Classifications

• • B—PERFORMING OPERATIONS; TRANSPORTING
  • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
  • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
  • B01J19/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
  • B01J19/0046—Sequential or parallel reactions, e.g. for the synthesis of polypeptides or polynucleotides; Apparatus and devices for combinatorial chemistry or for making molecular arrays
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
  • C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1034—Isolating an individual clone by screening libraries
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
• • B—PERFORMING OPERATIONS; TRANSPORTING
  • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
  • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
  • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
  • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
  • B01J2219/00583—Features relative to the processes being carried out
  • B01J2219/00585—Parallel processes
• • B—PERFORMING OPERATIONS; TRANSPORTING
  • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
  • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
  • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
  • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
  • B01J2219/00583—Features relative to the processes being carried out
  • B01J2219/00596—Solid-phase processes
• • B—PERFORMING OPERATIONS; TRANSPORTING
  • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
  • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
  • B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
  • B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
  • B01J2219/00718—Type of compounds synthesised
  • B01J2219/0072—Organic compounds
  • B01J2219/00722—Nucleotides

Definitions

• autosomal DNA sequences may be superior for population genetic analysis because it provides information from both lineages (i.e., maternal and paternal).
• lineages i.e., maternal and paternal.
• autosomal DNA sequencing technique for ancient DNA analysis in order to derive improved resolution for population genetic analysis.
• whole genome sequencing of single ancient genomes including Neanderthals, Denisovan, a Paleo-Eskimo, the Tyrolean Iceman, and an Australian Abrare, have transformed our understanding of human migrations and revealed previously unknown admixture among ancient populations.
• sequencing libraries derived from bones and teeth from temperate environments typically contain ⁇ 1% endogenous DNA. While samples with 1-2%
• the method comprises: a) extracting DNA from a sample that comprises endogenous DNA and environmental DNA to produce extracted DNA, wherein the extracted DNA comprises more environmental DNA than endogenous DNA; b) ligating a universal adaptor to the extracted DNA; c) hybridizing the extracted DNA, in solution, with affinity- tagged RNA probes generated by: in vitro transcribing, in the presence of a affinity-tagged ribonucleotide, a library comprising fragmented reference genomic DNA that has been ligated to an RNA promoter adaptor; d) binding the product of step c) with a capture agent for the affinity tag that is tethered to a substrate in the presence of RNA oligonucleotides that are complementary to the adaptors, thereby capturing the hybridized DNA molecules on the substrate; e) washing the substrate to remove any unbound DNA molecules; and f) releasing the captured DNA molecules.
• a kit for performing the method is
• Fig. 1 schematically illustrates a Whole-Genome In-Solution Capture Process.
• a human genomic library is created via adapters containing T7 RNA polymerase promoters (green boxes). This library is subjected to in vitro transcription via T7 RNA polymerase and biotin-16-UTP (stars), creating a biotinylated bait library.
• the ancient DNA library aDNA "pond" is prepared via standard indexed Illumina adapters (purple boxes). These aDNA libraries often contain ⁇ 1% endogenous DNA, with the remainder being environmental in origin.
• the bait and pond are combined in the presence of adaptor-blocking RNA oligos (blue zigzags), which are complimentary to the indexed Illumina adapters and thus prevent nonspecific hybridization between adapters in the aDNA library.
• the biotinylated bait and bound aDNA is pulled down with streptavidin-coated magnetic beads, and any unbound DNA is washed away. Finally, the DNA is eluted and amplified for sequencing.
• Fig. 2 shows the results of increased Sequencing of Samples M4 and NA40.
• A Yield of unique fragments for M4 (Bronze Age hair) precapture (blue) and postcapture (red) libraries with increasing amounts of sequencing. The fold enrichment in number of unique reads with increasing amounts of sequencing is plotted in green, with values on the secondary y axis.
• B Yield of unique fragments for NA40 (Peruvian bone) precapture (blue) and postcapture (red) libraries with increasing amounts of sequencing. The fold enrichment in number of unique reads with increasing amounts of sequencing is plotted in green, with values on the secondary y axis.
• F Percent GC content of reads for NA40 pre- and postcapture libraries.
• Fig. 3 shows the results of principal component analysis of pre- and post-capture samples based on sequencing one million reads each.
• Principal component analysis of SNPs overlapping between the 1000 Genomes reference panel and each ancient individual, with Native American individuals also included in (E) and (F). The principal components were calculated with the modern individuals only, and the ancient individual was then projected onto the plot. Shown are (A) V2 (Bulgarian tooth) precapture and (B) postcapture; (C) M4 (Bronze Age hair) precapture and (D) postcapture; and (E) NA40 (Peruvian bone) precapture and (F) postcapture.
• ASW Americans of African ancestry in SW USA
• AYM Aymara from the Peruvian Andes
• CEU Utah residents (CEPH) with Northern and Western European ancestry
• CHB Han Chinese in Beijing, China
• CHS Southern Han Chinese
• CLM Colombians from Medellin, Columbia
• FIN Finnish in Finland
• GBR GBR
• Fig. 4 shows data obtained from various sequencing experiments.
• nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.
• BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale & Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, N.Y. (1991) provide one of skill with the general meaning of many of the terms used herein. Still, certain terms are defined below for the sake of clarity and ease of reference.
