EP2488548A1 - A low density lipoprotein-related protein 1 splice variant as cancer marker - Google Patents

A low density lipoprotein-related protein 1 splice variant as cancer marker

Info

Publication number
EP2488548A1
EP2488548A1 EP10766044A EP10766044A EP2488548A1 EP 2488548 A1 EP2488548 A1 EP 2488548A1 EP 10766044 A EP10766044 A EP 10766044A EP 10766044 A EP10766044 A EP 10766044A EP 2488548 A1 EP2488548 A1 EP 2488548A1
Authority
EP
European Patent Office
Prior art keywords
seq
polypeptide
sequence
cancer
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP10766044A
Other languages
German (de)
French (fr)
Inventor
Wilhelm Gerdes
Monika Birkenmeier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biomac Privatinstitut fur Medizinische und Zahnmedizinische Forschung Entwicklung und Diagnostik GmbH
Fraunhofer Gesellschaft zur Forderung der Angewandten Forschung eV
Original Assignee
Biomac Privatinstitut fur Medizinische und Zahnmedizinische Forschung Entwicklung und Diagnostik GmbH
Fraunhofer Gesellschaft zur Forderung der Angewandten Forschung eV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biomac Privatinstitut fur Medizinische und Zahnmedizinische Forschung Entwicklung und Diagnostik GmbH, Fraunhofer Gesellschaft zur Forderung der Angewandten Forschung eV filed Critical Biomac Privatinstitut fur Medizinische und Zahnmedizinische Forschung Entwicklung und Diagnostik GmbH
Priority to EP10766044A priority Critical patent/EP2488548A1/en
Publication of EP2488548A1 publication Critical patent/EP2488548A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/92—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving lipids, e.g. cholesterol, lipoproteins, or their receptors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1), a protein encoded by said nucleic acid molecule and fragments of said nucleic acid and said protein.
  • LRP1 low density lipoprotein-related protein 1
  • the present invention also relates to vectors, host cells, recombinant methods for producing said protein, antibodies, antibody-producing cells, affinity ligands and antagonists of said nucleic acid and protein and the use of the LRP1 splice variant as a cancer marker.
  • the invention further relates to corresponding diagnostic and pharmaceutical compositions, kits, medical uses and methods, as well as vaccines and methods of inducing immune responses.
  • Cancer is a class of diseases in which a group of cells displays uncontrolled growth, invasion and sometimes metastasis. These three malignant properties of cancers differentiate them from benign tumors, which are self-limited, do not invade or metastasize.
  • cells deriving from diverse organs like liver, brain, prostate or kidney are modified by endogenous processes or by exogenous factors in a way that they are able to abscond from the control of cell growth.
  • Eventually these cells may be disengaged from their original tissue and resettle in another organ after being spread via the blood flow or the lymphatic system and penetrate other organs, forming metastases. Cancerous cells can grow endlessly in the original organ as well as in the secondary sites and form malignant tumors, which can ultimately lead to the death of the affected person.
  • Cancer may affect people at all ages, but the risk for most varieties increases with age. Cancer causes about 13% of all deaths. According to the American Cancer Society, 7.6 million people died from cancer in the world during 2007. Among men, the three most commonly diagnosed cancers are prostate, lung and colorectal cancer in developed countries. Nearly all cancers are caused by abnormalities in the genetic material of the transformed cells. Genetic abnormalities found in cancer typically affect two general classes of genes, oncogenes and tumor suppressor genes. Cancer-promoting oncogenes are typically activated in cancer cells, giving those cells new properties, such as hyperactive growth and division, protection against programmed cell death, loss of respect for normal tissue boundaries, and the ability to become established in diverse tissue environments. Tumor suppressor genes, on the other hand, are inactivated in cancer cells, resulting in the loss of normal functions in those cells, such as accurate DNA replication, control over the cell cycle, orientation and adhesion within tissues, and interaction with protective cells of the immune system.
  • LDL low-density lipoprotein
  • LDL receptor There are seven known members of the LDL receptor superfamily which are structurally closely related: the LDL receptor, LRP1, LRPl-b, LRP2, LRP4, LRP5, LRP6, very low density lipoprotein receptor (VLDL), and LRP8/apo lipoprotein E receptor 2.
  • the LDL receptor seems to be the only member of the family with a role limited to the uptake of lipoproteins.
  • VLDL and LRP8 have been demonstrated to activate a kinase-dependent intracellular signaling cascade after binding to the neuronal signaling molecule Reelin.
  • the Reelin signaling pathway controls neuronal positioning in human and mouse brain during development as well as modulation of long-term potentiation (LTP) and behavior in the adult (Beffert et al, 2006, J. Neuroscience, 26 (7): 2041-2052).
  • LRP4 which is also known as multiple EGF-like domain (MEGF7), is expressed, inter alia, in migratory primordial germ cells in the hindgut and the dorsal mesentery of E9,5 embryos, in germ cells in the genital ridges of male and female embryos, as well as in spermatogonia of the neontal and adult testes and the immature oocytes and follicular cells of the adult ovary (May et al, 2007, Annals of Medicine, 39: 219-228).
  • MEGF7 multiple EGF-like domain
  • Homozygous LRP4-deficient mice show growth retardation and polysyndactyly, i.e. a fusion and duplication of digits at the fore and hind limbs. Digit formation results from complex and coordinated interactions between several signaling molecules (Capdevila et al, 2001, Annu Rev Cell Dev Biol, 17: 87-132). These include fibroblast growth factors (FGF), bone morphogenetic proteins (BMP), Wnt and sonic hedgehog (Shh).
  • FGF fibroblast growth factors
  • BMP bone morphogenetic proteins
  • Wnt sonic hedgehog
  • Loss of LRP4 results in abnormal expression of several of these signaling proteins, namely FGF8, Shh, BMP2, BMP4 and Wnt7a, as well as an abnormal expression of the Wnt- and BMP -responsive transcription factors Lmxlb and Msxl (Johnson et al, 2005, Hum Mol Genet, 14: 3523-3538). These findings suggest a role for LRP4 as a modulator of the signaling pathways that control limb development in the embryo.
  • LRP5/6 are membrane receptors acting as co-receptors of the wnt (wint)/beta-catenin signaling pathway. Ligation of the frizzled receptor by secreted wnt proteins induces the inhibition of the intracellular GSK-3 beta (glycogen synthase kinase-3 beta), an enzyme, which normally phosphorylates the ⁇ -catenin, which signals its degradation by the proteasomes (Bryja et al, 2009, Mol Biol Cell, 20(3):924-936). Non-phosphorylated beta-catenin enters the nucleus and modulates transcription of many target proteins involved in tumor growth. The wnt/beta-catenin pathway is activated in many tumors (Ying et al, 2009, Epigenetics, 4(5): 307-312).
  • LRP2 which is also known as Megalin, is a multifunctional receptor with a size of approximately 600 kDa. It is the antigenic determinant for Heymann nephritis in rats and is important for the reabsorption of various molecules in the proximal renal tubule. LRP2 has further been shown to be of importance in neurological development signal transduction cascades, e.g. in the patterning of the ventral telencepahlon (Spoelgen et al, 2005, Development, 132: 405-414).
  • LRP2 is an endocytic receptor that binds and internalizes a variety of ligands including protease- protease inhibitor complexes, vitamin- vitamin binding protein complexes, other hormones and lipoproteins. It is expressed at the apical surface of epithelial borders and is also found intracelluarly in endosomes (Christensen et al, 1995, J Cell Biol, 66: 349- 364). The endocytic uptake mediated by LRP2 is part of a superordinate regulatory process of systemic vitamin homeostasis and controls the availability of hormones and related first messengers in certain organ systems (March et al, 2005, Cell Mol Life Sci, 62: 2325-2338).
  • LRP2 binds and internalizes the signaling factor BMP4, which is subsequently degraded in the lysosome. Loss of LRP2 leads to the accumulation of BMP4, which is a negative regulator of the extracellular signaling molecule sonic hedgehog (Shh). Shh activity is accordingly reduced in the developing forebrain in LRP2-deficient animals.
  • the endocytic processes mediated by LRP2 can serve to limit the availability of a signaling factor in a tissue, where it has crucial functions in regulating development. LRP2 is hence a lipoprotein receptor at the intersection of endocytosis and signaling (May et al, 2007, Annals of Medicine, 39: 219-228).
  • LRPl which is also known as CD91 or alpha2-macroglobulin receptor is a ubiquitously expressed type 1 transmembrane receptor.
  • the active receptor protein is derived from a 600 kDa precursor processed by furin and consists of an 85 kDa membrane bound carboxyl fragment with intracellular and transmembrane domains and a noncovalently attached 515 kDa amino -terminal fragment with an extracellular domain.
  • LRPl is a multifunctional protein and has so far been implicated in two major physiological processes, endocytosis and regulation of signaling pathways.
  • LRPl Through its extracellular domain LRPl interacts with and mediates endocytosis of more than 40 different ligands ranging from lipoproteins, extracellular matrix proteins, protease/protease inhibitor complexes, and viruses to cytokines and growth factors (March et al, 2003, Traffic, 4: 291-301). Due to the wide range of ligand recognized by LRP the protein is assumed to play a pivotal role in diverse biological processes including lipid metabolism, cell growth, migration and tissue invasion. Additional signaling functions of LRPl have been described in the vessel wall, in neurons and in the lung. Furthermore, LRPl has been shown to have a major pathophysiological role in the central nervous system.
  • LRPl is a regulator of inflammatory responses in the lung, where it binds to the signaling inhibitory regulating protein alpha (SIRPalpha).
  • LRPl Like a variety of receptors and plasma membrane proteins, LRPl has been found to shed its extracellular domain and a soluble form of LRP can be detected in human plasma.
  • the shed LRPl contains the alpha-chain (515 kDa) and a 55 kDa fragment of the 85 kDa beta-chain, revealing that proteolysis occurs in a membrane-proximal region.
  • the physiological role of the shed ectodomains is assumed to include a competitive inhibition of ligand uptake by cell- surface-bound LRPl (Grimsley et al, 1999, Thromb Res, 94: 153-164).
  • the involvement of LRPl in signaling pathways involves, inter alia, the cleavage of LRPl within the plane of the membrane segment.
  • LRP-ICD The released intracellular domain subsequently translocates to a new location within the cell, where it may elicit its physiological response (May et al., 2002, J Biol Chem 277, 18736-18743).
  • the cleavage is mediated by a presenilin-containing gamma-secretase complex.
  • LRP-ICD appears to translocate to the nucleus where it colocalizes with the histone actetyltransferase Tip60, a transcription modulator having a role in the cleavage of APP to transcriptional activation.
  • MMP2 metalloproteinase 2
  • MMP9 metalloproteinase 2
  • a knockdown of full length LRPl expression greatly decreased U87 cell migration and invasion, which was rescued by the forced expression of a functional LRPl minireceptor.
  • Inhibition of ligand binding to full length LRPl by a specific antagonist, receptor-associated protein also led to reduced cancer cell migration and invasion. It was found that the expression of functional MMP2 and MMP9 was selectively decreased in full length LRPl knockdown cells.
  • a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1) or derivatives thereof, comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a polynucleotide having the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (b) a polynucleotide fragment of SEQ ID NO: 1 , SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (c) a polynucleotide encoding a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10; (d) a polynucleotide encoding the polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10; (e) a polynucleo
  • a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1) and, thus, representing an alternative and significantly size-reduced LRP1 splice product, in particular a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is detectable in a significant number of different cancer cells and cancer cell lines, but is absent in normal human tissues.
  • the alternative LRP1 splice product in particular a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 may be used as very effective biomarker for cancer prediction and as a decision tool for surveillance regimes, as well as for the prognosis and monitoring of cancer progression.
  • the new diagnostic tool of the present invention allows an advantageous approach towards cancer diagnosis, which was hitherto barely feasible.
  • the nucleic acid as mentioned above comprises a nucleotide sequence which is fused at the 3 ' end or at the 5 ' end to the nucleotide sequence encoding wild-type LRP1 as set forth in SEQ ID NO: 3 or to fragments thereof, with the proviso that the nucleic acid sequence is not the sequence as set forth in SEQ ID NO: 4 or a sequence encoding the amino acid sequence of SEQ ID NO: 5.
  • the nucleic acid as mentioned above comprises a nucleotide sequence which is fused at the 3 ' end or at the 5' end to a heterologous nucleotide sequence.
  • the present invention relates to a vector comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4.
  • the present invention relates to a method of making a recombinant host cell, comprising introducing the nucleic acid molecule as mentioned above, or the vector as mentioned above into a host cell.
  • the present invention relates to a recombinant host cell containing said nucleic acid molecule or said vector as mentioned above or produced according to the method as mentioned above.
  • said host cell expresses a polypeptide encoded by the nucleic acid molecule as mentioned above.
  • the present invention relates to a method of making a polypeptide encoded by the nucleic acid as mentioned above comprising the steps of (a) culturing the recombinant host cell as mentioned above under conditions such that said polypeptide is expressed; and (b) recovering said polypeptide.
  • the present invention relates to a polypeptide encoded by the nucleic acid molecule as mentioned herein above, or obtainable by the method of making a polypeptide mentioned above, with the proviso that the polypeptide has not the amino acid sequence of SEQ ID NO: 5.
  • the present invention relates to a polypeptide encoded by an alternative exon of LRP1 or derivatives thereof, comprising a polypeptide selected from the group consisting of: (a) a polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10; (b) a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10; (c) a polypeptide domain of SEQ ID NO: 2 or SEQ ID NO: 10; (d) a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10; (e) a polypeptide variant of SEQ ID NO: 2 or SEQ ID NO: 10; (f) an allelic variant of SEQ ID NO: 2 or SEQ ID NO: 10; (g) a species homologue of SEQ ID NO: 2 or SEQ ID NO: 10; and (h) a polypeptide which is at least 70%, 80%, 90% or 95% identical to a polypeptide as defined in any one of (a) to (g).
  • the polypeptide as mentioned above comprises an amino acid sequence which is fused at the N-terminus or at the C-terminus to the wild-type LRP1 protein as set forth in SEQ ID NO: 6 or to fragments thereof, with the proviso that the amino acid sequence has not the sequence of SEQ ID NO: 5.
  • the present invention relates to an antibody or fragment thereof, that specifically binds to the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5.
  • said antibody specifically binds to a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 or a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10.
  • said antibody or fragment thereof is a polyclonal antibody, a monoclonal antibody, a human antibody, a chimeric antibody, a humanized antibody, a whole immunoglobulin molecule, an scFv, a Fab fragment, a Fab' fragment, an F(ab')2, an Fv, a disulfide linked Fv, a diabody or a sc(Fv)2.
  • said antibody or fragment thereof is conjugated to a therapeutic or cytotoxic agent, is labeled or biotinylated.
  • said labeled antibody or fragment thereof is labeled with a radioactive label, an enzymatic label, a fluorescent label, a chemiluminescent label, or a bio luminescent label.
  • the present invention relates to a cell that produces the antibody or fragment thereof as mentioned herein above.
  • the present invention relates to a nucleic acid molecule encoding the antibody or fragment thereof as mentioned herein above.
  • the present invention relates to an antibody which has the antigen- specific binding characteristics of the R4B6G5 antibody produced by the hybridoma having DSMZ accession No. DSM ACC3000.
  • the present invention relates to an antibody produced by the hybridoma having DSMZ accession No. DSM ACC3000.
  • an affinity ligand for an expression product which comprises a nucleotide sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, preferably an oligonucleotide specific for the expression product, a probe specific for the expression product, an aptamer specific for the expression product or the polypeptide, a small molecule or peptidomimetic capable of specifically binding to the polypeptide or a non- coding RNA molecule specific for the expression product.
  • said non-coding RNA molecule is a miRNA or a siRNA molecule.
  • the present invention relates to an antagonist of an expression product which comprises a nucleotide sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, wherein said antagonist comprises an antisense molecule against the nucleic acid molecule as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, an aptamer specific for the expression product or a non-coding RNA molecule specific for the expression product, preferably a catalytic RNA molecule, a miRNA molecule or a siRNA molecule.
  • the present invention relates to an antagonist of the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, wherein said antagonist comprises a compound directly modulating the activity of said polypeptide, a dominant negative variant of said polypeptide, a molecule closely related to the natural ligand of said polypeptide, a polypeptide related to the LRP1 protein as set forth in SEQ ID NO: 6, an antibody as defined herein above, or a small molecule or peptidomimetic capable of specifically binding to the polypeptide.
  • the present invention relates to a nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or the polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5 for use as a marker for cancer.
  • the present invention relates to the use of the nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4 or the polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5 as a marker for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer.
  • the present invention relates to a diagnostic composition
  • a diagnostic composition comprising an affinity ligand for an expression product which comprises a nucleotide sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5.
  • the present invention relates to a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer, comprising an affinity ligand for an expression product which comprises a sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5.
  • the present invention relates to a diagnostic kit for detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer, comprising an affinity ligand for an expression product which comprises a nucleic acid molecule as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5.
  • said diagnostic composition or said diagnostic kit comprises an affinity ligand, which is a set of oligonucleotides specific for the expression product, a probe specific for the expression product, an aptamer specific for the expression product or the polypeptide or an antibody as mentioned herein above.
  • said use as a marker for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer as mentioned herein above is a use, wherein the diagnosing, detecting, monitoring or prognosticating is to be carried out on a sample obtained from an individual.
  • the present invention relates to a method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of determining the level of an expression product comprising a nucleic acid molecule as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or of a polypeptide as defined herein above or comprising the amino acid sequence of SEQ ID NO: 5.
  • the method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer as mentioned above comprises a determining step, which is accomplished by the measurement of the nucleic acid level of an expression product comprising a nucleic acid molecule as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, or of the protein level or biological activity of a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5.
  • the present invention relates to a method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptide.
  • the method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptide additionally comprises the measurement of the nucleic acid level of said truncated LRP 1 expression product and/or the measurement of the protein level or biological activity of said truncated LRP 1 polypeptide.
  • said truncated LRP 1 expression product comprises a nucleic acid molecule as herein above or comprises the nucleotide sequence of SEQ ID NO: 4 and/or said truncated LRP 1 polypeptide comprises a polypeptide as defined herein above or comprises the amino acid sequence of SEQ ID NO: 5.
  • the above mentioned methods are to be performed with a sample obtained from an individual.
  • the sample as mentioned above is a tissue sample, an urine sample, an urine sediment sample, a blood sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells.
  • the present invention relates to a method of identifying antagonists of the polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5, comprising the steps of: (a) producing cells which express said polypeptide either as secreted protein or on the cell membrane; (b) contacting the polypeptide produced in step (a) with a test sample comprising a potential antagonist; and (c) identifying an antagonist by observing binding and/or inhibition of activity of said polypeptide.
  • the present invention relates to a method of identifying antagonists of an expression product comprising a sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, comprising the steps of: (a) contacting a test sample comprising a potential antagonist with one or more cells expressing said sequence; (b) detecting the expression level(s) of said sequence; and (c) identifying an antagonist by observing reduction of the expression level of said sequence as compared to that detected in the absence of the potential antagonist.
  • the present invention relates to an antagonist obtainable by the method of identifying antagonists of the polypeptide or the expression product as mentioned herein above.
  • the present invention relates to a method of identifying a binding partner to the polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5 comprising: (a) contacting said polypeptide with a potential binding partner; and (b) determining whether a binding interaction between both molecules takes place.
  • the present invention relates to a binding partner to the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5 obtainable by the method of identifying binding partners as mentioned above.
  • the present invention relates to a method of making cytotoxic T lymphocytes (CTLs) specific for the polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5.
  • CTLs cytotoxic T lymphocytes
  • the present invention relates to a CTL specific for an antigen derived from a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5, or obtainable by the method of making cytotoxic T lymphocytes as mentioned herein above.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the antibody as mentioned above, the antagonist as mentioned above, the binding partner as mentioned above or the CTL as mentioned above.
  • nucleic acid molecule comprising an alternative exon of LRP1 and, thus, representing an alternative LRP1 splice product, is detectable in a significant number of different tumor cells and tumor cell lines, but is absent in normal human tissues, a nucleic acid molecule itself, a vector comprising the nucleic acid molecule, a host cell expressing said nucleic acid, a corresponding polypeptide, a specifically binding antibody, an antagonist against said nucleic acid and/or polypeptide or a binding partner of said polypeptide or a CTL according to the present invention may advantageously be used as medicaments.
  • short splice variant LRP 1 in particular variants thereof, and/or LRP1 modification agents may be used as a medicament, e.g. as a medicament counteracting the observed expression or up-regulation as well as subsequent or secondary consequences thereof, i.e. disease states.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the antibody as mentioned above, the antagonist as mentioned above, the binding partner as mentioned above or the CTL as mentioned above for the treatment or prevention of cancer.
  • the present invention relates to a medical kit for the treatment or prevention of cancer, comprising at least one element selected from the group consisting of: the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the antibody as mentioned above, the antagonist as mentioned above, the binding partner as mentioned above and the CTL as mentioned above.
  • the present invention relates to a vaccine comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the CTL as mentioned above or an anti-idiotypic antibody against the antibody as mentioned above.
  • the present invention relates to a vaccine comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the CTL as mentioned above or an anti-idiotypic antibody against the antibody as mentioned above for the treatment or prevention of cancer.
  • the present invention relates to a method of inducing an immune response against cancer in an individual comprising administering to said subject a therapeutically effective amount of the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the CTL as mentioned above or an anti- idiotypic antibody against the antibody as mentioned above.
  • the present invention relates to a method of treatment or prevention of cancer comprising administering to an individual a therapeutically effective amount of the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the antibody as mentioned above, the antagonist as mentioned above, the binding partner as mentioned above, the CTL as mentioned above or the vaccine as mentioned above.
  • said cancer as mentioned above is breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma.
  • said brain tumor is selected from the group of astrocytoma and glioma.
  • Fig. 1 depicts the results of an RT-PCR reaction of marker transcripts in several tumor- derived cell lines and normal human tissues/organs.
  • the control transcript has been obtained by RT-PCR from a full length LRPl transcript.
  • As positive and loading control the transcript of beta-actin was used.
  • the results show that the LRPl tumor marker according to the present invention is absent or below the detection limit in different non-cancerous organs investigated. This is in contrast to the unspliced parental transcript, which appears to be ubiquitary expressed.
  • Fig. 2 depicts the results of an RT-PCR reaction of marker transcripts in normal human tissues/organs corresponding to the tumor-derived cell lines shown in Fig. 1.
  • the control transcript has been obtained by RT-PCR from a full length LRPl transcript.
  • As positive and loading control the transcript of beta-actin was used.
  • the results show that the LRPl tumor marker according to the present invention is absent or below the detection limit in different non-cancerous organs investigated. This is in contrast to the unspliced full-length transcript, which appears to be ubiquitary expressed.
  • Fig. 3 shows the immunogenicity of a peptide derived from the marker sequence.
  • a peptide having the sequence of SEQ ID NO: 10 was used for immunization of rabbits for antibody production. Titer plates were coated with pure peptide (1, 4), peptide-BSA conjugate (2) and, as an antigenic control, female human serum (3). The rabbit Ig- fraction ⁇ g/ml) was added at the titer plate. A polyclonal anti-PSA-Ig (rabbit) antibody (non specific antibody) was used as antibody control (4). It could be demonstrated that the marker peptide having the sequence of SEQ ID NO: 10 is immunogenic and elicits the production of polyclonal antibodies.
  • Fig. 4 shows the immunogenicity of a peptide derived from the marker sequence.
  • a peptide having the sequence of SEQ ID NO: 10 was used for immunization of rabbits for antibody production.
  • a titer plate was coated with rabbit anti-peptide Ig.
  • Whole human serum was incubated with peptide-BSA, with BSA alone and loaded onto the titer plate (1 : Peptide-BSA in serum; 2: serum alone; 3: peptide-BSA in PBS-T; 4: BSA in serum).
  • the plate was washed with washing buffer and the cavities were incubated with rabbit anti-BSA Ig-HRP.
  • the results show that the marker peptide having the sequence of SEQ ID NO: 10 can be detected in whole human serum by ELISA without interference of serum proteins.
  • Fig. 5 shows the immunogenicity of a peptide derived from the marker sequence.
  • a peptide having the sequence of SEQ ID NO: 10 was coated to keyhole hemocyanin and used for immunization of BALB/c mice. Spleen cells were fused with SP2/0 myeloma cells and antibody-producing cell clones were screened. Highly active clones were selected, propagated and monoclonal antibodies were prepared from their supernatant. Titer plates were coated with the peptide (1, 3, 4, 6) and peptide-BSA conjugate (2, 5), incubated with different monoclonal antibodies or buffer (3, 6) and anti-mouse-Ig-HRP as secondary antibody.
  • the used antibodies were in 1 and 2: a clone 4/B 2A anti-peptide monoclonal antibody; and in 4 and 5: a clone R4B6G5 anti-peptide monoclonal antibody.
  • the Figure shows that the marker peptide having the sequence of SEQ ID NO: 10 is immunogenic in mice and elicits monoclonal antibodies, which are reactive with the peptide.
  • Fig. 6 depicts an immuno staining of malignant cells for analyzing the marker sequence having the sequence of SEQ ID NO: 10. Fixed 1321N1 astrocytoma were stained with anti-peptide-monoclonal antibody (clone R4B6G5) ( ⁇ g/ml) in TBS-T, 5% BSA overnight.
  • Fig. 7 depicts the evaluation of tissue penetration of a human glioma tumor in the form of an agarose gel electrophoresis for separation of marker PCR products.
  • Tumor material was obtained from a patient suffering from a glioma tumor.
  • RNA was prepared from tissue material obtained from the tumor center, margin and non-tumor
  • Lane 1 sample prepared from 1321N1 astrocytoma cells (positive control); lane 2: sample prepared from tissue sample from the tumor margin; lane 3: sample prepared from tissue sample from the tumor center; lane 4: tissue sample prepared from non-tumor brain tissue.
  • the Figure shows that marker expression is lower at the tumor margin and absent outside the tumor. Analysis of marker expression thus allows an evaluation of tissue penetration of tumor cells.
  • Fig. 8 shows the Elispot assay of human PBMC (peripheral blood lymphocyte) stimulated by a peptide having the sequence of SEQ ID NO: 10 for 24h to evaluate immune regulatory effects.
  • PBMC peripheral blood lymphocyte
  • PBMCs from 3 healthy volunteers were resuspended in RPMI medium with 1% L-glutamine, HEPES and 10% fetal bovine serum and plated at 150 000 PBMCs/well in duplicate for increasing concentrations of the peptide (2.5 ⁇ g to 10 ⁇ g/ml) and controls (PBS resp. PMA (phorbol myristate acetate).
  • ELISPOT plates were incubated at 37°C for 24 h in the presence of 5% C0 2 .
  • Fig. 8A shows the release of interferon gamma (IFN-gamma) from PBMC upon stimulation with the peptide.
  • NC treatment with PBS
  • PC(PMA) treatment with PMA.
  • Fig. 8B depicts the release of perforin by PBMC upon stimulation the peptide.
  • a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1) and, thus, representing an alternative LRP1 splice product, in particular a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is detectable in a significant number of different tumor cells and tumor cell lines, but is absent in normal human tissues.
  • the singular forms of "a” and “an” also include the respective plurals unless the context clearly dictates otherwise.
  • the terms “about” and “approximately” denote an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question.
  • the term typically indicates a deviation from the indicated numerical value of ⁇ 20 %, preferably ⁇ 15 %, more preferably ⁇ 10 %, and even more preferably ⁇ 5 %.
  • the term “about” may also refer to a value, which is larger or smaller by several integers, preferably by 5, 4, 3, 2, or 1 in comparison to the starting value.
  • the term “comprising” is not limiting.
  • the term “consisting of” is considered to be a preferred embodiment of the term “comprising of. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is meant to also encompass a group, which preferably consists of these embodiments only. If the term “comprising” is used in the context of sequences, in particular nucleotide sequences, the term may not only refer to the sequence mentioned in the sequence listing, but also to the complementary sequence thereof, unless the context states otherwise.
  • the terms used herein are defined as described in "A multilingual glossary of biotechno logical terms: (IUPAC Recommendations)", Leuenberger, H.G.W, Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland.
  • IUPAC Recommendations Leuenberger, H.G.W, Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland.
  • the present invention concerns a nucleic acid molecule comprising or consisting of an alternative exon of low density lipoprotein-related protein 1 (LRP1) or derivatives thereof, comprising or consisting of a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a polynucleotide having, comprising or consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (b) a polynucleotide fragment of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (c) a polynucleotide encoding a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10; (d) a polynucleotide encoding the polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10; (e) a polynucleotide encoding the poly
  • polynucleotide encoding a polypeptide having, comprising or consisting of an amino acid sequence at least 70%>, 80%>, 90%> or 95 %> identical to the amino acid sequence of a polypeptide encoded by a polynucleotide of any one of (a) to (m); and (o) a
  • a nucleic acid molecule according to the present invention may not have or consist of the sequence as set forth in SEQ ID NO: 4 or a sequence encoding the amino acid sequence of SEQ ID NO: 5.
  • the present invention relates to a polypeptide encoded by an alternative exon of LRP1 or derivatives thereof, comprising or consisting of a polypeptide selected from the group consisting of: (a) a polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10; (b) a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10; (c) a polypeptide domain of SEQ ID NO: 2 or SEQ ID NO: 10; (d) a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10; (e) a polypeptide variant of SEQ ID NO: 2 or SEQ ID NO: 10; (f) an allelic variant of SEQ ID NO: 2 or SEQ ID NO: 10; (g) a species homologue of SEQ ID NO: 2 or SEQ ID NO: 10; and (h) a polypeptide which is at least 70%, 80%, 90%) or 95% identical to a polypeptide as defined in any one of (a) toEQ ID
  • polynucleotide refers to a molecule having, comprising or consisting of a nucleic acid sequence or nucleotide sequence.
  • a polynucleotide according to the present invention may comprise or consist of an entire coding sequence or a portion of a coding sequences, and/or may comprise or consist of all or a portion of an intron, preferably as defined herein below, and/or may comprise an untranslated region, e.g. a 5' UTR and/or a 3' UTR.
  • a polynucleotide according to the present invention may also comprise or consist of portions of a genomic flanking gene, i.e. 5' or 3' to the genomic sequences, preferably of sequences corresponding to SEQ ID NO: 1, 3, 4, 7 or 8 or 11.
  • SEQ ID NO: 1 designates the nucleotide sequence corresponding to positions 55,825,540 and 55,829,730 to
  • SEQ ID NO: 3 designates the nucleotide sequence of the full-length LRP1 cDNA, e.g. the DNA sequence comprising the LRP1 open reading frame comprised in Genbank Accession No. NM_002332 (version NM_002332.2, GI: 126012561 as of 12 March 2009).
  • SEQ ID NO: 7 designates the nucleotide sequence corresponding to positions 55,825,540 and 55,829,730 to 55,830,105 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), i.e. the translated portion of the ultimate nucleotide of exon 6 and alternative exon 7 of LRPl as well as the untranslated portion of alternative exon 7 of LRPl .
  • SEQ ID NO: 8 designates the nucleotide sequence corresponding to positions 55,825,540 and 55,829,730 to
  • human chromosome 12 human genome assembly variant 53 (Ensembl) as of 18 March 2009
  • translated portion of the ultimate nucleotide of exon 6 and alternative exon 7 of LRPl as well as the untranslated portion of alternative exon 7 of LRPl and a 3' downstream sequence.
  • SEQ ID NO: 9 designates positions 55,825,540 and 55,829,730 to
  • SEQ ID NO: 11 designates the genomic sequence of the LRPl gene, e.g. the sequence as defined in Ensembl Accession No. ENSG00000123384 (Ensembl release 55, as of 22 September 2009).
  • polypeptide refers to a molecule having, comprising or consisting of the translated amino acid sequence generated from a polynucleotide or nucleic acid according to the present invention as defined throughout the specification.
  • the term refers to a molecule having, comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or 10, a fragment thereof, a domain thereof, an epitope contained therein, a variant thereof, an allelic variant thereof, a species homologue thereof as well as a homologous sequence thereof or any further combinations, fusion etc. thereof as defined throughout the specification.
  • SEQ ID NO: 2 designates the amino acid sequence of a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1.
  • SEQ ID NO: 6 designates the amino acid sequence of a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 3, e.g. the protein sequence as defined in Genbank Accession No. NM-002332
  • SEQ ID NO: 10 designates the amino acid sequence of a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 9, i.e. the amino acid sequence of SEQ ID NO: 2 followed by a C-terminal cysteine residue.
  • exon 1 of LRP 1 or “exon 1” as used throughout the present application refers to position 55,808,543 to 55,809,081 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 2 of LRP 1 or “exon 2” as used throughout the present application refers to position 55,818,509 to 55,818,631 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 3 of LRP 1 or “exon 3” as used throughout the present application refers to position 55,821 ,424 to 55,821,561 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 4 of LRP 1 or “exon 4" as used throughout the present application refers to position 55,823,729 to 55,823,848 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 5 of LRP 1 or “exon 5" as used throughout the present application refers to position 55,825,022 to 55,825,150 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 6 of LRP 1 or “exon 6” as used throughout the present application refers to position 55,825,277 to 55,825,540 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • alternative exon 7 of LRP 1 refers to position 55,829,730 to 55,830,105 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 8 of LRP 1 or “exon 8” as used throughout the present application refers to position 55,834,529 to 55,834,751 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 9 of LRP 1 refers to position 55,836,144 to 55,836,333 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 10 of LRP 1 or “exon 10” as used throughout the present application refers to position 55,836,827 to 55,836,970 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 11 of LRP 1" or “exon 11” as used throughout the present application refers to position 55,838,452 to 55,838,688 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 12 of LRP 1 refers to position 55,839,875 to 55,840,055 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 13 of LRP 1 or “exon 13” as used throughout the present application refers to position 55,840,943 to 55,841,165 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 14 of LRP 1" or “exon 14” as used throughout the present application refers to position 55,842,367 to 55,842,568 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 15 of LRP 1 refers to position 55,842,908 to 55,845,995 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 16 of LRP 1 or “exon 16” as used throughout the present application refers to position 55,845,855 to 55,845,995 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 17 of LRP 1" or “exon 17” as used throughout the present application refers to position 55,846,134 to 55,846,259 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 18 of LRP 1 or “exon 18” as used throughout the present application refers to position 55,846,980 to 55,847,096 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 19 of LRP 1 or “exon 19” as used throughout the present application refers to position 55,847,494 to 55,847,574 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 20 of LRP 1 or “exon 20” as used throughout the present application refers to position 55,849,190 to 55,849,357 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 21 of LRP 1 or “exon 21” as used throughout the present application refers to position 55,853,218 to 55,853,400 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 22 of LRP 1 or “exon 22” as used throughout the present application refers to position 55,853,830 to 55,854,030 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 23 of LRP 1 refers to position 55,855,510 to 55,855,755 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 24 of LRP 1 or “exon 24” as used throughout the present application refers to position 55,855,959 to 55,856,156 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 25 of LRP 1" or “exon 25” as used throughout the present application refers to position 55,857,091 to 55,857,295 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 26 of LRP 1 refers to position 55,857,477 to 55,857,641 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 27 of LRP 1 or “exon 27” as used throughout the present application refers to position 55,858,409 to 55,858,653 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 28 of LRP 1 or “exon 28” as used throughout the present application refers to position 55,858,940 to 55,859,071 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 29 of LRP 1 or “exon 29” as used throughout the present application refers to position 55,859,379 to 55,859,606 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 30 of LRP 1 or “exon 30” as used throughout the present application refers to position 55,859,832 to 55,860,006 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 31 of LRP 1 or “exon 31” as used throughout the present application refers to position 55,860,097 to 55,860,191 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 32 of LRP 1 or “exon 32” as used throughout the present application refers to position 55,860,380 to 55,860,529 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 33 of LRP 1 or “exon 33” as used throughout the present application refers to position 55,860,717 to 55,860,857 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 34 of LRP 1 or “exon 34” as used throughout the present application refers to position 55,861,207 to 55,861,341 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 35 of LRP 1 or “exon 35” as used throughout the present application refers to position 55,863,429 to 55,863,560 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 36 of LRP 1 or “exon 36” as used throughout the present application refers to position 55,863,825 to 55,863,959 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 37 of LRP 1 or “exon 37” as used throughout the present application refers to position 55,864,135 to 55,864,264 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 38 of LRP 1 or “exon 38” as used throughout the present application refers to position 55,864,376 to 55,864,502 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 39 of LRP 1 or “exon 39” as used throughout the present application refers to position 55,864,889 to 55,865,040 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 40 of LRP 1 or “exon 40” as used throughout the present application refers to position 55,865,131 to 55,865,255 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 41 of LRP 1 or “exon 41” as used throughout the present application refers to position 55,865,581 to 55,865,958 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 42 of LRP 1 or “exon 42” as used throughout the present application refers to position 55,867,317 to 55,867,506 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 43 of LRP 43 or “exon 43” as used throughout the present application refers to position 55,870,855 to 55,871,059 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 44 of LRP 1 or “exon 44” as used throughout the present application refers to position 55,871,370 to 55, 871, 562of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 45 of LRP 1 refers to position 55,872,895 to 55,873,020 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 46 of LRP 1 or “exon 46” as used throughout the present application refers to position 55,873,226 to 55,873,354 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 47 of LRP 1" or “exon 47” as used throughout the present application refers to position 55,873,616 to 55,873,735 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 48 of LRP 1 or “exon 48” as used throughout the present application refers to position 55,873,949 to 55,874,062 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 49 of LRP 1 or “exon 49” as used throughout the present application refers to position 55,874,404 to 55,874,553 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 50 of LRP 1 or “exon 50” as used throughout the present application refers to position 55,874,627 to 55,874,749 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 51 of LRP 1 or “exon 51” as used throughout the present application refers to position 55,875,035 to 55,875,151 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 52 of LRP 1 or “exon 52” as used throughout the present application refers to position 55,875,321 to 55,875,449 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 53 of LRP 1 or “exon 53” as used throughout the present application refers to position 55,875,708 to 55,875,830 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 54 of LRP 1 or “exon 54” as used throughout the present application refers to position 55,875,913 to 55,876,053 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 55 of LRP 1 or “exon 55” as used throughout the present application refers to position 55,876,137 to 55,876,327 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 56 of LRP 1 or “exon 56” as used throughout the present application refers to position 55,877,032 to 55,877,215 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 57 of LRP 1 or “exon 57” as used throughout the present application refers to position 55,877,349 to 55,877,434 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 58 of LRP 1 or “exon 58” as used throughout the present application refers to position 55,877,595 to 55,877,714 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 59 of LRP 1 or “exon 59” as used throughout the present application refers to position 55,878,206 to 55,878,393 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 60 of LRP 1 or “exon 60” as used throughout the present application refers to position 55,878,515 to 55,878,720 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 61 of LRP 1 refers to position 55,879,262 to 55,879,450 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 62 of LRP 1 or “exon 62” as used throughout the present application refers to position 55,879,927 to 55,880,075 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 63 of LRP 1 refers to position 55,880,492 to 55,880,585 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 64 of LRP 1 or “exon 64” as used throughout the present application refers to position 55,880,749 to 55,880,865 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 65 of LRP 1 or “exon 65” as used throughout the present application refers to position 55,881,084 to 55,881,203 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 66 of LRP 1 or “exon 66” as used throughout the present application refers to position 55,881,547 to 55,881,669 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 67 of LRP 1 or “exon 67” as used throughout the present application refers to position 55,881,830 to 55,881,955 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 68 of LRP 1 or “exon 687” as used throughout the present application refers to position 55,882,471 to 55,882,587 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 69 of LRP 1 or “exon 69” as used throughout the present application refers to position 55,883,231 to 55,883,337 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 70 of LRP 1 or “exon 70” as used throughout the present application refers to position 55,883,439 to 55,883,571 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 71 of LRP 1 or “exon 71” as used throughout the present application refers to position 55,884,460 to 55,884,579 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 72 of LRP 1 or “exon 72” as used throughout the present application refers to position 55,884,677 to 55,884,799 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 73 of LRP 1 or “exon 73” as used throughout the present application refers to position 55,885,159 to 55,885,299 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 74 of LRP 1 or “exon 74” as used throughout the present application refers to position 55,885,401 to 55,885,535 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 75 of LRP 1 or “exon 75” as used throughout the present application refers to position 55,885,608 to 55,885,727 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 76 of LRP 1 or “exon 76” as used throughout the present application refers to position 55,886,523 to 55,886,791 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 77 of LRP 1 or “exon 77” as used throughout the present application refers to position 55,888,088 to 55,888,266 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 78 of LRP 1 or “exon 78” as used throughout the present application refers to position 55,888,761 to 55,888,867 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 79 of LRP 1 or “exon 79” as used throughout the present application refers to position 55,889,133 to 55,889,249 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 80 of LRP 1 or “exon 80” as used throughout the present application refers to position 55,889,742 to 55,889,918 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 81 of LRP 1 or “exon 81” as used throughout the present application refers to position 55,890,079 to 55,890,219 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 82 of LRP 1 or “exon 82” as used throughout the present application refers to position 55,890,357 to 55,890,530 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 83 of LRP 1 or “exon 83” as used throughout the present application refers to position 55,890,768 to 55,890,929 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 84 of LRP 1 or “exon 84” as used throughout the present application refers to position 55,891,226 to 55,891,400 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 85 of LRP 1 refers to position 55,891,537 to 55,891,638 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 86 of LRP 1 or “exon 86” as used throughout the present application refers to position 55,891,800 to 55,891,864 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 87 of LRP 1 or “exon 87” as used throughout the present application refers to position 55,891,977 to 55,892,067 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • exon 88 of LRP 1 or “exon 88” as used throughout the present application refers to position 55,892,167 to 55,892,311 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • intronl-2 refers to the sequences comprising the positions between the exons as defined herein above, respectively.
