FR3100820A1 - Genotyping process suitable for processing a large number of samples, especially in cases of high polymorphism - Google Patents

Abstract

The invention relates to a genotyping method for simultaneously processing a large number of DNA samples. More particularly, it relates to a genotyping method comprising a first step of amplification by indexed PCR then a second step of high throughput sequencing, this method being simple, rapid and inexpensive.

Description

Genotyping process suitable for processing a large number of samples, especially in the case of high polymorphism

The invention relates to a genotyping method for simultaneously processing a large number of DNA samples. More particularly, it relates to a genotyping method comprising a first step of amplification by indexed PCR in a microfluidic system then a second step of high-throughput sequencing, this method is simple, rapid and less expensive than the methods of the state of the art. technical.

High-throughput sequencing (also called NGS for Next Generation Sequencing) makes it possible to operate a very large number of short sequences in parallel. The principle of this technique is as follows: The sequences to be analyzed are first prepared by adding adapter sequences to the ends. They are then fixed on a solid support via these adapter sequences and each fragment is enriched to form clonal “clusters” which will be sequenced thereafter. At each cycle, the addition of a nucleotide results in a fluorescent signal associated with each of the four nucleotides of DNA. These signals are then analyzed by data processing software which restores the result of reading the sequences. This method is fast and accurate.

In order to allow high multiplexing and in this context ensure the stability of hybridized DNA duplexes when the half-denaturation temperature (Tm) is high, LNA™ (Locked Nucleic Acid) bases are added, in particular in the NGS method developed by Fluidigm. These bases are modified oligonucleotides that obey Watson-Crick base-pairing rules and form duplexes, which are significantly more stable than similar duplexes formed by unmodified oligonucleotides. Thus, the sensitivity of discrimination between alleles with only minor differences, or even a single different nucleotide, is possible. This technique is particularly suitable when the polymorphism is very high.

This NGS technology is widely used in research and in diagnosis. It makes it possible to sequence entire genomes. It thus constitutes a very powerful tool and represents an aid to the diagnosis of genetic and oncological diseases, for example.

In order to allow the reading of target sequences, as is the case for diagnosis, a sequence library is prepared before sequencing in order to enrich the library with sequences of interest. This sequence amplification is carried out by polymerase chain reaction (PCR).

As NGS sequencing makes it possible to read a large number of sequences simultaneously, it is interesting to mix samples from different patients. In order to identify the sequences originating from the same sample, these can be labeled during the amplification step by adding label or “index” sequences. The indexed PCR method is known to those skilled in the art and described for example in the article by Stahlberg A. et al. (Nucleic Acid Research, 2016, vol.44, No.11)

Document EP 2599877 describes a sequencing method comprising a first PCR step during which the sequences are marked using an index and then a second second generation sequencing step. During sequencing, an incomplete DNA shearing strategy is implemented to increase the sequence reading amplitude.

NGS sequencing, although very powerful in terms of sequencing capacity, has drawbacks. The main obstacle is the time it takes to perform genotyping, from preparing the sample to obtaining the result, which takes several days.

There is a need for an accurate and fast sequencing method at a reasonable cost.

The present invention relates to a method for genotyping from DNA samples comprising:

1. a DNA amplification step by an indexed polymerase chain reaction (PCR) under weak multiplexing conditions carried out in a microfluidic system,
   • in which the specific primers comprise in 3' a stabilizing sequence comprising between 8 and 12 nucleotides among which 45% to 65% are G or C;
2. a high-throughput NGS-type sequencing step in which the sequencing primers do not contain an LNA™ base but a sequence complementary to said stabilizing sequence.

To stabilize the duplexes during sequencing, the inventors introduced sequences of about ten nucleotides at the ends of the primers. This addition makes it possible to dispense with modified bases while maintaining high read reliability during sequencing.

The present invention also relates to a genotyping kit for the successive implementation of indexed PCR in a microfluidic system and high-throughput NGS-type sequencing, as well as a reaction mixture for NGS sequencing without using LNA™ bases. .

