifiers, e.g., different products of TWEEN ® or SPAN ® product lines (fatty acid esters of polyethoxylated sorbitol and fatty-acid-substituted sorbitan surfactants, respectively), and different solubility enhancers such as PEG-40 Castor Oil or another PEGylated hydrogenated oil.
  • Human immune response refers to one that is mediated by antibodies.
  • Immune response in a subject refers to the development of a humoral immune response, a cellular immune response, or a humoral and a cellular immune response to an antigen. Immune responses can usually be determined using standard immunoassays and neutralization assays, which are known in the art.
  • Immunologically effective amount or "effective amount to produce an immune response" of an antigen is an amount effective to induce an immunogenic response in the recipient.
  • the immunogenic response may be sufficient for diagnostic purposes or other testing, or may be adequate to prevent signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a disease agent. Either humoral immunity or cell-mediated immunity or both may be induced.
  • the immunogenic response of an animal to an immunogenic composition may be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain, whereas the protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature number, overall physical condition, and overall health and performance of the subject.
  • the immune response may comprise, without limitation, induction of cellular and/or humoral immunity.
  • Immunogenic means evoking an immune or antigenic response.
  • an immunogenic composition would be any composition that induces an immune response.
  • Infected Premises refers to premises where presumptive positive case or confirmed positive case exists based on laboratory results, compatible clinical signs, FMD case definition, and international standards.
  • Infected Zone refers to an area within 3 km beyond perimeters of presumptive or confirmed Infected Premises.
  • Lipids refers to any of a group of organic compounds, including the fats, oils, waxes, sterols, and triglycerides that are insoluble in water but soluble in nonpolar organic solvents, are oily to the touch, and together with carbohydrates and proteins constitute the principal structural material of living cells.
  • “Pharmaceutically acceptable” refers to substances, which are within the scope of sound medical judgment, suitable for use in contact with the tissues of subjects without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit-to-risk ratio, and effective for their intended use.
  • TCID 50 refers to "tissue culture infective dose” and is defined as that dilution of a virus required to infect 50% of a given batch of inoculated cell cultures.
  • Various methods may be used to calculate TCID 50 , including the Spearman-Karber method which is utilized throughout this specification. For a description of the Spearman-Karber method, see B. W. Mahy & H. O. Kangro, Virology Methods Manual, p. 25-46 (1996 ).
  • Persistently infected or carrier animals are animals shedding FMD virus past 28 days post infection or onset of clinical disease.
  • the instant application discloses several adjuvant formulations suitable for the instant invention.
  • the common feature of these adjuvants is the presence of oil and one or more emulsifiers, wherein the oily phase comprises at least 50% of the vaccine composition encompassing the adjuvant formulations disclosed therein.
  • oils and combinations thereof are suitable for use of the instant invention.
  • These oils include, without limitations, animal oils, vegetable oils, as well as non-metabolizable oils.
  • Non-limiting examples of vegetable oils suitable in the instant invention are corn oil, peanut oil, soybean oil, coconut oil, and olive oil.
  • a non-limiting example of an animal oil is squalane.
  • Suitable non-limiting examples of non-metabolizable oils include light mineral oil, straight chained or branched saturated oils, and the like.
  • the oil used in the adjuvant formulations of the instant invention is a light mineral oil.
  • mineral oil refers to a mixture of liquid hydrocarbons obtained from petrolatum via a distillation technique.
  • the term is synonymous with "liquefied paraffin", "liquid petrolatum” and “white mineral oil.”
  • the term is also intended to include "light mineral oil,” i.e., oil which is similarly obtained by distillation of petrolatum, but which has a slightly lower specific gravity than white mineral oil. See, e.g., Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing Company, 1990, at pages 788 and 1323 ).
  • Mineral oil can be obtained from various commercial sources, for example, J. T. Baker (Phillipsburg, Pa.) or USB Corporation (Cleveland, Ohio).
  • Preferred mineral oil is light mineral oil commercially available under the name DRAKEOL ® .
  • the oily phase is present in an amount from 50% to 95% by volume; preferably, in an amount of greater than 50% to 85%; more preferably, in an amount from greater than 50% to 60%, and more preferably in the amount of greater than 50-52% v/v of the vaccine composition.
  • the oily phase includes oil and emulsifiers (e.g., SPAN ® 80, TWEEN ® 80, etc.), if any such emulsifiers are present.
  • the volume of the oily phase is calculated as a sum of volumes of the oil and the emulsifier(s).
  • the oily phase would be present at 52% v/v of the composition.
  • the oil is present in the amount of about 45% and the emulsifier(s) is present in the amount of about 6% of a composition, then the oily phase is present at about 51% v/v of the composition.
  • the oily phase is present in an amount from 50% to 95% by volume; preferably, in an amount of greater than 50% to 85%; more preferably, in an amount from 50% to 60%, and more preferably in the amount of 50-52% v/v of each of the adjuvants of the instant invention.
  • the volume percentage of the oil and the oil-soluble emulsifier together is at least 50%, e.g., 50% to 95% by volume; preferably, in an amount of greater than 50% to 85%; more preferably, in an amount from 50% to 60%, and more preferably in the amount of 50-52% v/v of the vaccine composition.
  • the oil may be present in the amount of 45% and the lipid-soluble emulsifier would be present in the amount of greater than 5% v/v.
  • the volume percentage of the oil and the oil-soluble emulsifier together would be at least 50%.
  • volume percentage of the oil is over 40%, e.g., 40% to 90% by volume; 40% to 85%; 43% to 60%, 44-50% v/v of the vaccine composition.
  • Emulsifiers suitable for use in the present emulsions include natural biologically compatible emulsifiers and non-natural synthetic surfactants.
  • Biologically compatible emulsifiers include phospholipid compounds or a mixture of phospholipids.
  • Preferred phospholipids are phosphatidylcholines (lecithin), such as soy or egg lecithin.
  • Lecithin can be obtained as a mixture of phosphatides and triglycerides by water-washing crude vegetable oils, and separating and drying the resulting hydrated gums.
  • a refined product can be obtained by fractionating the mixture for acetone insoluble phospholipids and glycolipids remaining after removal of the triglycerides and vegetable oil by acetone washing.
  • lecithin can be obtained from various commercial sources.
  • suitable phospholipids include phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, phosphatidic acid, cardiolipin, and phosphatidylethanolamine.
  • the phospholipids may be isolated from natural sources or conventionally synthesized.
  • the emulsifiers used herein do not include lecithin, or use lecithin in an amount which is not immunologically effective.
  • Non-natural, synthetic emulsifiers suitable for use in the adjuvant formulations of the present invention include sorbitan-based non-ionic surfactants, e.g. fatty-acid-substituted sorbitan surfactants (commercially available under the name SPAN ® or ARLACEL ® ), fatty acid esters of polyethoxylated sorbitol (TWEEN ® ), polyethylene glycol esters of fatty acids from sources such as castor oil (EMULFOR ® ); polyethoxylated fatty acid (e.g., stearic acid available under the name SIMULSOL ® M-53), polyethoxylated isooctylphenol/formaldehyde polymer (TYLOXAPOL ® ), polyoxyethylene fatty alcohol ethers (BRIJ ® ); polyoxyethylene nonphenyl ethers (TRITON ® N), polyoxyethylene isooctylphenyl ethers (TRITON
  • Preferred synthetic surfactants are the surfactants available under the name SPAN ® and TWEEN ® , such as TWEEN ® -80 (Polyoxyethylene (20) sorbitan monooleate) and SPAN ® -80 (sorbitan monooleate).
  • the emulsifier(s) may be present in the vaccine composition in an amount of 0.01% to 40% by volume, preferably, 0.1% to 15%, more preferably 2% to 10%.
  • Additional ingredients present in the instant adjuvant formulations include cationic carriers, immunostimulatory oligonucleotides, monophospholipid A and analogs thereof (MPL-A), Polyinosinic:polycytidylic acid (poly I:C), saponins, quaternary ammoniums, sterols, glycolipids, a source of aluminum (e.g., REHYDRAGEL ® or VAC 20 ® wet gel) and combinations thereof.
  • MPL-A immunostimulatory oligonucleotides
  • poly I:C Polyinosinic:polycytidylic acid
  • saponins quaternary ammoniums
  • sterols glycolipids
  • a source of aluminum e.g., REHYDRAGEL ® or VAC 20 ® wet gel
  • Suitable cationic carriers include, without limitations, dextran, dextran DEAE (and derivatives thereof), PEGs, guar gums, chitosan derivatives, polycellulose derivatives like hydroxyethyl cellulose (HEC) polyethylenimene, poly aminos like polylysine and the like.
  • Suitable immunostimulatory oligonucleotides include ODN (DNA-based), ORN (RNA-based) oligonucleotides, or chimeric ODN-ORN structures, which may have modified backbone including, without limitations, phosphorothioate modifications, halogenations, alkylation (e.g., ethyl- or methyl- modifications), and phosphodiester modifications.
  • ODN DNA-based
  • ORN RNA-based oligonucleotides
  • chimeric ODN-ORN structures which may have modified backbone including, without limitations, phosphorothioate modifications, halogenations, alkylation (e.g., ethyl- or methyl- modifications), and phosphodiester modifications.
  • poly I:C poly inosinic -cytidylic acid or derivative thereof
  • CpG oligonucleotides are a recently described class of pharmacotherapeutic agents that are characterized by the presence of an unmethylated CG dinucleotide in specific base-sequence contexts (CpG motif).
  • CpG motif specific base-sequence contexts
  • CpG motifs are not seen in eukaryotic DNA, in which CG dinucleotides are suppressed and, when present, usually methylated, but are present in bacterial DNA to which they confer immunostimulatory properties.
  • the adjuvants of the instant invention utilize a so-called P-class immunostimulatory oligonucleotide, more preferably, modified P- class immunostimulatory oligonucleotides, even more preferably, E-modified P-class oligonucleotides.
  • P-class immunostimulatory oligonucleotides are CpG oligonucleotides characterized by the presence of palindromes, generally 6-20 nucleotides long.
  • the P-Class oligonucleotides have the ability to spontaneously self-assemble into concatamers either in vitro and/or in vivo.
  • oligonucleotides are, in a strict sense, single-stranded, but the presence of palindromes allows for formation of concatamers or possibly stem-and-loop structures.
  • the overall length of P- class immunostimulatory oligonucleotides is between 19 and 100 nucleotides, e.g., 19-30 nucleotides, 30-40 nucleotides, 40-50 nucleotides, 50-60 nucleotides, 60-70 nucleotides, 70-80 nucleotides, 80-90 nucleotides, 90-100 nucleotides.
  • the immunostimulatory oligonucleotide contains a 5' TLR activation domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and connected to a 3' palindromic region of at least 8 nucleotides in length either directly or through a spacer.
  • the P-class immunostimulatory oligonucleotides may be modified according to techniques known in the art.
  • J-modification refers to iodo-modified nucleotides.
  • E-modification refers to ethyl-modified nucleotide(s).
  • E-modified P-class immunostimulatory oligonucleotides are P-class immunostimulatory oligonucleotides, wherein at least one nucleotide (preferably 5' nucleotide) is ethylated. Additional modifications include attachment of 6-nitro-benzimidazol, O-methylation, modification with proynyl-dU, inosine modification, 2-bromovinyl attachment (preferably to uridine).
  • the P-class immunostimulatory oligonucleotides may also contain a modified internucleotide linkage including, without limitations, phosphodiesther linkages and phosphorothioate linkages.
  • the oligonucleotides of the instant invention may be synthesized or obtained from commercial sources.
  • P-Class oligonucleotides and modified P-class oligonucleotides are further disclosed in published PCT application no. WO2008/068638, published on Jun. 12, 2008 .
  • Suitable non-limiting examples of modified P-class immunostiumulatory oligonucleotides are provided below ("*" refers to a phosphorothioate bond and "-" refers to a phosphodiester bond).
  • the amount of P-class immunostimulatory oligonucleotide for use in the adjuvant compositions depends upon the nature of the P-class immunostimulatory oligonucleotide used and the intended species.
  • the adjuvant formulations also comprise (or consist essentially of, or consist of) a combination of an immunostimulatory oligonucleotide and a polycationic carrier. These adjuvants are referred to as "TXO".
  • the TXO adjuvants may also include a source of aluminum, such as Al(OH) 3 gel.
  • the TXO adjuvants with aluminum are referred to as "TXO-A”.
  • adjuvants TXO and TXO-A may optionally contain a sterol, such as, for example, cholesterol, lanosterol, sigmasterol, etc.
  • TXO and TXO-A adjuvants containing the sterol are referred to as TCXO and TCXO-A, respectively.
  • the optionally present sterol may be present in the amount of up to about 1000 ⁇ g (e.g., 100-1000 ⁇ g, 200-1000 ⁇ g, 250-700 ⁇ g, or about 400-500 ⁇ g) per dose.
  • the immunostimulatory oligonucleotide preferably an ODN, preferably containing a palindromic sequence, and optionally with a modified backbone
  • the immunostimulatory oligonucleotide may be present in the amount of 5-400 ⁇ g per dose
  • the polycationic carrier may be present in the amount of 5-400 mg per dose.
  • one dose of TXO would comprise between about 5 and 400 ⁇ g per dose (e.g., 6.25-200 ⁇ g or 6.25-100 ⁇ g or 6.25-50 ⁇ g or 6.25-25 ⁇ g or 6.25-10 ⁇ g or 10-200 ⁇ g or 25-200 ⁇ g or 25-100 ⁇ g or 25-50 ⁇ g or 25-100 ⁇ g or 50-100 ⁇ g per dose) of the immunostimulatory oligonucleotide, and the polycationic carrier may be present in the amount of between about 5 and about 500 mg per dose (e.g., 6.25-200 mg or 6.25-100 mg or 6.25-50 mg or 6.25-25 mg or 6.25-10 mg or 10-200 mg or 25-200 mg or 25-100 mg or 25-50 mg or 25-100 mg or 50-100 mg per dose).
  • ⁇ g per dose e.g., 6.25-200 ⁇ g or 6.25-100 ⁇ g or 6.25-50 ⁇ g or 6.25-25 ⁇ g or 6.25-10 mg or 10-200 mg
  • TXO adjuvants are prepared as follows:
  • the immunostimulatory oligonucleotide in TXO-A adjuvants, is present as in the TXO adjuvant, the source of aluminum is present in the amount of up to 40% v/v (e.g., 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%). In a set of embodiments, the source of aluminum is present at 2%-20% v/v of the vaccine composition, more preferably between about 5% and about 17% v/v.
  • TXO-A adjuvants are prepared similarly to TXO adjuvants, and the source of aluminum is added to the aqueous solution.
  • TCXO and TCXO-A adjuvants cholesterol is dissolved in the oil solution, and the other steps of making TCXO and TCXO-A are similar to the steps used in preparation of TXO and TXO-A, respectively.
  • the adjuvants of the instant invention are capable of causing sufficient protection from Foot-And-Mouth disease even when the dose of the antigen is decreased from 10 ⁇ g of the inactivated FMD Cruzeiro strain virus to 0.5 ⁇ g.
  • the amount of the inactivated FMD Cruzeiro strain virus may be 0.5 ⁇ g, about 1 ⁇ g, about 2 ⁇ g, about 3 ⁇ g, about 4 ⁇ g, about 5 ⁇ g, about 6 ⁇ g, about 7 ⁇ g, about 8 ⁇ g, about 9 ⁇ g or about 10 ⁇ g.
  • the amount of the antigen may be between 0.5 and 1 ⁇ g, between 1 and 2 ⁇ g, between 2 and 3 ⁇ g, between 3 and 4 ⁇ g, between 4 and 5 ⁇ g, between 5 and 6 ⁇ g, between 6 and 8 ⁇ g, between 8 and 10 ⁇ g of inactivated FMD Cruzeiro strain virus (140 S particles).
  • FMD virus Cruzeiro strain which is of serotype A, is used as an antigen in this invention, provided that such virus is not pathogenic. Pathogenicity is reduced by inactivation of the virus, e.g., treatment with formaldehyde or BEI.
  • the virus may be attenuated by culture passage or via recombinant means. It has previously been demonstrated, for example, that deletion of the leader protein L pro coding region results in FMD virus which is attenuated in cattle and pigs. See, e.g., US 5,824,316 , US 8,765,141 , Virology 1997 227(1): 96-102 , J.Virol 2012 86:11675-11685 . Point mutations in at positions 55 and 58 within the SAP domain of L protein also resulted in a viable virus that displayed a mild attenuated phenotype in cell culture and was protective in swine FMD model. See US Patent No. 8,846,057 .