  • intron 1-2 refers to position 55,809,082 to 55,818,508 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009)
  • intron 8-9 refers to position 55,834,752 to 55,836,143 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009) etc.
  • polynucleotide fragment refers to a short polynucleotide having, comprising or consisting of a nucleic acid sequence, which is a portion of the sequence contained in the nucleotide sequence of SEQ ID NOs: 1 , 7, 8 or 9 or the complementary strand thereto.
  • a nucleotide fragments according to the invention may be at least about 10 nt, preferably at least about 15 nt, more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt or at least about 50 nt in length.
  • a fragment of "at least 20 nt in length” may, for example, include 20 or more contiguous bases from the sequence contained in the nucleotide sequence of SEQ ID NOs: 1, 3, 7, 8 or 9 or the complementary strand thereto.
  • representative examples of polynucleotide fragments of the invention include, for example, fragments comprising, or alternatively consisting of a sequence from about nucleotide number 1-10, 5-15, 11-20, 16 to 25, 21-30, 26-35, 31- 40, 36-45, 41 to the end of SEQ ID NOs: 1, 7, 8 or 9, or the complementary strand thereto.
  • polynucleotide fragments of the invention may include, for example, fragments comprising, or alternatively consisting of a sequence from about nucleotide number 1-500, 501-1000, 1001-1500, 1501-2000, 2001-2500, 2501-3000, 3001-3500, 3501-4000, 4001-4500, 4501-5000, 5001-5500, 5501-6000, 6001-6500, 6501-7000, 7001-7500, 7501-8000, 8001-8500, 8501-9000, 9001-9500, 9501-10000, 10001-10500, 10501-11000, 11001-11500, 11501-12000, 12001-12500, 12501-13000, 13001-13500, 13501-14000, 14001 to 14500, or 14501 to the end of SEQ ID NO: 3, or the complementary strand thereto.
  • polypeptide fragment refers to an amino acid sequence, which is a portion of the sequence contained in the amino acid sequence of SEQ ID NOs: 2, 6 or 10.
  • Polypeptide (or alternatively protein) fragments may be either
  • polypeptide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-5, 6-10, 11 to the end of SEQ ID NOs: 2 or 10.
  • polypeptide fragments of the invention may include, for example, fragments comprising, or alternatively consisting of a sequence from about amino acid number 1-200, 201-400, 401-600, 601-800, 801-1000, 1001- 1200, 1201-1400, 1401-1600, 1601-1800, 1801-2000, 2001-2200, 2201-2400, 2401- 2600, 2601-2800, 2801-3000, 3001-3200, 3201-3400, 3401-3600, 3601-3800, 3801- 4000, 4001-4200, 4201-4400, or 4401 to the end of SEQ ID NO: 6.
  • polypeptide fragments can be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, or 4400 amino acids in length.
  • polypeptide domain refers to functional or structural domains of a polypeptide, preferably to any typical secondary or 3-dimensional protein structure like a helical portion, a beta-sheet, a beta-bridge, a bonded turn or a bend.
  • secondary protein structure preferably relates to the 3-dimensional protein structure as defined in the Dictionary of Protein Secondary Structure (DSSP; Kabsch et al, 1983, Biopolymers 22 (12), 2577-2637). According to the DSSP method the protein secondary structure is typically described with single letter codes. The secondary structure may be assigned based on hydrogen bonding patterns.
  • G 3-turn helix (310 helix) with a minimum length of 3 residues.
  • H 4-turn helix (a helix) with a minimum length of 4 residues.
  • I 5-turn helix ( ⁇ helix) with a minimum length of 5 residues.
  • T hydrogen bonded turn (3, 4 or 5 turn).
  • E extended strand in parallel and/or anti-parallel ⁇ -sheet conformation with a minimum length of 2 residues.
  • Amino acid residues which are not in any of the above conformations are assigned as the eighth type 'Coil': typically codified as C (coil).
  • C coil
  • the helices (G, H and I) and sheet conformations are normally required to have a reasonable length. Accordingly, 2 adjacent residues in the primary structure must form the same hydrogen bonding pattern. If the helix or sheet hydrogen bonding pattern is too short they are designated as T or B, respectively.
  • the secondary structure of a protein or the presence of a corresponding domain in a protein or polypeptide may be predicted by suitable methods known to the person skilled in the art. Typically, methods of secondary- structure prediction may be used which are based on the helix- or sheet-forming propensities of individual amino acids, optionally coupled with rules for estimating the free energy of forming secondary structure elements. Furthermore, multiple sequence alignments may be exploited, thus using the full distribution of amino acids that occur at a position and in its vicinity, typically about 7 residues on either side throughout evolution. A further typical prediction approach is the examination of the average hydrophobicity or residue solvent accessibility at a certain position and at nearby positions. By combining alignment data and hydrophobicity or residue solvent accessibility data the accuracy of the prediction may be raised.
  • polypeptide domains are alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil- forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions.
  • polypeptide epitope refers to a portion of a polypeptide having antigenic and/or immunogenic activity in an appropriate host organism, e.g.
  • immunological epitope designates a portion of a protein that elicits an antibody response in an animal, preferably in a mammal, and more preferably in a human, a mouse or a rabbit.
  • immunogenic epitope designates a portion of a protein that elicits an antibody response in an animal
  • antigenic epitope is defined as a portion of a protein or polypeptide to which an antibody can immunospecifically bind, as determined by any method known in the art, e.g. by immunoassays. Immunospecific binding exclues non-specific binding but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic.
  • Fragments which function as epitopes may be produced by any conventional means, e.g. by those described in Houghten, PNAS, 1985, 82: 5131-5135.
  • antigenic epitopes comprise, or alternatively consist of, a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, and, most preferably, between about 10 to about 15 amino acids.
  • Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length.
  • Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies that specifically bind the epitope.
  • Preferred antigenic epitopes may include the antigenic epitopes as mentioned above, as well as any combination of 2, 3, 4, 5 or more of these antigenic epitopes. Antigenic epitopes may further be used as the target molecules in immunoassays.
  • immunogenic epitopes may be used, for example, to induce antibodies according to methods well known in the art, e.g. as described in Chow et al, 1985, PNAS, 82: 910914; and Bittle et al, 1985, J. Gen. Virol, 66: 2347-2354.
  • Preferred immunogenic epitopes may include the immunogenic epitopes as mentioned above, as well as any combination of 2, 3, 4 or 5 or more of these immunogenic epitopes.
  • the polypeptides comprising one or more immunogenic epitopes may be presented for eliciting an antibody response together with a carrier protein, such as an albumin, to an animal system (e.g. a rabbit or mouse), or, if the polypeptide is of sufficient length (at least about 25 amino acids) the polypeptide may be presented without a carrier.
  • a carrier protein such as an albumin
  • immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide.
  • Particularly preferred epitopes of the present invention comprise, or consist of the amino acid sequence as set forth in SEQ ID NO: 16 to 34.
  • polynucleotide or polypeptide which differs from the polynucleotide or polypeptide of the present invention, e.g. the polynucleotide of SEQ ID NOs: 1, 7, 8 or 9, or the polypeptide of SEQ ID NOs: 2 or 10, but retains essential properties thereof.
  • variants are overall closely similar, and, in many regions, identical to the polynucleotide or polypeptide of the present invention.
  • Variants according to the present invention may contain alterations in the coding regions, non-coding regions, or both.
  • polynucleotide variants containing alterations which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide.
  • nucleotide sequence variants which are produced by silent substitutions due to the degeneracy of the genetic code.
  • Polynucleotide variants can be produced for a variety of reasons, typically in order to optimize codon expression for a particular host, i.e. in order to change codons in the human mRNA to those preferred by a bacterial, plant or fungal host cells.
  • polypeptide variants in which 5 - 10, 1 - 5 or 1 - 2 amino acids are substituted, deleted, or added in any combination are preferred.
  • variants may be generated to improve or alter the characteristics of the polypeptides of the present invention. For instance, one or more amino acids may be deleted from the N-terminus or C-terminus without substantial loss of biological function.
  • deleting one or more amino acids from the N-terminus or C- terminus of a polypeptide results in modification or loss of one or more biological functions, other biological activities may still be retained.
  • polypeptide or polypeptide variants may include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as to have little effect on the activity or immunogenicity of the encoded protein or polypeptide.
  • variants may be produced via site directed mutagenesis or alanine-scanning mutagenesis, i.e. the introduction of single alanine mutations at every residue in the molecule. The resulting mutant molecules may subsequently be tested for biological activity.
  • most buried amino acid residues (within the tertiary structure of the protein) require nonpolar side chains, whereas few features of surface side chains are generally conserved.
  • tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and He;
  • variants of the present invention may also include substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or substitutions with one or more of amino acid residues having a substituent group, or a fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or a fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide, or leader or secretory sequence, or a sequence facilitating purification.
  • substitutions with one or more of the non-conserved amino acid residues where the substituted amino acid residues may or may not be one encoded by the genetic code, or substitutions with one or more of amino acid residues having a substituent group, or a fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of
  • the present invention relates to polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids, which may produce proteins with improved characteristics, such as less aggregation.
  • allelic variant as used herein relates to naturally occurring variants, i.e. to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. These allelic variants can vary at either the polynucleotide and/or polypeptide level and are included in the present invention. In a specific embodiment of the present invention the term also includes non-naturally occurring variants, which may, for example, be produced by mutagenesis techniques or by direct synthesis.
  • the term refers to naturally occurring allels of the polynucleotide of SEQ ID NOs: 1, 7, 8 or 9, or the polypeptide of SEQ ID NOs: 2 or 10 in the form of small nucleotide polymorphisms, preferably in the form of SNPs as derivable from the variation table of Ensembl database entries ENST00000243077 and ENST00000338962 (derivable, for example, from www.ensembl.org).
  • proteins homologue refers to polypeptide or polynucleotide sequences which show a high degree of identity to the polynucleotide or polypeptide of the present invention, e.g. to the polynucleotide of SEQ ID NOs: 1, 7, 8 or 9, or the polypeptide of SEQ ID NOs: 2 or 10 and which are derived from a different species, e.g. from monkeys, mice, rats, vertebrates,
  • nucleic acid molecules which comprise, or alternatively consist of a nucleotide sequence which is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, for example, the nucleotide sequence of SEQ ID NOs: 1, 3, 7, 8 or 9.
  • polypeptide molecules which comprise, or alternatively consist of an amino acid sequence which is at least 70%, 75%, 80%>, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, for example, the amino acid sequence in SEQ ID NOs: 2, 6 or 10.
  • nucleic acid having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100
  • nucleotides of the reference nucleotide sequence encoding the polypeptide may be obtained by obtaining a nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • the query sequence may be an entire sequence or any fragment as described herein.
  • nucleic acid molecule is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the presence invention can be determined conventionally using known computer programs.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al., 1990, Comp. App. Biosci. 6: 237-245.
  • RNA sequence can be compared by converting U's to T's.
  • the result of said global sequence alignment is in percent identity.
  • Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are:
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5 'and 3 Of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage may then be subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
  • a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
  • the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at the 5' end.
  • the 10 unpaired bases represent 10% of the sequence (number of bases at the 5'and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%).
  • a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5' or 3' end of the subject sequence, which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected.
  • a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, for instance, an amino acid sequence of the present invention can be determined
  • determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence can be determined using the FASTDB computer program based on the algorithm of Brutlag et al, 1990, Comp. App. Biosci. 6: 237-245.
  • a query sequence a sequence of the present invention
  • a subject sequence also referred to as a global sequence alignment
  • the query and subject sequences are both amino acid sequences.
  • the result of said global sequence alignment is given in percent identity.
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned may be determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%>.
  • a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Only residue positions outside the N- and C- terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected. No other manual corrections are to be made for the purposes of the present invention.
  • the present invention also relates in one aspect to polynucleotides capable of hybridizing under stringent hybridization conditions to nucleotide sequences of the invention as defined herein above, preferably to nucleotide sequences of SEQ ID NOs: 1, 7, 9 or 9.
  • stringent hybridization conditions refers to an overnight incubation at 42°C in a solution comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/m) denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65°C.
  • nucleic acid molecules that hybridize to the polynucleotides of the present invention at lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
  • washes performed following stringent hybridization may be carried out at higher salt concentrations (e. g. with 5X SSC).
  • blocking reagents used to suppress background in hybridization experiments.
  • Typical blocking reagents to be used in the context of the present invention include Denhardt's reagent, BLOTTO, heparin or denatured salmon sperm DNA.
  • the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • a polynucleotide which hybridizes only to poly A+ sequences or to a complementary stretch of T (or U) residues, would not be included in the definition of "polynucleotide” since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly A stretch or the complement thereof (e. g., practically any double-stranded cDNA clone generated using oligo dT as a primer).
  • nucleic acid molecule according to the present invention as defined herein above preferably a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 or fragments or variants thereof as defined herein above, is fused at the 3 ' end or at the 5 ' end to the nucleotide sequence encoding wild-type LRP1 as set forth in SEQ ID NO: 3 or to fragments thereof, with the proviso that the nucleic acid sequence resulting from the fusion is not the sequence as set forth in SEQ ID NO: 4 or a sequence encoding the amino acid sequence of SEQ ID NO: 5.
  • SEQ ID NO: 4" designates the nucleotide sequence corresponding to positions 55,808,543 to 55,809,081, 55,818,509 to 55,818,631, 55,821,424 to
  • SEQ ID NO: 5" designates the amino acid sequence of a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 4, in particular the protein sequence as defined in Genbank Accession No. BC072015 (version BC072015.1, GI: 47940658 as of 12 March 2009).
  • the fusion between the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 and the nucleotide sequence of SEQ ID NO: 3 comprises at least nucleotide sequences encoding the amino acid sequence as defined in SEQ ID NO: 2 and any fragment of SEQ ID NO: 3, which encodes the polypeptide of SEQ ID NO: 6 or fragments thereof.
  • fragments of SEQ ID NO: 3 comprising exons 1 to 5 and at least a part of exon 6, e.g.
  • up to position 55,825,536 of human chromosome 12 may be fused with a nucleotide sequence encoding the amino acid sequence as defined in SEQ ID NO: 2.
  • the fusion may, for example, be carried out at the 5 ' end or the 3 ' end of the the nucleic acid molecule encoding the amino acid sequence as defined in SEQ ID NO: 2.
  • Fragments of the nucleic acid molecule as defined in SEQ ID NO: 3 to be used for fusion proteins may comprise any stretch of at least 6 nucleotides length which encodes a fragment or portion of the polypeptide of SEQ ID NO: 6.
  • Fusion constructs may in addition to the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 also comprise more than one fragment of SEQ ID NO: 3, preferably one of the fragments mentioned herein above, e.g. two fragments, which are not in juxtaposition in the sequence of SEQ ID NO: 3.
  • the encoded protein or polypeptide sequence of such a construct must be derivable from the amino acid sequence of SEQ ID NO: 6, e.g. as combination of two or more non-contiguous fragments of SEQ ID NO: 6.
  • a polypeptide according to the present invention as defined herein above preferably a polypeptide having the amino acid sequence of SEQ ID NO: 2 or 10 or fragments, domains, epitops, homo logs or variants thereof as defined herein above, is fused at the N-terminus or at the C-terminus to the LRP1 protein as set forth in SEQ ID NO: 6 or to fragments thereof, with the proviso that the amino acid sequence resulting from the fusion is not the amino acid sequence of SEQ ID NO: 5 or is encoded by the nucleotide sequence of SEQ ID NO: 4.
  • the fusion between the amino acid sequence of SEQ ID NO: 2 or 10 and the amino acid sequence of SEQ ID NO: 6 comprises at least the amino acid sequence as defined in SEQ ID NO: 2 and any fragment of SEQ ID NO: 6.
  • fragments of SEQ ID NO: 6 encoded by exons 1 to 5 and at least a part of exon 6, e.g. up to position 55,825,536 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009) may be fused with the amino acid sequence as defined in SEQ ID NO: 2.
  • the fusion may, for example, be carried out at the N-terminus or at the C- terminus of the amino acid sequence as defined in SEQ ID NO: 2 or at both termini.
  • Fragments of the polypeptide molecule as defined in SEQ ID NO: 6 to be used for fusion proteins may comprise any stretch of at least 2 amino acids length which comprises a fragment or portion of the polypeptide of SEQ ID NO: 3.
  • Fusion constructs may in addition to the amino acid sequence of SEQ ID NO: 2 or 10 also comprise more than one fragment of SEQ ID NO: 6, preferably one of the fragments mentioned herein above, e.g. two fragments, which are not in juxtaposition in the sequence of SEQ ID NO: 6. If more than one fragment of SEQ ID NO: 6 is fused to the amino acid sequence of SEQ ID NO: 2 or 10, the used fragments may be in any possible order, not necessarily in the order provided by the sequence of SEQ ID NO: 6.
  • nucleic acid molecule according to the present invention as defined herein above preferably the nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 or fragments or variants thereof as defined herein above or a nucleic acid molecule representing a fusion of said nucleotide sequences with SEQ ID NO: 3 or fragments thereof as defined herein above may be fused at the 3' end or at the 5' end to a heterologous nucleotide sequence, preferably sequences encoding heterologous proteins.
  • the present invention also contemplates fusions of polypeptide molecule according to the present invention as defined herein above, preferably the nucleic acid molecule having the amino acid sequence of SEQ ID NO: 2 or 10 or fragments or variants thereof as defined herein above or a polypeptides representing a fusion of said nucleotide sequences with SEQ ID NO: 6 or fragments thereof as defined herein above.
  • the polypeptides may be fused at the N-terminus and/or at the C-terminus to a heterologous polypeptide.
  • heterologous refers to any type of sequence which is not directly derivable from the context of the LRPl gene, in particular from SEQ ID NO: 3 or SEQ ID NO: 6.
  • the term thus, also comprises sequences naturally occurring in the same cell, in the same tissue type or in the same organism as the LRPl gene.
  • the term relates to sequences derived from different organisms or different species.
  • nucleic acid molecules or polypeptides may be fused to sequences encoding or representing the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (constant heavy or constant light chains, CHI, CH2, CH3, CL etc. or any combination thereof and/or portions thereof) resulting in chimeric polypeptides.
  • immunoglobulins IgA, IgE, IgG, IgM
  • portions thereof constant heavy or constant light chains, CHI, CH2, CH3, CL etc. or any combination thereof and/or portions thereof
  • fusion constructs may facilitate purification and may increase half- life of the polypeptide in vivo.
  • the mentioned nucleic acids, molecules or polypeptides may also be fused with sequences encoding or representing epitope tags, e.g., the hemagglutinin ("HA") tag or flag tag, to aid in detection and purification of the expressed polypeptide.
  • epitope tags e.g., the hemag
  • a further preferred example of a fusion constructs comprises fusions with sequences encoding or representing therapeutic proteins, suicide proteins, tumor suppressor proteins, transcription factors, kinase inhibitors, kinases, regulatory proteins, apoptotic proteins, anti-apoptotic proteins, microbial antigens, viral antigens, bacterial antigens, parasitic antigens, cellular antigens, differentiation factors, immortalisation factors, protein toxins, enzymes or marker proteins, e.g. EGFP or luciferase.
  • therapeutic protein as used herein relates to any protein, which has a therapeutic effect on the animal body, in particular on the human body.
  • the term relates to any such protein known to the person skilled in the art.
  • therapeutic enzymes are alglucerase, which may be used in treating lysosomal glucocerebrosidase deficiency (Gaucher's disease), alpha-L-iduronidase, which may be used in treating mucopolysaccharidosis I; alpha-N-acetylglucosamidase, which may be used in treating sanfilippo B syndrome; lipase, which may be used in treating pancreatic insufficiency; adenosine deaminase, which may be used in treating severe combined immunodeficiency syndrome; or triose phosphate isomerase, which may be used in treating neuromuscular dysfunction associated with triose phosphate isomerase deficiency.
  • suicide proteins as used herein relates to any protein, which leads to the destruction of a cell due to the action of the protein, typically due to an enzymatic reaction in the presence of a corresponding substrate.
  • the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to nucleoside kinases, such as the HSV-1 TK or multisubstrate deoxyribonucleoside kinase ofDm-dNK.
  • tumor suppressor proteins as used herein relates to any protein, which protects a cell from one step on the path to cancer.
  • the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to the Rb protein, the p53 tumor suppressor, APC and CD95.
  • transcription factors as used herein relates to any protein, which binds to specific parts of DNA using DNA binding domains and is part of the system that controls the transcription of genetic information from DNA to RNA.
  • the term relates to any such factor known to the person skilled in the art. More preferably, the term relates to TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH and TATA binding protein (TBP).
  • kinase as used herein relates to any protein, which transfers phosphate groups from high-energy donor molecules, such as ATP, to specific target molecules.
  • the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to tyrosine kinase or MAP kinase, MEK1 or MEK2.
  • apoptotic protein as used herein relates to any protein, which leads to programmed cell death in multicellular organisms.
  • the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to the pro-apoptotic protein BAX, BID, BAK, or BAD.
  • anti-apoptotic protein as used herein relates to any protein, which impedes programmed cell death in multicellular organisms.
  • the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to the anti-apoptotic protein like Bcl-Xl, Bcl-2and further members of the Bcl-2 family.
  • microbial antigens relate to protein immunogens, which are able to stimulate an immune response derived from microbes, viruses, bacteria, parasites or cells, respectively.
  • the term relates to any such immunogens known to the person skilled in the art.
  • the term relates to tumor- associated antigens (TAAs) or bacterial, viral and parasitic surface proteins.
  • TAAs tumor- associated antigens
  • differentiation factor as used herein relates to any protein factor, which functions predominantly in development and leads to the differentiation of tissues, cell groups of specific cells.
  • the term relates to any such factor known to the person skilled in the art.
  • the term relates to growth differentiation factors (GDFs) like GDF1, GDF2, GDF3, GDF5, GDF6, GDF8, GDF9, GDF10, GDF11 and GDF15.
  • immortalisation factors as used herein relates to any factor, which provokes an absence of a sustained increase in the rate of mortality of a cell as a function of chronological age.
  • the term relates to any such factor known to the person skilled in the art. More preferably, the term relates to telomerase or large T-antigen.
  • protein toxin in the context of the present invention relates to any peptide or polypeptide/protein molecule, which is capable of causing disease or cell death on contact or absorption with body tissues by interacting with biological macromolecules such as enzymes or cellular receptors.
  • the term relates to any such factor known to the person skilled in the art. More preferably, the term relates to botulinum toxin, maurotoxin, agitoxin, charybdotoxin, margatoxin, slotoxin, scyllatoxin, calciseptine, taicatoxin and calcicludine.
  • DNA shuffling may be employed to modulate the activities or biological properties of polypeptides of the invention, such methods can be used to generate polypeptides with altered activity or properties, as well as agonists and antagonists of the polypeptides.
  • DNA shuffling involves the assembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the polynucleotide sequence.
  • polynucleotides of the invention may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination.
  • one or more components, motifs, sections, parts, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules as defined herein above.
  • nucleic acid molecule as defined herein above preferably the nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 or fragments or variants thereof as defined herein above or a nucleic acid molecule representing a fusion of said nucleotide sequences with SEQ ID NO: 3 or fragments thereof or fusion constructs as defined herein above, comprises sequential nucleotide deletions from either the 5 ' end and/or the 3 ' end.
  • sequence deletion refers to the diminishment of nucleic acids according to the present invention, by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or between 22 and about 75 nucleotides from the 5' or 3' end. Furthermore, such deletion at the 5 ' and 3 ' end may be combined in any suitable combination Preferably such nucleotide deletions have no or only marginal influence on the activity or properties of the encoded polypeptides or proteins.
  • a polypeptide according to the present invention may have a continuous series of deleted residues from the amino or the carboxy terminus, or both.
  • any number of amino acids, ranging from 1- 60, preferably between about 1 and 5, can be deleted from the amino terminus.
  • any number of amino acids, ranging from 1-60, preferably between about 1 and 5 can be deleted from the carboxy terminus.
  • any combination of the above mentioned amino and carboxy terminus deletions are preferred.
  • the nucleic acid molecule as defined herein above is DNA or RNA.
  • the nucleic acid molecule may also be PNA, CNA, ETNA, LNA or ANA or any other suitable nucleic acid format known to the person skilled in the art.
  • PNA peptide nucleic acid
  • the PNA backbone is typically composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds.
  • the various purine and pyrimidine bases are linked to the backbone by methylene carbonyl bonds.
  • PNAs are generally depicted like peptides, with the N- terminus at the first (left) position and the C-terminus at the right.
  • CNA as used herein relates to an aminocyclohexylethane acid nucleic acid. Furthermore, the term relates to a cyclopentane nucleic acid, i.e. a nucleic acid molecule comprising for example 2'-deoxycarbaguanosine.
  • FiNA hexitol nucleic acids
  • DNA analogues which are built up from standard nucleobases and a phosphorylated 1,5-anhydrohexitol backbone.
  • LNA locked nucleic acids
  • a locked nucleic acid is a modified and thus inaccessible RNA nucleotide.
  • the ribose moiety of an LNA nucleotide may be modified with an extra bridge connecting the 2' and 4' carbons. Such a bridge locks the ribose in a 3'-endo structural conformation.
  • the locked ribose conformation enhances base stacking and backbone pre-organization. This may significantly increase the thermal stability, i.e. melting temperature of the nucleic acid molecule.
  • ANA as used herein relates to arabinoic nucleic acids or derivatives thereof.
  • a preferred ANA derivative in the context of the present invention is a 2'-deoxy-2'- fluoro-beta-D-arabinonucleoside (2'F-ANA).
  • the present invention relates to a vector comprising the nucleic acid molecule as defined herein above, preferably the nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 or fragments or variants thereof as defined herein above or a nucleic acid molecule representing a fusion of said nucleotide sequences with SEQ ID NO: 3 or fragments thereof or fusion constructs as defined herein above or comprising the nucleotide sequence of SEQ ID NO: 4.
  • a suitable vector according to the present invention may be, for example, a phage, plasmid, viral, or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in
  • Polynucleotides according to the present invention may be joined to a vector containing a selectable marker for propagation in a host.
  • the polynucleotide insert may be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs.
  • Other suitable promoters are known to the person skilled in the art.
  • the expression constructs may further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. In particular, specific initiation signals may be required for efficient translation of inserted coding sequences.
  • These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon may typically be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert.
  • exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may further be enhanced by the inclusion of appropriate transcription enhancer elements etc.
  • the coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • selectable marker include, for instance, dihydro folate reductase, G418, hygromycin or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • Further selection markers include the herpes simplex virus thymidine kinase, hypoxanthine-guanine
  • Vectors preferred for use in bacteria include pQE70, pQE60 and pQE9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc.; pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech, Inc., and pET vectors available from Novagen.
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG andpSVL available from Pharmacia.
  • Preferred expression vectors for use in yeast systems include pYES2, pYDl, pTEFl/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-Sl, pPIC3.5K, pPIC9K, and PA0815.
  • Other suitable vectors are known to the person skilled in the art.
  • the present invention relates to a method of making a recombinant host cell, comprising introducing the nucleic acid molecule or the vector according to the present invention into a host cell.
  • host cell refers to any suitable host cell known to the person skilled in the art. Representative examples of appropriate host cells include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g.,
  • Saccharomyces cerevisiae or Pichia pastoris insect cells such as Drosophila melanogaster S2 and Spodoptera frugiperda Sf9 cells; and plant cells.
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e. g. glycosylation) and processing (e. g. cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the posttranslational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the introduced protein expressed. To this end, eukaryotic host cells, which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product are preferred.
  • Such mammalian host cells include HEK 293, Bowes melanoma cells, CHO, VERY, BHK, Hela, COS, MDCK, 293,3T3, W138, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such as, for example, CRL7030 and Hs578Bst.
  • cell lines which stably express the polypeptide of the present invention may be engineered according to standard procedures known to the person skilled in the art.
  • yeast Pichia pastoris may be used to express a
  • Pichia pastoris is a methylotrophic yeast, which can metabolize methanol as its sole carbon source.
  • a main step in the methanol metabolization pathway is the oxidation of methanol to formaldehyde using 0 2 . This reaction is catalyzed by the enzyme alcohol oxidase.
  • Pichia pastoris In order to metabolize methanol as its sole carbon source, Pichia pastoris must generate high levels of alcohol oxidase due, in part, to the relatively low affinity of alcohol oxidase for 0 2 .
  • AOXl alcohol oxidase genes
  • a heterologous coding sequence such as, for example, a polynucleotide according to the present invention as defined herein above, under the transcriptional regulation of all or part of the AOXl regulatory sequence is expressed at exceptionally high levels in Pichia yeast grown in the presence of methanol.
  • the plasmid vector pPIC9K may be used to express DNA encoding a polypeptide of the invention, as set forth herein, in a Pichia yeast system essentially as described in "Pichia Protocols: Methods in Molecular Biology," (D. R. Higgins and J. Cregg, eds; The Humana Press, Totowa, NJ, 1998).
  • This expression vector allows expression and secretion of a protein of the invention by virtue of the strong AOX1 promoter linked to the Pichia pastoris alkaline phosphatase (PHO) secretory signal peptide (i.e., leader) located upstream of a multiple cloning site.
  • PHO alkaline phosphatase
  • yeast vectors could be used in place of pPIC9K, e.g. the yeast vectors mentioned herein above, as long as the proposed expression construct provides appropriately located signals for transcription, translation, secretion (if desired), and the like, including an in- frame AUG, as required.
  • the term "introducing the nucleic acid molecule or the vector into a host cell" as used herein refers to any suitable cell nucleic acid introduction or transformation technique known to the person skilled in the art. For example, such introduction can be carried out by transfection, e.g. DEAE-dextran mediated transfection, electroporation,
  • microinjection infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, cationic lipid-mediated transfection, spheroplast fusion, etc.
  • Further introduction technique contemplated by the present invention include the contacting with defective or attenuated retrovirals, microparticle bombardment, the use of coatings with lipids or cell-surface receptors or transfecting agents, the use of encapsulation in liposomes, microparticles, or microcapsules, for instance by administering them in linkage to a peptide which is known to enter the nucleus, or by administering it in linkage to a ligand subject to receptor-mediated endocytosis.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may preferably be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • engineered cells may be allowed to grow under suitable conditions as known to the person skilled in the art, e.g. for 1-2 days in an enriched media, and then are switched to a selective media. Appropriate culture media and conditions for the above described host cells and vectors are known in the art.
  • the present invention relates to a recombinant host cell obtained or obtainable according to the above described introduction techniques.
  • recombinant host cells contain a nucleic acid molecule or a vector according to the present invention.
  • the recombinant host cells express a polypeptide encoded by the nucleic acid molecule according to the present invention.
  • recombinant host cells differ from naturally occurring cells or from known host cells by the presence of additional nucleic acid molecules or fragments thereof, which are not present in natural contexts or in the parental cells or cell lines.
  • recombinant host cells may comprise selection markers, duplicated or multimeric copies of naturally present genes or nucleic acids, heterologous elements like promoter sequences, terminator sequences etc. or genetic identification tags. These elements may preferably be used for the characterization of the recombinant host cells and for their distinguishing from natural contexts and from parental cells or cell lines.
  • introduced elements may be controlled by numerous standard gene expression tests known to the person skilled in the art. For instance, the transcription of an introduced nucleic acid may be tested in Northern analysis tests and/or the presence of correspondingly translated polypeptides may be tested via Western analysis tests. Further details and additional tests may be derived from qualified textbooks, e.g. from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
  • the invention in another aspect relates to a method of making a polypeptide encoded by a nucleic acid molecule according to the present invention as defined herein above comprising: (a) culturing the recombinant host cell as defined herein above such that the encoded polypeptide is expressed; and (b) recovering said polypeptide.
  • Method for the culturing of recombinant host cells in order to express encoded polypeptides are widely known in the art. For example, if a regulable promoter is used, an inducing agent may be added to the culture or the appropriate, optimal conditions for working may be set, e.g. a specific temperature, pH, ion concentration etc.
  • recovering refers to any suitable method for the extraction and/or purification of polypeptides from cells, cell suspensions or cell cultures known to the person skilled in the art.
  • Typical recovering methods include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction
  • HPLC high performance liquid chromatography
  • the present invention relates to a polypeptide encoded by the nucleic acid molecule as defined herein above or obtainable by the method of making a polypeptide as defined herein above, with the proviso that the polypeptide has not the amino acid sequence of SEQ ID NO: 5.
  • the polypeptides or proteins of the present invention may be glycosylated or may be non-glycosylated.
  • polypeptides or proteins of the invention may also include an initial modified methionine residue, in some cases as a result of hostmediated processes.
  • N- terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
  • polypeptide according to the present invention can also be recovered from products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures.
  • a polypeptide according to the invention can be chemically synthesized using techniques known in the art (e.g. Creighton, 1983, Proteins: Structures and Molecular Principles, W. H. Freeman & Co., N. Y., and Hunkapiller et al, 1984, Nature, 310, 105-111).
  • a polypeptide or peptide of the invention can be synthesized by use of a peptide synthesizer.
  • the present invention relates to an antibody or fragment thereof, that specifically binds to the polypeptide of the present invention as defined herein above or comprising the amino acid sequence of SEQ ID NO: 5.
  • said antibody specifically binds a polypeptide comprising parts or the entire sequence of exon 7 of LRP 1, more preferably said antibody specifically binds the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 or a polypeptide epitope of SEQ ID NO: 2, SEQ ID NO: 5 or SEQ ID NO: 10.
  • antibody refers to immunoglobulin molecules and
  • immunoglobulin molecules i. e. molecules that contain an antigen binding site that immunospecifically binds an antigen.
  • the immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e. g., IgGl, IgG2, IgG3, lgG4, IgAl and IgA2) or subclass of immunoglobulin molecule.
  • the antibody or fragment thereof as mentioned herein above comprises a human IgM heavy chain constant domain, a human IgGl heavy chain constant domain, a human IgG2 heavy chain constant domain, a human IgG3 heavy chain constant domain, a human IgG4 heavy chain constant domain, or a human IgA heavy chain constant domain.
  • the antibody or fragment as defined herein above in particular the antibody or fragment thereof comprising a human IgM heavy chain constant domain, a human IgGl heavy chain constant domain, a human IgG2 heavy chain constant domain, a human IgG3 heavy chain constant domain, a human IgG4 heavy chain constant domain, or a human IgA heavy chain constant domain as defined herein above, comprises a human Ig kappa light chain constant domain, or a human Ig lambda light chain constant domain.
  • binding refers to the immunospecific detection and binding of an antibody to an antigenic epitope as defined herein above.
  • the term “specifically binding” excludes non-specific binding but does not necessarily exclude cross-reactivity with other antigens, in particular with antigens comprising the same antigenic epitope detected by the present antibody.
  • antibodies of the invention include polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, Fab' fragments, fragments produced by a Fab expression library, F(ab')2, Fv, disulfide linked Fv, minibodies, diabodies, scFv, sc(Fv)2, whole immunoglobulin molecules, anti-idiotypic (anti-Id) antibodies (including, e. g., anti-Id antibodies to antibodies of the invention) and epitope-binding fragments of any of the above.
  • anti-Id anti-idiotypic antibodies
  • the antibodies are human antigen-binding antibody fragments of the present invention and include Fab, Fab' and F (ab')2, Fv, single-chain Fvs (scFv), sc(Fv)2, single-chain antibodies, disulfide- linked Fvs (sdFv) and fragments comprising either a VL or VH domain.
  • Fab fragment refers to antibody fragments consisting of the first constant domain of the heavy chain (CHI), the constant domain of the light chain (CL), the variable domain of the heavy chain (VH) and the variable domain of the light chain (VL) of an intact immunoglobulin protein.
  • Fab fragments are obtained by proteolytic cleavage by papain.
  • F(ab')2 or "F(ab')2 fragment” as used herein refers to antibody fragments consisting of two first constant domains of the heavy chain (CHI), two constant domains of the light chain (CL), two variable domains of the heavy chain (VH) and two variable domains of the light chain (VL) of an intact immunoglobulin protein, i.e. it comprises two Fab fragments. Additionally, F(ab')2 molecules comprise a S-S linkage in the antibody hinge region wich combines the Fab fragments. Typically, F(ab')2 fragments are obtained by proteolytic cleavage by pepsin.
  • Fab' fragment refers to fragments derived from “F(ab')2" molecules, preferably fragments comprising the S-S linkage in the antibody hinge region.
  • Fv fragments refers to antibody fragments consisting of the two variable antibody domains VH and VL (details may be derived from Skerra and Pluckthun, 1988, Science, 240: 1038-1041).
  • single chain Fv fragment relates to antibody fragments consisting of the two VH and VL domains linked together by a flexible peptide linker (details may be derived from Bird and Walker, 1991, Trends Biotechnol, 9: 132-137).
  • diabody refers to an antibody variant comprising a separated VH-VL and VL-VH fusion, wherein the fused domains are linked together by a flexible peptide linker.
  • the linker may have a length of about 1 to 20 amino acids, preferably of between about 2 and 7 amino acids. Typically, small amino acids like glycine may be used for the linker. They may also be combined with other amino acids (details may be derived from Hudson and Kortt, 1999, J Immunol Methods, 231(1-2): 177-89).
  • minibody refers to a size reduced antibody, e.g. an antibody comprising solely variable domains or lacking constant domains, or comprising the variable heavy domain (details may be derived from Quiocho, 1993, Nature, 362(6418): 293-294 and Skerra and Pluckthun, 1988, Science, 240: 1038-1041).
  • Antigen-binding antibody fragments may comprise the variable region(s) alone or in combination with the entirety or a portion of the hinge region, CHI, CH2, and/or CH3 domains. Also included in the invention are antigen- binding fragments also comprising any combination of variable region(s) with a hinge region, CHI, CH2, and CH3 domains.
  • the antibodies according to the invention may be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine (e. g., mouse and rat), donkey, monkey, rabbit, goat, guinea pig, camel, horse, or chicken.
  • the antibodies according to the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material.
  • Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which they recognize or specifically bind.
  • the epitope(s) or polypeptide portion(s) may be specified as described herein.
  • Preferred epitopes according to the present invention are set forth in SEQ ID NOs: 16 to 34.
  • Antibodies of the present invention may also be described or specified in terms of their cross-reactivity.
  • the present invention relates to antibodies that do not bind any other analog, ortholog, or homo log of a polypeptide of the present invention.
  • antibodies that bind polypeptides with at least 95%, at least 90%>, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are included in the present invention.
  • antibodies of the present invention may cross-react with murine, rat and/or rabbit homo logs of human proteins and the corresponding epitopes thereof.
  • Antibodies that do not bind polypeptides with less than 95%, less than 90%>, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention.
  • the above-described cross-reactivity is with respect to any single specific antigenic or immunogenic polypeptide, or
  • binding affinities include those with a dissociation constant or Kd less than 5 X 10 ⁇ 2 M, 10 ⁇ 2 M, 5 X 10 "3 M, 10 "3 M, 5 X 10 "4 M, 10 "4 M, 5 X 10 "5 M, 5 X 10 "6 M, 10 “6 M, 5 X 10 " 7 M, 10 ⁇ 7 M, 5 X 10 "8 M, 10 "8 M, 5 X 10 ⁇ 9 M, 10 ⁇ 9 M, 5 X 10 "10 M, 10 "10 M, 5 X 10 "11 M, 10 "11 M, 5 X 10 ⁇ 12 M, 10 "12 M, 5 X 10 "13 M, 10 "13 , 5 X 10 "14 M, 10 “14 M, 5 X 10 "15 M, or 10 "15 M
  • the invention also provides antibodies that may competitively inhibit binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, for example via immunoassays.
  • the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85 %, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.
  • the antibodies of the invention include derivatives which are modified, for instance by the covalent attachment of any type of molecule to the antibody such that said covalent attachment does not prevent the antibody from spefically binding to the epitope or from generating an anti-idiotypic response.