Advantages of the invention

The genotyping method according to the invention has several advantages: it is simple, rapid and inexpensive and makes it possible to process a large series of samples simultaneously.

It combines an indexed PCR carried out in a microfluidic system (saving time and material) with an NGS sequencing system (accuracy, speed).

This method is simple because it is 100% automated. It is offered as a ready-to-use kit. This format limits manipulation by the experimenter and therefore the risk of error. It also saves time by reducing the number of actions to be performed.

This method is fast since the result is obtained in less than 48 hours. Indeed, it takes 6h15 for the preparation of the bank, 32h for the sequencing and approximately 3h30 for the analysis, and this regardless of the number of patients diagnosed.

It is inexpensive and makes it possible to offer an efficient and very reliable genotyping solution, accessible to as many people as possible. It is intended to be deployed in all laboratories where genotyping is performed, for example in research centers, hospitals, blood banks and blood transfusion centers where it is part of a process of controlling public health and productivity costs.

It allows the processing of a large number of samples at the same time, which is profitable both in terms of time and cost. In the current version of the kit, it is possible to genotype 48 patients at the same time.

DETAILED DESCRIPTION OF THE INVENTION

A first object of the invention relates to a method of genotyping from DNA samples comprising:

1. a DNA amplification step by an indexed polymerase chain reaction (PCR) under low mutiplexing conditions and carried out in a microfluidic system,
   • in which the specific primers comprise in 3' a stabilizing sequence comprising from 8 to 12 nucleotides among which 45 to 65% are G or C;
2. a high-throughput NGS-type sequencing step in which the sequencing primers do not contain an LNA™ base but a sequence complementary to said stabilizing sequence.

By "stabilizing sequence" within the meaning of the invention, is meant a sequence of 8 to 12 nucleotides, namely 8, 9, 10, 11 or 12 nucleotides. In addition, these sequences are rich in G and C, that is to say they contain between 45% and 65% of G and/or C bases. Examples of stabilizing sequences that can be used according to the invention are the sequences SEQ ID No.1 and SEQ ID No.2. These examples are non-limiting because those skilled in the art will know how to combine the bases to modify the sequence of the stabilizing sequence.

In a preferred embodiment, the stabilizer sequences are 10 nucleotide sequences. In another preferred embodiment, the stabilizer sequences contain 50% to 60% G and/or C bases. For example, a 10 nucleotide sequence contains 5 to 6 G and/or C bases.

"Low multiplexing" conditions are understood to be conditions that allow a single target, or even 2, 3, or 4 targets to be amplified simultaneously in a single reaction mixture.

By "universal sequence" within the meaning of the invention is meant a defined sequence which will be used in all amplicons. The method actually implements two types of universal sequences, a sense sequence and an antisense sequence so as to be able to define the orientation of the amplified sequences. Examples of universal sequences which can be used according to the invention are the sequences SEQ ID No.3 and SEQ ID No.4. These examples are non-limiting because those skilled in the art will know how to use other sequences as universal sequences.

Step a. amplification of the sequences of interest is based on an indexed PCR technology allowing the simultaneous generation of amplicons and their labeling using a sample-specific label. In addition, it is implemented in a microfluidic system.

It can be summarized as follows:

1. Design of pairs of primers specific to the allelic sequences to be amplified and preparation of reaction mixtures that can combine several pairs of primers (simplexing or weak multiplexing)
2. Preparation of biological samples to be analyzed (normalization of the concentration)
3. Amplification reaction of sequences by PCR, preferably in a microfluidic system (to save time and material), and addition of sample-specific labels to each amplified sequence. This reaction uses two types of primers simultaneously:
   1. pairs of primers specific for the sequences to be amplified, these sense and antisense primers each comprising a universal sequence located at their 3' end, characterized in that the universal sequences contain at the 5' end (between the specific primer and the universal sequence) a stabilizing sequence of about ten nucleotides (generally between 8 and 12 nucleotides) consisting of 45% to 65% of G or C nucleotides;
   2. sense and antisense primer pairs comprising at least a first part capable of hybridizing with the universal sense and antisense sequences respectively and a second part comprising a sequence for an adapter necessary for sequencing, one of the sense or antisense primers further comprising an index positioned between these two parts.
4. Recovery, purification and quantification of indexed PCR products (amplicons) for their sequencing.