• sample as used herein relates to a material or mixture of materials, typically, although not necessarily, in liquid form, containing one or more analytes of interest.
• nucleic acid sample denotes a sample containing nucleic acids.
• Nucleic acid samples used herein may be complex in that they contain multiple different molecules that contain sequences. Genomic DNA from a mammal (e.g., mouse or human) are types of complex samples. Complex samples may have more then 10 4 , 10 5 , 10 6 or 10 7 different nucleic acid molecules.
• a DNA target may originate from any source such as genomic DNA, or an artificial DNA construct. Any sample containing nucleic acid, e.g., genomic DNA made from tissue culture cells or a sample of tissue, may be employed herein.
• a nucleic acid sample can be made from any suitable source, including a sample of tooth, bone, hair or bone, etc.
• nucleotide is intended to include those moieties that contain not only the known purine and pyrimidine bases, but also other heterocyclic bases that have been modified. Such modifications include methylated purines or pyrimidines, acylated purines or pyrimidines, alkylated riboses or other heterocycles.
• nucleotide includes those moieties that contain hapten or fluorescent labels and may contain not only conventional ribose and deoxyribose sugars, but other sugars as well. Modified nucleosides or nucleotides also include modifications on the sugar moiety, e.g., wherein one or more of the hydroxyl groups are replaced with halogen atoms or aliphatic groups, or are
• nucleic acid and “polynucleotide” are used interchangeably herein to describe a polymer of any length, e.g., greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, up to about 10,000 or more bases composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, and may be produced enzymatically or synthetically (e.g., PNA as described in U.S. Patent No.
• Naturally-occurring nucleotides include guanine, cytosine, adenine and thymine (G, C, A and T, respectively).
• DNA and RNA have a deoxyribose and ribose sugar backbone, respectively, whereas PNA's backbone is composed of repeating N-(2- aminoethyl)-glycine units linked by peptide bonds.
• PNA various purine and pyrimidine bases are linked to the backbone by methylene carbonyl bonds.
• a locked nucleic acid is a modified RNA nucleotide.
• the ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form duplexes.
• LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever desired.
• the term "unstructured nucleic acid,” or "UNA,” is a nucleic acid containing non-natural nucleotides that bind to each other with reduced stability.
• an unstructured nucleic acid may contain a G' residue and a C residue, where these residues correspond to non-naturally occurring forms, i.e., analogs, of G and C that base pair with each other with reduced stability, but retain an ability to base pair with naturally occurring C and G residues, respectively.
• Unstructured nucleic acid is described in US20050233340, which is incorporated by reference herein for disclosure of UNA. Also included in this definition are ZNAs, i.e., zip nucleic acids.
• oligonucleotide denotes a single-stranded multimer of nucleotide of from about 2 to 200 nucleotides, up to 500 nucleotides in length.
• Oligonucleotides may be synthetic or may be made enzymatically, and, in some
• Oligonucleotides are 30 to 150 nucleotides in length. Oligonucleotides may contain
• ribonucleotide monomers i.e., may be oligoribonucleotides
• deoxyribonucleotide monomers i.e., may be oligoribonucleotides
• An oligonucleotide may be 10 to 20, 21 to 30, 31 to 40, 41 to 50, 51to 60, 61 to 70, 71 to 80, 80 to 100, 100 to 150 or 150 to 200 nucleotides in length, for example.
• hybridization refers to the process by which a strand of nucleic acid joins with a complementary strand through base pairing as known in the art.
• a nucleic acid is considered to be "selectively hybridizable" to a reference nucleic acid sequence if the two sequences specifically hybridize to one another under moderate to high stringency hybridization and wash conditions. Moderate and high stringency hybridization conditions are known (see, e.g., Ausubel, et al, Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons 1995 and Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, 2001 Cold Spring Harbor, N.Y.).
• high stringency conditions includes hybridization at about 42 °C in 50% formamide, 5X SSC, 5X Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml denatured carrier DNA followed by washing two times in 2X SSC and 0.5% SDS at room temperature and two additional times in 0.1 X SSC and 0.5% SDS at 42
• duplex or “duplexed,” as used herein, describes two complementary polynucleotides that are base-paired, i.e., hybridized together.
• amplifying refers to generating one or more copies of a target nucleic acid, using the target nucleic acid as a template.
• analyzing are used interchangeably herein to refer to any form of measurement, and include determining if an element is present or not. These terms include both quantitative and/or qualitative determinations. Assessing may be relative or absolute. "Assessing the presence of includes determining the amount of something present, as well as determining whether it is present or absent.
• the term "using” has its conventional meaning, and, as such, means employing, e.g., putting into service, a method or composition to attain an end.
• a program is used to create a file
• a program is executed to make a file, the file usually being the output of the program.
• a computer file it is usually accessed, read, and the information stored in the file employed to attain an end.
• a unique identifier e.g., a barcode
• the unique identifier is usually read to identify, for example, an object or file associated with the unique identifier.
• the term "I'm” refers to the melting temperature of an oligonucleotide duplex at which half of the duplexes remain hybridized and half of the duplexes dissociate into single strands.
• partitioning refers to the separation of one part of the genome from the remainder of the genome to produce a product that is isolated from the remainder of the genome.
• partitioning encompasses enriching.
• genomic region refers to a region of a genome, e.g., an animal or plant genome such as the genome of a human, monkey, rat, fish or insect or plant.