  • the virus also contains negative antigenic markers which allow for DIVA (differentiating infected from vaccinated animals) assays.
  • the negative antigenic markers are introduced to 3D and/or 3B proteins. See, e.g., SEQ ID NOs 19, 20, 21, 22.
  • FMD virus continually evolves and mutates, thus one of the difficulties in vaccinating against it is the huge variation between, and even within, serotypes.
  • serotypes There is no cross-protection between serotypes (a vaccine for one serotype will not necessarily protect against any others) and in addition, two strains within a given serotype may have nucleotide sequences that differ by as much as 30% for a given gene. This means FMD vaccines must be highly specific to the strain involved.
  • endonuclease restriction sites are introduced into the genome of the virus, thereby allowing introduction of proteins (e.g., proteins forming the outer capsids) from heterologous FMD strains.
  • the antigen component comprises FMD strain A24 Cruzeiro, which may optionally be modified by deletion of leader protein, negative marker mutations in 3B and/or 3D proteins, and by introduction of restriction endonuclease sites for an easier introduction of sequences for antigens (e.g., capsid proteins) from heterologous strains. Suitable non-limiting examples of the antigens are described in US 8,765,141 . DNA sequences corresponding to RNA genome of a genetically modified FMDV are also provided in SEQ ID NO: 15 (A 24 LL3D YR ) and SEQ ID NO: 17 (A 24 LL3B PVKV 3D YR ).
  • a DNA sequence complementary to the DNA sequence set forth e.g., in SEQ ID NO: 15 is a template for, i.e. is complementary to or "encodes", the RNA genome of the FMDV virus (i.e., RNA that encodes the FMDV).
  • the virus comprises capsid protein(s) of heterologous FMD strains (i.e., strains of FMD other than A24 Cruzeiro, including without limitations, strains of lineages C, O, Asia 1, SAT3, SAT 1 and SAT 2, Turkey 06 and other strains of lineage A).
  • Non limiting examples of such heterologous antigens are illustrated in SEQ ID NO: 23 (Asia1-A 24 LL3B PVKV 3D YR ) and SEQ ID NO: 24 (A/Turkey/06-A 24 LL3B PVKV 3D YR ). Additionally, O1 campos-A 24 LL3B PVKV 3D YR (complete genome, also referred as O1campos), C3 Indaial-A 24 LL3B PVKV 3D YR (complete genome), and capsid Argentina 2001 iso93 (capsid and 2A partial sequence) are provided in SEQ ID NOs 25, 26, and 27, respectively.
  • variants of such antigens are also envisioned.
  • the variants are at least 80% identical (e.g., 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical or 99% identical) to a reference sequence using one of the alignment programs described using standard parameters. Multiple alignment tools are available to determine sequence identity, including, without limitations, BLAST, CLUSTAL or PHILIP.
  • the variants encompass more than the specific exemplary nucleotide or amino acid sequences and include functional equivalents thereof.
  • a codon for the amino acid alanine, a hydrophobic amino acid may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine.
  • polypeptides disclosed herein may also be altered in various ways including amino acid substitutions, deletions, truncations, and insertions.
  • Novel proteins having properties of interest may be created by combining elements and fragments of proteins of the present invention, as well as with other proteins. Methods for such manipulations are generally known in the art.
  • the genes and nucleotide sequences of the invention include both the naturally occurring sequences as well as mutant forms.
  • the proteins of the invention encompass naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired modified activities of the parent FMD virus.
  • the mutations that will be made in the DNA encoding the variant must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure.
  • the antigenic composition is depleted of non-structural proteins.
  • the antigenic composition contains both structural and non-structural FMD proteins.
  • the FMD antigen comprises structural proteins.
  • the FMD antigen comprises both structural and non-structural proteins, particularly 3D protein.
  • compositions of the present invention can be formulated following accepted convention to include acceptable carriers for animals, including humans, such as standard buffers, stabilizers, diluents, preservatives, and/or solubilizers, and can also be formulated to facilitate sustained release.
  • Diluents include water, saline, dextrose, ethanol, glycerol, and the like.
  • Additives for isotonicity include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others.
  • Stabilizers include albumin, among others.
  • Other suitable vehicles and additives, including those that are particularly useful in formulating modified live vaccines, are known or will be apparent to those skilled in the art. See, e.g., Remington's Pharmaceutical Science, 18th ed., 1990, Mack Publishing , which is incorporated herein by reference.
  • compositions of the present invention can further comprise one or more additional immunomodulatory components such as, e.g., an additional adjuvant or cytokine, among others.
  • additional adjuvants that can be used in the vaccine of the present invention include the RIBI adjuvant system (Ribi Inc., Hamilton, Mont.), Freund's complete and incomplete adjuvants, Block copolymer (CytRx, Atlanta Ga.), QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron, Emeryville Calif.), AMPHIGEN ® adjuvant, saponin, Quil A or other saponin fraction, monophosphoryl lipid A, and Avridine lipid-amine adjuvant.
  • Other immunomodulatory agents that can be included in the vaccine include, e.g., one or more interleukins, interferons, or other known cytokines.
  • the routes of administration for the adjuvant compositions include parenteral, oral, oronasal, intranasal, intratracheal, topical, subcutaneous, intramuscular, transcutaneous, intradermal, intraperitoneal, intraocular, intravenous, and lingual administration.
  • Any suitable device may be used to administer the compositions, including syringes, droppers, needleless injection devices, patches, and the like.
  • the route and device selected for use will depend on the composition of the adjuvant, the antigen, and the subject, and are well known to the skilled artisan.
  • measures which need to be taken to contain and/or eliminate FMD outbreak are controlled by regulatory authorities, such as, for example, national authorities of Agriculture and sanctioned by international organizations such as the OlE (International Office of Epizootics).
  • the measures which need to be undertaken in connection with the outbreak may include, without limitations, standstill of animal movements, effective controls on the movement of animal products, including milk, meat, hide, etc, stamping-out policy (slaughter of the animals in affected herd, and, where appropriate, those in other herds which have been exposed to infection by direct animal to animal contact, or by indirect contact with the pathogen). Often the animals in the neighboring herds are vaccinated followed by slaughter.
  • such immunogenic compositions prevent persistence, which is defined as the presence or shedding of FMD for longer than 28 days after the infection.
  • such immunogenic compositions comprise an antigen component and an adjuvant component, wherein the adjuvant component comprises (or consists essentially of or consists of) an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide comprising CpG in the amount of 75-200 ⁇ g per dose, and diethylaminoethyl (DEAE) Dextran in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to at least 6 ⁇ g of an inactivated FMD Cruzeiro strain virus per dose.
  • the adjuvant component comprises (or consists essentially of or consists of) an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oli
  • antigen may be present in the amount equivalent to 6-10 ⁇ g of an inactivated FMD Cruzeiro strain virus per dose, e.g., 8-10 ⁇ g of an inactivated FMD Cruzeiro strain virus per dose.
  • the amount of the immunostimulatory oligonucleotide comprising CpG may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 ⁇ g per dose.
  • the diethylaminoethyl (DEAE) Dextran may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose.
  • a method of reducing frequency of FMD persistence in a ruminant infected with FMD comprising administering to said ruminant prior to the infection the immunogenic compositions which comprise an antigen component and an adjuvant component, wherein the adjuvant component comprises (or consists essentially of or consists of) an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 ⁇ g per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD (Foot-and-Mouth Disease) antigen in the amount equivalent to at least 6 ⁇ g of FMD virus per dose.
  • FMD Freot-and-Mouth Disease
  • the amount of the antigen may be equivalent to 6-20 ⁇ g of FMD virus per dose, e.g., 8-20, 10-20, 12-20, 14-20, 16-20, 18-20, 6-10, 6-12, 6-18, 8-12, or 8-10 ⁇ g of FMD virus per dose.
  • the amount of the immunostimulatory oligonucleotide may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 ⁇ g per dose.
  • the polycationic polymer may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose.
  • ruminants e.g., cattle, sheep, camels, etc.
  • ruminants e.g., cattle, sheep, camels, etc.
  • the vaccinated members of the herd are not slaughtered after a suspected contact with FMD virus.
  • the vaccinated animals are kept in quarantine for a shorter time.
  • the animals suspected of coming in contact with FMD may be kept in quarantine for less than 30 days, e.g., 28 days, or 29 days.
  • designation of an area as a containment zone means severe limitations of prohibition on movement of animals or animal products from the containment zone, generally, 30 days or more.
  • the animals suspected of coming in contact with FMD may be moved from the containment zone within less than 30 days, e.g., 28 days or 29 days from the suspected contact with FMD.
  • the antigen component entails a genetically engineered FMD antigen, e.g., as described above, it is possible to differentiate vaccinated from infected animals. Therefore, in additional reference aspects, the herd management methods (or method of reducing frequency of FMD persistence in a ruminant infected with FMD).
  • the adjuvant component comprises (or consists essentially of or consists of) an emulsion containing oil, an immunostimulatory oligonucle
  • the amount of the antigen may be equivalent to 6-10 ⁇ g of an inactivated FMD Cruzeiro strain virus per dose, e.g., 8-10 ⁇ g of an inactivted FMD Cruzeiro strain virus per dose.
  • the amount of the immunostimulatory oligonucleotide comprising CpG may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 ⁇ g per dose.
  • the diethylaminoethyl (DEAE) Dextran may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose.
  • PEG poly-ethylene glycol precipitation methods
  • BHK-21 cells were infected with the FMD virus. Then (24-36 h later) the cells were lysed by freeze-thawing, and cell lysate was clarified of cell debris by low speed centrifugation (500 x g). PEG was added (8% w/v) to the supernatant containing both structural and non-structural proteins. The mixture was incubated for 12-18 hr at 4°C. During this incubation, FMDV particles associate with the PEG. Antigen was recovered by centrifugation at 16,000 xg and collection of the precipate pellet containing PEG and virus. The supernatant, containing cellular and viral non-structural proteins was discarded. The pellet, to which the virus particles are bound, was then washed with small volumes of buffer to elute the FMDV particles from the PEG.
  • An additional method described herein is based on hollow-fiber concentration, of FMDV culture supernatants.
  • the steps of this method consist of successive filtration arrangement to remove first the cell debris and large material from the cultures (BHK-21 cells infected with the FMD virus and lysed by freeze-thawing).
  • the culture material was pumped successively through a 10 ⁇ m capsule filter, a 4.5 ⁇ m capsule filter, then finally through a 0.8 ⁇ m/0.2 ⁇ m filter.
  • This filtrate was then concentrated using a hollow fiber ultrafiltration cartridge that allows particles smaller than 0.01 ⁇ m to flow through the membrane. FMDV particles and many non-structural proteins remain in the column circuit while liquid and smaller proteins go through the membrane into the waste.
  • the column circuit was run until the concentrate reaches the desired volume, normally a ten-fold concentration.
  • Figure 1 is a Western blot illustrating the difference in quality between the PEG precipitated and hollow fiber concentrated antigens.
  • Hollow fiber concentrated antigen contains large amounts of structural and non structural proteins as illustrated in this figure by western blot staining using an antibody specific for protein 3D, the largest FMDV non-structural proteins and antibody specific to capsid protein (structural protein).
  • PEG-precipitated antigens (lane 9) contained structural protein but did not contain detectable levels of 3D protein.
  • Serum separator blood tubes to obtain serum samples were collected at Days 0 (before vaccination), 4, 7, 14, 21 (before challenge), 24, 28, 31 and 42 from all animals. The serum samples were kept frozen until tested for the presence of neutralizing antibodies against FMDV in a serum neutralization assay (reported as the reciprocal of the last serum dilution to neutralize 100 TCID 50 of homologous FMDV in 50% of the wells) or to study the anti-3Dpol response (by means of a competitive Enzyme-Linked Immunosorbent Assay).
  • Antigens were prepared as described in Example 1. Antigen stock solutions contained 5.51 ⁇ g/ml antigen prepared by hollow fiber filtertration (Prep A) or 10.26 pg/ml antigen prepared by PEG precipitation (Prep B).
  • the immunogenic compositions of groups T02 through T06 were homogenized on the day of vaccination and administered to the animals on Day 0.
  • Persistence was measured as the presence or absence of virus (either FMDV viral RNA and/or infectious FMDV) determined using both viral isolation and quantitative rRT-PCR.
  • the primers used for the quantitative rRT-PCR were as follows: Forward (SEQ ID NO: 28): GACAAAGGTTTTGTTCTTGGTCA Reverse (SEQ ID NO: 29): TGCGAGTCCTGCCACGGA Taqman probe: (FAM reporter, TAMRA quencher, SEQ ID NO: 30) TCCTTTGCACGCCGTGGGAC
  • Serum neutralizing titers to FMDV are summarized in Table 2.
  • Signs of FMDV were scored as presence (1) or absence (0) of hoof vesicles, i.e., a presence of a vesicle on a single hoof produced the score of 1, the presence of vesicles on only 2 hooves produced score of 2 and vesicles on all 4 hooves produced a score of 4. Once an animal received a score of 4, it was considered to have a score of 4 for the duration of the study.
  • Peristence was defined as presence of infectious virus or viral RNA in oesophageal -pharyngeal fluid (obtained using a "Probang" cup) after 28 days post-challenge (day 49 after vaccination, as shown in tables 5 and 6).
  • Table 5 quantitative rRT-PCR results for individual animals and treatment group back-transformed least square means of FMDV RNA copy numbers per mL from probang samples are shown.
  • results of probang sample virus isolation testing are reported as either positive or negative. The values below 1.87 in table 5 were scored as 'negative' due to limit of detection of the assay.
  • Group 1 serum control
  • three animals were positive at least once for FMDV by rRT-PCR and two animals were always positive for virus isolation.
  • Group T05 one animal (R14-62) demonstrated the presence of the virus only on Day 38 by rRT-PCR but not by virus isolation and and virus was not detected by either test thereafter. FMDV was not detected either by rRT-PCR or by viral isolation assay at any time for the other three animals in group T05.
  • Table 7 summarizes the results of persistence experiments. Animals were considered as non-persistent if neitherrRT-PCR or viral isolation assays detected FMDV on both day 49 (28 days post-challenge) and day 52 (31 day post-challenge). Table 7 Frequency of Persistence and Non-Persistence Treatment Persistent % Not Persistent % T01 (saline) 50 50 T02 (FMDV PEG ppt - 8 ⁇ g) 0 100 T03 (FMDV PEG ppt - 2 ⁇ g) 50 50 T04 (FMDV PEG ppt - 0.5 ⁇ g) 100 0 T05 (FMDV Hollow fiber - 8 ⁇ g) 0 100 T06 (FMDV Hollow fiber - 2 ⁇ g) 50 50 T07 (FMDV Hollow fiber - 0.5 ⁇ g) 25 75
  • Treatment Persistent % Not Persistent % T01 50% (2 out of 4) 50% (2 out of 4) Prep A (hollow fiber, groups T05-T07 Combined) 25% (3 out of 12) 75 % (9 out of 12) Prep B (PEG precipitation, groups T02-T04 Combined) 50% (6 out of 12) 50% (6 out of 12)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Zoology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Inorganic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)