Such technology may for example be based on that developed by the company Fluidigm ("Integrated Fluidic Circuit" or IFC). Using such technology, in addition to saving time, makes it possible to work under standardized conditions.

In a preferred embodiment, the specific primers further comprise a universal sequence located 3' to said stabilizing sequence.

In an even more preferred embodiment, the amplification step further implements pairs of primers intended for the indexing and sequencing of the amplified sequences, said primers comprising:

1. at least a first part capable of hybridizing with the universal sequences amplified using the specific primers and
2. a second part comprising a sequence for an adapter necessary for sequencing,

one of the sense or antisense primers further comprising an index positioned between these two parts.

By "index" within the meaning of the invention is meant a sequence used as a label or barcode. In the context of NGS sequencing, indices are short polymorphic sequences. A unique particular index is associated with samples from the same patient and allows the labeling of sequences from this patient during the amplification step. Since samples from different patients are mixed during sequencing, these indices are used to know which patient to associate the sequences with after analysis. Examples of indexes that can be used according to the invention are the sequences SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7. These examples are non-limiting because those skilled in the art will be able to modify these indexes to provide a multitude of unique sequences.

By "adapter necessary for sequencing" within the meaning of the invention, is meant a sequence allowing the fixing of the sequences on a support with a view to their sequencing. Examples of attachment sequences necessary for the sequencing which can be used according to the invention are the sequences SEQ ID No.8 and SEQ ID No.9. These are the "P5" and "P7" adapters offered by Illumina® and suitable for NGS sequencing. These examples are non-limiting because those skilled in the art can use other adapter systems depending on the NGS technology used.

The amplification of DNA sequences in a microfluidic system makes it possible to carry out 48 PCRs per sample and to process 48 different samples simultaneously (i.e. a total of 2304 reaction chambers processed at one time), the PCR products each carrying a particular specific label of the sample. Thus, it is possible to pool and mix all the PCR products in order to perform a single sequencing reaction. The sequencing result then provides two pieces of information per sequence: the reading of the sequence of interest and the identification of the sample from which this sequence originated. Thus, it is possible to perform genotyping for 48 patients simultaneously.

The genotyping method according to the invention can be carried out either from DNA of human or animal origin.

Step b. sequencing is based on a high-throughput sequencing technology such as the NGS technology developed in particular by the company Illumina.

This type of technology implies a determined Tm (imposed by the technology used, in other words set by the supplier). This Tm turns out to be too high if one wishes to sequence amplicons obtained via indexed PCR in a microfluidic system. Indeed, these primers configured to operate in a microfluidic system, and whose complementary sequences are then used during the amplification step, generally have a lower Tm (in particular because they are short), which generates problems of 'instability. In such a case, it is classically recommended to integrate LNA™ bases into the sequences during amplification so that the duplexes formed with the sequencing and index reading primers during sequencing are stable. However, the addition of these LNA™ bases is expensive and constitutes additional steps in the method.

Very interestingly, the inventors have demonstrated that sequences of about ten nucleotides, called "stabilizing sequences" make it possible to maintain a sufficient degree of hybridization for NGS sequencing to proceed correctly even when the half-hybridization temperature ( Tm) is high. Thus, they showed that the stabilizing effect of LNA™ bases can be replaced by the addition of a stabilizing sequence and that this sequence is sufficient for the sequencing result to be as reliable as when LNA™ bases are used. Doing away with the use of LNA™ bases makes the method simpler and less expensive. Thus, the present invention proposes for the first time to combine indexed PCR in a microfluidic system with NGS sequencing in a method that is simple and quick to implement, and whose cost is controlled. The simplicity and speed are all the more remarkable as a ready-to-use kit for the implementation of this method is offered.