• an oligonucleotide used in the method described herein may be designed using a reference genomic region, i.e., a genomic region of known nucleotide sequence, e.g., a chromosomal region whose sequence is deposited at NCBFs Genbank database or other databases, for example.
• genomic sequence refers to a sequence that occurs in a genome. Because RNAs are transcribed from a genome, this term encompasses sequence that exist in the nuclear genome of an organism, as well as sequences that are present in a cDNA copy of an R A (e.g., an mR A) transcribed from such a genome.
• R A e.g., an mR A
• genomic fragment refers to a region of a genome, e.g., an animal or plant genome such as the genome of a human, monkey, rat, fish or insect or plant.
• a genomic fragment may be an entire chromosome, or a fragment of a chromosome.
• a genomic fragment may be adaptor ligated (in which case it has an adaptor ligated to one or both ends of the fragment, or to at least the 5' end of a molecule), or may not be adaptor ligated.
• an oligonucleotide used in the method described herein may be designed using a reference genomic region, i.e., a genomic region of known nucleotide sequence, e.g., a chromosomal region whose sequence is deposited at NCBFs Genbank database or other databases, for example.
• a reference genomic region i.e., a genomic region of known nucleotide sequence, e.g., a chromosomal region whose sequence is deposited at NCBFs Genbank database or other databases, for example.
• Such an oligonucleotide may be employed in an assay that uses a sample containing a test genome, where the test genome contains a binding site for the oligonucleotide.
• biotin moiety refers to an affinity agent that includes biotin or a biotin analogue such as desthiobiotin, oxybiotin, 2-iminobiotin, diaminobiotin, biotin sulfoxide, biocytin, etc.
• Biotin moieties bind to streptavidin with an affinity of at least
• a biotin affinity agent may also include a linker, e.g., -LC-biotin, -LC-LC-Biotin, - SLC -Biotin or -PEG n -Biotin where n is 3-12.
• linker e.g., -LC-biotin, -LC-LC-Biotin, - SLC -Biotin or -PEG n -Biotin where n is 3-12.
• ligating refers to the enzymatically catalyzed joining of the terminal nucleotide at the 5' end of a first DNA molecule to the terminal nucleotide at the 3' end of a second DNA molecule.
• a transposase can catalyze a ligation.
• a "plurality” contains at least 2 members. In certain cases, a plurality may have at least 10, at least 100, at least 100, at least 10,000, at least 100,000, at least 10 6 , at least 10 7 , at
• each base of one of the nucleic acids base pairs with corresponding nucleotides in the other nucleic acid.
• Two nucleic acids do not need to be perfectly complementary in order to hybridize to one another.
• separating refers to physical separation of two elements (e.g., by size or affinity, etc.) as well as degradation of one element, leaving the other intact.
• DNA usually exists in a double-stranded form, and as such, has two complementary strands of nucleic acid referred to herein as the “top” and “bottom” strands.
• complementary strands of a chromosomal region may be referred to as “plus” and “minus” strands, the “first” and “second” strands, the “coding” and “noncoding” strands, the “Watson” and “Crick” strands or the “sense” and “antisense” strands.
• top or bottom strand The assignment of a strand as being a top or bottom strand is arbitrary and does not imply any particular orientation, function or structure. Until they become covalently linked, the first and second strands are distinct molecules.
• top and bottom strands of a double-stranded nucleic acid in which the top and bottom strands have been covalently linked will still be described as the “top” and “bottom” strands. In other words, for the purposes of this disclosure, the top and bottom strands of a double-stranded DNA do not need to be separated molecules.
• top strand refers to either strand of a nucleic acid but not both strands of a nucleic acid.
• an oligonucleotide or a primer binds or anneals "only to a top strand,” it binds to only one strand but not the other.
• bottom strand refers to the strand that is complementary to the "top strand.”
• an oligonucleotide binds or anneals "only to one strand,” it binds to only one strand, e.g., the first or second strand, but not the other strand.
• the oligonucleotide may have two regions, a first region that hybridizes with the top strand of the double-stranded DNA, and a second region that hybridizes with the bottom strand of the double-stranded DNA.
• double-stranded DNA molecule refers to both double-stranded DNA molecules in which the top and bottom strands are not covalently linked, as well as double- stranded DNA molecules in which the top and bottom stands are covalently linked.
• the top and bottom strands of a double-stranded DNA are base paired with one other by Watson- Crick interactions.
• denaturing refers to the separation of at least a portion of the base pairs of a nucleic acid duplex by placing the duplex in suitable denaturing conditions. Denaturing conditions are well known in the art.
• the duplex in order to denature a nucleic acid duplex, the duplex may be exposed to a temperature that is above the T m of the duplex, thereby releasing one strand of the duplex from the other.
• a nucleic acid may be denatured by exposing it to a temperature of at least 90 °C for a suitable amount of time (e.g., at least 30 seconds, up to 30 mins).
• fully denaturing conditions may be used to completely separate the base pairs of the duplex.
• partially denaturing conditions e.g., with a lower temperature than fully denaturing conditions
• Nucleic acid may also be denatured chemically (e.g., using urea or NaOH).
• genotyping refers to any type of analysis of a nucleic acid sequence, and includes sequencing, polymorphism (SNP) analysis, and analysis to identify rearrangements.
• sequence refers to a method by which the identity of at least 10 consecutive nucleotides (e.g., the identity of at least 20, at least 50, at least 100 or at least 200 or more consecutive nucleotides) of a polynucleotide are obtained.
• next-generation sequencing refers to the so-called parallelized sequencing-by-synthesis or sequencing-by-ligation platforms currently employed by
• Next-generation sequencing methods may also include nanopore sequencing methods or electronic-detection based methods such as Ion Torrent technology commercialized by Life Technologies.
• endogenous DNA refers to DNA that is present in a sample (e.g., a sample of tooth, bone, hair or bone) that is naturally associated with the sample when the sample was part of a living being.