Description

    BACKGROUND
  • Foot and mouth disease (FMD) is an extremely contagious viral disease of cloven-hoofed ungulates which include domestic animals (cattle, pigs, sheep, goats, and others) and a variety of wild animals. The most prominent disease symptoms in FMDV-infected cattle include vesicular lesions of the epithelium of the mouth, tongue, teats and feet. Although some countries, among them United States, Canada, Mexico, Australia and most of Europe, are considered to be free of FMD, the disease is distributed worldwide and has a great economic impact on the export industry. Indeed, several economically devastating outbreaks have occurred over the past decade on almost every continent.
  • Currently killed-antigen FMDV vaccines are necessarily produced in expensive biological containment facilities, by growing large volumes (thousands of liters) of virulent FMDV that has been adapted to grow in cells, which can be sometimes difficult. This process has resulted in escape of virulent virus from the manufacturing facility causing costly outbreaks in livestock (see Cottam et al. 2008. PLoS Pathogen 4:1-8). After growth, virus is then inactivated using chemicals and antigen concentrates are prepared, followed by purification steps required to remove contaminant proteins. It is difficult to differentiate infected from vaccinated animals (DIVA) through serological diagnostic tests. There is little to no cross protection across serotypes and subtypes requiring the appropriate matching between vaccine and circulating field strains to achieve protection. Despite these shortcomings of the vaccines, billions of doses are manufactured every year around the world. Their use has been the basis for eradicating FMDV from Europe and for controlling the disease in many parts of the world through mass vaccination campaigns. Creation of genetically engineered viruses containing a backbone and suitable restriction sites partially addresses the shortcomings of inactivated vaccines as restriction sites provide loci for introduction of capsid proteins of different FMD strains. Nevertheless, the cost of antigen is the greatest contributor to the cost of FMD and most other vaccines.
  • The problem of FMD control is further exacerbated by the phenomenon of virus persistence. Briefly, historically, inactivated FMD vaccines have been unable to prevent persistence or carrier state (defined as virus shedding past 28 days following infection and/or exposure). Shedding animals, while not exhibiting any FMD symptoms, could remain a source of FMD infection to other animals. As such, commonly accepted disease control practices require slaughter of all animals in a vaccinated herd even if they do not have clinical signs of disease.
  • Yimei C, Expert Rev. Vaccines 13 (2014) Vol. 11, 1377-1385 discloses an overview of adjuvants for foot-and-mouth disease virus (FMDV) vaccine with a focus on their efficacy when used with FMD vaccine, and on mechanisms by which adjuvants mediate their effects.
  • Bucafusco D et al., Virology 476 (2015) 11-18 discloses a study of Interferon-y recall responses against foot-and-mouth disease virus in vaccinated cattle to study T-lymphocyte immunity against different strains of this virus.Ren J et al., Vaccine 29 (2011) 7960-7965 discloses a recombinant foot-and-mouth disease virus vaccine able to induce a specific antibody response in mice and cattle
  • As such, methods and compositions which lead to vaccines with a lower antigen load without compromising efficiency and/or reducing or eliminating FMD persistence are still desired.
  • SUMMARY OF THE INVENTION
  • Any references in the description to methods of treatment refer to the compounds, pharmaceutical compositions and medicaments of the present invention for use in a method for treatment of the human or animal body by therapy or for diagnosis.
  • In one aspect, the invention provides an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing oil, an immunostimulatory oligonucleotide comprising CpG, and diethylaminoethyl (DEAE) Dextran; and the antigen component comprises 0.5 - 10 µg of an inactivated FMD (Foot-and-Mouth Disease) Cruzeiro strain virus composition per dose.
  • In the present invention, the immunostimulatory oligonucleotide is a CpG containing oligonucleotide. In the present invention, the antigen is an FMD Cruzeiro strain virus composition, and may be present in the amount of 0.5-4 µg per dose, or 0.5 - 2 µg per dose, or 0.5 - 1 µg per dose, or in the amount of about 0.5 µg per dose.
  • The FMD Cruzeiro strain virus is inactivated. In certain embodiments, the inactivated FMD Cruzeiro strain virus is an inactivated FMD A24 Cruzeiro strain. In selected embodiments, the inactivated strain is a genetically engineered strain which contains a deletion of the leader coding region (LL) and optionally, contains negative antigenic markers.
  • In certain embodiments, the genetically engineered virus contains capsid proteins from a heterologous strain.
  • In another aspect, the invention provides the immunogenic composition according to the present invention for use in a method of preventing FMD in an animal in need thereof, the method comprising administering the immunogenic composition according to the embodiments of the previous aspect to said animal. In different embodiments, the animal is selected from bovines, ovines, porcines, and caprines.
  • In a reference aspect, a method of reducing frequency of FMD persistence in a ruminant infected with FMD is disclosed comprising administering to said ruminant prior to the infection an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 µg per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to 6 - 10 µg of FMD virus per dose.
  • In yet another reference aspect, a method of herd management is disclosed, comprising administering to animals in said herd an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 µg per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to 6 - 10 µg of FMD virus per dose, wherein, upon suspected contact with FMD infection, the vaccinated members of the herd are not slaughtered.
  • Further disclosed is a method of herd management, comprising administering to animals in said herd an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 µg per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to 6 - 10 µg of FMD virus per dose, wherein, upon suspected contact with FMD infection, the vaccinated members of the herd are quarantined for 0-62 days.
  • Further disclosed is a method of herd management, comprising administering to animals in said herd an immunogenic composition comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 µg per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to 6 - 10 µg of FMD virus per dose, wherein, upon suspected contact with FMD infection, the vaccinated members of the herd are moved beyond the infected zone.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • Figure 1 illustrates the difference in quality between the PEG precipitated and hollow fiber concentrated antigens.
  • DETAILED DESCRIPTION Definitions
  • "About" or "approximately," when used in connection with a measurable numerical variable, refers to the indicated value of the variable and to all values of the variable that are within the experimental error of the indicated value (e.g., within the 95% confidence interval for the mean) or within 10 percent of the indicated value, whichever is greater, unless about is used in reference to time intervals in weeks where "about 3 weeks," is 17 to 25 days, and about 2 to about 4 weeks is 10 to 40 days.
  • "Adjuvant" means any substance that increases the humoral or cellular immune response to an antigen. Adjuvants are generally used to accomplish two objectives: the controlled release of antigens from the injection site, and the stimulation of the immune system.
  • "Antibody" refers to an immunoglobulin molecule that can bind to a specific antigen as the result of an immune response to that antigen. Immunoglobulins are serum proteins composed of "light" and "heavy" polypeptide chains having "constant" and "variable" regions and are divided into classes (e.g., IgA, IgD, IgE, IgG, and IgM) based on the composition of the constant regions.
  • "Antigen" or "immunogen" refers to any substance that is recognized by the animal's immune system and generates an immune response. The term includes killed, inactivated, attenuated, or modified live bacteria, viruses, or parasites. The term "antigen" also includes polynucleotides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, or lipids, or fragments thereof, individually or in any combination thereof. The term antigen also includes antibodies, such as anti-idiotype antibodies or fragments thereof, and to synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope).
  • "Buffer" means a chemical system that prevents change in the concentration of another chemical substance, e.g., proton donor and acceptor systems serve as buffers preventing marked changes in hydrogen ion concentration (pH). A further example of a buffer is a solution containing a mixture of a weak acid and its salt (conjugate base) or a weak base and its salt (conjugate acid).
  • "Consisting essentially" as applied to the adjuvant formulations refers to formulation which does not contain unrecited additional adjuvanting or immunomodulating agents in the amounts at which said agent exert measurable adjuvanting or immunomodulating effects.
  • "Dose" refers to a vaccine or immunogenic composition given to a subject. A "first dose" or "priming vaccine" refers to the dose of such a composition given on Day 0. A "second dose" or a "third dose" or an "annual dose" refers to an amount of such composition given subsequent to the first dose, which may or may not be the same vaccine or immunogenic composition as the first dose.
  • The term "emulsifier" is used broadly in the instant disclosure. It includes substances generally accepted as emulsifiers, e.g., different products of TWEEN® or SPAN® product lines (fatty acid esters of polyethoxylated sorbitol and fatty-acid-substituted sorbitan surfactants, respectively), and different solubility enhancers such as PEG-40 Castor Oil or another PEGylated hydrogenated oil.
  • "Humoral immune response" refers to one that is mediated by antibodies.
  • "Immune response" in a subject refers to the development of a humoral immune response, a cellular immune response, or a humoral and a cellular immune response to an antigen. Immune responses can usually be determined using standard immunoassays and neutralization assays, which are known in the art.
  • "Immunologically effective amount" or "effective amount to produce an immune response" of an antigen is an amount effective to induce an immunogenic response in the recipient. The immunogenic response may be sufficient for diagnostic purposes or other testing, or may be adequate to prevent signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a disease agent. Either humoral immunity or cell-mediated immunity or both may be induced. The immunogenic response of an animal to an immunogenic composition may be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain, whereas the protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature number, overall physical condition, and overall health and performance of the subject. The immune response may comprise, without limitation, induction of cellular and/or humoral immunity.
  • "Immunogenic" means evoking an immune or antigenic response. Thus an immunogenic composition would be any composition that induces an immune response.
  • "Infected Premises" refers to premises where presumptive positive case or confirmed positive case exists based on laboratory results, compatible clinical signs, FMD case definition, and international standards.
  • "Infected Zone" refers to an area within 3 km beyond perimeters of presumptive or confirmed Infected Premises.
  • "Lipids" refers to any of a group of organic compounds, including the fats, oils, waxes, sterols, and triglycerides that are insoluble in water but soluble in nonpolar organic solvents, are oily to the touch, and together with carbohydrates and proteins constitute the principal structural material of living cells.
  • "Pharmaceutically acceptable" refers to substances, which are within the scope of sound medical judgment, suitable for use in contact with the tissues of subjects without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit-to-risk ratio, and effective for their intended use.
  • "TCID50" refers to "tissue culture infective dose" and is defined as that dilution of a virus required to infect 50% of a given batch of inoculated cell cultures. Various methods may be used to calculate TCID50, including the Spearman-Karber method which is utilized throughout this specification. For a description of the Spearman-Karber method, see B. W. Mahy & H. O. Kangro, Virology Methods Manual, p. 25-46 (1996).
  • Persistently infected or carrier animals are animals shedding FMD virus past 28 days post infection or onset of clinical disease.
  • Adjuvant formulations and methods of making
  • The instant application discloses several adjuvant formulations suitable for the instant invention. The common feature of these adjuvants is the presence of oil and one or more emulsifiers, wherein the oily phase comprises at least 50% of the vaccine composition encompassing the adjuvant formulations disclosed therein.
  • Multiple oils and combinations thereof are suitable for use of the instant invention. These oils include, without limitations, animal oils, vegetable oils, as well as non-metabolizable oils. Non-limiting examples of vegetable oils suitable in the instant invention are corn oil, peanut oil, soybean oil, coconut oil, and olive oil. A non-limiting example of an animal oil is squalane. Suitable non-limiting examples of non-metabolizable oils include light mineral oil, straight chained or branched saturated oils, and the like.
  • In a set of embodiments, the oil used in the adjuvant formulations of the instant invention is a light mineral oil. As used herein, the term "mineral oil" refers to a mixture of liquid hydrocarbons obtained from petrolatum via a distillation technique. The term is synonymous with "liquefied paraffin", "liquid petrolatum" and "white mineral oil." The term is also intended to include "light mineral oil," i.e., oil which is similarly obtained by distillation of petrolatum, but which has a slightly lower specific gravity than white mineral oil. See, e.g., Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing Company, 1990, at pages 788 and 1323). Mineral oil can be obtained from various commercial sources, for example, J. T. Baker (Phillipsburg, Pa.) or USB Corporation (Cleveland, Ohio). Preferred mineral oil is light mineral oil commercially available under the name DRAKEOL®.