Step b. of the method according to the invention is carried out using sequencing and index reading primers, none of which contains LNA™ bases but each of which contains a stabilizing sequence, namely:

• a pair of sequencing primers hybridizing to the universal sequences and including a stabilizing sequence positioned at the 5' end; these primers are used to amplify the sequences of interest for sequencing;
• an index read primer hybridizing to the universal sequence juxtaposing the index and comprising a stabilizing sequence; this primer allows the amplification of the index to identify the patient from whom the analyzed sequence originates.

It should be noted that the stabilizing sequences of the sequencing primers and of the index reading primer are complementary to the stabilizing sequences present on the sequences amplified for the purpose of sequencing. In other words, these stabilizing sequences have the same sequences as those present in the specific primers.

In a particular embodiment where the index is positioned 3′ of the sequence to be analyzed, the index reading primer is complementary to the universal antisense sequence and the stabilizing sequence is positioned at its 3′ end. In other words, the antisense primer is used as a forward primer upstream of the index.

Examples of sequences of sequencing primers which can be used according to the invention are the sequences SEQ ID No.10 and SEQ ID No.11. These examples are non-limiting because those skilled in the art can propose other sequencing primers depending on the universal sequences surrounding the sequences to be amplified.

A specificity of the present method lies in the high number of amplified targets which thus provides a great diversity of amplified sequences. Therefore, it is not necessary to use a base diversity control during sequencing.

A second object of the invention relates to a genotyping kit for the successive implementation of indexed PCR in a microfluidic system and high-throughput NGS-type sequencing without using an LNA™ base comprising:

• a PCR plate comprising primers intended for pre-aliquoted indexing mixed with the Master mix.
• a PCR plate comprising specific primers (diluted in a buffer suitable for use in microfluidics)
• pairs of primers specific to the sequences to be amplified, these primers comprising in 3′ a stabilizing sequence comprising from 8 to 12 nucleotides among which 45% to 65% are G or C, the said stabilizing sequence being preceded by a universal sequence ;
• pairs of primers allowing the indexing of the amplified sequences, these primers comprising at least a first part capable of hybridizing with said universal sequences amplified thanks to the specific primers and at least a second part comprising a sequence for an adapter necessary for sequencing , one of the forward or reverse primers further comprising an index positioned between these two parts;
• a reaction mixture for NGS sequencing without an LNA™ base comprising a pair of sequencing primers hybridizing to the universal sequences and a primer for reading the index, each of these primers comprising a sequence hybridizing with a stabilizer sequence.

In another preferred embodiment, this kit further includes at least one of the following:

• a buffer solution, preferably presented in tubes
• reaction mixtures for NGS sequencing without LNA™ base, preferably presented in tubes,
• a user manual

“Master Mix” means a mixture comprising Taq polymerase, a buffered solution containing MgCl ₂ , dNTPs (mixture of four deoxyribonucleotides: dATP (deoxy-adenine tri-phosphate), dCTP (deoxy-cytosine tri-phosphate ), dGTP (deoxy-guanine tri-phosphate), dTTP (deoxy-thymine tri-phosphate), a DMSO solution and a buffer that reduces the adhesion of molecules to the plastic.

Most preferably, the PCR plates are arranged on the same support, said support being a microfluidic plate comprising wells and nano-chambers for reaction. It is possible to use an IFC (Integrated Fluidic Circuit) support plate from Fluidigm.

Thus, in a particular embodiment, the invention relates to a kit as defined above in which the PCR plates in which the primers are deposited are placed on a microfluidic plate for the implementation of indexed PCR, said microfluidic plate comprising two 48-well zones for depositing specific primers on the one hand and primers allowing indexing and reaction micro-chambers on the other.

