EP2599877A1 - New pcr sequencing method and use thereof in hla genotyping - Google Patents

New pcr sequencing method and use thereof in hla genotyping Download PDF

Info

Publication number
EP2599877A1
EP2599877A1 EP11800190.8A EP11800190A EP2599877A1 EP 2599877 A1 EP2599877 A1 EP 2599877A1 EP 11800190 A EP11800190 A EP 11800190A EP 2599877 A1 EP2599877 A1 EP 2599877A1
Authority
EP
European Patent Office
Prior art keywords
hla
pcr
sequencing
seq
dqb1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP11800190.8A
Other languages
German (de)
French (fr)
Other versions
EP2599877B1 (en
EP2599877A4 (en
Inventor
Jian Li
Shiping Chen
Xiandong Zhang
Ying Liu
Caifen Zhang
Tao Liu
Meiru Zhao
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BGI Genomics Co Ltd
Original Assignee
BGI Shenzhen Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from CN 201010213721 external-priority patent/CN101921842B/en
Priority claimed from CN201010213719.5A external-priority patent/CN101921841B/en
Priority claimed from CN201010213717.6A external-priority patent/CN101921840B/en
Priority claimed from PCT/CN2010/002150 external-priority patent/WO2012083506A1/en
Priority claimed from PCT/CN2010/002149 external-priority patent/WO2012083505A1/en
Application filed by BGI Shenzhen Co Ltd filed Critical BGI Shenzhen Co Ltd
Publication of EP2599877A1 publication Critical patent/EP2599877A1/en
Publication of EP2599877A4 publication Critical patent/EP2599877A4/en
Application granted granted Critical
Publication of EP2599877B1 publication Critical patent/EP2599877B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • the present invention relates to the technical field of nucleic acid sequencing, in particular, the technical field of PCR sequencing.
  • the present invention also relates to DNA barcoding technique and DNA incomplete shearing strategy.
  • the method of the present invention is particularly applicable to the second generation sequencing technique, especially to the Paired-end sequencing technique of the second generation sequencing technique, and is also applicable to HLA genotyping.
  • the present invention provides a method for HLA genotyping, in particular, a method for HLA-A, HLA-B, HLA-C and HLA-DQB1 genotyping, and also provides the primer pairs for PCR amplification used in the method.
  • a PCR sequencing method refers to a technique wherein DNA fragments of a gene of interest are obtained by a PCR method, and the obtained DNA fragments of the gene of interest are subjected to DNA sequencing to obtain the DNA sequence information of the gene of interest.
  • PCR sequencing methods are widely applied to the fields such as detection of gene mutation and genotyping for a long time.
  • DNA sequencing technique is mainly classified into the first generation DNA sequencing technique represented by Sanger sequencing method and the second generation DNA sequencing technique represented by Illumina GA, Roche 454, ABI Solid, and the like.
  • Sanger DNA sequencing technique is characterized by simple experimental operations, visual and accurate results, and short experimental period, and thus is wildly applied in fields such as clinical gene mutation detection and genotyping, wherein a fast turnaround time is highly required as to detection results.
  • due to the characteristics such as low throughput and high cost its application in fields where genotyping is performed in a large scale, is limited.
  • the second generation DNA sequencing technique has the characteristics such as high sequencing throughput, low cost, high level of automation, and single-molecule sequencing.
  • a single sequencing run generates data of 50G (about 50 billion) bases, 5 billion bases data per day in average, and the average sequencing cost for a base is less than 1/1000 of the sequencing cost in Sanger method.
  • the analysis of results can be directly carried out by a computer.
  • the second generation DNA sequencing technique is a technique quite suitable for large-scale sequencing projects.
  • the contiguous sequencing length is generally short in the second generation DNA sequencing technique.
  • the maximum bidirectional sequencing length is 200bp for Illumina GA; although the maximum sequencing length can be up to about 500 bp for Roche 454 GS-FLX, the sequencing cost is high and the throughput is low.
  • a PCR amplicon is of a length greater than the maximum sequencing length in a sequencer, the thorough sequencing of the whole amplicon cannot be accomplished by sequencing directly, and the whole DNA sequence information of the amplicon cannot be obtained. Due to short maximum sequencing length, the application of the second generation sequencing technique in PCR sequencing method is limited. In addition to gradual improvement of sequencing technique to obtain a longer maximum sequencing length, it is urgent need to develop a new technique to overcome the deficiency of the current maximum sequencing length of the second generation DNA sequencer in the PCR sequencing application field.
  • HLA Human leukocyte antigen
  • the current international standard HLA high-resolution genotyping technique is a Sanger sequencing technique-based PCR sequencing method, which comprises PCR amplifying the corresponding HLA gene regions, sequencing the amplified product, subjecting the sequencing result to genotyping with a professional genotyping software, and finally obtaining the HLA genotype information of the sample. It is characterized by visual results, high resolution and capability of detecting new allele.
  • Sanger sequencing due to the characteristics of Sanger sequencing, such as high cost and low throughput, its application in institutes like hematopoietic stem cell volunteer registration database (Bone Marrow Bank), in which large-scale HLA genotyping detection is required, is limited.
  • Illumina GA has a shorter maximum sequencing length, but has obvious advantages in terms of sequencing throughput and sequencing cost. If the defect of the short maximum sequencing length of Illumina GA can be overcome, its application in HLA genotyping will make up for the shortage of the current HLA genotyping method.
  • PCR sequencing strategy is generally employed, wherein the combination of primer index and the second generation sequencing technique is employed directly.
  • the maximum sequencing length of the sequencer can cover the length of the whole PCR product, the above strategy meets the requirements.
  • Illumina GA needs to be replaced with the second generation sequencer having a longer maximum sequencing length (such as Roche 454 GS-FLX). If the maximum sequencing length still cannot meet the requirements, a first generation sequencer has to be employed with the scarification of cost and throughput.
  • Illumina GA has a super high sequencing throughput, but its maximum sequencing length is 200bp only; although the maximum sequencing length of Roche 454 GS-FLX can reach about 500 bp, the cost for sequencing is relative high and the throughput is relative low; although the maximum sequencing length of the first generation sequencer can reach above 1000bp, its throughput and cost are not comparable to those of the second generation sequencer.
  • the combination of primer indexes, DNA incomplete shearing strategy, and the second generation sequencing technique in the present application can make the length of PCR products that can be sequenced by a sequencer longer than the maximum sequencing length of the sequencer whilst making full use of the characteristics of the second generation sequencing technique such as high throughput and low cost, thereby greatly broadening its applicable scope.
  • the second generation sequencing technique employed in the present invention includes, among second generation sequencing techniques, a Paired-end sequencing technique, and a PCR sequencing technique which has a DNA reference sequence for the PCR template.
  • the present invention provides methods for PCR sequencing, by which the limitation resulted from short maximum sequencing length is alleviated and the application of the second generation DNA sequencing technique in the PCR sequencing application field is broadened.
  • index primers having a primer index added to the 5' end are used, the amplified PCR products are sheared, the sheared products are terminally repaired and have deoxyadenosine (A) ligated to their 3' ends, and then are ligated to different PCR-free adapters.
  • a PCR sequencing method based on DNA barcoding technique and DNA incomplete shearing strategy, can greatly increase the number of samples labeled specifically without increasing the number of primer indexes ( Figure 5 ).
  • the actually sequenced length of PCR products exceeds the maximum sequencing length of the sequencer by adding primer indexes to the forward and reverse PCR primers, in combination with using DNA incomplete shearing strategy, and applying the second generation sequencing technique.
  • an index sequence to the front end of an amplification primer is aimed to realize simultaneous sequencing of a plurality of samples.
  • a unique primer index is added to each sample during PCR by using PCR-index/barcode technique in combination with synthesizing an index primer by adding a primer index to the 5' end of a PCR primer.
  • samples have to be processed one by one only in PCR step, and may be mixed together and processed simultaneously in the rest experimental steps, and the final result for each sample can be traced by virtue of its unique primer index.
  • Adapter or “library adapter” index technique refers to a library indexing technique comprising adding different library adapters to multiple sequencing libraries (different library adapters consist of different sequences, and the different portion among the sequences is called adapter index), constructing indexed sequencing libraries, then accomplishing sequencing of multiple different indexed sequencing libraries in a pool, wherein the final sequencing result for each indexed sequencing library is distinguishable.
  • PCR-Free library adapter refers to a designed segment of bases, whose main role lies in auxiliary fixation of DNA molecule onto the sequencing chip and lies in providing the binding sites for universal sequencing primers, wherein PCR-Free library adapter may be directly ligated to the two termini of the DNA fragments in the sequencing library. Since no PCR is involved in the introduction of the adapter, the adapter is called PCR-Free library adapter.
  • PCR-FREE library adapters used in the Examples of the present invention are from ILLUMIA.
  • a method of constructing PCR-FREE library refers to direct ligation of library adapter to the two termini of the DNA fragment of the sequencing library. Since no PCR is involved in the introduction of the library adapter, it is called PCR-Free library construction. A DNA ligase may be used for ligation in the introduction process. Since no PCR is involved in the process of library construction, inaccuracy of the final results resulted from PCR bias is avoided during the construction of a library comprising PCR products of high sequence similarity.
  • DNA amplification methods, DNA extraction methods, DNA purification methods and DNA sequence alignment methods as involved in the present invention may be any methods available in the art. Said methods can be selected by a person skilled in the art according to practical situations. As to DNA sequencing methods, a person skilled in the art can carry out them according to conventional methods or following the instruction of the sequencer.
  • primer indexes vary depending on the applied experimental platform. In view of the characteristics of Illumina GA sequencing platform, the following factors are primarily considered when designing the primer indexes in the present invention: 1: a mononucleotide repeat sequence comprising 3 or more base is avoided in primer index sequences, 2: the total amount of base A and base C at the same site of all the primer indexes accounts for 30%-70% of the amount of all the bases, 3: the GC content of the primer index sequence itself is between 40 and 60%, 4: primer indexes differ from one another by at least 4 bases, 5: sequences having a high sequence similarity to the Illumina GA sequencing primers are avoided in primer index sequences, and 6: the circumstance where the addition of primer index sequences to PCR primers results in serious hairpin and dimer, are reduced.
  • two primer indexes (which are either identical or different) are added to two termini of a PCR product, respectively, so that the primer index at either terminal of the PCR product can specifically label the sample information of the PCR product.
  • the resultant PCR product is subjected to incomplete shearing.
  • the so-called "incomplete shearing” refers to the circumstance where the products comprise intact un-sheared PCR products and partially sheared PCR products.
  • the shearing methods include, but are not limited to, chemical shearing methods (such as enzymatic digestion) and physical shearing methods.
  • the physical shearing methods include ultrasonic shearing methods or mechanical shearing methods.
  • the sheared DNA is subjected to 2% agarose electrophoresis, and all DNA bands between the maximum sequencing length and the maximum applicable DNA length of the sequencer are purified and recovered by slicing the gel (the longest DNA applicable to Illumina GA sequencer is 700 bp, and the length refers to the original DNA length, which does not comprise the length of the library adapter sequence).
  • Methods for purification and recovery include, but are not limited to, recovery by electrophoresis and gel slicing, and recovery by magnetic beads.
  • the recovered DNA fragments are subjected to the construction of sequencing libraries according to the procedures for constructing the sequencing libraries for the second generation sequencer, and then are subjected to sequencing.
  • the sequencing libraries are constructed according to the PCR-FREE procedures for constructing sequencing libraries, and Paired-End method is used as the sequencing method.
  • PCR-Free construction of sequencing libraries is carried out according to methods known by a person skilled in the art.
  • the sequence information for all the test samples can be obtained by virtue of the primer index sequences.
  • the sequence reads are aligned to the corresponding DNA reference sequences of the PCR products by BMA, and the complete sequence is assembled by the overlapping and linkage relationship between the sequence reads ( Figure 1 ).
  • the linkage here refers to the paired-end linkage relationship due to paired-End sequencing characteristics.
  • Illumina GA sequencing Genetic Analyzer Sequencer from Illumina Inc., cited as Illumina GA for brief
  • DNA sequence analysis is carried out based on the principle of sequencing by synthesis. It may be applied to phase haplotype, and the finally obtained data refers to a series of base sequences and may be directly applied to the alignment with the reference sequences in HLA database. Since it does not have the defect of misjudgment of peaks present in the traditional typing software, it is advantageous for automation of software typing.
  • Illumina GA has a high sequencing throughput. Currently, one single sequencing run generates 50G (50 billion) base data, 5 billion base data per day in average. Due to the high data throughput, a high sequencing depth can be obtained for each sequence, thereby ensuring the reliability of the sequencing results.
  • the present invention applies Illumina GA sequencing to HLA typing field for the first time, and accomplishes HLA typing with low cost, high throughput, high accuracy and high resolution by using a PCR sequencing technique, based on DNA barcoding technique, DNA incomplete shearing and PCR-FREE library preparation.
  • samples to be analyzed are grouped; the samples of each group are subjected to the amplification of a fragment of interest of HLA genes with primers labeled by bidirectional primer indexes (the maximum length of PCR products depends on the maximum length of the DNA that can be applied in a sequencer; the maximum applicable DNA length is 700bp in the current Illumina GA, and the length is the original DNA length, which does not comprise the length of the library adapter sequence); the PCR products are pooled together with the same amount, then subjected to incomplete shearing and indexed PCR-Free DNA sequencing library preparation.
  • Different indexed sequencing libraries as obtained from various groups of samples, are mixed in an equal mole, all the DNA fragments of a length longer than the maximum sequencing length of the sequencer are selectively recovered and are sequenced by Illumina GA sequencer.
  • the DNA sequence reads for each sample can be obtained by screening the sequence information of adapter indexes, primer indexes and PCR primers in the total sequencing data.
  • the resultant DNA sequences after assembly are aligned with the corresponding data in IMGT HLA professional database, thereby determining the HLA genotype of the sample finally.
  • DNA from samples of different groups is ligated to a different library adapter during indexed PCR-Free library preparation, and therefore in the following typing steps, the resultant sequencing data can be traced to the samples one by one based on the primer indexes and adapter indexes used in each sample. Sequences of each sample are aligned to the known DNA reference sequence corresponding to the PCR product by software. Based on the sequence overlapping and linkage relationship, an intact sequence for the PCR product is assembled from the sequences of the sheared DNA.
  • the present invention provides Illumina GA sequencing technique-based high-resolution HLA genotyping methods, thereby accomplishing haplotype sequencing and software typing automation, enhancing HLA genotyping throughput, and reducing cost.
  • the original PCR primers for HLA-SBT methods are not applicable to new sequencing technique-based high-resolution HLA typing methods any more.
  • the present invention designs new PCR primers with good specificity and conservation, which amplify Exons 2, 3, 4 of HLA-A, B gene independently, and whose PCR products have a length no more than 700 bp and are particularly applicable to Illumina GA (the maximum DNA length applicable to the current Illumina GA is 700bp).
  • a set of PCR primers as provided in the present invention is applicable to HLA genotyping for subjects (in particular human) with a large scale, a high throughput and a low cost.
  • the 3' terminal of the primer should be specific as far as possible so as to ensure the specificity of amplifying HLA-A/B gene with the primers. Meanwhile, the length of the PCR products is less than 700bp, and the annealing temperature of forward and reverse primers are substantially the same.
  • HLA-A/B primers meeting the design requirements are used to amplify template DNAs of common HLA-A/B serotypes.
  • two sets of PCR primers of HLA-A/B (6 pairs for each set) with the best conservatism and specificity, for amplification of Exons 2, 3 and 4, respectively, are screened out.
  • the two sets of PCR primers (6 pairs for each set) are used as the basic primers, on the basis of which, 95 sets of index primers which are used for amplification of 95 and 950 DNA templates of common serotypes of HLA-A/B (the serotypes of these templates include all the common serotypes of HLA-A/B), respectively, are designed. All the PCR products are sequenced with Illumina GA Pair-End 100 after mixing in an equal amount, and the sequencing results after assembly are compared with the original typing results to confirm the conservatism and specificity of the PCR primers.
  • HLA-A, B primers as designed in the present invention i.e. two sets of PCR primers of HLA-A/B (6 pairs for each set) for amplification of Exons 2, 3 and 4, respectively, are shown in Table 1 and 2.
  • Table 1 PCR primers of HLA-A, B SEQ ID NO: primer No.
  • primer sequence the use of primer length of products 1 A-F2 CCTCTGYGGGGAGAAGCAA Amplifying Exon 2 of HLA-A gene 480bp 2 A-R2 ATCTCGGACCCGGAGACTG 3 A-F3 CGGGGCCAGGTTCTCACAC Amplifying Exon 3 of HLA-A gene 410bp 4 A-R3 5 A-F4 GTGTCCCATGACAGATGCAAAA Amplifying Exon 4 of HLA-A gene 430bp 6 A-R4 GGCCCTGACCCTGCTAAAGG 7 B-F2 AGGAGCGAGGGGACCGCA Amplifying Exon 2 of HLA-B gene 400bp 8 B-R2 CGGGCCGGGGTCACTCAC 9 B-F3 CGGGGCCAGGGTCTCACA Amplifying Exon 3 of HLA-B gene 370bp 10 B-R3 GAGGCCATCCCCGGCGAC 11 B-F4 GCTGGTCACATGGGTGGTCCTA Amplifying Exon
  • primer sequence the use of primer length of products 13 A-F2s CCTCTGYGGGGAGAAGCAA Amplifying Exon 2 of HLA-A gene 481bp 14 A-R2s GGATCTCGGACCCGGAGACTGT 15 A-F3s TGGGCTGACCGYGGGGTC Amplifying Exon 3 of HLA-A gene 403bp 16 A-R3s 17 A-F4s GTGTCCCATKACAGATGCAAAA Amplifying Exon 4 of HLA-A gene 405bp 18 A-R4s GGCCCTGACCCTGCTAAAGG 19 B-F2s AGGAGCGAGGGGACCGCA Amplifying Exon 2 of HLA-B gene 400bp 20 B-R2s CGGGCCGGGGTCACTCAC 21 B-F3s CCAAAATCCCCGCGGGTT Amplifying Exon 3 of HLA-B gene 405bp 22 B-R3s GAGGCCATCCCCGGCGAC 23 B-F4s GCTGGTC
  • the present invention designs 2 set of PCR primers (three pairs for each set) for amplification of Exons 2, 3 and 4 of HLA-C by using the method of designing PCR primers for amplification ofExons 2, 3 and 4 of HLA-A/B gene.
  • the present invention provides 2 set of PCR primers (three pairs for each set) for amplification of Exons 2, 3 and 4 of HLA-C gene, which are SEQ ID NOs: 25 and 26, 27 and 28, and 29 and 30 as shown in Table 3, and SEQ ID NOs: 31 and 32, 33 and 34, and 35 and 36 as shown in Table 4.
  • Said 6 pairs of PCR primers have good conservatism and specificity, and can cover the full-length sequences of Exons 2, 3 and 4 of HLA-C, wherein the length of all the PCR products is less than 700bp, which meets the requirement of normal Illumina Solexa sequencing.
  • the primers of the present invention are also applicable for Sanger sequencing.
  • Table 3 PCR primers ofExons 2, 3 and 4 of HLA-C gene SEQ ID NO: No. primer sequence HLA-C Exons length of products 25 C-F2 GACCCGGGGAGCCGCGCA 2 455bp 26 C-R2 TCGAGGGTCTGGGCGGGTT 27 C-F3 CCTTTACCCGGTTTCATTTTCRGTTT 3 417bp 28 C-R3 CTACGGGAGATGGGGAAGGCT 29 C-F4 GTGTCGCAAGAGAGATRCAAAGTGT 4 451bp 30 C-R4 GCTCTGGGAAAGGAGGRGAAGG Table 4: PCR primers ofExons 2, 3 and 4 of HLA-C gene SEQ ID NO: No.
  • the present invention provides the PCR primers for amplification of Exons 2 and/or 3 of HLA-DQB1, which are SEQ ID NOs: 37-40 as shown in Table 5.
  • the PCR primers have good conservatism and specificity, and can cover the full-length sequences of Exons 2, 3 of HLA-DQB1, wherein the length of all the PCR products is less than 700bp, which meets the requirement of normal Illumina Solexa sequencing.
  • the primers of the present invention are also applicable to Sanger sequencing. Table 5 PCR primers for amplification of the corresponding Exons of HLA-DQB1 SEQ ID NO: Primer No.
  • primer sequence amplification target length of amplified products 37 Q-F2 GATTCCYCGCAGAGGATTTCG Exon 2 of HLA-DQB1 311bp 38 Q-R2 AGGGGCRACSACGCTCACCTC 39 Q-F3 CCTGTCTGTTACTGCCCTCAGT Exon 3 of HLA-DQB1 339bp 40 Q-R3 GGCCCATAGTAACAGAAACTCAATA
  • Genotyping may be carried out on the basis of amplification of Exons 2 and/or 3 of HLA-DQB1 by using the primer pairs for amplification and the genotyping methods as provided in the present invention.
  • the genotyping methods use Illumina Solexa sequencing technique, which is characterized by the capability of obtaining a high resolution HLA typing results with high throughput and low cost.
  • the present invention provides a method for determining the nucleotide sequence of a nucleic acid of interest in a sample, comprising:
  • each pair of primer indexes and a pair of PCR primers form a pair of index primers
  • forward and reverse PCR primers have a forward primer index and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  • said PCR primers are PCR primers for amplification of HLA gene, particularly PCR primers for amplification of HLA-A/B gene, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7.
  • said PCR primers are PCR primers for amplification of HLA gene, particularly PCR primers for amplification of HLA-C gene, preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C; preferably, said PCR primers are shown in Table 3 or Table 4.
  • said PCR primers are PCR primers for amplification of HLA gene, preferably PCR primers for amplification of Exon 2 and/3 of HLA-DQB1 gene; preferably, said PCR primers are shown in Table 5.
  • said primer indexes are designed for PCR primers, preferably for PCR primers for amplification of specific gene of HLA, more preferably for PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B and Exon 2 for HLA-DRB1, particularly for PCR primers as shown in Table 1, Table 2 or Table 7; said primer indexes particularly comprise at least 10, or at least 20, or at least 30, or at least 40, or at least 50, or at least 60, or at least 70, or at least 80, or at least 90, or 95 pairs of 95 pairs of primer indexes as shown in Table 6 (or the set of primer indexes consisting of 10-95 pairs (for example, 10-95 pairs, 20-95 pairs, 30-95 pairs, 40-95 pairs, 50-95 pairs, 60-95 pairs, 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs) of the 95 pairs of primer indexes as shown in Table 6); and the set of index primers preferably comprises at least PI-1 to
  • said DNA shearing includes chemical shearing methods and physical shearing methods, wherein the chemical shearing methods include enzymatic digestion, and the physical shearing methods include ultrasonic shearing methods or mechanical shearing methods.
  • all the DNA bands between the maximum read length of the sequencer and the applicable maximum DNA length of the sequencer are purified and recovered, wherein said purification and recovery methods include, but are not limited to, recovery by electrophoresis and gel slicing, and recovery by magnetic beads.
  • a method for sequencing the nucleotide sequence of a nucleic acid of interest in a test sample comprising steps 1) to 4) of claim 1, and the following steps:
  • the present invention further provides the use of the above-mentioned method in HLA typing, characterized by comprising: sequencing a sample (particularly blood sample) from a patient by said method, and aligning the sequencing results with sequence data of Exons of HLA, preferably, Exons 2, 3, 4 of HLA-A/B, Exons 2, 3 and/or 4 of HLA-C, Exon 2 and/or 3 of HLA-DQB1 gene and/or Exon 2 of HLA-DRB1 in HLA database (such as IMGT HLA professional database); wherein if the result of sequence alignment shows 100% match, the HLA genotype of the corresponding sample is determined.
  • HLA database such as IMGT HLA professional database
  • the present invention provides a set of primer indexes, comprising at least 10, or at least 20, or at least 30, or at least 40, or at least 50, or at least 60, or at least 70, or at least 80, or at least 90, or 95 pairs of the 95 pairs of primer indexes as shown in Table 6 (or said set of primer indexes consisting of 10-95 pairs (for example, 10-95 pairs, 20-95 pairs, 30-95 pairs, 40-95 pairs, 50-95 pairs, 60-95 pairs, 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs) of the 95 pairs of primer indexes as shown in Table 6), and said set of index primers preferably comprises at least PI-1 to PI-10, or PI-11 to PI-20, or PI-21 to PI-30, or PI-31 to PI-40, or PI-41 to PI-50, or PI-51 to PI-60, or PI-61 to PI-70, or PI-71 to PI-80, or PI-81 to
  • the present invention further provides the use of said set of primer indexes in PCR sequencing methods, wherein in particular, each pair of primer indexes and a pair of PCR primers for amplification of a sequence of interest to be tested form a pair of index primers, wherein forward and reverse PCR primers have a forward primer index and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  • said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7; or preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are shown in Table 5.
  • the present invention provides a set of index primers comprising said set of primer indexes and a pair of PCR primers for amplification of a sequence of interest to be tested, wherein a pair of index primers comprises a pair of primer indexes and a pair of PCR primers, the forward and reverse PCR primer have a forward and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  • said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are shown in Table 5.
  • the present invention further provides the use of said index primers in PCR sequencing methods.
  • the present invention provides a HLA typing method, comprising:
  • a pair of index primers comprises a pair of primer indexes and a pair of PCR primers
  • the forward and reverse PCR primer have a forward and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  • said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are shown in Table 5.
  • said primer indexes are a set of primer indexes as described above.
  • said DNA shearing includes chemical shearing methods and physical shearing methods, wherein the chemical shearing methods include enzymatic digestion, and the physical shearing methods include ultrasonic shearing methods or mechanical shearing methods.
  • said purification and recovery methods include, but are not limited to, recovery by electrophoresis and gel slicing, and recovery by magnetic beads.
  • the construction of PCR-free sequencing libraries from the libraries of the sheared PCR products with library adapter indexing technique comprises, adding m library adapters to the m PCR product libraries obtained in 2), wherein each PCR product library uses a different library adapter, thereby constructing m adapter indexed sequencing libraries; m adapter indexed sequencing libraries are pooled together at equal mole to construct a mixture of adapter indexed sequencing libraries, wherein the method for linking library adapters refers to direct linkage using DNA ligase without a PCR procedure.
  • the present invention provides PCR primers for HLA genotyping, characterized by that said PCR primers are PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exons 2 and/or 3 of HLA-DQB1, preferably said PCR primers are shown in Table 5.
  • said PCR primers are PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of
  • the present invention further provides a sequencing method using said PCR primers, comprising providing a sample, particularly a blood sample, said blood sample is preferably from mammalian, particularly human; amplifying: amplifying DNA from the blood sample with the PCR primers to obtain PCR products, and purifying the PCR products; sequencing: subjecting the PCR products to sequencing, the sequencing method may be Sanger sequencing method, or the second generation sequencing method (such as Hiseq 2000, Illumina GA and Roche454).
  • the present invention further provides the use of said PCR primers in HLA genotyping, characterized by using said PCR primers, carrying out assembly and alignment analysis on the results obtained by the above sequencing method, and comparing the sequencing results with the standard sequences in the database to obtain the HLA genotyping results.
  • the present invention further provides a kit for HLA genotyping, comprising said PCR primers.
  • the present invention provides a set of PCR primers for HLA-A,B genotyping, characterized by that said PCR primers are as shown in Table 1 or Table 2.
  • the present invention provides a sequencing method using PCR primers for HLA-A,B genotyping, comprising:
  • the present invention further provides the use of said PCR primers in HLA genotyping, characterized by using said PCR primers, carrying out assembly and alignment analysis on the results obtained by the above sequencing method, and comparing the sequencing results with the standard sequences in the database to obtain the HLA genotyping results.
  • the present invention further provides a kit for HLA genotyping, comprising the PCR primers for HLA-A,B genotyping of the present invention.
  • the present invention further provides a new method for amplifying Exons 2, 3 and 4 of HLA-C gene, characterized by carrying out PCR amplification using the amplification primer pairs of the present invention, the sequences of the amplification primer pairs are as shown in Table 3 or Table 4.
  • the method of the present invention is particularly suitable for HLA-C genotyping.
  • Illumina Solexa sequencing technique-based HLA-SBT may be used during further genotyping.
  • the present invention further provides a method for sequencing Exons 2, 3 and 4 of HLA-C gene in samples, comprising the followings steps of:
  • the present invention further provides a HLA-C genotyping method, comprising:
  • the present invention further provides a kit for HLA-C genotyping, comprising the PCR primer pair for HLA-C genotyping of the present invention, preferably selected from the group consisting of the primer pair of SEQ ID NO: 25 and SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36.
  • said kit further comprises additional agents, for example, agents for DNA amplification, DNA purification, and/or DNA sequencing.
  • Genotyping may be performed on the basis of amplification of Exons 2, 3 and 4 of HLA-C, by using the amplification primer pair and the genotyping method as provided in the present invention.
  • the genotyping utilizes Illumina Solexa sequencing technique, enhances the throughput, simplifies the procedure, and meanwhile save time and cost.
  • the present invention further provides a new method for amplifying Exon 2 and/or 3 of HLA-DQB1, characterized by carrying out PCR amplification with the amplification primer pairs of the present invention, said amplification primer pairs are as shown in Table 5.
  • Exons 2 and/or 3 of HLA-DQB1 can be amplified by a PCR reaction, the method of the present invention is particularly suitable for HLA-DQB1 genotyping. As compared with the prior HLA-DQB1 genotyping methods, since the products obtained by using the method and the amplification primers of the present invention are controlled within 300-400 bp, Illumina Solexa sequencing technique-based HLA-SBT may be used during further typing.
  • the present invention further provides a method for sequencing Exon 2 and/or 3 of HLA-DQB1 in samples, comprising the following steps of:
  • the present invention provides an improved method for HLA-DQB1 genotyping, comprising:
  • the present invention further provides a kit for HLA-DQB1 genotyping, comprising the PCR primer pair for HLA- DQB1 genotyping of the present invention, preferably, the PCR amplification primer pairs as shown in Table 5.
  • said kit further comprises additional agents, for example, agents for DNA amplification, DNA purification, and/or DNA sequencing.
  • Exons 2, 3, 4 of HLA-A/B and Exon 2 of HLA-DRB1 in 95 samples were genotyped by using the combination of primer indexes + DNA incomplete shearing strategy + Illumia GA sequencer Paired-End 100 sequencing technique (PCR products have a length ranging from 290bp to 500bp), demonstrating that the method of the invention could accomplish the typing of gene fragments of a length exceeding the maximum read length of sequencer whilst sufficiently utilizing the characteristics of the second generation sequencer, such as high throughput and low cost.
  • primer indexes were introduced to the two termini of the PCR products of Exons 2, 3, 4 of HLA-A/B and Exon 2 of HLA-DRB1 by PCR reaction so as to specifically label the sample information of the PCR products.