• the term "environmental DNA” refers to DNA that is present in a sample (e.g., a sample of tooth, bone, hair or bone) that was not naturally associated with the sample when the sample was part of a living being.
• Environmental DNA can come from a variety of sources, including, but not limited to microbes that have contaminated the sample.
• the contaminating DNA may be genomic DNA from microbes that have grown on or in the sample over time.
• the sample may have been placed in an environment, e.g., soil or feces, that contains a significant amount of contaminating DNA.
• reference genomic DNA refers to genomic DNA from a species of interest.
• the species of interest may be eukaryotic or prokaryotic, including animal (e.g., mammalian), plant, and bacterial, species.
• Reference genomic DNA is selected so that it hybridizes to the endogenous DNA and not the environmental DNA at high stringency.
• adaptor refers to a nucleic acid that is ligatable to both strands of a double-stranded DNA molecule.
• an adaptor may be a hairpin adaptor (i.e., one molecule that base pairs with itself to form a structure that has a double-stranded stem and a loop, where the 3' and 5' ends of the molecule ligate to the 5' and 3' ends of the double-stranded DNA molecule, respectively).
• an adaptor may be a Y-adaptor.
• an adaptor may itself be composed of two distinct oligonucleotide molecules that are base paired with one another.
• a ligatable end of an adaptor may be designed to be compatible with overhangs made by cleavage by a restriction enzyme, or it may have blunt ends or a 5' T overhang.
• adaptor refers to double-stranded as well as single-stranded molecules.
• An adaptor can be DNA or RNA, or a mixture of the two.
• An adaptor containing RNA may be cleavable by RNase treatment or by alkaline hydrolysis.
• An adaptor may be 15 to 100 bases, e.g., 50 to 70 bases, although adaptors outside of this range are envisioned.
• adaptor-ligated refers to a nucleic acid that has been ligated to an adaptor.
• the adaptor can be ligated to a 5' end and/or a 3' end of a nucleic acid molecule.
• universal adaptor refers to an adaptor that is ligated to both ends of the nucleic acid molecules under study.
• the universal adaptor may be a Y-adaptor. Amplification of nucleic acid molecules that have been ligated to Y-adaptors at both ends results in an asymmetrically tagged nucleic acid, i.e., a nucleic acid that has a 5' end containing one tag sequence and a 3' end that has another tag sequence.
• Y-adaptor refers to an adaptor that contains: a double-stranded region and a single-stranded region in which the oligonucleotides are not complementary. The end of the double-stranded region ligates to target molecules such as double-stranded fragments of genomic DNA.
• Each strand of an adaptor-tagged double-stranded DNA that has been ligated to a Y adaptor is asymmetrically tagged in that it has the sequence of one strand of the Y- adaptor at one end and the other strand of the Y-adaptor at the other end.
• RNA promoter adaptor is an adaptor that contains a promoter for a bacteriophage RNA polymerase, e.g., the RNA polymerase from bacteriophage T3, T7, SP6 or the like.
• affinity tag and “capture agent” refer to a moieties that are capable of: a) specifically binding to one other non-covalently or b) selectively reacting one another to form a covalent bond.
• pairs of suitable affinity tags and capture agents that specifically bind to one another non-covalently are numerous and include, but are not limited to: streptavidin/avidin, digoxigenin/anti-digoxigenin antibody, fluorescein/anti- fluorescein antibody, although many others are known.
• chemoselective reactive groups that selectively react with one another to form a covalent bond are numerous and include: amines and active esters such as an NHS esters, thiols and maleimide or iodoacetamide), as well as groups that can react with one another via Click chemistry, e.g., azide and alkyne groups.
• amines and active esters such as an NHS esters, thiols and maleimide or iodoacetamide
• groups that can react with one another via Click chemistry e.g., azide and alkyne groups.
• Ribonucleotides that contain affinity tags that can be used herein are available commercially from many sources.
• biotinylated ribonucleotide refers to a ribonucleotide triphosphate (e.g., ATP, GTP, CTP and UTP) that is linked to a biotin moiety.
• Bio-16-UTP Biotin-16-uridine- 5 '-triphosphate
• T3, T7 or SP6 RNA polymerases are examples of a biotinylated ribonucleotide that can replace UTP for in vitro transcription reaction catalyzed by T3, T7 or SP6 RNA polymerases.
• the method may start by extracting DNA from a sample that comprises: both endogenous DNA and environmental DNA, to produce extracted DNA.
• the extracted DNA may comprise more (at least 2 times, at least 5 times, at least 10 times, at least 50 times, or at least 100 times, at least 500 times or at least 1,000 times more) environmental DNA than endogenous DNA.
• the DNA in these samples may be highly fragmented, e.g., to an average size in the range of 10 bp to 5 kb, e.g., 20 bp to 200 bp (see, e.g., Sawyer et al, PLoS ONE 7: e34131).
• the sample may be a sample of a hard tissue such as bone, hair, nail or tooth, from an ancient source (e.g., a source that died at least 10 years ago, at least 100 years ago or a source that died at least 1,000 years ago, such as a mummy, hard tissue found in a burial site or the like).
• the DNA is ligated to a universal adaptor, i.e., an adaptor that ligates to both ends of the fragments of DNA contained in the extracted DNA sample.
• the universal adaptor may be a Y-adaptor, an example of which is described below.
• the ligating may be done by polishing the ends of the extracted DNA using a polymerase, and then ligating the adaptor via a blunt-end ligation.
• the ends may be polished using Taq polymerase, which adds an additional 3' A (thereby producing a 3 ⁇ overhang), and the ligating may be done using an adaptor that has a 5' T overhang.
• the adaptor may be "indexed" in that it contains a molecular barcode that identifies the sample to which it was ligated (which allows samples to be pooled before sequencing).
• the adaptor may contain a random barcode or the like.
• Such an adaptor can be ligated to the fragments and substantially every fragment corresponding to a particular region are tagged with a different sequence. This allows for identification of PCR duplicates and allows molecules to be counted.