A third object of the invention relates to a reaction mixture for NGS sequencing without using an LNA™ base comprising the following primers:

• a forward sequencing primer hybridizing to the universal sequence located 5' from the sequence to be analyzed and comprising a stabilizing sequence at its 5' end;
• an antisense sequencing primer hybridizing to the universal sequence located 3' of the sequence to be analyzed and comprising a stabilizing sequence at its 5' end;
• an index reading primer hybridizing to the universal sequence juxtaposing the index and comprising a stabilizing sequence positioned at one of its ends.

In a particular embodiment, the index reading primer is a forward primer hybridizing to the universal sequence located 3′ of the sequence to be analyzed and comprising a stabilizing sequence positioned at its 3′ end.

In this mixture, the two sequencing primers capable of hybridizing to the universal sequences located on either side of the sequence to be analyzed allow the amplification of the latter while the sense primer hybridizing downstream of the sequence to be analyzed allows the amplification of the index to identify the patient from whom the analyzed sequence originates.

In a particular embodiment, the reaction mix for NGS sequencing without the use of LNA™ base comprises:

• a forward sequencing primer of sequence SEQ ID No.10;
• an antisense sequencing primer of sequence SEQ ID No.11; And
• a sequence index reading primer SEQ ID No. 12.

The method according to the invention, as well as the associated kit are particularly suitable for genotyping to process a large number of sequences (between 48 and 96) in a single reaction, in particular in the event of high polymorphism. However, the amplicons must not be too long (preferably <500 bp) and the multiplexing must be moderate (between 2 and 3 targets per PCR reaction). It thus makes it possible to answer complex organizational questions in laboratories by simultaneously treating a large number of patients.

The different preferred embodiments described above can be combined with each other, two by two or more extensively, until a preferred embodiment combining all the preferred modes is constituted.

The present invention will be better understood on reading the examples which follow, provided by way of illustration and should in no way be considered as limiting the scope of the present invention.

BRIEF DESCRIPTION OF FIGURES

Figure 1: Schematic representation of the primers used according to a particular embodiment of the present invention. (A) Specific primers, (B) Universal and stabilizer sequences, (C) P5-P7 and Index adapters, (D) Sense sequencing primer, (E) Anti-sense sequencing primer, (E) Index read primer .

Figure 2: Representation of an amplified sequence as a description of a particular embodiment.

EXAMPLE

EXAMPLE 1: Principle of the baseless NGS genotyping method LNA ™

1. Amplification of the sequences of interest by indexed PCR

From known allelic variants or mutations in a defined biological system, sequences of interest are identified for genotyping.

Pairs of primers specific to the allelic or mutant sequences to be amplified are designed and validated. These primers will allow the amplification of the sequences of interest. Since the amplification reactions are carried out by multiplexing, reaction mixtures combining several pairs of primers are prepared.

The biological samples to be analyzed are prepared for PCR, the DNA is extracted and purified. This preparation step is well known to those skilled in the art and results in samples having standardized DNA concentrations.

The actual amplification reaction is carried out in an IFC-type microfluidic plate from Fluidigm. The reaction mixtures containing the specific primers are deposited in a first zone of 48 wells and the primers intended for indexing as well as the Master Mix are deposited in a second zone of 48 wells.

The amplification reaction takes place under standard conditions, in a Juno-type automaton from Fuidigm, for example.

Once amplified, the sequences are recovered, purified and quantified to be sequenced.

2. NGS sequencing

The sequencing is carried out in an NGS sequencer from Illumina.

Sequencing is performed using the sequencing primer pair to amplify the sequences to be analyzed and the index read primer to identify the patient to whom the sequence relates.