  • modifications are glycosylation, acetylation, pegylation,
  • Antibodies may be produced according to any suitable method known to the person skilled in the art.
  • Polyclonal antibodies may be produced by immunization of animals with the antigen of choice.
  • a polypeptide of the invention can be administered to various host animals including any eukaryotic, prokaryotic, or phage clone.
  • Monoclonal antibodies of defined specificity may be produced using, for instance, the hybridoma technology developed by Kohler and Milstein (Kohler and Milstein, 1976, Eur. J. Immunol., 6: 511-519).
  • mice are immunized with a polypeptide of the invention or a cell expressing such peptide.
  • an immune response e.g., antibodies specific for the antigen are detected in the mouse serum
  • the mouse spleen is harvested and splenocytes isolated.
  • the splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20.
  • Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.
  • Antibody fragments which recognize specific epitopes may be generated by known techniques.
  • Fab and F (ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F (ab') 2 fragments).
  • antibodies of the present invention can also be generated using various phage display methods known in the art.
  • phage display methods functional antibody domains are displayed on the surface of phage particles, which carry the polynucleotide sequences encoding them.
  • phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e. g., human or murine).
  • Phages expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e. g., using labeled antigen or antigen bound or captured to a solid surface or bead.
  • Phages used in these methods are typically filamentous phages including Ml 3 binding domains expressed from a phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein.
  • Examples of phage display methods that can be used to produce antibodies according to the present invention include those disclosed in Brinkman et al, 1995, J. Immunol. Methods 182: 41-50 and Ames et al, 1995, J. Immunol. Methods 184: 177-186.
  • the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria.
  • mammalian cells including mammalian cells, insect cells, plant cells, yeast, and bacteria.
  • Fab, Fab' and F (ab') 2 fragments can also be employed using methods known in the art such as those disclosed WO 92/22324 or Mullinax et al, 1992, BioTechniques 12 (6): 864-869.
  • chimeric antibody refers to a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. Further details may be derived from Morrison, 1985, Science 229:
  • humanized antibody refers to antibody molecules, which bind the desired antigen having one or more complementarity determining regions (CDRs) from the nonhuman species and framework regions from a human immunoglobulin molecule.
  • CDRs complementarity determining regions
  • framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding.
  • framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. Techniques for the production of humanized antibodies are known to the person skilled in the art. Further details may be derived from U. S. Patent No.
  • human antibody refers to antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin.
  • Human antibodies can be made by a variety of methods known in the art including phage display methods as described above using antibody libraries derived from human immunoglobulin sequences. Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous
  • immunoglobulins but which can express human immunoglobulin genes.
  • the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells.
  • human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes.
  • the mouse heavy and light chain immunoglobulin genes may be rendered nonfunctional separately or simultaneously with the introduction of human
  • the modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice.
  • the chimeric mice are then bred to produce homozygous offspring, which express human antibodies.
  • the transgenic mice are immunized in the normal fashion with a selected antigen, e. g., all or a portion of a polypeptide of the invention. Subsequently, monoclonal antibodies directed against the antigen can be obtained from the
  • transgenic mice using conventional hybridoma technology.
  • the human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation.
  • IgG, IgA, IgM and IgE antibodies Further details may be derived from Lonberg and Huszar, 1995, Int. Rev. Immunol. 13: 65-93 or from U. S. Patent No. 5,939,598.
  • completely human antibodies which recognize a selected epitope can be generated using a technique referred to as guided selection.
  • a selected non-human monoclonal antibody e.g., a mouse antibody
  • the antibody or fragment thereof as defined herein above is conjugated to a therapeutic or cytotoxic agent.
  • therapeutic agent refers to any compound, drug, small molecule or medicament, which is able to confer a therapeutic effect to a cell, a tissue or the entire organism. Examples of such agents are known to the person skilled in the art.
  • cytotoxic agent refers to any compound, drug, small molecule which is able to confer a toxic effect to a cell or a tissue.
  • agents may, for example, comprise compounds which activate endogenous cytotoxic effector systems, as well as radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death.
  • the term may also include radioisotopes known in the art, additional antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin.
  • cytotoxic produgs By "cytotoxic prodrug” is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound.
  • Cytotoxic prodrugs that may be used according to the invention include glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of doxorubicin. Further exemplary agents have been mentioned in the context of toxic proteins herein above.
  • the antibody or fragment thereof as defined herein above may be biotinylated or labeled.
  • biotinylated as used herein means that said antibody is covalently attached to the molecule biotin.
  • biotin may be linked to primary amines, e.g. present as lysine side chains in epsilon-amines or N-terminal alpha-amines.
  • the linkage may be performed via sulfhydryl groups, carboxyl groups, sugar groups or residues present on the antibody molecule.
  • the biotinylation may be carried out as non-specific biotinylation.
  • labeled means that said antibody may comprise one or more labels at the C- or N-terminus of the antibody chains. Alternatively, said antibody may also comprise one or more labels at any position throughout the molecule. Preferably said antibody comprises between 1 and 10 labels, which may either be identical or different or any combination thereof. More preferably, the antibody may comprise between 1 and 5 labels, even more preferably one label. Said labels may be any suitable label known to the person skilled in the art, e.g. radioactive, fluorescent or
  • said label is a radioactive label, an enzymatic label, a fluorescent label, a chemiluminescent or a bio luminescent label.
  • the term "enzymatic label” relates to labels, which comprise enzymatic activities.
  • a typical, preferred example is the horseradish peroxidase enzyme (HRP), which may be tethered or attached to the antibody.
  • HRP horseradish peroxidase enzyme
  • This enzyme complex subsequently may catalyze the conversion of a suitable substrate, e.g. a chemiluminescent substrate into a sensitized reagent in the vicinity of the antibody which horrtly lead to the emission of light or production of a color reaction.
  • a suitable substrate e.g. a chemiluminescent substrate into a sensitized reagent in the vicinity of the antibody which horrtly lead to the emission of light or production of a color reaction.
  • enhanced chemiluminescence which may be used in this context, allows detection of minute quantities of labeled molecules.
  • radioactive label relates to labels emitting radioactive radiation, preferably composed of radioactive isotopes.
  • radioactive isotope in the context of the label relates to any such factor known to the person skilled in the art. More preferably, the term relates to 3 H, 14 C, 32 P, 33 P, 35 S or 125 I.
  • chemiluminescent label relates to a label, which is capable of emitting light (luminescence) with a limited emission of heat as the result of a chemical reaction.
  • the term relates to luminol, cyalume, oxalyl chloride, TMAE (tetrakis (dimethylamino) ethylene), pyragallol, lucigenin, acridinumester or dioxetane.
  • bio luminescent label relates to a label, which is capable of emitting light due to a biochemical reaction.
  • the term refers to the production of light due to the reaction of a luciferin and a luciferase.
  • the luciferase catalyzes the oxidation of luciferin resulting in light and an inactive oxyluciferin.
  • an antibody according to the present invention may be linked to a luciferase.
  • the antibody may also be labeld with luciferin.
  • the luciferin and the luciferase as well as a co-factor such as oxygen, may be bound together to form a single photoprotein.
  • This molecule may be linked to an antibody according to the present invention.
  • a light emission may be triggered when a particular compound is present, e.g. a specific type of ion, preferably calcium.
  • luciferin to be used in the context of the present invention include bacterial luciferin, dino flagellate luciferin, vargulin, coelenterazine and firefly luciferin.
  • fluorescent label relates to chemically reactive derivatives of a fluorophores.
  • amine reactive isothiocyanate derivatives such as FITC and TRITC (derivatives of fluorescein and rhodamine), amine reactive succinimidyl esters such as NHS-fluorescein, and sulfhydryl reactive maleimide activated fluors such as fluorescein-5-maleimide. Reaction of any of these reactive dyes with another molecule results in a stable covalent bond formed between a fluorophore and a labelled molecule. Following a fluorescent labeling reaction, it is often necessary to remove any nonreacted fluorophore from the labeled target molecule.
  • a particular advantage of fluorescent labels is that signals from fluorescent labels do not disperse.
  • Another advantage of fluorescent labels is that an easy multiple-color hybridization detection may be carried out, which permits direct quantitative determination of the relative abundance of the labeld molecule.
  • any suitable fluorescent label known to the person skilled in the art may be used.
  • the fluorescent labels 6-FAM, HEX, TET, ROX, Cy3, Cy3-OSu, Cy5, Cy5-Osu, Texas Red or Rhodamine may be used.
  • antibodies may also be labeled or combined with fluorescent
  • polypeptides e.g. green fluorescent protein (GFP) as well as derivates thereof known to the person skilled in the art. These labels may be used either individually or in groups in any combination.
  • GFP green fluorescent protein
  • the present invention relates to a nucleic acid molecule encoding the antibody or fragment thereof as defined herein above.
  • the invention also relates to a nucleic acid molecule encoding the antibody or fragment thereof as defined herein above.
  • the invention also relates to a nucleic acid molecule encoding the antibody or fragment thereof as defined herein above.
  • nucleic acid molecules that hybridize under stringent or lower stringency hybridization conditions, e.g., as defined herein above, to nucleic acid molecules that encode an antibody.
  • the antibody encoded by such hybridizing molecules specifically binds to a polypeptide of the invention as defined herein above, more preferably to the polypeptide of SEQ ID NO: 2 or epitopes contained therein.
  • the nucleic acid molecules may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e. g., as described in Kutmeier et al, 1994, BioTechniques 17: 242).
  • a polynucleotide encoding an antibody may be generated from a nucleic acid from a suitable source. If, for example, a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a source like an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ R A, isolated from any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention. This may preferably be done by PCR amplification using suitable primers. Amplified nucleic acids generated by PCR may subsequently be cloned into replicable cloning vectors using any suitable method well known in the art.
  • nucleotide sequence and corresponding amino acid sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e. g., recombinant DNA techniques, site directed mutagenesis, PCR, etc., to generate antibodies having a different or modified amino acid sequence or in order to create amino acid substitutions, deletions, and/or insertions.
  • amino acid sequence of the heavy and/or light chain variable domains may be inspected to identify the sequences of the
  • CDRs complementarity determining regions
  • framework regions e.g., into human framework regions to humanize a non human antibody, as mentioned herein above.
  • the framework regions may be naturally occurring or consensus framework regions, preferably human framework regions.
  • the polynucleotide or nucleic acid generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds to a polypeptide of the invention, more preferably to the polypeptide of SEQ ID NO: 2 or epitopes contained therein.
  • one or more amino acid substitutions may be made within the framework regions.
  • such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds.
  • Other alterations to the polynucleotide as known to the person skilled in the art are also encompassed by the present invention.
  • a nucleic acid molecule encoding the antibody or fragment thereof as defined herein above may be used for recombinant antibody expression.
  • an expression vector containing a polynucleotide that encodes the antibody preferably an expression vector as defined herein above.
  • expression vectors contain the antibody coding sequences and appropriate transcriptional and translational control signals.
  • the vectors may either comprise coding sequences for the variable heavy chain or the variable light chain or for both.
  • Such vectors may also include the nucleotide sequence encoding the constant regions of the antibody molecule.
  • vectors encoding both the heavy and light chains may be co-expressed in an appropriate host cell for expression of the entire immunoglobulin molecule.
  • mammalian cells more preferably Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus may be used as an effective expression system for antibodies.
  • CHO Chinese hamster ovary cells
  • a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed.
  • the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced.
  • pGEX vectors may also be used to express the antibody coding sequence as fusion proteins with glutathione S-transferase (GST).
  • GST glutathione S-transferase
  • corresponding fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads followed by elution in the presence of free
  • the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
  • Autographa californica nuclear polyhedrosis virus may be used as a vector to express antibody coding sequences.
  • the virus grows in Spodoptera frugiperda cells.
  • the antibody coding sequence may, for example, be cloned
  • the present invention relates to a cell that produces the antibody or fragment thereof as defined herein above.
  • a cell may be a hybridoma cell as defined herein above or a cell, which expresses a nucleic acid molecule encoding an antibody according to the present invention.
  • Particularly preferred are cells or cell lines, which stably express the antibody molecule.
  • host cells are preferably transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker, e.g. functional expression control elements as defined herein above.
  • a plasmid comprising the antibody encoding sequence may be stably integrated into a cellular chromosome. Growing foci may subsequently be cloned and expanded into antibody producing cell lines.
  • the expression levels of an antibody molecule in a suitable host cell may be increased by vector amplification.
  • a marker in the vector system expressing antibody is amplifiable, an increase in the level of inhibitor present in culture of a host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will correspondingly also increase.
  • the host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide.
  • the two vectors may contain identical selectable markers, which enable equal expression of heavy and light chain polypeptides.
  • a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (for further details see, for example, Proudfoot, 1986, Nature 322: 52).
  • an antibody molecule of the invention may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, preferably by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins known to the person skilled in the art.
  • chromatography e.g., ion exchange, affinity, preferably by affinity for the specific antigen after Protein A, and sizing column chromatography
  • centrifugation e.g., centrifugation, differential solubility, or by any other standard technique for the purification of proteins known to the person skilled in the art.
  • the antibodies of the present invention or fragments thereof can be fused to any heterologous polypeptide sequence, preferably to those defined herein above, e.g. in order to facilitate antibody purification or to provide target means for the antibody.
  • the antibodies of the present invention may be fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention to generate fusion proteins.
  • the fusion may be direct or occur through linker sequences.
  • Corresponding antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors.
  • antibodies according to the present invention preferably antibodies specifically binding the polypeptide comprising amino acid sequence SEQ ID NO: 2 or peptides or epitopes derived therefrom may be fused to a ligand molecule, e.g. a receptor binding ligand and correspondingly be targeted to particular cell types, in particular to cell types expressing said receptor.
  • the present invention relates to an antibody which has the antigen- specific binding characteristics of the R4B6G5 antibody produced by the hybridoma clone R4B6G5 being deposited at the DSMZ under the accession No. DSM ACC3000.
  • hybridoma cells deposited at the DSMZ under the accession No. DSM ACC3000 relate to hybridoma cells deposited at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ) on 15 July 2009 and having the following deposit numbers: DSM ACC3000.
  • the DSMZ is located at the InhoffenstraBe 7 B, 38124 Braunschweig, Germany.
  • the aforementioned deposits were made pursuant to the terms of the Budapest treaty on the international recognition of the deposit of microorganisms for the purposes of patent procedures.
  • antibody having the antigen-specific binding characteristics of the R4B6G5 antibody refers to the typical antigen-specific binding criteria known to a person skilled in the art or derivable form a suitable text book, e.g. from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
  • the term relates to the presence of heavy and/or light chain variable regions of the R4B6G5 antibody, more preferably the term relates to the presence of CDR1, CDR2 and/or CDR3 of the light chain and/or CDR1, CDR2 and/or CDR3 of the heavy chain of the R4B6G5 antibody.
  • the antigen-specific binding characteristics may also be conveyed by amino acid sequences being homologous to CDR1, CDR2 and/or CDR3 of the light chain and/or CDR1, CDR2 and/or CDR3 of the heavy chain of the R4B6G5 antibody, e.g. sequences which are 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the CDR1, CDR2 and/or CDR3 of the light chain and/or CDR1 , CDR2 and/or CDR3 of the heavy chain of the R4B6G5 antibody, respectively.
  • the elucidation of the sequence of the variable regions of the R4B6G5 antibody may be carried out according to standard procedures known to the person skilled in the art, e.g. according to techniques as described herein above.
  • the present invention relates to an antibody produced by the hybridoma having DSMZ accession No. DSM ACC3000, i.e. antibody R4B6G5.
  • the present invention relates to an affinity ligand for an expression product which comprises a nucleotide sequence according to the present invention or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide according to the present invention or comprising the amino acid sequence of SEQ ID NO: 5.
  • affinity ligand for an expression product which comprises a nucleotide sequence according to the present invention or comprising the nucleotide sequence of SEQ ID NO: 4" as used herein refers to a nucleic acid molecule being able to specifically bind to a transcript or nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or to the complementary sequence, or to a corresponding RNA or DNA molecule.
  • the nucleic acid affinity ligand may also be able to specifically bind to a nucleic acid molecule being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in any one of SEQ ID NO: 1, 4, 7, 8 or 9, or a nucleic acid molecule encoding an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2, 5 or 10.
  • affinity ligand for a polypeptide according to the present invention or comprising the amino acid sequence of SEQ ID NO: 5" as used herein preferably refers to a peptide molecule being able to specifically bind to a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10.
  • the peptide affinity ligand may also be able to specifically bind to an amino acid sequence encoded by a DNA sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, 4, 7, 8 or 9, or to an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2, 5 or 10.
  • the term "peptide" refers to any type of amino acid sequence comprising more than 5 amino acids, e.g. polypeptide structures, protein structures or functional derivatives thereof. Furthermore, the peptide may be combined with further chemical moieties or functionalities.
  • expression product refers to a transcript or a mRNA molecule generated by the expression of LRPl gene such that alternative exon 7 is spliced in. More preferably, the term relates to a processed LRPl transcript as defined herein above, e.g. a sequence corresponding to SEQ ID NO: 4 or comprising SEQ ID NO: 1.
  • the affinity ligand is a miRNA or a siRNA molecule.
  • oligonucleotide specific for the expression product refers to a nucleotide sequence which is complementary to the sense- or antisense-strand of the alternative LRPl splice product according to the present invention, preferably to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7 or 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5.
  • the oligonucleotide sequence may also be complementary to a nucleotide sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, 4, 7 or 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5. or a nucleic acid sequence encoding an amino acid sequence being at least 75%, 80%>, 85%, 90%>, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2 or 5.
  • the oligonucleotide may have any suitable length and sequence known to the person skilled in the art. Typically, the oligonucleotide may have a length of between 8 and 60 nucleotides, preferably of between 10 and 35 nucleotides, more preferably a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Oligonucleotide sequences specific for the alternative LRP1 splice product according to the present invention may be defined with the help of software tools known to the person skilled in the art, e.g.
  • the oligonucleotide has the sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13.
  • oligonucleotides binding to sequences of exon 1 e.g. as forward primer
  • exon 7 or downstream sequences in the 3' region of exon 7 preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3 * region of exon 7 (e.g. as reverse primer)
  • examples of such oligonucleotides may have the sequence as set forth in SEQ ID NOs: 37, 38, 39, 40, 41, 42 and 43, wherein
  • oligonucleotides of SEQ ID NOs: 37, 39, 41 and 42 may be used as exon 1 specific forward primers and oligonucleotides of SEQ ID NOs: 38, 40 and 43 may be used as exon 7 specific reverse primers.
  • Particularly preferred are combinations of SEQ ID NOs: 37 and 38, 39 and 40, 41 and 38, 42 and 38, as well as 37 and 43.
  • oligonucleotides binding to sequences of exon 2 e.g. as forward primer
  • exon 7 or downstream sequences in the 3' region of exon 7 preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3 * region of exon 7 (e.g. as reverse primer)
  • oligonucleotides may have the sequence as set forth in SEQ ID NOs: 40, 44, 45, 46, 47, 48 and 49, wherein oligonucleotides of SEQ ID NOs: 44, 46, and 48 may be used as exon 2 specific forward primers and oligonucleotides of SEQ ID NOs: 40, 45, 47 and 49 may be used as exon 7 specific reverse primers.
  • Particularly preferred are combinations of SEQ ID NOs: 44 and 45, 46 and 47, 44 and 47, 48 and 40, as well as 46 and 49.
  • oligonucleotides binding to sequences of exon 3 e.g. as forward primer
  • exon 7 or downstream sequences in the 3' region of exon 7 preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3 * region of exon 7 (e.g. as reverse primer)
  • examples of such oligonucleotides may have the sequence as set forth in SEQ ID NOs: 47, 50, 51, 53, 54, and 55, wherein
  • oligonucleotides of SEQ ID NOs: 50, 52, 53 and 55 may be used as exon 3 specific forward primers and oligonucleotides of SEQ ID NOs: 47, 51, and 54 may be used as exon 7 specific reverse primers.
  • Particularly preferred are combinations of SEQ ID NOs: 50 and 51, 52 and 47, 53 and 47, 50 and 54, as well as 55 and 47.
  • oligonucleotides binding to sequences of exon 4 e.g. as forward primer
  • exon 7 or downstream sequences in the 3' region of exon 7 preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3 * region of exon 7 (e.g. as reverse primer)
  • oligonucleotides may have the sequence as set forth in SEQ ID NOs: 38, 40, 56, 57, 58, and 59, wherein oligonucleotides of SEQ ID NOs: 56, 57, 58 and 59 may be used as exon 4 specific forward primers and oligonucleotides of SEQ ID NOs: 38 and 40 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 56 and 40, 57 and 40, 56 and 38, 58 and 40, as well as 59 and 40.
  • oligonucleotides binding to sequences of exon 5 e.g. as forward primer
  • exon 7 or downstream sequences in the 3' region of exon 7 preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3 * region of exon 7 (e.g. as reverse primer)
  • oligonucleotides may have the sequence as set forth in SEQ ID NOs: 40, 45, 60, 61, and 62, wherein oligonucleotides of SEQ ID NOs: 60, 61, and 62 may be used as exon 5 specific forward primers and oligonucleotides of SEQ ID NOs: 40 and 45 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 60 and 40, 61 and 40, 62 and 40, 60 and 45, as well as 61 and 45.
  • oligonucleotides binding to sequences of exon 6 e.g. as forward primer
  • exon 7 or downstream sequences in the 3' region of exon 7 preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3 * region of exon 7 (e.g. as reverse primer)
  • oligonucleotides may have the sequence as set forth in SEQ ID NOs: 47, 63, 64, 65, 66, 67, 68, 69 and 70, wherein oligonucleotides of SEQ ID NOs: 63, 65, 67 and 69 may be used as exon 6 specific forward primers and oligonucleotides of SEQ ID NOs: 47, 64, 66, 68 and 70 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 63 and 64, 65 and 66, 67 and 68, 69 and 47, as well as 63 and 70. Furthermore, any suitable combination of forward and reverse primer oligonucleotides selected form SEQ ID NO: 37 to 70 is envisaged by the present invention.
  • any of these antibodies may be used for the detection of transcripts or sequences comprising alternative exon 7 of LRP 1 or corresponding sequences, and/or truncated LRP 1 transcripts or sequences, e.g. in PCR approaches.
  • probe specific for the expression product means a nucleotide sequence which is complementary to the sense- or antisense-strand of the alternative LPvPl splice product according to the present invention, preferably to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5.
  • the probe sequence may also be complementary to a nucleic acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or a nucleic acid sequence encoding an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%o or 99% identical to the sequence as set forth in amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5.
  • the probe may have any suitable length and sequence known to the person skilled in the art.
  • the probe may have a length of between 6 and 300 nucleotides, preferably of between 15 and 60 nucleotides, more preferably a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
  • Probe sequences specific for the alternative LRP1 splice product according to the present invention may be defined with the help of software tools known to the person skilled in the art, e.g.
  • the probe may be designed such that it is localized at a position in between the binding positions of a forward and reverse primer.
  • the probe may be designed such that it is localized in the proximity of one of the primer oligonucleotides. More preferably, it may be localized in the proximity of the forward primer.
  • aptamer specific for the expression product refers to a short nucleic acid molecule, e.g. RNA, DNA, PNA, CNA, HNA, LNA or ANA or any other suitable nucleic acid format known to the person skilled in the art, being capable of very specifically binding to the LRP1 splice product according to the present invention, preferably to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5.
  • the nucleic acid aptamer molecule may specifically bind to a DNA sequence depicted in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or a double stranded derivative thereof.
  • the nucleic acid aptamer according to the present invention may also bind to an RNA molecule corresponding to the LRP1 transcript, preferably an RNA molecule corresponding to the DNA sequence as set forth in SEQ ID NO: 1.
  • the nucleic acid aptamer may further be capable of specifically binding to a DNA sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or a nucleic acid sequence encoding an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2 or SEQ ID NO: 5 or RNA molecules corresponding to these sequences.
  • Nucleic acid aptamers may be generated according to any suitable method known to the person skilled in the art, e.g. by in vitro selection or SELEX methods.
  • nucleic acid apatamers may be generated and/or designed according to the guidance provided in Ellington and Szostak, 1990, Nature, 346:818-822; Brody and Gold, 2000, J. BiotechnoL, 74:5-13 or Mayer and Jenne, 2004, BioDrugs 18:351-359.
  • a nucleic acid aptamer according to the present invention may further be combined with additional moieties, e.g. with interacting portions like biotin or enzymatic functionalities like ribozyme elements.
  • aptamer specific for the polypeptide refers to a short peptide capable of interacting and specifically binding the LRP1 protein comprising an alternative exon of the present invention as defined herein above, preferably a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5.
  • the peptide aptamer may also be able to specifically bind to an amino acid sequence encoded by a nucleic acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or to an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2 or SEQ ID NO: 5.
  • a peptide aptamer is a variable peptide loop, comprising for example, 10 to 20 amino acids.
  • the peptide aptamer may preferably be attached at one or both ends to a scaffold structure.
  • the scaffold structure may be any molecule, preferably a protein, which has good solubility and compacity properties. Suitable scaffold molecules would be known to the person skilled in the art.
  • a preferred scaffold molecule to be used in the context of the present invention is the bacterial protein thioredoxin A.
  • the aptamer peptide loop may preferably be inserted within a reducing active site of the scaffold molecule. Alternatively, staphylococcal protein A and domains thereof and derivatives of these domains, such as protein Z (details may be derived from Nord et al, 1997, Nat. BiotechnoL, 15:772-777);
  • lipocalins (details may be derived from Beste et al, 1999, PNAS, 96: 1898-1903); ankyrin repeat domains (details may be derived from Binz et al, 2003, J. MoT Biol. 332: 489-503); cellulose binding domains (CBD) (details may be derived from Smith et al, 1998, J. MoT Biol. 277: 317-332; Lehtio et al, 2000, Proteins, 41 :316-322); Y crystallines (details may be derived from WO 01/04144); green fluorescent protein (GFP) (details may be derived from Peelle et al, 2001, Chem. Biol, 8:521- 534);
  • GFP green fluorescent protein
  • CTLA-4 human cytotoxic T lymphocyte-associated antigen 4
  • CTLA-4 human cytotoxic T lymphocyte-associated antigen 4
  • Knottin proteins may be derived from Wentzel et al. 2001, J. Bacteriol, 183: 7273-7284
  • Kunitz domains details may be derived from Roberts et al, 1992, Gene, 121 :9-15
  • PDZ domains details may be derived from Schneider et al, 1999, Nat.
  • Peptide aptamers may be generated according to any suitable method known to the person skilled in the art, typically via yeast two-hybrid approaches.
  • small molecule capable of specifically binding to the polypeptide in the context of the present invention refers to a small organic compound that is preferably biologically active, i.e. a biomolecule, but is preferably not a polymer.
  • Such an organic compound may have any suitable form or chemical property.
  • the compound may be a natural compound, e.g. a secondary metabolites or an artificial compound, which has been designed and generated de novo, or has been obtained via suitable screening approaches. Methods and techniques for the identification and preparation of small molecules as well as assays for the testing of small molecules are known to the person skilled in the art.
  • peptidomimetic capable of specifically binding to the polypeptide refers to a small protein-like chain designed to mimic a peptide.
  • a peptidomimetic may arise from a modification of an existing peptide, e.g. a peptide or peptide aptamer as defined herein above, in order to alter the molecule's properties.
  • a peptidomimetic may arise from a modification, which changes the molecule's stability or binding capability. These modifications typically involve changes to the peptide that will not occur naturally.
  • a peptidomimetic according to the present invention may have altered peptide backbones or may comprise non-natural amino acids.
  • a peptidomimetic according to the present invention may represent the LRPl protein comprising an alternative exon of the present invention as defined herein above, preferably a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 or an interacting or sequestering protein thereof.
  • non-coding RNA molecule specific for the expression product refers to a molecule, which does not function as polypeptide encoding mRNA transcripts, transfers RNAs (tRNAs) or ribosomal RNAs (rRNAs).
  • tRNAs RNAs
  • rRNAs ribosomal RNAs
  • the term relates to a molecule, which does not function as a polypeptide encoding a full-length LRP1 mRNA transcript or a LRP1 variant mRNA transcript as defined herein above, e.g. transcripts corresponding to the sequence of SEQ ID NO: 1, 3 or 4.
  • a non-coding RNA molecule specific for the expression product of the present invention shows a specific interaction with said expression product, e.g.
  • a specific binding reaction a specific interaction with processing procedures based on the expression product, a specific cleavage reaction, a specific editing reaction, a specific interaction with the translation of the transcript or the translocation of a translated protein or a specific interaction with the stability of the transcript etc.
  • Such a specific interaction may lead to the degradation of the expression product, its modification, an enhanced or decreased stability of the expression product, or an enhanced or decreased translation efficiency etc.
  • Non-coding RNA molecules according to the present invention may be identified and/or obtained by chemical or enzymatic sequencing (see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 636 and 637), by using specialized cDNA libraries (see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 637 to 639), by appropriate microarray analyses (see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 639 to 641), by genomic SELEX (see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 641 to 642).
  • chemical or enzymatic sequencing see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 636 and 637
  • specialized cDNA libraries see, for example, Huttenhof
  • non-coding RNAs may subsequently be characterized, e.g. by functional RNomics approaches as described in Huttenhofer and Vogel, 2006, NAR, 34(2): 635- 646, in particular on page 643). Accordingly identified non-coding RNAs are also encompassed by the present invention.
  • non-coding RNA molecules may, for example, be comprised in an ribo- nucleoprotein particle (RNP).
  • RNP ribo- nucleoprotein particle
  • Correspondingly associated protein factors may also be identified according to suitable methods, e.g. as described in Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular on page 642. Accordingly identified proteins are also encompassed by the present invention.
  • Ul adaptor molecules e.g. as described by
  • Ul adaptors are typically bifunctional oligonucleotides with a target domain complementary to a site in the target gene's terminal exon and a Ul domain that binds to the Ul small nuclear RNA component of the Ul small nuclear ribonucleoprotein (Ul snRNP) splicing factor.
  • Ul adpators according to the present invention may, thus, be complementary to a site in alternative exon 7 of LRP 1, e.g.
  • the complementary sequence thereof may be used.
  • the ultimate portion of the transcript comprising alternative exon 7 of LRP 1 or its 3' downstream region as comprised in the 3' portion of SEQ ID NO: 8 may be used as target sequence.
  • any different 3' terminal portions of LRP 1 transcripts may be used as target sequences, e.g. passages
  • LRP 1 transcripts comprise truncated LRP 1 transcripts, e.g.
  • transcripts comprising exons 1 or exons 1 and 2, or exons 1 to 3, or exons 1 to 4, or exons 1 to 5, or exons 1 to 6, or exons 1 to 7, or exons 1 to 8, or exons 1 to 9, or exons 1 to 10, or exons 1 to 11 etc. as defined herein above or any other truncated version of LRP 1, e.g. any of the hitherto known or yet unknown LRP 1 transcripts.
  • any suitable domain known to the person skilled in the art may be used, preferably a domain comprising or consisting of the sequence 5'-CAGGUAAGUA-3' (SEQ ID NO: 74).
  • different U domains or any variation of the Ul domain may be used.
  • the sequence may, thus, be extended by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides, deletions or additions in the sequence may be present, or any nucleotide may be changed or modified, as long as a hybridization with Ul sRNPs or any other suitable sRNP is possible.
  • plasmids comprising Ul complementary regions and target sit hybridzing regions, optionally also a poly A site.
  • Such plasmids may be expression plasmids comprising any suitable type of promoter known to the person skilled in the art, e.g. constitutive or regulable promoters.
  • Ul adaptor oligonucleotides comprising a Ul domain and a target domain complementary to the Ul snRNP and the target transcript, respectively (Goraczniak et al, 2009, Nature Biotechnology, 27(3): 257-263).
  • Such oligonucleotides may be comprised of RNA, DNA or any other suitable nucleic acid as known to the person skilled in the art, e.g. as described herein.
  • the oligonucleotide may be transferred into the cell or may be expressed therein as known to the person skilled in the art, e.g. as described herein.
  • RNA molecules are microRNAs or miRNAs.
  • miRNA refers to a short single- stranded RNA molecule of typically 18-27 nucleotides in length, which regulate gene expression. miRNAs are encoded by genes from whose DNA they are transcribed but are not translated into a protein. In a natural context miRNAs are first transcribed as primary transcripts or pri-miRNA with a cap and poly-A tail and processed to short, 70- nucleotide stem-loop structures known as pre-miRNA in the cell nucleus.
  • RNA-induced silencing complex This complex is responsible for the gene silencing observed due to miRNA expression and RNA interference. Either the sense strand or antisense strand of DNA can function as templates to give rise to miRNA.
  • RISC RNA-induced silencing complex
  • ssRNA motifs could be of different composition while their length is of high importance if processing is to take place at all.
  • the Drosha complex cleaves the RNA molecule ⁇ 22 nucleotides away from the terminal loop.
  • Pre-miRNAs may not have a perfect double-stranded RNA (dsRNA) structure topped by a terminal loop.
  • Dicer cleaves the pre-miRNA stem-loop, typically two complementary short RNA molecules are formed, but only one is integrated into the RISC complex. This strand is known as the guide strand and is typically selected by the argonaute protein, the catalytically active RNase in the RISC complex, on the basis of the stability of the 5' end.
  • the remaining strand is typically degraded as a RISC complex substrate.
  • miRNAs may base pair with their complementary mRNA molecules and inhibit translation or may induce mRNA degradation by the catalytically active members of the RISC complex, e.g. argonaute proteins.
  • Mature miRNA molecules are typically at least partially complementary to mRNA molecules corresponding to the expression product of the present invention, and fully or partially down-regulate gene expression.
  • miRNAs according to the present invention for instance as identifiable and obtainable according to to assays and methods described in Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, may be 100% complementary to their target sequences. Alternatively, they may have 1, 2 or 3 mismatches, e.g. at the terminal residues or in the central portion of the molecule.
  • miRNA molecules according to the present invention may have a length of between about 18 to 27 nucleotides, e.g. 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides. Preferred are 21 to 23 mers.
  • miRNAs having 100% complementarity may preferably be used for the degradation of nucleic acids according to the present invention, whereas miRNAs showing less than 100% complementarity may preferably be used for the blocking of translational processes.
  • miR As specific for the short transcript LRP1 marker obtained or identified according the above described methods may be used as markers themselves, in particular as cancer markers. Accordingly, the expression of miRNAs, their tissue distribution, the time course of their appearance etc. may be detected with the help of suitable tests and methods known to the person skilled in the art. Correspondingly accumulated information may be used for a diagnosis or prognostication of cancer or the progression of cancer.
  • siRNA refers to a particular type of antisense-molecules, namely small inhibitory RNA duplexes that induce the RNA interference (RNAi) pathway. These molecules can vary in length and may be between about 18-28 nucleotides in length, e.g. have a length of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides. Preferably, the molecule has a length of 21, 22 or 23 nucleotides.
  • the siRNA molecule according to the present invention may contain varying degrees of complementarity to their target mRNA, preferably in the antisense strand. siRNAs may have unpaired overhanging bases on the 5' or 3' end of the sense strand and/or the antisense strand.
  • siRNA includes duplexes of two separate strands, as well as single strands that can form hairpin structures comprising a duplex region.
  • the siRNA may be double-stranded wherein the double-stranded siRNA molecule comprises a first and a second strand, each strand of the siRNA molecule is about 18 to about 23 nucleotides in length, the first strand of the siRNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA via RNA interference, and the second strand of said siRNA molecule comprises nucleotide sequence that is complementary to the first strand.
  • siRNA molecules may be obtained according to methods of identifying antagonists as described herein.
  • a siR A molecule according to the present invention may be directed to a nucleic acid or transcript comprising the sequence of any one of SEQ ID NO: 1, 4, 7 or 8.
  • a siRNA molecule according to the present invention may be directed to a nucleic acid or transcript comprising exon 2 of the LRP1 gene, e.g. as derivable from Genbank Accession No.: NM_002332 (version NM_002332.2, GI: 126012561 as of March 12 2009).
  • siRNAs against LRP 1 are particularly preferred, in particular the LRP 1 transcript comprising alternative exon 7 or a part thereof, e.g. comprising a nucleic acid or transcript having, comprising or consisting of the sequence of any one of SEQ ID NO: 1, 4, 7 or 8, which are provided in the form of short hairpin RNAs or hnRNAs.
  • hnRNAs may be produced or designed according to any suitable method or technique known to the person skilled in the art, preferably as described in the Examples, e.g. in Example 10.
  • a tool like the one provided at http://www.molgyn.kgu.de/ genesilencer/genesilencer.html may be used in order to generate LRP 1 specific hnRNA molecules, in particular LRP 1 including exon 7 specific hnRNA molecules.
  • such an hnRNA or hnRNA encoding molecule may comprise a first recombinant nucleic acid molecule, comprising at least a first sequence corresponding to a stretch of SEQ ID NO: 1, 4, 7 or 8 and at least a second sequence corresponding to the reverse complement of said first sequence.
  • the stretch may comprise between 17 and 25 nucleotides, preferably between 18 and 22, more preferably 19 nucleotides.
  • a loop sequence may be present between the two stretches of nucleic acid sequence. This loop sequence may have a length of between about 6 to 12 nucleotides, preferably a length of 9 nucleotides.
  • the hnRNA or hnRNA encoding molecule may comprise a terminator signal and/or sequences comprising restriction sites for endonucleases, e.g. for BamHl or Hindlll.
  • the at least first sequence corresponding to a stretch of SEQ ID NO: 1, 4, 7 or 8 and at least a second sequence corresponding to the reverse complement of said first sequence may be either entirely complementary to the sequence of SEQ ID NO: 1, 4, 7 or 8 or its reverse complement, or the sequences may comprise one or more mismatches, e.g. 1, 2, 3, 4, or 5 mismatches. Preferred is the presence of one mismatch.
  • hnRNA molecules having the sequence of SEQ ID NO: 77, 78 or 79, or complementary sequences thereof and/or DNA molecules corresponding to said sequences such as sequences having, comprising or consisting of the sequence of SEQ ID NO: 71, 72 or 73, or other nucleic acid molecules such as LNAs, ANAs etc. comprising said sequence, as described herein.
  • plasmids or expression vectors capable of expressing said molecules as RNA molecules. Examples of such plasmids or vectors and of corresponding introduction or expression techniques would be known to the person skilled in the art.
  • the present invention relates to an antagonist of an expression product of the invention, preferably of an expression product comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, or 8.
  • antagonist of an expression product refers to any molecule or compound which is capable of reducing the amount or stability of an expression product of the present invention.
  • reducing the amount of an expression product means a diminishment of the amount of the expression product by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% in comparison to a control situation in which no antagonist is used.
  • reducing the stability of an expression product means that the half-life of an expression product is diminished, preferably by factor 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 1000 or 10000 in comparison to a control situation in which no antagonist is used.
  • said antagonist of an expression product according to the present invention is an antisense molecule against the nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRPl), more preferably against a nucleic acid comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, an aptamer specific for the expression product as defined herein above or a non-coding RNA molecule specific for the expression product as defined herein above.
  • said antagonist of an expression product according to the present invention is a miR A or a siR A molecule as defined herein above or a catalytic RNA molecule. Also preferred are antagonists obtainable or obtained according to the method of identifying antagonists of the present invention, as described herein.
  • antisense molecule refers to nucleic acids corresponding to the sequences comprised in SEQ ID NO: 1, 4, 7, 8 or 9 or the complementary strand thereof.
  • the antisense molecule of the invention comprises a sequence
  • antisense molecules complementary to the coding region sequence of the invention may be used, those complementary to the transcribed untranslated region are preferred.
  • antisense technology can be used to control, i.e. reduce or terminate gene expression through antisense DNA or RNA, or through triple-helix formation.
  • an antisense molecule may be generated internally by the organism, for example intracellularly by transcription from an exogenous sequence.
  • a vector or a portion thereof may be transcribed, producing an antisense nucleic acid of the invention.
  • Such a vector would contain a sequence encoding the antisense nucleic acid of the invention.
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense molecule.
  • Corresponding vectors can be constructed by recombinant DNA technology methods known to the person skilled in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells, e.g. vectors as defined herein above.
  • the antisense molecule may be separately administered.
  • the 5' coding portion of a nucleic acid according to the present invention e.g. of the sequence of SEQ ID NO: 1 or 4 may be used to design an antisense RNA or DNA oligonucleotide of from about 6 to 50 nucleotides in length.
  • the sequence of SEQ ID NO: 1 or 4 may be used to design an antisense RNA or DNA oligonucleotide of from about 6 to 50 nucleotides in length.
  • the sequence of SEQ ID NO: 1 or 4 may be used to design an antisense RNA or DNA oligonucleotide of from about 6 to 50 nucleotides in length.