• the sample may be optionally amplified, by PCR, for example.
• the adaptor-ligated nucleic acids in the sample may be amplified using one or more primers that hybridize to the added adaptors (or their complements).
• the adaptor-ligated nucleic acids may be amplified by PCR using two primers: a first primer that hybridizes to the single-stranded region of the top strand of the adaptor, and a second primer that hybridizes to the
• the adaptor-ligated nucleic acid may be hybridized in solution under high stringency with affinity-tagged RNA probes that have been generated by in vitro transcribing a library of a reference genomic sample that has been ligated to an RNA promoter adaptor (e.g., a T7 promoter), in the presence of an affinity-tagged ribonucleotide.
• an RNA promoter adaptor e.g., a T7 promoter
• the reference sample may be from a species that is similar or identical to the source of the endogenous DNA, i.e., sufficiently similar that their DNAs will hybridize at high stringency (e.g., at a temperature of at least 42 °C, at least 50 °C or at least 60 °C for at least 24 hr).
• the hybridization may be done by phenol emulsion reassociation (PERT) (Miller at al, Nucleic Acids Res. 1995 23: 2339-2340) or oscillating phenol emulsion reassociation (osPERT) (Bruzel et al Genomics. 2006 87:286-9) in order to reassociate the sequences rapidly.
• PERT phenol emulsion reassociation
• osPERT oscillating phenol emulsion reassociation
• the reference sample may be, for example, (e.g., human) genomic DNA that has been fragmented to a desired size, e.g., an average size in the range of 100 bp to 10 kb, e.g., 100 bp to 500 bp, although sizes outside of these ranges are envisioned.
• a desired size e.g., an average size in the range of 100 bp to 10 kb, e.g., 100 bp to 500 bp, although sizes outside of these ranges are envisioned.
• Such fragments may be made by fragmenting a genome using physical methods (e.g., sonication, nebulization, or shearing), chemically, enzymatically (e.g., using a rare-cutting restriction enzyme) or using a transposable element. After fragmentation, the fragments may be ligated to an RNA polymerase promoter using conventional methods.
• the RNA polymerase promoter can also be added to the fragments during cleavage if a transposon is used.
• the fragments to which the RNA promoter has been ligated can then be transcribed in vitro into affinity-tagged RNA probes.
• the reference sample may be processed to select for or remove particular sequences.
• the reference sample may be processed to remove repetitive sequences, e.g., microsatellite sequences, LINEs and/or SINEs, etc., before use.
• the hybridized DNA molecules are captured on a substrate, e.g., a solid support or beads.
• the hybridized product is bound to a substrate that comprises a capture agent for the affinity tag, and the affinity tag binds to the capture agent. This step may be done in the presence of one or more RNA oligonucleotides that are complementary to or have the same sequence as one or more strands of the universal adaptor.
• these RNA oligonucleotides may themselves be made using in vitro transcription, e.g., by annealing two oligonucleotides together to produce a duplex that comprises a double-stranded RNA promoter upstream from a transcribed region, where the transcribed region can be transcribed to produce an RNA oligonucleotide.
• the RNA oligonucleotides may be complementary to or have the same sequence as at least 50% (e.g., at least 60%, at least 70%> or more) of the contiguous sequence of the universal adaptor.
• the substrate is washed to remove any unbound DNA molecules, and the captured DNA molecules can be released.
• the captured DNA molecules are released by treating the support with NaOH, which cleaves the in vitro transcribed RNA molecules, thereby releasing the DNA molecules. This step could be performed by treatment with RNaseH, RNaseA, or by heating the substrate to a temperature that is sufficient to denature the duplexes attached thereto.
• the captured DNA molecules may be optionally amplified (e.g., using primers that hybridize to the added adaptor sequences or their complements) and sequenced.
• the released DNA may be amplified using primers that are compatible with use in, e.g., Illumina's reversible terminator method, Roche's pyrosequencing method (454), Life Technologies' sequencing by ligation (the SOLiD platform) or Life Technologies' Ion Torrent platform.
• Margulies et al (Nature 2005 437: 376-80); Ronaghi et al (Analytical Biochemistry 1996 242: 84-9); Shendure et al (Science 2005 309: 1728- 32); Imelfort et al (Brief Bioinform. 2009 10:609-18); Fox et al (Methods Mol Biol.
• the released DNA may be sequenced using nanopore sequencing (e.g., as described in Soni et al. Clin Chem 2007 53: 1996-2001, or as described by Oxford Nanopore Technologies).
• Nanopore sequencing is a single-molecule sequencing technology whereby a single molecule of DNA is sequenced directly as it passes through a nanopore.
• a nanopore is a small hole, of the order of 1 nanometer in diameter. Immersion of a nanopore in a conducting fluid and application of a potential (voltage) across it results in a slight electrical current due to conduction of ions through the nanopore. The amount of current which flows is sensitive to the size and shape of the nanopore.
• Nanopore sequencing technology is disclosed in U.S. Pat. Nos. 5,795,782, 6,015,714, 6,627,067, 7,238,485 and 7,258,838 and U.S. Pat Appln Nos. 2006003171 and 20090029477.
• the isolated fragments may be sequenced directly or, in some embodiments, the released fragments may be amplified (e.g., by PCR) to produce amplification products that sequenced.
• amplification products may contain sequences that are compatible with use in, e.g., Illumina's reversible terminator method, Roche's
• the sample sequenced may comprise a pool of nucleic acids from a plurality of samples, wherein the nucleic acids in the sample have a molecular barcode to indicate their source.
• the nucleic acids being analyzed may be derived from a single source (e.g., a single organism, virus, tissue, cell, subject, etc.), whereas in other embodiments, the nucleic acid sample may be a pool of nucleic acids extracted from a plurality of sources (e.g., a pool of nucleic acids from a plurality of organisms, tissues, cells, subjects, etc.), where by "plurality" is meant two or more.