Table 1: Summary of described sequences

Description of the sequence SEQ ID N ^oh . Sequence 5'-3' Stabilizer Sequence 1 1 GCAGACTCAG Stabilizer Sequence 2 2 TGTTGACTCC Universal Sequence 1 3 ACACTCACGACATGGTTCTACA Universal Sequence 2 4 TACCGTAGCAGAGACTTGGTCT Index 1 5 CGCGACTTGT Index 2 6 GGTTGGAGTT Index 3 7 GAGCACGGAA P5 Sequencing Adapter (Illumina®) 8 AATGATACGGCGACCACCGAGATCT P7 Sequencing Adapter (Illumina®) 9 CAAGCAGAAGACGGCATACGAGAT Sense sequencing primer 10 ACACTCACGACATGGTTTCTACAGCAGACTCAG Antisense sequencing primer 11 TACCGTAGCAGAGACTTGGTCTTGTTGACTCC Index read primer 12 GGAGTCAACAAGACCAAGTCTCTGCTACGGTA

Claims (10)

Genotyping method from DNA samples including:
To . a DNA amplification step by an indexed chain polymerization reaction under weak multiplexing conditions carried out in a microfluidic system,

• in which the specific primer pairs comprise in 3′ a stabilizing sequence comprising from 8 to 12 nucleotides among which 45% to 65% are G or C;

b. a high-throughput NGS-type sequencing step in which the sequencing primers do not contain an LNA™ base but a sequence complementary to said stabilizing sequence. A method according to claim 1 wherein said stabilizing sequence comprises 10 nucleotides of which 5 to 6 nucleotides are Gs or Cs. Method according to Claim 2, in which the said stabilizing sequence is chosen from the sequences SEQ ID NO. 1 and SEQ ID NO.2 Method according to one of claims 1 to 3 wherein said specific primers further comprise a universal sequence located 3' to said stabilizing sequence. A method according to claim 4 wherein said DNA amplifying step further implements primer pairs for indexing and sequencing the amplified sequences comprising:

• at least a first part capable of hybridizing with the universal sequences amplified using the specific primers and
• at least a second part comprising a sequence for an adapter necessary for sequencing,

one of the sense or antisense primers further comprising an index positioned between these two parts. A method according to any preceding claim wherein the sequencing step is performed using the following primers:

• a pair of sequencing primers hybridizing to the universal sequences and comprising a stabilizing sequence positioned at the 5'end;
• an index reading primer hybridizing to the universal sequence juxtaposing the index and comprising a stabilizing sequence.

Genotyping kit for successive implementation of indexed PCR and NGS-like high-throughput sequencing without using LNA™ base including:

• a PCR plate comprising primers intended for pre-aliquoted indexing mixed with the master mix;
• a PCR plate comprising specific primers;
  • pairs of primers specific to the sequences to be amplified, these primers comprising in 3′ a stabilizing sequence comprising from 8 to 12 nucleotides among which at least 45% to 65% are G or C, preceded by a universal sequence;
  • pairs of primers allowing the indexing and the sequencing of the amplified sequences, these primers comprising at least a first part capable of hybridizing to the universal sequences and at least a second part comprising a sequence for an adapter necessary for the sequencing, the one of the sense or antisense primers further comprising an index positioned between these two parts;
• a reaction mixture for NGS sequencing without an LNA™ base comprising a pair of sequencing primers hybridizing to the universal sequences and a primer for reading the index, each of these primers comprising a stabilizing sequence.

Kit according to Claim 7, in which the said plates in which the primers are deposited are arranged on a microfluidic plate for the implementation of indexed PCR, the said microfluidic plate comprising two zones of 48 wells for depositing, on the one hand, the specific primers and on the other hand primers allowing indexing and reaction micro-chambers. Reaction mix for NGS sequencing without using LNA™ base including the following primers:

• a forward sequencing primer hybridizing to the universal sequence located 5' from the sequence to be analyzed and comprising a stabilizing sequence at its 5'end;
• an antisense sequencing primer hybridizing to the universal sequence located 3' to the sequence to be analyzed and comprising a stabilizing sequence at its 5'end;
• an index reading primer hybridizing to the universal sequence juxtaposing the index and comprising a stabilizing sequence positioned at one of its 3' ends.

A mixture according to claim 9 wherein:

• said forward sequencing primer is of sequence SEQ ID No.10;
• said antisense sequencing primer is of sequence SEQ ID No.11; And
• said index read primer is of sequence SEQ ID No.12.