  • the sequence of SEQ ID NO: 1 or 4 may be used to design an antisense RNA or DNA oligonucleotide of from about 6 to 50 nucleotides in length.
  • oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides in length.
  • the antisense nucleic acids of the invention typically comprise a sequence
  • RNA transcript complementary to at least a portion of an RNA transcript
  • complementarity means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex triplex formation in the case of double stranded antisense nucleic acids. The ability to hybridize will depend on both the degree of
  • the larger the hybridizing nucleic acid the more base mismatches with a RNA sequence of the invention it may contain and still form a stable duplex or triplex.
  • a person skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • antisense molecules complementary to the 5' end of the transcript e.g., the 5' untranslated sequence up to and including the AUG initiation codon may be used in or for the inhibition of translocation.
  • sequences complementary to the 3' untranslated sequences of mRNAs may also be used.
  • An antisense molecule according to the present invention may be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • An antisense molecule preferably an antisense olignucleotide or any further antisense nucleic acid molecule according to the present invention or a siRNA molecule according to the present invention or any other ncRNA molecule according to the present invention as defined herein above can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the molecule may include other appended groups such as peptides (e.
  • the molecule may accordingly be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent,
  • the molecule preferably an antisense molecule or antisense oligonucleotide, a siR A molecule or any other ncR A molecule, may comprise at least one modified base moiety which is selected from the group including 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-
  • the molecule may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
  • the molecule comprises alternatively or additionally at least one modified phosphate backbone, e.g. a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the antisense molecule e.g. the antisense oligonucleotide may be an a-anomeric oligonucleotide, i.e. an oligonucleotide, which forms specific double- stranded hybrids with complementary RNA in which the strands run parallel to each other.
  • Non-coding RNA molecules specific for the expression product e.g. the non-coding RNA molecules as defined herein above.
  • Preferred are a miRNA molecule as defined herein above or a siR A molecule as defined herein above, as well as a catalytic R A molecule or riboyzme
  • RNA refers to a non-coding RNA molecule, which is capable of specifically binding to a target mRNA and of cutting or degrading said target mRNA, e.g. a transcript comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 9.
  • ribozymes cleave mRNA at site specific recognition sequences and may be used to destroy mRNAs corresponding to the polynucleotides of the invention.
  • Preferred examples of ribozymes are hammerhead ribozymes. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA.
  • hammerhead ribozymes The construction and production of hammerhead ribozymes is known in the art and is described in Haseloff and Gerlach, 1988, Nature, 334: 585-591. There are numerous potential hammerhead ribozyme cleavage sites within each nucleotide sequence disclosed in the sequence listing. Preferably, the ribozyme may be engineered so that the cleavage recognition site is located near the 5' end of the mRNA corresponding to the polynucleotides of the invention.
  • Ribozymes or catalytic RNAs of the invention can be composed of modified
  • oligonucleotides and may be delivered to cells, which express the polynucleotides of the invention in vivo.
  • DNA constructs encoding a ribozyme or catalytic RNA according to the present invention may be introduced into the cell according to suitable methods known to the person skilled in the art.
  • a preferred method of delivery involves using a DNA construct encoding the ribozyme under the control of a strong constitutive promoter so that transfected cells will produce sufficient quantities of the ribozyme to destroy targeted messages and inhibit translation.
  • the present invention relates to an antagonist of the polypeptide of the invention, preferably of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10.
  • the antagonist may be any suitable antagonist of the polypeptide of the invention known to the person skilled in the art.
  • it may be a compound directly modulating the activity of said polypeptide, a dominant negative variant of said polypeptide, a molecule closely related to the natural ligand of said polypeptide, a polypeptide related to the LRP1 protein as set forth in SEQ ID NO: 6, an antibody according to the present invention, e.g. as defined herein above or a small molecule or peptidomimetic capable of specifically binding to the polypeptide, e.g. as defined herein above.
  • a compound directly modulating the activity of the polypeptide of the invention refers to a compound which is capable of decreasing or increasing the activity of the polypeptide of the present invention, typically via a direct interaction with said polypeptide. Preferred is a decreasing effect on the polypeptide.
  • a compound may be any direct interactor of the polypeptide, which has negative influence on the catalytic activity of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10.
  • Such a compound may preferably be an allosteric antagonist of the catalytic activity of the polypeptide of the present invention, e.g. a heterotropic allosteric modulator.
  • mutant negative variant of said polypeptide refers to a variant of the polypeptide of the invention, preferably of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10, which comprises an antimorphic modification, in particular which adversely affects the polypeptide of the invention, i.e. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10 or derivatives thereof.
  • antimorphic modification in particular which adversely affects the polypeptide of the invention
  • the antimorphic variant can interact with the polypeptide of the invention, i.e. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10, but blocks some aspect of its function.
  • such variants may comprise or lack specific domains of the polypeptide comprising SEQ ID NO: 2, 5 or 10 or derivatives thereof, e.g. one or more protein- protein interacting or dimerization domains, complex assembly domains, one or more membrane-associated domains etc.
  • Tests to identify dominant negative variants include appropriate genetic screenings, for instance readout-systems based on the expression of nucleic acids comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7 or 8 or the production of polypeptides comprising SEQ ID NO: 2, 5 or 10 or derivatives thereof.
  • molecule closely related to the natural ligand of said polypeptide refers to molecules which show a similarity or high degree of identiy with the natural ligand of the polypeptide of the invention, e.g. with a polypeptide comprising SEQ ID NO: 2, or 10 or derivatives thereof or the LRP1 full-length polypeptide as defined in SEQ ID NO: 5 or derivatives thereof.
  • Ligands of LRP1 comprise, for example, cellular prion protein, lactoferrin, alpha(2)-macroglobulin, ApoE, serpine- enzyme complexes, receptor-associated protein (RAP), protease nexin-1 (PN-1), blood clotting factor VIII, platelet-derived growth factor (PDGF-BB), transforming-growth factor-betal, amyloid precursor protein (APP) (TGF-betal), thrombospondin-1 (TSP-1), heat shock proteins (gp96, hsp90, hsp70) etc.; further ligands would be known to the person skilled in the art or can be derived from Lillis et al, 2008, Physiol Rev;
  • the term "high degree of identity” means that the molecules are at least about 70% to about 99.9%> identical to the mentioned ligands, preferably about 90%>, 95,%, 97%, 98% or 99%.
  • the term "similarity” as used in this context means that the molecule shows a lower degree of identity, e.g. between about 50%> to about 70%>. Such molecule can be rationally designed using known techniques.
  • Antagonistic activity of such molecules may be tested with appropriate assays.
  • cells expressing the polypeptide of the invention may be provided and subsequently contacted with a test compound potentially containing an antagonistic molecule to observe binding, stimulation, or inhibition of activity of either the polypeptide or the molecule.
  • the assay may further test binding of a candidate compound to the polypeptide of the invention, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to the polypeptide.
  • the present invention relates to the nucleic acid molecule comprising an alternative exon of LRPl or derivatives thereof as defined herein above, e.g. the nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or derivatives or variants thereof or the polypeptide encoded by an alternative exon of LRPl or derivatives thereof as defined herein above, e.g. the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5, or 10 or 9, or derivatives or variants thereof for use as a marker for cancer.
  • marker (or “marker unit”, “short splice variant LRP1 marker”, or “short splice variant LRP1 marker unit”, which may be used synonymously), as used herein, relates to the mentioned nucleic acid molecules or polypeptides according to the present invention, i.e. a nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as defined herein above, e.g. the nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or derivatives or variants thereof, or a polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as defined herein above, e.g.
  • polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5, or 10 or 9, or derivatives or variants thereof, whose expression level or amount is modified, preferably increased, in a cancerous cell or in cancerous tissue or in any type of sample comprising cancerous cells or cancerous tissues or portions or fragments thereof, in comparison to a control level or state.
  • control level (or "control state”), as used herein, relates to an expression level which may be determined at the same time as the test sample by using (a) sample(s) previously collected and stored from a subject/subjects whose disease state, e.g. non-cancerous, is/are known.
  • disease state or “cancerous disease state” relates to any state or type of cellular or molecular condition between (and excluding) a non-cancerous cell state and (including) a terminal cancerous cell state.
  • the term includes different cancerous proliferation/developmental stages or levels of tumor development in the organism between (and excluding) a non-cancerous cell state and (including) a terminal cancerous cell state.
  • Such developmental stages may include all stages of the TNM (Tumor, Node, Metastasis) classification system of malignant tumors as defined by the UICC, e.g. stages 0 and I to IV.
  • the term also includes stages before TNM stage 0, e.g. developmental stages in which cancer biomarkers known to the person skilled in the art show a modified expression or expression pattern.
  • cancer relates in the context of the present invention to a cancerous disease state as defined herein above.
  • non-cancerous relates in the context of the present invention to a condition in which neither benign nor malign proliferation can be detected. Suitable means for the detection of such a condition are known in the art.
  • control level may be determined by a statistical method based on the results obtained by analyzing previously determined expression level(s) of the nucleic acid molecule comprising an alternative exon of LRPl or derivatives thereof as defined herein above, e.g. the nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or derivatives or variants thereof or the polypeptide encoded by an alternative exon of LRPl or derivatives thereof as defined herein above, e.g. the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5, or 10 or 9, or derivatives or variants thereof in samples from subjects whose disease state is known.
  • control level can be derived from a database of expression patterns from previously tested subjects or cells.
  • the expression level of the short splice variant LRPl marker of the present invention in a biological sample to be tested may be compared to multiple control levels, whose control levels are determined from multiple reference samples. It is preferred to use a control level determined from a reference sample derived from a tissue type similar to that of the patient-derived biological sample. It is particularly preferred to use sample(s) derived from a subject/subjects whose disease state is non-cancerous or derived from a subject/subjects whose disease state is non-cancerous as defined herein above.
  • Examples of such a reference sample from a subject/subjects whose disease state is non-cancerous comprise cells or tissue parts derived from pancreas, kidney, muscle, liver, lung, heart, brain, placenta, spleen, thymus, prostate, testis, ovary, intestine, colon, blood, lymph, e.g. peripheral leukocytes, mammary gland, stomach, thyroid, uterus or mammary tissue.
  • Reference samples may also be derived from available panels, e.g. from human MTC panels, preferably MTC panels I or II (Clontech).
  • reference samples may comprise material derived from cells lines, e.g. immortalized cancer cell lines, or derived from tissue xenografts.
  • material, tissue or cells derived from breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus carcinoma, brain tumors, stomach carcinoma, colon carcinoma, melanoma, fibrosarcoma or blood tumor may be used.
  • a reference sample may, for example, comprise cells of at least one of the following tumor cell lines: MCF-7 (ACC 115), JIMT (ACC 589), MDA MB-231 (ATCC HTB-26), MDA MB-435, MDA MB-436 (ATCC HTB-130), LNCaP (ACC 256), PC-3 (ACC 465), Du-145 (ACC 261), OVCAR-3 (ATCC HTB 161), OVCAR-8, SKOV-3 (ATCC HTB 77), Colo-704 (ACC 198), SMKT-Rl, CAKI-2 (ACC 54), A549 (ACC 107), Colo 699 (ACC 196), HCC-15 (ACC 496), PA-TU-8988T (ACC 162), PANC-1 (ACC CRL-1469), 5637, ARK2, AN3-CA (ACC 267), 1321N1 (ECACC 86030102), LN405 (ACC 189), GOS-3 (ACC 408), SH-SY5Y (ACC 209), MKN
  • Reference material or samples may also be derived from fetal tissue. Samples as comprised in human fetal MTC Panel test kit (Clontech) may, for instance, be used.
  • the standard value of the expression levels of the short splice variant LRPl marker as defined herein above in a population with a known disease state may be obtained by any method known in the art. For example, a range of mean ⁇ 2 SD (standard deviation) or mean ⁇ 3 SD may be used as standard value.
  • control level may also be determined at the same time with the test sample by using (a) sample(s) previously collected and stored from a subject/subjects whose disease state is/are known to be cancerous, i.e. who have independently been diagnosed to suffer from certain cancer type.
  • a control level determined from a biological sample that is known not to be cancerous is called "normal control level". If the control level is determined from a cancerous biological sample, e.g. a sample from a subject for which was diagnosed independently, for breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma it may be designated as "cancerous control level”.
  • the present invention relates to the use of the short splice variant LRP1 marker as defined herein above for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer.
  • diagnosis cancer means that a subject or individual may be considered to be suffering from cancer, when the expression level of the short splice variant LRP1 marker of the present invention is modified, preferably increased or up- regulated, compared to a control level as defined herein above, preferably if compared to the normal control level as defined herein above.
  • diagnosis also refers to the conclusion reached through that comparison process.
  • the diagnosis may be carried out in vivo, or in vitro, or it may comprise steps carried out in vivo and steps carried out in vitro.
  • modified or modified expression level in the context of the present invention thus denotes a change in the expression level.
  • expression level refers to the amount of transcript comprising an alternative exon of LRP1 or derivatives thereof as defined herein above or the amount of subsequently translated, corresponding polypeptides. Expression levels are deemed to be "changed” when the expression of the short splice variant LRP1 marker, i.e. the presence of a nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as defined herein above, e.g. the nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or derivatives or variants thereof or the presence of a polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as defined herein above, e.g.
  • the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5, or 10 or 9, or derivatives or variants thereof, e.g. in a sample to be analysed differs by, for example, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, or more than 50% from a control level, or at least 0.1 fold, at least 0.2 fold, at least 1 fold, at least 2 fold, at least 5 fold, or at least 10 fold or more in comparison to a control level.
  • the control level may either be a normal control level or a cancerous control level as defined herein above. If a comparison with a cancerous control level is to be carried out an additional comparison with a normal control level is preferred. Such an additional comparison allows for the determination of a tendency of the modification, i.e. an increase or a decrease of the expression level is observed.
  • modified relates preferably to an increase or up-regulation of the expression level of the short splice variant LRPl marker if a test sample is compared to a control level.
  • the control level may either be a normal control level or a cancerous control level as defined herein above.
  • increased expression level or up-regulated expression level or “increase of expression level” in the context of the present invention thus denotes a reduction of the expression level of the short splice variant LRPl marker between a situation to be analysed, e.g. a situation derivable from a patient's sample, and a reference point, which could either be a normal control level or cancerous control level derivable from any suitable cancer stage known to the person skilled in the art.
  • Expression levels are deemed to be "increased” or “up-regulated” when the expression of the short splice variant LRPl marker increases by, for example, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, or more than 50% from a control level, or at least 0.1 fold, at least 0.2 fold, at least 1 fold, at least 2 fold, at least 5 fold, or at least 10 fold or more in comparison to a control level.
  • an additional similarity in the overall gene expression pattern between a sample obtained from a subject and a reference as defined herein above, which is cancerous indicates that the subject is suffering from a cancer.
  • the diagnosis may be combined with the elucidation of additional cancer biomarker expression levels.
  • biomarkers like MAGE antigen, a SSX antigen family member, NY-ESO- 1 , Melan- A/MART- 1 , gp 100, tyrosinase, tyrosinase-related protein 1 (TRP 1 ), TRP2, CEA, PSA, Her2/neu, p53, MUC1, PRAME, sarcosin (N-methylglycin), CA-125 (Carbophydrate antigen- 125) or survivin may be tested.
  • a cancer may be considered as being diagnosed when the expression level of the short splice variant LRPl marker of the present invention is modified, preferably increased or up-regulated, compared to the normal control level as defined herein above.
  • a breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma may considered as being diagnosed if the expression level of the short splice variant LRPl marker, as defined herein above, is increased by a value of between 20% to 80%, preferably by a value of 30%), 40%>, 50%>, 60%> or 70%> in a test sample in comparison to a control level.
  • the control level may either be a normal control level or a cancerous control level.
  • detecting cancer means that the presence of a cancerous disease or disorder in an organism may be determined or that a cancerous disease or disorder may be identified in an organism.
  • the determination or identification of a cancerous disease or disorder may be accomplished by a comparison of the expression level of the short splice variant LRPl marker of the present invention and the normal control level as defined herein above.
  • a cancer may be detected when the expression level of the short splice variant LRPl marker is similar to a cancerous control level as defined herein above.
  • a breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma may be detected if the expression level of the short splice variant LRPl marker is similar to a cancerous control level of an established
  • monitoring cancer as used herein relates to the accompaniment of a diagnosed or detected cancerous disease or disorder, e.g. during a treatment procedure or during a certain period of time, typically during 6 months, 1 year, 2 years, 3 years, 5 years, 10 years, or any other period of time.
  • accompaniment means that states of disease as defined herein above and, in particular, changes of these sates of disease may be detected by comparing the expression level of the short splice variant LRPl marker of the present invention in a sample to a normal or a cancerous control level as defined herein above in any type of periodical time segment, e.g.
  • the cancerous control level may be derived from samples corresponding to different stages of cancer development, e.g. stages 0 and I to IV of the TNM classification system.
  • the term relates to the accompaniment of a diagnosed breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma.
  • the monitoring may also be used for the accompaniment of such cancers, e.g. during a treatment procedure.
  • prognosticating cancer refers to the prediction of the course or outcome of a diagnosed or detected cancerous disease, e.g. during a certain period of time, during a treatment or after a treatment.
  • the term may also refer to a determination of chance of survival or recovery from a disease, as well as to a prediction of the expected survival time of a subject.
  • a prognosis may, specifically, involve establishing the likelihood for survival of a subject during a period of time into the future, such as 6 months, 1 year, 2 years, 3 years, 5 years, 10 years or any other period of time.
  • progression of cancer relates to a switch between different stages of cancer development, e.g. stages 0 and I to IV of the TNM classification, or any other stage or sub-stage, starting from a healthy condition up to a terminal cancer scenario.
  • switches are accompanied by a modification of the expression level of the short splice variant LRP1 marker, preferably a decrease, in a test sample in comparison to a previous test sample from the same individual.
  • a progression of cancer may considered as being detected or diagnosed if the short splice variant LRP1 marker expression level, as defined herein above, is increased by a value of between 3% to 50%, preferably by a value of 10%, 15%, 20% or 25% in a test sample in comparison to a previous test sample from the same individual.
  • the modification may be detected over any period of time, preferably over 1, 2, 3, 4, 5, 6, 7, 8 9, 10, 11, 12 months, 1.5, 2, 3, 4,
  • the value indicated above may be calculated by comparing the expression level of the short splice variant LRP1 marker at a first point in time and at a second point in time after the above indicated period of time.
  • the modification may be detected over any period of time, preferably over 1, 2, 3, 4, 5,
  • 6, 7, 8, 9, 10, 11, 12 months, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 years, i.e. the value indicated above may be calculated by comparing the expression level of the short splice variant LRPl marker at a first point in time and at a second point in time after the above indicated period of time.
  • the present invention relates to the diagnosis and detection of a predisposition for developing cancer, preferably prostate cancer, more preferably hormone-resistant prostate cancer.
  • a "predisposition for developing cancer” in the context of the present invention is a state of risk of developing cancer.
  • a predisposition for developing cancer may be present in cases in which the short splice variant LRPl marker expression level as defined herein above is above a cancerous control level as defined herein above, i.e. a reference expression level derived from tissues or samples of a subject which evidently suffers from cancer.
  • the term "above” in this context relates to an expression level of the short splice variant LRPl marker, which is increased by about 40 % to 80% in comparison to such a cancerous control level, preferably increased by about 50%>.
  • a predisposition for developing cancer in the context of the present invention may be given in situations in which the short splice variant LRPl marker expression level as defined herein above is above a cancerous control level as defined herein above, i.e. a reference expression level derived from tissues or samples of a subject which evidently suffers from cancer, preferably by about 20%> to 40%>, more preferably by about 30% and in which further, alternative cancer markers, e.g. PSA or CA-125, show no modification of expression level or a modification of the expression pattern. Suitable further cancer markers are known to the person skilled in the art.
  • a predisposition for cancer may be considered as being diagnosed or detected if one of the above depicted situations is observed.
  • control nucleic acids or polypeptides e.g. the expression products or produced amino acids of housekeeping genes whose expression levels are known not to differ depending on the cancerous or non-cancerous state of the cell.
  • control genes include inter alia beta-actin, glycerinaldehyde 3-phosphate dehydrogenase (GAPDH), and ribosomal protein PI .
  • Further control nucleic acids or polypeptides comprise the full-length LRP1 gene, e.g.
  • nucleotide sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 6 preferably portions of the full-length LRP1 transcript and polypeptide, which are not comprised in the nucleotide sequence of any one of SEQ ID NOs: 1, 4, 7 or 8 or in the polypeptide sequence of any one of SEQ ID NOs: 2 or 5, more preferably portions comprising exons 8 to 89 of full-length LRP1 as defined herein above or as derivable from Genbank Accession No. NM_002332.2 (as of 18 March 2009).
  • the presence of full- length LRP1 transcripts may be detected by using oligonucleotide primers having the sequence of SEQ ID NO: 14 and 15.
  • the terms “diagnosing” and “prognosticating” are also intended to encompass predictions and likelihood analyses.
  • the short splice variant LRP1 marker of the present invention may accordingly be used clinically in making decisions concerning treatment modalities, including therapeutic intervention or diagnostic criteria such as a surveillance for the disease.
  • an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease.
  • the present invention may be used to detect cancerous cells in a subject-derived tissue, and provide a doctor with useful information to diagnose that the subject suffers from the disease.
  • a subject or individual to be diagnosed, monitored or in which a cancer, a progression of cancer or predisposition for cancer is to be detected or prognosticated according to the present invention is a mammal, preferably a human being. Further preferred are mammals such as dogs, cats, mice, rats, monkeys, rabbits, goats, sheep, pigs, guinea pigs, cattle, horses etc.
  • the short splice variant LRP1 marker may be used as a marker for metastases or circulating tumor or cancerous cells, e.g. in body fluids like blood or the liquor. Due to the non-expression of the short splice variant LRP1 marker in blood cancer cells (see Example 3) non-hemato logic or non- blood cancer cells may easily be detected. The detection of such cells may be considered as indication for a metastasing cancer or tumor or the presence of disintegrating cancerous tissue. The detection may be carried out in vivo, or in vitro, or it may comprise steps carried out in vivo and steps carried out in vitro.
  • the present invention relates to a diagnostic composition
  • a diagnostic composition comprising an affinity ligand for an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8. or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5.
  • the diagnostic composition may be for use in vivo, or in vitro situations, for both.
  • the present invention relates to a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer or a predisposition for cancer in an individual comprising an affinity ligand for an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8. or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5.
  • the diagnostic composition may be for use in vivo, or in vitro situations, for both.
  • diagnostic detecting
  • monitoring detecting
  • prognosticating have already been defined herein above and are used in this context with the same meaning.
  • Affinity ligands to be comprised in diagnostic compositions according to the present invention have already been described herein above.
  • Preferred affinity ligands to be used in a diagnostic composition of the present invention include an oligonucleotide or a set of oligonucleotides, typically in forward and reverse direction, specific for the expression product as defined herein above, preferably one or more oligonucleotides as defined herein above, a probe specific for the expression product as defined herein above, an aptamer specific for the expression product or the polypeptide as defined herein above, a small molecule or peptidomimetic capable of specifically binding to the polypeptide of the invention as defined herein above and an antibody against the polypeptide of the present invention as defined herein above.
  • composition may additionally comprise suitable control agents or compound.
  • diagnostic composition may comprise a set of oligonucleotides having the nucleotide sequences of SEQ ID NO: 12 and 13 or any suitable combination of forward and reverse primers selected from SEQ ID NOs: 37 to 70, as a control agent a set of oligonucleotides having the nucleotide sequence of SEQ ID NO: 14 and 15, and/or antibody R4B6G5 (produced by a hybridoma having DSMZ accession No. DSM ACC3000).
  • a diagnostic composition according to the present invention may comprise accessory ingredients like PCR buffers, dNTPs, a polymerase, ions like bivalent cations or monovalent cations, hybridization solutions, secondary affinity ligands like, e.g. secondary antibodies, detection dyes and any other suitable compound or liquid necessary for the performance of a detection based on any of the affinity ligands as defined herein above, which is known to the person skilled in the art.
  • accessory ingredients like PCR buffers, dNTPs, a polymerase, ions like bivalent cations or monovalent cations, hybridization solutions, secondary affinity ligands like, e.g. secondary antibodies, detection dyes and any other suitable compound or liquid necessary for the performance of a detection based on any of the affinity ligands as defined herein above, which is known to the person skilled in the art.
  • the present invention relates to the use of a nucleic acid or peptide affinity ligand for an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5 for the preparation of a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer or a predisposition for cancer, as described herein above.
  • a nucleic acid or peptide affinity ligand for an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5 for the preparation of a diagnostic composition for
  • the diagnosing, detecting, monitoring or prognosticating of cancer or of the progression of cancer or of a predisposition for cancer may be performed in vivo, or in vitro situations, or partially in vivo and in vitro.
  • the invention relates to the use of a oligonucleotide or a set of oligonucleotides, typically in forward and reverse direction, specific for the expression product as defined herein above, a probe specific for the expression product as defined herein above, an aptamer specific for the expression product or the polypeptide as defined herein above, a small molecule or peptidomimetic capable of specifically binding to the polypeptide of the invention as defined herein above and an antibody against the polypeptide of the present invention as defined herein above and optionally a control agent, e.g. a set of control
  • oligonucleotides for the preparation of a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer or a predisposition for cancer.
  • the present invention relates to the use of a set of oligonucleotides having the nucleotide sequences of SEQ ID NO: 12 and 13 or any suitable combination of forward and reverse primers selected from SEQ ID NOs: 37 to 70, of a control agent comprising the oligonucleotides having the nucleotide sequence of SEQ ID NO: 14 and 15, and/or of antibody R4B6G5 (produced by a hybridoma having DSMZ accession No. DSM ACC3000) for the preparation of a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer or a predisposition for cancer.
  • the present invention relates to a diagnostic kit, preferably for detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer.
  • a diagnostic kit may comprise an affinity ligand for an expression product which comprises a nucleic acid molecule of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5.
  • the invention relates to a kit comprising an oligonucleotide or a set of oligonucleotides, typically in forward and reverse direction, specific for the expression product as defined herein above, preferably an oligonucleotide or set of oligonucleotides as defined herein above, a probe specific for the expression product as defined herein above, an aptamer specific for the expression product or the polypeptide as defined herein above, a small molecule or peptidomimetic capable of specifically binding to the polypeptide of the invention as defined herein above and an antibody against the polypeptide of the present invention as defined herein above and optionally a control agent, e.g. a set of control oligonucleotides.
  • a control agent e.g. a set of control oligonucleotides.
  • the present invention relates to a kit comprising a set of oligonucleotides having the nucleotide sequences of SEQ ID NO: 12 and 13, or any suitable combination of forward and reverse primers selected from SEQ ID NOs: 37 to 70, a control agent comprising the oligonucleotides having the nucleotide sequence of SEQ ID NO: 14 and 15, and/or antibody R4B6G5 (produced by a hybridoma having DSMZ accession No. DSM ACC3000).
  • LRP 1 oligonucleotides comprising SEQ ID NOs: 37 and 38, 39 and 40, 41 and 38, 42 and 38, 37 and 43, 44 and 45, 46 and 47, 44 and 47, 48 and 40, 46 and 49, 50 and 51, 52 and 47, 53 and 47, 50 and 54, 55 and 47, 56 and 40, 57 and 40, 56 and 38, 58 and 40, 59 and 40, 60 and 40, 61 and 40, 62 and 40, 60 and 45, 61 and 45, 63 and 64, 65 and 66, 67 and 68, 69 and 47, as well as 63 and 70, or any groupings thereof.
  • the diagnostic kits of the present invention contain one or more agents allowing the specific detection of the short splice variant LRP1 marker.
  • the agents or ingredients of a diagnostic kit may, according to the present invention, be comprised in one or more containers or separate entities. The nature of the agents is determined by the method of detection for which the kit is intended. Where detection at the short splice variant LRP1 marker mR A expression level, i.e.
  • the agents to be comprised may be a set of oligonucleotides specific for the short splice variant LRP1 marker and/or a probe specific for the short splice variant LRP1 marker as defined herein above, which may be optionally labeled according to methods known in the art, e.g. with labels described herein above.
  • the agents to be comprised may be antibodies or compounds containing an antigen-binding fragment of an antibody or antibody variants as defined herein above, specific for an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5.
  • a diagnostic kit of the present invention contains detection reagents for the expression product or the polypeptide of the invention.
  • detection reagents comprise, for example, buffer solutions, labels or washing liquids etc.
  • the kit may comprise an amount of a known nucleic acid molecule, which can be used for a calibration of the kit.
  • a diagnostic kit for the detection of the expression products of the present invention may comprise accessory ingredients like a PCR buffers, dNTPs, a polymerase, ions like bivalent cations or monovalent cations, hybridization solutions etc.
  • a diagnostic kit for the detection of proteins of the present invention may comprise accessory ingredients like secondary affinity ligands, e.g.
  • kit may comprise an instruction leaflet.
  • the present invention relates to a method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of determining the level of an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 or of a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5.
  • determining the level of an expression product refers to the determination of the presence and/or amount of short splice variant LRP1 marker expression products, e.g. short splice variant LRP1 marker transcript(s) which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 and/or the determination of the presence and/or amount of short splice variant LRP1 marker protein(s), i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5.
  • the determination the presence and/or amount of short splice variant LRP1 marker expression products, e.g. short splice variant LRP1 marker transcript(s) and/or short splice variant LRP1 marker protein(s) may be accomplished by any means known in the art.
  • the short splice variant LRP1 marker expression level(s) may be determined by a method involving the detection of an mRNA encoded by the short splice variant LRP1 marker, the detection of the short splice variant LRP1 marker protein encoded by the short splice variant LRP1 marker transcript and/or the detection of the biological activity of the short splice variant LRP1 marker protein.
  • the measurement of the nucleic acid level of the LRPl marker expression may be assessed by separation of nucleic acid molecules (e.g.
  • RNA or cDNA obtained from the sample in agarose or poly aery lamide gels, followed by hybridization with short splice variant LRPl marker specific oligonucleotide probes, e.g. as defined herein above.
  • the difference in expression level may be determined by the labeling of nucleic acid obtained from the sample followed by separation on a sequencing gel. Nucleic acid samples may be placed on the gel such that patient and control or standard nucleic acid are in adjacent lanes. Comparison of expression levels may be accomplished visually or by means of a densitometer.
  • nucleic acid level of short splice variant LRPl marker expression may be detected in a microarray approach.
  • sample nucleic acids derived from subjects to be tested are processed and labeled, preferably with a fluorescent label.
  • nucleic acid molecules may be used in a hybridization approach with immobilized capture probes corresponding to the short splice variant LRPl marker of the present invention or known biomarker or cancer marker genes. Suitable means for carrying out microarray analyses are known to the person skilled in the art.
  • microarray based expression profiling may be carried out, for example, by the method as disclosed in "Microarray Biochip Technology” (Schena M., Eaton Publishing, 2000).
  • a DNA array comprises immobilized high-density probes to detect number of genes.
  • the probes on the array are complementary to one or more parts of the sequence of the marker gene, or to the entire coding region of the marker gene.
  • any type of short splice variant LRPl marker associated polynucleotide may be used as probe for the DNA array, as long as the polynucleotide allows for a specific distinction between short splice variant LRPl marker expression and the expression of other genes.
  • oligonucleotides are useful as probes.
  • a probe involving the specific portions of alternative exon 7 LRPl more preferably a probe derived of or comprising the sequence of SEQ ID NO: 1, 7 or 8 may be used as a probe.
  • the determination of the short splice variant LRPl marker expression also the determination of the expression of other genes, e.g. additional biomarker or cancer marker genes may be accomplished.
  • a DNA array-based detection method typically comprises the following steps: (1) Isolating mRNA from a sample and optionally converting the mRNA to cDNA, and subsequently labeling this RNA or cDNA. Methods for isolating RNA, converting it into cDNA and for labeling nucleic acids are described in manuals for micro array technology. (2) Hybridizing the nucleic acids from step 1 with probes for the marker genes.
  • the nucleic acids from a sample can be labeled with a dye, such as the fluorescent dyes Cy3 (red) or Cy5 (blue). Generally a control sample is labeled with a different dye.
  • a marker gene can be represented by two or more probes, the probes hybridizing to different parts of a gene. Probes are designed for each selected marker gene. Such a probe is typically an oligonucleotide comprising 5-50 nucleotide residues, preferably about 40 nucleotide residues. Longer DNAs can be synthesized by PCR or chemically. Methods for synthesizing such oligonucleotides and applying them on a substrate are well known in the field of micro-arrays. Genes other than the marker genes may be also spotted on the DNA array. For example, a probe for a gene whose expression level is not significantly altered may be spotted on the DNA array to normalize assay results or to compare assay results of multiple arrays or different assays.
  • a DNA array may comprise exon and intron sequences of LRP 1 as defined herein above.
  • a DNA array according to the present invention may comprise only exon sequences of LRPl as defined herein above.
  • a DNA array according to the present invention may comprise only intron sequences of LRP 1, preferably intron 1-2, intron 2-3, intron 3-4, intron 4-5,intron 5-6 or intron 6-7 as defined herein above.
  • a DNA array may comprise oligonucleotide probes comprising sequences of exon 1 to alternative exon 7, more preferably of exon 2 to alternative exon 7, exon 3 to alternative exon 7, exon 4 to alternative exon 7, exon 5 to alternative exon 7, and most preferably exon 6 to alternative exon 7 of LRP 1, as defined herein above.
  • Particularly preferred is the presence of sequences of alternative exon 7 and intron 6-7 of LRP 1 as well as of 3' downstream sequences of alternative exon 7 of LRP 1 as described herein above.
  • the oligonucleotide may have any suitable length.
  • the oligonucleotide may comprise sense or antisense sequences of the LRP 1 exons and/or introns as defined herein above.
  • the array may comprise any suitable type of control probes, e.g. match probes, mismatch probes, loading probes etc.
  • the nucleic acid level of short splice variant LRPl marker expression may be detected in a quantitative RT-PCR approach, preferably in a real-time PCR approach following the reverse transcription of the short splice variant LRPl marker mRNA transcript.
  • a transcript is reverse transcribed into a cDNA molecule according to any suitable method known to the person skilled in the art, e.g. a method as derivable from standard textbooks like Sambrook et al, Molecular Cloning: A Laboratory Manual, 2001, Cold Spring Harbor Laboratory Press.
  • a quantitative or real-time PCR approach may subsequently be carried out based on a first DNA strand obtained as described above.
  • FRET fluorescent resonance energy transfer
  • Taqman or Molecular Beacon probes as principal FRET-based probes of this type may be used for quantitative PCR detection.
  • the probes preferably short splice variant LRPl marker probes as defined herein above, serve as internal probes which are used in conjunction with a pair of opposing primers that flank the target region of interest, preferably a set of short splice variant LRPl marker oligonucleotides as defined herein above.
  • the probe may selectively bind to the products at an identifying sequence in between the primer sites, thereby causing increases in FRET signaling relative to increases in target frequency.
  • a Taqman probe to be used for a quantitative PCR approach may comprises a short splice variant LRPl marker oligonucleotide as defined above of about 22 to 30 bases that is labeled on both ends with a FRET pair.
  • the 5' end will have a shorter wavelength fiuorophore such as fluorescein (e.g. FAM) and the 3' end is commonly labeled with a longer wavelength fluorescent quencher (e.g. TAMRA) or a non-fluorescent quencher compound (e.g. Black Hole Quencher).
  • FAM fluorescein
  • TAMRA fluorescent quencher
  • non-fluorescent quencher compound e.g. Black Hole Quencher
  • the probe normally coil in a random fashion or fold so that the labeled ends are in proximity and 5' fluorescent emissions are effectively quenched.
  • the probe binds to an internal target sequence during the annealing step of PCR, the advancing Taq polymerase having 5 -3' exonuclease activity will degrade the bound probe and thus permanently release the components in solution. Once a 5' fluorophore is thereby released, it can emit fluorescent signaling, and thus the level of fluorescence that results is proportional to the frequency of amp
  • the probes to be used for quantitative PCR in particular the short splice variant LRPl marker probes as defined herein above, have no guanine (G) at the 5' end adjacent to the reporter dye in order to avoid quenching of the reporter fluorescence after the probe is degraded.
  • G guanine
  • a Molecular Beacon probe to be used for a quantitative PCR approach uses FRET interactions to detect and quantify a PCR product, with each probe having a 5' fluorescent-labeled end and a 3' quencher-labeled end. Further details may be derived from US 5,925,517.
  • Molecular Beacons include short artificial segments of 5 to 7 bases at each end that are complementary to one another but not complementary to the target. In the absence of target binding, these matching end sequences will bind together in solution, thereby bringing the quencher- labeled end in proximity to the fluorophore-labeled end so that fluorescent signaling is suppressed.
  • This hairpin or stem-loop configuration of the probe structure comprises preferably a stem with two short self-binding ends and a loop with a long internal target-specific region of about 20 to 30 bases. Due to this configuration and the relatively greater length of the target-specific region, Molecular Beacon probes according to the present invention may preferentially hybridize to available complementary targets, thereby causing the probes to straighten and extend. Consequently, with target binding, the labeled ends of the probe may separate from one another, thereby releasing fluorescent emissions. This mechanism typically does not depend on the degradation of the probe and may, thus, be employed in a variety of detection schemes in addition to PCR assays based on Taqman probes.
  • Alternative detection mechanisms which may also be employed in the context of the present invention are directed to a probe fabricated with only a loop structure and without a short complementary stem regions (see, for example, US 5,691,146).
  • An alternative FRET-based approach for quantitative PCR which may also be used in the context of the present invention is based on the use of two hybridization probes that bind to adjacent sites on the target wherein the first probe has a fluorescent donor label at the 3' end and the second probe has a fluorescent acceptor label at its 5' end (see, for example, Wittmer et al., 1997, Biotechniques, 22: 130-138).
  • FRET-based approach is based on Scorpion probes, which provide a FRET-based stem-loop detection mechanism similar to Molecular Beacons, except that the probe also has a segment attached that serves as an amplification primer (see Whitcombe et al, 1999, Nat BiotechnoL, 17(8): 804-7).
  • the stem-loop structure may be cut into two units with one unit having four components, i.e., the 5' fluorophore, the target specific segment, the blocker and the primer, and with the other unit having the quencher and a probe segment.
  • PCR in particular nested PCR or fluorescence PCR, may be employed for any detection steps based on the presence of the short splice variant LRPl marker expression product.
  • PCRs may be particularly useful in the context of the analysis of body fluid samples, e.g. blood samples. Corresponding techniques and strategies would be known to the person skilled in the art.
  • the measurement of protein levels of the short splice variant LRPl marker protein may be carried out via any suitable detection technique known in the art.
  • the protein level of the short splice variant LRPl marker may be determined
  • the present invention also envisages the use of peptide affinity ligands like aptamers specific for the short splice variant LRPl marker protein as defined herein above. Determination of the protein levels of the short splice variant LRPl marker protein can be accomplished, for example, by the separation of proteins from a sample on a polyacrylamide gel, followed by identification of the short splice variant LRPl marker protein using specifically binding antibodies in a Western blot analysis. Alternatively, proteins can be separated by two-dimensional gel electrophoresis systems.
  • Two- dimensional gel electrophoresis is well known in the art and typically involves isoelectric focusing along a first dimension followed by SDS-PAGE electrophoresis along a second dimension.
  • the analysis of 2D SDS-PAGE gels can be performed by determining the intensity of protein spots on the gel, or can be performed using immune detection.
  • protein samples are analyzed by mass spectroscopy.
  • short splice variant LRPl marker protein specific antibodies may be placed on a support and be immobilized. Proteins derived from samples or tissues to be analyzed may subsequently be mixed with the antibodies. A detection reaction may then be carried out, e.g. with a second affinity ligand as defined herein above, preferably with a specific antibody.
  • Immunoassays which may be used in the context of the present invention, in particular for the diagnostic purposes of the present invention, include, for example, competitive and non-competitive assay systems using techniques such as western blots,
  • radioimmunoassay like RIA (radio-linked immunoassay), ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, e.g. latex agglutination, complement-fixation assays,
  • immunoradiometric assays fluorescent immunoassays, e.g. FIA (fluorescence- linked immunoassay), chemiluminescence immunoassays, electrochemiluminescence immunoassay (ECLIA) and protein A immunoassays.
  • fluorescent immunoassays e.g. FIA (fluorescence- linked immunoassay)
  • chemiluminescence immunoassays chemiluminescence immunoassays
  • electrochemiluminescence immunoassay ELIA
  • protein A immunoassays protein A immunoassays.
  • immunoprecipitation protocols may comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding a suitable antibody to the cell lysate, incubating for a period of time (e.g., 1 -4 hours) at 4°C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 4°C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer.