• a nucleic acid sample can contain nucleic acids from 2 or more sources, 3 or more sources, 5 or more sources, 10 or more sources, 50 or more sources, 100 or more sources, 500 or more sources, 1000 or more sources, 5000 or more sources, up to and including about 10,000 or more sources.
• Molecular barcodes may allow the sequences from different sources to be distinguished after they are analyzed.
• the method described above may be used to isolate endogenous DNA from a variety of different samples, which endogenous DNA can be genotyped, e.g., sequenced, to investigate the individual from which the sample was obtained.
• the method can be used to isolate fragments that represent at least 10%, at least 30%>, at least 50%>, or at least 70%) or more of a genome of an individual, and the fragments can be sequenced and, optionally, compared to the genome of the reference sample.
• forensics is the study of evidence, for example, that discovered at a crime or accident scene that is then used in a court of law.
• Formsic science is any science used to answer questions of interest to the legal system, in particular the criminal or civil justice system, providing impartial scientific evidence for use in the courts of law, for example, in criminal investigations and trials. Forensic science is a multidisciplinary subject, drawing principally from chemistry and biology, but also from physics, geology, psychology and social science, for example.
• the goal of one aspect of human forensics, forensic DNA typing is to determine the identity or genotype of DNA acquired from a forensic sample, for example, evidence from a crime scene or DNA sample from an individual.
• Typical sources of such DNA evidence include hair, bones, teeth, and body fluids such as saliva, semen, and blood.
• kits that contain reagents for practicing the subject methods, as described above.
• the subject kits contain at least: a) a universal adaptor (which may comprise a 5' T overhang); c) a library comprising fragmented human genomic DNA that has been ligated to an RNA promoter adaptor or a library of affinity-tagged transcripts made from the same; d) RNA oligonucleotides that are complementary to or have the same sequence as a sequence in the universal adaptor, or DNA oligonucleotides for making the same by in vitro transcription.
• a universal adaptor which may comprise a 5' T overhang
• a library comprising fragmented human genomic DNA that has been ligated to an RNA promoter adaptor or a library of affinity-tagged transcripts made from the same
• RNA oligonucleotides that are complementary to or have the same sequence as a sequence in the universal adaptor, or DNA oligonucleotides for making the same by in vitro transcription.
• the kit may contain: e) a DNA-dependent RNA polymerase that primes R A synthesis from the R A promoter; f) a ribonucleotide mix that comprises an affinity- tagged ribonucleotide (e.g., biotin-UTP); and g) a substrate, e.g., beads, comprising a capture agent for the affinity tag.
• a DNA-dependent RNA polymerase that primes R A synthesis from the R A promoter
• a ribonucleotide mix that comprises an affinity- tagged ribonucleotide (e.g., biotin-UTP)
• a substrate e.g., beads, comprising a capture agent for the affinity tag.
• the kit may optionally contain other components, for example: ligase, polymerase (e.g., a DNA polymerase such as Taq polymerase and an RNA polymerase such as T7 RNA polymerase), nucleotides, buffers, hybridization reagents, e.g., reagents for performing PERT or osPERT,etc.
• polymerase e.g., a DNA polymerase such as Taq polymerase and an RNA polymerase such as T7 RNA polymerase
• nucleotides e.g., a DNA polymerase such as Taq polymerase and an RNA polymerase such as T7 RNA polymerase
• buffers e.g., a DNA polymerase such as Taq polymerase and an RNA polymerase such as T7 RNA polymerase
• hybridization reagents e.g., reagents for performing PERT or osPERT,etc.
• the subject kits may further include instructions for using the components of the kit to practice the subject methods, i.e., instructions for sample analysis.
• the instructions for practicing the subject methods are generally recorded on a suitable recording medium.
• the instructions may be printed on a substrate, such as paper or plastic, etc.
• the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging), etc.
• the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g., CD-ROM, diskette, etc.
• the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g., via the internet, are provided.
• An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
• WISC whole-genome in-solution capture
• FIG. 1 shows a schematic overview of the WISC process, including the creation of the RNA bait libraries.
• Sample PI 92-1 was found at the site of a pit sanctuary near Svilengrad, Bulgaria, excavated between 2004 and 2006. The pits are associated with the Thracian culture and date to the Early Iron Age (800-500 BC) based on pottery found in the pits. A total of 67 ritual pits, including 16 pits containing human skeletons or parts of skeletons, were explored during the excavations. An upper wisdom tooth from an adult male was used for DNA analysis.
• Sample T2G2 was found in a Thracian tumulus (burial mound) near the village of
• Sample V2 was found in a flat cemetery dating to the Late Bronze Age (1500-1100 BC) near the village of Vratitsa, Bulgaria. Nine inhumation burials were excavated between 2003 and 2004. A molar from a juvenile male (age 16-17) was used for DNA analysis.
• Sample K8 was found in the Yakimova Mogila Tumulus, which dates to the Iron Age (450-400 BC), near Krushare, Bulgaria. An aristocratic inhumation burial containing rich grave goods was excavated in 2008.
• Sample M4 is an ancient hair sample obtained from the Borum Eshoj Bronze Age burial in Denmark. The burial comprised three individuals in oak coffins, commonly referred to as "the woman,” “the young man,” and “the old man.” The M4 sample is from the latter. The site was excavated in 1871-1875 and the coffins dated to c.1350 BC.
• Samples NA39-50 were obtained from pre-Columbian Chachapoyan and
• Chachapoya-Inca remains dating between 1000 and 1500 AD. They were recovered from the site Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website Website
• each tooth was wiped with a 10% bleach solution and then UV irradiated for 20 min. Part of the root was then excised and the inside of the tooth was drilled to produce approximately 200 mg of powder. DNA was isolated with a previously described silica-based extraction method.