  • In certain embodiments particularly suitable for preventing or eliminating FMD persistence, the oily phase is present in an amount from 50% to 95% by volume; preferably, in an amount of greater than 50% to 85%; more preferably, in an amount from greater than 50% to 60%, and more preferably in the amount of greater than 50-52% v/v of the vaccine composition. The oily phase includes oil and emulsifiers (e.g., SPAN® 80, TWEEN® 80, etc.), if any such emulsifiers are present. The volume of the oily phase is calculated as a sum of volumes of the oil and the emulsifier(s). Thus, for example, if the volume of the oil is 40% and the volume of the emulsifier(s) is 12% of a composition, then the oily phase would be present at 52% v/v of the composition. Similarly, if the oil is present in the amount of about 45% and the emulsifier(s) is present in the amount of about 6% of a composition, then the oily phase is present at about 51% v/v of the composition.
  • It also should be understood that since the adjuvants of the instant invention form only a part of the vaccines of the instant invention, the oily phase is present in an amount from 50% to 95% by volume; preferably, in an amount of greater than 50% to 85%; more preferably, in an amount from 50% to 60%, and more preferably in the amount of 50-52% v/v of each of the adjuvants of the instant invention.
  • In a subset of embodiments, the volume percentage of the oil and the oil-soluble emulsifier together is at least 50%, e.g., 50% to 95% by volume; preferably, in an amount of greater than 50% to 85%; more preferably, in an amount from 50% to 60%, and more preferably in the amount of 50-52% v/v of the vaccine composition. Thus, for example and without limitations, the oil may be present in the amount of 45% and the lipid-soluble emulsifier would be present in the amount of greater than 5% v/v. Thus, the volume percentage of the oil and the oil-soluble emulsifier together would be at least 50%.
  • In yet another subset, applicable to all vaccines of the invention, volume percentage of the oil is over 40%, e.g., 40% to 90% by volume; 40% to 85%; 43% to 60%, 44-50% v/v of the vaccine composition.
  • Emulsifiers suitable for use in the present emulsions include natural biologically compatible emulsifiers and non-natural synthetic surfactants. Biologically compatible emulsifiers include phospholipid compounds or a mixture of phospholipids. Preferred phospholipids are phosphatidylcholines (lecithin), such as soy or egg lecithin. Lecithin can be obtained as a mixture of phosphatides and triglycerides by water-washing crude vegetable oils, and separating and drying the resulting hydrated gums. A refined product can be obtained by fractionating the mixture for acetone insoluble phospholipids and glycolipids remaining after removal of the triglycerides and vegetable oil by acetone washing. Alternatively, lecithin can be obtained from various commercial sources. Other suitable phospholipids include phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, phosphatidic acid, cardiolipin, and phosphatidylethanolamine. The phospholipids may be isolated from natural sources or conventionally synthesized.
  • In additional embodiments, the emulsifiers used herein do not include lecithin, or use lecithin in an amount which is not immunologically effective.
  • Non-natural, synthetic emulsifiers suitable for use in the adjuvant formulations of the present invention include sorbitan-based non-ionic surfactants, e.g. fatty-acid-substituted sorbitan surfactants (commercially available under the name SPAN® or ARLACEL®), fatty acid esters of polyethoxylated sorbitol (TWEEN®), polyethylene glycol esters of fatty acids from sources such as castor oil (EMULFOR®); polyethoxylated fatty acid (e.g., stearic acid available under the name SIMULSOL® M-53), polyethoxylated isooctylphenol/formaldehyde polymer (TYLOXAPOL®), polyoxyethylene fatty alcohol ethers (BRIJ®); polyoxyethylene nonphenyl ethers (TRITON® N), polyoxyethylene isooctylphenyl ethers (TRITON® X). Preferred synthetic surfactants are the surfactants available under the name SPAN® and TWEEN®, such as TWEEN®-80 (Polyoxyethylene (20) sorbitan monooleate) and SPAN®-80 (sorbitan monooleate).
  • Generally speaking, the emulsifier(s) may be present in the vaccine composition in an amount of 0.01% to 40% by volume, preferably, 0.1% to 15%, more preferably 2% to 10%.
  • Additional ingredients present in the instant adjuvant formulations include cationic carriers, immunostimulatory oligonucleotides, monophospholipid A and analogs thereof (MPL-A), Polyinosinic:polycytidylic acid (poly I:C), saponins, quaternary ammoniums, sterols, glycolipids, a source of aluminum (e.g., REHYDRAGEL® or VAC 20® wet gel) and combinations thereof.
  • Suitable cationic carriers include, without limitations, dextran, dextran DEAE (and derivatives thereof), PEGs, guar gums, chitosan derivatives, polycellulose derivatives like hydroxyethyl cellulose (HEC) polyethylenimene, poly aminos like polylysine and the like.
  • Suitable immunostimulatory oligonucleotides include ODN (DNA-based), ORN (RNA-based) oligonucleotides, or chimeric ODN-ORN structures, which may have modified backbone including, without limitations, phosphorothioate modifications, halogenations, alkylation (e.g., ethyl- or methyl- modifications), and phosphodiester modifications. In some embodiments, poly inosinic -cytidylic acid or derivative thereof (poly I:C) may be used.
  • CpG oligonucleotides are a recently described class of pharmacotherapeutic agents that are characterized by the presence of an unmethylated CG dinucleotide in specific base-sequence contexts (CpG motif). (Hansel TT, Barnes PJ (eds): New Drugs for Asthma, Allergy and COPD. Prog Respir Res. Basel, Karger, 2001, vol 31, pp 229-232, which is incorporated herein by reference). These CpG motifs are not seen in eukaryotic DNA, in which CG dinucleotides are suppressed and, when present, usually methylated, but are present in bacterial DNA to which they confer immunostimulatory properties.
  • In selected embodiments, the adjuvants of the instant invention utilize a so-called P-class immunostimulatory oligonucleotide, more preferably, modified P- class immunostimulatory oligonucleotides, even more preferably, E-modified P-class oligonucleotides. P-class immunostimulatory oligonucleotides are CpG oligonucleotides characterized by the presence of palindromes, generally 6-20 nucleotides long. The P-Class oligonucleotides have the ability to spontaneously self-assemble into concatamers either in vitro and/or in vivo. These oligonucleotides are, in a strict sense, single-stranded, but the presence of palindromes allows for formation of concatamers or possibly stem-and-loop structures. The overall length of P- class immunostimulatory oligonucleotides is between 19 and 100 nucleotides, e.g., 19-30 nucleotides, 30-40 nucleotides, 40-50 nucleotides, 50-60 nucleotides, 60-70 nucleotides, 70-80 nucleotides, 80-90 nucleotides, 90-100 nucleotides.
  • In one aspect of the invention the immunostimulatory oligonucleotide contains a 5' TLR activation domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and connected to a 3' palindromic region of at least 8 nucleotides in length either directly or through a spacer.
  • The P-class immunostimulatory oligonucleotides may be modified according to techniques known in the art. For example, J-modification refers to iodo-modified nucleotides. E-modification refers to ethyl-modified nucleotide(s). Thus, E-modified P-class immunostimulatory oligonucleotides are P-class immunostimulatory oligonucleotides, wherein at least one nucleotide (preferably 5' nucleotide) is ethylated. Additional modifications include attachment of 6-nitro-benzimidazol, O-methylation, modification with proynyl-dU, inosine modification, 2-bromovinyl attachment (preferably to uridine).
  • The P-class immunostimulatory oligonucleotides may also contain a modified internucleotide linkage including, without limitations, phosphodiesther linkages and phosphorothioate linkages. The oligonucleotides of the instant invention may be synthesized or obtained from commercial sources.
  • P-Class oligonucleotides and modified P-class oligonucleotides are further disclosed in published PCT application no. WO2008/068638, published on Jun. 12, 2008 . Suitable non-limiting examples of modified P-class immunostiumulatory oligonucleotides are provided below ("*" refers to a phosphorothioate bond and "-" refers to a phosphodiester bond).
    SEQ ID NO: 1 5' TC-GTC-GAC-GATC-GGCGC-GCGCCG 3'
    SEQ ID NO: 2 5' TC-GACGTCGATCGGCGCGCGCCG 3'
    SEQ ID NO: 3 5' TCGACGTCGATCGGCGCGCGCCGT 3'
    SEQ ID NO: 4 5' JUC-GACGTCGATCGGCGCGCGCCG 3'
    SEQ ID NO: 5 5' JUC-GACGTCGATCGGCGCGCGCC G*T 3'
    SEQ ID NO: 6 5' JUCGACGTCGATCGGCGCGCGCC GT 3'
    SEQ ID NO: 7 5' EUC-GACGTCGATCGGCGCGCGCCG 3'
    SEQ ID NO: 8 5' JUC-GTCGACGATCGGCGGCCGCC GT 3'
    SEQ ID NO: 9 5' JUCGTCGACGATCGGCGGCCGCC GT 3'
    SEQ ID NO: 10 5' TC-GTC-GAC-GATC-GGCGC-GCGCCG 3'
    SEQ ID NO: 11 5'-UUGUUGUUGUUGUUGUUGUU-3'
    SEQ ID NO: 12 5'-UUAUUAUUAUUAUUAUUAUU-3'
    SEQ ID NO: 13 5'-AAACGCUCAGCCAAAGCAG-3'
    SEQ ID NO: 14 dTdCdGdTdCdGdTdTdTdTrGrUrUrGrUrGrUdTdTdTdT-3'
  • The amount of P-class immunostimulatory oligonucleotide for use in the adjuvant compositions depends upon the nature of the P-class immunostimulatory oligonucleotide used and the intended species.
  • In addition to the oil and the emulsifier(s), the adjuvant formulations also comprise (or consist essentially of, or consist of) a combination of an immunostimulatory oligonucleotide and a polycationic carrier. These adjuvants are referred to as "TXO".
  • In a set of embodiments, the TXO adjuvants may also include a source of aluminum, such as Al(OH)3 gel. The TXO adjuvants with aluminum are referred to as "TXO-A".
  • In a set of embodiments, adjuvants TXO and TXO-A may optionally contain a sterol, such as, for example, cholesterol, lanosterol, sigmasterol, etc. TXO and TXO-A adjuvants containing the sterol are referred to as TCXO and TCXO-A, respectively. The optionally present sterol may be present in the amount of up to about 1000 µg (e.g., 100-1000 µg, 200-1000 µg, 250-700 µg, or about 400-500 µg) per dose.
  • In a set of embodiments, in TXO adjuvants, the immunostimulatory oligonucleotide, preferably an ODN, preferably containing a palindromic sequence, and optionally with a modified backbone, may be present in the amount of 5-400 µg per dose, and the polycationic carrier may be present in the amount of 5-400 mg per dose.
  • For example, in certain embodiments, one dose of TXO would comprise between about 5 and 400 µg per dose (e.g., 6.25-200 µg or 6.25-100 µg or 6.25-50 µg or 6.25-25 µg or 6.25-10 µg or 10-200 µg or 25-200 µg or 25-100 µg or 25-50 µg or 25-100 µg or 50-100 µg per dose) of the immunostimulatory oligonucleotide, and the polycationic carrier may be present in the amount of between about 5 and about 500 mg per dose (e.g., 6.25-200 mg or 6.25-100 mg or 6.25-50 mg or 6.25-25 mg or 6.25-10 mg or 10-200 mg or 25-200 mg or 25-100 mg or 25-50 mg or 25-100 mg or 50-100 mg per dose).
  • In certain embodiments, TXO adjuvants are prepared as follows:
    1. a) Sorbitan monooleate is dissolved in light mineral oil. The resulting oil solution is sterile filtered;
    2. b) The immunostimulatory oligonucleotide, Dextran DEAE and Polyoxyethylene (20) sorbitan monooleate are dissolved in aqueous phase, thus forming the aqueous solution; and
    3. c) The aqueous solution is added to the oil solution under continuous homogenization thus forming the adjuvant formulation TXO.
  • In a set of embodiments, in TXO-A adjuvants, the immunostimulatory oligonucleotide is present as in the TXO adjuvant, the source of aluminum is present in the amount of up to 40% v/v (e.g., 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%). In a set of embodiments, the source of aluminum is present at 2%-20% v/v of the vaccine composition, more preferably between about 5% and about 17% v/v.
  • In certain embodiments, TXO-A adjuvants are prepared similarly to TXO adjuvants, and the source of aluminum is added to the aqueous solution.
  • In preparation of TCXO and TCXO-A adjuvants, cholesterol is dissolved in the oil solution, and the other steps of making TCXO and TCXO-A are similar to the steps used in preparation of TXO and TXO-A, respectively.
  • Antigens
  • The inventors have surprisingly discovered that the adjuvants of the instant invention are capable of causing sufficient protection from Foot-And-Mouth disease even when the dose of the antigen is decreased from 10 µg of the inactivated FMD Cruzeiro strain virus to 0.5 µg. Thus, in different embodiments of the invention, the amount of the inactivated FMD Cruzeiro strain virus may be 0.5 µg, about 1 µg, about 2 µg, about 3 µg, about 4 µg, about 5 µg, about 6 µg, about 7 µg, about 8 µg, about 9 µg or about 10 µg. The amount of the antigen may be between 0.5 and 1 µg, between 1 and 2 µg, between 2 and 3 µg, between 3 and 4 µg, between 4 and 5 µg, between 5 and 6 µg, between 6 and 8 µg, between 8 and 10 µg of inactivated FMD Cruzeiro strain virus (140 S particles).
  • Currently, seven serotypes of FMD have been isolated. Of the seven serotypes of this virus, A, C, O, Asia 1, and SAT3 appear to be distinct lineages; SAT 1 and SAT 2 are unresolved clades. Within each serovar, multiple strains exist. For example, A24 Cruzeiro belongs to serotype A, and O1 Campos belongs to serotype O.
  • FMD virus Cruzeiro strain, which is of serotype A, is used as an antigen in this invention, provided that such virus is not pathogenic. Pathogenicity is reduced by inactivation of the virus, e.g., treatment with formaldehyde or BEI.
  • In certain embodiments, the virus may be attenuated by culture passage or via recombinant means. It has previously been demonstrated, for example, that deletion of the leader protein Lpro coding region results in FMD virus which is attenuated in cattle and pigs. See, e.g., US 5,824,316 , US 8,765,141 , Virology 1997 227(1): 96-102, J.Virol 2012 86:11675-11685. Point mutations in at positions 55 and 58 within the SAP domain of L protein also resulted in a viable virus that displayed a mild attenuated phenotype in cell culture and was protective in swine FMD model. See US Patent No. 8,846,057 .
  • In certain embodiments, the virus also contains negative antigenic markers which allow for DIVA (differentiating infected from vaccinated animals) assays. In certain embodiments, the negative antigenic markers are introduced to 3D and/or 3B proteins. See, e.g., SEQ ID NOs 19, 20, 21, 22.
  • Like other viruses, the FMD virus continually evolves and mutates, thus one of the difficulties in vaccinating against it is the huge variation between, and even within, serotypes. There is no cross-protection between serotypes (a vaccine for one serotype will not necessarily protect against any others) and in addition, two strains within a given serotype may have nucleotide sequences that differ by as much as 30% for a given gene. This means FMD vaccines must be highly specific to the strain involved.