  • a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxy
  • the ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis.
  • Method parameters may suitable be modified by the person skilled in the art, for instance in order to increase the binding of the antibody to an antigen and/or decrease the background (e.g., by pre-clearing the cell lysate with sepharose beads or the like). Details may, for example, be derived from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
  • Western blot analysis may comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the
  • polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon
  • blocking the membrane in blocking solution e.g., PBS with 3% BSA or non-fat milk
  • washing buffer e.g., PBS-Tween 20
  • primary antibody the antibody of interest
  • secondary antibody which recognizes the primary antibody
  • an enzymatic substrate e.g., horseradish peroxidase or alkaline phosphatase
  • radioactive molecule e.g., 32 P or 125 I
  • An ELISA enzyme- linked immunosorbent assay
  • an antibody or antigen bound to a solid phase and an enzyme-antigen or enzyme-antibody conjugate to detect and quantify the amount of an antigen or antibody present in a sample.
  • a description of the ELISA technique may found in any suitable textbook, e.g. in Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
  • the binding affinity of an antibody to an antigen and the off-rate of an antibody- antigen interaction may be determined by competitive binding assays.
  • a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., 3 H or 125 I) with a suitable antibody in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen.
  • labeled antigen e.g., 3 H or 125 I
  • the affinity of the antibody of interest for a particular antigen and the binding off- rates may be determined from the data by any suitable analysis approach, e.g. by a scatchard plot analysis. Competition with a second antibody may also be determined using radioimmunoassays.
  • the antigen may be incubated with a suitable antibody conjugated to a labeled compound (e.g., 3 H or 125 I) in the presence of increasing amounts of an unlabeled second antibody.
  • a suitable antibody conjugated to a labeled compound e.g., 3 H or 125 I
  • Details may, for example, be derived from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
  • aptamers specific for the short splice variant LRP1 marker protein may be used in a method of detecting short splice variant LRP1 marker proteins.
  • Such aptamers may preferably be labeled in order to allow the detection of a protein- ligand interaction.
  • Corresponding techniques are known to the person skilled in the art and may be derived from Ireson and Kelland, 2006, Mol Cancer Ther., 5(12): 2957-62.
  • the determination of the biological activity of the short splice variant LRP1 marker may be carried out by employing molecular or enzymatic assays specific to the corresponding function or functions of the short splice variant LRP1 marker.
  • Such assays may also comprise the detection of changes or modifications of gene expression of non-LRP 1 genes, e.g. downstream targets known to the person skilled in the art, preferably via array approaches, e.g. nucleic acid/transcription microarray or protein/peptide arrays etc.
  • the level of short splice variant LRPl marker may also be detected in methods involving histological or cell-biological procedures. Typically, visual techniques, such as light microscopy or immunofluoresence microscopy, as well as flow cytometry or luminometry may be used.
  • visual techniques such as light microscopy or immunofluoresence microscopy, as well as flow cytometry or luminometry may be used.
  • the presence of short splice variant LRPl marker protein in a cell may, for instance, be detected or determined by removing cells to be tested from samples as defined herein above. Also tissue sections or biopsy samples may be used for these metho ds .
  • affinity ligands for the short splice variant LRPl marker may be applied, preferably antibodies or aptamers.
  • affinity ligands are labeled, preferably with fluorescent labels as defined herein above.
  • Suitable visualization methods are known to the person skilled in the art.
  • Typical methods to be used comprise fluorometric, luminometric and/or enzymatic techniques. Fluorescence is normally detected and/or quantified by exposing fluorescent labels to light of a specific wavelength and thereafter detecting and/or quantifying the emitted light of a specific wavelength. The presence of a luminescently tagged affinity ligand may be detected and/or quantified by luminescence developed during a chemical reaction. Detection of an enzymatic reaction is due to a color shift in the sample arising from chemical reaction.
  • the method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprises additional steps, e.g. steps of comparing the level of short splice variant LRPl marker expression with a standard or control gene expression level as defined herein above, whereby modification, typically increase in the assayed expression level compared to the standard or control expression level is indicative of cancer.
  • additional steps e.g. steps of comparing the level of short splice variant LRPl marker expression with a standard or control gene expression level as defined herein above, whereby modification, typically increase in the assayed expression level compared to the standard or control expression level is indicative of cancer.
  • indications provided for determination of a cancerous sate or a predisposition therefore as defined in the context of the characterization of the "short splice variant LRP1 marker” also apply to the method of detecting, diagnosing, monitoring or
  • prognosticating cancer or the progression of cancer comprises additional step, in particular the steps of comparing the level of short splice variant LRP1 marker expression with a standard or control gene expression level as defined herein above.
  • the method may be performed in vivo, or in vitro, or partially in vivo and in vitro.
  • obtained values like luminescence intensity or brightness etc. may accordingly be compared to suitable standard or control values and, if suitable, subsequently provided in a numeric format.
  • the obtained data, in particular said numeric format may preferably be used following the definition of "detecting", “diagnosing", “monitoring” and “prognosticating” as provided herein above in the context of the characterization of the short splice variant LRP1 marker.
  • the short transcript LRP1 marker may be used for the detection, diagnosis or prognostication of tissue penetration of cancerous cells.
  • tissue penetration refers to dispersion of cancerous cells inside a tissue or within a group of non-cancerous cells.
  • the detection of expression of the short splice variant LRP1 marker e.g. via any of the above described methods or approaches, in more than one cell derived from a tissue may be used for the localization of the cancerous cells.
  • the absence of expression or the gradual reduction of expression in comparison to a cancerous control as defined herein above may be seen as indicative for the presence of healthy tissue or a departing from a cancer or tumor focus.
  • an average value of short splice variant LRP1 marker expression may be calculated and compared to a normal and a cancerous control as defined herein above. Such a comparison allows a characterization of the infestion within the analysed tissue or organ.
  • the method may be performed in vivo, or in vitro, or partially in vivo and in vitro.
  • the present invention relates to a method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptides.
  • truncated LRP 1 expression product and/or a truncated LRP 1 polypeptides refers to transcripts or RNA products derived from the LRP 1 gene (e.g. SEQ ID NO: 11 or derivatives, species homologues etc. thereof), which have not the full-length of wildtype LRP 1 as shown in SEQ ID NO: 3 (or species homologoues thereof) or the corresponding, encoded polypeptides.
  • Such truncated expression products may preferably comprise LRP 1 transcripts which are derivable from additional or alternative splice processes on the LRP 1 full-length transcript and which do not result in the sequence of SEQ ID NO: 3.
  • LRP 1 may comprise one or more portions of the genomic sequence of LRP 1 (SEQ ID NO: 11) which comprise exonic or exon like sequences, wherein intron or intron-like sequences starting with the nucleotides GT in the genomic sequence of SEQ ID NO: 11 and ending with the nucleotides AG in the genomic sequence of SEQ ID NO: 11 are not present.
  • Corresponding RNA molecules may comprise instead of GT the nucleotides GU.
  • “Intron” or “intron-like” sequences in the context of the splice variants may be any stretches of the genomic sequence of LRP 1 or of SEQ ID NO: 11 which comprise in the 5'-portion the nucleotides GT (or GU in the case of RNAs) and in the 3'-portion the nucleotides AG, i.e. any sequence reaching from the combination GT (or GU) to the combination AG.
  • the intron or intron-like sequence may comprise near the 3' end a branch site, more preferably followed by a series of pyrimidines, or a polypyrimidine tract. Even more preferably the branch site may follow the consensus sequence yUnAy.
  • the intron or intron-like sequence may comprise splicing silencers and/or splicing enhancers as known to the person skilled in the art.
  • the method may be performed in vivo, or in vitro, or partially in vivo and in vitro.
  • such truncated expression products may comprise sequences spanning exon 1 to alternative exon 7 of LRP 1 as defined herein above.
  • Truncated expression products may alternatively also comprise sequences of exon 2 to alternative exon 7 of LRP 1, exon 3 to alternative exon 7, exon 4 to alternative exon 7, exon 5 to alternative exon 7, exon 6 to alternative exon 7 or alternative exon 7 alone, as defined herein above.
  • truncated expression products may also comprise sequences of exon 1 to exon 8 of LRP 1, exon 1 to exon 9 of LRP 1, exon 1 to exon 10 of LRP 1, exon 1 to exon 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26., 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 or 88 of LRP 1 as defined herein above.
  • truncated expression products may also comprise sequences of exon 2, exon 3, exon 4, exon 5, exon 6, alternative exon 7 to exon 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26., 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 or 88 of LRP 1 as defined herein above.
  • the presence of such truncated LRP 1 expression products and/or polypeptides may be indicative for the presence of cancer.
  • truncated LRP 1 expression products may be determined according to any suitable method known to the person skilled in the art. For example, PCR reactions with primer oligonucleotides binding to exon 1 and alternative exon 7, exon 2 an alternative exon 7, exon 3 and alternative exon 7, exon 4 and alternative exon 7, exon 5 and alternative exon 7, exon 6 and alternative exon 7 may be carried out. Suitable primers for such PCR reactions are described in Example 9, below. Furthermore, polydT -primers and/or other typical ingredients and/or strategies for cDNA analysis and amplification may be used. Preferably, such primers may have the sequences of SEQ ID NO: 37 to 70.
  • Further methods for the determination of truncated LRP 1 expression products may comprise microarray hybridization techniques, specific hybridization techniques.
  • specific hybridization techniques For the determination of truncated polypeptides specific antibodies, ELISA tests, 2D gel electrophoresis etc. may be used.
  • a cancer, a predisposition for cancer or the progression of cancer may be considered as being detected if at least one truncated LRP 1 expression product has been identified. Furthermore, a predisposition for cancer or the progression of cancer may be considered as being detected if more than one, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 etc different truncated LRP 1 expression products have been identified.
  • the method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptides additionally comprises the measurement of the nucleic acid level of said truncated LRP 1 expression product and/or the measurement of the protein level or biological activity of said truncated LRP 1 polypeptide.
  • the amount of the nucleic acid level of said truncated LRP 1 expression product and/or the measurement of the protein level or biological activity may be determined according to any suitable method known to the person skilled in the art, preferably according to the methods as described herein above.
  • a cancer, a predisposition for cancer or the progression of cancer may be considered as being detected if the amount of at least one truncated LRP 1 expression product comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 95, 99 or 100% of the amount of all LRP 1 transcripts, i.e. of the sum of LRP 1 wildtype transcripts and truncated LRP 1 expression products.
  • a predisposition for cancer or the progression of cancer may be considered as being detected if the amount of all truncated LRP 1 expression products comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 95, 99 or 100% of the amount of all LRP 1 transcripts, i.e. of the sum of LRP 1 wildtype transcripts and all truncated LRP 1 expression products.
  • said truncated LRP 1 expression product comprises a nucleic acid molecule as defined herein above or comprises the nucleotide sequence of SEQ ID NO: 4 and/or said truncated LRP 1 polypeptide comprises a polypeptide as defined herein above or comprises the amino acid sequence of SEQ ID NO: 5.
  • said truncated LRP 1 expression product comprises the sequence of SEQ ID NO: 1, 7 or 8, or fragments or portions thereof or derivatives thereof.
  • said truncated LRP 1 polypeptide comprises the sequence of SEQ ID NO: 2 or 10 fragments or portions thereof or derivatives thereof.
  • the diagnosing, detecting, monitoring or prognosticating as mentioned above is to be carried out on a sample obtained from an individual.
  • sample obtained from an individual as used herein relates to any biological material obtained via suitable methods known to the person skilled in the art from an individual.
  • the sample used in the context of the present invention should generally be collected in a clinically acceptable manner, preferably in a way that nucleic acids (in particular RNA) or proteins are preserved.
  • the biological samples may include body tissues and fluids, such as an urine sample, an urine sediment sample, a blood sample, e.g. a serum sample or a plasma sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells as well as feces or stool samples.
  • body tissues and fluids such as an urine sample, an urine sediment sample, a blood sample, e.g. a serum sample or a plasma sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells as well as feces or stool samples.
  • condensed respiration or exhalation sample refers to samples comprising cells in exhaled air, e.g. cells present in exhaled air due to abrasion or attrition in pulmonary
  • the biological sample may contain a cell extract derived from or a cell population including an epithelial cell, preferably a cancerous epithelial cell or an epithelial cell derived from tissue suspected to be cancerous.
  • cells may be purified from obtained body tissues and fluids if necessary, and then used as the biological sample. Samples, in particular after initial processing may be pooled. However, also non-pooled samples may be used.
  • the content of a biological sample may also be submitted to an enrichment step.
  • a sample may be contacted with ligands specific for the cell membrane or organelles of certain cell types, e.g. breast, prostate, ovarian, renal, lung, pancreas, urinary bladder, uterus, brain, stomach, colon, skin, or muscle cells, functionalized for example with magnetic particles.
  • the material concentrated by the magnetic particles may subsequently be used for detection and analysis steps.
  • biopsy or resections samples may be obtained and/or used.
  • samples may comprise cells or cell lysates.
  • cells e.g. tumor cells
  • cells may be enriched via filtration processes of fluid or liquid samples, e.g. blood, urine, sweat etc.
  • filtration processes may also be combined with enrichment steps based on ligand specific interactions as described herein above.
  • a sample is a tissue sample, an urine sample, an urine sediment sample, a blood sample, e.g. a serum sample or a plasma sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells.
  • a blood sample e.g. a serum sample or a plasma sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells.
  • the use of blood samples may in a particularly preferred embodiment be used for the detection of circulating tumor or cancerous cells or metastasing tumor or cancerous cells without the necessity of carrying out cell separation steps.
  • the present invention relates to a method of identifying antagonists of the polypeptide of the present invention, e.g. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5, comprising the steps of: (a) producing cells which express said polypeptide either as secreted protein or on the cell membrane; (b) contacting the polypeptide produced in step (a) with a test sample comprising a potential antagonist; and (c) identifying an antagonist by observing binding and/or inhibition of activity of said polypeptide.
  • a polypeptide of the present invention e.g. polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5, or a fragment thereof, may be used to screen for potentially antagonistic molecules that bind to the polypeptide or for potentially antagonistic molecules to which the polypeptide binds.
  • the binding of the polypeptide and the potentially antagonistic molecule may inhibit or decrease the amount and/or activity of the polypeptide of the present invention.
  • the screening for such molecules involves producing appropriate cells, which express the polypeptide of the present invention, either as a secreted protein or on the cell membrane.
  • Preferred cells include cells from mammals, yeast, Drosophila, or E. coli.
  • suitable functional domains may be added or fused to the polypeptide.
  • the polypeptide may be provided with a suitable signal peptide sequence and, optionally, additional target or processing signals in order to allow its secretion or its presence in certain cell compartments.
  • the polypeptide may be fused to a functional domain providing or allowing membrane localization, e.g. a transmembrane domain.
  • the polypeptide according to the present invention may be fused in way that the amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5 or a fragment thereof is located intracellulary or extracellularly, more preferably extracellulary. Suitable means and methods would be known to the person skilled in the art.
  • Cells expressing the polypeptide or cell membranes or membrane fractions containing the expressed polypeptide may subsequently be contacted with a potential antagonist to observe binding, stimulation, and/or inhibition of activity of the polypeptide.
  • a corresponding assay may test the binding of a potential antagonist to the polypeptide, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the potential antagonist results in a signal generated by binding to the polypeptide to the present invention.
  • the assay can be carried out using cell-free preparations.
  • the assay may also comprise the steps of mixing a potential antagonist with a solution containing a polypeptide, measuring polypeptide/molecule activity or binding, and comparing the polypeptide/molecule activity or binding to a standard.
  • an ELISA assay may be used for such a purpose, which can measure polypeptide level or activity in a sample (e. g., biological sample) using an appropriate monoclonal or polyclonal antibody.
  • the antibody can measure polypeptide level or activity by either binding, directly or indirectly, to the polypeptide or by competing with the polypeptide for a substrate.
  • the interactor to which a polypeptide of the invention binds can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting.
  • the polypeptide of the present invention or a functional fragment thereof may be used in a bound form, e.g. bound to a carrier.
  • a carrier examples include insoluble polysaccharides, such as agarose, cellulose and dextran; and synthetic resins, such as polyacrylamide, polystyrene and silicon; preferably commercially available beads and plates (e.g., multi-well plates, biosensor chip, etc.) prepared from the above materials may be used. When using beads, they may be filled into a column.
  • magnetic beads are also known in the art, and enables to readily isolate polypeptides and agents bound on the beads via magnetism.
  • binding of a polypeptide to a carrier may be conducted according to routine methods, such as chemical bonding and physical adsorption.
  • a polypeptide may be bound to a carrier via antibodies specifically recognizing the protein.
  • binding of a polypeptide to a carrier can also be conducted by means of interacting molecules, such as the combination of avidin and biotin.
  • Screening methods using such carrier-bound polypeptides of the invention or functional fragments thereof include, for example, the steps of contacting a test agent or potential antagonist to the carrier-bound polypeptide, incubating the mixture, washing the carrier, and detecting and/or measuring the potential antagonist to the carrier.
  • the binding may be carried out in buffer, for example, phosphate buffer and Tris buffer, as long as the buffer does not inhibit the binding.
  • An exemplary screening method wherein such carrier-bound polypeptide of the preset invention or fragments thereof and a composition (e.g., cell extracts, cell lysates, etc.) are used as the test agent includes affinity chromatography.
  • the polypeptide of the present invention may be immobilized on a carrier of an affinity column, and a potential antagonist, containing a substance capable of binding to the polypeptide, is applied to the column. After loading the potential antagonist, the column is washed, and then the substance bound to the polypeptide is eluted with an appropriate buffer.
  • a biosensor e.g. a BIAcore sensor, using surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound potential antagonist in the present invention.
  • a biosensor e.g. a BIAcore sensor, using surface plasmon resonance phenomenon
  • the interaction between the polypeptide of the present invention and a test agent can be observed real-time as a surface plasmon resonance signal, using only a minute amount of the polypeptide and without labeling.
  • this invention provides a method of screening potential agonists to identify those, which modulate the action of the polypeptide of the present invention.
  • An example of such an assay comprises combining a mammalian fibroblast cell, the polypeptide of the present invention, the compound to be screened and 3 H thymidine under cell culture conditions where the fibroblast cell would normally proliferate.
  • a control assay may be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of 3 H thymidine in each case.
  • the amount of fibroblast cell proliferation is measured by liquid scintillation chromatography which measures the incorporation of 3 H-1 thymidine. By this procedure at least antagonist compounds may be identified.
  • any other suitable screening approach may be performed, e.g. any suitable proliferation approach known to the person skilled in the art.
  • the response of a known second messenger system following interaction of a compound to be screened and the polypeptide of the present invention may be measured and the ability of the compound to bind to polypeptide and elicit a second messenger response may be measured to determine if the compound is a potential antagonist.
  • second messenger systems may include cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.
  • antagonists of the polypeptide of the present invention may be identified by using cancer cells expressing and producing said polypeptide, e.g.
  • MCF-7 ACC 115
  • JIMT ACC 589
  • MDA MB-231 ATCC HTB-26
  • MDA MB-435 MDA MB-436
  • LNCaP ACC 256
  • PC-3 ACC 465)
  • Du-145 ACC 261
  • OVCAR-3 ATCC HTB 161
  • OVCAR-8 SKOV-3
  • Colo-704 ACC 198
  • SMKT-Rl CAKI-2
  • A549 ACC 107
  • Colo 699 ACC 196
  • HCC-15 ACC 496)
  • PA-TU-8988T ACC 162
  • PANC-1 ACC CRL-1469
  • These cells may be contacted with a test sample comprising a potential antagonist and an antagonist may be identified by observing (a) the activity of said polypeptide, and/or (b) the presence and/or amount of said polypeptide and/or (c) the proliferation and molecular behavior of the cells.
  • An antagonist to be identified may, for example, be expected to have an inhibitory effect on the proliferation of the tested cancer or tumor cell. It may, alternatively, have a cytotoxic effect on the tumor cell, preferably a specific cyotoxic effect on a tumor cell expressing the polypeptide of the present invention.
  • the present invention relates to a method of identifying a binding partner to the polypeptide of according to the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5 comprising: (a) contacting said polypeptide with a potential binding partner; and (b) determining whether a binding interaction between both molecules takes place.
  • a binding interaction according to this method may be determined according to any of the above identified binding techniques, preferably via the use of biosensors or by employing carrier-bound entities as described herein. Furthermore, immunoprecipitation techniques may be used for the determination of binding interactions.
  • an immune complex may be formed by contacting an antibody (recognizing the polypeptide of the present invention or a functional fragment thereof or an epitope tagged to the polypeptide or fragment) to the reaction mixture comprising the polypeptide of the present invention and the potential binding partner. If the potential binding partner has the ability to bind the polypeptide, then the formed immune complex will be composed of the polypeptide of the present invention, the potential binding partner, and the antibody.
  • the formed immune complex only includes the polypeptide of the present invention and the antibody. Therefore, the binding ability of a potential binding partner to a polypeptide of the present invention can be examined by, for example, measuring the size of the formed immune complex. Any method for detecting the size of a substance can be used, including chromatography, electrophoresis, and such. For example, when mouse IgG antibody is used for the detection, Protein A or Protein G sepharose can be used for quantifying the immune complex formed. Alternatively, a two-hybrid system utilizing cells may be used.
  • the polypeptide of the present invention or a fragment thereof is fused to the SRF- binding region or GAL4-binding region and expressed in yeast cells.
  • a cDNA library is prepared from cells expected to express at least one protein binding to the polypeptide of the present invention, such that the library, when expressed, is fused to the VP 16 or GAL4 transcriptional activation region.
  • the cDNA library is then introduced into a suitable yeast cell and the cDNA derived from the library may be isolated from the positive clones detected.
  • Immunoprecipitation and two-hybrid methods may also be used in the context of a method of antagonists of the polypeptide of the present invention.
  • An identified binding partner may, for example, be tested with respect to an inhibitory effect on the activity of the polypeptide of the present invention.
  • the present invention relates to a method of identifying antagonists of an expression product comprising a sequence of the present invention, e.g. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8, comprising the steps of: (a) contacting a test sample comprising a potential antagonist with one or more cells expressing said sequence of the present invention; (b) detecting the expression level(s) of said sequence; and (c) identifying an antagonist by observing reduction of the expression level of said sequence as compared to that detected in the absence of the potential antagonist.
  • a sequence of the present invention e.g. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 comprising the steps of: (a) contacting a test sample comprising a potential antagonist with one or more cells expressing said sequence of the present invention; (b) detecting the expression level(s) of said sequence; and (c) identifying an antagonist by observing reduction of the expression level of said sequence as compared to that detected in the absence
  • the cell to be employed in this method may be any suitable cell.
  • Preferred cells include cells from mammals, yeast, Drosophila, or E. coli.
  • the expression may be induced, .e.g. by a heterologous vector expressing a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8, or naturally occurring.
  • a "naturally occurring" expression may, for instance, be present in tumor cells expressing a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8, e.g.
  • MCF-7 (ACC 115), JIMT (ACC 589), MDA MB-231 (ATCC HTB-26), MDA MB-435, MDA MB-436 (ATCC HTB-130), LNCaP (ACC 256), PC-3 (ACC 465), Du-145 (ACC 261), OVCAR-3 (ATCC HTB 161), OVCAR-8, SKOV-3 (ATCC HTB 77), Colo-704 (ACC 198), SMKT-Rl, CAKI-2 (ACC 54), A549 (ACC 107), Colo 699 (ACC 196), HCC-15 (ACC 496), PA-TU-8988T (ACC 162), PANC-1 (ACC CRL-1469), 5637, ARK2, AN3-CA (ACC 267), 1321N1 (ECACC 86030102), LN405 (ACC 189), GOS-3 (ACC 408), SH-SY5Y (ACC 209), MKN-45 (ACC 40),
  • sequence may be determined by any suitable method known to the person skilled in the art, e.g. via any of the methods described herein above.
  • a Northern analysis or a microarray based hybridization technique as described herein above may be employed.
  • a decrease in the expression level of the expressing of a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 as compared to a control level in the absence of the test compound indicates that an antagonist has been found.
  • an antagonist with an anti- cancerous potential to be identified may, for example, be expected to have an inhibitory effect on the proliferation of the tested cancer or tumor cell. It may, alternatively, have a cytotoxic effect on the tumor cell, preferably a specific cytotoxic effect on a tumor cell expressing a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8.
  • potential antagonist refers to any type of organic or anorganic, biological, chemical or physical compound or entity.
  • potentially antagonistic molecules or binding partners include molecules as described herein above, e.g.
  • antibodies oligonucleotides, proteins, aptamers, ncRNAs such as siRNAs, ribozymes or miRNAs, peptidomimetics or small molecules.
  • the potentially antagonistic molecules or binding partners may be provided individually or in libraries, e.g. in the form of commercially available compound libraries comprising natural products, bioactive lipids, ligands etc.
  • Potentially antagonistic molecules or binding partners may further be derived from cell extracts, cell culture supernatant, or be products of fermenting microorganisms, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic compounds (including nucleic acid constructs, such as antisense R A, siR A, ribozymes, etc.) and natural compounds. These molecules can also be used in the screening methods of the present invention.
  • a potentially antagonistic molecule or binding partner of the present invention can also be obtained using any of the numerous approaches in combinatorial library methods known in the art, including, but not limited to (1) the use of biological libraries, (2) the use of spatially addressable parallel solid phase or solution phase libraries, (3) the use of synthetic library methods requiring deconvolution, (4) the use of a "one-bead one-compound” library method and (5) the use of synthetic library methods using affinity chromatography selection etc.
  • the biological library methods using affinity chromatography selection may be limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (see Lam, L., 1997, Anticancer Drug Des 12, 145-167).
  • Libraries of compounds may, for example, be presented in solution, on beads, chips, bacteria, spores, plasmids or phages.
  • agents to be identified through the present screening methods may be any compound or composition, including several compounds.
  • the test agent exposed to a cell or protein according to the screening methods of the present invention may be a single compound or a combination of compounds. When a combination of compounds is used in the methods, the compounds may be contacted sequentially or simultaneously.
  • the present invention relates to an antagonist or binding partner identified by, obtainable by or obtained by one the above defined methods.
  • Correspondingly identified binding partner may additionally be tested for their ability to function as antagonist, or in a specific embodiment, as agonist of the polypeptide of the present invention.
  • Correspondingly identified antagonists may further be analyzed with respect to their ability to prevent cancer cell growth in animal models or test subjects or in clinical trials and for their pharmaceutical usability including the occurrence of secondary or adverse effects according to suitable procedures known to the person skilled in the art.
  • the present invention relates to a method of making cytotoxic T lymphocytes (CTLs) specific for the polypeptide of the present invention, e.g.
  • CTL or "cytotoxic T lymphocyte” as used herein refers to a CD4+ T lymphocyte, a CD8+ T lymphocyte or a natural killer cell. Preferably, the term refers to a CD8+ T lymphocyte or a natural killer cell.
  • the term “making CTLs specific for the polypeptide of the present invention” as used herein refers to an approach for the generation of a CTL, which specifically detects a polypeptide according to the present invention, preferably a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5. Subsequently, such a CTL may perform a cytotoxic reaction, e.g.
  • the making of CTLs typically comprises the presentation of antigens, preferably of MHC I specific antigenic peptides, to T cells, preferably to CD8+ T cells.
  • antigens preferably of MHC I specific antigenic peptides
  • T cells preferably to CD8+ T cells.
  • a peptide sequence as set forth in SEQ ID NO: 16 to 26 may be used.
  • the antigen or antigenic peptide may be presented by a dendritic cell (DC), more preferably by a MHC I molecule present on a dendritic cell.
  • DC dendritic cell
  • T lymphocytes may subsequently be selected, enriched and/or expanded according to suitable methods known to the person skilled in the art.
  • T cells to be used for the production of CTLs according to the present invention may be derived from lymphoid tissue, preferably they may be obtained from a peripheral blood mononuclear cell (PBMC) cell fraction.
  • PBMCs may be extracted from whole blood using ficoll.
  • PBMC may be extracted from whole blood using a hypotonic lysis. Any other suitable method known to the person skilled in the art may also be used.
  • PBMCs to be used may be derived from blood obtained from blood donors.
  • autologous PBMCs may be used.
  • autologous cells any suitable method known to the person skilled in the art may be used.
  • the present invention relates to a method of making cytotoxic T lymphocytes (CTLs) specific for the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, which comprises the step of stimulating autologous T cells in vitro with dendritic cells loaded with a peptide derived from the polypeptide according to the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, or a fragment thereof.
  • CTLs cytotoxic T lymphocytes
  • non-adherent PBMCs may be co-cultered in a suitable medium, e.g. in human serum, preferably in Aim-V medium supplemented with 10% pooled human serum, with mature dendritic cells preincubated with peptides derived from the polypeptide of the present invention, preferably with peptides derived from the amino acid sequence of SEQ ID NO: 2 or 5.
  • a suitable medium e.g. in human serum, preferably in Aim-V medium supplemented with 10% pooled human serum
  • mature dendritic cells preincubated with peptides derived from the polypeptide of the present invention, preferably with peptides derived from the amino acid sequence of SEQ ID NO: 2 or 5.
  • the co-cultivation may be carried out according to suitable parameters, e.g. for 7-10 days.
  • the preincubation with the peptides may also be carried out according to any suitable parameters known to the person skilled in the art.
  • the peptide may be used in a concentration of 50 ⁇ g/ml.
  • T cells may be collected and preferably restimulated with dendritic cells loaded with peptides derived from the amino acid sequence of SEQ ID NO: 2 or 5.
  • the restimulation may preferably be carried out once in a week.
  • the medium may be supplemented with additional factors, e.g. with IL-2, IL-7 and/or IL-15.
  • T-cell lines may be established by limiting-dilutions.
  • T-cell line clones may be expanded in T-cell medium comprising IL-2, IL-7 and/or IL-15, e.g. during 2 weeks.
  • the CTLs may additionally be tested for their biological activity according to known methods, e.g. a cytotoxicity test.
  • CTLs may be stored or further expanded or be used for the preparation of medicaments of pharmaceutical compositions.
  • the present invention relates to the stimulation of natural killer cells by LRP 1 peptides, preferably by peptides encoded by portions of exon 7 of LRP 1, more preferably by a peptide sequence as set forth in SEQ ID NO: 16 to 26.
  • natural killer cell or "NK cell” as used herein refers to cytotoxic lymphocytes of the innate immune system. NK cells kill by releasing small cytoplasmic granules of perforin and granzyme that cause the target cell to die by apoptosis.
  • NK- cells typically are large granular lymphocytes (LGL) and constitute a cell type differentiated from the common lymphoid progenitor generating B and T lymphocytes.
  • TCR T-cell antigen receptors
  • Pan T marker CD3 or surface immunoglobulins (Ig) B cell receptor but that usually express surface markers CD 16 (Fc gamma RIII) and CD56 in humans, and NK1.1/NK1.2 in certain strains of mice.
  • the great majority of NK cells expresses CD8.
  • the stimulation may be carried out according to the above described stimulation of CTLs or according to any other suitable method known to the person skilled in the art.
  • the present invention relates to a CTL obtainable or obtained by the above described method.
  • Such a CTL may preferably be able to recognize an antigen derived from the polypeptide of the present invention, or a poypeptide of the present invention or a fragment or peptide thereof.
  • the present invention relates to a CTL which is specific for an antigen derived from the polypeptide of the present invention, or which is specific for a polypeptide of the present invention or a fragment thereof, e.g. for a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5 or a fragment thereof.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10., the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiably according to the present invention as defined herein above or a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention.
  • a pharmaceutical composition may also, e.g. optionally, comprise a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable means approved by a regulatory agency or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • a carrier is pharmaceutically acceptable, i.e. is generally non-toxic to a recipient at the dosage and concentration employed. It is preferably isotonic, hypotonic or weakly hypertonic and has a relatively low ionic strength, such as provided by a sucrose solution.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers.
  • Suitable pharmaceutical excipients include starch, glucose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium ion, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of, e.g., solutions, suspensions, emulsion, powders, sustained-release formulations and the like. Examples of suitable pharmaceutical carriers are described in "Remington's
  • Some other examples of substances which can serve as pharmaceutical carriers are sugars, such as glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethycellulose, ethylcellulose and cellulose acetates; powdered tragancanth; malt; gelatin; talc; stearic acids; magnesium stearate; calcium sulfate; calcium carbonate; vegetable oils, such as peanut oils, cotton seed oil, sesame oil, olive oil, corn oil and oil of theobroma; polyols such as propylene glycol, glycerine, sorbitol, manitol, and polyethylene glycol; agar; alginic acids; pyrogen-free water; isotonic saline;
  • cranberry extracts and phosphate buffer solution skim milk powder; as well as other non-toxic compatible substances used in pharmaceutical formulations such as Vitamin C, estrogen and echinacea, for example.
  • Wetting agents and lubricants such as sodium lauryl sulfate, as well as coloring agents, flavoring agents, lubricants, excipients, tabletting agents, stabilizers and anti-oxidants can also be present. It is also envisaged by the present invention to administer the active ingredients of the pharmaceutical composition in encapsulated form, e.g. as cellulose encapsulation, in gelatine, with polyamides, niosomes, wax matrices, with cyclodextrins or liposomally encapsulated.
  • the ingredients may be supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilised powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • the pharmaceutical composition, vaccine or kit may be formulated in accordance with routine procedures adapted for intravenous
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection.
  • a solubilizing agent such as lignocaine to ease pain at the site of the injection.
  • the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the pharmaceutical composition can also be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
  • the pharmaceutical composition of the present invention can also comprise a preservative.
  • Preservatives according to certain compositions of the invention include butylparaben, ethylparaben, imidazolidinyl urea, methylparaben, O-phenylphenol, propylparaben, quaternium-14, quaternium-15, sodium dehydro acetate, zinc pyrithione, thimerosal and the like.
  • the preservatives may be used, for example, in amounts effective to prevent or retard microbial growth. Generally, the preservatives are used in amounts of about 0.1 % to about 1 % by weight of the total composition with about 0.1% to about 0.8%) being preferred and about 0.1%> to about 0.5%> being most preferred.
  • the pharmaceutical composition may comprise or be mixed with at least one suitable adjuvant.
  • Adjuvants may be used to enhance the effectiveness of the pharmaceutical composition.
  • adjuvants include, for example, chloroquine, protic polar compounds, such as propylene glycol, polyethylene glycol, glycerol, EtOH, 1 -methyl L-2-pyrrolidone or their derivatives, or aprotic polar compounds such as dimethylsulfoxide (DMSO), diethylsulfoxide, di-n- propylsulfoxide, dimethylsulfone, sulfolane, dimethylformamide, dimethylacetamide, tetra-methylurea, acetonitrile or their derivatives.
  • DMSO dimethylsulfoxide
  • DMSO dimethylsulfoxide
  • di-n- propylsulfoxide dimethylsulfone
  • sulfolane dimethylformamide
  • dimethylacetamide tetra-methylurea
  • a pharmaceutical composition according to the present invention may be administered to a patient, subject or individual with the help of any suitable delivery system known to the person skilled in the art, e.g., via encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor- mediated endocytosis, construction of a nucleic acid as part of a retroviral or other vector, etc.
  • Methods of introduction may be any suitable method known, including topical, enteral or parenteral introduction.
  • the methods of introduction may also include intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, inhalational, epidural, and oral routes.
  • composition may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) or by inhalation and may be administered together with other biologically active agents.
  • infusion or bolus injection by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) or by inhalation and may be administered together with other biologically active agents.
  • Administration can be systemic or local.
  • intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.
  • Pulmonary or inhalational administration can be employed, e.g., via the use of an inhaler or nebulizer, and a concomitant formulation with an aerosolizing agent.
  • any ingredient of the pharmaceutical composition of the present invention as defined herein above may be complexed with a delivery vehicle to be administered by direct injection into or locally within the area of arteries.
  • Administration of a composition locally within the area of arteries refers to injecting the composition centimeters and preferably, millimeters within arteries.
  • Another method of local administration is to contact a pharmaceutical composition of the present invention in or around a surgical wound.
  • a patient can undergo surgery and the pharmaceutical composition can be coated on the surface of tissue inside the wound or the pharmaceutical composition can be injected into areas of tissue inside the wound.
  • ingredients of the pharmaceutical composition of the present invention as defined herein above can be complexed to a targeted delivery vehicle.
  • Suitable delivery vehicles for use with systemic administration comprise liposomes comprising ligands for targeting the vehicle to a particular site.
  • Preferred methods of systemic administration include intravenous injection, aerosol, oral and percutaneous (topical) delivery. Intravenous injections can be performed using methods standard in the art. Aerosol delivery can also be performed using standard methods in the art (see, for example, Stribling et al, 1992, PNAS, 189: 11277-11281).
  • Oral delivery can be performed by complexing ingredients of the pharmaceutical composition of the present invention as defined herein above to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal.
  • a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal.
  • Such carriers include plastic capsules or tablets, such as those known in the art.
  • Topical delivery can be performed, for instance, by mixing a polynucleotide construct of the present invention with a lipophilic reagent (e.g., DMSO) that is capable of passing into the skin.
  • a lipophilic reagent e.g., DMSO
  • the pharmaceutical composition may be delivered directly to internal organs, body cavities and the like by use of imaging devices used to guide an injecting needle directly to the site of interest.
  • the pharmaceutical composition may also be administered to disease sites at the time of surgical intervention.
  • the pharmaceutical composition may be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249, 1527-1533; Treat et al, 1989 in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365; Lopez-Berestein, ibid., pp. 317-327).
  • the composition can be delivered in a controlled release system.
  • a pump may be used.
  • polymeric materials can be use.
  • a controlled release system can be placed in proximity of a therapeutic target, e.g. the brain, lymphatic organs etc. thus requiring only a fraction of the systemic dose.
  • the pharmaceutical composition is in a form, which is suitable for oral, local or systemic administration.
  • the pharmaceutical composition is administered locally, orally or systemically.
  • composition of the present invention can be administered to a mammal.
  • mammal as used herein is intended to have the same meaning as commonly understood by one of ordinary skill in the art. Particularly, the term “mammal” encompasses human beings. Also encompassed are mammals such as dogs, cats, mice, rats, monkeys, rabbits, goats, sheep, pigs, guinea pigs, cattle, horses etc.
  • administered means administration of a therapeutically effective dose of the pharmaceutical composition.
  • therapeutically effective amount is meant a dose that produces the effects for which it is administered, preferably this effect is reduction of the expression or amount of the short splice variant LRP1, more preferably the destruction of cancerous cells or the inhibition of cancerous growth.
  • the exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As is known in the art adjustments for systemic versus localized delivery, age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art.
  • the pharmaceutical composition may be used in both human therapy and veterinary therapy, preferably in human therapy.
  • the compounds described herein having the desired therapeutic activity may be administered in a physiologically acceptable carrier to a patient, as described herein.
  • the concentration of the therapeutically active compound in the formulation may vary from about 0.00001-100 wt %.
  • concentration of the active ingredients or compounds of a pharmaceutical composition according to the present invention may be further adjusted to the intended dosage regimen, the intended usage duration, the exact amount and ratio of all ingredients of the composition and further factors and parameter known to the person skilled in the art.
  • Topical administration of the pharmaceutical composition of the present invention is useful when the desired treatment involves areas or organs readily accessible by topical administration.
  • the pharmaceutical composition is preferably formulated with a suitable paste, ointment, lotion, cream, gel or transdermal patches.
  • the pharmaceutical preparations can, depending on the field of use, also be in the form of a foam, gel spray, mousse, suspensions or powder, e.g. if used for topical administration.
  • a suitable paste comprises the active ingredient suspended in a carrier.
  • Such carriers may include petroleum, soft white paraffin, yellow petroleum jelly and glycerol.
  • the pharmaceutical composition may also be formulated with a suitable ointment comprising the active components suspended or dissolved in a carrier.
  • Such carriers may include one or more of glycerol, mineral oil, liquid oil, liquid petroleum, white petroleum, yellow petroleum jelly, propylene glycol, alcohols, triglycerides, fatty acid esters such as cetyl ester, polyoxy ethylene polyoxypropylene compound, waxes such as white wax and yellow beeswax, fatty acid alcohols such as cetyl alcohol, stearyl alcohol and
  • cetylstearylalcohol fatty acids such as stearic acid, cetyl stearate, lanolin, magnesium hydroxide, kaolin and water.
  • the pharmaceutical composition may also be formulated with a suitable lotion or cream comprising the active components suspended or dissolved in a carrier.
  • suitable lotion or cream comprising the active components suspended or dissolved in a carrier.
  • Such carriers may include one or more of mineral oil such as paraffin, vegetable oils such as castor oil, castor seed oil and hydrogenated castor oil, sorbitan monostearat, polysorbat, fatty acid esters such as cetyl ester, wax, fatty acid alcohols such as cetyl alcohol, stearyl alcohol, 2-octyldodecanol, benzyl alcohol, alcohols, triglycerides and water.