• the purified DNA was subjected to end repair and dA-tailing with the Next End Prep Enzyme Mix (New England Biolabs) according to the manufacturer's instructions.
• ligation to Illumina PE adapters Illumina was performed by mixing 25 ⁇ of the end repair/dA-tailing reaction with 1 ⁇ of PE adapters (5 ⁇ ) and 1 ⁇ of Quick T4 DNA Ligase (NEB). The mixture was incubated at 25°C for 10 min and then purified with a QIAGEN MinElute spin column according to the manufacturer's instructions (QIAGEN).
• the libraries were amplified by PCR by mixing 5 ⁇ of the DNA library template with 5 ⁇ 10 ⁇ PCR buffer, 2 ⁇ MgC12 (50 mM), 2 ⁇ BSA (20 mg/ml), 0.4 ⁇ dNTPs (25 mM), 1 ⁇ each primer (10 ⁇ , inPE + multiplex indexed), and 0.2 ⁇ of Platinum Taq High Fidelity Polymerase (Invitrogen/Life Technologies).
• the PCR conditions were as follows: 94°C/5 min; 25 cycles of 94°C/30 s, 60°C/20 s, 68°C/20 s; 72°C/7 min.
• the resulting libraries were purified with QiaQuick spin columns (QIAGEN) and eluted in 30 ⁇ EB buffer.
• DNA was isolated from seven bone samples via a previously described silica-based extraction method.
• DNA was further converted into indexed Illumina libraries with 20 ⁇ of each DNA extract with the NEBNext DNA Library Prep Master Mix Set for 454 (NEB) according to the manufacturer's instructions, except that SPRI bead purification was replaced by
• MinElute silica column purification QIAGEN. Illumina multiplex blunt end adapters were used for ligation at a final concentration of 1.0 ⁇ in a final volume of 25 ⁇ . The Bst Polymerase fill-in reaction was inactivated after 20 min of incubation by freezing the sample. Library preparation was followed by a two-step PCR amplification.
• Amplification of purified libraries was done with Platinum Taq High Fidelity DNA Polymerase (Invitrogen) with a final mixture of 10 x High Fidelity PCR Buffer, 50 mM magnesium sulfate, 0.2 mM dNTP, 0.5 ⁇ Multiplexing PCR primer 1.0, 0.1 ⁇ Multiplexing PCR primer 2.0, 0.5 ⁇ PCR primer Index, 3% DMSO, 0.02 U/ ⁇ Platinum Taq High Fidelity Polymerase, 5 ⁇ of template, and water to 25 ⁇ final volume.
• PCR reactions were done for each library with the following PCR conditions: a 3 min activation step at 94°C, followed by 14 cycles of 30 s at 94°C, 20 s at 60°C, 20 s at 68°C, with a final extension of 7 min at 72°C. All three reactions per library were purified with QIAGEN MinElute columns and pooled into one single reaction. A second PCR was performed with the same conditions as before but with 22 cycles. One reaction per library was then performed with 10 ⁇ from the purified pool of the three previous reactions. Libraries were run on a 2% agarose gel and gel purified with a QIAGEN gel extraction kit according to the manufacturer's instructions.
• DNA was extracted from 70 mg of hair with phenol-chloroform combined with MinElute columns from QIAGEN as previously described.
• End-repair was performed in 25 ⁇ reactions with 20 ⁇ of DNA extract. This was incubated for 20 min at 12°C and 15 min at 37°C and purified with PN buffer with QIAGEN MinElute spin columns and eluted in 15 ⁇ . After end-repair, Illumina-specific adapters were ligated to the end-repaired DNA in 25 ⁇ reactions. The reaction was incubated for 15 min at 20°C and purified with PB buffer on QIAGEN MinElute columns before being eluted in 20 ⁇ EB Buffer.
• the adaptor fill-in reaction was performed in a final volume of 25 ⁇ and incubated for 20 min at 37°C followed by 20 min at 80°C to inactivate the Bst enzyme.
• the entire DNA library (25 ⁇ ) was then amplified and indexed in a 50 ⁇ PCR reaction, mixing with 5 ⁇ 10x PCR buffer, 2 ⁇ MgS04 (50 mM), 2 ⁇ BSA (20 mg/ml), 0.4 ⁇ dNTPs (25 mM), 1 ⁇ of each primer (10 ⁇ , inPE forward primer + multiplex indexed reverse primer), and 0.2 ⁇ Platinum Taq High Fidelity DNA Polymerase (Invitrogen). Thermocycling was carried out with 5 min at 95°C, followed by 25 cycles of 30 s at 94°C, 20 s at 60°C, and 20 s at
• the amplified library was then purified with PB buffer on QIAGEN MinElute columns, before being eluted in 30 ⁇ EB.
• GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG*T-3' (SEQ ID NO: l) and 5'-P-CCCTATAGTGAGTCGTATTAGTACTCTAGCCTTAAGATC-3' (SEQ ID NO:2)) were annealed by mixing a 12.5 ⁇ of each 200 ⁇ oligo stock with 5 ⁇ of 10 x buffer 2 (NEB) and 20 ⁇ of FLO. This mixture was heated to 95°C for 5 min, then left on the bench to cool to room temperature for approximately 1 hr.
• T7 adaptor stock was used for the ligation reaction, again according to the library preparation kit instructions (KAPA).
• KAPA library preparation kit instructions
• the libraries were then size selected on a 2% agarose gel to remove unligated adapters and select for fragments ⁇ 200- 300 bp in length (inserts ⁇ 120-220 bp).
• the libraries were PCR amplified in four separate reactions with the following components: 25 ⁇ 2x HiFi HotStart ReadyMix (KAPA), 20 ⁇ H 2 0, 5 ⁇ PCR primer (5'-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG*T-3', same as T7 oligo 1 above, 10 ⁇ stock), and 5 ⁇ purified ligation mix.
• the cycling conditions were as follows: 98°C/1 min, 98°C/15 s; 10 cycles of 60°C/15 s, 72°C/30 s; 72°C/5 min.
• the reactions were pooled and purified with AMPure XP beads (Beckman Coulter), eluting in 25 ⁇ H 2 0.
• QIAGEN RNeasy Mini kit
• a single reaction produced ⁇ 50 ⁇ g of RNA.
• the size of the RNA was checked by running ⁇ 100 ng on a 5% TBE/Urea gel and staining with ethidium bromide. For long-term storage, 1.5 ⁇ of SUPERase-In was added, and the RNA was stored at -80°C.
• T7 universal promoter (5 '- AGT ACTAATACGACTC ACTAT AGG-3 ' (SEQ ID NO:3)) + either Multiplex-block-P5 (5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTAT C ATTCCTATAGTGAGTCGT ATT AGTACT-3 ' (SEQ ID NO:4)) or Multiplex-block-P7 (5'-
• AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGT CTTCTGCTTGCCTATAGTGAGTCGTATTAGTACT-3' (SEQ ID NO:5)), the latter containing random nucleotides at the site of the index sequence, which allows the same adaptor-blocking oligos to be used for all libraries.
• RNA was purified with an RNeasy Mini kit according to the manufacturer's instructions, except that 675 ⁇ of ethanol (instead of 250 ⁇ ) was added at step 2 of the protocol to ensure the retention of small RNAs.
• the RNA was eluted in 30 ⁇ H 2 0, to which 1.5 ⁇ of
• RNA baits and adaptor-blocking oligos were mixed in a separate 1.5 ml tube as follows: for each capture, 1 ⁇ (500 ng) biotinylated RNA bait library, 3 ⁇ SUPERase-In, 2 ⁇ P5 multiplex block RNA (100 ⁇ stock, see above), and 2 ⁇ P7 multiplex block RNA (100 ⁇ stock, see above).