  • the products of PCR amplification of three sites (HLA-A/B/DRB1) in each group of samples were pooled together to obtain a library of PCR products; after incomplete ultrasonic shearing of the library of PCR products, a PCR-free sequencing library was constructed.
  • the sequencing library was subjected to 2% low melting point agarose gel electrophoresis, and all the DNA bands of a length ranging from 450bp to 750bp were purified and recovered by gel slicing (during the construction of the PCR-Free sequencing library, since library adapters were added to the two termini of the DNA fragments, the length of the DNA band as shown in the electrophoretogram was about 250 bp longer than the actual length of the DNA fragments; therefore, the fragments of a length ranging from 450bp to 700bp as recovered here actually correspond to DNA fragments of an original length ranging from 200 bp to 500 bp).
  • the recovered DNA was sequenced by Illumina GA PE-100.
  • sequence information of all the tested samples can be traced by primer index sequences, and the sequence of the whole PCR product can be assembled on the basis of the known reference sequences and the overlapping and linkage relationship between the sequences of DNA fragments,
  • the complete sequence of the original PCR product can be assembled with the standard database of the corresponding exons of HLA-A/B/DRB1, thereby accomplishing HLA-A/B/DRB1 genotyping.
  • DNAs were extracted from 95 blood samples with known HLA-SBT typing results (China Marrow Donor Program cited hereafter as (CMDP)) by using KingFisher Automatic Extraction Instrument (US Thermo Co.).
  • the main steps were as follows: as directed in the handbook, a certain amount of self-contained agents was added to six deep-well plates and one shallow-well plate equipped by the KingFisher Automatic Extraction Instrument, and all the plates, to which the agents were added, were placed in the corresponding positions as required.
  • the program "Bioeasy_200ul Blood DNA_KF.msz” was selected, and was implemented to extract nucleic acids by pressing "star”. Approximately 100 ⁇ l eluted products (i.e. the extracted DNA) were collected from plate Elution after the program was finished.
  • PCR index primers were made by synthesizing PCR primers having different primer indexes at 5' end, and such different PCR index primers may be applied to different samples, wherein the PCR primers were PCR primers for Exons 2, 3, 4 of HLA-A/B and Exon 2 of HLA-DRB1. Thereafter, primer indexes were introduced to the two termini of the PCR products by PCR reaction, thereby specifically labeling the PCR products from different samples.
  • each forward PCR primer has the forward primer index in the pair of primer indexes linked at the 5' end
  • the reverse PCR primer has the reverse primer index in the pair of primer indexes linked at the 5' end.
  • the 95 DNAs obtained from the sample extraction step of Example 1 were designated as No. 1-95.
  • PCR reaction took place in 96-well plates, 7 plates in total, designated as HLA-P-A2, HLA-P-A3, HLA-P-A4, HLA-P-B2, HLA-P-B3, HLA-P-B4 and HLA-P-DRB1-2 (A2/A3/A4, B2/B3/B4, DRB1-2 represent the amplified sites), wherein a negative control without adding any template was set in each plate, and the primers used in the negative control were the same as those for Template 1.
  • Table 6 Relevant information of primer indexes Primer index No.
  • primer sequence use of primer length of products D2-F1 CACGTTTCTTGGAGTACTCTA For amplification of Exon 2 of HLA-DRB1 gene 300bp D2-F2 GTTTCTTGTGGCAgCTTAAgTT D2-F3 CCTGTGGCAGGGTAAGTATA D2-F4 D2-F5 GCACGTTTCTTGGAGGAGG D2-F6 TTTCCTGTGGCAGCCTAAGA D2-F7 GTTTCTTGGAGCAGGTTAAAC D2-R CCTCACCTCGCCGCTGCAC
  • D2-F1, D2-F2, D2-F3, D2-F4, D2-F5, D2-F6, D2-F7 were forward primers for amplification of Exon 2 of HLA-DRB1, D2-R was a reverse primer for amplification of Exon 2 of HLA-DRB1.
  • PCR reaction system for HLA-A/B was as follows, wherein all the agents were purchased from Promega (Beijing) Bio-Tech Co.
  • Promega 5 ⁇ buffer I Mg2+ plus) 5.0ul dNTP Mixture (2.5mM/ ⁇ l each) 2.0ul PI nf -A/B-F 2/3/4 (2pmol/ ul) 1.0ul PI nr -A/B-R 2/3/4 (2pmol/ ul) 1.0ul Promega Taq (5U/ul) 0.2ul DNA (about 20 ng/ul) 5.0ul ddH 2 O 10.8ul Total 25.0ul
  • the PCR reaction system for HLA-DRB1 was as follows: Promega 5 ⁇ buffer I (Mg2+ plus) 5.0ul dNTP Mixture (2.5mM/ ⁇ l each) 2.0ul PI nf -D2-F1 (2pmol/ul) 1.0ul PI nf -D2-F2 (2pmol/ ul) 1.0ul PI nf -D2-F3 (2pmol/ ul) 1.0ul PI nf -D2-F4 (2pmol/ ul) 1.0ul PI nf -D2-F5 (2pmol/ ul) 1.0ul PI nf -D2-F6 (2pmol/ ul) 1.0ul PI nf -D2-F7 (2pmol/ ul) 1.0ul PI nr -D2-R (2pmol/ ul) 1.0ul Promega Taq (5U/ul) 0.2ul DNA (about 20 ng/ul) 5.0ul ddH 2 O 4.8ul Total 2
  • PI nf -A/B/D2-F 1/2/3/4/5/6/7 represents the F primer of HLA-A/B/DRB1 having the forward primer index sequence No. n (Table 6) at 5' end
  • PI nr -A/B/D2-R 2/3/4 represents the R primer of HLA-A/B/DRB1 having the reverse primer index sequence No. n at 5' end (here n ⁇ 95), and the rest may be deduced similarly.
  • each sample corresponds to a specific set of PCR primers (PI nf -A/B/D2-F 1/2/3/4/5/6/7 , PI nr -A/B/D2-R 2/3/4 ).
  • PCR reaction was carried out in PTC-200 PCR apparatus from Bio-Rad Co.. After PCR reaction, 2ul PCR products were subjected to 1% agarose gel electrophoresis.
  • Figure 2 showed the electrophoretic result of the PCR products of the corresponding exons of HLA-A/B/DRB1 of Sample No. 1, and the marker for DNA molecular weights was DL 2000 (Takara Co.).
  • N negative control
  • HLA-A2-Mix pooling and purification of PCR products 20 ⁇ l of the rest PCR products was taken from each well of the 96-well plate HLA-P-A2 (except for the negative control), and was mixed homogeneously under shaking in a 3 ml EP tube (designated as HLA-A2-Mix). The same operation was applied to the other 6 96-well plates, designated as HLA-A3-Mix, HLA-A4-Mix, HLA-B2-Mix, HLA-B3-Mix, HLA-B4-Mix and HLA-D2-Mix.
  • HLA-Mix 200ul was taken from each of HLA-A2-Mix, HLA-A3-Mix, HLA-A4-Mix, HLA-B2-Mix, HLA-B3-Mix, HLA-B4-Mix and HLA-D2-Mix, and was mixed in a 3 ml EP tube, designated as HLA-Mix.
  • 500ul DNA mixture from HLA-Mix was subjected to column purification with Qiagen DNA Purification kit (QIAGEN Co.) (For the specific purification steps, please refer to the manufacturer's instruction). It was determined by Nanodrop 8000 (Thermo Fisher Scientific Co.) that the 200ul DNA obtained by purification has a HLA-Mix DNA concentration of 48 ng/ul.
  • the shearing conditions were as follows:
  • HLA-Mix All the sheared products of HLA-Mix were recovered and purified by QIAquick PCR Purification Kit, and were dissolved in 37.5ul EB (QIAGEN Elution Buffer), respectively.
  • the purified HLA-Mix after the shearing was subject to DNA terminal repairing reaction was as follows (all the agents were purchased from Enzymatics Co.): DNA 37.5 ⁇ L H 2 O 37.5 ⁇ L 10x Polynucleotide Kinase Buffer (B904) 10 ⁇ L dNTP mixture (Solution Set (10mM each)) 4 ⁇ L T4 DNA Polymerase 5 ⁇ L Klenow Fragment 1 ⁇ L T4 Polynucleotide Kinase 5 ⁇ L Total volume 100 ⁇ L
  • Reaction conditions incubating at 20°C for 30 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • reaction products were recovered and purified by the QIAquick PCR Purification Kit, and were dissolved in 34 ⁇ l EB (QIAGEN Elution Buffer).
  • DNA obtained in the last step 32 ⁇ L 10x blue buffer 5 ⁇ L dATP (1mM, GE Co.) 10 ⁇ L Klenow (3'-5' exo-) 3 ⁇ L Total volume 50 ⁇ L
  • Reaction conditions incubating at 37 ⁇ for 30 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • reaction products were recovered and purified by MiniElute PCR Purification Kit (QIAGEN Co.), and were dissolved in 13 ⁇ l EB (QIAGEN Elution Buffer).
  • PCR-Free library adapter refers to a segment of designed bases, whose main role lies in auxiliary fixation of DNA molecule onto the sequencing chip and lies in providing the binding sites for universal sequencing primers, wherein PCR-Free library adapter may be directly ligated to the two termini of the DNA fragments in the sequencing library; since no PCR was involved in the introduction of the library adapter, the library adapter was called PCR-Free library adapter.
  • the products having A added were ligated to the Illumina GA PCR-Free library adapters, and the reaction system was as follows (all the agents were purchased from Illumina Co.): DNA obtained in the last step 11 ⁇ L 2x Rapid ligation buffer 15 ⁇ L PCR-free adapter oligo mix (30mM) 1 ⁇ L T4 DNA Ligase (Rapid, L603-HC-L) 3 ⁇ L Total volume 30 ⁇ L
  • Reaction conditions incubating at 20 ⁇ for 15 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50ul deionized water, and the DNA concentration determined by Fluorescence quantitative PCR (QPCR) was as follows: result determined by qPCR (nM) HLA-Mix 78.90
  • HLA-Mix was subjected to 2% low melting point agarose gel electrophoresis.
  • the electrophoretic condition was 100V, 100min.
  • DNA marker was the 50bp DNA marker from NEB Co..
  • the gel containing the DNA fragments ranging from 450 to 750bp was sliced ( Figure 3 ).
  • the products in the sliced gel were recovered and purified by QIAquick PCR Purification Kit (QIAGEN Co.), the volume after purification was 32ul, and the DNA concentration measured by Fluorescence quantitative PCR (QPCR) was 10.16nM.
  • the sequencing results from Illumina GA were a series of DNA sequences, and by searching the forward and reverse primer index sequences and primer sequences in the sequencing results, databases comprising the sequencing results of the PCR products of various exons of HLA-A/B/DRB1 for each sample corresponding to respective primer index were constructed.
  • the sequencing results of each exon were aligned to the reference sequence (reference sequences were from http://www.ebi.ac.uk/imgt/hla/) of the corresponding exon by BWA (Burrows-Wheeler Aligner), and meanwhile, the consensus sequences of each database were constructed, and the DNA sequences in the database were selected and corrected.
  • the corrected DNA sequences were assembled into the corresponding sequences of exons of HLA-A/B/DRB1 on the basis of sequence overlapping and linkage (Paired-End linkage) relationship.
  • the resultant DNA sequence was aligned with the sequence database of the corresponding exon of HLA-A/B/DRB1 in IMGT HLA professional database. If the result of sequence alignment shows 100% match, the HLA-A/B/DRB1 genotype of the corresponding sample was determined. Please refer to the screen-capture of the program for construction of consensus sequence of Exon 2 of HLA-A site in Sample No.1 as illustrated in Figure 4 .
  • DNAs were extracted from 950 blood samples with known HLA-SBT typing results (China Marrow Donor Program cited hereafter as (CMDP)) by using KingFisher Automatic Extraction Instrument (US Thermo Co.). The method was as described in Example 1.
  • the 950 DNAs obtained from the sample extraction step were designated as No. 1-950, and were divided into 10 groups (95 DNAs for each), which were designated as HLA-1, HLA-2, HLA-3, HLA-4, HLA-5, HLA-6, HLA-7, HLA-8, HLA-9, HLA-10.
  • 95 DNA samples were amplified by 95 sets of PCR primers (Table 1) carrying bidirectional primer indexes (Table 6) for amplification of Exons 2, 3, 4 of HLA-A/B and PCR primers (Table 7) carrying bidirectional primer indexes (Table 6) for amplification of Exon 2 of HLA-DRB1.
  • PCR reaction took place in 96-well plates, using 70 plates in total, designated as HLA-X-P-A2, HLA-X-P-A3, HLA-X-P-A4, HLA-X-P-B2, HLA-X-P-B3, HLA-X-P-B4 and HLA-X-P-DRB1-2
  • X represents the information of the group number 1/2/3/4/5/6/7/8/9/10, "A2/3/4", "B2/3/4", "DRB1-2” represent the amplification sites
  • a negative control without adding any template was set in each plate, and the primers used for the negative control were primers labeled by PI-1 (Table 6).
  • PI-1 Table 6
  • HLA-X-A2-Mix For samples of Group X ("X" is 1/2/3/4/5/6/7/8/9/10), 20 ⁇ l of rest PCR products was taken from each well of the 96-well plate HLA-X-P-A2 (except for the negative control), and was mixed homogeneously under shaking in a 3 ml EP tube (designated as HLA-X-A2-Mix). The same operation was applied to the other 6 96-well plates of the samples of Group X, designated as HLA-X-A3-Mix, HLA-X-A4-Mix, HLA-X-B2-Mix, HLA-X-B3-Mix, HLA-X-B4-Mix and HLA-X-D2-Mix.
  • HLA-X-A2-Mix 200ul was taken from each of HLA-X-A2-Mix, HLA-X-A3-Mix, HLA-X-A4-Mix, HLA-X-B2-Mix, HLA-X-B3-Mix, HLA-X-B4-Mix and HLA-X-D2-Mix, and was mixed in a 3ml EP tube, designated as HLA-X-Mix.
  • 500ul DNA mixture from HLA-X-Mix was subjected to column purification with Qiagen DNA Purification kit (QIAGEN Co.) (For the specific purification steps, please refer to the manufacturer's instruction) to obtain 200ul DNA, and its DNA concentration was determined by Nanodrop 8000 (Thermo Fisher Scientific Co.).
  • reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50ul deionized water, and the DNA molar concentrations determined by Fluorescence quantitative PCR (QPCR) were as follows: HLA-1-Mix HLA-2-Mix HLA-3-Mix HLA-4-Mix HLA-5-Mix HLA-6-Mix HLA-7-Mix HLA-8-Mix HLA-9-Mix HLA-10 -Mix Conc. (nM) 78.90 72.13 79.33 80.21 77.68 78.50 89.12 78.60 81.32 80.82
  • HLA-1-Mix, HLA-2-Mix, HLA-3-Mix, HLA-4-Mix, HLA-5-Mix, HLA-6-Mix, HLA-7-Mix, HLA-8-Mix, HLA-9-Mix and HLA-10-Mix were mixed at an equal mole (final concentration was 72.13 nM/ul), designated as HLA-Mix-10.
  • 30 ⁇ L HLA-Mix-10 was subjected to 2% low melting point agarose gel electrophoresis. The electrophoretic condition was 100V, 100min.
  • DNA marker was the 50bp DNA marker from NEB Co..
  • the gel containing the DNA fragments ranging from 450 to 750bp was sliced.
  • the products in the sliced gel were recovered and purified by QIAquick PCR Purification Kit (QIAGEN Co.), the volume after purification was 32ul, and the DNA concentration measured by Fluorescence quantitative PCR (QPCR) was 9.96nM.
  • each set of PCR index primers consisted of PCR primers for amplification of Exons 2, 3, 4 of HLA-C (Table 3) and a pair of bidirectional primer indexes (as described below), each forward PCR primer has the forward primer index of a pair of primer indexes linked at the 5' end, and the reverse PCR primer has the reverse primer index of a pair of primer indexes linked at the 5' end.
  • the primer indexes were directly added to the 5' end of the PCR primers.
  • the 95 DNAs obtained from the sample extraction step were designated as No. 1-95.
  • PCR reaction took place in 96-well plates, 3 plates in total, designated as HLA-P-C2, HLA-P-C3, HLA-P-A4 (C2/3/4 represent the amplification sites), wherein a negative control without adding any template was set in each plate, and the primers used in the negative control were the same as the primer PI-96.
  • the numbering information of the sample corresponding to each pair of primer indexes was recorded.
  • the primer indexes used were the primer indexes PI-1 to PI-95 as listed in Table 6, and the following negative control primer index PI-96 (Table 8) Table 8: Relevant information of the primer index used for the negative control PI-96 CACTGTATAGCT CGACTAGTACTA H12 Negative control
  • PCR amplification was carried out in single tubes by using primers for exons of HLA-C, wherein the primers have indexes at 5' end. PCR procedure was as follows:
  • PCR reaction system of HLA-C was as follows: Promega 5 ⁇ buffer I (Mg2+ plus) 5.0 ⁇ L dNTP mixture (2.5 mM each) 2.0 ⁇ L PInr-C-F2/3/4 (50 ng/ul) 1.5 ⁇ L PInf-C-R2/3/4 (50 ng/ul) 1.5 ⁇ L Promega Taq (5 U/ul) 0.2 ⁇ L DNA (about 20 ng/ul) 2.0 ⁇ L ddH 2 O 12.8 ⁇ L Total 25.0 ⁇ L
  • PI nf -C-F 2/3/4 represents the F primer of HLA-C having the forward primer index sequence No. n (Table 2) at 5' end
  • PI nr -C-R 2/3/4 represents the R primer of HLA-C having the reverse primer index sequence No. n at 5' end (here n ⁇ 96), and the rest may be deduced similarly.
  • each sample corresponds to a specific set of PCR primers.
  • PCR reaction was carried out in PTC-200 PCR apparatus from Bio-Rad Co.. After PCR reaction, 2ul PCR products were subjected to 1.5% agarose gel electrophoresis.
  • Figure 6 showed the electrophoretic result of the PCR products of the corresponding exons of HLA-C of the first 20 samples, and the DNA molecular marker was DL 2000 (Takara Co.).
  • HLA-C2-Mix 20 ⁇ l of the rest PCR products was taken from each well of the 96-well plate HLA-P-C2 (except for the negative control), and was pooled homogeneously under shaking in a 3 ml EP tube (designated as HLA-C2-Mix). The same operation was applied to the other 2 96-well plates, designated as HLA-C3-Mix and HLA-C4-Mix. 200ul was taken from each of HLA-C2-Mix, HLA-C3-Mix and HLA-C4-Mix, and was mixed in a 1.5 ml EP tube, designated as HLA-Mix.
  • the shearing conditions were as follows:
  • HLA-Mix All the sheared products of HLA-Mix were recovered and purified by QIAquick PCR Purification Kit, and were dissolved in 37.5ul EB (QIAGEN Elution Buffer), respectively.
  • the purified products were subject to DNA terminal repairing reaction, the reaction system was as follows (all the agents were purchased from Enzymatics Co.): Products purified in the last step 37.5 ⁇ L 10x Polynucleotide Kinase Buffer (B904) 5 ⁇ L dNTP mixture (Solution Set (10mM each)) 2 ⁇ L T4 DNA Polymerase 2.5 ⁇ L Klenow Fragment 0.5 ⁇ L T4 Polynucleotide Kinase 2.5 ⁇ L Total volume ⁇ L
  • Reaction conditions incubating at 20°C for 30 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • reaction products were recovered and purified by the QIAquick PCR Purification Kit, and were dissolved in 32 ⁇ l EB (QIAGEN Elution Buffer).
  • DNA obtained in the last step 32 ⁇ L 10x blue buffer 5 ⁇ L dATP (1mM, GE Co.) 10 ⁇ L Klenow (3'-5' exo-) 3 ⁇ L Total volume 50 ⁇ L
  • Reaction conditions incubating at 37°C for 30 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • reaction products were recovered and purified by MiniElute PCR Purification Kit (QIAGEN Co.), and were dissolved in 38 ⁇ l EB (QIAGEN Elution Buffer).
  • the products having A added were ligated to the Illumina GA PCR-Free library adapters, and the reaction system was as follows (all the agents were purchased from Illumina Co.): DNA obtained in the last step 38 ⁇ L 10x Ligation buffer 5 ⁇ L PCR-free adapter oligo mix (30mM) 2 ⁇ L T4 DNA Ligase (Rapid, L603-HC-L) 5 ⁇ L Total volume 50 ⁇ L
  • Reaction conditions incubating at 16°C overnight in a Thermomixer (Thermomixer, Eppendorf Co.).
  • reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50ul deionized water, and the DNA concentration determined by Fluorescence quantitative PCR (QPCR) was as follows: result determined by qPCR (nM) HLA-Mix 122.71
  • HLA-Mix was subjected to 2% low melting point agarose gel electrophoresis.
  • the electrophoretic condition was 100V, 100min.
  • DNA marker was the 50bp DNA Ladder from NEB Co..
  • the gel containing the DNA fragments ranging from 400 to 750bp was sliced ( Figure 7 ).
  • the products in the sliced gel were recovered and purified by QIAquick PCR Purification Kit (QIAGEN Co.), the volume after purification was 32ul, and the DNA concentration measured by Fluorescence quantitative PCR (QPCR) was 17.16nM.
  • the sequencing results from Illumina GA were a series of DNA sequences, and by searching the forward and reverse primer index sequences and primer sequences in the sequencing results, databases comprising the sequencing results of the PCR products of various exons of HLA-C for each sample corresponding to respective primer index were constructed were constructed.
  • the sequencing results of each exon was aligned to the reference sequence (reference sequences were from http://www.ebi.ac.uk/imgt/hla/) of the corresponding exon by BWA (Burrows-Wheeler Aligner), and consensus sequences of each database were constructed; and the sequence reads were selected and corrected based on the quality value of base sequencing, and difference between the sequence reads and consensus sequences.
  • the corrected DNA sequences were assembled into the corresponding sequences of exons of HLA-C on the basis of sequence overlapping and linkage (Paired-End linkage) relationship.
  • the screen-capture of Figure 8 illustrates the procedure for construction of consensus sequence of Exon 2 of HLA-C site in Sample No.2.
  • the resultant DNA sequence was aligned with the sequence database of the corresponding exon of HLA-C in IMGT HLA professional database. If the result of sequence alignment showed 100% match, the HLA-C genotype of the corresponding sample was determined.
  • the typing results obtained by the above method were completely consistent with the known typing results, wherein the typing results of Samples No. 1-32 were as follows: (as shown in Table 9, all the obtained results were identical to the original known results). Table 9: Comparison of the typing results obtained by the above method with the original known typing results of the samples Sample No.
  • DNAs were extracted by using KingFisher Automatic Extraction Instrument from 26 out of 95 samples with known HLA genotypes.
  • PCR reaction system of HLA-C was as follows: Promega 5 ⁇ buffer I (Mg2+ plus) 5.0 ⁇ L dNTP Mixture (2.5 mM each) 2.0 ⁇ L Primer mix (50 ng/ ⁇ L) 3.0 ⁇ L Promega Taq (5 U/ ⁇ L) 0.2 ⁇ L DNA (about 20 ng/ ⁇ L) 2.0 ⁇ L ddH 2 O 12.8 ⁇ L total 25.0 ⁇ L
  • PCR products were subject to agarose gel electrophoresis ( Figure 9 ) before purification.
  • PCR products were purified by using Millipore purification plates.
  • the main steps were as follows.
  • the wells to be used were marked with a marker pen in the 96-well purification plate for PCR products, and 50 ⁇ l ultrapure water was added to each of the wells to be used.
  • the rest wells were sealed by sealing film.
  • the plate was stood for 15 min or was connected to a drawing and filtering system (-10 pa) for 5 min. When the purification plate was taken from the drawing and filtering system, liquid in the discharge port at the bottom of the purification plate was sipped up with absorbent paper.
  • PCR products to be purified were centrifuged at 4000 rpm for 1 min; the cover or silica gel pad for the PCR products to be purified was removed, and 100 ⁇ l ultrapure water was added to each PCR reaction system. Then, the purification plate, to which the PCR products to be purified were added, was connected to the drawing and filtering system, and the vacuum degree was adjusted to -10 pa as shown in barometer. The drawing and filtering were continued until no liquid was left on the microporous regeneratable cellulose film at the bottom of the purification plate, and no reflection gloss of intact liquid surface was found when observing under light.
  • the system for sequencing reaction was Purified PCR products 1 ⁇ L primers (3.2 pmol/l) 1 ⁇ L 2.5 *Bigdye 0.3 ⁇ L 5*Buffer 0.85 ⁇ L water 1.85 ⁇ L Total volume 5 ⁇ L
  • the products of the sequencing reaction were purified by the following steps: the sequencing reaction plate was balanced, and centrifuged at 3000 g for 1 min. In the 96-well plate, to each 5 ⁇ L reaction system, 2 ⁇ L 0.125 mol/L EDTA-Na2 solution, 33 ⁇ L 85% ethanol were added, and the plate was covered by a silica gel pad and was sufficiently vibrated for 3 min. The plate was then centrifuged at 4°C, 3000 g for 30 min. The sequencing plate was taken out after centrifugation, the silica gel pad was removed, and the sequencing plate was placed downwardly onto absorbent paper, and was then subjected to inverted centrifugation until the centrifugal force reached 185 g.
  • HLA-DQB1 genotyping by using the second generation sequencing technique (Illumina Solexa)
  • each set of PCR index primers consisted of PCR primers for amplification of Exon 2 or 3 of HLA-DQB1 (Table 5) and a pair of bidirectional primer indexes (as described above), each forward PCR primer has the forward primer index of a pair of primer indexes linked at the 5' end, and the reverse PCR primer has the reverse primer index of a pair of primer indexes linked at the 5' end.
  • the primer indexes were directly added to the 5' end of the PCR primers, wherein the primers were synthesized by Shanghai Invitrogen Co.
  • the 94 DNAs obtained in the sample extraction step were designated as No. 1-94.
  • PCR reaction was carried out in 96-well plates, Exons 2, 3 of DQB1 in each sample was amplified in the same well.
  • Two negative controls without adding any template were set in each plate, and the primer indexes used in negative controls are PI-95 and PI-96.
  • the numbering information of the sample corresponding to each pair of primer indexes was recorded.
  • the primer indexes used were the primer indexes PI-1 to PI-94 as listed in Table 6, and the following primer indexes PI-95 and PI-96 (Table 11) for negative controls.
  • Table 11 Relevant information on the primer indexes used for negative controls PI-95 CGACGTAGAGTC CAGTAGCACTAC H11 Negative control PI-96 CACTGTATAGCT CGACTAGTACTA H12 Negative control
  • PCR reaction system for HLA-DQB1 was as follows: Promega 5 ⁇ buffer I (Mg2+ plus) 5.0 ul dNTP mixture (2.5 mM each) 2.0 ul PInf-Q-F2 (2 pmol/ul) 1.0 ul PInf-Q-R2 (2 pmol/ul) 1.0 ul PInf-Q-F3 (2 pmol/ul) 1.0 ul PInf-Q-R3 (2 pmol/ul) 1.0 ul Promega Taq (5U/ul) 0.2 ul DNA (about 20 ng/ul) 5.0 ul ddH 2 O 8.8 ul Total 25.0 ul
  • PInf-Q-F2/3 represents the F primer of HLA-DQB1 having the forward primer index sequence No. n (Table 1) at 5' end;
  • PInf-Q-R 2/3 represents the R primer of HLA-DQB1 having the reverse primer index sequence No. n at 5' end (here n ⁇ 96); and the rest may be deduced similarly.
  • each sample corresponds to a specific set of PCR primers.
  • PCR reaction was carried out in PTC-200 PCR apparatus from Bio-Rad Co.. After PCR reaction, 2ul PCR products were subjected to 1.5% agarose gel electrophoresis. Figure 11 showed the electrophoretic result of the PCR products of Exons 2+3 of HLA-DQB 1 of 94 samples, and the DNA molecular marker was DL 2000 (Takara Co.).
  • HLA-Q-Mix 20 ⁇ l of the rest PCR products was taken from each well of the 96-well plate HLA-P-DQB1 (except for the negative control), and was mixed homogeneously in a 3 ml EP tube (designated as HLA-Q-Mix).
  • 500ul DNA mixture from HLA-Q-Mix was subjected to column purification with Qiagen DNA Purification kit (QIAGEN Co.) (For the specific purification steps, please refer to the manufacturer's instruction). It was determined by Nanodrop 8000 (Thermo Fisher Scientific Co.) that the 200ul DNA obtained by purification has a HLA-Q-Mix DNA concentration of 48ng/ul.
  • reaction products were subjected to terminal repairing reaction, and then were recovered and purified by QIAquick PCR Purification Kit, and were dissolved in 34ul EB (QIAGEN Elution Buffer).
  • reaction products were further subjected to the addition of A at 3' end, and then were recovered and purified by MiniElute PCR Purification Kit (QIAGEN Co.), and were dissolved in 13 ⁇ l EB solution (QIAGEN Elution Buffer).
  • reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50 ⁇ l deionized water, and the DNA concentration determined by Fluorescence quantitative PCR (QPCR) was as follows: result determined by qPCR (nM) HLA-Q-Mix 115.3
  • the gel containing the DNA fragments ranging from 350 to 550bp was sliced ( Figure 12 ). After purification and recovery of the products from the gel, the DNA concentration, as determined by Fluorescence quantitative PCR (QPCR), was 18.83 nM.
  • the sequencing results from Illumina GA were a series of DNA sequences, and by searching the forward and reverse primer index sequences and primer sequences in the sequencing results, databases, comprising the sequencing results of the PCR products of various exons of HLA-DQB1 for each sample corresponding to respective primer index were constructed.
  • the sequencing results of each exon was aligned to the reference sequence (reference sequences were from http://www.ebi.ac.uk/imgt/hla/) of the corresponding exon by BWA (Burrows-Wheeler Aligner), and consensus sequences of each database were constructed, and the sequence reads were selected and corrected based on the quality value of base sequencing, and difference between the sequence reads and consensus sequences.
  • the corrected DNA sequences were assembled into the corresponding sequences of Exons 2, 3 of HLA-DQB1 on the basis of sequence overlapping and linkage (Paired-End linkage) relationship.
  • the screen-capture of Figure 13 illustrates the procedure for construction of consensus sequence of Exon 2 of HLA-DQB1 site in Sample No.7.
  • HLA-DQB1 genotyping by using Sanger sequencing method
  • DNAs were extracted by using KingFisher Automatic Extraction Instrument from 20 out of 94 samples with known HLA genotypes.
  • PCR reaction system for HLA-Q was as follows: Promega 5 ⁇ buffer I (Mg2+ plus) 5.0 ⁇ L dNTP Mixture (2.5 mM each) 2.0 ⁇ L Primer mixture (25 ng/ ⁇ L) 3.0 ⁇ L Promega Taq (5 U/ ⁇ L) 0.2 ⁇ L DNA (about 20 ng/ ⁇ L) 2.0 ⁇ L ddH2O 12.8 ⁇ L total 25.0 ⁇ L
  • PCR products were subject to agarose gel electrophoresis before purification.
  • Exons 2, 3, 4 of HLA-A/B/C and Exons 2, 3 of HLA-DQB1 in 950 samples were genotyped by using the combination of primer indexes, DNA incomplete shearing strategy, library indexes, PCR-Free libraries preparation, and Illumia GA Paired-End 100 sequencing technique (PCR products having a length ranging from 300bp to 500bp), demonstrating that the method of the present invention could accomplish the genotyping of gene fragments of a length exceeding the maximum read length of sequencer, and also demonstrating that the present invention could accomplish HLA genotyping with low cost, high throughput, high accuracy and high resolution.
  • the samples to be analyzed were divided into 10 groups; for samples of each group, primer indexes were introduced to the two termini of the PCR products of Exons 2, 3, 4 of HLA-A/B/C and Exons 2, 3 of HLA-DQB1 by PCR reaction so as to specifically label the sample information of the PCR products.
  • the products of PCR amplification of four sites (HLA-A/B/C/DQB1) in each group of samples were mixed together to obtain a library of PCR products; after incomplete ultrasonic shearing of the libraries of PCR products, indexed PCR-free sequencing libraries were constructed (wherein for the PCR product library of each sample group, a different adapter was used, thereby constructing 10 indexed sequencing libraries).
  • the 10 indexed sequencing libraries were pooled together at an equal mole to construct a mixed index sequencing library.
  • the mixed index sequencing library was subjected to 2% low melting point agarose gel electrophoresis, and all the DNA bands of a length ranging from 450bp to 750bp were recovered and purified by gel slicing.
  • the recovered DNA was sequenced by the Illumina GA PE-100 method.
  • sequence information of all the tested samples can be traced by primer index sequences and library index sequences, and the sequence of the whole PCR product can be assembled on the basis of the known reference sequences and the overlapping and linkage relationship between the sequences of DNA fragments,
  • the complete sequence of the original PCR product can be aligned with the standard database of the corresponding exons of HLA-A/B/C/DQB1, thereby accomplishing HLA-A/B/C/DQB1 genotyping.
  • DNAs were extracted from 950 blood samples with known HLA-SBT typing results (China Marrow Donor Program cited hereafter as (CMDP)) by using KingFisher Automatic Extraction Instrument (US Thermo Co.). The process was the same as that described in Example 1.
  • the 950 DNAs obtained from the sample extraction step were designated as No. 1-950, and were divided into 10 groups (95 DNAs for each group), which were designated as HLA-1, HLA-2, HLA-3, HLA-4, HLA-5, HLA-6, HLA-7, HLA-8, HLA-9, HLA-10.
  • 95 DNA samples were amplified by 95 sets of PCR primers carrying bidirectional primer indexes (Table 6) for amplification of Exons 2, 3, 4 of HLA-A/B (Table 2), for amplification of Exons 2, 3, 4 of HLA-C (Table 4), and for amplification of Exons 2, 3 of HLA-DQB1 (Table 5), respectively.
  • PCR reaction took place in 96-well plates, using 100 plates in total, designated as HLA-X-P-A2, HLA-X-P-A3, HLA-X-P-A4, HLA-X-P-B2, HLA-X-P-B3, HLA-X-P-B4, HLA-X-P-C2, HLA-X-P-C3, HLA-X-P-C4 and HLA-X-P-DQB1
  • X represents the information of the group number 1/2/3/4/5/6/7/8/9/10, "A2/3/4", "B2/3/4", "C2/3/4", "DQB1" represent the amplification sites), wherein a negative control without adding any template was set in each plate, and the primers used for the negative control were primers labeled by PI-1 (Table 6).
  • the PCR procedure and PCR reaction system for HLA-A/B/C were the same as those described in Example 2.
  • the PCR primers for amplification of the corresponding exons of HLA-A/B were shown in Table 2, and the PCR primers for amplification of the corresponding exons of HLA-C were shown in Table 4.
  • PCR procedure for HLA-DQB1 was as follows. 96°C 2min 95°C 30s ⁇ 55°C 30s ⁇ 72°C 20s (32cycles) 15°C ⁇
  • PI nf -A/B/C-F 2/3/4 and PI nf -Q-F2/F3 represent the F primers of HLA-A/B/C/DQB1 having the forward primer index sequence No. n (Table 6) at 5' end
  • PI nr -A/B/C-R 2/3/4 and PI nr -Q-R2/R3 represent the R primers of HLA-A/B/C/DQB1 having the reverse primer index sequence No. n at 5' end (here n ⁇ 95), and the rest may be deduced similarly.
  • each sample corresponds to a specific set of PCR primers (PI nf -A/B/C-F 2/3/4 , PI nr -A/B/C-R 2/3/4 , PI nf -Q-F2/F3, PI nr -Q-R2/R3).
  • PCR reaction was carried out in PTC-200 PCR apparatus from Bio-Rad Co.. After PCR reaction, 3ul PCR products were subjected to 2% agarose gel electrophoresis.
  • Figure 16 showed the electrophoretic result of the PCR products of the corresponding exons of HLA-A/B/C/DQB1 of Sample No. 1, and the DNA molecular marker was DL 2000 (Takara Co.). There were a series of single bands of a length ranging from 300 bp to 500 bp in the electrophorogram, indicating successful PCR amplification of exons (A2, A3, A4, B2, B3, B4, C2, C3, C4, DRB1) of HLA-A/B/C/DQB1 of Sample No.1. There was no amplification band in negative control (N). The results of other samples were similar.
  • HLA-X-A3-Mix HLA-X-A4-Mix
  • HLA-X-B2-Mix HLA-X-B3-Mix
  • HLA-X-B4-Mix HLA-X-C2-Mix
  • HLA-X-C3-Mix HLA-X-C4-Mix
  • HLA-X-DQB1-Mix HLA-X-DQB1-Mix
  • HLA-X-A2-Mix HLA-X-A3-Mix
  • HLA-X-A4-Mix HLA-X-B2-Mix
  • HLA-X-B3-Mix HLA-X-B4-Mix
  • HLA-X-C2-Mix HLA-X-C3-Mix
  • HLA-X-C4-Mix HLA-X-DQB1-Mix
  • Example 4 As described in Example 4, a total amount of 5ug DNA, taken from the purified HLA-X-Mix, was subjected to DNA shearing, purification after shearing, terminal repairing reaction, addition of A at 3' end, and ligation of Illumina GA PCR-Free library adapter.
  • reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50ul deionized water, and the DNA concentrations determined by Fluorescence quantitative PCR (QPCR) were as follows: HLA-1-Mix HLA-2-Mix HLA-3-Mix HLA-4-Mix HLA-5-Mix HLA-6-Mix HLA-7-Mix HLA-8-Mix HLA-9 -Mix HLA-10 -Mix Conc./nM 86.60 78.21 54.56 87.35 84.37 85.09 96.21 85.81 88.14 88.26
  • HLA-1-Mix, HLA-2-Mix, HLA-3-Mix, HLA-4-Mix, HLA-5-Mix, HLA-6-Mix, HLA-7-Mix, HLA-8-Mix, HLA-9-Mix and HLA-10-Mix were mixed at an equal mole (final concentration was 70.86nM/ul), designated as HLA-Mix-10.
  • 30 ⁇ L HLA-Mix-10 was subjected to 2% low melting point agarose gel electrophoresis. The electrophoretic condition was 100V, 100min.
  • DNA marker was the 50bp DNA marker from NEB Co..
  • the gel containing the DNA fragments ranging from 450 to 750bp was sliced ( Figure 17 ).
  • the products in the sliced gel were recovered and purified by QIAquick PCR Purification Kit (QIAGEN Co.), the volume after purification was 32ul, the DNA concentration measured by Fluorescence quantitative PCR (QPCR) was 10.25nM.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Management, Administration, Business Operations System, And Electronic Commerce (AREA)