  • the pharmaceutical composition may also be formulated with a suitable gel comprising the active components suspended or dissolved in a carrier.
  • suitable carriers include, but are not limited to, one or more of water, glycerol, propyleneglycole, liquid paraffin, polyethylene, fatty oils, cellulose derivatives, bentonite and colloidal silicon dioxide.
  • the pharmaceutical composition according to the invention may generally comprise further auxiliaries as are customarily used in such preparations, e.g. preservatives, perfumes, antifoams, dyes, pigments, thickeners, surface-active substances, emulsifiers, emollients, finishing agents, fats, oils, waxes or other customary constituents of a dermato logical formulation, such as alcohols, polyols, polymers, foam stabilizers, solubility promoters, electrolytes, organic acids, organic solvents, or silicone derivatives.
  • the pharmaceutical composition according to the invention may also comprise emollients. Emollients may be used in amounts, which are effective to prevent or relieve dryness.
  • Useful emollients include, without limitation: hydrocarbon oils and waxes; silicone oils; triglyceride esters; acetoglyceride esters; ethoxylated glyceride; alkyl esters; alkenyl esters; fatty acids; fatty alcohols; fatty alcohol ethers; etheresters; lanolin and derivatives; polyhydric alcohols (polyols) and polyether derivatives; polyhydric alcohol (polyol) esters; wax esters; beeswax derivatives; vegetable waxes;
  • typical emollients include mineral oil, especially mineral oils having a viscosity in the range of 50 to 500 SUS, lanolin oil, mink oil, coconut oil, cocoa butter, olive oil, almond oil, macadamia nut oil, aloa extract, jojoba oil, safflower oil, corn oil, liquid lanolin, cottonseed oil, peanut oil, purcellin oil, perhydrosqualene (squalene), caster oil, polybutene, odorless mineral spirits, sweet almond oil, avocado oil, calophyllum oil, ricin oil, vitamin E acetate, olive oil, mineral spirits, cetearyl alcohol (mixture of fatty alcohols consisting predominantly of cetyl and stearyl alcohols), linolenic alcohol, oleyl alcohol, octyl dodecanol, the oil of cereal germs such as the oil of wheat germ cetearyl octanoate (ester of cetearyl alcohol and 2-
  • the pharmaceutical composition according to the invention may also comprise emulsifiers.
  • Emulsifiers i.e., emulsifying agents
  • Useful emulsifiers include (i) anionics such as fatty acid soaps, e.g., potassium stearate, sodium stearate, ammonium stearate, and triethanolamine stearate; polyol fatty acid monoesters containing fatty acid soaps, e.g., glycerol monostearate containing either potassium or sodium salt; sulfuric esters (sodium salts), e.g., sodium lauryl 5 sulfate, and sodium cetyl sulfate; and polyol fatty acid monoesters containing sulfuric esters, e.g., glyceryl monostearate containing sodium lauryl surfate; (ii) cationics chloride such as N(stearoyl colamin
  • polyoxy ethylene fatty acid esters e.g., polyoxyethylene stearate; polyoxyethylene sorbitan fatty acid esters, e.g., polyoxyethylene sorbitan monostearate; sorbitan fatty acid esters, e.g., sorbitan; polyoxyethylene glycol fatty acid esters, e.g., polyoxy ethylene glycol monostearate; and polyol fatty acid esters, e.g., glyceryl monostearate and propylene glycol monostearate; and ethoxylated lanolin derivatives, e.g., ethoxylated lanolins, ethoxylated lanolin alcohols and ethoxylated cholesterol.
  • emulsifiers is exemplarily described in Schrader, Hiithig Buch Verlag, Heidelberg, 2 nd edition, 1989, 3 rd part.
  • the pharmaceutical composition according to the invention may also include a surfactant.
  • Suitable surfactants may include, for example, those surfactants generally grouped as cleansing agents, emulsifying agents, foam boosters, hydrotropes, solubilizing agents, suspending agents and nonsurfactants (facilitates the dispersion of solids in liquids).
  • the surfactants are usually classified as amphoteric, anionic, cationic and nonionic surfactants.
  • Amphoteric surfactants include acylamino acids and derivatives and N- alkylamino acids.
  • Anionic surfactants include: acylamino acids and salts, such as, acylglutamates, acylpeptides, acylsarcosinates, and acyltaurates; carboxylic acids and salts, such as, alkanoic acids, ester carboxylic acids, and ether carboxylic acids; sulfonic acids and salts, such as, acyl isethionates, alkylaryl sulfonates, alkyl sulfonates, and sulfosuccinates; sulfuric acid esters, such as, alkyl ether sulfates and alkyl sulfates.
  • Cationic surfactants include: alkylamines, alkyl imidazolines, ethoxylated amines, and quaternaries (such as, alkylbenzyldimethylammonium salts, alkyl betaines, heterocyclic ammonium salts, and tetra alkylammonium salts).
  • nonionic surfactants include: alcohols, such as primary alcohols containing 8 to 18 carbon atoms; alkanolamides such as alkanolamine derived amides and ethoxylated amides; amine oxides; esters such as ethoxylated carboxylic acids, ethoxylated glycerides, glycol esters and derivatives, monoglycerides, polyglyceryl esters, polyhydric alcohol esters and ethers,
  • sorbitan/sorbitol esters and triesters of phosphoric acid; and ethers such as ethoxylated alcohols, ethoxylated lanolin, ethoxylated polysiloxanes, and propoxylated
  • a pharmaceutical composition according to the invention may also comprise a film former.
  • suitable film formers which are used in accordance with the invention keep the composition smooth and even and include, without limitation: acrylamide/sodium acrylate copolymer; ammonium acrylates copolymer; Balsam Peru; cellulose gum; ethylene/maleic anhydride copolymer; hydroxyethylcellulose;
  • hydroxypropylcellulose polyacrylamide; polyethylene; polyvinyl alcohol; pvm/MA copolymer (polyvinyl methylether/maleic anhydride); PVP (polyvinylpyrrolidone); maleic anhydride copolymer such as PA- 18 available from Gulf Science and
  • PVP/hexadecene copolymer such as Ganex V-216 available from GAF Corporation; acryliclacrylate copolymer; and the like.
  • film formers can be used in amounts of about 0.1% to about 10% by weight of the total composition with about 1% to about 8% being preferred and about 0.1 DEG/O to about 5% being most preferred.
  • Humectants can also be used in effective amounts, including: fructose; glucose; glulamic acid; glycerin; honey; maltitol; methyl gluceth-10; methyl gluceth-20; propylene glycol; sodium lactate; sucrose; and the like.
  • Other ingredients which can be added or used in a pharmaceutical composition according to the invention in amounts effective for their intended use include:
  • biological additives to enhance performance or consumer appeal such as amino acids, proteins, vanilla, aloe extract, bioflavinoids, and the like; buffering agents, chelating agents such as EDTA; emulsion stabilizers; pH adjusters; opacifying agents; and propellants such as butane carbon dioxide, ethane, hydrochlorofluorocarbons 22 and 142b, hydro fluoro carbon 152a, isobutane, isopentane, nitrogen, nitrous oxide, pentane, propane, and the like.
  • composition according to the invention may also comprise compounds, which have an antioxidative, free-radical scavenger,
  • these compounds can be chosen from the group of vitamins, plant extracts, alpha- and beta-hydroxy acids, ceramides, antiinflammatory, antimicrobial or UV-filtering substances, and derivatives thereof and mixtures thereof.
  • the lipid phase is advantageously chosen from the group of substances of mineral oils, mineral waxes, branched and/or unbranched hydrocarbons and hydrocarbon waxes, triglycerides of saturated and/or unsaturated, branched and/or unbranched C8-C24- alkanecarboxylic acids; they can be chosen from synthetic, semisynthetic or natural oils, such as olive oil, palm oil, almond oil or mixtures; oils, fats or waxes, esters of saturated and/or unsaturated, branched and/or unbranched C3-C3o-alkane carboxylic acids and saturated and/or unsaturated, branched and/or unbranched C3-C3o-alcohols, from aromatic carboxylic acids and saturated and/or unsaturated, branched and/or unbranched C3-C3o-alcohols, for example isopropyl myristate, isopropyl stearate, hexyldecyl stearate
  • a pharmaceutical composition may comprise nucleic acids according to the present invention which are provided via living therapeutics.
  • living therapeutic means that said nucleic acids are expressed in any suitable live carrier.
  • the present invention relates to corresponding polynucleotides, which are suitable for expression in a living cell.
  • the present invention also relates to vectors containing such polynucleotides, appropriate host cells, and the production of polypeptides by recombinant techniques in said host cells.
  • live carrier relates to any appropriate living host cell or virus known to the person skilled in the art.
  • appropriate hosts include bacterial cells such as Escherichia coli or Lactobacillus, fungal cells, such as yeast cells, protozoa, insect cells, or animal cells.
  • the term relates to attenuated bacteria, attenuated fungal cells or attenuated protozoa.
  • appropriate viruses include viruses of the group of adenoviruses, retrovirues or lentirviruses, preferably attenuated viruses of the group of adenoviruses, retroviruses or lentirviruses.
  • probiotic bacterial cells in particular probiotic Escherichia coli or Lactobacillus cells may be used. More preferably, cells of Escherichia coli Nissle 1973 and even more preferably cells of Lactobacillus casei or Lactobacillus zeae 393 may be used. Such bacterial cells, in particular the Lactobacillus cells, may be used at a suitable location, preferably in the gastrointestinal tract. The bacterial cells may be administered to a patient in any suitable form known to the person skilled in the art, preferably orally.
  • the cells may be cultured ex vivo, e.g. under laboratory conditions.
  • pGhost4 pGhost5 and pGhost6 available from Appligene-Oncor, Illkirch, France.
  • pIAb8 pIAV7, pPSC22, pH2515, pLP3537 and pUCL287 may be used.
  • Other suitable vectors will be known to the skilled person
  • a live cell or living therapeutic as defined herein above or if the pharmaceutical composition comprises a CTL according to the present invention transformed and/or prepared cells may be administered to a patient in any suitable form known to the person skilled in the art.
  • living therapeutics or CTLs may be administered in the form of a composition comprising a microorganism, e.g. a
  • Lactobacillus or a CTL as described above in an amount between 10 ⁇ to 1012 cells, preferably 10 ⁇ to 10 ⁇ cells.
  • a composition may be solid.
  • the amount of the microorganisms or CTLs may be between 10 ⁇ to 10 ⁇ cells per ml.
  • the amount of the microorganism or CTL may be different and/or adjusted according to suitable parameters known to the person skilled in the art.
  • the ratio between ingredients in the pharmaceutical composition or medicament may be suitably adjusted according to the skilled person's knowledge.
  • a ratio similar ratio between components of a kit may be adjusted according to the skilled person's knowledge.
  • Assays e.g.
  • dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
  • a typical dose can be, for example, in the range of 0.001 to 1000 ⁇ g; however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors.
  • a pharmaceutical composition may preferably be given once a week, more preferably 2 times, 3 times, 4 times, 5 times or 6 times a week and most preferably daily and or 2 times a day or more often, unless otherwise indicated.
  • the dosages may be given in much longer time intervals and in need can be given in much shorter time intervals, e.g., several times a day.
  • the present invention relates to a pharmaceutical composition as described herein above for the or for use in the treatment or prevention of cancer.
  • cancer refers to a class of diseases in which a group of cells may display uncontrolled growth, i.e. division beyond the normal limits, invasion, i.e. intrusion on and destruction of adjacent tissues, and in certain cases metastasis, i.e. a spread to other locations in the body typically via lymph or blood. In a specific embodiment the term also includes tumors.
  • tumor refers to a neoplastic, abnormal growth of cells, typically in the form of swellings or lesions.
  • tumors are a benign, a pre-malignant or a malignant tumor.
  • a pre-malignant and most preferably a malignant tumor may be treated with a pharmaceutical composition according to the present invention.
  • prevention of cancer refers to a therapeutic approach which is started before a cancerous state is detectable, preferably is histologically detectable, e.g. in the form of visible swellings, lesions etc., i.e. a very early disease state or pre-disease state.
  • the term refers to a blocking or stopping of such an early or pre-disease state.
  • a therapeutic approach i.e. the administration of a pharmaceutical composition according to the present invention for preventive purposes, may be based on diagnostic, detection, monitoring or prognostication results, preferably diagnostic, detection, monitoring or prognostication results, based on the expression of the short splice variant LRP1 marker as defined herein above. Also independent results obtained via alternative diagnostic approaches known to the person skilled in the art may be used.
  • the present invention relates to the use of a nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g.
  • the present invention relates to a medical kit comprising at least one element selected from the group consisting of: the nucleic acid molecule of the present invention, e.g.
  • the vector comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above or a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention.
  • the present invention relates to a medical kit for the or for use in the treatment or prevention of cancer.
  • Said kit preferably comprises at least one element selected from the group consisting of: the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g.
  • a medical kit that can be used in the context of the administration of the pharmaceutical composition as defined herein above.
  • a medical kit may accordingly be formulated and administered similar to a
  • compositions or comprise carriers, adjuvants etc. as defined for a pharmaceutical composition herein above.
  • the ingredients of a medical kit may, according to the present invention, be comprised in one or more containers or separate entities. They may preferably be formulated as pharmaceutical compositions or medicaments, more preferably they may be formulated as has been described herein above in the context of the pharmaceutical compositions of the present invention, e.g. they may comprise suitable pharmaceutical carriers etc. Particularly preferred are formulations for topical, intravenous, subcutaneous, intranasal, inhalational, epidural, intramuscular, intramuscular in combination with electoporation, or oral routes administration as mentioned herein above in the context of pharmaceutical compositions of the invention. The formulation may further be made dependent on the ingredient, concentration, intended mode of action etc.
  • the medical kit according to the present invention may optionally also comprise a documentation, which indicates the use or employment of the medical kit and its components.
  • instructions comprised in the medical kit of the present invention may comprise recommended treatment options, dosage regimens etc.
  • the medical kit may also comprise an instruction leaflet.
  • the medical kit of the present invention may be administered to a patient according to any suitable dosage regimen known to the person skilled in the art.
  • the medical kit or kit components may preferably be given once a week, more preferably 2 times, 3 times, 4 times, 5 times or 6 times a week and most preferably daily and or 2 times a day or more often, unless otherwise indicated.
  • the dosages may be given in much longer time intervals and in need can be given in much shorter time intervals, e.g., several times a day.
  • a response to the treatment may be monitored using herein described methods and further methods known to those skilled in the art and dosages may accordingly be optimized, e.g., in time, amount and/or composition. Progress can be monitored by periodic assessment.
  • the present invention relates to a method of treatment or prevention of cancer comprising administering to an individual a therapeutically effective amount of the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above or a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention.
  • the mentioned ingredients may be formulated in the form of a
  • compositions herein above are administered, prepared and used according to the specifications provided in the context of pharmaceutical compositions herein above.
  • the present invention relates to a vaccine comprising the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above, a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention or an anti-idiotypic antibody against an antibody of the invention as defined herein above.
  • a vaccine according to the present invention may, for example, comprise polypeptides or proteins of varying length comprising the amino acids sequence of SEQ ID NO: 2, nucleotide sequences encoding such a polypeptide, in particular expression vectors capable of expressing the polypeptide, e.g. DNA plasmid vectors, viral vectors etc. as described herein above, host cells expressing the such a polypeptide as described herein above, preferably host cells expressing the polypeptide at the surface of the cell, or secrete the polypeptide.
  • expression vectors capable of expressing the polypeptide e.g. DNA plasmid vectors, viral vectors etc. as described herein above
  • host cells expressing the such a polypeptide as described herein above, preferably host cells expressing the polypeptide at the surface of the cell, or secrete the polypeptide.
  • These components or ingredients may be present either separately or in combination or in any sub-grouping or sub-combination of the mentioned items.
  • the components may be delivered using
  • the polypeptide comprised in the vaccine may comprise one epitope or various epitopes, e.g. a MHC I and/or a MHC II epitope or two or more copies of each or combinations thereof.
  • Corresponding, i.e. encoding nucleic acid molecules may be provided, preferably in the form of DNA or RNA molecules, e.g. DNA vectors or expression vectors.
  • Such vectors may preferably be DNA plasmids or viral vectors.
  • Vectors, in particular viral vectors may be capable of replication or be replication- impaired or non-replicating.
  • the term "non-replicating" or “replication-impaired" as used herein means not capable of replication to any significant extent in the majority of normal mammalian cells or normal human cells.
  • Viruses which are non-replicating or replication-impaired may have become so naturally (i.e. they may be isolated as such from nature) or artificially e.g. by breeding in vitro or by genetic manipulation, for example deletion of a gene which is critical for replication.
  • Suitable viral vectors for use in a vaccine according to the present invention include non-replicating adenoviruses such as El deletion mutants, vectors based on herpes virus and Venezuelan equine encephalitis virus (VEE).
  • Suitable bacterial vectors include recombinant BCG and recombinant Salmonella and Salmonella transformed with plasmid DNA (see Darji et al., 1997, Cell 91 : 765-775).
  • Alternative suitable non-viral vectors include lipid-tailed peptides known as lipopeptides, peptides fused to carrier proteins such as KLH either as fusion proteins or by chemical linkage.
  • a vaccinia virus vector such as MVA or NYVAC may be used.
  • MVA vaccinia strain modified virus ankara
  • MVA is a replication impaired vaccinia strain with a good safety record. In most cell types and normal human tissues, MVA does not replicate; limited replication of MVA is observed in a few transformed cell types such as BHK21 cells.
  • Alternatives to vaccinia vectors include pox virus vectors, e.g. avipox vectors such as fowl pox or canarypox vectors. Particularly suitable as an avipox vector is a strain of canarypox known as ALVAC, and strains derived therefrom.
  • the vaccine may alternatively or additionally comprise any of the CTLs defined herein above, e.g.
  • an anti- idiotypic antibody against an antibody of the invention as defined herein above in the vaccine.
  • anti-idiotypic antibody relates to an antibody, the activity of which is directed specifically against the antigenic determinants (idiotope) of a particular immunoglobulin molecule, e.g. another antibody.
  • an anti-idiotypic antibody of the present invention may be specifically binding to an antibody, which in turn specifically binds to an epitope of the present invention.
  • anti-idiotypic antibody against an antibody of the invention thus refers to an antibody which recognizes the idiotype of an antibody which is directed against a polypeptide of the present invention, in particular against a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, or variants thereof, e.g. present on the amino acid sequence of SEQ ID NO: 2 or comprising said sequence, more preferably against an epitope as set forth in SEQ ID NO: 16 to 34.
  • an epitope of a polypeptide of the present invention may be formed on the paratope of the anti-idiotypic antibody as a mimic for the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or an epitope derived therefrom, since it has been found that anti-idiotypic antibodies that bind to the antigen-combining sites of antibodies can effectively mimic the three-dimensional structures and functions of the external antigens and can be used as surrogate antigens for active specific
  • Corresponding antibodies may be obtained according to techniques known to the person skilled in the art, e.g. from Bhattacharya-Chatterjee et al, 2006, Cancer Drug Discovery and Development, Immunotherapy of Cancer, Humana Press, 139-149, Greenspan & Bona, 1989, FASEB J. 7 (5): 437-444; or Nissinoff, 1991, J. Immunol. 147 (8): 2429-2438.
  • an anti-idiotypic antibody against antibody R4B6G5 or an antibody produced by hybridoma clone R4B6G5 or by the hybridoma having DSMZ accession No. DSM ACC3000 may be employed.
  • the vaccine comprises an epitope derived from a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, or variants thereof as described herein above.
  • an epitope may be of varying length. It may be a B-cell, T-cell,
  • MHC I specific, or MHC II specific epitope may preferably have a length of about 8 to 10 amino acids in the case of a MHC I specific epitope, e.g. 8, 9 or 10 amino acids, it may preferably have a length of about 13 to 17 amino acids in the case of a MHC II epitope, e.g. 13, 14, 15, 16 ro 17 amino acids.
  • the epitope may be capable of eliciting B-cell or T-cell immune responses.
  • the epitope may alternatively be capable of eliciting CTL or cytotoxic reactions.
  • T-helper cell response the presentation by MHC II molecules may be required.
  • T-cell response the presentation by MHC I molecules may be required.
  • Peptides or epitopes according to the present invention may also stimulate NK-cell (natural killer cells) that are effective tumor killing cells and may be used for such an approach.
  • Peptides or epitopes according to the present invention may also stimulate dendritic cells for enhancing antigenic stimulation of lymphocytes and may be used for such an approach.
  • the activation of cells e.g. T-cells, NK cells or dendritic cells, may be tested with suitable tests known to the person skilled in the art.
  • an ELISPOT assay as known to the person skilled in the art, preferably as described in Example 8, may be used.
  • the present invention also envisages peptides or epitopes derived from a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, or variants thereof as described herein above which can be identified according to activation tests, e.g. ELISPOT tests.
  • activation tests e.g. ELISPOT tests.
  • Particularly preferred are peptides or epitopes, which show a cell activation in such tests, more preferably a significant cell activation, e.g. a significant T-cell activation, a significant NK-cell activation or a significant activation of dendritic cells.
  • epitopes may be used or employed in, for or in the context of the present vaccine:
  • KRAQENEVTTQHG (SEQ ID NO: 31) KRAQENEVTTQHGC (SEQ ID NO: 32) RRSRKRAQENEVTTQHG (SEQ ID NO: 33) and/or
  • the epitopes of the present invention may be present in a peptide, polypeptide, protein, polyprotein or particle comprising as two or more epitopes, or as a recombinant string of epitopes or in the context of the native target antigen, or in the form of a mixture or combination of the mentioned entities.
  • polyprotein refers to two or more proteins which may be the same, or preferably different, linked together.
  • Particularly preferred in this embodiment is a recombinant proteinaceous particle such as a Ty virus-like particle (VLP) (see Burns et al. 1994, Molec. Biotechnol. 1 : 137-145).
  • VLP Ty virus-like particle
  • epitope string refers to a juxtaposition or combination of one or more epitopes, e.g. of2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more epitopes.
  • Such a string may comprise solely MHC I specific epitopes or MHC II specific epitopes or a combination of both.
  • the epitopes in a string of epitopes or of multiple epitopes may be linked together without intervening sequences so that unnecessary nucleic acid and/or amino acid material is avoided.
  • the epitopes in a string of epitopes or of multiple epitopes may be linked together with intervening sequences.
  • Such intervening sequences may have a length of 1 to 10 amino acids, preferably 2 to 5 amino acids. They may comprise amino acids without influence on the overall structure of the string, e.g. glycine.
  • the string of epitopes or multiple epitopes may include one or more epitopes recognised by T helper cells, to augment the immune response generated by the epitope string.
  • T helper cell epitopes are ones, which are active in individuals of different HLA types, for example T helper epitopes from tetanus (against which most individuals will already be primed).
  • Particularly preferred is a combination of three T helper epitopes and an eptioppe according to the present invention.
  • the epitope string may also include one or more B cell epitopes for stimulating B cell responses and antibody production.
  • B cell epitopes for stimulating B cell responses and antibody production.
  • Suitable T helper and B cell epitopes are known to the person skilled in the art.
  • the present invention relates to a vaccine comprising the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g.
  • a vaccine according to the present invention is for the or for use in the treatment or prevention of cancer, it may preferably comprise, in addition to antigens or epitopes comprising the polypeptide of the invention, in particular SEQ ID NO: 2, as mentioned above, additional antigens or epitopes derived from or representing known tumor associated antigens (TAAs). Furthermore the string of epitopes or multiple epitopes of a corresponding vaccine may include one or more epitopes derived from or representing a known tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • TAAs which may be included in vaccines of the present invention are MAGE antigen, a SSX antigen family member, NY-ESO-1, Melan-A/MART-1, gplOO, tyrosinase, tyrosinase-related protein 1 (TRPl), TRP2, CEA, PSA, Her2/neu, p53, MUCl, PRAME, sarcosin (N-methylglycin), CA-125 (Carbophydrate antigen- 125) or survivin.
  • TAAs MAGE antigen
  • SSX antigen family member NY-ESO-1
  • Melan-A/MART-1 Melan-A/MART-1
  • gplOO tyrosinase
  • TRPl tyrosinase-related protein 1
  • TRP2 TRP2
  • CEA PSA
  • Her2/neu Her2/neu
  • p53 Her2/neu
  • MUCl Her2/neu
  • PRAME sarc
  • the present invention relates to the use of a nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g.
  • a vaccine as defined herein above may be used for the preparation of a vaccine for the or for use in the treatment or prevention of cancer.
  • the present invention relates to a method of inducing an immune response in an individual comprising administering to said subject a therapeutically effective amount of a nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g.
  • immune response refers to a therapeutic immune response beneficial for the subject or individual. Such an immune response may be a passive or active immunization, or it may be a short-term or long-term immunoprotection.
  • the immune response is an immune response against cancer.
  • immune response against cancer means that a cancerous cell or tissue may be attacked by components of the immune system, e.g. by CTLs or antibodies as defined herein above, that a cancerous cell or tissue may be reduced in its size or modified in its structure by the mentioned entities or that the cancerous cell or tissue may be eliminated by the mentioned entities.
  • a vaccine according to the present invention or vaccine compounds or ingredients as defined herein above i.e. a nucleic acid molecule of the present invention, e.g.
  • the vector comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above, a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention or an anti-idiotypic antibody against an antibody of the invention as defined herein above may be given or administered, e.g.
  • a vaccine or vaccine ingredients are given or administered more than once a prime and boost administration may be pursued, e.g. a "prime” administration is followed by one or more "boosts" to achieve the desired effects.
  • the same composition or vaccine ingredient can be administered as the prime and as the one or more boosts.
  • different compositions or vaccine ingredients can be used for priming and boosting.
  • priming and boosting compositions or vaccines may comprise different combinations of vaccine ingredients, e.g.
  • prime and boost compositions may be different in terms of vectors to be used.
  • the priming composition may be a viral vector and the boosting composition may also be a viral vector, however derived from a different virus.
  • a prime composition may comprise a DNA or plasmid vector and the boost composition may comprise a viral vector, or vice versa.
  • prime boost schemes in which at least one of the vectors is replication-impaired or non- replicating.
  • Carriers and further ingredients for the formulation of a composition which may also be used for vaccines, have already been mentioned in the context of pharmaceutical compositions herein above.
  • a preferred carrier for vaccines is a molecule that does not itself induce the production of antibodies harmful to the individual receiving the vaccine.
  • Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycollic acids, polymeric amino acids, amino acid copolymers, lipid aggregates, and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Furthermore, the
  • polypeptide of the present invention may be conjugated to carrier elements such as a bacterial toxoid, such as toxoid from diphtheria, tetanus, cholera, etc.
  • carrier elements such as a bacterial toxoid, such as toxoid from diphtheria, tetanus, cholera, etc.
  • the vaccine used according to the invention may also be provided in frozen, freez-dried or lyophilized form, which may be thawed, or reconstituted, respectively, when needed.
  • the vaccine may comprise or be mixed with at least one suitable adjuvant.
  • Adjuvants which are preferred, e.g. for vaccines, kits, compositions etc., comprise 1018 ISS, aluminium salts, such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, Amplivax, AS 15, BCG, CP- 870893, CpG7909, CyaA, dSLIM, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM- 174, OM-197-MP-EC, SAF, RAS, ONTAK, PepTel vector system, PLG microparticles, resiquimod, SRL1 72, Virosomes and
  • PT pertussis toxin
  • LT heat-labile toxin
  • CT-S 109 where serine is substituted for the wild-type amino acid at position 109
  • PT-K9/G129 MF59
  • saponin adjuvants such as Stimulon and cytokines, such as interleukins (IL-1, IL-2, etc.), M-CSF, GM-CSF, TNF, etc., as well as muramyl peptides like N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), Nacteyl- normuramyl-L-alanyl-D-isogluatme (nor-MDP), N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), Nacteyl- normuramyl-L-alanyl-D-isogluatme (nor-MDP),
  • Adjuvants may be combined in any suitable form and amount with the pharmaceutical composition, kit or vaccine of the present invention.
  • the use of an adjuvant may be adjusted to the concrete purpose of the treatment. Such a use may vary depending on the target cell or tissue, the administration way, treatment scheme etc.
  • a vaccine or immunological formulation may contain the immunogenic active substance at any suitable concentration, preferably at low concentrations, such as in an immunogenic amount ranging from 0.01 ⁇ g to 10 mg.
  • a suitable immunogenic dose may be chosen, e.g. in the range of from 0.01 ⁇ g to 750 ⁇ g, preferably 100 ⁇ g to 500 ⁇ g.
  • the vaccine according to the present invention may be provided in the form of a depot vaccine which is to be delivered to the organism over an extended period of time may.
  • the amount of ingredients may be higher such as from at least 1 mg to up to more than 10 mg.
  • a vaccine usually may be provided, for example, in ready-to-use syringes having a volume of from 0.01 to 1 ml, preferably 0.1 to 0.75 ml, of the concentrated solution, or suspension, respectively.
  • the present invention further provides a vaccine formulation comprising the antibodies against the short splice variant LRP1 as defined herein above in a range of from 1 mg to 10 g, preferably from 10 mg to 1 g.
  • the present invention further envisages a vaccination or administration employing a short splice variant LRP1 -peptide or -protein, preferably a peptide or protein comprising or consisting of parts or the entire sequence of exon 7 of LRP 1, more preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 coupled to a suitable heat shock protein or part thereof, preferably a chaperone HSP protein, more preferably a chaperon HSP110 protein.
  • the coupling which is mainly based on the application of heat shocks or a temperature increase, may be carried out according to any suitable method known to the person skilled in the art.
  • coupled proteins or peptides may further be combined with any suitable additional elements, e.g. buffers, additional proteins, adjuvants etc. as desecribed herein.
  • the present invention further envisages a vaccination or administration employing a short splice variant LRP1 -peptide or -protein, preferably a peptide or protein comprising or consisting of parts or the entire sequence of exon 7 of LRP 1, more preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 coupled to one or more Ii-Key functional groups of LRMK or one or more suitable derivatives thereof.
  • the coupling may be based on any suitable covalent or non- covalent binding. Examples are a binding via a polymethylene linker.
  • the use of Ii-Key functional groups of LRMK may be based on any suitable method known to the person skilled in the art. Particularly preferred is the method or technique described in
  • Coupled proteins or peptides may further be combined with any suitable additional elements, e.g. buffers, additional proteins, adjuvants etc. as desecribed herein.
  • Vaccines of the present invention may be administered to a subject or individual by any suitable method, preferably via injection using either a conventional syringe or a gene gun, such as the Accell® gene delivery system. Delivery of DNA into cells of the epidermis is particularly preferred as this mode of administration provides access to skin-associated lymphoid cells and provides for a transient presence of DNA in the recipient. Both, nucleic acids and/or peptides and/or antibodies can be injected either subcutaneously, epidermally, intradermally, intramuco sally such as nasally, rectally and vaginally, intraperitoneally, intravenously, orally or intramuscularly.
  • auxiliary agents for the vaccine formulation, e.g. an adsorbate or a suspended mixture of vaccine ingredient with the auxiliary agent is administered.
  • the vaccine is administered as a solution, or liquid vaccine, respectively, in an aqueous solvent.
  • Dosage treatment may be a single dose schedule or a multiple dose schedule.
  • nucleic acids may also be combined with administration of peptides or other substances.
  • the active agents or compounds e.g. the pharmaceutical composition, kit or vaccine according to the present invention may be administered alone or in combination with other treatments. It is, for example, envisaged that the pharmaceutical composition, kit or vaccine is employed in co-therapy approaches, i.e. in co-administration with other medicaments or drugs, for example antibiotics, antiviral medicaments or IgG or IgA immunoglobulins, preferably anticancer medicaments or chemotherapeutic
  • the pharmaceutical composition, kit or vaccine may be employed in co-therapy with anti-TGF-beta medicaments, e.g. with neutralizing anti-TGF-beta antibodies and/or with orally applied proteases that diminish TGF-betal levels in humans and/or with anti-Her2/neu monoclonal antibodies and/or with the immunoadjuvant granulocyte macrophage colony-stimulating factor (GM-CSF).
  • GM-CSF immunoadjuvant granulocyte macrophage colony-stimulating factor
  • the pharmaceutical composition, kit or vaccine of the present invention may be employed in co-therapy with anti-TGF-beta medicaments, e.g. with neutralizing anti-TGF-beta antibodies and/or with orally applied proteases that diminish TGF-betal levels in humans and/or with anti-Her2/neu monoclonal antibodies and/or with the immunoadjuvant granulocyte macrophage colony-stimulating factor (GM-CSF).
  • GM-CSF immuno
  • an anti-cancer treatment e.g. during, before or after chemotherapy or before tumors are detectable, i.e. in preventative anticancer approaches or via preventative anticancer vaccines.
  • the pharmaceutical composition, kit or vaccine according to the present invention may be administered in combination with an elements, protein, peptide, composition, drug, small molecule etc., which leads to an increase of the expression of LRP 1.
  • the pharmaceutical composition, kit or vaccine according to the present invention may comprise such elements, proteins, peptides, compositions, drugs, small molecules etc., which lead to an increase of the expression of LRP 1.
  • Particularly preferred is the use or co-administration of transformed alpha2- macroglobulin (A2M*), which is known to lead to an increase of the expression of LRP 1, or the preparation of compositions, kits or vaccines according to the present invention which additionally comprise transformed alpha2-macroglobulin (A2M*).
  • Elements, proteins, peptides, compositions, drugs, small molecules etc. which lead to an increase of the expression of LRP 1 may be used in any suitable form or concentration. Details on corresponding elements and/or techniques etc. may be derived, for example, from Calderwood et al, 2007, Methods, 43(3): 199-206.
  • a short splice variant LRP1- peptide or -protein as defined herein above preferably a peptide or protein comprising or consisting of parts or the entire sequence of exon 7 of LRP 1, more preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 may be directly coupled to, combinded to or fused to alpha2-macroglobulin (A2M*).
  • a short splice variant LRP 1 -peptide or -protein as defined herein above preferably a peptide or protein comprising or consisting of parts or the entire sequence of exon 7 of LRP 1, more preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 may be directly coupled to, combinded to or fused to other elements, in particular peptides or proteins which lead to an increase of the expression of LRP 1.
  • a method is envisaged directed to the detection of variations in one or two copies of the LRP1 gene, wherein said variations are at positions being is in strong linkage disequilibrium (99.5%) with a SNP in a region comprising positions 55,825,400 to 55,829,950 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), preferably of a single nucleotide polymorphism at position 55,829,839 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
  • Such variations are preferably in a region comprising 3,000 bp upstream and downstream of positions
  • the method may be carried out in vivi, or in vitro, e.g. based on a sample, or may comprise steps carried out in vivo and steps carried out in vivo.
  • linkage disequilibrium refers to a situation in which some combinations of genetic markers occur more or less frequently in the population than would be expected from their distance apart. It implies that a group of markers has been inherited coordinately. It can result from reduced recombination in the region or from a founder effect, in which there has been insufficient time to reach equilibrium since one of the markers was introduced into the population. Variations at the SNP position indicated above may be identified and characterized according to any suitable method, including single-strand conformation polymorphism analysis, heteroduplex analysis by denaturing high-performance liquid chromatography (DHPLC) or direct DNA sequencing and computational methods. For instance, such a variation may be assayed using Allele Specific Amplification (ASA). For the process at least 3 primers are required.
  • ASA Allele Specific Amplification
  • a common primer is used in reverse complement to the polymorphism being assayed.
  • This common primer can be between 50 and 1500 bp from the polymorphic base.
  • the other two (or more) primers are identical to each other except that the final 3 ' base wobbles to match one of the two (or more) alleles that make up the polymorphism.
  • Two (or more) PCR reactions are then conducted on sample DNA, each using the common primer and one of the Allele Specific Primers. If sequence information is accessible in public databases, computational tools can be used to align independently submitted sequences for a given gene.
  • Detection technologies include fluorescent polarization, luminometric detection of pyrophosphate release (pyro sequencing), fluorescence resonance energy transfer (FRET)-based cleavage assays and mass spectrometry. Further preferred is the detection of the polymorphism by means of the INVADERTM technology (available from Third Wave Technologies Inc. Madison, WI). In this assay, a specific upstream "invader” oligonucleotide and a partially overlapping downstream probe together form a specific structure when bound to complementary DNA template.
  • This structure is recognized and cut at a specific site by the Cleavase enzyme, resulting in the release of the 5' flap of the probe oligonucleotide.
  • This fragment then serves as the "invader" oligonucleotide with respect to synthetic secondary targets and secondary fluorescently-labeled signal probes contained in the reaction mixture. This results in specific cleavage of the secondary signal probes by the Cleavase enzyme. Fluorescence signal is generated when this secondary probe, labeled with dye molecules capable of fluorescence resonance energy transfer, is cleaved.
  • Cleavases have stringent requirements relative to the structure formed by the overlapping DNAsequences or flaps and can, therefore, be used to specifically detect single base pair mismatches immediately upstream of the cleavage site on the downstream DNA strand. Further details may be derived from Ryan et al, 1999, Molecular Diagnosis, Vol. 4, No 2: 135-144.
  • the present invention relates to a kit for the detection of SNP variations, comprising a set of genotyping oligonucleotides as described hereina above, as well as additional components like polymerases, dNTPs, buffer, ions etc.
  • the cancer to be detected, diagnosed, prognosticated, monitored, treated, prevented etc. is breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma.
  • it is a brain tumor selected from the group of astrocytoma and glioma.
  • Example 1 Peptide sequence, chemical synthesis and coupling to protein carriers cDNA and Peptide sequence
  • the peptide sequence of the marker was derived from the nucleotide sequence from the inclusion of the new last exon:
  • the conjugate was ultrafiltrated using a filter with a cutoff of 10.000 (Life Science) to remove unbound peptide.
  • R A was isolated from normal human tissues/organs and tumor- derived cell lines, reverse transcribed and amplified using the following primers and conditions: Marker Transcript
  • PCR Product size amplicon size 209 bp
  • the control transcript was obtained by RT-PCR from the consensus parental transcript (full length LRPl) coding for a receptor protein (consensus spliced form of the marker).
  • the transcript of beta-actin was used as positive and loading control.
  • PCR mix consisted of 2.5 ⁇ 10 x puffer complete (Bioron, Ludwigshafen, Germany), 1.25 u DFS Taq DNA polymerase
  • RNA 1 ⁇ g total RNA was denatured in 6.75 ⁇ sterile nuclease free water at 70°C for 5 min before quenching on ice.
  • Reverse transcription was performed by the addition of 2.5 ⁇ 5x transcriptase buffer, 15 Units AMV reverse transcriptase (Promega, Mannheim, Germany), 20 U RNase inhibitor (RNasin, Promega), 8 ⁇ oligo dT primer (Metabion, Martinsried, Germany) and 0.5 mM dNTPs (Larova, Teltow, Germany) in a final volume of 12.5 ⁇ and incubated at 42°C for 60 min. The reaction was stopped by heating at 70°C for 10 min. 1 ⁇ of each cDNA was used for PCR.
  • PCR products were separated on a 2% agarose gel (SeaKem LE Agarose, Lonza, Rockland, USA) containing 500 ⁇ g/ml ethidium bromide. The gel was run at 100 V and visualised under UV light. DNA molecular standard was from Invitrogen (1 Kb Plus DNA Ladder Cat.No. 10787-018).
  • the new tumor marker obtained by alternative splicing is present only in cancer cells, it is absent or below the detection limit in different non-cancerous organs investigated. This is in contrast to the unspliced parental transcript, which appears to be ubiquitary expressed.
  • RNA was prepared from tissue material as described above and first-strand cDNA was prepared by reverse transcription.
  • the samples were provided by the Human fetal MTC Panel Test kit (Cat.No 636747; Clontech).
  • the results in A and B show that (i) the marker is not expressed (below the detection limit) in all tissues investigated; (ii) no marker expression could be observed in fetal human tissues, indicating that the marker is not an oncofetal protein and (iii) no positive signal could be detected in normal peripheral mononucleated blood cells.
  • tumor cell lines were screened for the presence of marker mRNA by RT-PCR. 1 ⁇ g cDNA was used for PCR reaction described above, beta-actin RNA was used for calibration. Relative expression is described as high (+++), medium (++) and low (+) according to the band appearance in agarose gel.
  • the used marker peptide is immunogenic and elicits the production of polyclonal antibodies.
  • the antibodies are specific as no reactivity with serum components is observed and irrelevant antibodies do not react with the peptide.
  • a titer plate was coated with rabbit anti-peptide Ig (2 ⁇ g/ml).