• the DNA pond was heated in a thermal cycler to 95°C for 5 min, followed by 65°C for 5 min.
• the RNA bait mix was heated to 65°C for 2.5 min in a heat block.
• 26 ⁇ of prewarmed hybridization buffer (10 x SSPE, 10x Denhardt's, 10 mM EDTA, 0.2% SDS, and 0.01% Tween 20) was added, followed by 8 ⁇ RNA bait/block mix to produce a 66 ⁇ total reaction.
• the reaction was mixed by pipetting, then incubated at 65°C for ⁇ 66 hr.
• Dynabeads MyOne Streptavidin CI beads (Life Technologies) was mixed with 200 ⁇ bead wash buffer (1 M NaCl, 10 mM Tris-HCl [pH 7.5], 1 mM EDTA, and 0.01%> Tween 20), vortexed for 30 s, then separated on a magnetic plate for 2 min before supernatant was removed. This wash step was repeated twice and after the last wash the beads were resuspended in 134 ⁇ bead wash per sample.
• the captured pond was PCR amplified by combining the 30 ⁇ of captured DNA with 50 ⁇ 2 NEB Next Master Mix, 0.5 ⁇ each primer (200 ⁇ stocks of primer P5, 5'- AATGATACGGCGACCACCGA-3' (SEQ ID NO:6), and P7, 5'- CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:7)), 0.5 ⁇ RNase A (7,000 U/ml, QIAGEN), and 18.5 ⁇ H 2 0. Cycling conditions were as follows: 98°C/30 s; 15-20 cycles of 98°C/10 s, 60°C/30 s, 72°C/30 s; 72°C/2 min. The reactions were purified with 1.8* (180 ⁇ ) AMPure XP beads and eluted in 30 ⁇ H 2 0.
• Captured libraries were pooled in equimolar amounts (determined by analysis on an Agilent Bioanalyzer 2100) and sequenced on either a MiSeq (postcapture Bulgarian libraries, 2 x 150 bp reads) or HiSeq (precapture Bulgarian libraries (2 x 90 bp reads) and all other libraries (2 x 101 bp reads).
• MiSeq postcapture Bulgarian libraries, 2 x 150 bp reads
• HiSeq precapture Bulgarian libraries (2 x 90 bp reads
• all other libraries (2 x 101 bp reads
• paired-end reads were merged and adapters were trimmed with the program SeqPrep with default settings, including a length cutoff of 30 nt.
• the merged reads and trimmed unmerged reads were mapped separately to the human reference genome (UCSC Genome Browser hgl9) with BWA v.0.5 with seeding disabled (-1 1000).
• Duplicates were then removed from the combined bam file with samtools (v.0.1.18) and reads were filtered for mapping qualities >30.
• Phase 1 data set (v.3), filtering for base qualities >30 in the ancient samples and removing related individuals from 1000 Genomes.
• PCAs with Native Americans low-coverage sequenced genomes from ten additional individuals (Mayan individuals HGDP00854, HGDP00855, HGDP00856, HGDP00857, HGDP00860, HGDP00868, HGDP00877;
• WISC was tested on 12 human aDNA libraries derived from non- frozen-preserved specimens: four Iron and Bronze Age human teeth from Bulgaria, seven pre-Columbian human mummies from Peru, and one Bronze Age human hair sample from Denmark.
• the DNA was extracted and the libraries built in a dedicated clean room (see Material and Methods). Shotgun sequencing prior to capture indicated that all libraries contained low levels of endogenous DNA (average 1.2%, range 0.04%-6.2%; see Fig. 4).
• the numbers of reads in the pre- and postcapture libraries were adjusted to be equal prior to mapping by taking the first n reads from the respective raw fastq files (Fig. 4). In the case of the hair and bone libraries, the results for 1 million reads are shown for ease of comparison with the tooth libraries.
• Figures 2A and 2B show the results of increasing levels of sequencing of libraries NA40 (Peruvian bone) and M4 (Danish hair), which are generally representative of the patterns we saw for the remaining six libraries (see Figure SI).
• NA40 Peruvian bone
• M4 Disish hair
• WISC whole-genome in-solution capture method
• Genomes reference panel The likelihood that a damaged SNP will be found at the exact same position and with a matching allele as a SNP from the reference set is quite low, and thus we were able to leverage the identified SNPs to perform informative population genetics analyses without filtering out large subsets of the data (Fig. 3)
• a reference panel preferably with full genome sequence data (although this is not essential), is required for this type of analysis of poorly preserved specimens with low levels of genome coverage.
• WISC reduces the required amount of sequencing required per library, multiple individuals from the same population can be analyzed, a key consideration for studies focusing on the spatial and temporal distribution of ancient populations. As shown in Fig. 4, >1 x coverage of the mtDNA was obtained for five of the libraries. This number is lower than the typical enrichment achieved when targeting the mtDNA alone via capture, but this is not surprising given that a wider range of sequences is being targeted. A similar phenomenon was observed in the capture of nuclear and organellar DNA from ancient maize. mtDNA haplogroups could be tentatively called for these samples.
• Haplogroup U3 is especially common in the countries surrounding the Black Sea, including Bulgaria, and in the Near East, and HV is also found at low frequencies in Europe and peaks in the Near East.
• WISC could also be used to capture DNA from specimens of extinct species by creating baits from the genome of an extant relative.
• sequence divergence between species on capture efficiency remains to be determined, but chimpanzee-targeted probes have successfully been used to capture human and gorilla sequences.
• WISC has applications in other contexts, such as the enrichment of DNA in forensic, metagenomic, and museum specimens.

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Genetics & Genomics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Analytical Chemistry (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Immunology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Crystallography & Structural Chemistry (AREA)
• Plant Pathology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (2)

Publications (3)

Family

ID=51867654

Family Applications (1)

Country Status (5)

Families Citing this family (15)

Family Cites Families (21)

• 2014
  • 2014-05-02 WO PCT/US2014/036670 patent/WO2014182574A1/en active Application Filing
  • 2014-05-02 US US14/653,748 patent/US10576446B2/en active Active
  • 2014-05-02 CN CN201480038300.7A patent/CN105358714B/zh active Active
  • 2014-05-02 DK DK14794007.6T patent/DK2992114T3/da active
  • 2014-05-02 EP EP14794007.6A patent/EP2992114B1/de active Active
• 2020
  • 2020-01-15 US US16/743,501 patent/US10981137B2/en active Active

Also Published As

Similar Documents

Legal Events