Abstract

The invention provides a PCR sequencing method, wherein the combination of primer indexes, DNA incomplete shearing strategy and the second generation sequencing technique (Paired-End sequencing technique) can make the length of PCR products that can be sequenced by a sequencer longer than the maximum sequencing length of the sequencer whilst making full use of the characteristics of the second generation sequencing technique such as high throughput and low cost, thereby greatly broadening its applicable scope. In addition, the present invention also provides primer indexes for the PCR sequencing method and the use of the method in genotyping, particularly in HLA analysis, and also provides the PCR primers used, particularly the PCR primers for HLA-A, B, HLA-C and HLA-DQB1 gene.

Description

    RELATED APPLICATIONS
  • The present application claims the priority right of the Chinese Patent Application Nos. 201010213717.6 , 201010213719.5 , and 201010213721.2 as filed on Jun. 30, 2010 and the priority right of the International Application Nos. PCT/CN2010/002150 and PCT/CN2010/002149 as filed on Dec. 24, 2010 , the contents of which are incorporated herein by reference in their entirety.
  • TECHNICAL FIELD
  • The present invention relates to the technical field of nucleic acid sequencing, in particular, the technical field of PCR sequencing. In addition, the present invention also relates to DNA barcoding technique and DNA incomplete shearing strategy. The method of the present invention is particularly applicable to the second generation sequencing technique, especially to the Paired-end sequencing technique of the second generation sequencing technique, and is also applicable to HLA genotyping. In particular, the present invention provides a method for HLA genotyping, in particular, a method for HLA-A, HLA-B, HLA-C and HLA-DQB1 genotyping, and also provides the primer pairs for PCR amplification used in the method.
  • BACKGROUND
  • A PCR sequencing method refers to a technique wherein DNA fragments of a gene of interest are obtained by a PCR method, and the obtained DNA fragments of the gene of interest are subjected to DNA sequencing to obtain the DNA sequence information of the gene of interest. PCR sequencing methods are widely applied to the fields such as detection of gene mutation and genotyping for a long time.
  • DNA sequencing technique is mainly classified into the first generation DNA sequencing technique represented by Sanger sequencing method and the second generation DNA sequencing technique represented by Illumina GA, Roche 454, ABI Solid, and the like. Sanger DNA sequencing technique is characterized by simple experimental operations, visual and accurate results, and short experimental period, and thus is wildly applied in fields such as clinical gene mutation detection and genotyping, wherein a fast turnaround time is highly required as to detection results. However, due to the characteristics such as low throughput and high cost, its application in fields where genotyping is performed in a large scale, is limited.
  • As compared with the first generation DNA sequencing technique, the second generation DNA sequencing technique has the characteristics such as high sequencing throughput, low cost, high level of automation, and single-molecule sequencing. Taken Illumina GA single-molecule sequencing as an example, a single sequencing run generates data of 50G (about 50 billion) bases, 5 billion bases data per day in average, and the average sequencing cost for a base is less than 1/1000 of the sequencing cost in Sanger method. Moreover, the analysis of results can be directly carried out by a computer. Thus, the second generation DNA sequencing technique is a technique quite suitable for large-scale sequencing projects. However, the contiguous sequencing length is generally short in the second generation DNA sequencing technique. Currently, the maximum bidirectional sequencing length is 200bp for Illumina GA; although the maximum sequencing length can be up to about 500 bp for Roche 454 GS-FLX, the sequencing cost is high and the throughput is low. When a PCR amplicon is of a length greater than the maximum sequencing length in a sequencer, the thorough sequencing of the whole amplicon cannot be accomplished by sequencing directly, and the whole DNA sequence information of the amplicon cannot be obtained. Due to short maximum sequencing length, the application of the second generation sequencing technique in PCR sequencing method is limited. In addition to gradual improvement of sequencing technique to obtain a longer maximum sequencing length, it is urgent need to develop a new technique to overcome the deficiency of the current maximum sequencing length of the second generation DNA sequencer in the PCR sequencing application field.
  • Human leukocyte antigen (HLA) is one of the gene systems found so far to be of the highest polymorphism. It is a primary gene system for modulating specific immune response in human bodies and determining individual difference in susceptibility to diseases, and is closely associated with allogeneic organ transplant rejection. It is found in studies that the higher the matching degree of genes, such as HLA-A, B, C, DRB1 and DQB1, as well as the resolution are in a donor and a receptor, the longer a transplant survives. It is already a regular testing item to subject a potential donor and a receptor to high-resolution HLA genotyping before hematopoietic stem cell transplantation.
  • The current international standard HLA high-resolution genotyping technique is a Sanger sequencing technique-based PCR sequencing method, which comprises PCR amplifying the corresponding HLA gene regions, sequencing the amplified product, subjecting the sequencing result to genotyping with a professional genotyping software, and finally obtaining the HLA genotype information of the sample. It is characterized by visual results, high resolution and capability of detecting new allele. However, due to the characteristics of Sanger sequencing, such as high cost and low throughput, its application in institutes like hematopoietic stem cell volunteer registration database (Bone Marrow Bank), in which large-scale HLA genotyping detection is required, is limited.
  • It was reported that a Roche 454 GS-FLX-based PCR sequencing method was used in HLA genotyping. However, since its cost for sequencing was relatively high, it was not significantly superior over the Sanger sequencing-based HLA genotyping technique in terms of sequencing throughput and sequencing cost. As compared with Roche 454 GS-FLX, Illumina GA has a shorter maximum sequencing length, but has obvious advantages in terms of sequencing throughput and sequencing cost. If the defect of the short maximum sequencing length of Illumina GA can be overcome, its application in HLA genotyping will make up for the shortage of the current HLA genotyping method.
  • SUMMARY OF THE INVENTION
  • When conducting sequencing analysis simultaneously to sequences associated with a specific gene in a large number of samples by the second generation sequencing technique, PCR sequencing strategy is generally employed, wherein the combination of primer index and the second generation sequencing technique is employed directly. When the maximum sequencing length of the sequencer can cover the length of the whole PCR product, the above strategy meets the requirements. When the maximum sequencing length of the sequencer cannot cover the length of the whole PCR product, Illumina GA needs to be replaced with the second generation sequencer having a longer maximum sequencing length (such as Roche 454 GS-FLX). If the maximum sequencing length still cannot meet the requirements, a first generation sequencer has to be employed with the scarification of cost and throughput.
  • The actual situation is that Illumina GA has a super high sequencing throughput, but its maximum sequencing length is 200bp only; although the maximum sequencing length of Roche 454 GS-FLX can reach about 500 bp, the cost for sequencing is relative high and the throughput is relative low; although the maximum sequencing length of the first generation sequencer can reach above 1000bp, its throughput and cost are not comparable to those of the second generation sequencer.
  • Is there a technique capable of enhancing the length of PCR products that can be sequenced thoroughly by a sequencer without the scarification of cost and throughput? The combination of primer indexes, DNA incomplete shearing strategy, and the second generation sequencing technique in the present application can make the length of PCR products that can be sequenced by a sequencer longer than the maximum sequencing length of the sequencer whilst making full use of the characteristics of the second generation sequencing technique such as high throughput and low cost, thereby greatly broadening its applicable scope. The second generation sequencing technique employed in the present invention includes, among second generation sequencing techniques, a Paired-end sequencing technique, and a PCR sequencing technique which has a DNA reference sequence for the PCR template.
  • The present invention provides methods for PCR sequencing, by which the limitation resulted from short maximum sequencing length is alleviated and the application of the second generation DNA sequencing technique in the PCR sequencing application field is broadened. For example, when performing sequencing with the second generation sequencing technique, index primers having a primer index added to the 5' end are used, the amplified PCR products are sheared, the sheared products are terminally repaired and have deoxyadenosine (A) ligated to their 3' ends, and then are ligated to different PCR-free adapters.
  • A PCR sequencing method, based on DNA barcoding technique and DNA incomplete shearing strategy, can greatly increase the number of samples labeled specifically without increasing the number of primer indexes (Figure 5). In the present invention, the actually sequenced length of PCR products exceeds the maximum sequencing length of the sequencer by adding primer indexes to the forward and reverse PCR primers, in combination with using DNA incomplete shearing strategy, and applying the second generation sequencing technique.
  • The addition of an index sequence to the front end of an amplification primer is aimed to realize simultaneous sequencing of a plurality of samples. Concretely speaking, a unique primer index is added to each sample during PCR by using PCR-index/barcode technique in combination with synthesizing an index primer by adding a primer index to the 5' end of a PCR primer. As such, during the sequencing by the second generation sequencing technique, samples have to be processed one by one only in PCR step, and may be mixed together and processed simultaneously in the rest experimental steps, and the final result for each sample can be traced by virtue of its unique primer index.
  • "Adapter" or "library adapter" index technique refers to a library indexing technique comprising adding different library adapters to multiple sequencing libraries (different library adapters consist of different sequences, and the different portion among the sequences is called adapter index), constructing indexed sequencing libraries, then accomplishing sequencing of multiple different indexed sequencing libraries in a pool, wherein the final sequencing result for each indexed sequencing library is distinguishable. The term "PCR-Free library adapter" refers to a designed segment of bases, whose main role lies in auxiliary fixation of DNA molecule onto the sequencing chip and lies in providing the binding sites for universal sequencing primers, wherein PCR-Free library adapter may be directly ligated to the two termini of the DNA fragments in the sequencing library. Since no PCR is involved in the introduction of the adapter, the adapter is called PCR-Free library adapter. For example, PCR-FREE library adapters used in the Examples of the present invention are from ILLUMIA.
  • A method of constructing PCR-FREE library, wherein a library adapter index technique is used, refers to direct ligation of library adapter to the two termini of the DNA fragment of the sequencing library. Since no PCR is involved in the introduction of the library adapter, it is called PCR-Free library construction. A DNA ligase may be used for ligation in the introduction process. Since no PCR is involved in the process of library construction, inaccuracy of the final results resulted from PCR bias is avoided during the construction of a library comprising PCR products of high sequence similarity.
  • DNA amplification methods, DNA extraction methods, DNA purification methods and DNA sequence alignment methods as involved in the present invention may be any methods available in the art. Said methods can be selected by a person skilled in the art according to practical situations. As to DNA sequencing methods, a person skilled in the art can carry out them according to conventional methods or following the instruction of the sequencer.
  • The design of primer indexes varies depending on the applied experimental platform. In view of the characteristics of Illumina GA sequencing platform, the following factors are primarily considered when designing the primer indexes in the present invention: 1: a mononucleotide repeat sequence comprising 3 or more base is avoided in primer index sequences, 2: the total amount of base A and base C at the same site of all the primer indexes accounts for 30%-70% of the amount of all the bases, 3: the GC content of the primer index sequence itself is between 40 and 60%, 4: primer indexes differ from one another by at least 4 bases, 5: sequences having a high sequence similarity to the Illumina GA sequencing primers are avoided in primer index sequences, and 6: the circumstance where the addition of primer index sequences to PCR primers results in serious hairpin and dimer, are reduced.
  • In the present invention, two primer indexes (which are either identical or different) are added to two termini of a PCR product, respectively, so that the primer index at either terminal of the PCR product can specifically label the sample information of the PCR product. The resultant PCR product is subjected to incomplete shearing. The so-called "incomplete shearing" refers to the circumstance where the products comprise intact un-sheared PCR products and partially sheared PCR products. The shearing methods include, but are not limited to, chemical shearing methods (such as enzymatic digestion) and physical shearing methods. The physical shearing methods include ultrasonic shearing methods or mechanical shearing methods. The sheared DNA is subjected to 2% agarose electrophoresis, and all DNA bands between the maximum sequencing length and the maximum applicable DNA length of the sequencer are purified and recovered by slicing the gel (the longest DNA applicable to Illumina GA sequencer is 700 bp, and the length refers to the original DNA length, which does not comprise the length of the library adapter sequence). Methods for purification and recovery include, but are not limited to, recovery by electrophoresis and gel slicing, and recovery by magnetic beads. The recovered DNA fragments are subjected to the construction of sequencing libraries according to the procedures for constructing the sequencing libraries for the second generation sequencer, and then are subjected to sequencing. Preferably, the sequencing libraries are constructed according to the PCR-FREE procedures for constructing sequencing libraries, and Paired-End method is used as the sequencing method. PCR-Free construction of sequencing libraries is carried out according to methods known by a person skilled in the art. In the sequencing data obtained, the sequence information for all the test samples can be obtained by virtue of the primer index sequences. The sequence reads are aligned to the corresponding DNA reference sequences of the PCR products by BMA, and the complete sequence is assembled by the overlapping and linkage relationship between the sequence reads (Figure 1). The linkage here refers to the paired-end linkage relationship due to paired-End sequencing characteristics.
  • In Illumina GA sequencing (Genome Analyzer Sequencer from Illumina Inc., cited as Illumina GA for brief), DNA sequence analysis is carried out based on the principle of sequencing by synthesis. It may be applied to phase haplotype, and the finally obtained data refers to a series of base sequences and may be directly applied to the alignment with the reference sequences in HLA database. Since it does not have the defect of misjudgment of peaks present in the traditional typing software, it is advantageous for automation of software typing. Illumina GA has a high sequencing throughput. Currently, one single sequencing run generates 50G (50 billion) base data, 5 billion base data per day in average. Due to the high data throughput, a high sequencing depth can be obtained for each sequence, thereby ensuring the reliability of the sequencing results.
  • There are no studies on applying Illumina GA to HLA typing field yet. The present invention applies Illumina GA sequencing to HLA typing field for the first time, and accomplishes HLA typing with low cost, high throughput, high accuracy and high resolution by using a PCR sequencing technique, based on DNA barcoding technique, DNA incomplete shearing and PCR-FREE library preparation.
  • In the present invention, by using a PCR sequencing technique which is based on DNA barcoding technique, DNA incomplete shearing and PCR-FREE library preparation, samples to be analyzed are grouped; the samples of each group are subjected to the amplification of a fragment of interest of HLA genes with primers labeled by bidirectional primer indexes (the maximum length of PCR products depends on the maximum length of the DNA that can be applied in a sequencer; the maximum applicable DNA length is 700bp in the current Illumina GA, and the length is the original DNA length, which does not comprise the length of the library adapter sequence); the PCR products are pooled together with the same amount, then subjected to incomplete shearing and indexed PCR-Free DNA sequencing library preparation. Different indexed sequencing libraries, as obtained from various groups of samples, are mixed in an equal mole, all the DNA fragments of a length longer than the maximum sequencing length of the sequencer are selectively recovered and are sequenced by Illumina GA sequencer. The DNA sequence reads for each sample can be obtained by screening the sequence information of adapter indexes, primer indexes and PCR primers in the total sequencing data. The resultant DNA sequences after assembly are aligned with the corresponding data in IMGT HLA professional database, thereby determining the HLA genotype of the sample finally.
  • In the methods described above, after shearing said DNA, DNA from samples of different groups is ligated to a different library adapter during indexed PCR-Free library preparation, and therefore in the following typing steps, the resultant sequencing data can be traced to the samples one by one based on the primer indexes and adapter indexes used in each sample. Sequences of each sample are aligned to the known DNA reference sequence corresponding to the PCR product by software. Based on the sequence overlapping and linkage relationship, an intact sequence for the PCR product is assembled from the sequences of the sheared DNA.
  • The present invention provides Illumina GA sequencing technique-based high-resolution HLA genotyping methods, thereby accomplishing haplotype sequencing and software typing automation, enhancing HLA genotyping throughput, and reducing cost.
  • Due to the requirement on the length of DNA template in the current sequencing techniques and the short read length in the current sequencing techniques, the original PCR primers for HLA-SBT methods are not applicable to new sequencing technique-based high-resolution HLA typing methods any more. The present invention designs new PCR primers with good specificity and conservation, which amplify Exons 2, 3, 4 of HLA-A, B gene independently, and whose PCR products have a length no more than 700 bp and are particularly applicable to Illumina GA (the maximum DNA length applicable to the current Illumina GA is 700bp). A set of PCR primers as provided in the present invention is applicable to HLA genotyping for subjects (in particular human) with a large scale, a high throughput and a low cost.
  • In the technical solutions employed in the present invention, all the latest HLA-A/B gene sequences are downloaded from IMGT/HLA internet website (http://www.ebi.ac.uk/imgt/hla/), and then are saved in the local disk as HLA-A data set; meanwhile, all the latest HLA-I gene sequences other than HLA-A sequences are downloaded as the comparison data set. Said two data sets are compared to look for conservative and specific sequences for each gene site at the two termini and internal portion of Exons 2, 3, 4, and the designed PCR primer sequence is compared with the whole human genome sequence for homology. Since HLA-A/B gene is highly similar to other genes belonging to HLA-I molecules in terms of sequence, when designing PCR primers, the 3' terminal of the primer should be specific as far as possible so as to ensure the specificity of amplifying HLA-A/B gene with the primers. Meanwhile, the length of the PCR products is less than 700bp, and the annealing temperature of forward and reverse primers are substantially the same.
  • Multiple pairs of candidate HLA-A/B primers meeting the design requirements are used to amplify template DNAs of common HLA-A/B serotypes. Among them, two sets of PCR primers of HLA-A/B (6 pairs for each set) with the best conservatism and specificity, for amplification of Exons 2, 3 and 4, respectively, are screened out.
  • The two sets of PCR primers (6 pairs for each set) are used as the basic primers, on the basis of which, 95 sets of index primers which are used for amplification of 95 and 950 DNA templates of common serotypes of HLA-A/B (the serotypes of these templates include all the common serotypes of HLA-A/B), respectively, are designed. All the PCR products are sequenced with Illumina GA Pair-End 100 after mixing in an equal amount, and the sequencing results after assembly are compared with the original typing results to confirm the conservatism and specificity of the PCR primers.
  • HLA-A, B primers as designed in the present invention, i.e. two sets of PCR primers of HLA-A/B (6 pairs for each set) for amplification of Exons 2, 3 and 4, respectively, are shown in Table 1 and 2. Table 1: PCR primers of HLA-A, B
    SEQ ID NO: primer No. primer sequence the use of primer length of products
    1 A-F2 CCTCTGYGGGGAGAAGCAA Amplifying Exon 2 of HLA-A gene 480bp
    2 A-R2 ATCTCGGACCCGGAGACTG
    3 A-F3 CGGGGCCAGGTTCTCACAC Amplifying Exon 3 of HLA-A gene 410bp
    4 A-R3
    Figure imgb0001
    5 A-F4 GTGTCCCATGACAGATGCAAAA Amplifying Exon 4 of HLA-A gene 430bp
    6 A-R4 GGCCCTGACCCTGCTAAAGG
    7 B-F2 AGGAGCGAGGGGACCGCA Amplifying Exon 2 of HLA-B gene 400bp
    8 B-R2 CGGGCCGGGGTCACTCAC
    9 B-F3 CGGGGCCAGGGTCTCACA Amplifying Exon 3 of HLA-B gene 370bp
    10 B-R3 GAGGCCATCCCCGGCGAC
    11 B-F4 GCTGGTCACATGGGTGGTCCTA Amplifying Exon 4 of HLA-B gene 380bp
    12 B-R4 CTCCTTACCCCATCTCAGGGTG
    Table 2: PCR primers of HLA-A, B
    SEQ ID NO: primer No. primer sequence the use of primer length of products
    13 A-F2s CCTCTGYGGGGAGAAGCAA Amplifying Exon 2 of HLA-A gene 481bp
    14 A-R2s GGATCTCGGACCCGGAGACTGT
    15 A-F3s TGGGCTGACCGYGGGGTC Amplifying Exon 3 of HLA-A gene 403bp
    16 A-R3s
    Figure imgb0002
    17 A-F4s GTGTCCCATKACAGATGCAAAA Amplifying Exon 4 of HLA-A gene 405bp
    18 A-R4s GGCCCTGACCCTGCTAAAGG
    19 B-F2s AGGAGCGAGGGGACCGCA Amplifying Exon 2 of HLA-B gene 400bp
    20 B-R2s CGGGCCGGGGTCACTCAC
    21 B-F3s CCAAAATCCCCGCGGGTT Amplifying Exon 3 of HLA-B gene 405bp
    22 B-R3s GAGGCCATCCCCGGCGAC
    23 B-F4s GCTGGTCACATGGGTGGTCCTA Amplifying Exon 4 of HLA-B gene 374bp
    24 B-R4s TGACCCCTCATCCCCCTCCT
  • Degenerate primers refer to a mixture of all possible different sequences representing all different bases encoding a single amino acid. In order to increase specificity, degeneracy may be reduced according to bias of base usage in different organisms by referring to codon table, wherein R=A/G, Y=C/T, M=A/C, K=G/T, S =C/G, W=A/T, H=A/C/T, B = C/G/T, V = A/C/G, D=A/G /T, N=A/C/G/T.
  • The present invention designs 2 set of PCR primers (three pairs for each set) for amplification of Exons 2, 3 and 4 of HLA-C by using the method of designing PCR primers for amplification ofExons 2, 3 and 4 of HLA-A/B gene.
  • In the following Examples, 95 and 950 blood samples with known HLA genotypes are subjected to PCR amplification for HLA-C by using the selected 2 set of PCR primers (3 pairs for each set), respectively. The amplified products are sequenced by Sanger method and the second generation sequencing method. The sequencing results are applied to HLA-C typing, and are compared with the original typing results to confirm the conservatism and specificity of the PCR primers.
  • The present invention provides 2 set of PCR primers (three pairs for each set) for amplification of Exons 2, 3 and 4 of HLA-C gene, which are SEQ ID NOs: 25 and 26, 27 and 28, and 29 and 30 as shown in Table 3, and SEQ ID NOs: 31 and 32, 33 and 34, and 35 and 36 as shown in Table 4. Said 6 pairs of PCR primers have good conservatism and specificity, and can cover the full-length sequences of Exons 2, 3 and 4 of HLA-C, wherein the length of all the PCR products is less than 700bp, which meets the requirement of normal Illumina Solexa sequencing. In addition, the primers of the present invention are also applicable for Sanger sequencing. Table 3: PCR primers ofExons 2, 3 and 4 of HLA-C gene
    SEQ ID NO: No. primer sequence HLA-C Exons length of products
    25 C-F2 GACCCGGGGAGCCGCGCA 2 455bp
    26 C-R2 TCGAGGGTCTGGGCGGGTT
    27 C-F3 CCTTTACCCGGTTTCATTTTCRGTTT 3 417bp
    28 C-R3 CTACGGGAGATGGGGAAGGCT
    29 C-F4 GTGTCGCAAGAGAGATRCAAAGTGT 4 451bp
    30 C-R4 GCTCTGGGAAAGGAGGRGAAGG
    Table 4: PCR primers ofExons 2, 3 and 4 of HLA-C gene
    SEQ ID NO: No. primer sequence HLA-C Exons length of products
    31 C-F2s GACCCGGGGAGCCGCGCA 2 455bp
    32 C-R2s TCGAGGGTCTGGGCGGGTT
    33 C-F3s GCCCAGACCCTCGRCCGGA 3 443bp
    34 C-R3s AGATRGGGAAGGCTCCCCACT
    35 C-F4s TCTCAGGATRGTCACATGGGC 4 481bp
    36 C-R4s
    Figure imgb0003
  • According to the methods as described above, in order to apply the second generation sequencing technique to HLA-DQB1 genotyping, the present invention provides the PCR primers for amplification of Exons 2 and/or 3 of HLA-DQB1, which are SEQ ID NOs: 37-40 as shown in Table 5. The PCR primers have good conservatism and specificity, and can cover the full-length sequences of Exons 2, 3 of HLA-DQB1, wherein the length of all the PCR products is less than 700bp, which meets the requirement of normal Illumina Solexa sequencing. In addition, the primers of the present invention are also applicable to Sanger sequencing. Table 5 PCR primers for amplification of the corresponding Exons of HLA-DQB1
    SEQ ID NO: Primer No. primer sequence amplification target length of amplified products
    37 Q-F2 GATTCCYCGCAGAGGATTTCG Exon 2 of HLA-DQB1 311bp
    38 Q-R2 AGGGGCRACSACGCTCACCTC
    39 Q-F3 CCTGTCTGTTACTGCCCTCAGT Exon 3 of HLA-DQB1 339bp
    40 Q-R3 GGCCCATAGTAACAGAAACTCAATA
  • Genotyping may be carried out on the basis of amplification of Exons 2 and/or 3 of HLA-DQB1 by using the primer pairs for amplification and the genotyping methods as provided in the present invention. In relative to the prior art, the genotyping methods use Illumina Solexa sequencing technique, which is characterized by the capability of obtaining a high resolution HLA typing results with high throughput and low cost.
  • SPECIFIC MODE FOR CARRYING OUT THE INVENTION
  • A method for nucleic acid sequencing
  • In one aspect, the present invention provides a method for determining the nucleotide sequence of a nucleic acid of interest in a sample, comprising:
    1. 1) providing n samples, wherein n is an integer of ≥ 1, the samples are preferably from mammalian, more preferably human, particularly are human blood sample; optionally, the n samples to be analyzed are divided into m groups, m is an integer and n≥m≥1;
    2. 2) amplifying: a pair or multiple pairs of index primers are used for each sample, when there are templates from the sample, PCR amplification is performed under conditions suitable for amplifying the nucleic acid of interest, wherein each pair of index primers consist of a forward index primer and a reverse index primer (both of which may be degenerate primers) comprising primer indexes, wherein the primer indexes comprised in the forward index primer and reverse index primer may be identical or different: the primer indexes in the pairs of index primers used for different samples are different;
    3. 3) pooling: when n>1, pooling PCR products from each of the samples together:
    4. 4) shearing: subjecting the amplified products to incomplete shearing, and purifying and recovering;
    5. 5) sequencing: subjecting the recovered DNA mixture to sequencing by using the second generation sequencing technique, preferably, Paired-End technique (for example, Illumina GA, Illumina Hiseq 2000), to obtain sequences of the sheared DNA; and
    6. 6) assembling: corresponding the obtained sequencing data to samples one by one based on the unique primer index for each sample, aligning each sequence read to the DNA reference sequence corresponding to the PCR products by using alignment program (such as Blast, BWA program), assembling a complete sequence of the nucleic acid of interest from the sequences of the sheared DNA by virtue of sequence overlapping and linkage relationship.
  • In one aspect of the present invention, each pair of primer indexes and a pair of PCR primers form a pair of index primers, forward and reverse PCR primers have a forward primer index and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  • In one embodiment of the present invention, said PCR primers are PCR primers for amplification of HLA gene, particularly PCR primers for amplification of HLA-A/B gene, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7.
  • In one embodiment of the present invention, said PCR primers are PCR primers for amplification of HLA gene, particularly PCR primers for amplification of HLA-C gene, preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C; preferably, said PCR primers are shown in Table 3 or Table 4.
  • In one embodiment of the present invention, said PCR primers are PCR primers for amplification of HLA gene, preferably PCR primers for amplification of Exon 2 and/3 of HLA-DQB1 gene; preferably, said PCR primers are shown in Table 5.
  • In one aspect of the present invention, said primer indexes are designed for PCR primers, preferably for PCR primers for amplification of specific gene of HLA, more preferably for PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B and Exon 2 for HLA-DRB1, particularly for PCR primers as shown in Table 1, Table 2 or Table 7; said primer indexes particularly comprise at least 10, or at least 20, or at least 30, or at least 40, or at least 50, or at least 60, or at least 70, or at least 80, or at least 90, or 95 pairs of 95 pairs of primer indexes as shown in Table 6 (or the set of primer indexes consisting of 10-95 pairs (for example, 10-95 pairs, 20-95 pairs, 30-95 pairs, 40-95 pairs, 50-95 pairs, 60-95 pairs, 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs) of the 95 pairs of primer indexes as shown in Table 6); and
    the set of index primers preferably comprises at least PI-1 to PI-10, or PI-11 to PI-20, or PI-21 to PI-30, or PI-31 to PI-40, or PI-41 to PI-50, or PI-51 to PI-60, or PI-61 to PI-70, or PI-71 to PI-80, or PI-81 to PI-90, or PI-91 to PI-95 of 95 pairs of primer indexes as shown in Table 6, or combinations of any two or more of them.
  • In one embodiment of the present invention, said DNA shearing includes chemical shearing methods and physical shearing methods, wherein the chemical shearing methods include enzymatic digestion, and the physical shearing methods include ultrasonic shearing methods or mechanical shearing methods.
  • In one embodiment of the present invention, after said DNA shearing, all the DNA bands between the maximum read length of the sequencer and the applicable maximum DNA length of the sequencer are purified and recovered, wherein said purification and recovery methods include, but are not limited to, recovery by electrophoresis and gel slicing, and recovery by magnetic beads.
  • In another embodiment of the present invention, a method for sequencing the nucleotide sequence of a nucleic acid of interest in a test sample, comprising steps 1) to 4) of claim 1, and the following steps:
    • 5) constructing a library: constructing a PCR-free sequencing library by using the library of the sheared PCR products, wherein different library adapters may be added to distinguish different PCR-Free sequencing libraries, all the DNA bands between the maximum read length of the sequencer and the applicable maximum DNA length of the sequencer, preferably DNA fragments of 450 to 750 bp, are purified and recovered;
    • 6) sequencing: subjecting the recovered DNA mixture to sequencing by using the second generation sequencing technique, preferably Paired-End technique (for example, Illumina GA, Illumina Hiseq 2000), obtaining the sequences of the sheared DNAs;
    • 7) assembling: corresponding the obtained sequencing data to the samples one by one based on different library adapter sequences of the libraries and the unique primer index for each sample, aligning each sequence read to the DNA reference sequence corresponding to the PCR products by using alignment program (such as Blast, BWA program), assembling a complete sequence of the nucleic acid of interest from the sequences of the sheared DNA based on sequence overlapping and linkage relationship.