  • Whole human serum (1 : 10 diluted) was incubated with peptide-BSA (100 ⁇ g/ml), with BSA alone (100 ⁇ g/ml) and loaded onto the titer plate ( ⁇ each) and incubated for 1.5 h (lh, 37°). Plate was washed with washing buffer (PBS-T) and the cavities were incubated with rabbit anti-BSA Ig-HRP and developed as described above. The plate was recorded in a spectrophotometer at 492 nm.
  • Lanes 1 to 4 correspond to the following: 1 :
  • Peptide-BSA (10( ⁇ g/ml) in serum; 2: Serum alone; 3: Peptide-BSA in PBS-T
  • the marker peptide was coated to keyhole hemocyanin and used for immunization of BALB/c mice according to standard procedures.
  • Spleen cells were fused with SP2/0 myeloma cells and antibody-producing cell clones were screened. Highly active clones were selected, propagated and monoclonal antibodies were prepared from their supernatant.
  • Titer plates were coated with the peptide (10 ⁇ g/ml) (see Fig. 5: 1, 3, 4, 6) and peptide-BSA conjugate (40 ⁇ g/ml) (see Fig. 5: 2, 5), incubated with different monoclonal antibodies (10 ⁇ g/ml) or buffer (see Fig. 5: 3, 6) and anti-mouse-Ig-HRP (1 : 1000) as secondary antibody.
  • the plate was recorded in a spectrophotometer at 492 run.
  • the used marker peptide is immunogenic in mice, elicits monoclonal antibodies which are reactive with the peptide.
  • polypeptide containing the marker peptide shows a cytoplasmic localisation with accumulation in the plasma membrane of 132 IN 1 astrocytoma cells.
  • the marker can thus be used to detect malignant transformation in cells of tissue sections
  • prostate carcinoma cells Du-145 are seeded in 5 ml normal heparinized human blood and mixed with 125 ⁇ 1 antibody-coated DynabeadsTM (Dynabead Epithelial Enrich Kit Cat.No. 161- 02, Invitrogen, USA).
  • the enriched cells are lysed with the lysis buffer supplied in the Dynabeads ® mRNA DIRECT TM Micro Kit (Cat.No. 610-11; Invitrogen).
  • mRNA is captured by Oligo (TT)- beads and reversed described.
  • the cDNA loaded beads are used as templates for PCR.
  • the samples are processed according to the manual of the manufacturer.
  • Detection of the marker is performed by PCR reaction followed by agarose gel electrophoresis.
  • the PCR-product (447 bp) of the marker is recognized in Du-145 cancer cells, and whole blood sample mixed with cancer cells but is absent in the whole blood sample (not mixed with cancer cells) as well as in the water control.
  • the size of the PCR products is compared against the 100 bp ladder.
  • This approach may provide the information that (i) seeding cancer cells can be detected in human whole blood by RT-PCR of the marker-RNA, and that (ii) normal blood cells do not interfere with marker detection.
  • the presence of secondary leukemic tumor cells does not interfer the testing because the marker is not expressed in tumors derived from blood cells (see also Example 3, supra).
  • tissue penetration of a human glioma tumor was tested in an agarose gel electrophoresis approach for separation of marker PCR products.
  • Tumor material was obtained from a patient suffering from a glioma tumor.
  • R A was prepared from tissue material obtained from the tumor center, margin and non-tumor neighborhood and analysed by RT-PCR of the marker, ⁇ g cDNA was used for PCR reaction.
  • a tissue sample prepared from the tumor margin In lane 1 of Fig. 7 the following is indicated: 1321N1 astrocytoma cells. In lane 2 of Fig. 7 the following is indicated: a tissue sample prepared from the tumor margin. In lanes 3 of Fig. 7 the following is indicated: a tissue sample prepared from the tumor center. In lanes 4 of Fig. 7 the following is indicated: tissue sample prepared from non- tumor brain tissue.
  • marker expression is lower at tumor margin and absent outside the tumor. Analysis of marker expression allows evaluation of tissue penetration of tumor cells.
  • Drugs affecting the expression of the marker can be evaluated according to the following test:
  • Human astrocytoma cells (1321 Nl; ECACC no. 86030102) are cultured in DMEM (Gibco, No. 41966-092), 10% FCS, containing penicillin/streptomycin (100 units of penicillin/ml; 100 ⁇ g streptomycin/ml, Gibco; no. 15140/122) in the presence of 10%> fetal calf serum (Biochrom, SOI 13/5), 2 mM L-glutamine, (Gibco, No. 25030-024) at 37°C, 5% C0 2 in 70ml culture flasks up to 60 %. The supernatant is removed, cells are washed with PBS and incubated in culture medium without FCS for 24h. Afterward, the medium is replaced by fresh medium containing increasing concentrations of test substances (growth factors, cytokines, chemical drugs, plant extracts etc.) and the incubation is continued for further 24 h.
  • test substances growth factors, cytokines, chemical drugs,
  • Cells are harvested by trypsination with trypsin/EDTA and pelleted after two washings with PBS.
  • R A is extracted, reverse transcribed into cDNA according to standard protocols.
  • cDNA is subjected to PCR using specific primers for the marker (arrow). PCR products are subsequently normalised to beta-actin.
  • the appearance or disappearance of the marker expression can be evaluated to show which substance may affect expression of the marker and may thus relate to transition of cells to various stages of differentiation.
  • Example 8 Elispot assay of human PBMC stimulated by the marker peptide
  • PBMC peripheral blood lymphocyte
  • SEQ ID NO: 10 an Elispot assay of human PBMC (peripheral blood lymphocyte) stimulated by a peptide having the sequence of SEQ ID NO: 10 was performed to evaluate immune regulatory effects.
  • the assay was carried out for 24h according to MultiScreenHTS Filter Plate (Millipore, Billerica, MA, USA) technical notes for interferon gamma (IFN-gamma) ELISPOT (Millipore Corporation. IFN-gamma Elispot Assays on MultiScreen IP. A Publication of Technical Services. Lit.No.: TN1003EN00). Both IFN-gamma capture and detection antibody were purchased from Mabtech (Stockholm, Sweden). Perforin antibodies were provided by AID (Autoimmun Diagnostika, Strassberg, Germany). PBMCs from 3 healthy volunteers were resuspended in RPMI medium with 1% L- glutamine, HEPES and 10% fetal bovine serum (PAA Laboratories, Pasching,
  • ELISPOT plates were incubated at 37°C for 24 h in the presence of 5% C0 2 . Plate analysis and enumeration of cell counts was done using an AID EliSpot 04 HR Reader and appropriate AID reader software, release 4.0 (AID).
  • IFN-gamma could not be observed as indicator of a T cell directed immunogeneity.
  • the peptide has a low capacity to induce an immune response directed to the peptide.
  • NK cells and cytotoxic T cells a dose dependent stimulation of perforin secretion is induced. This could be connected with an anti-tumor activity of these cells.
  • shRNA-coding constructs against the LRP1 splice variant Short hairpin R A (shRNA) coding constructs were designed against the LRP 1 transcript variant of SEQ ID NO: 4. These constructs lead after the expression of the shRNA to RNA interference (see Paddison et al., 2002, Genes & Development; 16: 948-958). The constructs were generated with the help of online-tool
  • the coding sequence of alternative exon 7 (position 1314 to 1363 of SEQ ID NO: 4) was used as template for the algorithm. Due to the short template sequence only one potential specific 19 nt long target sequence (positions 1344 to 1363 of SEQ ID NO: 4) was identified:
  • siRNA sequence for the expression as shRNA the identified siRNA sequence (sense) was combined via a loop sequence with the reverse complementary siRNA sequence (antisense). On the 5' and 3' termini specific restriction sites for endonucleases (BamHI and Hindlll) were added in order to allow directed cloning in an expression vector:
  • artificial shR A may be carried out with a HI- or an U6 promoter (both polymerase III) (Brummelkamp et al., 2002 Science,296: 550-553; Paddison et al., 2002, Genes & Development; 16: 948-958).
  • a further siRNA against LRP 1 transcript variant of SEQ ID NO: 4 was designed, which comprises at position 10 of the siRNA (SEQ ID NO: 73) a different nucleotide, i.e. A was exchanged for T.
  • This modification increases the incorporation of the antisense strand into the RISC complex.
  • this modified siRNA avoids activation of intracellular signal pathways in reaction to double stranded RNAs (Cullen, 2006, Nature Methods ;3(9):677-81).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • General Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1), a protein encoded by said nucleic acid molecule and fragments of said nucleic acid and said protein. The present invention also relates to vectors, host cells, recombinant methods for producing said protein, antibodies, antibody-producing cells, affinity ligands and antagonists of said nucleic acid and protein and the use of the LRP1 splice variant as a cancer marker. The invention further relates to corresponding diagnostic and pharmaceutical compositions, kits, medical uses and methods, as well as vaccines and methods of inducing immune responses.

Description

A low density lipoprotein-related protein 1 splice variant as cancer marker
The present invention relates to a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1), a protein encoded by said nucleic acid molecule and fragments of said nucleic acid and said protein. The present invention also relates to vectors, host cells, recombinant methods for producing said protein, antibodies, antibody-producing cells, affinity ligands and antagonists of said nucleic acid and protein and the use of the LRP1 splice variant as a cancer marker. The invention further relates to corresponding diagnostic and pharmaceutical compositions, kits, medical uses and methods, as well as vaccines and methods of inducing immune responses.
Cancer is a class of diseases in which a group of cells displays uncontrolled growth, invasion and sometimes metastasis. These three malignant properties of cancers differentiate them from benign tumors, which are self-limited, do not invade or metastasize. Typically, cells deriving from diverse organs like liver, brain, prostate or kidney are modified by endogenous processes or by exogenous factors in a way that they are able to abscond from the control of cell growth. Eventually these cells may be disengaged from their original tissue and resettle in another organ after being spread via the blood flow or the lymphatic system and penetrate other organs, forming metastases. Cancerous cells can grow endlessly in the original organ as well as in the secondary sites and form malignant tumors, which can ultimately lead to the death of the affected person.
Cancer may affect people at all ages, but the risk for most varieties increases with age. Cancer causes about 13% of all deaths. According to the American Cancer Society, 7.6 million people died from cancer in the world during 2007. Among men, the three most commonly diagnosed cancers are prostate, lung and colorectal cancer in developed countries. Nearly all cancers are caused by abnormalities in the genetic material of the transformed cells. Genetic abnormalities found in cancer typically affect two general classes of genes, oncogenes and tumor suppressor genes. Cancer-promoting oncogenes are typically activated in cancer cells, giving those cells new properties, such as hyperactive growth and division, protection against programmed cell death, loss of respect for normal tissue boundaries, and the ability to become established in diverse tissue environments. Tumor suppressor genes, on the other hand, are inactivated in cancer cells, resulting in the loss of normal functions in those cells, such as accurate DNA replication, control over the cell cycle, orientation and adhesion within tissues, and interaction with protective cells of the immune system.
Typical functions involved in the etiology of cancer are regulation hot spots responsible for differentiation or proliferation programs. Such regulators are frequently involved in signal transduction or signaling pathways. Among the participants of signaling cascades the members of the low-density lipoprotein (LDL) receptor gene superfamily are outstanding since they are involved in a wide range of different signaling pathways including the control of fundamental developmental processes in the embryo, the remodeling of tissue in the adult organism and the regulation of neuronal survival and degeneration.
There are seven known members of the LDL receptor superfamily which are structurally closely related: the LDL receptor, LRP1, LRPl-b, LRP2, LRP4, LRP5, LRP6, very low density lipoprotein receptor (VLDL), and LRP8/apo lipoprotein E receptor 2. The founding member of the family, the LDL receptor regulates cholesterol homeostasis by receptor-mediated endocytosis of cholsterol-rich LDL particles (May et al, 2007, Annals of Medicine, 39: 219-228). However, the LDL receptor seems to be the only member of the family with a role limited to the uptake of lipoproteins.
VLDL and LRP8 have been demonstrated to activate a kinase-dependent intracellular signaling cascade after binding to the neuronal signaling molecule Reelin. The Reelin signaling pathway controls neuronal positioning in human and mouse brain during development as well as modulation of long-term potentiation (LTP) and behavior in the adult (Beffert et al, 2006, J. Neuroscience, 26 (7): 2041-2052). LRP4, which is also known as multiple EGF-like domain (MEGF7), is expressed, inter alia, in migratory primordial germ cells in the hindgut and the dorsal mesentery of E9,5 embryos, in germ cells in the genital ridges of male and female embryos, as well as in spermatogonia of the neontal and adult testes and the immature oocytes and follicular cells of the adult ovary (May et al, 2007, Annals of Medicine, 39: 219-228).
Homozygous LRP4-deficient mice show growth retardation and polysyndactyly, i.e. a fusion and duplication of digits at the fore and hind limbs. Digit formation results from complex and coordinated interactions between several signaling molecules (Capdevila et al, 2001, Annu Rev Cell Dev Biol, 17: 87-132). These include fibroblast growth factors (FGF), bone morphogenetic proteins (BMP), Wnt and sonic hedgehog (Shh). Loss of LRP4 results in abnormal expression of several of these signaling proteins, namely FGF8, Shh, BMP2, BMP4 and Wnt7a, as well as an abnormal expression of the Wnt- and BMP -responsive transcription factors Lmxlb and Msxl (Johnson et al, 2005, Hum Mol Genet, 14: 3523-3538). These findings suggest a role for LRP4 as a modulator of the signaling pathways that control limb development in the embryo.
LRP5/6 are membrane receptors acting as co-receptors of the wnt (wint)/beta-catenin signaling pathway. Ligation of the frizzled receptor by secreted wnt proteins induces the inhibition of the intracellular GSK-3 beta (glycogen synthase kinase-3 beta), an enzyme, which normally phosphorylates the β-catenin, which signals its degradation by the proteasomes (Bryja et al, 2009, Mol Biol Cell, 20(3):924-936). Non-phosphorylated beta-catenin enters the nucleus and modulates transcription of many target proteins involved in tumor growth. The wnt/beta-catenin pathway is activated in many tumors (Ying et al, 2009, Epigenetics, 4(5): 307-312).
LRP2, which is also known as Megalin, is a multifunctional receptor with a size of approximately 600 kDa. It is the antigenic determinant for Heymann nephritis in rats and is important for the reabsorption of various molecules in the proximal renal tubule. LRP2 has further been shown to be of importance in neurological development signal transduction cascades, e.g. in the patterning of the ventral telencepahlon (Spoelgen et al, 2005, Development, 132: 405-414). Functional analysis showed that LRP2 is an endocytic receptor that binds and internalizes a variety of ligands including protease- protease inhibitor complexes, vitamin- vitamin binding protein complexes, other hormones and lipoproteins. It is expressed at the apical surface of epithelial borders and is also found intracelluarly in endosomes (Christensen et al, 1995, J Cell Biol, 66: 349- 364). The endocytic uptake mediated by LRP2 is part of a superordinate regulatory process of systemic vitamin homeostasis and controls the availability of hormones and related first messengers in certain organ systems (May et al, 2005, Cell Mol Life Sci, 62: 2325-2338). It could be shown that LRP2 binds and internalizes the signaling factor BMP4, which is subsequently degraded in the lysosome. Loss of LRP2 leads to the accumulation of BMP4, which is a negative regulator of the extracellular signaling molecule sonic hedgehog (Shh). Shh activity is accordingly reduced in the developing forebrain in LRP2-deficient animals. The endocytic processes mediated by LRP2 can serve to limit the availability of a signaling factor in a tissue, where it has crucial functions in regulating development. LRP2 is hence a lipoprotein receptor at the intersection of endocytosis and signaling (May et al, 2007, Annals of Medicine, 39: 219-228).
LRPl, which is also known as CD91 or alpha2-macroglobulin receptor is a ubiquitously expressed type 1 transmembrane receptor. The active receptor protein is derived from a 600 kDa precursor processed by furin and consists of an 85 kDa membrane bound carboxyl fragment with intracellular and transmembrane domains and a noncovalently attached 515 kDa amino -terminal fragment with an extracellular domain. LRPl is a multifunctional protein and has so far been implicated in two major physiological processes, endocytosis and regulation of signaling pathways. Through its extracellular domain LRPl interacts with and mediates endocytosis of more than 40 different ligands ranging from lipoproteins, extracellular matrix proteins, protease/protease inhibitor complexes, and viruses to cytokines and growth factors (May et al, 2003, Traffic, 4: 291-301). Due to the wide range of ligand recognized by LRP the protein is assumed to play a pivotal role in diverse biological processes including lipid metabolism, cell growth, migration and tissue invasion. Additional signaling functions of LRPl have been described in the vessel wall, in neurons and in the lung. Furthermore, LRPl has been shown to have a major pathophysiological role in the central nervous system. It is for example highly expressed in neurons, where it interacts with several neuronal proteins such as NMDA receptor subunits and apparently regulates calcium signaling (Olney et al, 1997, Arch Neurol, 54: 1234-1240; Tseng et al, 2004, FEBS Lett, 562: 71-78). Additional evidence demonstrates that LRPl is a regulator of inflammatory responses in the lung, where it binds to the signaling inhibitory regulating protein alpha (SIRPalpha).
Like a variety of receptors and plasma membrane proteins, LRPl has been found to shed its extracellular domain and a soluble form of LRP can be detected in human plasma. The shed LRPl contains the alpha-chain (515 kDa) and a 55 kDa fragment of the 85 kDa beta-chain, revealing that proteolysis occurs in a membrane-proximal region. The physiological role of the shed ectodomains is assumed to include a competitive inhibition of ligand uptake by cell- surface-bound LRPl (Grimsley et al, 1999, Thromb Res, 94: 153-164). The involvement of LRPl in signaling pathways involves, inter alia, the cleavage of LRPl within the plane of the membrane segment. The released intracellular domain (LRP-ICD) subsequently translocates to a new location within the cell, where it may elicit its physiological response (May et al., 2002, J Biol Chem 277, 18736-18743). The cleavage is mediated by a presenilin-containing gamma-secretase complex. LRP-ICD appears to translocate to the nucleus where it colocalizes with the histone actetyltransferase Tip60, a transcription modulator having a role in the cleavage of APP to transcriptional activation.
The involvement of the full length LRPl in cancer development has been demonstrated in a study directed to the expression analysis in cancer cells (Song et al, 2009, Cancer Res, 69(3): 879-886). A mechanism, which could explain the involvement of full length LRPl in cancer development is the induction of the expression of matrix
metalloproteinase 2 (MMP2) and MMP9 and a corresponding promotion of the migration and invasion of cancer cells. For example, a knockdown of full length LRPl expression greatly decreased U87 cell migration and invasion, which was rescued by the forced expression of a functional LRPl minireceptor. Inhibition of ligand binding to full length LRPl by a specific antagonist, receptor-associated protein, also led to reduced cancer cell migration and invasion. It was found that the expression of functional MMP2 and MMP9 was selectively decreased in full length LRPl knockdown cells. Since decreased cell migration and invasion of LRPl knockdown cells were completely rescued by exogenous expression of MMP2 or MMP9, it was assumed that these MMPs are likely downstream targets of full length LRP1 -mediated signaling (Song et al, 2009, Cancer Res, 69(3): 879-886).
Although the elucidation of mechanistic interrelationships and connections prevailing during the molecular processes of differentiation or proliferation programs, in particular in the context of signal transduction cascades, has reached an advanced stage, tumors often possess a cytogenetical heterogeneity, which contributes to differences in clinical behavior and may lead to complications during the course of treatment procedures. This situation renders punctual and constricted diagnostic approaches mostly futile, in particular if a tumor has reached an advanced stage. What is more, a diagnostic marker for making an ultimate decision whether tumor development is ongoing or not is not yet available. None of the currently practiced standard diagnosis methods are sufficiently sensitive and specific for reliably diagnosing cancer which makes early detection of cancer difficult. Therefore there is a need for the provision of a new and effective, alternative diagnosis perspective for the detection, monitoring and prognostication of cancer, in particular of a versatile, tissue- and cell-type independent and ubiquitously usable cancer marker.
The present invention addresses this need and provides means and methods which allow the diagnosis and detection of cancer. This objective is accomplished by a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1) or derivatives thereof, comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a polynucleotide having the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (b) a polynucleotide fragment of SEQ ID NO: 1 , SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (c) a polynucleotide encoding a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10; (d) a polynucleotide encoding the polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10; (e) a polynucleotide encoding a polypeptide domain of SEQ ID NO: 2 or SEQ ID NO: 10; (f) a polynucleotide encoding a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10; (g) a polynucleotide which is a variant of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (h) a polynucleotide encoding a variant of SEQ ID NO: 2 or SEQ ID NO: 10; (i) a polynucleotide which is an allelic variant of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (j) a polynucleotide encoding an allelic variant of SEQ ID NO: 2 or SEQ ID NO: 10; (k) a polynucleotide which is a species homologue of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (1) a polynucleotide encoding a species homologue of SEQ ID NO: 2 or SEQ ID NO: 10; (m) a polynucleotide which is at least 70%, 80%, 90% or 95 % identical to a polynucleotide as defined in any one of (a) to (1); (n) a polynucleotide encoding a polypeptide having an amino acid sequence at least 70%>, 80%>, 90%> or 95 % identical to the amino acid sequence of a polypeptide encoded by a polynucleotide of any one of (a) to (m); and (o) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a) to (n); or the complementary strand of the polynucleotides (a) to (o).
The inventors surprisingly found that a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1) and, thus, representing an alternative and significantly size-reduced LRP1 splice product, in particular a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is detectable in a significant number of different cancer cells and cancer cell lines, but is absent in normal human tissues. Thus, the alternative LRP1 splice product, in particular a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 may be used as very effective biomarker for cancer prediction and as a decision tool for surveillance regimes, as well as for the prognosis and monitoring of cancer progression. Thus, the new diagnostic tool of the present invention allows an advantageous approach towards cancer diagnosis, which was hitherto barely feasible.
In a preferred embodiment of the present invention the nucleic acid as mentioned above comprises a nucleotide sequence which is fused at the 3 ' end or at the 5 ' end to the nucleotide sequence encoding wild-type LRP1 as set forth in SEQ ID NO: 3 or to fragments thereof, with the proviso that the nucleic acid sequence is not the sequence as set forth in SEQ ID NO: 4 or a sequence encoding the amino acid sequence of SEQ ID NO: 5. In a further preferred embodiment of the present invention the nucleic acid as mentioned above comprises a nucleotide sequence which is fused at the 3 ' end or at the 5' end to a heterologous nucleotide sequence. In another aspect the present invention relates to a vector comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4.
In another aspect the present invention relates to a method of making a recombinant host cell, comprising introducing the nucleic acid molecule as mentioned above, or the vector as mentioned above into a host cell.
In another aspect the present invention relates to a recombinant host cell containing said nucleic acid molecule or said vector as mentioned above or produced according to the method as mentioned above. In a preferred embodiment of the present invention said host cell expresses a polypeptide encoded by the nucleic acid molecule as mentioned above.
In yet another aspect the present invention relates to a method of making a polypeptide encoded by the nucleic acid as mentioned above comprising the steps of (a) culturing the recombinant host cell as mentioned above under conditions such that said polypeptide is expressed; and (b) recovering said polypeptide.
In another aspect the present invention relates to a polypeptide encoded by the nucleic acid molecule as mentioned herein above, or obtainable by the method of making a polypeptide mentioned above, with the proviso that the polypeptide has not the amino acid sequence of SEQ ID NO: 5.
In another aspect the present invention relates to a polypeptide encoded by an alternative exon of LRP1 or derivatives thereof, comprising a polypeptide selected from the group consisting of: (a) a polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10; (b) a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10; (c) a polypeptide domain of SEQ ID NO: 2 or SEQ ID NO: 10; (d) a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10; (e) a polypeptide variant of SEQ ID NO: 2 or SEQ ID NO: 10; (f) an allelic variant of SEQ ID NO: 2 or SEQ ID NO: 10; (g) a species homologue of SEQ ID NO: 2 or SEQ ID NO: 10; and (h) a polypeptide which is at least 70%, 80%, 90% or 95% identical to a polypeptide as defined in any one of (a) to (g). In a preferred embodiment of the present invention the polypeptide as mentioned above comprises an amino acid sequence which is fused at the N-terminus or at the C-terminus to the wild-type LRP1 protein as set forth in SEQ ID NO: 6 or to fragments thereof, with the proviso that the amino acid sequence has not the sequence of SEQ ID NO: 5. In another aspect the present invention relates to an antibody or fragment thereof, that specifically binds to the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5.
In a preferred embodiment of the present invention said antibody specifically binds to a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 or a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10.
In a further preferred embodiment of the present invention said antibody or fragment thereof is a polyclonal antibody, a monoclonal antibody, a human antibody, a chimeric antibody, a humanized antibody, a whole immunoglobulin molecule, an scFv, a Fab fragment, a Fab' fragment, an F(ab')2, an Fv, a disulfide linked Fv, a diabody or a sc(Fv)2.
In a further preferred embodiment of the present invention said antibody or fragment thereof is conjugated to a therapeutic or cytotoxic agent, is labeled or biotinylated. In a particularly preferred embodiment said labeled antibody or fragment thereof is labeled with a radioactive label, an enzymatic label, a fluorescent label, a chemiluminescent label, or a bio luminescent label. In another aspect the present invention relates to a cell that produces the antibody or fragment thereof as mentioned herein above. In yet another aspect the present invention relates to a nucleic acid molecule encoding the antibody or fragment thereof as mentioned herein above.
In a further aspect the present invention relates to an antibody which has the antigen- specific binding characteristics of the R4B6G5 antibody produced by the hybridoma having DSMZ accession No. DSM ACC3000.
In another aspect the present invention relates to an antibody produced by the hybridoma having DSMZ accession No. DSM ACC3000.
In another aspect the present invention relates to an affinity ligand for an expression product which comprises a nucleotide sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, preferably an oligonucleotide specific for the expression product, a probe specific for the expression product, an aptamer specific for the expression product or the polypeptide, a small molecule or peptidomimetic capable of specifically binding to the polypeptide or a non- coding RNA molecule specific for the expression product. In a preferred embodiment said non-coding RNA molecule is a miRNA or a siRNA molecule.
In another aspect the present invention relates to an antagonist of an expression product which comprises a nucleotide sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, wherein said antagonist comprises an antisense molecule against the nucleic acid molecule as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, an aptamer specific for the expression product or a non-coding RNA molecule specific for the expression product, preferably a catalytic RNA molecule, a miRNA molecule or a siRNA molecule.
In another aspect the present invention relates to an antagonist of the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, wherein said antagonist comprises a compound directly modulating the activity of said polypeptide, a dominant negative variant of said polypeptide, a molecule closely related to the natural ligand of said polypeptide, a polypeptide related to the LRP1 protein as set forth in SEQ ID NO: 6, an antibody as defined herein above, or a small molecule or peptidomimetic capable of specifically binding to the polypeptide.
In another aspect the present invention relates to a nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or the polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5 for use as a marker for cancer. In yet another aspect the present invention relates to the use of the nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4 or the polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5 as a marker for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer.
In another aspect the present invention relates to a diagnostic composition comprising an affinity ligand for an expression product which comprises a nucleotide sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5.
In another aspect the present invention relates to a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer, comprising an affinity ligand for an expression product which comprises a sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5. In yet another aspect the present invention relates to a diagnostic kit for detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer, comprising an affinity ligand for an expression product which comprises a nucleic acid molecule as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5.
In a preferred embodiment of the present invention said diagnostic composition or said diagnostic kit comprises an affinity ligand, which is a set of oligonucleotides specific for the expression product, a probe specific for the expression product, an aptamer specific for the expression product or the polypeptide or an antibody as mentioned herein above. In a further preferred embodiment of the present invention said use as a marker for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer as mentioned herein above is a use, wherein the diagnosing, detecting, monitoring or prognosticating is to be carried out on a sample obtained from an individual. In another aspect the present invention relates to a method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of determining the level of an expression product comprising a nucleic acid molecule as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4 or of a polypeptide as defined herein above or comprising the amino acid sequence of SEQ ID NO: 5.
In a further preferred embodiment the method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer as mentioned above comprises a determining step, which is accomplished by the measurement of the nucleic acid level of an expression product comprising a nucleic acid molecule as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, or of the protein level or biological activity of a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5. In a further aspect the present invention relates to a method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptide. In a preferred embodiment of the present invention the method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptide additionally comprises the measurement of the nucleic acid level of said truncated LRP 1 expression product and/or the measurement of the protein level or biological activity of said truncated LRP 1 polypeptide.
In a further preferred embodiment of the present invention said truncated LRP 1 expression product comprises a nucleic acid molecule as herein above or comprises the nucleotide sequence of SEQ ID NO: 4 and/or said truncated LRP 1 polypeptide comprises a polypeptide as defined herein above or comprises the amino acid sequence of SEQ ID NO: 5. In a preferred embodiment of the present invention the above mentioned methods are to be performed with a sample obtained from an individual.
In a particularly preferred embodiment of the present invention the sample as mentioned above is a tissue sample, an urine sample, an urine sediment sample, a blood sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells.
In a further aspect the present invention relates to a method of identifying antagonists of the polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5, comprising the steps of: (a) producing cells which express said polypeptide either as secreted protein or on the cell membrane; (b) contacting the polypeptide produced in step (a) with a test sample comprising a potential antagonist; and (c) identifying an antagonist by observing binding and/or inhibition of activity of said polypeptide.
In a further aspect the present invention relates to a method of identifying antagonists of an expression product comprising a sequence as mentioned herein above or comprising the nucleotide sequence of SEQ ID NO: 4, comprising the steps of: (a) contacting a test sample comprising a potential antagonist with one or more cells expressing said sequence; (b) detecting the expression level(s) of said sequence; and (c) identifying an antagonist by observing reduction of the expression level of said sequence as compared to that detected in the absence of the potential antagonist.
In yet another aspect the present invention relates to an antagonist obtainable by the method of identifying antagonists of the polypeptide or the expression product as mentioned herein above. In yet another aspect the present invention relates to a method of identifying a binding partner to the polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5 comprising: (a) contacting said polypeptide with a potential binding partner; and (b) determining whether a binding interaction between both molecules takes place.
In yet another aspect the present invention relates to a binding partner to the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5 obtainable by the method of identifying binding partners as mentioned above. In another aspect the present invention relates to a method of making cytotoxic T lymphocytes (CTLs) specific for the polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5.
In another aspect the present invention relates to a CTL specific for an antigen derived from a polypeptide as mentioned herein above or comprising the amino acid sequence of SEQ ID NO: 5, or obtainable by the method of making cytotoxic T lymphocytes as mentioned herein above.
In another aspect the present invention relates to a pharmaceutical composition comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the antibody as mentioned above, the antagonist as mentioned above, the binding partner as mentioned above or the CTL as mentioned above. Due to the surprising finding that a nucleic acid molecule comprising an alternative exon of LRP1 and, thus, representing an alternative LRP1 splice product, is detectable in a significant number of different tumor cells and tumor cell lines, but is absent in normal human tissues, a nucleic acid molecule itself, a vector comprising the nucleic acid molecule, a host cell expressing said nucleic acid, a corresponding polypeptide, a specifically binding antibody, an antagonist against said nucleic acid and/or polypeptide or a binding partner of said polypeptide or a CTL according to the present invention may advantageously be used as medicaments. Thus, by counteracting the observed expression or up-regulation process, short splice variant LRP 1 , in particular variants thereof, and/or LRP1 modification agents may be used as a medicament, e.g. as a medicament counteracting the observed expression or up-regulation as well as subsequent or secondary consequences thereof, i.e. disease states. In yet another aspect the present invention relates to a pharmaceutical composition comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the antibody as mentioned above, the antagonist as mentioned above, the binding partner as mentioned above or the CTL as mentioned above for the treatment or prevention of cancer.
In a further aspect the present invention relates to a medical kit for the treatment or prevention of cancer, comprising at least one element selected from the group consisting of: the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the antibody as mentioned above, the antagonist as mentioned above, the binding partner as mentioned above and the CTL as mentioned above.
In another aspect the present invention relates to a vaccine comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the CTL as mentioned above or an anti-idiotypic antibody against the antibody as mentioned above.
In another aspect the present invention relates to a vaccine comprising the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the CTL as mentioned above or an anti-idiotypic antibody against the antibody as mentioned above for the treatment or prevention of cancer.
In a further aspect the present invention relates to a method of inducing an immune response against cancer in an individual comprising administering to said subject a therapeutically effective amount of the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the CTL as mentioned above or an anti- idiotypic antibody against the antibody as mentioned above.
In a further aspect the present invention relates to a method of treatment or prevention of cancer comprising administering to an individual a therapeutically effective amount of the nucleic acid molecule as mentioned above or comprising the nucleotide sequence of SEQ ID NO: 4, the vector as mentioned above, the host cell as mentioned above, the polypeptide as mentioned above or comprising the amino acid sequence of SEQ ID NO: 5, the antibody as mentioned above, the antagonist as mentioned above, the binding partner as mentioned above, the CTL as mentioned above or the vaccine as mentioned above.
In a preferred embodiment said cancer as mentioned above is breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma. In a particularly preferred embodiment said brain tumor is selected from the group of astrocytoma and glioma. These and other characteristics, features and objectives of the present invention will become apparent from the following detailed description, taken in conjunction with the accompanying figures and examples, which demonstrate by way of illustration the principles of the invention.
The description is given for the sake of example only, without limiting the scope of the invention.
DESCRIPTON OF THE FIGURES
Fig. 1 depicts the results of an RT-PCR reaction of marker transcripts in several tumor- derived cell lines and normal human tissues/organs. The control transcript has been obtained by RT-PCR from a full length LRPl transcript. As positive and loading control the transcript of beta-actin was used. The results show that the LRPl tumor marker according to the present invention is absent or below the detection limit in different non-cancerous organs investigated. This is in contrast to the unspliced parental transcript, which appears to be ubiquitary expressed.
Fig. 2 depicts the results of an RT-PCR reaction of marker transcripts in normal human tissues/organs corresponding to the tumor-derived cell lines shown in Fig. 1. The control transcript has been obtained by RT-PCR from a full length LRPl transcript. As positive and loading control the transcript of beta-actin was used. The results show that the LRPl tumor marker according to the present invention is absent or below the detection limit in different non-cancerous organs investigated. This is in contrast to the unspliced full-length transcript, which appears to be ubiquitary expressed.
Fig. 3 shows the immunogenicity of a peptide derived from the marker sequence. A peptide having the sequence of SEQ ID NO: 10 was used for immunization of rabbits for antibody production. Titer plates were coated with pure peptide (1, 4), peptide-BSA conjugate (2) and, as an antigenic control, female human serum (3). The rabbit Ig- fraction ^g/ml) was added at the titer plate. A polyclonal anti-PSA-Ig (rabbit) antibody (non specific antibody) was used as antibody control (4). It could be demonstrated that the marker peptide having the sequence of SEQ ID NO: 10 is immunogenic and elicits the production of polyclonal antibodies. The antibodies are specific as no reactivity with serum components is observed and non-specific antibodies do not react with the peptide. Fig. 4 shows the immunogenicity of a peptide derived from the marker sequence. A peptide having the sequence of SEQ ID NO: 10 was used for immunization of rabbits for antibody production. A titer plate was coated with rabbit anti-peptide Ig. Whole human serum was incubated with peptide-BSA, with BSA alone and loaded onto the titer plate (1 : Peptide-BSA in serum; 2: serum alone; 3: peptide-BSA in PBS-T; 4: BSA in serum). The plate was washed with washing buffer and the cavities were incubated with rabbit anti-BSA Ig-HRP. The results show that the marker peptide having the sequence of SEQ ID NO: 10 can be detected in whole human serum by ELISA without interference of serum proteins.
Fig. 5 shows the immunogenicity of a peptide derived from the marker sequence. A peptide having the sequence of SEQ ID NO: 10 was coated to keyhole hemocyanin and used for immunization of BALB/c mice. Spleen cells were fused with SP2/0 myeloma cells and antibody-producing cell clones were screened. Highly active clones were selected, propagated and monoclonal antibodies were prepared from their supernatant. Titer plates were coated with the peptide (1, 3, 4, 6) and peptide-BSA conjugate (2, 5), incubated with different monoclonal antibodies or buffer (3, 6) and anti-mouse-Ig-HRP as secondary antibody. The used antibodies were in 1 and 2: a clone 4/B 2A anti-peptide monoclonal antibody; and in 4 and 5: a clone R4B6G5 anti-peptide monoclonal antibody. The Figure shows that the marker peptide having the sequence of SEQ ID NO: 10 is immunogenic in mice and elicits monoclonal antibodies, which are reactive with the peptide. Fig. 6 depicts an immuno staining of malignant cells for analyzing the marker sequence having the sequence of SEQ ID NO: 10. Fixed 1321N1 astrocytoma were stained with anti-peptide-monoclonal antibody (clone R4B6G5) (^g/ml) in TBS-T, 5% BSA overnight. Cells were washed and incubated with goat anti-mouse Ig-Cy3. Slides were analysed by means of a fluorescence microscope. Shown is immunoreactivity in the cytoplasma and the cell membrane. Nuclei were counterstained with DAPI. The Figure shows that a polypeptide containing the sequence of SEQ ID NO: 10 demonstrates a cytoplasmic localisation with accumulation in the plasma membrane of 132 IN 1 astrocytoma cells. The marker can, thus, efficiently be used to detect malignant transformation in cells of tissue sections.
Fig. 7 depicts the evaluation of tissue penetration of a human glioma tumor in the form of an agarose gel electrophoresis for separation of marker PCR products. Tumor material was obtained from a patient suffering from a glioma tumor. RNA was prepared from tissue material obtained from the tumor center, margin and non-tumor
neighborhood and analysed by RT-PCR of the marker, ^g cDNA was used for PCR reaction. Lane 1 : sample prepared from 1321N1 astrocytoma cells (positive control); lane 2: sample prepared from tissue sample from the tumor margin; lane 3: sample prepared from tissue sample from the tumor center; lane 4: tissue sample prepared from non-tumor brain tissue. The Figure shows that marker expression is lower at the tumor margin and absent outside the tumor. Analysis of marker expression thus allows an evaluation of tissue penetration of tumor cells. Fig. 8 shows the Elispot assay of human PBMC (peripheral blood lymphocyte) stimulated by a peptide having the sequence of SEQ ID NO: 10 for 24h to evaluate immune regulatory effects. PBMCs from 3 healthy volunteers were resuspended in RPMI medium with 1% L-glutamine, HEPES and 10% fetal bovine serum and plated at 150 000 PBMCs/well in duplicate for increasing concentrations of the peptide (2.5 μg to 10 μg/ml) and controls (PBS resp. PMA (phorbol myristate acetate). ELISPOT plates were incubated at 37°C for 24 h in the presence of 5% C02. Fig. 8A shows the release of interferon gamma (IFN-gamma) from PBMC upon stimulation with the peptide. NC: treatment with PBS; PC(PMA): treatment with PMA. The data demonstrate that IFN- gamma as indicator of a T cell directed immunogeneity could not be observed and that peptide has a low capacity to induce an immune response directed to the peptide. Fig. 8B depicts the release of perforin by PBMC upon stimulation the peptide. NC:
treatment with PBS; PC(PMA): treatment with PMA. The data demonstrate that in NK cells and cytotoxic T cells, a dose dependent stimulation of perforin secretion is induced.
DETAILED DESCRIPTION OF THE INVENTION
The inventors have found that a nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRP1) and, thus, representing an alternative LRP1 splice product, in particular a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is detectable in a significant number of different tumor cells and tumor cell lines, but is absent in normal human tissues.
Although the present invention will be described with respect to particular
embodiments, this description is not to be construed in a limiting sense.
Before describing in detail exemplary embodiments of the present invention, definitions important for understanding the present invention are given.
As used in this specification and in the appended claims, the singular forms of "a" and "an" also include the respective plurals unless the context clearly dictates otherwise. In the context of the present invention, the terms "about" and "approximately" denote an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates a deviation from the indicated numerical value of ±20 %, preferably ±15 %, more preferably ±10 %, and even more preferably ±5 %. In certain aspects the term "about" may also refer to a value, which is larger or smaller by several integers, preferably by 5, 4, 3, 2, or 1 in comparison to the starting value.
It is to be understood that the term "comprising" is not limiting. For the purposes of the present invention the term "consisting of is considered to be a preferred embodiment of the term "comprising of. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is meant to also encompass a group, which preferably consists of these embodiments only. If the term "comprising" is used in the context of sequences, in particular nucleotide sequences, the term may not only refer to the sequence mentioned in the sequence listing, but also to the complementary sequence thereof, unless the context states otherwise.
Furthermore, the terms "first", "second", "third" or "(a)", "(b)", "(c)", "(d)" or "(i)", "(ii)", "(iii)", "(iv)", "(v)", "(vi)", "(vii)" etc. and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
In case the terms "first", "second", "third" or "(a)", "(b)", "(c)", "(d)" or "(i)", "(ii)", "(iii)", "(iv)", "(v)", "(vi)", "(vii)" etc. relate to steps of a method or use there is no time or time interval coherence between the steps, i.e. the steps may be carried out simultaneously or there may be time intervals of seconds, minutes, hours, days, weeks, months or even years between such steps, unless otherwise indicated in the application or claims as set forth herein above or below.