  • Thus, in certain embodiments, endonuclease restriction sites are introduced into the genome of the virus, thereby allowing introduction of proteins (e.g., proteins forming the outer capsids) from heterologous FMD strains.
  • In certain embodiments, the antigen component comprises FMD strain A24 Cruzeiro, which may optionally be modified by deletion of leader protein, negative marker mutations in 3B and/or 3D proteins, and by introduction of restriction endonuclease sites for an easier introduction of sequences for antigens (e.g., capsid proteins) from heterologous strains. Suitable non-limiting examples of the antigens are described in US 8,765,141 . DNA sequences corresponding to RNA genome of a genetically modified FMDV are also provided in SEQ ID NO: 15 (A24LL3DYR) and SEQ ID NO: 17 (A24 LL3B PVKV3DYR). Thus, a DNA sequence complementary to the DNA sequence set forth e.g., in SEQ ID NO: 15 is a template for, i.e. is complementary to or "encodes", the RNA genome of the FMDV virus (i.e., RNA that encodes the FMDV). In certain embodiments, the virus comprises capsid protein(s) of heterologous FMD strains (i.e., strains of FMD other than A24 Cruzeiro, including without limitations, strains of lineages C, O, Asia 1, SAT3, SAT 1 and SAT 2, Turkey 06 and other strains of lineage A). Non limiting examples of such heterologous antigens are illustrated in SEQ ID NO: 23 (Asia1-A24LL3BPVKV3DYR) and SEQ ID NO: 24 (A/Turkey/06-A24LL3BPVKV3DYR). Additionally, O1 campos-A24LL3BPVKV3DYR (complete genome, also referred as O1campos), C3 Indaial-A24LL3BPVKV3DYR (complete genome), and capsid Argentina 2001 iso93 (capsid and 2A partial sequence) are provided in SEQ ID NOs 25, 26, and 27, respectively.
  • Variants of such antigens are also envisioned. The variants are at least 80% identical (e.g., 85% identical, 90% identical, 95% identical, 96% identical, 97% identical, 98% identical or 99% identical) to a reference sequence using one of the alignment programs described using standard parameters. Multiple alignment tools are available to determine sequence identity, including, without limitations, BLAST, CLUSTAL or PHILIP.
  • One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like.
  • In certain embodiments, the variants encompass more than the specific exemplary nucleotide or amino acid sequences and include functional equivalents thereof. Alterations in a nucleic acid fragment that result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products.
  • The polypeptides disclosed herein may also be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Novel proteins having properties of interest may be created by combining elements and fragments of proteins of the present invention, as well as with other proteins. Methods for such manipulations are generally known in the art. Thus, the genes and nucleotide sequences of the invention include both the naturally occurring sequences as well as mutant forms. Likewise, the proteins of the invention encompass naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired modified activities of the parent FMD virus. The mutations that will be made in the DNA encoding the variant must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure.
  • Methods of growing and purifying the antigens suitable for the instant invention are well known in the art and include, without limitations, hollow fiber filtration and PEG precipitation. These methods yield somewhat different antigenic compositions. For example, in PEG precipitation, the antigenic composition is depleted of non-structural proteins. In other methods, such as, for example, hollow fiber filtration, the antigenic composition contains both structural and non-structural FMD proteins. Accordingly, in some embodiments, the FMD antigen comprises structural proteins. In other embodiments, such as, for example, where the FMD antigen is prepared by hollow fiber filtration, the FMD antigen comprises both structural and non-structural proteins, particularly 3D protein.
  • Using current vaccine platforms, devoid of intrinsic antigenic markers to differentiate vaccinated from infected animals, removal of non-structural proteins is desirable as this remains desirable due to the fact that presence of antibodies to non-structural protein identifies infected animals. However in the context of the FMDLL3B3D platform, the presence of non-structural protein in the antigen preparation does not preclude differentiation between vaccinated and infected animals. It is in this context that the present formulation of antigen including non-structural proteins and adjuvant provide both protection against clinical disease at lower doses than purified antigen formulations and also prevent more effectively the establishment of persistent infections in ruminants.
  • Compositions
  • The compositions of the present invention can be formulated following accepted convention to include acceptable carriers for animals, including humans, such as standard buffers, stabilizers, diluents, preservatives, and/or solubilizers, and can also be formulated to facilitate sustained release. Diluents include water, saline, dextrose, ethanol, glycerol, and the like. Additives for isotonicity include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin, among others. Other suitable vehicles and additives, including those that are particularly useful in formulating modified live vaccines, are known or will be apparent to those skilled in the art. See, e.g., Remington's Pharmaceutical Science, 18th ed., 1990, Mack Publishing, which is incorporated herein by reference.
  • The compositions of the present invention can further comprise one or more additional immunomodulatory components such as, e.g., an additional adjuvant or cytokine, among others. Non-limiting examples of such additional adjuvants that can be used in the vaccine of the present invention include the RIBI adjuvant system (Ribi Inc., Hamilton, Mont.), Freund's complete and incomplete adjuvants, Block copolymer (CytRx, Atlanta Ga.), QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron, Emeryville Calif.), AMPHIGEN® adjuvant, saponin, Quil A or other saponin fraction, monophosphoryl lipid A, and Avridine lipid-amine adjuvant. Other immunomodulatory agents that can be included in the vaccine include, e.g., one or more interleukins, interferons, or other known cytokines.
  • The routes of administration for the adjuvant compositions include parenteral, oral, oronasal, intranasal, intratracheal, topical, subcutaneous, intramuscular, transcutaneous, intradermal, intraperitoneal, intraocular, intravenous, and lingual administration. Any suitable device may be used to administer the compositions, including syringes, droppers, needleless injection devices, patches, and the like. The route and device selected for use will depend on the composition of the adjuvant, the antigen, and the subject, and are well known to the skilled artisan.
  • In view of high infectivity of FMD, measures which need to be taken to contain and/or eliminate FMD outbreak are controlled by regulatory authorities, such as, for example, national Ministries of Agriculture and sanctioned by international organizations such as the OlE (International Office of Epizootics). The measures which need to be undertaken in connection with the outbreak may include, without limitations, standstill of animal movements, effective controls on the movement of animal products, including milk, meat, hide, etc, stamping-out policy (slaughter of the animals in affected herd, and, where appropriate, those in other herds which have been exposed to infection by direct animal to animal contact, or by indirect contact with the pathogen). Often the animals in the neighboring herds are vaccinated followed by slaughter.
  • The inventors have surprisingly discovered that certain immunogenic compositions described herein prevent persistence, which is defined as the presence or shedding of FMD for longer than 28 days after the infection. In certain embodiments, such immunogenic compositions comprise an antigen component and an adjuvant component, wherein the adjuvant component comprises (or consists essentially of or consists of) an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide comprising CpG in the amount of 75-200 µg per dose, and diethylaminoethyl (DEAE) Dextran in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to at least 6 µg of an inactivated FMD Cruzeiro strain virus per dose.
  • In certain embodiments, antigen may be present in the amount equivalent to 6-10 µg of an inactivated FMD Cruzeiro strain virus per dose, e.g., 8-10 µg of an inactivated FMD Cruzeiro strain virus per dose. The amount of the immunostimulatory oligonucleotide comprising CpG may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 µg per dose. The diethylaminoethyl (DEAE) Dextran may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose.
  • Therefore, also disclosed herein is a method of reducing frequency of FMD persistence in a ruminant infected with FMD comprising administering to said ruminant prior to the infection the immunogenic compositions which comprise an antigen component and an adjuvant component, wherein the adjuvant component comprises (or consists essentially of or consists of) an emulsion containing an oily phase, said oily phase comprising at least 50% v/v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 µg per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigen component comprises a FMD (Foot-and-Mouth Disease) antigen in the amount equivalent to at least 6 µg of FMD virus per dose.
  • In reference aspects, the amount of the antigen may be equivalent to 6-20 µg of FMD virus per dose, e.g., 8-20, 10-20, 12-20, 14-20, 16-20, 18-20, 6-10, 6-12, 6-18, 8-12, or 8-10 µg of FMD virus per dose. The amount of the immunostimulatory oligonucleotide may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 µg per dose. The polycationic polymer may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose.
  • Administration of these immunogenic compositions to ruminants (e.g., cattle, sheep, camels, etc.) allows for the change in herd management practices. In such reference aspects, the vaccinated members of the herd are not slaughtered after a suspected contact with FMD virus.
  • In alternative (or additional) reference aspects, the vaccinated animals are kept in quarantine for a shorter time. Thus, in certain reference aspects, the animals suspected of coming in contact with FMD may be kept in quarantine for less than 30 days, e.g., 28 days, or 29 days.
  • Further, designation of an area as a containment zone means severe limitations of prohibition on movement of animals or animal products from the containment zone, generally, 30 days or more. Thus, in certain reference aspects, the animals suspected of coming in contact with FMD may be moved from the containment zone within less than 30 days, e.g., 28 days or 29 days from the suspected contact with FMD.
  • In the embodiments where the antigen component entails a genetically engineered FMD antigen, e.g., as described above, it is possible to differentiate vaccinated from infected animals. Therefore, in additional reference aspects, the herd management methods (or method of reducing frequency of FMD persistence in a ruminant infected with FMD).
  • In other words, the immunogenic compositions, in certain embodiments comprising an antigen component and an adjuvant component, wherein the adjuvant component comprises (or consists essentially of or consists of) an emulsion containing oil, an immunostimulatory oligonucleotide comprising CpG in the amount of 75-200 µg per dose, and diethylaminoethyl (DEAE) Dextran in the amount of 75-200 mg per dose; and the antigen component comprises a FMD antigen in the amount equivalent to at least 6 µg of an inactivated FMD Cruzeiro strain virus per dose may be used for herd management wherein, upon suspected contact with FMD infection, the vaccinated members of said herd are not slaughtered; and/or quarantined for 0-30 days after the suspected contact and/or moved beyond the infected premises within 30 days of the suspected contact.
  • In different embodiments, the amount of the antigen may be equivalent to 6-10 µg of an inactivated FMD Cruzeiro strain virus per dose, e.g., 8-10 µg of an incativated FMD Cruzeiro strain virus per dose. The amount of the immunostimulatory oligonucleotide comprising CpG may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 µg per dose. The diethylaminoethyl (DEAE) Dextran may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose.
  • The invention will be further described in the following non-limiting examples.
  • EXAMPLES Example 1. Preparation of Antigens
  • Two methods were used to prepare the antigens: Hollow Fiber Filtration and PEG precipitation.
  • PEG (poly-ethylene glycol) precipitation methods have been known in the art. Briefly, BHK-21 cells were infected with the FMD virus. Then (24-36 h later) the cells were lysed by freeze-thawing, and cell lysate was clarified of cell debris by low speed centrifugation (500 x g). PEG was added (8% w/v) to the supernatant containing both structural and non-structural proteins. The mixture was incubated for 12-18 hr at 4°C. During this incubation, FMDV particles associate with the PEG. Antigen was recovered by centrifugation at 16,000 xg and collection of the precipate pellet containing PEG and virus. The supernatant, containing cellular and viral non-structural proteins was discarded. The pellet, to which the virus particles are bound, was then washed with small volumes of buffer to elute the FMDV particles from the PEG.
  • An additional method described herein is based on hollow-fiber concentration, of FMDV culture supernatants. The steps of this method consist of successive filtration arrangement to remove first the cell debris and large material from the cultures (BHK-21 cells infected with the FMD virus and lysed by freeze-thawing). The culture material was pumped successively through a 10 µm capsule filter, a 4.5 µm capsule filter, then finally through a 0.8 µm/0.2 µm filter. This filtrate was then concentrated using a hollow fiber ultrafiltration cartridge that allows particles smaller than 0.01 µm to flow through the membrane. FMDV particles and many non-structural proteins remain in the column circuit while liquid and smaller proteins go through the membrane into the waste. The column circuit was run until the concentrate reaches the desired volume, normally a ten-fold concentration.
  • Figure 1 is a Western blot illustrating the difference in quality between the PEG precipitated and hollow fiber concentrated antigens. Hollow fiber concentrated antigen contains large amounts of structural and non structural proteins as illustrated in this figure by western blot staining using an antibody specific for protein 3D, the largest FMDV non-structural proteins and antibody specific to capsid protein (structural protein). In contrast, PEG-precipitated antigens (lane 9) contained structural protein but did not contain detectable levels of 3D protein.