  • In one aspect, the present invention further provides the use of the above-mentioned method in HLA typing, characterized by comprising: sequencing a sample (particularly blood sample) from a patient by said method, and aligning the sequencing results with sequence data of Exons of HLA, preferably, Exons 2, 3, 4 of HLA-A/B, Exons 2, 3 and/or 4 of HLA-C, Exon 2 and/or 3 of HLA-DQB1 gene and/or Exon 2 of HLA-DRB1 in HLA database (such as IMGT HLA professional database); wherein if the result of sequence alignment shows 100% match, the HLA genotype of the corresponding sample is determined.
  • A set of primer indexes
  • In another aspect, the present invention provides a set of primer indexes, comprising at least 10, or at least 20, or at least 30, or at least 40, or at least 50, or at least 60, or at least 70, or at least 80, or at least 90, or 95 pairs of the 95 pairs of primer indexes as shown in Table 6 (or said set of primer indexes consisting of 10-95 pairs (for example, 10-95 pairs, 20-95 pairs, 30-95 pairs, 40-95 pairs, 50-95 pairs, 60-95 pairs, 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs) of the 95 pairs of primer indexes as shown in Table 6), and
    said set of index primers preferably comprises at least PI-1 to PI-10, or PI-11 to PI-20, or PI-21 to PI-30, or PI-31 to PI-40, or PI-41 to PI-50, or PI-51 to PI-60, or PI-61 to PI-70, or PI-71 to PI-80, or PI-81 to PI-90, or PI-91 to PI-95 of 95 pairs of primer indexes as shown in Table 6, or combinations of any two or more of them.
  • The present invention further provides the use of said set of primer indexes in PCR sequencing methods, wherein in particular, each pair of primer indexes and a pair of PCR primers for amplification of a sequence of interest to be tested form a pair of index primers, wherein forward and reverse PCR primers have a forward primer index and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  • In one aspect of the present invention, said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7; or preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are shown in Table 5.
  • In another aspect, the present invention provides a set of index primers comprising said set of primer indexes and a pair of PCR primers for amplification of a sequence of interest to be tested, wherein a pair of index primers comprises a pair of primer indexes and a pair of PCR primers, the forward and reverse PCR primer have a forward and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  • In one embodiment of the present invention, said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are shown in Table 5.
  • In another aspect, the present invention further provides the use of said index primers in PCR sequencing methods.
  • A HLA typing method
  • In one aspect, the present invention provides a HLA typing method, comprising:
    1. 1) providing n samples, wherein n is an integer of ≥1, the sample is preferably from mammalian, more preferably human, particularly human blood sample;
    2. 2) dividing n samples to be analyzed into m groups, m is an integer and n≥m≥1;
    3. 3) amplifying: a pair of index primers is used for each sample, when there are templates from the sample, PCR amplification is performed under conditions suitable for amplifying the nucleic acid of interest, wherein each pair of index primers consists of a forward index primer and a reverse index primer (both of which may be degenerate primers) comprising primer indexes, wherein the primer indexes comprised in the forward index primer and reverse index primer may be identical or different: the primer indexes in the pairs of index primers used for different samples are different;
    4. 4) pooling: pooling PCR amplified products from each of the samples together to obtain PCR product libraries;
    5. 5) shearing: subjecting the resultant PCR product libraries to incomplete shearing;
    6. 6) constructing libraries: constructing PCR-free sequencing libraries from the library of the sheared PCR products with library adapter index technique, wherein different library adapters may be added to distinguish different PCR-Free sequencing libraries, all the DNA bands between the maximum read length of the sequencer and the applicable maximum DNA length of the sequencer, particularly DNA fragments of 450 to 750 bp, are recovered;
    7. 7) sequencing: subjecting the recovered DNA mixture to sequencing by using the second generation sequencing technique, preferably Paired-End technique (for example, Illumina GA, Illumina Hiseq 2000), obtaining the sequences of the sheared DNAs;
    8. 8) assembling: corresponding the obtained sequencing results to the samples one by one based on different library adapter sequences of the libraries and the unique primer index for each sample, aligning each sequence read to the DNA reference sequence corresponding to the PCR products by using alignment program (such as Blast, BWA program), assembling a complete sequence of the nucleic acid of interest from the sequences of the sheared DNA based on sequence overlapping and linkage relationship; and
    9. 9) typing: aligning the sequencing results with sequence data of Exons of HLA, preferably, Exons 2, 3, 4 of HLA-A/B, Exons 2, 3 and/or 4 of HLA-C, Exon 2 and/or 3 of HLA-DQB1 gene and/or Exon 2 of HLA-DRB1 in HLA database (such as IMGT HLA professional database), wherein if the result of sequence alignment shows 100% match, the HLA genotype of the corresponding sample is determined.
  • In the HLA typing method of the present invention, a pair of index primers comprises a pair of primer indexes and a pair of PCR primers, the forward and reverse PCR primer have a forward and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  • In one embodiment of the present invention, said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are shown in Table 5.
  • In one embodiment of the present invention, said primer indexes are a set of primer indexes as described above.
  • In one embodiment of the HLA typing method of the present invention, said DNA shearing includes chemical shearing methods and physical shearing methods, wherein the chemical shearing methods include enzymatic digestion, and the physical shearing methods include ultrasonic shearing methods or mechanical shearing methods.
  • In one embodiment of the HLA typing method of the present invention, said purification and recovery methods include, but are not limited to, recovery by electrophoresis and gel slicing, and recovery by magnetic beads.
  • In one embodiment of the HLA typing method of the present invention, the construction of PCR-free sequencing libraries from the libraries of the sheared PCR products with library adapter indexing technique comprises, adding m library adapters to the m PCR product libraries obtained in 2), wherein each PCR product library uses a different library adapter, thereby constructing m adapter indexed sequencing libraries; m adapter indexed sequencing libraries are pooled together at equal mole to construct a mixture of adapter indexed sequencing libraries, wherein the method for linking library adapters refers to direct linkage using DNA ligase without a PCR procedure.
  • PCR primers for HLA genotyping
  • In one aspect, the present invention provides PCR primers for HLA genotyping, characterized by that said PCR primers are PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exons 2 and/or 3 of HLA-DQB1, preferably said PCR primers are shown in Table 5.
  • The present invention further provides a sequencing method using said PCR primers, comprising
    providing a sample, particularly a blood sample, said blood sample is preferably from mammalian, particularly human;
    amplifying: amplifying DNA from the blood sample with the PCR primers to obtain PCR products, and purifying the PCR products;
    sequencing: subjecting the PCR products to sequencing, the sequencing method may be Sanger sequencing method, or the second generation sequencing method (such as Hiseq 2000, Illumina GA and Roche454).
  • In another aspect, the present invention further provides the use of said PCR primers in HLA genotyping, characterized by using said PCR primers, carrying out assembly and alignment analysis on the results obtained by the above sequencing method, and comparing the sequencing results with the standard sequences in the database to obtain the HLA genotyping results.
  • In another aspect, the present invention further provides a kit for HLA genotyping, comprising said PCR primers.
  • PCR primers for HLA-A, B genotyping
  • In one aspect, the present invention provides a set of PCR primers for HLA-A,B genotyping, characterized by that said PCR primers are as shown in Table 1 or Table 2.
  • In another aspect, the present invention provides a sequencing method using PCR primers for HLA-A,B genotyping, comprising:
    • providing a sample, particularly a blood sample, said blood sample is preferably from mammalian, particularly human;
    • amplifying: amplifying DNA from the blood sample with the PCR primers to obtain PCR products, and purifying the PCR products;
    • sequencing: subjecting the PCR products to sequencing, the sequencing method may be Sanger sequencing method, or the second generation sequencing method (such as Hiseq 2000, Illumina GA and Roche454).
  • In another aspect, the present invention further provides the use of said PCR primers in HLA genotyping, characterized by using said PCR primers, carrying out assembly and alignment analysis on the results obtained by the above sequencing method, and comparing the sequencing results with the standard sequences in the database to obtain the HLA genotyping results.
  • In another aspect, the present invention further provides a kit for HLA genotyping, comprising the PCR primers for HLA-A,B genotyping of the present invention.
  • PCR primers for HLA-C genotyping
  • The present invention further provides a new method for amplifying Exons 2, 3 and 4 of HLA-C gene, characterized by carrying out PCR amplification using the amplification primer pairs of the present invention, the sequences of the amplification primer pairs are as shown in Table 3 or Table 4.
  • Since Exons 2, 3 and 4 of HLA-C can be amplified by a PCR reaction, the method of the present invention is particularly suitable for HLA-C genotyping. As compared with the prior HLA-C genotyping methods, since the products obtained by using the method and the amplification primers of the present invention are controlled within 700 bp, Illumina Solexa sequencing technique-based HLA-SBT may be used during further genotyping.
  • The present invention further provides a method for sequencing Exons 2, 3 and 4 of HLA-C gene in samples, comprising the followings steps of:
    1. 1) providing a sample and extracting DNA of the sample;
    2. 2) amplifying the DNA with the PCR primer pair for HLA-C genotyping of the present invention to obtain PCR products, preferably purifying the PCR products, said PCR primer pair is preferably selected from the group consisting of the primer pair of SEQ ID NO: 25 and SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36;
    3. 3) subjecting the PCR products to sequencing, preferably by the second generation sequencing method, such as Illumina Solexa or Roche454.
  • The present invention further provides a HLA-C genotyping method, comprising:
    1. 1) PCR amplifying Exons 2, 3 and/or 4 of HLA-C gene of the sample to be tested with the PCR primer pair for HLA-C genotyping of the present invention, said PCR primer pair is preferably selected from the group consisting of the primer pair of SEQ ID NO: 25 and SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36;
    2. 2) subjecting the amplified exons to sequencing, comparing the sequencing results with the standard sequences in the database so as to determine the genotyping results, wherein the sequencing is carried out by Sanger sequencing method, or the second generation sequencing method, such as Illumina Solexa or Roche454.
  • In another aspect, the present invention further provides a kit for HLA-C genotyping, comprising the PCR primer pair for HLA-C genotyping of the present invention, preferably selected from the group consisting of the primer pair of SEQ ID NO: 25 and SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36. In one embodiment, said kit further comprises additional agents, for example, agents for DNA amplification, DNA purification, and/or DNA sequencing.
  • Genotyping may be performed on the basis of amplification of Exons 2, 3 and 4 of HLA-C, by using the amplification primer pair and the genotyping method as provided in the present invention. Hence, as compared with the prior art, the genotyping utilizes Illumina Solexa sequencing technique, enhances the throughput, simplifies the procedure, and meanwhile save time and cost.
  • PCR primers for HLA-DQB1 genotyping
  • The present invention further provides a new method for amplifying Exon 2 and/or 3 of HLA-DQB1, characterized by carrying out PCR amplification with the amplification primer pairs of the present invention, said amplification primer pairs are as shown in Table 5.
  • Since Exons 2 and/or 3 of HLA-DQB1 can be amplified by a PCR reaction, the method of the present invention is particularly suitable for HLA-DQB1 genotyping. As compared with the prior HLA-DQB1 genotyping methods, since the products obtained by using the method and the amplification primers of the present invention are controlled within 300-400 bp, Illumina Solexa sequencing technique-based HLA-SBT may be used during further typing.
  • The present invention further provides a method for sequencing Exon 2 and/or 3 of HLA-DQB1 in samples, comprising the following steps of:
    1. 1) providing a sample and extracting DNA of the sample;
    2. 2) amplifying the DNA with the PCR primer pair for HLA-DQB1 genotyping of the present invention, preferably PCR primer pairs shown in Table 5, to obtain PCR products, preferably purifying the PCR products;
    3. 3) subjecting the PCR products to sequencing, preferably by the second generation sequencing method, such as Illumina Solexa or Roche454.
  • In another aspect of the present invention, the present invention provides an improved method for HLA-DQB1 genotyping, comprising:
    1. 1) amplifying Exon 2 and/or 3 of HLA-DQB1 to be tested with the PCR primer pair for HLA-DQB1 genotyping of the present invention, preferably the PCR primer pairs as shown in Table 5;
    2. 2) subjecting the amplified exons to sequencing, comparing the sequencing results with the standard sequences in the database so as to determine the genotyping results, wherein the sequencing method may be Sanger sequencing method or the second generation sequencing method, such as Illumina Solexa or Roche454.
  • In another aspect, the present invention further provides a kit for HLA-DQB1 genotyping, comprising the PCR primer pair for HLA- DQB1 genotyping of the present invention, preferably, the PCR amplification primer pairs as shown in Table 5. In one embodiment, said kit further comprises additional agents, for example, agents for DNA amplification, DNA purification, and/or DNA sequencing.
  • BRIEF DESCRIPTION OF THE DRAWINGS
    • Figure 1: A drawing illustrating the sequence assembling after labeling with primer indexes, DNA shearing and DNA sequencing. The forward and reverse primer index sequences Index-N-F/R (1) are introduced to the two termini of the PCR products of the sample No. N. The PCR products after shearing by a physical shearing method, comprises products carrying primer index sequences at one end, products carrying no primer index sequence at two termini, and completely unsheared products. All the DNA bands between the maximum read length of the sequencer and the applicable maximum DNA length of the sequencer are purified and recovered by gel slicing, and used for sequencing (2). The sequencing data of the PCR products belonging to the sample No. N are traced using Index-N-F/R. The known reference sequences of the PCR products are used to localize the relative positions of the sequence reads, and the sequencing results of the complete PCR products are assembled based on the overlapping and linkage relationship between the sequence reads (3, 4).
    • Figure 2: A drawing illustrating the results of electrophoresis of PCR products of the corresponding Exons of HLA-A/B/DRB1 in Sample No.1 of Example 2. It can be seen from electrophoretogram that PCR products are a series of single bands of 300bp-500bp, wherein Lane M is a marker of molecular weight (DL 2000, Takara Co.), Lanes 1-7 are the PCR products of the exons (A2, A3, A4, B2, B3, B4, DRB1-2) of HLA-A/B/DRB1 of Sample No.1, and there is no amplification band in negative control (N). The results of other samples are similar.
    • Figure 3: A drawing illustrating results of DNA electrophoresis after shearing HLA-Mix in Example 4 (before and after gel slicing), wherein the gel-slicing area is the area of 450-750bp. Lane M is a marker of molecular weight (NEB-50bp DNA Ladder), and Lane 1 shows the electrophoretic result of HLA-Mix before gel slicing, and Lane 2 is a drawing showing the gel of HLA-Mix after slicing.
    • Figure 4: A screen-capture of the program for construction of consensus sequence of Sample No.1 in Example 6, illustrating assembling the complete sequence of the PCR products based on primer indexes and the overlapping relationship between DNA fragments. Please refer to http://www.ebi.ac.uk/imgt/hla/align.html for nomenclature of HLA genotypes. One could find the results of all the coding sequence of A*02:03:01 A*11:01:01 in the result output column on the left, wherein the sequence of Exon 2 is identical to the original known result of Template 1.
    • Figure 5: A drawing illustrating the PCR product after labeling with primer indexes and an adapter index. During experimentation, primer indexes are introduced to the two termini of the PCR product of each sample by PCR simultaneously; multiple PCR products carrying different primer indexes are pooled together to construct a sequencing library. During construction of sequencing libraries, when multiple sequencing libraries have to be constructed, the sequencing libraries may be labeled with the library adapters carrying different adapter indexes. After finishing the construction of libraries, multiple sequencing libraries labeled with different adapter indexes are pooled together and are sequenced by Illumina GA simultaneously (the primer indexes may be identical among sequencing libraries labeled with different adapter indexes). After getting the sequencing results, DNA sequence information for each sample may be obtained by screening the sequence information of the adapter indexes and the primer indexes in the sequencing results.
    • Figure 6: A drawing illustrating the electrophoretic result of the PCR products of Exons 2, 3, 4 of HLA-C of some samples in Example 8. It can be seen from electrophoretogram that PCR products are a series of single bands of 400bp-500bp, wherein Lane M is reference for standard DNA molecular weights (DL 2000, Takara Co.).
    • Figure 7: A drawing illustrating results of DNA electrophoretic gel slicing after shearing HLA-Mix in Example 8, wherein the gel-slicing area is the area of 450-750bp. Lane M is a marker of molecular weight (NEB-50bp DNA Ladder), and Lane 1 is a drawing showing the gel of HLA-Mix before slicing, and Lane 2 is a drawing showing the gel of HLA-Mix after slicing.
    • Figure 8: A screen-capture of the program for construction of consensus sequence of Exon 2 of HLA-C site of Sample No. 2 in Example 8. Firstly, the sequence reads of C site of the sample are aligned with the reference sequence by BWA software, thereby constructing the consensus sequences of Exons 2, 3, 4 of C site of the sample; further, the haplotype sequence of each exon of C site is determined on the basis of the linkage relationship between SNPs; and finally the type of the sample is determined by the intersection of the haplotype sequences of the exons. As shown in the figure, two heterozygous SNP are comprised in 695-764 area of C gene sequence of sample No.2, and it can be determined from read1 and read2 that the linkage relationship of SNP is A-C, G-A ("..." in the figure represents the bases identical to those of the reference sequence). The sequences correspond to the shaded parts of the sequences of the C*010201 and C*07020101 types, respectively. The judgment of the linkage relationship of other areas is similar.
    • Figure 9: A drawing illustrating electrophoresis results of PCR products of Exons 2, 3 and 4 of HLA-C site of 26 samples in Example 9. As shown in the figure, all the PCR products are of a length less than 500 bp; the electrophoretic band is single; there is no obvious non-specific band; and the amplification efficiency of the same pair of primers is the same in various samples.
    • Figure 10: A drawing illustrating the analytic results of the sequencing data of PCR amplification products of Template 1 by using uType software in Example 9. The result output column on the left shows the result, C*08:01:01 C*15:05:01, which are identical to the original known type of Template 1.
    • Figure 11: A drawing illustrating the electrophoretic result of PCR products of Exon 2+3 of HLA-DQB1 in 94 samples of Example 10. It can be seen from electrophoretogram that PCR products are a series of single bands of 250bp-500bp, wherein Lane M is reference for standard DNA molecular weights (DL 2000, Takara Co.), Lanes PI-1 to PI-94 are the PCR amplification products of Exon 2+3 of HLA-DQB1 in 94 samples, and there is no amplification band in negative control (N).
    • Figure 12 shows the results of DNA electrophoretic gel slicing after shearing HLA-Q-Mix in Example 10, wherein the gel-slicing area is an area of 350-550bp. Lane M is a marker of standard DNA molecular weights (NEB-50bp DNA Ladder), and Lane 1 is a drawing showing the gel of HLA-Q-Mix before slicing, and Lane 2 is a drawing showing the gel of HLA-Q-Mix after slicing.
    • Figure 13 shows a screen-capture of the program for construction of consensus sequence of Sample No. 7 in Example 10, illustrating the main procedure of data analysis. Firstly, the sequence reads of the DQB1 site of the sample are aligned with the reference sequence by BWA software, thereby constructing the consensus sequences of Exons 2, 3 of DQB1 of the sample; and haplotype sequences of Exons 2, 3 of DQB1 are determined based on the linkage relationship between SNPs. As shown in the figure, six heterozygous SNPs are comprised in 2322-2412 area of DQB1 gene sequence of Sample No.7, and it can be determined from read1 that the linkage relationship of SNP1-SNP5 is T-G-T-C-C; it can be determined from read2 that the linkage relationship of another SNP1-SNP5 is C-C-A-G-T; it can be determined from read3 that the linkage relationship of SNP3-SNP6 is A-G-T-G; it can be determined from read4 that the linkage relationship of another SNP3-SNP6 is T-C-C-A; and it can be determined from the above linkage relationships of said SNPs that read1 is linked to read4, read2 is linked to read3, the complete SNP combination in this area is T-G-T-C-C-A and C-C-A-G-T-G, and the sequences correspond to the shaded parts of the sequences of DQB1*0303 and DQB1*0602 type. The judgment of the linkage relationship of other areas is similar.
    • Figure 14 shows the electrophoretogram of the products in Example 11, resulted from amplification of each of Exons 2 and 3 of HLA-DQB1 site and amplification of Exons 2 and 3 with two pairs of PCR primers, respectively. The electrophoretogram shows three sets of PCR products from seven DNA templates, wherein all the PCR products have a length less than 500 bp; electrophoretic bands are single; and there is no obvious non-specific band. There is no amplification band in negative control (N), and Lane M is reference for standard DNA molecular weights (DL 2000, Takara Co.).
    • Figure 15 illustrates the analytic results of the sequencing data of PCR products resulted from amplification of Exons 2 and 3 of HLA-DQB1 of Template 7, by using uType software in Example 11. The result output column on the left shows the result, DQB1*03:03 DQB1*06:02, which is identical to the original known result of Template 7.
    • Figure 16 shows the electrophoretic results of PCR products from the corresponding Exons of HLA-A/B/C/DQB1 in Sample No. 1 in Example 12. It can be seen from electrophoretogram that PCR products are a series of single bands of 300bp-500bp, wherein Lane M is a marker of molecular weights (DL 2000, Takara Co.); Lanes 1-10 are the PCR amplified products of the Exons (A2, A3, A4, B2, B3, B4, C2, C3, C4, DQB1) of HLA-A/B/C/DQB1 of Sample No. 1; no amplification band is present in negative control (N). The results of other samples are similar.
    • Figure 17 illustrates the result of recovery from agarose gel after pooling HLA-1-Mix, HLA-2-Mix, HLA-3-Mix, HLA-4-Mix, HLA-5-Mix, HLA-6-Mix, HLA-7-Mix, HLA-8-Mix, HLA-9-Mix and HLA-10-Mix in equal mole in Example 12. Lane M is a marker of molecular weights, and Lane 1 is the electrophoretic result of the pool, and Lane 2 is the electrophoretogram after gel slicing containing the DNA fragments of a length ranging from 450 to 750 bp.
    • Figure 18 shows a screen-capture of the program for construction of consensus sequence of Exon 2 of HLA-C site of Sample No. 1 in Example 12. Firstly, the sequence reads of C site of the sample are aligned with the reference sequence by BWA software, thereby constructing the consensus sequences of Exons 2, 3, 4 of C site of the sample; further, the haplotype sequences of the exons of C site are determined on the basis of the linkage relationship between SNPs; and finally the type of the sample is determined by the intersection of the haplotype sequences of the exons. As shown in the figure, two heterozygous SNPs are comprised in 695-764 area of C gene sequence of Sample No. 1, and it can be determined from read1 and read2 that the linkage relationship of SNPs is A-C, G-A ("..." in the figure represents the bases identical to those of the reference sequence). The sequences correspond to the shaded parts of the sequences of the C*010201 and C*07020101 type, respectively. The judgment of linkage relationship of other areas is similar.
    EXAMPLES
  • The embodiments of the present invention are described in detail in the following examples. However, a person skilled in the art would understand that the following examples are used to illustrate the present invention rather than restricting the scope of the present invention.
  • In Examples 1-6 of the present invention, Exons 2, 3, 4 of HLA-A/B and Exon 2 of HLA-DRB1 in 95 samples were genotyped by using the combination of primer indexes + DNA incomplete shearing strategy + Illumia GA sequencer Paired-End 100 sequencing technique (PCR products have a length ranging from 290bp to 500bp), demonstrating that the method of the invention could accomplish the typing of gene fragments of a length exceeding the maximum read length of sequencer whilst sufficiently utilizing the characteristics of the second generation sequencer, such as high throughput and low cost.
  • Principle: for the sample to be analyzed, primer indexes were introduced to the two termini of the PCR products of Exons 2, 3, 4 of HLA-A/B and Exon 2 of HLA-DRB1 by PCR reaction so as to specifically label the sample information of the PCR products. The products of PCR amplification of three sites (HLA-A/B/DRB1) in each group of samples were pooled together to obtain a library of PCR products; after incomplete ultrasonic shearing of the library of PCR products, a PCR-free sequencing library was constructed. The sequencing library was subjected to 2% low melting point agarose gel electrophoresis, and all the DNA bands of a length ranging from 450bp to 750bp were purified and recovered by gel slicing (during the construction of the PCR-Free sequencing library, since library adapters were added to the two termini of the DNA fragments, the length of the DNA band as shown in the electrophoretogram was about 250 bp longer than the actual length of the DNA fragments; therefore, the fragments of a length ranging from 450bp to 700bp as recovered here actually correspond to DNA fragments of an original length ranging from 200 bp to 500 bp). The recovered DNA was sequenced by Illumina GA PE-100. The sequence information of all the tested samples can be traced by primer index sequences, and the sequence of the whole PCR product can be assembled on the basis of the known reference sequences and the overlapping and linkage relationship between the sequences of DNA fragments, The complete sequence of the original PCR product can be assembled with the standard database of the corresponding exons of HLA-A/B/DRB1, thereby accomplishing HLA-A/B/DRB1 genotyping.
  • Example 1 Sample extraction
  • DNAs were extracted from 95 blood samples with known HLA-SBT typing results (China Marrow Donor Program cited hereafter as (CMDP)) by using KingFisher Automatic Extraction Instrument (US Thermo Co.). The main steps were as follows: as directed in the handbook, a certain amount of self-contained agents was added to six deep-well plates and one shallow-well plate equipped by the KingFisher Automatic Extraction Instrument, and all the plates, to which the agents were added, were placed in the corresponding positions as required. The program "Bioeasy_200ul Blood DNA_KF.msz" was selected, and was implemented to extract nucleic acids by pressing "star". Approximately 100 µl eluted products (i.e. the extracted DNA) were collected from plate Elution after the program was finished.
  • Example 2 PCR amplification
  • Different PCR index primers were made by synthesizing PCR primers having different primer indexes at 5' end, and such different PCR index primers may be applied to different samples, wherein the PCR primers were PCR primers for Exons 2, 3, 4 of HLA-A/B and Exon 2 of HLA-DRB1. Thereafter, primer indexes were introduced to the two termini of the PCR products by PCR reaction, thereby specifically labeling the PCR products from different samples.
  • 95 sets of PCR index primers were used to amplify 95 DNA samples, respectively, wherein each set of PCR index primers consisted of a pair of bidirectional primer indexes (Table 6) and PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B (Table 1) and of Exon 2 of HLA-DRB1 (Table 7), each forward PCR primer has the forward primer index in the pair of primer indexes linked at the 5' end, and the reverse PCR primer has the reverse primer index in the pair of primer indexes linked at the 5' end. During the synthesis of primers, the primer indexes were directly added to the 5' end of the PCR primers.
  • The 95 DNAs obtained from the sample extraction step of Example 1 were designated as No. 1-95. PCR reaction took place in 96-well plates, 7 plates in total, designated as HLA-P-A2, HLA-P-A3, HLA-P-A4, HLA-P-B2, HLA-P-B3, HLA-P-B4 and HLA-P-DRB1-2 (A2/A3/A4, B2/B3/B4, DRB1-2 represent the amplified sites), wherein a negative control without adding any template was set in each plate, and the primers used in the negative control were the same as those for Template 1. During experimentation, the numbering information of the samples corresponding to each pair of primer indexes was recorded. Table 6: Relevant information of primer indexes
    Primer index No. Forward primer index Reverse primer index Corresponding position in 96-well plate Corresponding template (Group 1)
    PI-1 TCGCAGACATCA TGACACGATGCT A1 1
    PI-2 TACATCGCACTA TACAGATGCTGA A2 2
    PI-3 CTCGATGAGTAC ACGTCTAGACAC A3 3
    PI-4 TCTGTATACTCA TGCTGTAGTGAC A4 4
    PI-5 TATCTGCTCATA AGATATCGAGCT A5 5
    PI-6 TACATGCTGAGC ACGTGTCTATCA A6 6
    PI-7 TCATATCGCGAT AGATCGTATAGC A7 7
    PI-8 ACAGATGCACGC ATCTCGTGACAG A8 8
    PI-9 TAGATCGTACAT ACTAGTACACGC A9 9
    PI-10 ACTACACGTCTC ATAGTCACGCGT A10 10
    PI-11 AGACTCGCGTAT TACTAGCTGACG A11 11
    PI-12 ATACTAGTGCTC TGTATCGTGCTC A12 12
    PI-13 CACGATGACATC TAGTGAGCGCAC B1 13
    PI-14 TGCTGTCTCGAG CATAGCAGTGTC B2 14
    PI-15 TGTGCTCGAGTC TCTGATCGAGCA B3 15
    PI-16 CACTCGTACATC AGCGATGCTCAT B4 16
    PI-17 CGACGTGCTCGC CGCGTACTGCAG B5 17
    PI-18 ACGCATCTATAC CTAGTATCGCAG B6 18
    PI-19 CGAGATGACTCT TGTATACACGAT B7 19
    PI-20 ACTGTCTCGAGC ACGTAGCGCACA B8 20
    PI-21 CATCTGCTATAG TCTAGCTCATGA B9 21
    PI-22 ACGCACTCTAGA CTATGCACTGAT B10 22
    PI-23 TGAGATACAGTA ATCTGCTATGAC B11 23
    PI-24 ACTCATCGTGCT TAGAGCTGTCAC B12 24
    PI-25 TACACTGTCTAT CAGCACATAGAT C1 25
    PI-26 CACAGTACTCGC CTGCTAGTGTAT C2 26
    PI-27 TGTACTATCATA TGTGATAGACAC C3 27
    PI-28 CTAGTACTGACG AGCGAGTCTACT C4 28
    PI-29 TAGACTGAGCTA ACATACTGAGAC C5 29
    PI-30 CAGACGCGTGAG TACATCTCGTAT C6 30
    PI-31 CGCGACATCACG TAGCGATGAGAC C7 31
    PI-32 ACACTCATAGAT CTATCATGACAC C8 32
    PI-33 AGCGTATACTAG CATACTCACGTA C9 33
    PI-34 TGTCGTGCTATC ACATGACTCACG C10 34
    PI-35 CGCTAGACTGTA TACTATAGTCGA C11 35
    PI-36 ACAGTGTAGCGC TGATATGCTACA C12 36
    PI-37 CACTCTATCGAC TCACGCGATGAG D1 37
    PI-38 ACACTCTAGTCA ACGTAGATCTAT D2 38
    PI-39 CATATGAGATCG AGCAGAGTGCTC D3 39
    PI-40 CAGCTATCATAC CACTGCAGACGA D4 40
    PI-41 TATACTCTAGAT TGCATAGAGCGC D5 41
    PI-42 TGTATGCTCGTC TCGTGACAGATC D6 42
    PI-43 TAGTGATGCTCT ACGAGCTGATAT D7 43
    PI-44 AGACTCTGAGTC CTGATAGTATCA D8 44
    PI-45 CTCATAGACTAC ATCGCGAGTGAC D9 45
    PI-46 TCGCTCACTACA TGTCTCGACATC D10 46
    PI-47 ATAGAGTCTCAT CGCATAGCGTAT D11 47
    PI-48 CGAGACACTCGC TCGTAGTCTACA D12 48
    PI-49 CAGCATACTATC TCGTGATACAGA E1 49
    PI-50 CAGCTATAGTCT ATGCAGATATCT E2 50
    PI-51 TCTATCGATGCA ACACGCAGATCG E3 51
    PI-52 CATGAGTATAGC CTAGCTGACGTA E4 52
    PI-53 TAGCATATCGAG TACACGTATGAG E5 53
    PI-54 ACGACTCGCTAC TCATGACTAGTA E6 54
    PI-55 TAGCATACACGC TGACGCGTATAC E7 55
    PI-56 CGTCATATGCAG TATAGCGATGAC E8 56
    PI-57 TGCAGCGAGTAC TCGACGCTAGCG E9 57
    PI-58 CGTGTCGACAGA CAGTCGTGAGCA E10 58
    PI-59 ACTCGACGTGAG ACGCGAGTGATA E11 59
    PI-60 ACTCGTCTGACG TGCTATCACTGA E12 60
    PI-61 CATACTGTATCT TACATAGATGTC F1 61
    PI-62 TCTACTCGTGAC CACGTATAGTGA F2 62
    PI-63 CTGCACTAGACA ACTCATATCGCA F3 63
    PI-64 ACACGAGCTCAT CACTCATATCGA F4 64
    PI-65 TACAGATAGTCT TCGTCTGTGATA F5 65
    PI-66 TACACTCGTGCT TGACGCTCATCT F6 66
    PI-67 TACATGTGACGA TCGTACATGCTC F7 67
    PI-68 TGTATGATCTCG CACTGTGCTCAT F8 68
    PI-69 CAGTACACTCTA ACTGCATGATCG F9 69
    PI-70 CATACTATCACG TCGTGTCACTAC F10 70
    PI-71 CACTATACAGAT CGACACGTACTA F11 71
    PI-72 ATATCGTAGCAT TCGTGATCACTA F12 72
    PI-73 TAGTCTATACAT AGACGCTGTCGA G1 73
    PI-74 TGTCACAGTGAC TCATATGATCGA G2 74
    PI-75 ATCGACTATGCT CGATCATATGAG G3 75
    PI-76 ATACTAGCATCA TCATGCTGACGA G4 76
    PI-77 CACTGACGCTCA CACTACATCGCT G5 77
    PI-78 TCGCTCATCTAT TAGTACAGAGCT G6 78
    PI-79 TGTATCACGAGC ATGATCGTATAC G7 79
    PI-80 TACTGCTATCTC CGCTGCATAGCG G8 80
    PI-81 CGCGAGCTCGTC ACTCGATGAGCT G9 81
    PI-82 TAGAGTCTGTAT TGTCTATCACAT G10 82
    PI-83 TACTATCGCTCT TATGTGACATAC G11 83
    PI-84 TAGATGACGCTC TACTCGTAGCGC G12 84
    PI-85 TCGCGTGACATC ATCTACTGACGT H1 85
    PI-86 ACACGCTCTACT ACAGTAGCGCAC H2 86
    PI-87 TACATAGTCTCG CTAGTATCATGA H3 87
    PI-88 TGAGTAGCACGC TCGATCATGCAG H4 88
    PI-89 TAGATGCTATAC TACATGCACTCA H5 89
    PI-90 ATCGATGTCACG CAGCTCGACTAC H6 90
    PI-91 ATCATATGTAGC CTCTACAGTCAC H7 91
    PI-92 TAGCATCGATAT AGATAGCACATC H8 92
    PI-93 TGATCGACGCTC CTAGATATCGTC H9 93
    PI-94 TGCAGCTCATAG TACAGACTGCAC H10 94
    PI-95 CGACGTAGAGTC CAGTAGCACTAC H11 95
    Table 7: PCR primers for amplification of the corresponding exons of DRB1 and without primer indexes
    primer No. primer sequence use of primer length of products
    D2-F1 CACGTTTCTTGGAGTACTCTA For amplification of Exon 2 of HLA-DRB1 gene 300bp
    D2-F2 GTTTCTTGTGGCAgCTTAAgTT
    D2-F3 CCTGTGGCAGGGTAAGTATA
    D2-F4
    Figure imgb0004
    D2-F5 GCACGTTTCTTGGAGGAGG
    D2-F6 TTTCCTGTGGCAGCCTAAGA
    D2-F7 GTTTCTTGGAGCAGGTTAAAC
    D2-R CCTCACCTCGCCGCTGCAC
  • D2-F1, D2-F2, D2-F3, D2-F4, D2-F5, D2-F6, D2-F7 were forward primers for amplification of Exon 2 of HLA-DRB1, D2-R was a reverse primer for amplification of Exon 2 of HLA-DRB1.
  • PCR procedure for HLA-A/B/DRB1 was as follows:
    • 96□ 2min
    • 95□ 30s →60□ 30s →72□ 20s (32cycles)
    • 15°C∞
  • PCR reaction system for HLA-A/B was as follows, wherein all the agents were purchased from Promega (Beijing) Bio-Tech Co.
    Promega 5×buffer I (Mg2+ plus) 5.0ul
    dNTP Mixture (2.5mM/ µl each) 2.0ul
    PInf-A/B-F2/3/4 (2pmol/ ul) 1.0ul
    PInr-A/B-R2/3/4 (2pmol/ ul) 1.0ul
    Promega Taq (5U/ul) 0.2ul
    DNA (about 20 ng/ul) 5.0ul
    ddH2O 10.8ul
    Total 25.0ul
  • The PCR reaction system for HLA-DRB1 was as follows:
    Promega 5×buffer I (Mg2+ plus) 5.0ul
    dNTP Mixture (2.5mM/ µl each) 2.0ul
    PInf-D2-F1 (2pmol/ul) 1.0ul
    PInf-D2-F2 (2pmol/ ul) 1.0ul
    PInf-D2-F3 (2pmol/ ul) 1.0ul
    PInf-D2-F4 (2pmol/ ul) 1.0ul
    PInf-D2-F5 (2pmol/ ul) 1.0ul
    PInf-D2-F6 (2pmol/ ul) 1.0ul
    PInf-D2-F7 (2pmol/ ul) 1.0ul
    PInr-D2-R (2pmol/ ul) 1.0ul
    Promega Taq (5U/ul) 0.2ul
    DNA (about 20 ng/ul) 5.0ul
    ddH2O 4.8ul
    Total 25.0ul
  • Wherein PInf-A/B/D2-F1/2/3/4/5/6/7 represents the F primer of HLA-A/B/DRB1 having the forward primer index sequence No. n (Table 6) at 5' end, PInr-A/B/D2-R2/3/4 represents the R primer of HLA-A/B/DRB1 having the reverse primer index sequence No. n at 5' end (here n≤95), and the rest may be deduced similarly. Moreover, each sample corresponds to a specific set of PCR primers (PInf-A/B/D2-F1/2/3/4/5/6/7, PInr-A/B/D2-R2/3/4).
  • PCR reaction was carried out in PTC-200 PCR apparatus from Bio-Rad Co.. After PCR reaction, 2ul PCR products were subjected to 1% agarose gel electrophoresis. Figure 2 showed the electrophoretic result of the PCR products of the corresponding exons of HLA-A/B/DRB1 of Sample No. 1, and the marker for DNA molecular weights was DL 2000 (Takara Co.). There were a series of single bands of a length ranging from 300 bp to 500 bp in the electrophorogram, indicating successful PCR amplification of the exons (A2, A3, A4, B2, B3, B4, DRB1-2) of HLA-A/B/DRB1 of Sample No.1. There was no amplification band in the negative control (N). The results of other samples were similar.
  • Example 3
  • Pooling and purification of PCR products 20 µl of the rest PCR products was taken from each well of the 96-well plate HLA-P-A2 (except for the negative control), and was mixed homogeneously under shaking in a 3 ml EP tube (designated as HLA-A2-Mix). The same operation was applied to the other 6 96-well plates, designated as HLA-A3-Mix, HLA-A4-Mix, HLA-B2-Mix, HLA-B3-Mix, HLA-B4-Mix and HLA-D2-Mix. 200ul was taken from each of HLA-A2-Mix, HLA-A3-Mix, HLA-A4-Mix, HLA-B2-Mix, HLA-B3-Mix, HLA-B4-Mix and HLA-D2-Mix, and was mixed in a 3 ml EP tube, designated as HLA-Mix. 500ul DNA mixture from HLA-Mix was subjected to column purification with Qiagen DNA Purification kit (QIAGEN Co.) (For the specific purification steps, please refer to the manufacturer's instruction). It was determined by Nanodrop 8000 (Thermo Fisher Scientific Co.) that the 200ul DNA obtained by purification has a HLA-Mix DNA concentration of 48 ng/ul.
  • Example 4
  • Shearing of PCR products, and construction of Illumina GA PCR-Free sequencing libraries
  • 1. DNA shearing
  • A total amount of 5ug DNA, taken from the purified HLA-Mix, was contained in a Covaris microtube with an AFA fiber and Snap-Cap and was subjected to the shearing in Covaris S2DNA Shearer (Covaris Co.). The shearing conditions were as follows:
  • Frequency sweeping
  • Duty Cycle 10%
    Intensity
    5
    Cycles/Burst 200
    Time (second) 300
  • 2. Purification after shearing
  • All the sheared products of HLA-Mix were recovered and purified by QIAquick PCR Purification Kit, and were dissolved in 37.5ul EB (QIAGEN Elution Buffer), respectively.
  • 3. Terminal repairing reaction
  • The purified HLA-Mix after the shearing was subject to DNA terminal repairing reaction, and the reaction system was as follows (all the agents were purchased from Enzymatics Co.):
    DNA 37.5µL
    H2O 37.5µL
    10x Polynucleotide Kinase Buffer (B904) 10 µL
    dNTP mixture (Solution Set (10mM each)) 4 µL
    T4 DNA Polymerase 5µL
    Klenow Fragment 1µL
    T4 Polynucleotide Kinase 5µL
    Total volume
    100 µL
  • Reaction conditions: incubating at 20°C for 30 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • The reaction products were recovered and purified by the QIAquick PCR Purification Kit, and were dissolved in 34 µl EB (QIAGEN Elution Buffer).
  • 4. Addition of A at 3' end
  • A was added to 3' end of the DNA recovered in the last step, and the reaction system was as follows (all the agents were purchased from Enzymatics Co.):
    DNA obtained in the last step 32 µL
    10x blue buffer 5 µL
    dATP (1mM, GE Co.) 10 µL
    Klenow (3'-5' exo-) 3 µL
    Total volume
    50 µL
  • Reaction conditions: incubating at 37□ for 30 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • The reaction products were recovered and purified by MiniElute PCR Purification Kit (QIAGEN Co.), and were dissolved in 13 µl EB (QIAGEN Elution Buffer).
  • 5. Ligation of Illumina GA PCR-Free library adapter
  • The term "PCR-Free library adapter" refers to a segment of designed bases, whose main role lies in auxiliary fixation of DNA molecule onto the sequencing chip and lies in providing the binding sites for universal sequencing primers, wherein PCR-Free library adapter may be directly ligated to the two termini of the DNA fragments in the sequencing library; since no PCR was involved in the introduction of the library adapter, the library adapter was called PCR-Free library adapter.
  • The products having A added were ligated to the Illumina GA PCR-Free library adapters, and the reaction system was as follows (all the agents were purchased from Illumina Co.):
    DNA obtained in the last step 11µL
    2x Rapid ligation buffer 15µL
    PCR-free adapter oligo mix (30mM) 1µL
    T4 DNA Ligase (Rapid, L603-HC-L) 3µL
    Total volume
    30 µL
  • Reaction conditions: incubating at 20□ for 15 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • The reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50ul deionized water, and the DNA concentration determined by Fluorescence quantitative PCR (QPCR) was as follows:
    result determined by qPCR (nM)
    HLA-Mix 78.90
  • 6. Recovery by gel slicing
  • 30µL HLA-Mix was subjected to 2% low melting point agarose gel electrophoresis. The electrophoretic condition was 100V, 100min. DNA marker was the 50bp DNA marker from NEB Co.. The gel containing the DNA fragments ranging from 450 to 750bp was sliced (Figure 3). The products in the sliced gel were recovered and purified by QIAquick PCR Purification Kit (QIAGEN Co.), the volume after purification was 32ul, and the DNA concentration measured by Fluorescence quantitative PCR (QPCR) was 10.16nM.
  • Example 5 Illumina GA sequencing
  • According to the results of QPCR, 10pmol DNA was taken and subjected to the sequencing by Illumina GA PE-100 program. For the specific operation procedure, please refer to the Illumina GA operation instruction (Illumina GA IIx).
  • Example 6 Analysis of the results
  • The sequencing results from Illumina GA were a series of DNA sequences, and by searching the forward and reverse primer index sequences and primer sequences in the sequencing results, databases comprising the sequencing results of the PCR products of various exons of HLA-A/B/DRB1 for each sample corresponding to respective primer index were constructed. The sequencing results of each exon were aligned to the reference sequence (reference sequences were from http://www.ebi.ac.uk/imgt/hla/) of the corresponding exon by BWA (Burrows-Wheeler Aligner), and meanwhile, the consensus sequences of each database were constructed, and the DNA sequences in the database were selected and corrected. The corrected DNA sequences were assembled into the corresponding sequences of exons of HLA-A/B/DRB1 on the basis of sequence overlapping and linkage (Paired-End linkage) relationship. The resultant DNA sequence was aligned with the sequence database of the corresponding exon of HLA-A/B/DRB1 in IMGT HLA professional database. If the result of sequence alignment shows 100% match, the HLA-A/B/DRB1 genotype of the corresponding sample was determined. Please refer to the screen-capture of the program for construction of consensus sequence of Exon 2 of HLA-A site in Sample No.1 as illustrated in Figure 4.
  • For all 95 samples, the typing results obtained by the above method were completely consistent with the known typing results, wherein the results of Samples No. 1-32 were as follows:
    Sample No. Original known HLA-A/B/DRB1 type
    1 A*02:03 A*11:01 B*38:02 B*48:01 DRB1*14:54 DRB1*15:01
    2 A*01:01 A*30:01 B*08:01 B*13:02 DRB1*03:01 DRB1*07:01
    3 A*01:01 A*02:01 B*15:11 B*47:01 DRB1*13:02 DRB1*15:01
    4 A*24:08 A*26:01 B*40:01 B*51:01 DRB1*04:04 DRB1*09:01
    5 A*01:01 A*24:02 B*54:01 B*55:02 DRB1*04:05 DRB1*09:01
    6 A*01:01 A*03:02 B*15:11 B*37:01 DRB1*10:01 DRB1*14:54
    7 A*11:01 A*30:01 B*13:02 B*15:18 DRB1*04:04 DRB1*07:01
    8 A*01:01 A*02:01 B*35:03 B*81:01 DRB1*11:01 DRB1*15:01
    9 A*02:06 A*31:01 B*27:07 B*40:02 DRB1*03:01 DRB1*13:02
    10 A*01:01 A*66:01 B*37:01 B*49:01 DRB1*10:01 DRB1*13:02
    11 A*01:01 A*03:01 B*35:01 B*52:01 DRB1*01:01 DRB1*15:02
    12 A*11:01 A*11:01 B*15:01 B*15:05 DRB1*04:06 DRB1*15:01
    13 A*01:01 A*11:02 B*07:02 B*15:02 DRB1*09:01 DRB1*15:01
    14 A*01:01 A*02:01 B*52:01 B*67:01 DRB1*15:02 DRB1*16:02
    15 A*01:01 A*02:05 B*15:17 B*50:01 DRB1*07:01 DRB1*15:01
    16 A*01:01 A*11:01 B*37:01 B*40:02 DRB1*10:01 DRB1*12:02
    17 A*24:07 A*32:01 B*35:05 B*40:01 DRB1*03:01 DRB1*04:05
    18 A*11:01 A*24:02 B*13:01 B*35:01 DRB1*16:02 DRB1*16:02
    19 A*11:01 A*11:01 B*40:02 B*55:12 DRB1*04:05 DRB1*15:01
    20 A*02:11 A*24:02 B*40:01 B*40:06 DRB1*11:01 DRB1*15:01
    21 A*01:01 A*02:06 B*51:01 B*57:01 DRB1*07:01 DRB1*12:01
    22 A*01:01 A*29:01 B*07:05 B*15:01 DRB1*04:05 DRB1*07:01
    23 A*01:01 A*02:07 B*37:01 B*46:01 DRB1*04:03 DRB1*10:01
    24 A*24:85 A*30:01 B*13:02 B*55:02 DRB1*07:01 DRB1*15:01
    25 A*11:01 A*31:01 B*07:06 B*51:01 DRB1*12:02 DRB1*14:05
    26 A*01:01 A*11:01 B*46:01 B*57:01 DRB1*07:01 DRB1*08:03
    27 A*01:01 A*02:01 B*15:18 B*37:01 DRB1*04:01 DRB1*15:01
    28 A*01:01 A*24:02 B*37:01 B*46:01 DRB1*09:01 DRB1*10:01
    29 A*26:01 A*66:01 B*40:40 B*41:02 DRB1*12:01 DRB1*15:01
    30 A*02:01 A*29:02 B*13:02 B*45:01 DRB1*03:01 DRB1*12:02
    31 A*01:01 A*11:03 B*15:01 B*57:01 DRB1*07:01 DRB1*15:01
    32 A*11:01 A*26:01 B*35:03 B*38:01 DRB1*11:03 DRB1*14:04
    Sample No. The determined HLA-A/B/DRB1 type
    1 A*02:03 A*11:01 B*38:02 B*48:01 DRB1*14:54 DRB1*15:01
    2 A*01:01 A*30:01 B*08:01 B*13:02 DRB1*03:01 DRB1*07:01
    3 A*01:01 A*02:01 B*15:11 B*47:01 DRB1*13:02 DRB1*15:01
    4 A*24:08 A*26:01 B*40:01 B*51:01 DRB1*04:04 DRB1*09:01
    5 A*01:01 A*24:02 B*54:01 B*55:02 DRB1*04:05 DRB1*09:01
    6 A*01:01 A*03:02 B*15:11 B*37:01 DRB1*10:01 DRB1*14:54
    7 A*11:01 A*30:01 B*13:02 B*15:18 DRB1*04:04 DRB1*07:01
    8 A*01:01 A*02:01 B*35:03 B*81:01 DRB1*11:01 DRB1*15:01
    9 A*02:06 A*31:01 B*27:07 B*40:02 DRB1*03:01 DRB1*13:02
    10 A*01:01 A*66:01 B*37:01 B*49:01 DRB1*10:01 DRB1*13:02
    11 A*01:01 A*03:01 B*35:01 B*52:01 DRB1*01:01 DRB1*15:02
    12 A*11:01 A*11:01 B*15:01 B*15:05 DRB1*04:06 DRB1*15:01
    13 A*01:01 A*11:02 B*07:02 B*15:02 DRB1*09:01 DRB1*15:01
    14 A*01:01 A*02:01 B*52:01 B*67:01 DRB1*15:02 DRB1*16:02
    15 A*01:01 A*02:05 B*15:17 B*50:01 DRB1*07:01 DRB1*15:01
    16 A*01:01 A*11:01 B*37:01 B*40:02 DRB1*10:01 DRB1*12:02
    17 A*24:07 A*32:01 B*35:05 B*40:01 DRB1*03:01 DRB1*04:05
    18 A*11:01 A*24:02 B*13:01 B*35:01 DRB1*16:02 DRB1*16:02
    19 A*11:01 A*11:01 B*40:02 B*55:12 DRB1*04:05 DRB1*15:01
    20 A*02:11 A*24:02 B*40:01 B*40:06 DRB1*11:01 DRB1*15:01
    21 A*01:01 A*02:06 B*51:01 B*57:01 DRB1*07:01 DRB1*12:01
    22 A*01:01 A*29:01 B*07:05 B*15:01 DRB1*04:05 DRB1*07:01
    23 A*01:01 A*02:07 B*37:01 B*46:01 DRB1*04:03 DRB1*10:01
    24 A*24:85 A*30:01 B*13:02 B*55:02 DRB1*07:01 DRB1*15:01
    25 A*11:01 A*31:01 B*07:06 B*51:01 Drub1*12:02 DRB1*14:05
    26 A*01:01 A*11:01 B*46:01 B*57:01 DRB1*07:01 DRB1*08:03
    27 A*01:01 A*02:01 B*15:18 B*37:01 DRB1*04:01 Drub1*15:01
    28 A*01:01 A*24:02 B*37:01 B*46:01 DRB1*09:01 DRB1*10:01
    29 A*26:01 A*66:01 B*40:40 B*41:02 DRB1*12:01 DRB1*15:01
    30 A*02:01 A*29:02 B*13:02 B*45:01 DRB1*03:01 DRB1*12:02
    31 A*01:01 A*11:03 B*15:01 B*57:01 DRB1*07:01 DRB1*15:01
    32 A*11:01 A*26:01 B*35:03 B*38:01 DRB1*11:03 DRB1*14:04
    Note: among HLA-DRB1 types, DRB1*1201 does not exclude the possibility of DRB1*1206/1210/1217, and DRB1*1454 does not exclude the possibility of DRB1*1401, because said alleles were completely identical in the sequence of Exon 2 of HLA-DRB1.
  • Example 7
  • HLA-A,B and DRB1 genotyping by using the second generation sequencing technique (Illumina GA)
  • Sample extraction
  • DNAs were extracted from 950 blood samples with known HLA-SBT typing results (China Marrow Donor Program cited hereafter as (CMDP)) by using KingFisher Automatic Extraction Instrument (US Thermo Co.). The method was as described in Example 1.
  • PCR amplification
  • The 950 DNAs obtained from the sample extraction step were designated as No. 1-950, and were divided into 10 groups (95 DNAs for each), which were designated as HLA-1, HLA-2, HLA-3, HLA-4, HLA-5, HLA-6, HLA-7, HLA-8, HLA-9, HLA-10. For each group of samples, 95 DNA samples were amplified by 95 sets of PCR primers (Table 1) carrying bidirectional primer indexes (Table 6) for amplification of Exons 2, 3, 4 of HLA-A/B and PCR primers (Table 7) carrying bidirectional primer indexes (Table 6) for amplification of Exon 2 of HLA-DRB1. PCR reaction took place in 96-well plates, using 70 plates in total, designated as HLA-X-P-A2, HLA-X-P-A3, HLA-X-P-A4, HLA-X-P-B2, HLA-X-P-B3, HLA-X-P-B4 and HLA-X-P-DRB1-2 ("X" represents the information of the group number 1/2/3/4/5/6/7/8/9/10, "A2/3/4", "B2/3/4", "DRB1-2" represent the amplification sites), wherein a negative control without adding any template was set in each plate, and the primers used for the negative control were primers labeled by PI-1 (Table 6). During experimentation, the information of each sample on the group number and primer indexes was recorded. The method was as described in Example 2.
  • Pooling and purification of PCR products
  • For samples of Group X ("X" is 1/2/3/4/5/6/7/8/9/10), 20 µl of rest PCR products was taken from each well of the 96-well plate HLA-X-P-A2 (except for the negative control), and was mixed homogeneously under shaking in a 3 ml EP tube (designated as HLA-X-A2-Mix). The same operation was applied to the other 6 96-well plates of the samples of Group X, designated as HLA-X-A3-Mix, HLA-X-A4-Mix, HLA-X-B2-Mix, HLA-X-B3-Mix, HLA-X-B4-Mix and HLA-X-D2-Mix. 200ul was taken from each of HLA-X-A2-Mix, HLA-X-A3-Mix, HLA-X-A4-Mix, HLA-X-B2-Mix, HLA-X-B3-Mix, HLA-X-B4-Mix and HLA-X-D2-Mix, and was mixed in a 3ml EP tube, designated as HLA-X-Mix. 500ul DNA mixture from HLA-X-Mix was subjected to column purification with Qiagen DNA Purification kit (QIAGEN Co.) (For the specific purification steps, please refer to the manufacturer's instruction) to obtain 200ul DNA, and its DNA concentration was determined by Nanodrop 8000 (Thermo Fisher Scientific Co.). The same operation was also applied to other groups. The finally determined DNA concentrations were as follows.
    HLA-1-Mix HLA-2-Mix HLA-3-Mix HLA-4-Mix HLA-5-Mix HLA-6-Mix HLA-7-Mix HLA-8-Mix HLA-9-Mix HLA-10 -Mix
    concentration (ng/ul) 48.0 52.1 49.3 50.2 47.6 48.5 49.1 48.6 51.3 50.8
  • The method was as described in Example 3.
  • The construction of Illumina GA Sequencing libraries was performed by the method of Example 4. The corresponding relationships between the sample groups and the library adapters were as follows.
    Sample group No. HLA-1 HLA-2 HLA-3 HLA-4 HLA-5 HLA-6 HLA-7 HLA-8 HLA-9 HLA-10
    Library adapterNo. 1 2 3 4 5 6 7 8 9 10
  • The reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50ul deionized water, and the DNA molar concentrations determined by Fluorescence quantitative PCR (QPCR) were as follows:
    HLA-1-Mix HLA-2-Mix HLA-3-Mix HLA-4-Mix HLA-5-Mix HLA-6-Mix HLA-7-Mix HLA-8-Mix HLA-9-Mix HLA-10 -Mix
    Conc. (nM) 78.90 72.13 79.33 80.21 77.68 78.50 89.12 78.60 81.32 80.82
  • Recovery by gel slicing
  • HLA-1-Mix, HLA-2-Mix, HLA-3-Mix, HLA-4-Mix, HLA-5-Mix, HLA-6-Mix, HLA-7-Mix, HLA-8-Mix, HLA-9-Mix and HLA-10-Mix were mixed at an equal mole (final concentration was 72.13 nM/ul), designated as HLA-Mix-10. 30µL HLA-Mix-10 was subjected to 2% low melting point agarose gel electrophoresis. The electrophoretic condition was 100V, 100min. DNA marker was the 50bp DNA marker from NEB Co.. The gel containing the DNA fragments ranging from 450 to 750bp was sliced. The products in the sliced gel were recovered and purified by QIAquick PCR Purification Kit (QIAGEN Co.), the volume after purification was 32ul, and the DNA concentration measured by Fluorescence quantitative PCR (QPCR) was 9.96nM.
  • The sequencing and result analysis were performed as described in Examples 5 and 6. For all 950 samples, the typing results obtained by the above method were completely consistent with the known typing results.
  • Example 8
  • HLA-C genotyping by using the second generation sequencing technique (Illumina GA)
  • 1. DNA sample extraction
  • The steps were as described in Example 1.
  • 2. PCR amplification
  • The steps were as described in Example 2, except that the PCR primers used were PCR primers for Exons 2, 3 and 4 of HLA-C, as shown in Table 3.
  • 95 sets of PCR index primers were used to amplify 95 DNA samples, respectively, wherein each set of PCR index primers consisted of PCR primers for amplification of Exons 2, 3, 4 of HLA-C (Table 3) and a pair of bidirectional primer indexes (as described below), each forward PCR primer has the forward primer index of a pair of primer indexes linked at the 5' end, and the reverse PCR primer has the reverse primer index of a pair of primer indexes linked at the 5' end. During the synthesis of primers, the primer indexes were directly added to the 5' end of the PCR primers.
  • The 95 DNAs obtained from the sample extraction step were designated as No. 1-95. PCR reaction took place in 96-well plates, 3 plates in total, designated as HLA-P-C2, HLA-P-C3, HLA-P-A4 (C2/3/4 represent the amplification sites), wherein a negative control without adding any template was set in each plate, and the primers used in the negative control were the same as the primer PI-96. During experimentation, the numbering information of the sample corresponding to each pair of primer indexes was recorded.
  • The primer indexes used were the primer indexes PI-1 to PI-95 as listed in Table 6, and the following negative control primer index PI-96 (Table 8) Table 8: Relevant information of the primer index used for the negative control
    PI-96 CACTGTATAGCT CGACTAGTACTA H12 Negative control
  • The DNAs, extracted by using KingFisher Automatic Extraction Instrument in step 1, were used as the templates, and PCR amplification was carried out in single tubes by using primers for exons of HLA-C, wherein the primers have indexes at 5' end. PCR procedure was as follows:
    • C2: 96°C 2 min
    • 95°C 30s →62°( 30s →72°C 20s (35 cycles)
    • 15°C ∞
    • C3: 96°C 2 min
    • 95°C 30s →56°C 30s →72°C 20s (35 cycles)
    • 15°C ∞
    • C4: 96°C 2 min
    • 95°C 30s →60°C 30s →72°C 20s (35 cycles)
    • 15°C ∞
  • PCR reaction system of HLA-C was as follows:
    Promega 5×buffer I (Mg2+ plus) 5.0 µL
    dNTP mixture (2.5 mM each) 2.0 µL
    PInr-C-F2/3/4 (50 ng/ul) 1.5 µL
    PInf-C-R2/3/4 (50 ng/ul) 1.5 µL
    Promega Taq (5 U/ul) 0.2 µL
    DNA (about 20 ng/ul) 2.0 µL
    ddH2O 12.8 µL
    Total 25.0 µL
  • Wherein, PInf-C-F2/3/4 represents the F primer of HLA-C having the forward primer index sequence No. n (Table 2) at 5' end, PInr-C-R2/3/4 represents the R primer of HLA-C having the reverse primer index sequence No. n at 5' end (here n≤96), and the rest may be deduced similarly. Moreover, each sample corresponds to a specific set of PCR primers.
  • PCR reaction was carried out in PTC-200 PCR apparatus from Bio-Rad Co.. After PCR reaction, 2ul PCR products were subjected to 1.5% agarose gel electrophoresis. Figure 6 showed the electrophoretic result of the PCR products of the corresponding exons of HLA-C of the first 20 samples, and the DNA molecular marker was DL 2000 (Takara Co.). There were a series of single bands of a length ranging from 400 bp to 500 bp in the electrophorogram, indicating successful PCR amplification of exons (C2, C3, C4) of HLA-C of the samples. The results of other samples were similar.
  • Pooling and purification of PCR products
  • 20 µl of the rest PCR products was taken from each well of the 96-well plate HLA-P-C2 (except for the negative control), and was pooled homogeneously under shaking in a 3 ml EP tube (designated as HLA-C2-Mix). The same operation was applied to the other 2 96-well plates, designated as HLA-C3-Mix and HLA-C4-Mix. 200ul was taken from each of HLA-C2-Mix, HLA-C3-Mix and HLA-C4-Mix, and was mixed in a 1.5 ml EP tube, designated as HLA-Mix. 500ul DNA mixture from HLA-Mix was subjected to column purification with Qiagen DNA Purification kit (QIAGEN Co.) (For the specific purification steps, please refer to the manufacturer's instruction). It was determined by Nanodrop 8000 (Thermo Fisher Scientific Co.) that the 200ul DNA obtained by purification has a HLA-Mix DNA concentration of 50ng/ul.
  • 4. Construction of Illumina GA PCR-Free sequencing libraries 4.1 Shearing of PCR products
  • A total amount of 5ug DNA, taken from the purified HLA-Mix, was contained in a Covaris microtube with AFA fiber and Snap-Cap and was subjected to the shearing in Covaris S2 (Covaris Co.). The shearing conditions were as follows:
  • Frequency sweeping
  • Duty Cycle 10%
    Intensity
    3
    Cycles/Burst 200
    Time (s) 180
  • 4.2 Purification of the sheared PCR products
  • All the sheared products of HLA-Mix were recovered and purified by QIAquick PCR Purification Kit, and were dissolved in 37.5ul EB (QIAGEN Elution Buffer), respectively.
  • 4.3 Terminal repairing reaction
  • The purified products were subject to DNA terminal repairing reaction, the reaction system was as follows (all the agents were purchased from Enzymatics Co.):
    Products purified in the last step 37.5 µL
    10x Polynucleotide Kinase Buffer (B904) 5 µL
    dNTP mixture (Solution Set (10mM each)) 2 µL
    T4 DNA Polymerase 2.5 µL
    Klenow Fragment 0.5 µL
    T4 Polynucleotide Kinase 2.5 µL
    Total volume µL
  • Reaction conditions: incubating at 20°C for 30 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • The reaction products were recovered and purified by the QIAquick PCR Purification Kit, and were dissolved in 32 µl EB (QIAGEN Elution Buffer).
  • 4.4 Addition of A at 3' end
  • A was added to 3' end of the DNA recovered in the last step, and the reaction system was as follows (all the agents were purchased from Enzymatics Co.):
    DNA obtained in the last step 32 µL
    10x blue buffer 5 µL
    dATP (1mM, GE Co.) 10 µL
    Klenow (3'-5' exo-) 3 µL
    Total volume
    50 µL
  • Reaction conditions: incubating at 37°C for 30 min in a Thermomixer (Thermomixer, Eppendorf Co.).
  • The reaction products were recovered and purified by MiniElute PCR Purification Kit (QIAGEN Co.), and were dissolved in 38 µl EB (QIAGEN Elution Buffer).
  • 4.5 Ligation of Illumina GA PCR-Free library adapter
  • The products having A added were ligated to the Illumina GA PCR-Free library adapters, and the reaction system was as follows (all the agents were purchased from Illumina Co.):
    DNA obtained in the last step 38 µL
    10x Ligation buffer 5 µL
    PCR-free adapter oligo mix (30mM) 2 µL
    T4 DNA Ligase (Rapid, L603-HC-L) 5 µL
    Total volume
    50 µL
  • Reaction conditions: incubating at 16°C overnight in a Thermomixer (Thermomixer, Eppendorf Co.).
  • The reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50ul deionized water, and the DNA concentration determined by Fluorescence quantitative PCR (QPCR) was as follows:
    result determined by qPCR (nM)
    HLA-Mix 122.71
  • 4.6 Recovery by gel slicing
  • 30µL HLA-Mix was subjected to 2% low melting point agarose gel electrophoresis. The electrophoretic condition was 100V, 100min. DNA marker was the 50bp DNA Ladder from NEB Co.. The gel containing the DNA fragments ranging from 400 to 750bp was sliced (Figure 7). The products in the sliced gel were recovered and purified by QIAquick PCR Purification Kit (QIAGEN Co.), the volume after purification was 32ul, and the DNA concentration measured by Fluorescence quantitative PCR (QPCR) was 17.16nM.
  • 5. Illumina GA sequencing
  • According to the detection results of QPCR, 10pmol DNA was taken and subjected to the sequencing by Illumina GA PE-100 program. For the specific operation procedure, please refer to the Illumina GA operation instruction (Illumina GA IIx).
  • 6. Analysis of the results
  • The sequencing results from Illumina GA were a series of DNA sequences, and by searching the forward and reverse primer index sequences and primer sequences in the sequencing results, databases comprising the sequencing results of the PCR products of various exons of HLA-C for each sample corresponding to respective primer index were constructed were constructed. The sequencing results of each exon was aligned to the reference sequence (reference sequences were from http://www.ebi.ac.uk/imgt/hla/) of the corresponding exon by BWA (Burrows-Wheeler Aligner), and consensus sequences of each database were constructed; and the sequence reads were selected and corrected based on the quality value of base sequencing, and difference between the sequence reads and consensus sequences. The corrected DNA sequences were assembled into the corresponding sequences of exons of HLA-C on the basis of sequence overlapping and linkage (Paired-End linkage) relationship. The screen-capture of Figure 8 illustrates the procedure for construction of consensus sequence of Exon 2 of HLA-C site in Sample No.2.
  • The resultant DNA sequence was aligned with the sequence database of the corresponding exon of HLA-C in IMGT HLA professional database. If the result of sequence alignment showed 100% match, the HLA-C genotype of the corresponding sample was determined. For all 95 samples, the typing results obtained by the above method were completely consistent with the known typing results, wherein the typing results of Samples No. 1-32 were as follows: (as shown in Table 9, all the obtained results were identical to the original known results). Table 9: Comparison of the typing results obtained by the above method with the original known typing results of the samples
    Sample No. Original known HLA-C genotype Results for HLA-C obtained at this time Identical or not
    1 C*08:01 C*15:05 C*08:01 C*15:05 yes
    2 C*01:02 C*07:02 C*01:02 C*07:02 yes
    3 C*08:01 C*16:02 C*08:01 C*16:02 yes
    4 C*01:02 C*03:02 C*01:02 C*03:02 yes
    5 C*01:02 C*02:02 C*01:02 C*02:02 yes
    6 C*01:02 C*15:02 C*01:02 C*15:02 yes
    7 C*01:02 C*03:04 C*01:02 C*03:04 yes
    8 C*03:02 C*07:02 C*03:02 C*07:02 yes
    9 C*06:02 C*16:02 C*06:02 C*16:02 yes
    10 C*01:02 C*03:04 C*01:02 C*03:04 yes
    11 C*03:04 C*07:02 C*03:04 C*07:02 yes
    12 C*07:02 C*08:01 C*07:02 C*08:01 yes
    13 C*01:02 C*15:02 C*01:02 C*15:02 yes
    14 C*01:02 C*03:04 C*01:02 C*03:04 yes
    15 C*01:02 C*03:04 C*01:02 C*03:04 yes
    16 C*07:02 C*12:02 C*07:02 C*12:02 yes
    17 C*04:01 C*08:01 C*04:01 C*08:01 yes
    18 C*08:01 C*16:02 C*08:01 C*16:02 yes
    19 C*14:02 C*15:02 C*14:02 C*15:02 yes
    20 C*01:02 C*03:03 C*01:02 C*03:03 yes
    21 C*03:03 C*08:01 C*03:03 C*08:01 yes
    22 C*03:04 C*07:02 C*03:04 C*07:02 yes
    23 C*07:02 C*08:01 C*07:02 C*08:01 yes
    24 C*07:02 C*12:02 C*07:02 C*12:02 yes
    25 C*07:02 C*12:03 C*07:02 C*12:03 yes
    26 C*03:04 C*08:01 C*03:04 C*08:01 yes
    27 C*01:02 C*03:04 C*01:02 C*03:04 yes
    28 C*07:02 C*12:02 C*07:02 C*12:02 yes
    29 C*03:02 C*07:02 C*03:02 C*07:02 yes
    30 C*01:02 C*03:03 C*01:02 C*03:03 yes
    31 C*01:02 C*07:02 C*01:02 C*07:02 yes
    32 C*01:02 C*07:02 C*01:02 C*07:02 yes
    Note: among HLA-C types, C*0303 does not exclude the possibility of C*0320N, C*0401 does not exclude the possibility of C*0409N/0430, C*0702 does not exclude the possibility of C*0750, C*0801 does not exclude the possibility of C*0822, C*1505 does not exclude the possibility of C*1529, because said alleles were completely identical in the sequences of Exons 2, 3, 4 of HLA-C.
  • Example 9 HLA-C genotyping by using Sanger sequencing method 1. Sample DNA extraction
  • As described in Example 1, DNAs were extracted by using KingFisher Automatic Extraction Instrument from 26 out of 95 samples with known HLA genotypes.
  • 2. PCR amplification
  • The above DNAs, extracted by using KingFisher Automatic Extraction Instrument, were used as templates, and PCR amplification was carried out in single tubes by using three pairs of PCR primers C-F2/C-R2, C-F3/C-R3, C-F4/C-R4 (Table 3), respectively. The PCR procedure for each pair of primers was as follows:
    • C2: 96°C 2 min
    • 95°C 30s →62°( 30s →72°C 20s (35 cycles)
    • 15°C ∞
    • C3: 96°C 2min
    • 95°C 30s →56°C 30s →72°C 20s (35 cycles)
    • 15°C ∞
    • C4: 96°C 2min
    • 95°C 30s →60°C 30s →72°C 20s (35 cycles)
    • 15°C ∞
  • PCR reaction system of HLA-C was as follows:
    Promega 5×buffer I (Mg2+ plus) 5.0 µL
    dNTP Mixture (2.5 mM each) 2.0 µL
    Primer mix (50 ng/µL) 3.0 µL
    Promega Taq (5 U/µL) 0.2 µL
    DNA (about 20 ng/µL) 2.0 µL
    ddH2O 12.8 µL
    total 25.0 µL
  • PCR products were subject to agarose gel electrophoresis (Figure 9) before purification.
  • 3. Purification of PCR products
  • PCR products were purified by using Millipore purification plates. The main steps were as follows. The wells to be used were marked with a marker pen in the 96-well purification plate for PCR products, and 50 µl ultrapure water was added to each of the wells to be used. The rest wells were sealed by sealing film. The plate was stood for 15 min or was connected to a drawing and filtering system (-10 pa) for 5 min. When the purification plate was taken from the drawing and filtering system, liquid in the discharge port at the bottom of the purification plate was sipped up with absorbent paper.
  • PCR products to be purified were centrifuged at 4000 rpm for 1 min; the cover or silica gel pad for the PCR products to be purified was removed, and 100 µl ultrapure water was added to each PCR reaction system. Then, the purification plate, to which the PCR products to be purified were added, was connected to the drawing and filtering system, and the vacuum degree was adjusted to -10 pa as shown in barometer. The drawing and filtering were continued until no liquid was left on the microporous regeneratable cellulose film at the bottom of the purification plate, and no reflection gloss of intact liquid surface was found when observing under light.
  • In the wells containing PCR products to be purified, 50 µl ultrapure water or TE was added to the microporous regeneratable cellulose film; the purification plate was vibrated at room temperature in a trace vibrator for 5 min; and the whole liquids contained in the corresponding wells were transferred to the corresponding wells of a new 96-well PCR plate.
  • 4. Performance of sequencing reaction and purification of products of the sequencing reaction
  • The above purified PCR products were used as templates for sequencing reaction.
  • Conditions for sequencing reaction
  • 96°C 2 min
    96°C 10s → 55°C 5s → 60°C 2min (25 cycles)
    15°C ∞
  • The system for sequencing reaction was
    Purified PCR products 1 µL
    primers (3.2 pmol/l) 1 µL
    2.5 *Bigdye 0.3 µL
    5*Buffer 0.85 µL
    water 1.85 µL
    Total volume
    5 µL
  • The products of the sequencing reaction were purified by the following steps: the sequencing reaction plate was balanced, and centrifuged at 3000 g for 1 min. In the 96-well plate, to each 5 µL reaction system, 2µL 0.125 mol/L EDTA-Na2 solution, 33 µL 85% ethanol were added, and the plate was covered by a silica gel pad and was sufficiently vibrated for 3 min. The plate was then centrifuged at 4°C, 3000 g for 30 min. The sequencing plate was taken out after centrifugation, the silica gel pad was removed, and the sequencing plate was placed downwardly onto absorbent paper, and was then subjected to inverted centrifugation until the centrifugal force reached 185 g. To each well of the 96-well plate, 50 µl 70% ethanol was added. The plate was covered with a silica gel pad, and vibrated for 1.5 min, and centrifuged at 4°C, 3000 g for 15 min. The sequencing reaction plate was then placed in a dark and ventilated place for 30 min so as to be air-dried until no ethanol odor was felt. To each well of the 96-well plate, 10 µL HI-DI formamide was added (alternatively, to each well of a 384-well plate, 8 µL was added), and then the plate was covered by sealing film, and was centrifuged to 1000 rpm after vibrating for 5s.