  • Example 2. Effects of FMD vaccines adjuvanted with TXO Animals and Sample Collection
  • Six- to eight-month-old Holstein steers weighing 180-230 kg were used in this study. The animals were free of FMDV-reactive antibodies as determined by 3D ELISA test prior to vaccination as determined later from serum samples taken on Day 0. All 28 animals were commingled in one room in a BSL-3-Ag animal testing facility. The animals were fed complete ration pellets or alfalfa cubes, with water and salt blocks available ad libitum. Animals were acclimatized five days to the facilities prior to Day 0. Animals were previously treated with Bovi-Shield GOLD ® 5, Micotil® 300, Liquamycin®LA-200® and Dectomax®. Groups of animals (n=4 each) with consecutive ear tag numbers were assigned to a treatment group.
  • No adverse events were documented following vaccination.
  • Serum separator blood tubes to obtain serum samples were collected at Days 0 (before vaccination), 4, 7, 14, 21 (before challenge), 24, 28, 31 and 42 from all animals. The serum samples were kept frozen until tested for the presence of neutralizing antibodies against FMDV in a serum neutralization assay (reported as the reciprocal of the last serum dilution to neutralize 100 TCID50 of homologous FMDV in 50% of the wells) or to study the anti-3Dpol response (by means of a competitive Enzyme-Linked Immunosorbent Assay).
  • As recommended by the OlE ("Manual of Diagnostic Tests and Vaccines forTerrestrial Animals"), challenge of vaccinated cattle for vaccine efficacy was by needle inoculation by the intradermal lingual (IDL) route. At 21 days post-vaccination, all vaccinated and naïve animals were inoculated IDL with 10,000 BTID50 (50% bovine tongue infectious doses) of homologous FMDV A24 Cruzeiro divided as 4 inoculations of 0.1 ml/each with 2,500 BTID50/0.1 ml. All animals were followed for 10 days post-challenge to assess development of clinical disease as expressed by fever, nasal secretion, salivation, loss of appetite and / or lameness. Clinical evaluation for the presence of hoof vesicles was performed with sedation (xylazine given IM at 0.22 mg/kg so as to maintain sternal recumbency for the duration of the procedure) at day 21 (before inoculation) and days 24, 28 and 31. The sedative was reversed with tolazoline, IV, at a dose of 2 mg/kg.
  • Vaccines
  • Antigens were prepared as described in Example 1. Antigen stock solutions contained 5.51 µg/ml antigen prepared by hollow fiber filtertration (Prep A) or 10.26 pg/ml antigen prepared by PEG precipitation (Prep B).
  • The details of the immunogenic compositions administered to the animals are provided in Table 1. Each group contained four animals. Table 1. Study Design
    Group Antigen Amount/5 ml Adjuvant/5 ml Volume injected, ml, IM
    T01 None N/A PBS (Neg control) 5
    T02 FMDV (Prep B)-PEG ppt. 8 µg Light Mineral oil - SPAN®80 5
    T03 FMDV (Prep B) PEG ppt. 2 µg TWEEN®80 1.25
    DEAE Dextran (100 mg);
    T04 FMDV (Prep B)-PEG ppt. 0.5 µg SEQ ID NO: 8; 75% pure: 100 µg 0.3125
    T05 FMDV (Prep A) - Hollow fiber filt.- 8 µg 5
    T06 FMDV (Prep A)-Hollow fiber filt. 2 µg 1.25
    T07 FMDV (Prep A)-Hollow fiber filt. 0.5 µg 0.3125
  • The immunogenic compositions of groups T02 through T06 were homogenized on the day of vaccination and administered to the animals on Day 0.
  • Persistence was measured as the presence or absence of virus (either FMDV viral RNA and/or infectious FMDV) determined using both viral isolation and quantitative rRT-PCR. The primers used for the quantitative rRT-PCR were as follows:
    Forward (SEQ ID NO: 28): GACAAAGGTTTTGTTCTTGGTCA
    Reverse (SEQ ID NO: 29): TGCGAGTCCTGCCACGGA
    Taqman probe: (FAM reporter, TAMRA quencher, SEQ ID NO: 30) TCCTTTGCACGCCGTGGGAC
  • Serum neutralizing titers to FMDV are summarized in Table 2. Table 2 - Serum Neutralizing Titers
    Treatment Serum Neutralizing Titer
    Day 0 Day 21 Day 42
    T01 0.45 a 0.45 a 2.62 ab
    T02 0.45 a 1.64 c 2.84 b
    T03 0.45 a 0.90 b 2.39 ab
    T04 0.45 a 0.76 b 2.74 ab
    T05 0.45 a 1.55 c 2.28 a
    T06 0.45 a 0.81 b 2.36 ab
    T07 0.45 a 0.54 a 2.68 ab
    a,b,cTreatment groups with same letter within each day are not significantly different at alpha=0.05
  • Signs of FMDV were scored as presence (1) or absence (0) of hoof vesicles, i.e., a presence of a vesicle on a single hoof produced the score of 1, the presence of vesicles on only 2 hooves produced score of 2 and vesicles on all 4 hooves produced a score of 4. Once an animal received a score of 4, it was considered to have a score of 4 for the duration of the study.
  • The scores from individual animals for each hoof and for each day of examination are shown in Table 3. In Table 4, a summary of each animal's scores according to whether any hoof was positive is presented. Table 3 - FMDV Vesicle Scoring individual Animal Listing
    Day of Study
    21 24 28 31
    Location Location Location Location
    LEFT FOR E LEFT REA R RIGH T FORE RIGH T REAR LEFT FOR E LEFT REA R RIGH T FORE RIGH T REAR LEFT FOR E LEFT REA R RIGH T FORE RIGH T REAR LEFT FOR E LEFT REA R RIGH T FORE RIGH T REAR
    Treatme nt Anim al
    T01 R14-84 0 0 0 0 0 1 0 1 1 1 1 1 1* 1* 1* 1*
    R14-85 0 0 0 0 1 1 1 1 1* 1* 1* 1* 1* 1* 1* 1*
    R 14-86 0 0 0 0 0 1 0 0 1 1 1 1 1* 1* 1* 1*
    R14-87 0 0 0 0 1 1 1 1 1* 1* 1* 1* 1* 1* 1* 1*
    T02 R14-72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    T03 R14-76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-77 0 0 0 0 0 1 0 0 0 1 0 0 0 1 0 0
    R14-78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    T04 R14-80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-82 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-83 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    T05 R14-60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    T06 R14-64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-65 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-66 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-67 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    T07 R14-68 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-69 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    R14-71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
    *Automatically scored as a '1' since all hooves for this animal previously had vesicles on all four hooves.
    Table 4 - FMDV Vesicle Scoring - Any Hoof Location Positive
    Day of Study
    21 24 28 31
    Treatment Animal
    T01 R14-84 No Yes Yes Yes*
    R14-85 No Yes Yes* Yes*
    R14-86 No Yes Yes Yes*
    R14-87 No Yes Yes* Yes*
    T02 R14-72 No No No No
    R14-73 No No No No
    R14-74 No No No No
    R14-75 No No No No
    T03 R14-76 No No No No
    R14-77 No Yes Yes Yes
    R14-78 No No No No
    R14-79 No No No No
    T04 R14-80 No No No No
    R14-81 No No No No
    R14-82 No No No No
    R14-83 No No No No
    T05 R14-60 No No No No
    R14-61 No No No No
    R14-62 No No No No
    R14-63 No No No No
    T06 R14-64 No No No No
    R14-65 No No No No
    R14-66 No No No No
    R14-67 No No No No
    T07 R14-68 No No No No
    R14-69 No No No No
    R14-70 No No No No
    R14-71 No No No No
    *Automatically scored as Yes since all hooves for this animal previously had vesicles on all four hooves
  • All animals in T01 (negative control) exhibited hoof vesicles starting on Day 24. On Days 28 and 31, all hooves in all T01 animals were found to have vesicles. In contrast, full protection (i.e., no hoof vesicles) was observed for every group except T03 (2 µg dose of FMDV precipitated with PEG), where one animal (R14-77) received the score of 1 at Days 24, 28, and 31.The effects of the tested immunogenic compositions on persistent infection are illustrated in Tables 5 and 6. Peristence was defined as presence of infectious virus or viral RNA in oesophageal -pharyngeal fluid (obtained using a "Probang" cup) after 28 days post-challenge (day 49 after vaccination, as shown in tables 5 and 6). In Table 5, quantitative rRT-PCR results for individual animals and treatment group back-transformed least square means of FMDV RNA copy numbers per mL from probang samples are shown. In Table 6, results of probang sample virus isolation testing are reported as either positive or negative. The values below 1.87 in table 5 were scored as 'negative' due to limit of detection of the assay. Table 5 - Probang rRT-PCR Individual Animal Listing and Back-Transformed Least Squares Means per Treatment Group
    Day 38 Day 42 Day 49 Day 52
    Treatment Number Animal Test Result Test Result Test Result Test Result
    T01 R14-84 4.29 4.72 <1.87 3.83
    T01 R14-85 4.26 6.01 5.14 4.7
    T01 R14-86 <1.87 3.62 <1.87 <1.87
    T01 R14-87 <1.87 <1.87 <1.87 <1.87
    Group Mean 1.999 3.130 1.432 1.992
    T02 R14-72 <1.87 <1.87 <1.87 <1.87
    T02 R14-73 <1.87 <1.87 <1.87 <1.87
    T02 R14-74 <1.87 <1.87 <1.87 <1.87
    T02 R14-75 <1.87 <1.87 <1.87 <1.87
    Group Mean 0.935 0.935 0.935 0.935
    T03 R14-76 4.98 4.68 <1.87 <1.87
    T03 R14-77 5.52 3.43 <1.87 <1.87
    T03 R14-78 <1.87 4.35 <1.87 5.3
    T03 R14-79 <1.87 <1.87 <1.87 <1.87
    Group Mean 2.214 2.843 0.935 1.443
    T04 R14-80 <1.87 <1.87 4.88 4.59
    T04 R14-81 5.08 4.01 3.98 4.65
    T04 R14-82 <1.87 4.47 6.12 4.32
    T04 R14-83 <1.87 <1.87 <1.87 <1.87
    Group Mean 1.427 1.990 3.247 3.047
    T05 R14-60 <1.87 <1.87 <1.87 <1.87
    T05 R14-61 <1.87 <1.87 <1.87 <1.87
    T05 R14-62 4.75 <1.87 <1.87 <1.87
    T05 R14-63 <1.87 <1.87 <1.87 <1.87
    Group Mean 1.404 0.935 0.935 0.935
    T06 R14-64 <1.87 <1.87 <1.87 <1.87
    T06 R14-65 4.10 4.11 <1.87 3.39
    T06 R14-66 <1.87 <1.87 <1.87 <1.87
    T06 R14-67 4.14 5.08 5.18 4.82
    Group Mean 1.963 2.067 1.434 1.944
    T07 R14-68 <1.87 <1.87 <1.87 <1.87
    T07 R14-69 <1.87 <1.87 <1.87 <1.87
    T07 R14-70 <1.87 <1.87 <1.87 <1.87
    T07 R14-71 5.34 5.46 4.49 3.7
    Group Mean 1.445 1.453 1.384 1.319
    Table 6 - Probang Sample Virus Isolation - Individual Animal Listing
    Day of Study
    38 42 49 52
    Treatment Animal
    T01 R14-84 Pos Pos Pos Pos
    R14-85 Pos Pos Pos Pos
    R14-86 Neg Neg Neg Neg
    R14-87 Neg Neg Neg Neg
    T02 R14-72 Neg Neg Neg Neg
    R14-73 Neg Neg Neg Neg
    R14-74 Neg Pos Neg Neg
    R14-75 Neg Neg Neg Neg
    T03 R14-76 Pos Pos Neg Pos
    R14-77 Pos Pos Neg Neg
    R14-78 Pos Pos Pos Pos
    R14-79 Neg Neg Neg Neg
    T04 R14-80 Pos Neg Pos Pos
    R14-81 Pos Pos Pos Pos
    R14-82 Pos Pos Pos Pos
    R14-83 Pos Pos Pos Pos
    T05 R14-60 Neg Neg Neg Neg
    R14-61 Neg Neg Neg Neg
    R14-62 Neg Neg Neg Neg
    R14-63 Neg Neg Neg Neg
    T06 R14-64 Neg Neg Neg Neg
    R14-65 Pos Pos Pos Pos
    R14-66 Neg Neg Neg Neg
    R14-67 Pos Pos Pos Pos
    T07 R14-68 Neg Neg Neg Neg
    R14-69 Neg Neg Neg Neg
    R14-70 Neg Neg Neg Neg
    R14-71 Pos Pos Pos Pos
  • For Group 1 (saline control), three animals were positive at least once for FMDV by rRT-PCR and two animals were always positive for virus isolation.
  • In Group T02, no animal was ever found to be carrying FMDV by rRT-PCR, but one animal (R14-74) was found to be positive by virus isolation assay at a single time point only (Day 42: day 21 post-challenge) but negative thereafter(Days 49:and 52,indicating the absence of persistent infection. The other animals in T02 did not carry FMDV detectable either by rRT-PCR or by viral isolation assay at day 38 and beyond.
  • In group T03, one animal (R14-79) was fully protected from FMDV infection, two animals demonstrated the presence of FMDV (either by rRT-PCR or by viral isolation assay) on three or four of the testing days and one animal (R14-77) demonstrated FMDV presence by both tests on Days 38 and 42, but not thereafter.
  • In group T04, all four animals exhibited persistence of FMDV by one or both tests through Day 52.
  • In Group T05, one animal (R14-62) demonstrated the presence of the virus only on Day 38 by rRT-PCR but not by virus isolation and and virus was not detected by either test thereafter. FMDV was not detected either by rRT-PCR or by viral isolation assay at any time for the other three animals in group T05.
  • In Group T06, two animals were fully protected from persistence while the other two were either rRT-PCR or virus isolation positive at every time point examined.
  • In group T07, three out of four animals were fully protected while one animal (R14-71) was positive for both rRT-PCR and virus isolation at each time point.
  • Table 7 summarizes the results of persistence experiments. Animals were considered as non-persistent if neitherrRT-PCR or viral isolation assays detected FMDV on both day 49 (28 days post-challenge) and day 52 (31 day post-challenge). Table 7 Frequency of Persistence and Non-Persistence
    Treatment Persistent % Not Persistent %
    T01 (saline) 50 50
    T02 (FMDV PEG ppt - 8 µg) 0 100
    T03 (FMDV PEG ppt - 2 µg) 50 50
    T04 (FMDV PEG ppt - 0.5 µg) 100 0
    T05 (FMDV Hollow fiber - 8 µg) 0 100
    T06 (FMDV Hollow fiber - 2 µg) 50 50
    T07 (FMDV Hollow fiber - 0.5 µg) 25 75
  • Only two of the eight animals administered 8 µg of antigen (Groups T02 and T05) ever exhibited the presence of virus and that was for one day only (one each on Days 37 and 42). The other animals in these groups were fully protected Considering that the virus presence was not detected on both 28 and 31 days after infection, none of the animals administered 8 µg of antigen was considered to be persistently infected. Five out of eight animals administered 2 µg of antigen (Groups T03 and T06) exhibited viral persistence. Four out of eight animals eight animals administered 0.5 µg of antigen (Groups T04 and T07) exhibited persistence.
  • Taken together, these results indicate protection from FMDV viral persistence in animals administered 8 µg antigen, and it also appears that the purification of the antigen by hollow fiber filtration is advantageous compared to PEG precipitation. The main difference between the two antigen formulations is the presence of non-structural proteins in addition to structural ones in the hollow fiber filtration formulation. Thus, without being bound by theory, it appears that the quality of the immune response elicited by vaccines where the antigen contains both structural and non-structural proteins, and particularly protein 3D, are more effective in preventive FMDV persistence, as illustrated in Table 8. Table 8. Effect of antigen preparation method on immune response.
    Treatment Persistent % Not Persistent %
    T01 (saline) 50% (2 out of 4) 50% (2 out of 4)
    Prep A (hollow fiber, groups T05-T07 Combined) 25% (3 out of 12) 75 % (9 out of 12)
    Prep B (PEG precipitation, groups T02-T04 Combined) 50% (6 out of 12) 50% (6 out of 12)
  • All publications cited in the specification, both patent publications and non-patent publications, are indicative of the level of skill of those skilled in the art to which this invention pertains. All these publications are referenced herein.
  • Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention which is defined by the following claims.