  • 5. Sequencing and result analysis
  • Purified products of the sequencing reaction were subjected to capillary electrophoresis sequencing in ABI 3730XL. The sequencing peaks were analyzed by uType software (Invitrogen) to obtain HLA typing results (Figure 10). All the results obtained by the above method were identical to the original known results, as shown in Table 10. Table 10: Comparison of the typing results obtained by the above method with the original known typing results
    Sample No. Original known HLA-C genotype Results for HLA-C obtained at this time Identical or not
    1 C*08:01 C*15:05 C*08:01 C*15:05 yes
    2 C*01:02 C*07:02 C*01:02 C*07:02 yes
    3 C*08:01 C*16:02 C*08:01 C*16:02 yes
    4 C*01:02 C*03:02 C*01:02 C*03:02 yes
    5 C*01:02 C*02:02 C*01:02 C*02:02 yes
    6 C*01:02 C*15:02 C*01:02 C*15:02 yes
    7 C*01:02 C*03:04 C*01:02 C*03:04 yes
    8 C*03:02 C*07:02 C*03:02 C*07:02 yes
    9 C*06:02 C*16:02 C*06:02 C*16:02 yes
    10 C*01:02 C*03:04 C*01:02 C*03:04 yes
    11 C*03:04 C*07:02 C*03:04 C*07:02 yes
    12 C*07:02 C*08:01 C*07:02 C*08:01 yes
    13 C*01:02 C*15:02 C*01:02 C*15:02 yes
    14 C*01:02 C*03:04 C*01:02 C*03:04 yes
    15 C*01:02 C*03:04 C*01:02 C*03:04 yes
    16 C*07:02 C*12:02 C*07:02 C*12:02 yes
    17 C*04:01 C*08:01 C*04:01 C*08:01 yes
    18 C*08:01 C*16:02 C*08:01 C*16:02 yes
    19 C*14:02 C*15:02 C*14:02 C*15:02 yes
    20 C*01:02 C*03:03 C*01:02 C*03:03 yes
    21 C*03:03 C*08:01 C*03:03 C*08:01 yes
    22 C*03:04 C*07:02 C*03:04 C*07:02 yes
    23 C*07:02 C*08:01 C*07:02 C*08:01 yes
    24 C*07:02 C*12:02 C*07:02 C*12:02 yes
    25 C*07:02 C*12:03 C*07:02 C*12:03 yes
    26 C*01:02 C*07:02 C*01:02 C*07:02 yes
  • Example 10 HLA-DQB1 genotyping by using the second generation sequencing technique (Illumina Solexa)
  • 94 blood samples with known HLA-SBT typing results were subjected to HLA-DQB1 genotyping, according to the methods as described in Example 8, except for the following items.
  • 94 sets of PCR index primers were used to amplify 94 DNA samples, respectively, wherein each set of PCR index primers consisted of PCR primers for amplification of Exon 2 or 3 of HLA-DQB1 (Table 5) and a pair of bidirectional primer indexes (as described above), each forward PCR primer has the forward primer index of a pair of primer indexes linked at the 5' end, and the reverse PCR primer has the reverse primer index of a pair of primer indexes linked at the 5' end. During the synthesis of primers, the primer indexes were directly added to the 5' end of the PCR primers, wherein the primers were synthesized by Shanghai Invitrogen Co.
  • The 94 DNAs obtained in the sample extraction step, were designated as No. 1-94. PCR reaction was carried out in 96-well plates, Exons 2, 3 of DQB1 in each sample was amplified in the same well. Two negative controls without adding any template were set in each plate, and the primer indexes used in negative controls are PI-95 and PI-96. During experimentation, the numbering information of the sample corresponding to each pair of primer indexes was recorded.
  • The primer indexes used were the primer indexes PI-1 to PI-94 as listed in Table 6, and the following primer indexes PI-95 and PI-96 (Table 11) for negative controls. Table 11: Relevant information on the primer indexes used for negative controls
    PI-95 CGACGTAGAGTC CAGTAGCACTAC H11 Negative control
    PI-96 CACTGTATAGCT CGACTAGTACTA H12 Negative control
  • PCR procedure for HLA-DQB1 was as follows:
    • 96°C 2min
    • 95°C 30s→60°C 30s→72°C 20s (32 cycles)
    • 15°C ∞
  • PCR reaction system for HLA-DQB1 was as follows:
    Promega 5×buffer I (Mg2+ plus) 5.0 ul
    dNTP mixture (2.5 mM each) 2.0 ul
    PInf-Q-F2 (2 pmol/ul) 1.0 ul
    PInf-Q-R2 (2 pmol/ul) 1.0 ul
    PInf-Q-F3 (2 pmol/ul) 1.0 ul
    PInf-Q-R3 (2 pmol/ul) 1.0 ul
    Promega Taq (5U/ul) 0.2 ul
    DNA (about 20 ng/ul) 5.0 ul
    ddH2O 8.8 ul
    Total 25.0 ul
  • Wherein, PInf-Q-F2/3 represents the F primer of HLA-DQB1 having the forward primer index sequence No. n (Table 1) at 5' end; PInf-Q-R 2/3 represents the R primer of HLA-DQB1 having the reverse primer index sequence No. n at 5' end (here n≤96); and the rest may be deduced similarly. Moreover, each sample corresponds to a specific set of PCR primers.
  • PCR reaction was carried out in PTC-200 PCR apparatus from Bio-Rad Co.. After PCR reaction, 2ul PCR products were subjected to 1.5% agarose gel electrophoresis. Figure 11 showed the electrophoretic result of the PCR products of Exons 2+3 of HLA-DQB 1 of 94 samples, and the DNA molecular marker was DL 2000 (Takara Co.).
  • Pooling and purification of PCR products
  • 20 µl of the rest PCR products was taken from each well of the 96-well plate HLA-P-DQB1 (except for the negative control), and was mixed homogeneously in a 3 ml EP tube (designated as HLA-Q-Mix). 500ul DNA mixture from HLA-Q-Mix was subjected to column purification with Qiagen DNA Purification kit (QIAGEN Co.) (For the specific purification steps, please refer to the manufacturer's instruction). It was determined by Nanodrop 8000 (Thermo Fisher Scientific Co.) that the 200ul DNA obtained by purification has a HLA-Q-Mix DNA concentration of 48ng/ul.
  • Conditions for shearing were as follows:
  • Frequency sweeping
    Duty Cycle 10%
    Intensity
    5
    Cycles/Burst 200
    Time (s) 300
  • The reaction products were subjected to terminal repairing reaction, and then were recovered and purified by QIAquick PCR Purification Kit, and were dissolved in 34ul EB (QIAGEN Elution Buffer).
  • The reaction products were further subjected to the addition of A at 3' end, and then were recovered and purified by MiniElute PCR Purification Kit (QIAGEN Co.), and were dissolved in 13 µl EB solution (QIAGEN Elution Buffer).
  • After ligation of library adapters, the reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50 µl deionized water, and the DNA concentration determined by Fluorescence quantitative PCR (QPCR) was as follows:
    result determined by qPCR (nM)
    HLA-Q-Mix 115.3
  • The gel containing the DNA fragments ranging from 350 to 550bp was sliced (Figure 12). After purification and recovery of the products from the gel, the DNA concentration, as determined by Fluorescence quantitative PCR (QPCR), was 18.83 nM.
  • Analysis of the results
  • The sequencing results from Illumina GA were a series of DNA sequences, and by searching the forward and reverse primer index sequences and primer sequences in the sequencing results, databases, comprising the sequencing results of the PCR products of various exons of HLA-DQB1 for each sample corresponding to respective primer index were constructed. The sequencing results of each exon was aligned to the reference sequence (reference sequences were from http://www.ebi.ac.uk/imgt/hla/) of the corresponding exon by BWA (Burrows-Wheeler Aligner), and consensus sequences of each database were constructed, and the sequence reads were selected and corrected based on the quality value of base sequencing, and difference between the sequence reads and consensus sequences. The corrected DNA sequences were assembled into the corresponding sequences of Exons 2, 3 of HLA-DQB1 on the basis of sequence overlapping and linkage (Paired-End linkage) relationship. The screen-capture of Figure 13 illustrates the procedure for construction of consensus sequence of Exon 2 of HLA-DQB1 site in Sample No.7.
  • The resultant DNA sequence for Exons 2, 3 of HLA-DQB1 was aligned with the sequence database of the corresponding exon of HLA-DQB1 in IMGT HLA professional database. If the result of sequence alignment showed 100% match, the HLA-DQB1 genotype of the corresponding sample was determined.
  • For all 94 samples, the typing results obtained by the above method were completely consistent with the original known typing results, wherein the results of Samples No. 1-32 were shown in Table 12. Table 12: The typing results of Samples No. 1-32
    Sample No. Original known DQB1 genotype Results for DQB 1 obtained at this time Identical or not
    1 DQB1*02:02 DQB1*03:01 DQB1*02:02 DQB1*03:01 yes
    2 DQB1*02:02 DQB1*04:01 DQB1*02:02 DQB1*04:01 yes
    3 DQB1*05:02 DQB1*02:02 DQB1*05:02 DQB1*02:02 yes
    4 DQB1*02:02 DQB1*06:03 DQB1*02:02 DQB1*06:03 yes
    5 DQB1*03:03 DQB1*04:02 DQB1*03:03 DQB1*04:02 yes
    6 DQB1*05:02 DQB1*03:17 DQB1*05:02 DQB1*03:17 yes
    7 DQB1*03:03 DQB1*06:02 DQB1*03:03 DQB1*06:02 yes
    8 DQB1*05:03 DQB1*04:02 DQB1*05:03 DQB1*04:02 yes
    9 DQB1*04:02 DQB1*06:01 DQB1*04:02 DQB1*06:01 yes
    10 DQB1*05:01 DQB1*06:10 DQB1*05:01 DQB1*06:10 yes
    11 DQB1*03:01 DQB1*03:03 DQB1*03:01 DQB1*03:03 yes
    12 DQB1*05:01 DQB1*05:01 DQB1*05:01 DQB1*05:01 yes
    13 DQB1*02:02 DQB1*04:02 DQB1*02:02 DQB1*04:02 yes
    14 DQB1*05:02 DQB1*02:01 DQB1*05:02 DQB1*02:01 yes
    15 DQB1*02:01 DQB1*06:02 DQB1*02:01 DQB1*06:02 yes
    16 DQB1*03:03 DQB1*04:01 DQB1*03:03 DQB1*04:01 yes
    17 DQB1*05:01 DQB1*03:02 DQB1*05:01 DQB1*03:02 yes
    18 DQB1*03:03 DQB1*06:01 DQB1*03:03 DQB1*06:01 yes
    19 DQB1*03:03 DQB1*06:10 DQB1*03:03 DQB1*06:10 yes
    20 DQB1*05:03 DQB1*04:01 DQB1*05:03 DQB1*04:01 yes
    21 DQB1*05:02 DQB1*04:01 DQB1*05:02 DQB1*04:01 yes
    22 DQB1*03:01 DQB1*03:03 DQB1*03:01 DQB1*03:03 yes
    23 DQB1*05:02 DQB1*05:03 DQB1*05:02 DQB1*05:03 yes
    24 DQB1*05:02 DQB1*03:02 DQB1*05:02 DQB1*03:02 yes
    25 DQB1*03:03 DQB1*06:01 DQB1*03:03 DQB1*06:01 yes
    26 DQB1*05:02 DQB1*06:09 DQB1*05:02 DQB1*06:09 yes
    27 DQB1*02:02 DQB1*06:02 DQB1*02:02 DQB1*06:02 yes
    28 DQB1*05:02 DQB1*03:01 DQB1*05:02 DQB1*03:01 yes
    29 DQB1*02:01 DQB1*03:01 DQB1*02:01 DQB1*03:01 yes
    30 DQB1*06:03 DQB1*06:09 DQB1*06:03 DQB1*06:09 yes
    31 DQB1*05:02 DQB1*02:02 DQB1*05:02 DQB1*02:02 yes
    32 DQB1*05:01 DQB1*06:01 DQB1*05:01 DQB1*06:01 yes
  • Example 11 HLA-DQB1 genotyping by using Sanger sequencing method 1. Sample DNA extraction
  • As described in Example 1, DNAs were extracted by using KingFisher Automatic Extraction Instrument from 20 out of 94 samples with known HLA genotypes.
  • 2. PCR amplification
  • The above DNAs, extracted by using KingFisher Automatic Extraction Instrument, were used as templates, and PCR amplification was carried out in single tubes by using two pairs of PCR primers (Q-F2 and Q-R2, Q-F3 and Q-R3) as listed in Table 5, respectively. The PCR procedure for each pair of primers was as follows:
    • 96°C 2min
    • 95°C 30s→56°C 30s→72°C 20s (35 cycles)
    • 15°C ∞
  • PCR reaction system for HLA-Q was as follows:
    Promega 5×buffer I (Mg2+ plus) 5.0 µL
    dNTP Mixture (2.5 mM each) 2.0 µL
    Primer mixture (25 ng/µL) 3.0 µL
    Promega Taq (5 U/µL) 0.2 µL
    DNA (about 20 ng/µL) 2.0 µL
    ddH2O 12.8 µL
    total 25.0 µL
  • PCR products were subject to agarose gel electrophoresis before purification.
  • 3. Purification of PCR products
  • The method and steps were the same as those described in Example 9.
  • 4. Performance of sequencing reaction and purification of products of the sequencing reaction
  • The method and steps were the same as those described in Example 9.
  • 5. Sequencing and result analysis
  • Purified products of the sequencing reaction were subjected to capillary electrophoresis sequencing in ABI 3730XL. The sequencing peaks were analyzed by uType software (Invitrogen) to obtain HLA typing results (Figure 15). All the results obtained by the above method were identical to the original known results, as shown in Table 13. Table 13: Comparison of the typing results obtained by the above method with the original known typing results
    Sample No. Original known DQB 1 genotype Results for DQB1 obtained at this time Identical or not
    1 DQB1*02:02 DQB1*03:01 DQB1*02:02 DQB1*03:01 yes
    2 DQB1*02:02 DQB1*04:01 DQB1*02:02 DQB1*04:01 yes
    3 DQB1*05:02 DQB1*02:02 DQB1*05:02 DQB1*02:02 yes
    4 DQB1*02:02 DQB1*06:03 DQB1*02:02 DQB1*06:03 yes
    5 DQB1*03:03 DQB1*04:02 DQB1*03:03 DQB1*04:02 yes
    6 DQB1*05:02 DQB1*03:17 DQB1*05:02 DQB1*03:17 yes
    7 DQB1*03:03 DQB1*06:02 DQB1*03:03 DQB1*06:02 yes
    8 DQB1*05:03 DQB1*04:02 DQB1*05:03 DQB1*04:02 yes
    9 DQB1*04:02 DQB1*06:01 DQB1*04:02 DQB1*06:01 yes
    10 DQB1*05:01 DQB1*06:10 DQB1*05:01 DQB1*06:10 yes
    11 DQB1*03:01 DQB1*03:03 DQB1*03:01 DQB1*03:03 yes
    12 DQB1*05:01 DQB1*05:01 DQB1*05:01 DQB1*05:01 yes
    13 DQB1*02:02 DQB1*04:02 DQB1*02:02 DQB1*04:02 yes
    14 DQB1*05:02 DQB1*02:01 DQB1*05:02 DQB1*02:01 yes
    15 DQB1*02:01 DQB1*06:02 DQB1*02:01 DQB1*06:02 yes
    16 DQB1*03:03 DQB1*04:01 DQB1*03;03 DQB1*04:01 yes
    17 DQB1*05:01 DQB1*03:02 DQB1*05:01 DQB1*03:02 yes
    18 DQB1*03:03 DQB1*06:01 DQB1*03:03 DQB1*06:01 yes
    19 DQB1*03:03 DQB1*06:10 DQB1*03:03 DQB1*06:10 yes
    20 DQB1*05:03 DQB1*04:01 DQB1*05:03 DQB1*04:01 yes
  • Example 12 Genotyping of Exons 2, 3, 4 of HLA-A/B/C and Exons 2, 3 of HLA-DQB1 in 950 samples
  • In the present example, Exons 2, 3, 4 of HLA-A/B/C and Exons 2, 3 of HLA-DQB1 in 950 samples were genotyped by using the combination of primer indexes, DNA incomplete shearing strategy, library indexes, PCR-Free libraries preparation, and Illumia GA Paired-End 100 sequencing technique (PCR products having a length ranging from 300bp to 500bp), demonstrating that the method of the present invention could accomplish the genotyping of gene fragments of a length exceeding the maximum read length of sequencer, and also demonstrating that the present invention could accomplish HLA genotyping with low cost, high throughput, high accuracy and high resolution.
  • Principle: the samples to be analyzed were divided into 10 groups; for samples of each group, primer indexes were introduced to the two termini of the PCR products of Exons 2, 3, 4 of HLA-A/B/C and Exons 2, 3 of HLA-DQB1 by PCR reaction so as to specifically label the sample information of the PCR products. The products of PCR amplification of four sites (HLA-A/B/C/DQB1) in each group of samples were mixed together to obtain a library of PCR products; after incomplete ultrasonic shearing of the libraries of PCR products, indexed PCR-free sequencing libraries were constructed (wherein for the PCR product library of each sample group, a different adapter was used, thereby constructing 10 indexed sequencing libraries). The 10 indexed sequencing libraries were pooled together at an equal mole to construct a mixed index sequencing library. The mixed index sequencing library was subjected to 2% low melting point agarose gel electrophoresis, and all the DNA bands of a length ranging from 450bp to 750bp were recovered and purified by gel slicing. The recovered DNA was sequenced by the Illumina GA PE-100 method. The sequence information of all the tested samples can be traced by primer index sequences and library index sequences, and the sequence of the whole PCR product can be assembled on the basis of the known reference sequences and the overlapping and linkage relationship between the sequences of DNA fragments, The complete sequence of the original PCR product can be aligned with the standard database of the corresponding exons of HLA-A/B/C/DQB1, thereby accomplishing HLA-A/B/C/DQB1 genotyping.
  • 1. Sample extraction
  • DNAs were extracted from 950 blood samples with known HLA-SBT typing results (China Marrow Donor Program cited hereafter as (CMDP)) by using KingFisher Automatic Extraction Instrument (US Thermo Co.). The process was the same as that described in Example 1.
  • 2. PCR amplification
  • The 950 DNAs obtained from the sample extraction step were designated as No. 1-950, and were divided into 10 groups (95 DNAs for each group), which were designated as HLA-1, HLA-2, HLA-3, HLA-4, HLA-5, HLA-6, HLA-7, HLA-8, HLA-9, HLA-10. For each group of samples, 95 DNA samples were amplified by 95 sets of PCR primers carrying bidirectional primer indexes (Table 6) for amplification of Exons 2, 3, 4 of HLA-A/B (Table 2), for amplification of Exons 2, 3, 4 of HLA-C (Table 4), and for amplification of Exons 2, 3 of HLA-DQB1 (Table 5), respectively. PCR reaction took place in 96-well plates, using 100 plates in total, designated as HLA-X-P-A2, HLA-X-P-A3, HLA-X-P-A4, HLA-X-P-B2, HLA-X-P-B3, HLA-X-P-B4, HLA-X-P-C2, HLA-X-P-C3, HLA-X-P-C4 and HLA-X-P-DQB1 ("X" represents the information of the group number 1/2/3/4/5/6/7/8/9/10, "A2/3/4", "B2/3/4", "C2/3/4", "DQB1" represent the amplification sites), wherein a negative control without adding any template was set in each plate, and the primers used for the negative control were primers labeled by PI-1 (Table 6). During experimentation, the information of each sample on the group number and primer indexes was recorded. For example, the relevant information on primer indexes PI-1 and PI-2 was as follows, and the rest may be deduced similarly.
    primer index No. forward primer index reverse primer index Correspon ding position in 96-well plate Correspon ding template (Group 1) Corresponding template (Group n+1, wherein 1 ≤ n<10, n was an integer)
    PI-1 TCGCAGACATCA TGACACGATGCT A1 1 1+95*n
    PI-2 TACATCGCACTA TACAGATGCTGA A2 2 2+95*n
  • The PCR procedure and PCR reaction system for HLA-A/B/C were the same as those described in Example 2. The PCR primers for amplification of the corresponding exons of HLA-A/B were shown in Table 2, and the PCR primers for amplification of the corresponding exons of HLA-C were shown in Table 4.
  • PCR procedure for HLA-DQB1 was as follows.
    96°C 2min
    95°C 30s→55°C 30s→72°C 20s (32cycles)
    15°C ∞
  • Multiple PCR reaction system for HLA-DQB1 (amplification of Exons 2, 3 simultaneously) is the same as the one described in Example 10, and the PCR primers for amplification of the corresponding exons of HLA-DQB1 were as shown in Table 5.
  • Wherein, PInf-A/B/C-F2/3/4 and PInf-Q-F2/F3 represent the F primers of HLA-A/B/C/DQB1 having the forward primer index sequence No. n (Table 6) at 5' end, PInr-A/B/C-R2/3/4 and PInr-Q-R2/R3 represent the R primers of HLA-A/B/C/DQB1 having the reverse primer index sequence No. n at 5' end (here n≤95), and the rest may be deduced similarly. Moreover, each sample corresponds to a specific set of PCR primers (PInf-A/B/C-F2/3/4, PInr-A/B/C-R2/3/4, PInf-Q-F2/F3, PInr-Q-R2/R3).
  • PCR reaction was carried out in PTC-200 PCR apparatus from Bio-Rad Co.. After PCR reaction, 3ul PCR products were subjected to 2% agarose gel electrophoresis.
  • Figure 16 showed the electrophoretic result of the PCR products of the corresponding exons of HLA-A/B/C/DQB1 of Sample No. 1, and the DNA molecular marker was DL 2000 (Takara Co.). There were a series of single bands of a length ranging from 300 bp to 500 bp in the electrophorogram, indicating successful PCR amplification of exons (A2, A3, A4, B2, B3, B4, C2, C3, C4, DRB1) of HLA-A/B/C/DQB1 of Sample No.1. There was no amplification band in negative control (N). The results of other samples were similar.
  • 3. Pooling and purification of PCR products
  • For samples of Group X ("X" is 1/2/3/4/5/6/7/8/9/10), 20 µl of the rest PCR products was taken from each well of the 96-well plate HLA-X-P-A2 (except for the negative control), and was mixed homogeneously under shaking in a 3 ml EP tube (designated as HLA-X-A2-Mix). The same operation was applied to the other 9 96-well plates of the samples of Group X, designated as HLA-X-A3-Mix, HLA-X-A4-Mix, HLA-X-B2-Mix, HLA-X-B3-Mix, HLA-X-B4-Mix, HLA-X-C2-Mix, HLA-X-C3-Mix, HLA-X-C4-Mix, and HLA-X-DQB1-Mix. 200ul was taken from each of HLA-X-A2-Mix, HLA-X-A3-Mix, HLA-X-A4-Mix, HLA-X-B2-Mix, HLA-X-B3-Mix, HLA-X-B4-Mix, HLA-X-C2-Mix, HLA-X-C3-Mix, HLA-X-C4-Mix, and HLA-X-DQB1-Mix, and was mixed in a 3ml EP tube, designated as HLA-X-Mix. 500ul DNA mixture from HLA-X-Mix was subjected to column purification with Qiagen DNA Purification kit (QIAGEN Co.) (For the specific purification steps, please refer to the manufacturer's instruction) to obtain 200ul purified DNA, of which the DNA concentration were determined by Nanodrop 8000 (Thermo Fisher Scientific Co.). The same operation was also applied to the other 9 groups of samples. The finally determined DNA concentrations of the 10 groups of samples were as follows.
    HLA-1-Mix HLA-2-Mix HLA-3-Mix HLA-4-Mix HLA-5-Mix HLA-6-Mix HLA-7-Mix HLA-8-Mix HLA-9-Mix HLA-10 -Mix
    Conc. (ng/ul) 53.1 52.3 56.1 57.2 50.5 55.7 54.2 58.6 53.9 54.8
  • 4. Construction of Illumina GA sequencing libraries
  • As described in Example 4, a total amount of 5ug DNA, taken from the purified HLA-X-Mix, was subjected to DNA shearing, purification after shearing, terminal repairing reaction, addition of A at 3' end, and ligation of Illumina GA PCR-Free library adapter.
  • The corresponding relationship between the sample groups and library adapters was as follows.
    Sample group No. HLA-1 HLA-2 HLA-3 HLA-4 HLA-5 HLA-6 HLA-7 HLA-8 HLA-9 HLA-10
    Library adapter No. 1 2 3 4 5 6 7 8 9 10
  • The obtained reaction products were purified by Ampure Beads (Beckman Coulter Genomics), and were dissolved in 50ul deionized water, and the DNA concentrations determined by Fluorescence quantitative PCR (QPCR) were as follows:
    HLA-1-Mix HLA-2-Mix HLA-3-Mix HLA-4-Mix HLA-5-Mix HLA-6-Mix HLA-7-Mix HLA-8-Mix HLA-9 -Mix HLA-10 -Mix
    Conc./nM 86.60 78.21 54.56 87.35 84.37 85.09 96.21 85.81 88.14 88.26
  • 5. Recovery by gel slicing
  • HLA-1-Mix, HLA-2-Mix, HLA-3-Mix, HLA-4-Mix, HLA-5-Mix, HLA-6-Mix, HLA-7-Mix, HLA-8-Mix, HLA-9-Mix and HLA-10-Mix were mixed at an equal mole (final concentration was 70.86nM/ul), designated as HLA-Mix-10. 30µL HLA-Mix-10 was subjected to 2% low melting point agarose gel electrophoresis. The electrophoretic condition was 100V, 100min. DNA marker was the 50bp DNA marker from NEB Co.. The gel containing the DNA fragments ranging from 450 to 750bp was sliced (Figure 17). The products in the sliced gel were recovered and purified by QIAquick PCR Purification Kit (QIAGEN Co.), the volume after purification was 32ul, the DNA concentration measured by Fluorescence quantitative PCR (QPCR) was 10.25nM.
  • 6. Illumina GA sequencing and result analysis
  • Sequencing and result analysis were carried out according to the methods as described in Examples 5 and 6.
  • Databases, comprising the sequencing results of the PCR products of various exons of HLA-A/B/C/DQB1 for each sample corresponding to respective primer index were constructed. The resultant DNA sequence was aligned with the sequence database of the corresponding exon of HLA-A/B/C/DQB1 in IMGT HLA professional database. If the result of sequence alignment showed 100% match, the HLA-A/B/C/DQB1 genotype of the corresponding sample was determined. Please refer to the screen-capture of the program for construction of consensus sequence of Exon 2 of HLA-C site in Sample No.1, as illustrated in Figure 18. For all 950 samples, the typing results obtained by the above method were completely consistent with the original known typing results, wherein the results of Samples No. 1-32 were as follows:
    No. Original known HLA-A/B/C/DQB1 type
    1 A*02:07 A*03:01 B*07:02 B*46:01 C*01:02 C*07:02 DQB1*03:03 DQB1*06:02
    2 A*11: 01 A*31: 01 B*15: 11 B*38: 02 C*03: 03 C*07: 02 DQB1*03 :03 DQB1*04 :01
    3 A*02: 07 A*24: 02 B*13: 01 B*46: 01 C*01: 02 C*03: 04 DQB1*03 :02 DQB1*06 :01
    4 A*24: 02 A*33: 03 B*40: 01 B*51: 01 C*01: 02 C*14: 02 DQB1*03 :03 DQB1*03 :03
    5 A*31: 01 A*31: 01 B*15: 01 B*35: 01 C*04: 01 C*04: 01 DQB1*03 :02 DQB1*06 :02
    6 A*02: 07 A*03: 01 B*44: 02 B*46: 01 C*01: 02 C*05: 01 DQB1*03 :01 DQB1*06 :02
    7 A*02: 01 A*30: 01 B*07: 02 B*13: 02 C*06: 02 C*07: 02 DQB1*02 :02 DQB1*06 :01
    8 A*02: 07 A*02: 07 B*46: 01 B*46: 01 C*01: 02 C*01: 02 DQB1*05 :02 DQB1*03 :03
    9 A*01: 01 A*33: 03 B*49: 01 B*58: 01 C*03: 02 C*07: 01 DQB1*06 :04 DQB1*06 :09
    10 A*02: 07 A*11: 01 B*46: 01 B*48: 01 C*01: 03 C*08: 01 DQB1*05 :03 DQB1*03 :02
    11 A*02: 06 A*30: 01 B*13: 02 B*15: 02 C*06: 02 C*08: 01 DQB1*03 :01 DQB1*03 :01
    12 A*24: A*31: B*35: B*51: C*03: C*14: DQB1*03 DQB1*06
    02 01 01 01 03 02 :03 :01
    13 A*11: 01 A*33: 03 B*46: 01 B*46: 01 C*01: 02 C*01: 02 DQB1*03 :02 DQB1*03 :03
    14 A*01: 01 A*02: 03 B*38: 02 B*57: 01 C*06: 02 C*07: 02 DQB1*05 :02 DQB1*03 :03
    15 A*02: 06 A*24: 02 B*13: 01 B*15: 25 C*03: 04 C*07: 02 DQB1*03 :01 DQB1*06 :01
    16 A*11: 01 A*24: 02 B*15: 02 B*15: 27 C*04: 01 C*08: 01 DQB1*03 :01 DQB1*03 :03
    17 A*24: 02 A*24: 02 B*40: 01 B*46: 01 C*01: 02 C*03: 04 DQB1*03 :03 DQB1*06 :02
    18 A*24: 02 A*24: 02 B*40: 01 B*46: 01 C*01: 02 C*03: 04 DQB1*03 :03 DQB1*06 :02
    19 A*11: 01 A*33: 03 B*40: 02 B*58: 01 C*03: 02 C*03: 04 DQB1*02 :01 DQB1*03 :02
    20 A*24: 02 A*30: 01 B*13: 02 B*40: 01 C*03: 04 C*06: 02 DQB1*06 :02 DQB1*06 :03
    21 A*02: 01 A*24: 02 B*40: 01 B*40: 01 C*07: 02 C*14: 02 DQB1*04 :02 DQB1*06 :02
    22 A*02: 01 A*33: 03 B*15: 01 B*44: 03 C*01: 02 C*14: 03 DQB1*03 :01 DQB1*06 :04
    23 A*26: 01 A*33: 03 B*15: 01 B*58: 01 C*03: 02 C*08: 01 DQB1*02 :01 DQB1*03 :01
    24 A*02: 01 A*11: 01 B*13: 01 B*55: 02 C*01: 06 C*03: 04 DQB1*03 :01 DQB1*03 :03
    25 A*02: 01 A*32: 01 B*40: 01 B*52: 01 C*03: 04 C*12: 02 DQB1*05 :02 DQB1*06 :01
    26 A*02: 03 A*02: 07 B*40: 01 B*46: 01 C*01: 02 C*07: 02 DQB1*03 :02 DQB1*06 :01
    27 A*02: 07 A*02: 07 B*46: 01 B*46: 01 C*01: 02 C*01: 02 DQB1*03 :03 DQB1*06 :01
    28 A*24: 02 A*30: 01 B*13: 02 B*39: 05 C*06: 02 C*07: 02 DQB1*02 :02 DQB1*06 :01
    29 A*31: 01 A*33: 03 B*15: 18 B*58: 01 C*03: 02 C*07: 04 DQB1*04 :01 DQB1*06 :09
    30 A*02: 06 A*03: 01 B*27: 05 B*40: 02 C*02: 02 C*03: 04 DQB1*03 :01 DQB1*03 :01
    31 A*02: 06 A*33: 03 B*15: 02 B*58: 01 C*03: 02 C*08: 01 DQB1*05 :01 DQB1*06 :01
    32 A*03: 01 A*30: 01 B*13: 02 B*51: 01 C*06: 02 C*15: 02 DQB1*02 :02 DQB1*03 :01
  • No. HLA-A/B/C/DQB1 type determined by the method of the invention
    1 A*02: 07 A*03: 01 B*07: 02 B*46: 01 C*01: 02 C*07: 02 DQB1*03 :03 DQB1*06 :02
    2 A*11: 01 A*31: 01 B*15: 11 B*38: 02 C*03: 03 C*07: 02 DQB1*03 :03 DQB1*04 :01
    3 A*02: 07 A*24: 02 B*13: 01 B*46: 01 C*01: 02 C*03: 04 DQB1*03 :02 DQB1*06 :01
    4 A*24: 02 A*33: 03 B*40: 01 B*51: 01 C*01: 02 C*14: 02 DQB1*03 :03 DQB1*03 :03
    5 A*31: 01 A*31: 01 B*15: 01 B*35: 01 C*04: 01 C*04: 01 DQB1*03 :02 DQB1*06 :02
    6 A*02: 07 A*03: 01 B*44: 02 B*46: 01 C*01: 02 C*05: 01 DQB1*03 :01 DQB1*06 :02
    7 A*02: 01 A*30: 01 B*07: 02 B*13: 02 C*06: 02 C*07: 02 DQB1*02 :02 DQB1*06 :01
    8 A*02: 07 A*02: 07 B*46: 01 B*46: 01 C*01: 02 C*01: 02 DQB1*05 :02 DQB1*03 :03
    9 A*01: 01 A*33: 03 B*49: 01 B*58: 01 C*03: 02 C*07: 01 DQB1*06 :04 DQB1*06 :09
    10 A*02: 07 A*11: 01 B*46: 01 B*48: 01 C*01: 03 C*08: 01 DQB1*05 :03 DQB1*03 :02
    11 A*02: 06 A*30: 01 B*13: 02 B*15: 02 C*06: 02 C*08: 01 DQB1*03 :01 DQB1*03 :01
    12 A*24: 02 A*31: 01 B*35: 01 B*51: 01 C*03: 03 C*14: 02 DQB1*03 :03 DQB1*06 :01
    13 A*11: 01 A*33: 03 B*46: 01 B*46: 01 C*01: 02 C*01: 02 DQB1*03 :02 DQB1*03 :03
    14 A*01: 01 A*02: 03 B*38: 02 B*57: 01 C*06: 02 C*07: 02 DQB1*05 :02 DQB1*03 :03
    15 A*02: 06 A*24: 02 B*13: 01 B*15: 25 C*03: 04 C*07: 02 DQB1*03 :01 DQB1*06 :01
    16 A*11: 01 A*24: 02 B*15: 02 B*15: 27 C*04: 01 C*08: 01 DQB1*03 :01 DQB1*03 :03
    17 A*24: 02 A*24: 02 B*40: 01 B*46: 01 C*01: 02 C*03: 04 DQB1*03 :03 DQB1*06 :02
    18 A*24: 02 A*24: 02 B*40: 01 B*46: 01 C*01: 02 C*03: 04 DQB1*03 :03 DQB1*06 :02
    19 A*11: 01 A*33: 03 B*40: 02 B*58: 01 C*03: 02 C*03: 04 DQB1*02 :01 DQB1*03 :02
    20 A*24: 02 A*30: 01 B*13: 02 B*40: 01 C*03: 04 C*06: 02 DQB1*06 :02 DQB1*06 :03
    21 A*02: A*24: B*40: B*40: C*07: C*14: DQB1*04 DQB1*06
    01 02 01 01 02 02 :02 :02
    22 A*02: 01 A*33: 03 B*15: 01 B*44: 03 C*01: 02 C*14: 03 DQB1*03 :01 DQB1*06 :04
    23 A*26: 01 A*33: 03 B*15: 01 B*58: 01 C*03: 02 C*08: 01 DQB1*02 :01 DQB1*03 :01
    24 A*02: 01 A*11: 01 B*13: 01 B*55: 02 C*01: 06 C*03: 04 DQB1*03 :01 DQB1*03 :03
    25 A*02: 01 A*32: 01 B*40: 01 B*52: 01 C*03: 04 C*12: 02 DQB1*05 :02 DQB1*06 :01
    26 A*02: 03 A*02: 07 B*40: 01 B*46: 01 C*01: 02 C*07: 02 DQB1*03 :02 DQB1*06 :01
    27 A*02: 07 A*02: 07 B*46: 01 B*46: 01 C*01: 02 C*01: 02 DQB1*03 :03 DQB1*06 :01
    28 A*24: 02 A*30: 01 B*13: 02 B*39: 05 C*06: 02 C*07: 02 DQB1*02 :02 DQB1*06 :01
    29 A*31: 01 A*33: 03 B*15: 18 B*58: 01 C*03: 02 C*07: 04 DQB1*04 :01 DQB1*06 :09
    30 A*02: 06 A*03: 01 B*27: 05 B*40: 02 C*02: 02 C*03: 04 DQB1*03 :01 DQB1*03 :01
    31 A*02: 06 A*33: 03 B*15: 02 B*58: 01 C*03: 02 C*08: 01 DQB1*05 :01 DQB1*06 :01
    32 A*03: 01 A*30: 01 B*13: 02 B*51: 01 C*06: 02 C*15: 02 DQB1*02 :02 DQB*03 :01
  • Notice: In case that the sequences of Exons 2, 3, 4 of HLA-A/B/C were completely identical, a common type was selected.
  • 950 samples with known HLA-SBT typing results were subjected to genotyping of HLA-A/B/C/DQB1 sites by the technical strategy of the present invention, and the results showed that the typing results obtained by the technical strategy of the present invention were completely consistent with the original known results.
  • Although the embodiments of the present invention have been already described in detail, a person skilled in the art would understand that based on all the teaching as disclosed, various modification and substitution may be made to the embodiments without departing from the spirit and scope of the present invention. The scope of the present invention is defined by the claims appended and any equivalent thereof.
  • References
    1. [1]. http://www.ebi.ac.uk/imgt/hla/stats.html
    2. [2]. Tiercy J M. Molecular basis of HLA polymorphism: implications in clinical transplantation. [J]. Transpl Immunol, 2002, 9: 173-180.
    3. [3]. C.Antoine, S.Müller, A.Cant, et al. Long-term survival and transplantation of haemopoietic stem cells for immunodeficiencies: report of the European experience. 1968-99. [J]. The Lancet, 2003, 9357:553-560.
    4. [4]. H. A. Erlich, G. Opelz, J. Hansen, et al. HLA DNA Typing and Transplantation.[J].Immunity, 2001, 14:347-356.
    5. [5]. Lillo R, Balas A, Vicario JL, et al. Two new HLA class allele, DPB1*02014, by sequence-based typing. [J]. Tissue Antigens, 2002, 59: 47-48.
    6. [6]. A. Dormoy, N. Froelich. Leisenbach, et al. Mono-allelic amplification of exons 2-4 using allele group-specific primers for sequence-based typing (SBT) of the HLA-A, -B and -C genes: Preparation and validation of ready-to-use pre-SBT mini-kits. [J]. Tissue Antigens, 2003, 62: 201-216.
    7. [7]. Elaine R. Mardis. The impact of next-generation sequencing technology on genetics. [J].Trends in Genetics.2008, 24:133-141.
    8. [8]. Christian Hoffmann1, Nana Minkah1, Jeremy Leipzig. DNA barcoding and pyrosequencing to identify rare HIV drug resistance mutations. [J]. Nucleic Acids Research, 2007, 1-8.
    9. [9]. Shannon J.Odelberg, Robert B.Weiss, Akira Hata. Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I. [J]. Nucleic Acids Research. 1995, 23:2049-2057.
    10. [10]. Sayer D, Whidborne R, Brestovac B. HLA-DRB1 DNA sequencing based typing: an approach suitable for high throughput typing including unrelated bone marrow registry donors. [J]. Tissue Antigens. 2001, 57(1):46-54.
    11. [11]. Iwanka Kozarewa, Zemin Ning, Michael A Quail. Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of (G+C)-biased genomes. [J]. Nature Methods. 2009, 6: 291-295.
    12. [12]. Marsh, S.G.E., Parham, P. & Barber, L.D. The HLA Facts Book 3-91 (Academic Press, London, 2000).
    13. [13]. Campbell, K.J. et al. Characterization of 47 MHC class I sequences in Filipino cynomolgus macaques. ).
    14. [14]. Goulder, P.J.R. & Watkins, D.I. Impact of MHC class I diversity on immune control of immunodeficiency virus replication. Nat. Rev. Immunol. 8, 619-630 (2008).
    15. [15]. O'Leary, C.E. et al. Identification of novel MHC class I sequences in pig-tailed macaques by amplicon pyrosequencing and full-length cDNA cloning and sequencing. ).
    16. [16]. Robinson J, Malik A, Parham P, Bodmer JG, Marsh SGE.IMGT/HLA database-a sequence database for the human major histocompatibility complex. Tissue Antigens 55, 80-7 (2000).
    17. [17]. Hoffmann C, Minkah N, Leipzig J, Wang G, Arens MQ, Tebas P, Bushman FD. DNA bar coding and pyrosequencing to identify rare HIV drug resistance mutations. Nucleic Acids Res. 2007; 35(13):e91.
    18. [18]. WU, D. L. et al. Comparative analysis of serologic typing and HLA-II typing by micro-PCR-SSP. Di Yi Jun Yi Da Xue Xue Bao, 2002, 22:247-249.
    19. [19]. Al- Hussein K A, Rama N R, Butt A I, et al. HLA class II sequence based typing in normal Saudi individuals. Tissue Antigens, 2002, 60: 259-261.
    20. [20]. D. C. Sayer, D. M. Goodridge. Pilot study: assessment of interlaboratory variability of sequencing-based typing DNA sequence data quality. Tissue Antigens, 2007, 69 Suppl: 66-68.
    21. [21]. Horton V, Stratton I, Bottazzo G. F. et al. Genetic heterogeneity of autoimmune diabetes: age of presentation in adults is influenced by HLA DRB1 and DQB1 genotypes. Diabetologia, 1999, 42:608-616.
    22. [22]. C.E.M. Voorter, M.C. Kik1, E.M. van den Berg-Loonen et al. High-resolution HLA typing for the DQB1 gene by sequence-based typing. Tissue Antigens, 2008, 51:80-87.
    23. [23]. G. Bentley, R. Higuchi, B. Hoglund et al. High-resolution, high-throughput HLA genotyping by next-generation sequencing. Tissue Antigens, 2009, 74: 393-403.
    Figure imgb0005
    Figure imgb0006
    Figure imgb0007
    Figure imgb0008
    Figure imgb0009
    Figure imgb0010
    Figure imgb0011
    Figure imgb0012
    Figure imgb0013
    Figure imgb0014
    Figure imgb0015
    Figure imgb0016
    Figure imgb0017
    Figure imgb0018
    Figure imgb0019
    Figure imgb0020
    Figure imgb0021
    Figure imgb0022
    Figure imgb0023
    Figure imgb0024
    Figure imgb0025
    Figure imgb0026
    Figure imgb0027
    Figure imgb0028
    Figure imgb0029
    Figure imgb0030
    Figure imgb0031
    Figure imgb0032
    Figure imgb0033
    Figure imgb0034
    Figure imgb0035
    Figure imgb0036
    Figure imgb0037
    Figure imgb0038