Claims (14)

  1. An immunogenic composition comprising an antigen component and an adjuvant component, wherein
    a) the adjuvant component comprises an emulsion containing oil, an immunostimulatory oligonucleotide comprising CpG, and diethylaminoethyl (DEAE) Dextran; and
    b) the antigen component comprises 0.5 - 10 µg of an inactivated FMD (Foot-and-Mouth Disease) Cruzeiro strain virus composition per dose.
  2. The immunogenic composition of claim 1, wherein the immunostimulatory oligonucleotideis a P-class immunostimulatory oligonucleotide.
  3. The immunogenic composition of any one of claims 1-2, wherein the immunostimulatory oligonucleotide comprises at least 15 contiguous nucleotides of SEQ ID NO: 8.
  4. The immunogenic composition of any one of claims 1-3, wherein the volume percentage of the oil is 40% to 85% v/v of the composition.
  5. The immunogenic composition of any one of claims 1-4, wherein the volume percentage of the oil is 44-50 % v/v of the composition.
  6. The immunogenic composition of any one of claims 1-5 further comprising one or more emulsifiers.
  7. The immunogenic composition of any one of claims 1-6, wherein the adjuvant component comprises SEQ ID NO: 8.
  8. The immunogenic composition of any one of claims 1-7, wherein the DEAE Dextran is present in the amount of 6-200 mg per dose and/or wherein the immunostimulatory oligonucleotide is present in the amount of 6-200 µg per dose.
  9. The immunogenic composition of any one of claims 1 to 8, wherein said FMD virus Cruzeiro strain is genetically engineered and contains a deletion of the leader coding region (LL) and, optionally, further contains a capsid protein from a heterologous strain.
  10. The immunogenic composition of any one of claims 1 to 9, wherein said FMD virus Cruzeiro strain contains negative antigenic markers introduced in one or both of the viral non-structural 3Dpol and 3B proteins.
  11. The immunogenic composition of any one of claims 9 or 10, wherein said FMD virus Cruzeiro strain contains a heterologous capsid protein.
  12. The immunogenic composition of claim 11, wherein the strain other than Cruzeiro is selected from Asial, Turkey06, O1Campos, C3lndaial, and A2001-Argentina.
  13. The immunogenic composition of any one of claims 1-12, wherein the antigen component comprises a 0.5 - 6 µg of FMD virus per dose.
  14. An immunogenic composition according to any one of claims 1-13 for use in a method of preventing FMD in an animal in need thereof, comprising administering to said animal the immunogenic composition.
EP16704959.2A 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine Active EP3244920B1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
SI201631724T SI3244920T1 (en) 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine
EP23177533.9A EP4248992A3 (en) 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine
HRP20230752TT HRP20230752T1 (en) 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562104314P 2015-01-16 2015-01-16
PCT/US2016/013587 WO2016115456A1 (en) 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP23177533.9A Division EP4248992A3 (en) 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine

Publications (2)

Publication Number Publication Date
EP3244920A1 EP3244920A1 (en) 2017-11-22
EP3244920B1 true EP3244920B1 (en) 2023-06-07

Family

ID=55361946

Family Applications (2)

Application Number Title Priority Date Filing Date
EP16704959.2A Active EP3244920B1 (en) 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine
EP23177533.9A Pending EP4248992A3 (en) 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP23177533.9A Pending EP4248992A3 (en) 2015-01-16 2016-01-15 Foot-and-mouth disease vaccine

Country Status (27)

Country Link
US (3) US10478487B2 (en)
EP (2) EP3244920B1 (en)
JP (3) JP7113620B2 (en)
KR (3) KR102508719B1 (en)
CN (3) CN115317600A (en)
AR (1) AR103427A1 (en)
AU (2) AU2016206525A1 (en)
BR (1) BR112017015288A2 (en)
CA (1) CA2973828C (en)
CO (1) CO2017007057A2 (en)
DK (1) DK3244920T3 (en)
ES (1) ES2950822T3 (en)
FI (1) FI3244920T3 (en)
HK (1) HK1246659A1 (en)
HR (1) HRP20230752T1 (en)
HU (1) HUE063288T2 (en)
IL (1) IL253137B2 (en)
LT (1) LT3244920T (en)
MX (2) MX2017009306A (en)
PH (1) PH12017501257A1 (en)
PL (1) PL3244920T3 (en)
PT (1) PT3244920T (en)
RU (1) RU2698305C2 (en)
SG (1) SG11201705737RA (en)
SI (1) SI3244920T1 (en)
WO (1) WO2016115456A1 (en)
ZA (1) ZA201704596B (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2973828C (en) * 2015-01-16 2023-09-19 Zoetis Services Llc Foot-and-mouth disease vaccine
CN106474466B (en) * 2016-12-07 2018-04-13 申联生物医药(上海)股份有限公司 A kind of preparation method of aftosa vaccine
KR20230039766A (en) * 2017-12-20 2023-03-21 조에티스 서비시즈 엘엘씨 Vaccines against hendra and nipah virus infection
KR102285977B1 (en) 2019-03-15 2021-08-05 대한민국 An adjuvant which can be administered in combination with an oil emulsion for immunization of foot-and-mouth disease vaccine and vaccine composition containing the same adjuvant
CN112516325B (en) * 2019-09-18 2023-12-08 洛阳赛威生物科技有限公司 Stable foot-and-mouth disease vaccine composition and application thereof
PE20230833A1 (en) * 2020-05-27 2023-05-19 Us Agriculture LIVE ATTENUATED STRAINS OF FOOT AND MOUTH DISEASE MODIFIED BY DEOPTIMIZATION AND THEIR USES

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007053899A1 (en) * 2005-11-10 2007-05-18 Diva Solutions Pty Ltd Differentiating therapeutic composition
WO2008068638A2 (en) * 2006-09-27 2008-06-12 Coley Pharmaceutical Gmbh Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity

Family Cites Families (101)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR228580A1 (en) 1980-11-25 1983-03-30 Torre Jose Leonardo PROCEDURE FOR INACTIVATING FOOT-AND-MOUTH DISEASE VIRUS
US4732971A (en) 1985-06-03 1988-03-22 Eli Lilly And Company Synthetic vaccines for foot and mouth disease
NZ221306A (en) 1986-08-15 1990-02-26 Commw Scient Ind Res Org 2-component immunoadjuvant comprising a mycobacterial free immunoadjuvant oil and a polycationic polyelectrolyte immunoadjuvant and vaccines thereof
ES2037072T3 (en) 1986-12-19 1993-06-16 Duphar International Research B.V STABILIZED COADJUVANT SUSPENSION INCLUDING DIMETHYL-DIOCTADECIL-AMMONIUM BROMIDE.
US5057540A (en) 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
NZ230747A (en) 1988-09-30 1992-05-26 Bror Morein Immunomodulating matrix comprising a complex of at least one lipid and at least one saponin; certain glycosylated triterpenoid saponins derived from quillaja saponaria molina
RU1615918C (en) * 1989-05-22 1995-07-09 Всероссийский научно-исследовательский институт защиты животных Adjuvant
ZA936095B (en) 1992-08-21 1994-03-14 Univ Melbourne Cytokine applications.
US6764682B1 (en) 1994-06-16 2004-07-20 Aventis Pasteur Limited Adjuvant compositions containing more than one adjuvant
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6846489B1 (en) 1995-04-25 2005-01-25 Smithkline Beecham Biologicals S.A. Vaccines containing a saponin and a sterol
US5824316A (en) 1996-05-24 1998-10-20 The United States Of America As Represented By The Secretary Of Agriculture Leader-proteinase deleted foot-and-mouth disease viruses and their use as vaccines
ES2241042T3 (en) 1996-10-11 2005-10-16 The Regents Of The University Of California IMMUNO STIMULATOR POLINUCLEOTIDE CONJUGATES / IMMUNOMODULATOR MOLECULA.
EP0855184A1 (en) 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
WO1998037919A1 (en) 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
EP2172216A3 (en) 1997-03-10 2010-11-24 Ottawa Hospital Research Institute Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
BR9809426A (en) 1997-04-30 2000-06-13 Merieux Oravax Composition of anti-helicobacter vaccine for use by the subdiaphragmatic systemic route and combined mucosal / parenteral immunization method
DE69841002D1 (en) 1997-05-14 2009-09-03 Univ British Columbia Highly effective encapsulation of nucleic acids in lipid vesicles
JP4101888B2 (en) 1997-06-06 2008-06-18 ダイナバックス テクノロジーズ コーポレイション Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
NZ508650A (en) 1998-05-14 2003-05-30 Coley Pharm Gmbh Regulating hematopoiesis using unmethylated C and G CpG-oligonucleotides with a phosphorothioate modification
EP1733735B1 (en) 1998-05-22 2017-03-22 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US20040247662A1 (en) 1998-06-25 2004-12-09 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
DK1104306T3 (en) 1998-08-10 2006-05-22 Antigenics Inc Preparations of CpG and Saponin Adjuvants and Methods for Using Them
AUPP807399A0 (en) * 1999-01-08 1999-02-04 Csl Limited Improved immunogenic lhrh composition and methods relating thereto
AU2501700A (en) * 1999-01-12 2000-08-01 Princeton University Glycopeptide antibiotics containing a desmethylvancosamine residue, combinatorial libraries of same and methods of producing same
EP2286792A1 (en) 1999-02-26 2011-02-23 Novartis Vaccines and Diagnostics, Inc. Microemulsions with an adsorbent surface, comprising a microdroplet emulsion
WO2000061184A2 (en) 1999-04-08 2000-10-19 Glenn Gregory M Dry formulation for transcutaneous immunization
US6977245B2 (en) 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
HU229255B1 (en) 1999-04-19 2013-10-28 Smithkline Beecham Biolog Vaccines
DE60013591T2 (en) 1999-04-29 2005-02-03 Coley Pharmaceutical Gmbh SCREENING FOR MODULATORS OF THE FUNCTION OF IMMUNSTIMULATORY DNA
DE60131430T2 (en) 2000-01-14 2008-10-16 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services OLIGODE OXYNUCLEOTIDES AND THEIR USE FOR INDUCING AN IMMUNE REACTION
EP1311288A1 (en) 2000-01-20 2003-05-21 Ottawa Health Research Institute Immunostimulatory nucleic acids for inducing a th2 immune response
AT409085B (en) 2000-01-28 2002-05-27 Cistem Biotechnologies Gmbh PHARMACEUTICAL COMPOSITION FOR IMMUNULATING AND PRODUCING VACCINES
RS51164B (en) 2000-02-21 2010-10-31 H. Lundbeck A/S. Method for down-regulation ofamyloid
EP1278761B1 (en) 2000-05-01 2005-04-06 Hybridon, Inc. MODULATION OF OLIGONUCLEOTIDE CpG-MEDIATED IMMUNE STIMULATION BY POSITIONAL MODIFICATION OF NUCLEOSIDES
AT410173B (en) 2000-06-08 2003-02-25 Cistem Biotechnologies Gmbh ANTIQUE COMPOSITION
GB0025577D0 (en) 2000-10-18 2000-12-06 Smithkline Beecham Biolog Vaccine
EP1350262B8 (en) 2000-12-08 2008-08-13 Coley Pharmaceuticals GmbH Cpg-like nucleic acids and methods of use thereof
US7244438B2 (en) 2001-01-05 2007-07-17 Intercell Ag Uses for polycationic compounds
US7713942B2 (en) 2001-04-04 2010-05-11 Nordic Vaccine Technology A/S Cage-like microparticle complexes comprising sterols and saponins for delivery of polynucleotides
ES2399386T3 (en) 2001-04-05 2013-04-01 Novartis Vaccines And Diagnostics, Inc. Increased mucosal immunity after parenteral sensitization
US7105495B2 (en) 2001-04-30 2006-09-12 Idera Pharmaceuticals, Inc. Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
WO2002094845A2 (en) 2001-05-21 2002-11-28 Intercell Ag Method for stabilising of nucleic acids
EP1395262A4 (en) 2001-06-15 2006-04-12 Ribapharm Corp Nucleoside vaccine adjuvants
PT2027873E (en) 2001-07-02 2015-11-03 Zoetis Services Llc One dose vaccination with mycoplasma hyopneumoniae
EP1521592A2 (en) 2001-07-02 2005-04-13 Pfizer Products Inc. Mycoplasma hyopneumoniae vaccine and methods for reducing mycoplasma bovis pneumonia in cattle
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
JP2005518343A (en) 2001-08-03 2005-06-23 メダレックス, インク. Novel PGC-1 isoforms and their use to improve use-mediated immunotherapy
AU2002326561B2 (en) 2001-08-07 2008-04-03 Dynavax Technologies Corporation Immunomodulatory compositions, formulations, and methods for use thereof
US20030138434A1 (en) 2001-08-13 2003-07-24 Campbell Robert L. Agents for enhancing the immune response
EP1446162B1 (en) 2001-08-17 2008-10-15 Coley Pharmaceutical GmbH Combination motif immune stimulatory oligonucleotides with improved activity
IL159145A0 (en) 2001-08-28 2004-06-01 Pfizer Prod Inc Mycoplasma bovis challenge model, methods for administering m. bovis and methods for inducing pneumonic lung lesions
CA2492826C (en) 2001-09-14 2016-12-13 Cytos Biotechnology Ag Encapsulation of unmethylated cpg-containing oligonucleotides into virus-like particles: method of preparation and use
WO2004012669A2 (en) 2002-08-01 2004-02-12 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory arthropathies with suppressors of cpg oligonucleotides
US20030119774A1 (en) 2001-09-25 2003-06-26 Marianna Foldvari Compositions and methods for stimulating an immune response
GB0123580D0 (en) 2001-10-01 2001-11-21 Glaxosmithkline Biolog Sa Vaccine
CA2471968C (en) 2001-10-06 2013-07-23 Merial Limited Immunostimulatory nucleic acids and use thereof
US7276489B2 (en) 2002-10-24 2007-10-02 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
RU2212895C2 (en) 2001-11-01 2003-09-27 Федеральное государственное учреждение Всероссийский научно-исследовательский институт защиты животных Vaccine against o-type foot-and-mouth disease and method for its preparing
CA2472055A1 (en) 2001-11-07 2003-05-15 Inex Pharmaceuticals Corporation Improved mucosal vaccines and methods for using the same
JP2005519035A (en) 2001-12-07 2005-06-30 インターツェル・アクチェンゲゼルシャフト Immunostimulatory oligodeoxynucleotides
CA2474709A1 (en) 2002-02-04 2003-08-14 Biomira, Inc. Immunostimulatory, covalently lipidated oligonucleotides
US8088388B2 (en) 2002-02-14 2012-01-03 United Biomedical, Inc. Stabilized synthetic immunogen delivery system
JP2005517718A (en) 2002-02-19 2005-06-16 シンセリカ・コーポレイション Compositions and methods for modulation of immune response and transport by surrogate antibodies
CA2478932A1 (en) * 2002-03-29 2003-10-16 Merck & Co., Inc. Large scale methods of producing adenovirus and adenovirus seed stocks
AU2003230806B2 (en) 2002-04-04 2009-05-07 Zoetis Belgium S.A. Immunostimulatory G,U-containing oligoribonucleotides
AU2003262379A1 (en) 2002-04-16 2003-11-03 Auburn University TRANSIENT AND/OR PERMANENT MODIFICATION OF SEXUAL BEHAVIOR AND/OR FERTILITY USING RECOMBINANT CHIMERIC GnRH
US7371734B2 (en) 2002-04-22 2008-05-13 Bioniche Life Sciences Inc. Oligonucleotide compositions and their use for the modulation of immune responses
KR100456681B1 (en) 2002-05-22 2004-11-10 주식회사 대웅 Immnune-stimulating and controlling Composition comprising bacterial chromosomal DNA fragments and detoxified lipopolysaccharides
WO2003100040A1 (en) 2002-05-28 2003-12-04 Merck Patent Gmbh A method for generating antigen-presenting cells
CA2388049A1 (en) 2002-05-30 2003-11-30 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
SE0201701D0 (en) 2002-06-05 2002-06-05 Gotovax Ab Treatment of epithelial tumors and infections
AU2003243409A1 (en) 2002-06-05 2003-12-22 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory cpg nucleic acids
RU2220744C1 (en) 2002-07-01 2004-01-10 Федеральное государственное учреждение Всероссийский научно-исследовательский институт защиты животных Vaccine against foot-and-mouth asia-1 type and method for it preparing
MXPA05004969A (en) 2002-11-05 2005-08-02 James Hardie Int Finance Bv Method and apparatus for producing calcium silicate hydrate.
KR20050103215A (en) 2003-01-29 2005-10-27 화이자 프로덕츠 인코포레이티드 Canine vaccines against bordetella bronchiseptica
ZA200507562B (en) * 2003-03-26 2006-11-29 Cytos Biotechnology Ag HIV-peptide-carrier-conjugates
NZ542576A (en) 2003-04-04 2008-11-28 Pfizer Prod Inc Submicron oil-in-water emulsions composed of a non-metabolizable oil, at least one surfactant, and an aqueous component, where the oil is dispersed in the aqueous component with al droplet size in the submicron range
SE0301998D0 (en) 2003-07-07 2003-07-07 Isconova Ab Quil A fraction with low toxicity and use thereof
CA2561914C (en) 2004-04-05 2013-09-10 Pfizer Products Inc. Microfluidized oil-in-water emulsions and vaccine compositions
WO2006078943A2 (en) * 2005-01-19 2006-07-27 Micro Beef Technologies, Ltd. Method and system for tracking and managing animals and/or food products
CA2604488A1 (en) 2005-04-07 2006-10-12 Pharmacia & Upjohn Company Llc Formulations and process for production of bordetella bronchiseptica p68 antigen and vaccines
AU2007209104B2 (en) 2006-01-26 2010-04-08 Zoetis Services Llc Novel glycolipid adjuvant compositions
US20080038295A1 (en) * 2006-04-13 2008-02-14 Regents Of The University Of Michigan Compositions and methods for orthopox virus vaccination
US20080292663A1 (en) 2007-05-22 2008-11-27 Gerber Jay D Adjuvant compositions and methods for delivering vaccines
CL2008001806A1 (en) 2007-06-20 2008-09-05 Wyeth Corp COMPOSITION OF VACCINE IN EMULSION WATER IN OIL THAT INCLUDES AN ANTIGEN AND AN ADJUSTER IN THE WATERPROOF PHASE; AND METHOD OF ELABORATION.
BRPI0913954B1 (en) * 2008-06-27 2022-04-05 Zoetis Services Llc Vaccine compositions and their use
AU2010218752B2 (en) 2009-02-27 2015-05-28 Toray Industries, Inc. Immunogenic composition
US20110014232A1 (en) * 2009-07-16 2011-01-20 Agricultural Research Council Chimeric foot and mouth disease viruses
WO2011031850A1 (en) * 2009-09-10 2011-03-17 Merial Limited New vaccine formulations comprising saponin-containing adjuvants
US8846057B2 (en) 2010-01-19 2014-09-30 The United States Of America, As Represented By The Secretary Of Agriculture Recombinant live attenuated foot-and-mouth disease (FMD) vaccine containing mutations in the L protein coding region
US8765141B2 (en) 2010-07-01 2014-07-01 The United States Of America, As Represented By The Secretary Of Agriculture Development of a marker foot and mouth disease virus vaccine candidate that is attenuated in the natural host
SI2670432T1 (en) 2011-02-04 2021-08-31 Zoetis Services Llc Immunogenic bordetella bronchiseptica compositions
EP3777886A1 (en) * 2012-11-16 2021-02-17 United Biomedical Inc. Synthetic peptide-based emergency vaccine against foot and mouth disease (fmd)
CN103083663B (en) * 2013-02-04 2014-12-10 江苏省农业科学院 Immunity enhancing agent, inactivated vaccine, and preparation method thereof
NZ717594A (en) 2013-09-19 2017-07-28 Zoetis Services Llc Oil-based adjuvants
CA2973828C (en) * 2015-01-16 2023-09-19 Zoetis Services Llc Foot-and-mouth disease vaccine
US10035841B2 (en) 2016-01-29 2018-07-31 The Texas A&M University System Monoclonal antibody against novel epitopes of foot-and-mouth disease virus protein 3ABC and uses thereof
US10172933B2 (en) 2016-10-31 2019-01-08 The United States Of America, As Represented By The Secretary Of Agriculture Mosaic vaccines for serotype a foot-and-mouth disease virus

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007053899A1 (en) * 2005-11-10 2007-05-18 Diva Solutions Pty Ltd Differentiating therapeutic composition
WO2008068638A2 (en) * 2006-09-27 2008-06-12 Coley Pharmaceutical Gmbh Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ALEXANDERSEN SOREN ET AL: "Review Aspects of the persistence of foot-and-mouth disease virus in animals-the carrier problem", 1 January 2002 (2002-01-01), pages 1099 - 1110, XP093002018, Retrieved from the Internet <URL:https://reader.elsevier.com/reader/sd/pii/S1286457902016349?token=45BCA0E4629D9D311349197AEBF2DD3E54B8081EF147107928EF400E911ED349DB90536D78DC92CF14724F34D88E74C9&originRegion=eu-west-1&originCreation=20221128110753> [retrieved on 20221125] *
BABU ARAVINDH PARTHIBAN ET AL: "Virus Excretion from Foot-And-Mouth Disease Virus Carrier Cattle and Their Potential Role in Causing New Outbreaks", 1 January 2015 (2015-01-01), pages 1 - 13, XP093002021, Retrieved from the Internet <URL:https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0128815&type=printable> [retrieved on 20221125] *
DIAZ-SAN SEGUNDO FAYNA ET AL: "Poly ICLC increases the potency of a replication-defective human adenovirus vectored foot-and-mouth disease vaccine", VIROLOGY, ELSEVIER, AMSTERDAM, NL, vol. 468, 12 September 2014 (2014-09-12), pages 283 - 292, XP029088580, ISSN: 0042-6822, DOI: 10.1016/J.VIROL.2014.08.012 *
JILING REN ET AL: "CpG oligodeoxynucleotide and montanide ISA 206 adjuvant combination augments the immune responses of a recombinant FMDV vaccine in cattle", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 29, no. 45, 15 August 2011 (2011-08-15), pages 7960 - 7965, XP028311169, ISSN: 0264-410X, [retrieved on 20110818], DOI: 10.1016/J.VACCINE.2011.08.072 *
JIN H ET AL: "Effect of chemical adjuvants on DNA vaccination", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 22, no. 21-22, 29 July 2004 (2004-07-29), pages 2925 - 2935, XP004520431, ISSN: 0264-410X, DOI: 10.1016/J.VACCINE.2003.12.026 *
MOONEN P. ET AL: "Carriers of foot-and-mouth disease virus: A review", VETERINARY QUARTERLY., vol. 22, no. 4, 1 October 2000 (2000-10-01), NL, pages 193 - 197, XP093002010, ISSN: 0165-2176, DOI: 10.1080/01652176.2000.9695056 *

Also Published As

Publication number Publication date
CN107106674A (en) 2017-08-29
KR20200068759A (en) 2020-06-15
US20220088173A1 (en) 2022-03-24
HK1246659A1 (en) 2018-09-14
MX2021015972A (en) 2022-02-10
AU2016206525A1 (en) 2017-07-13
CA2973828A1 (en) 2016-07-21
JP7113620B2 (en) 2022-08-05
KR102508719B1 (en) 2023-03-09
RU2017124186A3 (en) 2019-02-18
KR20220044395A (en) 2022-04-07
JP2022130383A (en) 2022-09-06
AR103427A1 (en) 2017-05-10
SG11201705737RA (en) 2017-08-30
LT3244920T (en) 2023-08-25
HRP20230752T1 (en) 2023-10-27
EP4248992A3 (en) 2023-12-27
JP2023012507A (en) 2023-01-25
CA2973828C (en) 2023-09-19
IL253137A0 (en) 2017-08-31
DK3244920T3 (en) 2023-06-26
AU2021257973A1 (en) 2021-11-25
JP7361867B2 (en) 2023-10-16
PL3244920T3 (en) 2023-09-25
KR20170097116A (en) 2017-08-25
JP2018502166A (en) 2018-01-25
US10967058B2 (en) 2021-04-06
FI3244920T3 (en) 2023-08-04
CN115317600A (en) 2022-11-11
JP2021001205A (en) 2021-01-07
ZA201704596B (en) 2018-05-30
US20180264101A1 (en) 2018-09-20
RU2698305C2 (en) 2019-08-26
PT3244920T (en) 2023-07-28
EP3244920A1 (en) 2017-11-22
RU2017124186A (en) 2019-02-18
MX2017009306A (en) 2017-11-08
JP7232225B2 (en) 2023-03-02
ES2950822T3 (en) 2023-10-13
US10478487B2 (en) 2019-11-19
IL253137B2 (en) 2024-03-01
CO2017007057A2 (en) 2017-10-31
BR112017015288A2 (en) 2018-01-16
PH12017501257A1 (en) 2017-10-30
KR102382773B1 (en) 2022-04-04
CN114699518A (en) 2022-07-05
IL253137B1 (en) 2023-11-01
SI3244920T1 (en) 2023-09-29
EP4248992A2 (en) 2023-09-27
WO2016115456A1 (en) 2016-07-21
HUE063288T2 (en) 2024-01-28
US20200078456A1 (en) 2020-03-12
US11865171B2 (en) 2024-01-09

Similar Documents

Publication Publication Date Title
US11865171B2 (en) Foot-and-mouth disease vaccine
US10485866B2 (en) Vaccine against porcine parvovirus
TWI788309B (en) Vaccine against porcine parvovirus and porcine reproductive and respiratory syndrome virus and methods of production thereof
CN109078179A (en) Hendra and Nipah viral G glycoprotein immunogenic composition
US20240197855A1 (en) Foot-and-mouth disease vaccine
WO2022037248A1 (en) Live attenuated sars-cov-2 virus immunogenic compositions, methods of making and using
JP7506708B2 (en) Foot and mouth disease vaccine
AU2019200943B2 (en) Vaccine against Bovine Viral Diarrhea Virus
NZ750583B2 (en) Vaccine against bovine viral diarrhea virus

Legal Events

Date Code Title Description
REG Reference to a national code

Ref country code: HR

Ref legal event code: TUEP

Ref document number: P20230752T

Country of ref document: HR

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20170816

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20180807

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1246659

Country of ref document: HK

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20230102

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

Ref country code: AT

Ref legal event code: REF

Ref document number: 1572921

Country of ref document: AT

Kind code of ref document: T

Effective date: 20230615

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602016079847

Country of ref document: DE

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

Effective date: 20230619

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230526

REG Reference to a national code

Ref country code: PT

Ref legal event code: SC4A

Ref document number: 3244920

Country of ref document: PT

Date of ref document: 20230728

Kind code of ref document: T

Free format text: AVAILABILITY OF NATIONAL TRANSLATION

Effective date: 20230724

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

REG Reference to a national code

Ref country code: RO

Ref legal event code: EPE

REG Reference to a national code

Ref country code: NL

Ref legal event code: FP

REG Reference to a national code

Ref country code: NO

Ref legal event code: T2

Effective date: 20230607

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2950822

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20231013

REG Reference to a national code

Ref country code: EE

Ref legal event code: FG4A

Ref document number: E023460

Country of ref document: EE

Effective date: 20230803

REG Reference to a national code

Ref country code: SK

Ref legal event code: T3

Ref document number: E 42022

Country of ref document: SK

REG Reference to a national code

Ref country code: HR

Ref legal event code: T1PR

Ref document number: P20230752

Country of ref document: HR

REG Reference to a national code

Ref country code: GR

Ref legal event code: EP

Ref document number: 20230401126

Country of ref document: GR

Effective date: 20231010

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20230607

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SK

Payment date: 20231215

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GR

Payment date: 20231228

Year of fee payment: 9

Ref country code: GB

Payment date: 20231218

Year of fee payment: 9

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20231007

REG Reference to a national code

Ref country code: HU

Ref legal event code: AG4A

Ref document number: E063288

Country of ref document: HU

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20230607

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20231007

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: PT

Payment date: 20231228

Year of fee payment: 9

Ref country code: NL

Payment date: 20231220

Year of fee payment: 9

Ref country code: LV

Payment date: 20231218

Year of fee payment: 9

Ref country code: LU

Payment date: 20231218

Year of fee payment: 9

Ref country code: LT

Payment date: 20231218

Year of fee payment: 9

Ref country code: IE

Payment date: 20231228

Year of fee payment: 9

Ref country code: FR

Payment date: 20231214

Year of fee payment: 9

Ref country code: FI

Payment date: 20231228

Year of fee payment: 9

Ref country code: EE

Payment date: 20231218

Year of fee payment: 9

Ref country code: CZ

Payment date: 20231221

Year of fee payment: 9

Ref country code: BG

Payment date: 20231220

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: PL

Payment date: 20231218

Year of fee payment: 9

Ref country code: BE

Payment date: 20231219

Year of fee payment: 9

REG Reference to a national code

Ref country code: HR

Ref legal event code: ODRP

Ref document number: P20230752

Country of ref document: HR

Payment date: 20231222

Year of fee payment: 9

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602016079847

Country of ref document: DE

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20240222

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: AT

Payment date: 20231228

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: RO

Payment date: 20240108

Year of fee payment: 9

Ref country code: HU

Payment date: 20231221

Year of fee payment: 9

Ref country code: DE

Payment date: 20231215

Year of fee payment: 9

Ref country code: CH

Payment date: 20240202

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SI

Payment date: 20231219

Year of fee payment: 9

26N No opposition filed

Effective date: 20240308

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20230607

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: TR

Payment date: 20240111

Year of fee payment: 9

Ref country code: SE

Payment date: 20240109

Year of fee payment: 9

Ref country code: NO

Payment date: 20231228

Year of fee payment: 9

Ref country code: HR

Payment date: 20240220

Year of fee payment: 9

Ref country code: DK

Payment date: 20240104

Year of fee payment: 9