Claims (51)

  1. A method for determining the nucleotide sequence of a nucleic acid of interest in a sample, comprising:
    1) providing n samples, wherein n is an integer of ≥ 1, the samples are preferably from mammalian, more preferably human, particularly are human blood sample; optionally, the n samples to be analyzed are divided into m groups, m is an integer and n≥m>1 ;
    2) amplifying: a pair or multiple pairs of index primers are used for each sample, when there are templates from the sample, PCR amplification is performed under conditions suitable for amplifying the nucleic acid of interest, wherein each pair of index primers consist of a forward index primer and a reverse index primer (both of which may be degenerate primers) comprising primer indexes, wherein the primer indexes comprised in the forward index primer and reverse index primer may be identical or different: the primer indexes in the pairs of index primers used for different samples are different;
    3) pooling: when n>1, pooling PCR products from each of the samples together:
    4) shearing: subjecting the amplified products to incomplete shearing, and purifying and recovering;
    5) sequencing: subjecting the recovered DNA mixture to sequencing by using the second generation sequencing technique, preferably, Paired-End technique (for example, Illumina GA, Illumina Hiseq 2000), to obtain sequences of the sheared DNA; and
    6) assembling: corresponding the obtained sequencing data to samples one by one based on the unique primer index for each sample, aligning each sequence read to the DNA reference sequence corresponding to the PCR products by using alignment program (such as Blast, BWA program), assembling a complete sequence of the nucleic acid of interest from the sequences of the sheared DNA by virtue of sequence overlapping and linkage relationship.
  2. A method of claim 1, wherein each pair of primer indexes and a pair of PCR primers form a pair of index primers, wherein forward and reverse PCR primers have a forward primer index and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  3. A method of claim 1 or 2, wherein said PCR primers are PCR primers for amplification of HLA gene, particularly PCR primers for amplification of HLA-A/B gene, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB1 as shown in Table 7.
  4. A method of claim 1 or 2, wherein said PCR primers are PCR primers for amplification of HLA gene, particularly PCR primers for amplification of HLA-C gene, preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C; preferably, said PCR primers are as shown in Table 3 or Table 4.
  5. A method of claim 1 or 2, wherein said PCR primers are PCR primers for amplification of HLA gene, particularly PCR primers for amplification of HLA-DQB1 gene, preferably PCR primers for amplification of Exon 2 and/3 of HLA-DQB1 gene; preferably, said PCR primers are as shown in Table 5.
  6. A method of claim 1, wherein said primer indexes are designed for PCR primers, preferably for PCR primers for amplification of a specific gene of HLA, more preferably for PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B and Exon 2 of HLA-DRB1, particularly for PCR primers as shown in Table 1, Table 2 or Table 7; said primer indexes particularly comprise at least 10, or at least 20, or at least 30, or at least 40, or at least 50, or at least 60, or at least 70, or at least 80, or at least 90, or 95 pairs of the 95 pairs of primer indexes as shown in Table 6 (or the set of primer indexes consisting of 10-95 pairs (for example, 10-95 pairs, 20-95 pairs, 30-95 pairs, 40-95 pairs, 50-95 pairs, 60-95 pairs, 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs) of the 95 pairs of primer indexes as shown in Table 6); and
    the set of index primers preferably comprises at least PI-1 to PI-10, or PI-11 to PI-20, or PI-21 to PI-30, or PI-31 to PI-40, or PI-41 to PI-50, or PI-51 to PI-60, or PI-61 to PI-70, or PI-71 to PI-80, or PI-81 to PI-90, or PI-91 to PI-95 of the 95 pairs of primer indexes as shown in Table 6, or combinations of any two or more of them.
  7. A method of claim 1, wherein said DNA shearing includes chemical shearing methods and physical shearing methods, wherein the chemical shearing methods include enzymatic digestion, and the physical shearing methods include ultrasonic shearing methods or mechanical shearing methods.
  8. A method of claim 1, wherein after said DNA shearing, all the DNA bands between the maximum read length of the sequencer and the applicable maximum DNA length of the sequencer are purified and recovered, wherein said purification and recovery methods include, but are not limited to, recovery by electrophoresis and gel slicing, and recovery by magnetic beads.
  9. A method of claim 1, comprising, in addition to steps 1) to 4) of claim 1, the following steps:
    5) constructing a library: constructing a PCR-free sequencing library by using the library of the sheared PCR products, wherein different library adapters may be added to distinguish different PCR-Free sequencing libraries, all the DNA bands between the maximum read length of the sequencer and the applicable maximum DNA length of the sequencer, preferably DNA fragments of 450 to 750 bp, are purified and recovered;
    6) sequencing: subjecting the recovered DNA mixture to sequencing by using the second generation sequencing technique, preferably Paired-End technique (for example, Illumina GA, Illumina Hiseq 2000), obtaining the sequences of the sheared DNAs;
    7) assembling: corresponding the obtained sequencing data to the samples one by one based on different library adapter sequences of the libraries and the unique primer index for each sample, aligning each sequence read to the DNA reference sequence corresponding to the PCR products by using alignment program (such as Blast, BWA program), assembling a complete sequence of the nucleic acid of interest from the sequences of the sheared DNA based on sequence overlapping and linkage relationship.
  10. Use of a method of any one of claims 1 to 9 in HLA typing, characterized by comprising: sequencing a sample (particularly blood sample) from a patient by the method of any one of claims 1 to 7, and aligning the sequencing results with sequence data of Exons of HLA, preferably, Exons 2, 3, 4 of HLA-A/B, Exons 2, 3 and/or 4 of HLA-C, Exon 2 and/or 3 of HLA-DQB1 gene and/or Exon 2 of HLA-DRB 1 in HLA database (such as IMGT HLA professional database); wherein if the result of sequence alignment shows 100% match, the HLA genotype of the corresponding sample is determined.
  11. A set of primer indexes, comprising at least 10, or at least 20, or at least 30, or at least 40, or at least 50, or at least 60, or at least 70, or at least 80, or at least 90, or 95 pairs of the 95 pairs of primer indexes as shown in Table 6 (or said set of primer indexes consisting of 10-95 pairs (for example, 10-95 pairs, 20-95 pairs, 30-95 pairs, 40-95 pairs, 50-95 pairs, 60-95 pairs, 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs) of the 95 pairs of primer indexes as shown in Table 6), and
    said set of index primers preferably comprises at least PI-1 to PI-10, or PI-11 to PI-20, or PI-21 to PI-30, or PI-31 to PI-40, or PI-41 to PI-50, or PI-51 to PI-60, or PI-61 to PI-70, or PI-71 to PI-80, or PI-81 to PI-90, or PI-91 to PI-95 of the 95 pairs of primer indexes as shown in Table 6, or combinations of any two or more of them.
  12. The use of the set of primer indexes of claim 11 in PCR sequencing methods, wherein in particular, each pair of primer indexes and a pair of PCR primers for amplification of a sequence of interest to be tested form a pair of index primers, wherein forward and reverse PCR primers have a forward primer index and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  13. The use of claim 12, wherein said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB 1 as shown in Table 7; or preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are as shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are as shown in Table 5.
  14. A set of index primers comprising the set of primer indexes of claim 11 and a pair of PCR primers for amplification of a sequence of interest to be tested, wherein a pair of index primers comprises a pair of primer indexes and a pair of PCR primers, the forward and reverse PCR primer have a forward and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  15. The index primers of claim 14, wherein said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB 1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are as shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are as shown in Table 5.
  16. Use of the index primers of claim 14 in PCR sequencing methods.
  17. A HLA typing method, comprising:
    1) providing n samples, wherein n is an integer of ≥1, the sample is preferably from mammalian, more preferably human, particularly human blood sample;
    2) dividing n samples to be analyzed into m groups, m is an integer and n≥m≥1 ;
    3) amplifying: a pair of index primers is used for each sample, when there are templates from the sample, PCR amplification is performed under conditions suitable for amplifying the nucleic acid of interest, wherein each pair of index primers consists of a forward index primer and a reverse index primer (both of which may be degenerate primers) comprising primer indexes, wherein the primer indexes comprised in the forward index primer and reverse index primer may be identical or different: the primer indexes in the pairs of index primers used for different samples are different;
    4) pooling: pooling PCR amplified products from each of the samples together to obtain PCR product libraries;
    5) shearing: subjecting the resultant PCR product libraries to incomplete shearing;
    6) constructing libraries: constructing PCR-free sequencing libraries from the library of the sheared PCR products with library adapter index technique, wherein different library adapters may be added to distinguish different PCR-Free sequencing libraries, all the DNA bands between the maximum read length of the sequencer and the applicable maximum DNA length of the sequencer, particularly DNA fragments of 450 to 750 bp, are recovered;
    7) sequencing: subjecting the recovered DNA mixture to sequencing by using the second generation sequencing technique, preferably Paired-End technique (for example, Illumina GA, Illumina Hiseq 2000), obtaining the sequences of the sheared DNAs;
    8) assembling: corresponding the obtained sequencing results to the samples one by one based on different library adapter sequences of the libraries and the unique primer index for each sample, aligning each sequence read to the DNA reference sequence corresponding to the PCR products by using alignment program (such as Blast, BWA program), assembling a complete sequence of the nucleic acid of interest from the sequences of the sheared DNA based on sequence overlapping and linkage relationship; and
    9) typing: aligning the sequencing results with sequence data of Exons of HLA, preferably, Exons 2, 3, 4 of HLA-A/B, Exons 2, 3 and/or 4 of HLA-C, Exon 2 and/or 3 of HLA-DQB1 gene and/or Exon 2 of HLA-DRB 1 in HLA database (such as IMGT HLA professional database), wherein if the result of sequence alignment shows 100% match, the HLA genotype of the corresponding sample is determined.
  18. A method of claim 17, wherein a pair of index primers comprises a pair of primer indexes and a pair of PCR primers, the forward and reverse PCR primer have a forward and a reverse primer index at 5' end (or optionally linked by a linker sequence), respectively.
  19. A method of claim 17, wherein said PCR primers are PCR primers for amplification of a specific gene of HLA, preferably PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB 1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are as shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exon 2 and/or 3 of HLA-DQB1, preferably said PCR primers are as shown in Table 5.
  20. A method of claim 17, wherein said primer indexes are as shown in claim 6.
  21. A method of claim 17, wherein said DNA shearing includes chemical shearing methods and physical shearing methods, wherein the chemical shearing methods include enzymatic digestion, and the physical shearing methods include ultrasonic shearing methods or mechanical shearing methods.
  22. A method of claim 17, wherein said purification and recovery methods include, but are not limited to, recovery by electrophoresis and gel slicing, and recovery by magnetic beads.
  23. A method of claim 17, wherein the construction of PCR-free sequencing libraries from the libraries of the sheared PCR products with library adapter indexing technique comprises, adding m library adapters to the m PCR product libraries obtained in 2), wherein each PCR product library uses a different library adapter, thereby constructing m adapter indexed sequencing libraries; m adapter indexed sequencing libraries are pooled together at equal mole to construct a mixture of adapter indexed sequencing libraries, wherein the method for linking library adapters refers to direct linkage using DNA ligase without a PCR procedure.
  24. PCR primers for HLA genotyping, characterized by that said PCR primers are PCR primers for amplification of Exons 2, 3, 4 of HLA-A/B gene and Exon 2 of HLA-DRB1, preferably PCR primers for amplification of Exons 2, 3 and 4 of HLA-A/B as shown in Table 1 or Table 2, or preferably PCR primers for amplification of Exon 2 of HLA-DRB 1 as shown in Table 7; preferably PCR primers for amplification of Exons 2, 3 and/or 4 of HLA-C, preferably said PCR primers are as shown in Table 3 or Table 4; or preferably PCR primers for amplification of Exons 2 and/or 3 of HLA-DQB1, preferably said PCR primers are as shown in Table 5.
  25. A sequencing method using the PCR primers of claim 24, comprising
    providing a sample, particularly a blood sample, said blood sample is preferably from mammalian, particularly human;
    amplifying: amplifying DNA from the blood sample with the PCR primers to obtain PCR products, and purifying the PCR products;
    sequencing: subjecting the PCR products to sequencing, the sequencing method may be Sanger sequencing method, or the second generation sequencing method (such as Hiseq 2000, Illumina GA and Roche454).
  26. Use of the PCR primers of claim 24 in HLA genotyping, characterized by using the PCR primers of claim 24, carrying out assembly and alignment analysis on the results obtained by the method of claim 25, and comparing the sequencing results with the standard sequences in the database to obtain the HLA genotyping results.
  27. A kit for HLA genotyping, comprising the PCR primers of claim 24.
  28. A set of PCR primers for HLA-A, B genotyping, characterized by that said PCR primers are as shown in Table 1 or Table 2; preferably, said typing is based on sequencing methods, including the second generation sequencing method and Sanger method.
  29. A sequencing method using PCR primers of claim 28, comprising:
    providing a sample, particularly a blood sample, said blood sample is preferably from mammalian, particularly human;
    amplifying: amplifying DNA from the blood sample with the PCR primers to obtain PCR products, and purifying the PCR products;
    sequencing: subjecting the PCR products to sequencing, the sequencing method may be Sanger sequencing method, or the second generation sequencing method (such as Hiseq 2000, Illumina GA and Roche454).
  30. Use of the PCR primers of claim 28 in HLA genotyping, characterized by using the PCR primers of claim 28, carrying out assembly and alignment analysis on the results obtained by the method of claim 29, and comparing the sequencing results with the standard sequences in the database to obtain the HLA genotyping results.
  31. A kit for HLA genotyping, comprising the PCR primers of claim 28.
  32. A polynucleotide having a sequence as shown in any of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36.
  33. A method for amplifying Exons 2, 3 and/or 4 of HLA-C gene, characterized by amplifying Exon 2, 3 and/or 4 of HLA-C gene with the PCR primer pair selected from the group consisting of SEQ ID NO: 25 and SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36.
  34. A method for sequencing Exons 2, 3 and 4 of HLA-C gene in a sample, comprising the followings steps of:
    1) providing a sample and extracting DNA of the sample;
    2) amplifying the DNA with a PCR primer pair to obtain PCR products, preferably purifying the PCR products, wherein said PCR primer pair is selected from the group consisting of SEQ ID NO: 25 and SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36;
    3) subjecting the PCR products to sequencing.
  35. The method of claim 34, wherein said sample is a blood sample.
  36. The method of claim 35, wherein said blood sample is from mammalian or human.
  37. A method for HLA-C genotyping, comprising:
    1) PCR amplifying Exons 2, 3 and/or 4 of HLA-C gene of a sample to be tested with a PCR primer pair selected from the group consisting of SEQ ID NO: 25 and SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36;
    2) subjecting the amplified exons to sequencing, and comparing the sequencing results with the standard sequences in the database so as to determine the genotyping results.
  38. The method of claim 34 or 37, wherein the sequencing is carried out by Sanger sequencing method, or the second generation sequencing method.
  39. The method of claim 38, wherein said second generation sequencing method is Illumina Solexa or Roche454.
  40. A kit for HLA-C genotyping, comprising a PCR amplification primer pair selected from the group consisting SEQ ID NO: 25 and SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, or SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36, and preferably further comprising agents for DNA amplification, DNA purification, and/or DNA sequencing.
  41. Use of the polynucleotide of claim 32, the method of claim 37, or the kit of claim 40 in HLA-C genotyping.
  42. A polynucleotide having a sequence as shown in any of SEQ ID NO: 37 to SEQ ID NO: 40.
  43. A method for amplifying Exons 2 and/or 3 of HLA-DQB1, characterized by performing PCR amplification using the primer pair of SEQ ID NO: 37 and SEQ ID NO: 38; and/or SEQ ID NO: 39 and SEQ ID NO: 40.
  44. A method for sequencing Exons 2 and/or 3 of HLA-DQB1 in a sample, comprising the following steps of:
    1) providing a sample and extracting DNA of the sample;
    2) amplifying the DNA with the primer pair of SEQ ID NO: 37 and SEQ ID NO: 38; and/or SEQ ID NO: 39 and SEQ ID NO: 40, so as to obtain PCR products, preferably purifying the PCR products,
    3) subjecting the PCR products to sequencing.
  45. The method of claim 44, wherein said sample is a blood sample.
  46. The method of claim 45, wherein said blood sample is from mammalian or human.
  47. A method for HLA-DQB1 genotyping, comprising:
    1) PCR amplifying Exons 2 and/or 3 of HLA-DQB1 in a sample to be tested with the PCR primer pair of SEQ ID NO: 37 and SEQ ID NO: 38; and/or SEQ ID NO: 39 and SEQ ID NO: 40,
    2) subjecting the amplified exons to sequencing, and comparing the sequencing results with the standard sequences in the database so as to determine the genotyping results.
  48. The method of claim 44 or 47, wherein said sequencing is carried out by Sanger sequencing method or the second generation sequencing method.
  49. The method of claim 48, wherein said second generation sequencing method is Illumina Solexa or Roche454.
  50. A kit for HLA-DQB1 genotyping, comprising the primer pair of SEQ ID NO: 37 and SEQ ID NO: 38; and/or SEQ ID NO: 39 and SEQ ID NO: 40, and preferably further comprising agents for DNA amplification, DNA purification, and/or DNA sequencing.
  51. Use of the polynucleotide of claim 42, the method of claim 47, or the kit of claim 50 in HLA-DQB1 genotyping.
EP11800190.8A 2010-06-30 2011-06-30 New pcr sequencing method and use thereof in hla genotyping Active EP2599877B1 (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
CN 201010213721 CN101921842B (en) 2010-06-30 2010-06-30 HLA (Human Leukocyte Antigen)-A,B genotyping PCR (Polymerase Chain Reaction) primer and application method thereof
CN201010213719.5A CN101921841B (en) 2010-06-30 2010-06-30 HLA (Human Leukocyte Antigen) gene high-resolution genotyping method based on Illumina GA sequencing technology
CN201010213717.6A CN101921840B (en) 2010-06-30 2010-06-30 DNA molecular label technology and DNA incomplete interrupt policy-based PCR sequencing method
PCT/CN2010/002150 WO2012083506A1 (en) 2010-12-24 2010-12-24 Method for hla-dqb1 genotyping and related primers thereof
PCT/CN2010/002149 WO2012083505A1 (en) 2010-12-24 2010-12-24 Method for hla-c genotyping and related primers thereof
PCT/CN2011/076688 WO2012000445A1 (en) 2010-06-30 2011-06-30 New pcr sequencing method and use thereof in hla genotyping

Publications (3)

Publication Number Publication Date
EP2599877A1 true EP2599877A1 (en) 2013-06-05
EP2599877A4 EP2599877A4 (en) 2014-01-01
EP2599877B1 EP2599877B1 (en) 2017-09-27

Family

ID=45401405

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11800190.8A Active EP2599877B1 (en) 2010-06-30 2011-06-30 New pcr sequencing method and use thereof in hla genotyping

Country Status (12)

Country Link
US (1) US9957564B2 (en)
EP (1) EP2599877B1 (en)
JP (1) JP5968879B2 (en)
KR (1) KR101709826B1 (en)
AU (1) AU2011274090B2 (en)
BR (1) BR112012032586B1 (en)
CA (1) CA2803940C (en)
DK (1) DK2599877T3 (en)
MY (1) MY173793A (en)
RU (1) RU2587606C2 (en)
SG (1) SG186876A1 (en)
WO (1) WO2012000445A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105400864A (en) * 2014-09-12 2016-03-16 深圳华大基因股份有限公司 Method for constructing sequencing library based on blood samples, and uses of method in determination of fetal genetic abnormality
EP3006571A4 (en) * 2013-05-09 2017-02-22 Genodive Pharma Inc. Hla gene multiplex dna typing method and kit
EP3191630A4 (en) * 2014-09-12 2017-07-19 BGI Genomics Co., Limited Method for constructing sequencing library based on blood sample and usage thereof in determining fetal genetic abnormality
WO2017147294A1 (en) * 2016-02-23 2017-08-31 Novozymes A/S Improved next-generation sequencing
US10233490B2 (en) 2014-11-21 2019-03-19 Metabiotech Corporation Methods for assembling and reading nucleic acid sequences from mixed populations
EP3626835A1 (en) 2018-09-18 2020-03-25 Sistemas Genómicos, S.L. Method for genotypically identifying both alleles of at least one locus of a subject's hla gene
CN111235266A (en) * 2020-03-10 2020-06-05 广州医科大学附属第二医院 HLA subtype detection kit and its application
WO2021048504A1 (en) 2019-09-12 2021-03-18 Bionobis Genotyping method suitable for processing a large number of samples, in particular in cases of high polymorphism
FR3106596A1 (en) 2020-01-27 2021-07-30 Bionobis SIMPLE AND FAST HLA GENOTYPING PROCESS
FR3110178A1 (en) 2020-05-18 2021-11-19 Bionobis Genotyping process suitable for the simultaneous treatment of a large number of patients
US11859171B2 (en) 2013-04-17 2024-01-02 Agency For Science, Technology And Research Method for generating extended sequence reads

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10508311B2 (en) * 2013-08-26 2019-12-17 The Translational Genomics Research Institute Single molecule-overlapping read analysis for minor variant mutation detection in pathogen samples
GB201409282D0 (en) 2014-05-23 2014-07-09 Univ Sydney Tech Sequencing process
CN106661636A (en) * 2014-09-05 2017-05-10 凯杰有限公司 Preparation of adapter-ligated amplicons
US9859394B2 (en) 2014-12-18 2018-01-02 Agilome, Inc. Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids
US9857328B2 (en) 2014-12-18 2018-01-02 Agilome, Inc. Chemically-sensitive field effect transistors, systems and methods for manufacturing and using the same
US10020300B2 (en) 2014-12-18 2018-07-10 Agilome, Inc. Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids
US10006910B2 (en) 2014-12-18 2018-06-26 Agilome, Inc. Chemically-sensitive field effect transistors, systems, and methods for manufacturing and using the same
US9618474B2 (en) 2014-12-18 2017-04-11 Edico Genome, Inc. Graphene FET devices, systems, and methods of using the same for sequencing nucleic acids
US10429342B2 (en) 2014-12-18 2019-10-01 Edico Genome Corporation Chemically-sensitive field effect transistor
WO2016124069A1 (en) * 2015-02-04 2016-08-11 深圳华大基因研究院 Method for constructing long fragment sequencing library
KR101651817B1 (en) * 2015-10-28 2016-08-29 대한민국 Primer set for Preparation of NGS library and Method and Kit for making NGS library using the same
EP3459115A4 (en) 2016-05-16 2020-04-08 Agilome, Inc. GRAPHEN-FET DEVICES, SYSTEMS AND METHODS FOR USE THEREOF FOR SEQUENCING NUCLEIC ACIDS
JP6941680B2 (en) 2016-10-24 2021-09-29 ジェネインフォセック、インコーポレイテッド Concealment of information existing in nucleic acids
CN110168100A (en) * 2016-11-15 2019-08-23 奎斯特诊断投资有限责任公司 Method for detecting cystic fibrosis mutations using MITRA tip extraction
US11441192B2 (en) 2016-11-15 2022-09-13 Quest Diagnostics Investments Llc Methods for detecting DNA mutations using mitra tip extraction
RU2703401C1 (en) * 2018-10-24 2019-10-16 Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" Test system for detecting and genotyping rna of swine reproductive-respiratory syndrome virus
RU2703394C1 (en) * 2018-10-24 2019-10-16 Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" Method for detecting and genotyping rna of porcine reproductive-respiratory syndrome virus
CN112553313A (en) * 2020-12-30 2021-03-26 武汉康圣达医学检验所有限公司 Method for denaturing sequencing reaction product for Sanger method
KR102507110B1 (en) * 2022-02-15 2023-03-07 주식회사 네오젠티씨 Apparatus and method for analyzing type of major histocompatibility complex

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993009245A1 (en) * 1991-10-31 1993-05-13 University Of Pittsburgh Reverse dot blot hybridization using tandem head-to-tail monomers containing probes synthesized by staggered complementary primers
US5580730A (en) * 1994-08-19 1996-12-03 Olympus America, Inc. Enzyme digestion method for the detection of amplified DNA
AU6321998A (en) 1997-02-11 1998-08-26 William H. Hildebrand Class i sequence based typing of hla-a, -b, and -c alleles by direct dna sequencing
EP0953650A1 (en) * 1998-04-20 1999-11-03 Innogenetics N.V. Method for typing of HLA alleles
CA2513889A1 (en) * 2003-01-29 2004-08-19 454 Corporation Double ended sequencing
US7300755B1 (en) * 2003-05-12 2007-11-27 Fred Hutchinson Cancer Research Center Methods for haplotyping genomic DNA
WO2005042764A2 (en) * 2003-10-28 2005-05-12 Dynal Biotech Llc Primers, methods and kits for amplifying or detecting human leukocyte antigen alleles
DK1885882T3 (en) * 2005-05-10 2011-04-11 State Of Oregon Acting By & Through The State Board Of Higher Eduction On Behalf Of The University O Methods for mapping polymorphisms and polymorphism microarray
US20090317798A1 (en) * 2005-06-02 2009-12-24 Heid Christian A Analysis using microfluidic partitioning devices
CA2910861C (en) 2005-09-29 2018-08-07 Michael Josephus Theresia Van Eijk High throughput screening of mutagenized populations
CN101310024B (en) 2005-11-14 2012-10-03 科因股份有限公司 A method for high-throughput screening of transposon marker populations and sequence identification of massively parallel insertion sites
JP5452021B2 (en) * 2005-12-22 2014-03-26 キージーン ナムローゼ フェンノートシャップ High-throughput AFLP polymorphism detection method
CA2654729A1 (en) * 2006-06-09 2007-12-13 Conexio 4 Pty Ltd Identification of a nucleic acid molecule
WO2009049889A1 (en) * 2007-10-16 2009-04-23 Roche Diagnostics Gmbh High resolution, high throughput hla genotyping by clonal sequencing
US20100086914A1 (en) * 2008-10-03 2010-04-08 Roche Molecular Systems, Inc. High resolution, high throughput hla genotyping by clonal sequencing
RU2393231C1 (en) * 2008-12-29 2010-06-27 Федеральное государственное учреждение здравоохранения "Российский научно-исследовательский противочумный институт "Микроб" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека ("РосНИПЧИ "Микроб") Method for determination of genetic relationship of comma bacilli strains by sequencing genes flanking cluster of o-antigen biosynthesis genes
CN101921840B (en) * 2010-06-30 2014-06-25 深圳华大基因科技有限公司 DNA molecular label technology and DNA incomplete interrupt policy-based PCR sequencing method
CN101921841B (en) 2010-06-30 2014-03-12 深圳华大基因科技有限公司 HLA (Human Leukocyte Antigen) gene high-resolution genotyping method based on Illumina GA sequencing technology
CN101921842B (en) * 2010-06-30 2013-08-07 深圳华大基因科技有限公司 HLA (Human Leukocyte Antigen)-A,B genotyping PCR (Polymerase Chain Reaction) primer and application method thereof

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11859171B2 (en) 2013-04-17 2024-01-02 Agency For Science, Technology And Research Method for generating extended sequence reads
US12480115B2 (en) 2013-04-17 2025-11-25 Agency For Science, Technology And Research Method for generating extended sequence reads
EP3006571A4 (en) * 2013-05-09 2017-02-22 Genodive Pharma Inc. Hla gene multiplex dna typing method and kit
US10711306B2 (en) 2013-05-09 2020-07-14 Genodive Pharma Inc. Method and kit for multiplex DNA typing of HLA gene
EP3191630A4 (en) * 2014-09-12 2017-07-19 BGI Genomics Co., Limited Method for constructing sequencing library based on blood sample and usage thereof in determining fetal genetic abnormality
CN105400864A (en) * 2014-09-12 2016-03-16 深圳华大基因股份有限公司 Method for constructing sequencing library based on blood samples, and uses of method in determination of fetal genetic abnormality
US10233490B2 (en) 2014-11-21 2019-03-19 Metabiotech Corporation Methods for assembling and reading nucleic acid sequences from mixed populations
US20190048413A1 (en) * 2016-02-23 2019-02-14 Novozymes A/S Improved next-generation sequencing
CN108699600A (en) * 2016-02-23 2018-10-23 诺维信公司 Improved next-generation sequencing
WO2017147294A1 (en) * 2016-02-23 2017-08-31 Novozymes A/S Improved next-generation sequencing
EP3626835A1 (en) 2018-09-18 2020-03-25 Sistemas Genómicos, S.L. Method for genotypically identifying both alleles of at least one locus of a subject's hla gene
WO2021048504A1 (en) 2019-09-12 2021-03-18 Bionobis Genotyping method suitable for processing a large number of samples, in particular in cases of high polymorphism
FR3100820A1 (en) 2019-09-12 2021-03-19 Bionobis Genotyping process suitable for processing a large number of samples, especially in cases of high polymorphism
FR3106596A1 (en) 2020-01-27 2021-07-30 Bionobis SIMPLE AND FAST HLA GENOTYPING PROCESS
WO2021152257A1 (en) 2020-01-27 2021-08-05 Bionobis Simple and rapid hla genotyping method
CN111235266B (en) * 2020-03-10 2023-12-01 广州医科大学附属第二医院 HLA subtype detection kit and its application
CN111235266A (en) * 2020-03-10 2020-06-05 广州医科大学附属第二医院 HLA subtype detection kit and its application
FR3110178A1 (en) 2020-05-18 2021-11-19 Bionobis Genotyping process suitable for the simultaneous treatment of a large number of patients
WO2021234269A1 (en) 2020-05-18 2021-11-25 Bionobis Genotyping method suitable for the simultaneous treatment of a large number of patients

Also Published As

Publication number Publication date
WO2012000445A1 (en) 2012-01-05
AU2011274090B2 (en) 2015-04-09
CA2803940C (en) 2019-07-02
EP2599877B1 (en) 2017-09-27
US9957564B2 (en) 2018-05-01
JP2013529472A (en) 2013-07-22
EP2599877A4 (en) 2014-01-01
AU2011274090A1 (en) 2013-02-07
US20130237432A1 (en) 2013-09-12
RU2013103795A (en) 2014-08-20
RU2587606C2 (en) 2016-06-20
KR20130038353A (en) 2013-04-17
MY173793A (en) 2020-02-24
CA2803940A1 (en) 2012-01-05
BR112012032586B1 (en) 2021-08-17
BR112012032586A2 (en) 2019-07-30
DK2599877T3 (en) 2017-11-20
KR101709826B1 (en) 2017-02-24
JP5968879B2 (en) 2016-08-10
SG186876A1 (en) 2013-02-28

Similar Documents

Publication Publication Date Title
EP2599877B1 (en) New pcr sequencing method and use thereof in hla genotyping
CN101921840B (en) DNA molecular label technology and DNA incomplete interrupt policy-based PCR sequencing method
AU2007313472B2 (en) Population scale HLA-typing and uses thereof
CN108460246A (en) A kind of HLA methods of genotyping based on three generations&#39;s microarray dataset
CN101921842B (en) HLA (Human Leukocyte Antigen)-A,B genotyping PCR (Polymerase Chain Reaction) primer and application method thereof
CN116179671A (en) A kind of amplification primer set, kit and method for HLA genotyping
CN111286548A (en) Kit for detecting 68 loci based on next-generation sequencing technology and primer combination used by kit
WO2011030159A1 (en) Method using hla epitope determination
CN103270170B (en) HLA-DQB1 Genotyping Method and Related Primers
KR102475292B1 (en) Composition for Amplifying HLA genes and Uses thereof
TWI542696B (en) HLA - C genotyping and its related primers
WO2017135396A1 (en) Probe set for hla genotyping by capture method without using pcr, and typing method in which same is used
KR102393484B1 (en) Molecular marker based on nuclear genome sequence for discriminating genotype of Peucedanum japonicum resources and uses thereof
Baek et al. The HLA‐B* 07: 457 allele identified in a volunteer donor for hematopoietic stem cell transplant.
Wu et al. HLA-A* 02: 01: 01: 28, a novel HLA allele identified by nextgeneration sequencing in a Chinese family.
HK1185115B (en) Method for hla-dqb1 genotyping and related primers thereof
HK1185114B (en) Method for hla-c genotyping and related primers thereof
HK1148788B (en) An illumina paired-end sequencing based pcr-barcoded amplicon fragments sequencing method
HK1148788A (en) An illumina paired-end sequencing based pcr-barcoded amplicon fragments sequencing method
HK1148787B (en) Pcr primers for hla-a,b genotyping and use thereof
HK1148787A1 (en) Pcr primers for hla-a,b genotyping and use thereof
HK1149949A1 (en) An illumina ga sequencing-based method for high-resolution hla genotyping
HK1149949B (en) An illumina ga sequencing-based method for high-resolution hla genotyping

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20121224

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20131202

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/11 20060101ALI20131122BHEP

Ipc: C12Q 1/68 20060101AFI20131122BHEP

17Q First examination report despatched

Effective date: 20150330

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BGI GENOMICS CO., LIMITED

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20170406

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: AT

Ref legal event code: REF

Ref document number: 932007

Country of ref document: AT

Kind code of ref document: T

Effective date: 20171015

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602011041975

Country of ref document: DE

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

Effective date: 20171114

REG Reference to a national code

Ref country code: NL

Ref legal event code: FP

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20171227

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: LT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

REG Reference to a national code

Ref country code: LT

Ref legal event code: MG4D

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK05

Ref document number: 932007

Country of ref document: AT

Kind code of ref document: T

Effective date: 20170927

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20171227

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20171228

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: ES

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20180127

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 8

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602011041975

Country of ref document: DE

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

26N No opposition filed

Effective date: 20180628

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: BE

Ref legal event code: MM

Effective date: 20180630

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20180630

REG Reference to a national code

Ref country code: IE

Ref legal event code: MM4A

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20180630

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20180630

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20180630

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20180630

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20180630

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20110630

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MK

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20170927

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20170927

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230722

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20250528

Year of fee payment: 15

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20250617

Year of fee payment: 15

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20250625

Year of fee payment: 15

Ref country code: DK

Payment date: 20250527

Year of fee payment: 15

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20250630

Year of fee payment: 15