It is to be understood that this invention is not limited to the particular methodology, protocols, proteins, bacteria, vectors, reagents etc. described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention that will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.
Preferably, the terms used herein are defined as described in "A multilingual glossary of biotechno logical terms: (IUPAC Recommendations)", Leuenberger, H.G.W, Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland. Although several documents are cited throughout the text of this specification, which are incorporated by reference in their entirety, nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
As set out above the present invention concerns a nucleic acid molecule comprising or consisting of an alternative exon of low density lipoprotein-related protein 1 (LRP1) or derivatives thereof, comprising or consisting of a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a polynucleotide having, comprising or consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (b) a polynucleotide fragment of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (c) a polynucleotide encoding a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10; (d) a polynucleotide encoding the polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10; (e) a polynucleotide encoding a polypeptide domain of SEQ ID NO: 2 or SEQ ID NO: 10; (f) a polynucleotide encoding a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10; (g) a polynucleotide which is a variant of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (h) a polynucleotide encoding a variant of SEQ ID NO: 2 or SEQ ID NO: 10; (i) a polynucleotide which is an allelic variant of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; 0') a polynucleotide encoding an allelic variant of SEQ ID NO: 2 or SEQ ID NO: 10; (k) a polynucleotide which is a species homologue of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (1) a polynucleotide encoding a species homologue of SEQ ID NO: 2 or SEQ ID NO: 10; (m) a polynucleotide which is at least 70%, 80%, 90% or 95 %> identical to a polynucleotide as defined in any one of (a) to (1); (n) a
polynucleotide encoding a polypeptide having, comprising or consisting of an amino acid sequence at least 70%>, 80%>, 90%> or 95 %> identical to the amino acid sequence of a polypeptide encoded by a polynucleotide of any one of (a) to (m); and (o) a
polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a) to (n); or the complementary strand of polynucleotides (a) to (o). In a particular embodiment of the present invention, a nucleic acid molecule according to the present invention may not have or consist of the sequence as set forth in SEQ ID NO: 4 or a sequence encoding the amino acid sequence of SEQ ID NO: 5. In another aspect the present invention relates to a polypeptide encoded by an alternative exon of LRP1 or derivatives thereof, comprising or consisting of a polypeptide selected from the group consisting of: (a) a polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10; (b) a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10; (c) a polypeptide domain of SEQ ID NO: 2 or SEQ ID NO: 10; (d) a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10; (e) a polypeptide variant of SEQ ID NO: 2 or SEQ ID NO: 10; (f) an allelic variant of SEQ ID NO: 2 or SEQ ID NO: 10; (g) a species homologue of SEQ ID NO: 2 or SEQ ID NO: 10; and (h) a polypeptide which is at least 70%, 80%, 90%) or 95% identical to a polypeptide as defined in any one of (a) to (g). In a particular embodiment of the present invention, a polypeptide according to the present invention may not have or consist of the amino acid sequence of SEQ ID NO: 5.
The term "polynucleotide" as used herein refers to a molecule having, comprising or consisting of a nucleic acid sequence or nucleotide sequence. A polynucleotide according to the present invention may comprise or consist of an entire coding sequence or a portion of a coding sequences, and/or may comprise or consist of all or a portion of an intron, preferably as defined herein below, and/or may comprise an untranslated region, e.g. a 5' UTR and/or a 3' UTR. A polynucleotide according to the present invention may also comprise or consist of portions of a genomic flanking gene, i.e. 5' or 3' to the genomic sequences, preferably of sequences corresponding to SEQ ID NO: 1, 3, 4, 7 or 8 or 11.
The term "SEQ ID NO: 1" as used in the context of the present invention designates the nucleotide sequence corresponding to positions 55,825,540 and 55,829,730 to
55,829,779 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), i.e. the translated portion of the ultimate nucleotide of exon 6 and alternative exon 7 of lipoprotein receptor-related protein 1 (LRP1). The term "SEQ ID NO: 3" designates the nucleotide sequence of the full-length LRP1 cDNA, e.g. the DNA sequence comprising the LRP1 open reading frame comprised in Genbank Accession No. NM_002332 (version NM_002332.2, GI: 126012561 as of 12 March 2009). The term "SEQ ID NO: 7" designates the nucleotide sequence corresponding to positions 55,825,540 and 55,829,730 to 55,830,105 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), i.e. the translated portion of the ultimate nucleotide of exon 6 and alternative exon 7 of LRPl as well as the untranslated portion of alternative exon 7 of LRPl . The term "SEQ ID NO: 8" designates the nucleotide sequence corresponding to positions 55,825,540 and 55,829,730 to
55,830,444 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), i.e. the translated portion of the ultimate nucleotide of exon 6 and alternative exon 7 of LRPl as well as the untranslated portion of alternative exon 7 of LRPl and a 3' downstream sequence.
The term "SEQ ID NO: 9" designates positions 55,825,540 and 55,829,730 to
55,829,779 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), i.e. the translated portion of the ultimate nucleotide of exon 6 and alternative exon 7 of lipoprotein receptor-related protein 1 (LRPl) followed by the triplet TGC encoding a cysteine amino acid before the stop codon. The term "SEQ ID NO: 11" as used in the context of the present invention designates the genomic sequence of the LRPl gene, e.g. the sequence as defined in Ensembl Accession No. ENSG00000123384 (Ensembl release 55, as of 22 September 2009).
The term "polypeptide" as used herein refers to a molecule having, comprising or consisting of the translated amino acid sequence generated from a polynucleotide or nucleic acid according to the present invention as defined throughout the specification. Preferably, the term refers to a molecule having, comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or 10, a fragment thereof, a domain thereof, an epitope contained therein, a variant thereof, an allelic variant thereof, a species homologue thereof as well as a homologous sequence thereof or any further combinations, fusion etc. thereof as defined throughout the specification.
The term "SEQ ID NO: 2" designates the amino acid sequence of a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1. The term "SEQ ID NO: 6" designates the amino acid sequence of a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 3, e.g. the protein sequence as defined in Genbank Accession No. NM-002332
(version NM-002332.2, GI: 126012561 as of 12 March 2009). The term "SEQ ID NO: 10" designates the amino acid sequence of a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 9, i.e. the amino acid sequence of SEQ ID NO: 2 followed by a C-terminal cysteine residue.
The term "exon 1 of LRP 1" or "exon 1" as used throughout the present application refers to position 55,808,543 to 55,809,081 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 2 of LRP 1" or "exon 2" as used throughout the present application refers to position 55,818,509 to 55,818,631 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 3 of LRP 1" or "exon 3" as used throughout the present application refers to position 55,821 ,424 to 55,821,561 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 4 of LRP 1" or "exon 4" as used throughout the present application refers to position 55,823,729 to 55,823,848 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 5 of LRP 1" or "exon 5" as used throughout the present application refers to position 55,825,022 to 55,825,150 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 6 of LRP 1" or "exon 6" as used throughout the present application refers to position 55,825,277 to 55,825,540 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "alternative exon 7 of LRP 1" or "alternative exon 7" as used throughout the present application refers to position 55,829,730 to 55,830,105 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 8 of LRP 1" or "exon 8" as used throughout the present application refers to position 55,834,529 to 55,834,751 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 9 of LRP 1" or "exon 9" as used throughout the present application refers to position 55,836,144 to 55,836,333 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 10 of LRP 1" or "exon 10" as used throughout the present application refers to position 55,836,827 to 55,836,970 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 11 of LRP 1" or "exon 11" as used throughout the present application refers to position 55,838,452 to 55,838,688 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 12 of LRP 1" or "exon 12" as used throughout the present application refers to position 55,839,875 to 55,840,055 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 13 of LRP 1" or "exon 13" as used throughout the present application refers to position 55,840,943 to 55,841,165 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 14 of LRP 1" or "exon 14" as used throughout the present application refers to position 55,842,367 to 55,842,568 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 15 of LRP 1" or "exon 15" as used throughout the present application refers to position 55,842,908 to 55,845,995 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 16 of LRP 1" or "exon 16" as used throughout the present application refers to position 55,845,855 to 55,845,995 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 17 of LRP 1" or "exon 17" as used throughout the present application refers to position 55,846,134 to 55,846,259 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 18 of LRP 1" or "exon 18" as used throughout the present application refers to position 55,846,980 to 55,847,096 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 19 of LRP 1" or "exon 19" as used throughout the present application refers to position 55,847,494 to 55,847,574 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 20 of LRP 1" or "exon 20" as used throughout the present application refers to position 55,849,190 to 55,849,357 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 21 of LRP 1" or "exon 21" as used throughout the present application refers to position 55,853,218 to 55,853,400 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 22 of LRP 1" or "exon 22" as used throughout the present application refers to position 55,853,830 to 55,854,030 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 23 of LRP 1" or "exon 23" as used throughout the present application refers to position 55,855,510 to 55,855,755 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 24 of LRP 1" or "exon 24" as used throughout the present application refers to position 55,855,959 to 55,856,156 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 25 of LRP 1" or "exon 25" as used throughout the present application refers to position 55,857,091 to 55,857,295 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 26 of LRP 1" or "exon 26" as used throughout the present application refers to position 55,857,477 to 55,857,641 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 27 of LRP 1" or "exon 27" as used throughout the present application refers to position 55,858,409 to 55,858,653 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 28 of LRP 1" or "exon 28" as used throughout the present application refers to position 55,858,940 to 55,859,071 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 29 of LRP 1" or "exon 29" as used throughout the present application refers to position 55,859,379 to 55,859,606 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 30 of LRP 1" or "exon 30" as used throughout the present application refers to position 55,859,832 to 55,860,006 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 31 of LRP 1" or "exon 31" as used throughout the present application refers to position 55,860,097 to 55,860,191 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 32 of LRP 1" or "exon 32" as used throughout the present application refers to position 55,860,380 to 55,860,529 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 33 of LRP 1" or "exon 33" as used throughout the present application refers to position 55,860,717 to 55,860,857 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 34 of LRP 1" or "exon 34" as used throughout the present application refers to position 55,861,207 to 55,861,341 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 35 of LRP 1" or "exon 35" as used throughout the present application refers to position 55,863,429 to 55,863,560 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 36 of LRP 1" or "exon 36" as used throughout the present application refers to position 55,863,825 to 55,863,959 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 37 of LRP 1" or "exon 37" as used throughout the present application refers to position 55,864,135 to 55,864,264 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 38 of LRP 1" or "exon 38" as used throughout the present application refers to position 55,864,376 to 55,864,502 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 39 of LRP 1" or "exon 39" as used throughout the present application refers to position 55,864,889 to 55,865,040 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 40 of LRP 1" or "exon 40" as used throughout the present application refers to position 55,865,131 to 55,865,255 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 41 of LRP 1" or "exon 41" as used throughout the present application refers to position 55,865,581 to 55,865,958 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 42 of LRP 1" or "exon 42" as used throughout the present application refers to position 55,867,317 to 55,867,506 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 43 of LRP 43" or "exon 43" as used throughout the present application refers to position 55,870,855 to 55,871,059 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 44 of LRP 1" or "exon 44" as used throughout the present application refers to position 55,871,370 to 55, 871, 562of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 45 of LRP 1" or "exon 45" as used throughout the present application refers to position 55,872,895 to 55,873,020 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 46 of LRP 1" or "exon 46" as used throughout the present application refers to position 55,873,226 to 55,873,354 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 47 of LRP 1" or "exon 47" as used throughout the present application refers to position 55,873,616 to 55,873,735 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 48 of LRP 1" or "exon 48" as used throughout the present application refers to position 55,873,949 to 55,874,062 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 49 of LRP 1" or "exon 49" as used throughout the present application refers to position 55,874,404 to 55,874,553 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 50 of LRP 1" or "exon 50" as used throughout the present application refers to position 55,874,627 to 55,874,749 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 51 of LRP 1" or "exon 51" as used throughout the present application refers to position 55,875,035 to 55,875,151 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 52 of LRP 1" or "exon 52" as used throughout the present application refers to position 55,875,321 to 55,875,449 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 53 of LRP 1" or "exon 53" as used throughout the present application refers to position 55,875,708 to 55,875,830 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 54 of LRP 1" or "exon 54" as used throughout the present application refers to position 55,875,913 to 55,876,053 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 55 of LRP 1" or "exon 55" as used throughout the present application refers to position 55,876,137 to 55,876,327 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 56 of LRP 1" or "exon 56" as used throughout the present application refers to position 55,877,032 to 55,877,215 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 57 of LRP 1" or "exon 57" as used throughout the present application refers to position 55,877,349 to 55,877,434 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 58 of LRP 1" or "exon 58" as used throughout the present application refers to position 55,877,595 to 55,877,714 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 59 of LRP 1" or "exon 59" as used throughout the present application refers to position 55,878,206 to 55,878,393 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 60 of LRP 1" or "exon 60" as used throughout the present application refers to position 55,878,515 to 55,878,720 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 61 of LRP 1" or "exon 61" as used throughout the present application refers to position 55,879,262 to 55,879,450 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 62 of LRP 1" or "exon 62" as used throughout the present application refers to position 55,879,927 to 55,880,075 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 63 of LRP 1" or "exon 63" as used throughout the present application refers to position 55,880,492 to 55,880,585 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 64 of LRP 1" or "exon 64" as used throughout the present application refers to position 55,880,749 to 55,880,865 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 65 of LRP 1" or "exon 65" as used throughout the present application refers to position 55,881,084 to 55,881,203 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 66 of LRP 1" or "exon 66" as used throughout the present application refers to position 55,881,547 to 55,881,669 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 67 of LRP 1" or "exon 67" as used throughout the present application refers to position 55,881,830 to 55,881,955 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 68 of LRP 1" or "exon 687" as used throughout the present application refers to position 55,882,471 to 55,882,587 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 69 of LRP 1 " or "exon 69" as used throughout the present application refers to position 55,883,231 to 55,883,337 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 70 of LRP 1" or "exon 70" as used throughout the present application refers to position 55,883,439 to 55,883,571 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 71 of LRP 1" or "exon 71" as used throughout the present application refers to position 55,884,460 to 55,884,579 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 72 of LRP 1" or "exon 72" as used throughout the present application refers to position 55,884,677 to 55,884,799 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 73 of LRP 1" or "exon 73" as used throughout the present application refers to position 55,885,159 to 55,885,299 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 74 of LRP 1" or "exon 74" as used throughout the present application refers to position 55,885,401 to 55,885,535 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 75 of LRP 1" or "exon 75" as used throughout the present application refers to position 55,885,608 to 55,885,727 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 76 of LRP 1" or "exon 76" as used throughout the present application refers to position 55,886,523 to 55,886,791 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 77 of LRP 1" or "exon 77" as used throughout the present application refers to position 55,888,088 to 55,888,266 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 78 of LRP 1" or "exon 78" as used throughout the present application refers to position 55,888,761 to 55,888,867 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 79 of LRP 1" or "exon 79" as used throughout the present application refers to position 55,889,133 to 55,889,249 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 80 of LRP 1" or "exon 80" as used throughout the present application refers to position 55,889,742 to 55,889,918 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 81 of LRP 1" or "exon 81" as used throughout the present application refers to position 55,890,079 to 55,890,219 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 82 of LRP 1" or "exon 82" as used throughout the present application refers to position 55,890,357 to 55,890,530 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 83 of LRP 1" or "exon 83" as used throughout the present application refers to position 55,890,768 to 55,890,929 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 84 of LRP 1" or "exon 84" as used throughout the present application refers to position 55,891,226 to 55,891,400 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 85 of LRP 1" or "exon 85" as used throughout the present application refers to position 55,891,537 to 55,891,638 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 86 of LRP 1" or "exon 86" as used throughout the present application refers to position 55,891,800 to 55,891,864 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 87 of LRP 1" or "exon 87" as used throughout the present application refers to position 55,891,977 to 55,892,067 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The term "exon 88 of LRP 1" or "exon 88" as used throughout the present application refers to position 55,892,167 to 55,892,311 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009).
The terms "intronl-2", "intron 2-3", "intron 3-4", "intron 4-5", "intron 5-6" and "intron 6-7", "intron 8-9", "intron 9-10", "intron 10-11" etc. up to "intron 87-88" refer to the sequences comprising the positions between the exons as defined herein above, respectively. E.g., "intron 1-2" refers to position 55,809,082 to 55,818,508 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), or "intron 8-9" refers to position 55,834,752 to 55,836,143 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009) etc.
The term "polynucleotide fragment" as used herein refers to a short polynucleotide having, comprising or consisting of a nucleic acid sequence, which is a portion of the sequence contained in the nucleotide sequence of SEQ ID NOs: 1 , 7, 8 or 9 or the complementary strand thereto. A nucleotide fragments according to the invention may be at least about 10 nt, preferably at least about 15 nt, more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt or at least about 50 nt in length. A fragment of "at least 20 nt in length" may, for example, include 20 or more contiguous bases from the sequence contained in the nucleotide sequence of SEQ ID NOs: 1, 3, 7, 8 or 9 or the complementary strand thereto. Moreover, representative examples of polynucleotide fragments of the invention include, for example, fragments comprising, or alternatively consisting of a sequence from about nucleotide number 1-10, 5-15, 11-20, 16 to 25, 21-30, 26-35, 31- 40, 36-45, 41 to the end of SEQ ID NOs: 1, 7, 8 or 9, or the complementary strand thereto. Alternatively, polynucleotide fragments of the invention may include, for example, fragments comprising, or alternatively consisting of a sequence from about nucleotide number 1-500, 501-1000, 1001-1500, 1501-2000, 2001-2500, 2501-3000, 3001-3500, 3501-4000, 4001-4500, 4501-5000, 5001-5500, 5501-6000, 6001-6500, 6501-7000, 7001-7500, 7501-8000, 8001-8500, 8501-9000, 9001-9500, 9501-10000, 10001-10500, 10501-11000, 11001-11500, 11501-12000, 12001-12500, 12501-13000, 13001-13500, 13501-14000, 14001 to 14500, or 14501 to the end of SEQ ID NO: 3, or the complementary strand thereto.
The term "polypeptide fragment" as used herein refers to an amino acid sequence, which is a portion of the sequence contained in the amino acid sequence of SEQ ID NOs: 2, 6 or 10. Polypeptide (or alternatively protein) fragments may be either
"freestanding" or be comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-5, 6-10, 11 to the end of SEQ ID NOs: 2 or 10. Alternatively, polypeptide fragments of the invention may include, for example, fragments comprising, or alternatively consisting of a sequence from about amino acid number 1-200, 201-400, 401-600, 601-800, 801-1000, 1001- 1200, 1201-1400, 1401-1600, 1601-1800, 1801-2000, 2001-2200, 2201-2400, 2401- 2600, 2601-2800, 2801-3000, 3001-3200, 3201-3400, 3401-3600, 3601-3800, 3801- 4000, 4001-4200, 4201-4400, or 4401 to the end of SEQ ID NO: 6. Moreover, polypeptide fragments can be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, or 4400 amino acids in length. The term "polypeptide domain" as used herein refers to functional or structural domains of a polypeptide, preferably to any typical secondary or 3-dimensional protein structure like a helical portion, a beta-sheet, a beta-bridge, a bonded turn or a bend. The term "secondary protein structure" preferably relates to the 3-dimensional protein structure as defined in the Dictionary of Protein Secondary Structure (DSSP; Kabsch et al, 1983, Biopolymers 22 (12), 2577-2637). According to the DSSP method the protein secondary structure is typically described with single letter codes. The secondary structure may be assigned based on hydrogen bonding patterns. Typically, there are eight types of secondary structure, which the DSSP method describes: G = 3-turn helix (310 helix) with a minimum length of 3 residues. H = 4-turn helix (a helix) with a minimum length of 4 residues. I = 5-turn helix (π helix) with a minimum length of 5 residues. T = hydrogen bonded turn (3, 4 or 5 turn). E = extended strand in parallel and/or anti-parallel β-sheet conformation with a minimum length of 2 residues. B = residue in isolated β-bridge (single pair β-sheet hydrogen bond formation) and S = bend (the only non-hydrogen-bond based assignment). Amino acid residues, which are not in any of the above conformations are assigned as the eighth type 'Coil': typically codified as C (coil). The helices (G, H and I) and sheet conformations are normally required to have a reasonable length. Accordingly, 2 adjacent residues in the primary structure must form the same hydrogen bonding pattern. If the helix or sheet hydrogen bonding pattern is too short they are designated as T or B, respectively.
The secondary structure of a protein or the presence of a corresponding domain in a protein or polypeptide may be predicted by suitable methods known to the person skilled in the art. Typically, methods of secondary- structure prediction may be used which are based on the helix- or sheet-forming propensities of individual amino acids, optionally coupled with rules for estimating the free energy of forming secondary structure elements. Furthermore, multiple sequence alignments may be exploited, thus using the full distribution of amino acids that occur at a position and in its vicinity, typically about 7 residues on either side throughout evolution. A further typical prediction approach is the examination of the average hydrophobicity or residue solvent accessibility at a certain position and at nearby positions. By combining alignment data and hydrophobicity or residue solvent accessibility data the accuracy of the prediction may be raised. Typically, mathematical methods including neural networks, hidden Markov models and support vector machines may be used for the prediction of secondary structures of the protein. Preferred examples of polypeptide domains according to the present invention are alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil- forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions. The term "polypeptide epitope" as used in the context of the present invention refers to a portion of a polypeptide having antigenic and/or immunogenic activity in an appropriate host organism, e.g. in an animal, preferably in a mammal, and more preferably in a human, a mouse or a rabbit. The term "immunogenic epitope" as used herein designates a portion of a protein that elicits an antibody response in an
appropriate host organism, e.g. in an animal, as determined by any method known in the art, for example, by the methods for generating antibodies described in Geysen et al, PNAS, 1983, 81 : 3998- 4002. The term "antigenic epitope" as used herein, is defined as a portion of a protein or polypeptide to which an antibody can immunospecifically bind, as determined by any method known in the art, e.g. by immunoassays. Immunospecific binding exclues non-specific binding but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic.
Fragments which function as epitopes may be produced by any conventional means, e.g. by those described in Houghten, PNAS, 1985, 82: 5131-5135.
Preferably, antigenic epitopes according to the present invention comprise, or alternatively consist of, a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, and, most preferably, between about 10 to about 15 amino acids. Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length. Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies that specifically bind the epitope. Preferred antigenic epitopes may include the antigenic epitopes as mentioned above, as well as any combination of 2, 3, 4, 5 or more of these antigenic epitopes. Antigenic epitopes may further be used as the target molecules in immunoassays.
Similarly, immunogenic epitopes may be used, for example, to induce antibodies according to methods well known in the art, e.g. as described in Chow et al, 1985, PNAS, 82: 910914; and Bittle et al, 1985, J. Gen. Virol, 66: 2347-2354. Preferred immunogenic epitopes may include the immunogenic epitopes as mentioned above, as well as any combination of 2, 3, 4 or 5 or more of these immunogenic epitopes. The polypeptides comprising one or more immunogenic epitopes may be presented for eliciting an antibody response together with a carrier protein, such as an albumin, to an animal system (e.g. a rabbit or mouse), or, if the polypeptide is of sufficient length (at least about 25 amino acids) the polypeptide may be presented without a carrier.
However, immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide.
Particularly preferred epitopes of the present invention comprise, or consist of the amino acid sequence as set forth in SEQ ID NO: 16 to 34.
The term "variant" as used in the context of the present invention refers to a
polynucleotide or polypeptide which differs from the polynucleotide or polypeptide of the present invention, e.g. the polynucleotide of SEQ ID NOs: 1, 7, 8 or 9, or the polypeptide of SEQ ID NOs: 2 or 10, but retains essential properties thereof. Generally, variants are overall closely similar, and, in many regions, identical to the polynucleotide or polypeptide of the present invention. Variants according to the present invention may contain alterations in the coding regions, non-coding regions, or both. Especially preferred are polynucleotide variants containing alterations, which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. Further preferred are nucleotide sequence variants, which are produced by silent substitutions due to the degeneracy of the genetic code.
Polynucleotide variants can be produced for a variety of reasons, typically in order to optimize codon expression for a particular host, i.e. in order to change codons in the human mRNA to those preferred by a bacterial, plant or fungal host cells.
Furthermore, polypeptide variants in which 5 - 10, 1 - 5 or 1 - 2 amino acids are substituted, deleted, or added in any combination are preferred. In particular, by using methods of protein engineering and recombinant DNA technology known to the person skilled in the art, variants may be generated to improve or alter the characteristics of the polypeptides of the present invention. For instance, one or more amino acids may be deleted from the N-terminus or C-terminus without substantial loss of biological function. In addition, even if deleting one or more amino acids from the N-terminus or C- terminus of a polypeptide results in modification or loss of one or more biological functions, other biological activities may still be retained. For example, the ability of a deletion variant to induce and/or to bind antibodies which recognize the polypeptide or peptide will likely be retained when less than the majority of the residues of the secreted form are removed from the N-terminus or C-terminus. Whether a particular polypeptide lacking N- or C-terminal residues of a protein retains such immunogenic activities can be determined by standard methods known to the person skilled in the art. In a further embodiment of the present invention polynucleotide or polypeptide variants may include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as to have little effect on the activity or immunogenicity of the encoded protein or polypeptide. For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al, 1990, Science 247: 1306-1310. Variants may be produced via site directed mutagenesis or alanine-scanning mutagenesis, i.e. the introduction of single alanine mutations at every residue in the molecule. The resulting mutant molecules may subsequently be tested for biological activity. Typically, most buried amino acid residues (within the tertiary structure of the protein) require nonpolar side chains, whereas few features of surface side chains are generally conserved. Moreover, tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and He;
replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gin, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small- sized amino acids Ala, Ser, Thr, Met, and Gly.
Besides conservative amino acid substitution, variants of the present invention may also include substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or substitutions with one or more of amino acid residues having a substituent group, or a fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or a fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide, or leader or secretory sequence, or a sequence facilitating purification.
In a preferred embodiment the present invention relates to polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids, which may produce proteins with improved characteristics, such as less aggregation.
The term "allelic variant" as used herein relates to naturally occurring variants, i.e. to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. These allelic variants can vary at either the polynucleotide and/or polypeptide level and are included in the present invention. In a specific embodiment of the present invention the term also includes non-naturally occurring variants, which may, for example, be produced by mutagenesis techniques or by direct synthesis. In a further specific embodiment the term refers to naturally occurring allels of the polynucleotide of SEQ ID NOs: 1, 7, 8 or 9, or the polypeptide of SEQ ID NOs: 2 or 10 in the form of small nucleotide polymorphisms, preferably in the form of SNPs as derivable from the variation table of Ensembl database entries ENST00000243077 and ENST00000338962 (derivable, for example, from www.ensembl.org).
The term "species homologue" as used in the context of the present invention refers to polypeptide or polynucleotide sequences which show a high degree of identity to the polynucleotide or polypeptide of the present invention, e.g. to the polynucleotide of SEQ ID NOs: 1, 7, 8 or 9, or the polypeptide of SEQ ID NOs: 2 or 10 and which are derived from a different species, e.g. from monkeys, mice, rats, vertebrates,
invertebrates, bacteria, plants etc., preferably from a mammal. The term "high degree of identity" as used herein in the context of polynucleotides relates to nucleic acid molecules which comprise, or alternatively consist of a nucleotide sequence which is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, for example, the nucleotide sequence of SEQ ID NOs: 1, 3, 7, 8 or 9. The term "high degree of identity" as used herein in the context of polypeptides relates to polypeptide molecules which comprise, or alternatively consist of an amino acid sequence which is at least 70%, 75%, 80%>, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, for example, the amino acid sequence in SEQ ID NOs: 2, 6 or 10.
By a nucleic acid having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention, it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100
nucleotides of the reference nucleotide sequence encoding the polypeptide. In other words, to obtain a nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. The query sequence may be an entire sequence or any fragment as described herein.
Whether any particular nucleic acid molecule is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the presence invention can be determined conventionally using known computer programs. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al., 1990, Comp. App. Biosci. 6: 237-245.
In a nucleotide sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are:
Matrix=Unitary, k-tuple=4, Mismatch Penalty=l, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=l, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length of the subject nucleotide sequence, whichever is shorter. If the subject sequence is shorter than the query sequence because of 5'or 3' deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for 5' and 3' truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5' or 3' ends, relative to the query sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5 'and 3 Of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage may then be subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at the 5' end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5'and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%). In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5' or 3' end of the subject sequence, which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected.
However, only bases 5' and 3'of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to be made for the purposes of the present invention. By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
Whether any particular polypeptide is at least at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, for instance, an amino acid sequence of the present invention can be determined
conventionally by using known computer programs. A preferred method for
determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al, 1990, Comp. App. Biosci. 6: 237-245. In an amino acid sequences alignment the query and subject sequences are both amino acid sequences. The result of said global sequence alignment is given in percent identity. Preferred parameters used in a
FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=l, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=l, Window
Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the subject amino acid sequence, whichever is shorter. If the subject sequence is shorter than the query sequence due to N- or C-terminal deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity. For subject sequences truncated at the N- and C-termini, relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned may be determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N-and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%>. In another example, a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Only residue positions outside the N- and C- terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected. No other manual corrections are to be made for the purposes of the present invention.
The present invention also relates in one aspect to polynucleotides capable of hybridizing under stringent hybridization conditions to nucleotide sequences of the invention as defined herein above, preferably to nucleotide sequences of SEQ ID NOs: 1, 7, 9 or 9. The term "stringent hybridization conditions" refers to an overnight incubation at 42°C in a solution comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/m) denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65°C.
Also contemplated are nucleic acid molecules that hybridize to the polynucleotides of the present invention at lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature. For example, lower stringency conditions include an overnight incubation at 37° C in a solution comprising 6X SSPE (20X SSPE = 3M NaCl; 0.2M NaH2P04; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 μg/ml salmon sperm blocking DNA; followed by washes at 50°C with IX SSPE, 0.1%) SDS. In addition, to achieve even lower stringency, washes performed following stringent hybridization may be carried out at higher salt concentrations (e. g. with 5X SSC).
Further variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents to be used in the context of the present invention include Denhardt's reagent, BLOTTO, heparin or denatured salmon sperm DNA. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
A polynucleotide which hybridizes only to poly A+ sequences or to a complementary stretch of T (or U) residues, would not be included in the definition of "polynucleotide" since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly A stretch or the complement thereof (e. g., practically any double-stranded cDNA clone generated using oligo dT as a primer).
In a specific embodiment of the present invention a nucleic acid molecule according to the present invention as defined herein above, preferably a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 or fragments or variants thereof as defined herein above, is fused at the 3 ' end or at the 5 ' end to the nucleotide sequence encoding wild-type LRP1 as set forth in SEQ ID NO: 3 or to fragments thereof, with the proviso that the nucleic acid sequence resulting from the fusion is not the sequence as set forth in SEQ ID NO: 4 or a sequence encoding the amino acid sequence of SEQ ID NO: 5.
The term "SEQ ID NO: 4" designates the nucleotide sequence corresponding to positions 55,808,543 to 55,809,081, 55,818,509 to 55,818,631, 55,821,424 to
55,821,561, 55,823,729 to 55,823,848, 55,825,022 to 55,825,150, 55,825,277 to 55,825,540 and 55,829,730 to 55,830,105 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), i.e. exons 1 to 6 and alternative exon 7 of LRP 1 , in particular the DNA sequence as defined in Genbank Accession No. BC052593 (version BC052593.1, GI: 30851202 as of 12 March 2009). The term "SEQ ID NO: 5" designates the amino acid sequence of a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 4, in particular the protein sequence as defined in Genbank Accession No. BC072015 (version BC072015.1, GI: 47940658 as of 12 March 2009).
In a preferred embodiment of the present invention the fusion between the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 and the nucleotide sequence of SEQ ID NO: 3 comprises at least nucleotide sequences encoding the amino acid sequence as defined in SEQ ID NO: 2 and any fragment of SEQ ID NO: 3, which encodes the polypeptide of SEQ ID NO: 6 or fragments thereof. In a particularly preferred embodiment fragments of SEQ ID NO: 3 comprising exons 1 to 5 and at least a part of exon 6, e.g. up to position 55,825,536 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), may be fused with a nucleotide sequence encoding the amino acid sequence as defined in SEQ ID NO: 2. The fusion may, for example, be carried out at the 5 ' end or the 3 ' end of the the nucleic acid molecule encoding the amino acid sequence as defined in SEQ ID NO: 2.
Fragments of the nucleic acid molecule as defined in SEQ ID NO: 3 to be used for fusion proteins may comprise any stretch of at least 6 nucleotides length which encodes a fragment or portion of the polypeptide of SEQ ID NO: 6. Preferably, fragments of at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, 3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150, 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10000, 10050, 10100, 10150, 10200, 10250, 10300, 10350, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 11000, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, 13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800 or 14850 nucleotides of the nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 3 may be used for the preparation of fusion molecules with the nucleotide sequence of SEQ ID NO: 1 , 7, 8 or 9, more preferably with the nucleotide sequence of SEQ ID NO: 1.
Fusion constructs may in addition to the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 also comprise more than one fragment of SEQ ID NO: 3, preferably one of the fragments mentioned herein above, e.g. two fragments, which are not in juxtaposition in the sequence of SEQ ID NO: 3. However, the encoded protein or polypeptide sequence of such a construct must be derivable from the amino acid sequence of SEQ ID NO: 6, e.g. as combination of two or more non-contiguous fragments of SEQ ID NO: 6. In a further specific embodiment of the present invention a polypeptide according to the present invention as defined herein above, preferably a polypeptide having the amino acid sequence of SEQ ID NO: 2 or 10 or fragments, domains, epitops, homo logs or variants thereof as defined herein above, is fused at the N-terminus or at the C-terminus to the LRP1 protein as set forth in SEQ ID NO: 6 or to fragments thereof, with the proviso that the amino acid sequence resulting from the fusion is not the amino acid sequence of SEQ ID NO: 5 or is encoded by the nucleotide sequence of SEQ ID NO: 4.
In a preferred embodiment of the present invention the fusion between the amino acid sequence of SEQ ID NO: 2 or 10 and the amino acid sequence of SEQ ID NO: 6 comprises at least the amino acid sequence as defined in SEQ ID NO: 2 and any fragment of SEQ ID NO: 6. In a particularly preferred embodiment fragments of SEQ ID NO: 6 encoded by exons 1 to 5 and at least a part of exon 6, e.g. up to position 55,825,536 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), may be fused with the amino acid sequence as defined in SEQ ID NO: 2. The fusion may, for example, be carried out at the N-terminus or at the C- terminus of the amino acid sequence as defined in SEQ ID NO: 2 or at both termini. Fragments of the polypeptide molecule as defined in SEQ ID NO: 6 to be used for fusion proteins may comprise any stretch of at least 2 amino acids length which comprises a fragment or portion of the polypeptide of SEQ ID NO: 3. Preferably, fragments of at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, 3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, or 4500 amino acids length derived from the polypeptide having the amino acid sequence of SEQ ID NO: 6 may be used for the preparation of fusion molecules with the amino acid sequence of SEQ ID NO: 2, or 10, more preferably with the amino acid sequence of SEQ ID NO: 2. Fusion constructs may in addition to the amino acid sequence of SEQ ID NO: 2 or 10 also comprise more than one fragment of SEQ ID NO: 6, preferably one of the fragments mentioned herein above, e.g. two fragments, which are not in juxtaposition in the sequence of SEQ ID NO: 6. If more than one fragment of SEQ ID NO: 6 is fused to the amino acid sequence of SEQ ID NO: 2 or 10, the used fragments may be in any possible order, not necessarily in the order provided by the sequence of SEQ ID NO: 6. In a further preferred embodiment of the present invention the nucleic acid molecule according to the present invention as defined herein above, preferably the nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 or fragments or variants thereof as defined herein above or a nucleic acid molecule representing a fusion of said nucleotide sequences with SEQ ID NO: 3 or fragments thereof as defined herein above may be fused at the 3' end or at the 5' end to a heterologous nucleotide sequence, preferably sequences encoding heterologous proteins.
Similarly, the present invention also contemplates fusions of polypeptide molecule according to the present invention as defined herein above, preferably the nucleic acid molecule having the amino acid sequence of SEQ ID NO: 2 or 10 or fragments or variants thereof as defined herein above or a polypeptides representing a fusion of said nucleotide sequences with SEQ ID NO: 6 or fragments thereof as defined herein above. The polypeptides may be fused at the N-terminus and/or at the C-terminus to a heterologous polypeptide.
The term "heterologous" as used herein refers to any type of sequence which is not directly derivable from the context of the LRPl gene, in particular from SEQ ID NO: 3 or SEQ ID NO: 6. The term, thus, also comprises sequences naturally occurring in the same cell, in the same tissue type or in the same organism as the LRPl gene. Preferably, the term relates to sequences derived from different organisms or different species.
For example, the above described nucleic acid molecules or polypeptides may be fused to sequences encoding or representing the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (constant heavy or constant light chains, CHI, CH2, CH3, CL etc. or any combination thereof and/or portions thereof) resulting in chimeric polypeptides. Such fusion constructs may facilitate purification and may increase half- life of the polypeptide in vivo. The mentioned nucleic acids, molecules or polypeptides may also be fused with sequences encoding or representing epitope tags, e.g., the hemagglutinin ("HA") tag or flag tag, to aid in detection and purification of the expressed polypeptide. A further preferred example of a fusion constructs comprises fusions with sequences encoding or representing therapeutic proteins, suicide proteins, tumor suppressor proteins, transcription factors, kinase inhibitors, kinases, regulatory proteins, apoptotic proteins, anti-apoptotic proteins, microbial antigens, viral antigens, bacterial antigens, parasitic antigens, cellular antigens, differentiation factors, immortalisation factors, protein toxins, enzymes or marker proteins, e.g. EGFP or luciferase.
The term "therapeutic protein" as used herein relates to any protein, which has a therapeutic effect on the animal body, in particular on the human body. Preferably, the term relates to any such protein known to the person skilled in the art. Examples of therapeutic enzymes are alglucerase, which may be used in treating lysosomal glucocerebrosidase deficiency (Gaucher's disease), alpha-L-iduronidase, which may be used in treating mucopolysaccharidosis I; alpha-N-acetylglucosamidase, which may be used in treating sanfilippo B syndrome; lipase, which may be used in treating pancreatic insufficiency; adenosine deaminase, which may be used in treating severe combined immunodeficiency syndrome; or triose phosphate isomerase, which may be used in treating neuromuscular dysfunction associated with triose phosphate isomerase deficiency.
The term "suicide proteins" as used herein relates to any protein, which leads to the destruction of a cell due to the action of the protein, typically due to an enzymatic reaction in the presence of a corresponding substrate. Preferably, the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to nucleoside kinases, such as the HSV-1 TK or multisubstrate deoxyribonucleoside kinase ofDm-dNK.
The term "tumor suppressor proteins" as used herein relates to any protein, which protects a cell from one step on the path to cancer. Preferably, the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to the Rb protein, the p53 tumor suppressor, APC and CD95.
The term "transcription factors" as used herein relates to any protein, which binds to specific parts of DNA using DNA binding domains and is part of the system that controls the transcription of genetic information from DNA to RNA. Preferably, the term relates to any such factor known to the person skilled in the art. More preferably, the term relates to TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH and TATA binding protein (TBP).
The term "kinase" as used herein relates to any protein, which transfers phosphate groups from high-energy donor molecules, such as ATP, to specific target molecules. Preferably, the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to tyrosine kinase or MAP kinase, MEK1 or MEK2.
The term "apoptotic protein" as used herein relates to any protein, which leads to programmed cell death in multicellular organisms. Preferably, the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to the pro-apoptotic protein BAX, BID, BAK, or BAD.
The term "anti-apoptotic protein" as used herein relates to any protein, which impedes programmed cell death in multicellular organisms. Preferably, the term relates to any such protein known to the person skilled in the art. More preferably, the term relates to the anti-apoptotic protein like Bcl-Xl, Bcl-2and further members of the Bcl-2 family.
The terms "microbial antigens", "viral antigens", "bacterial antigens", "parasitic antigens" and "cellular antigens" as used herein relate to protein immunogens, which are able to stimulate an immune response derived from microbes, viruses, bacteria, parasites or cells, respectively. Preferably, the term relates to any such immunogens known to the person skilled in the art. More preferably, the term relates to tumor- associated antigens (TAAs) or bacterial, viral and parasitic surface proteins. The term "differentiation factor" as used herein relates to any protein factor, which functions predominantly in development and leads to the differentiation of tissues, cell groups of specific cells. Preferably, the term relates to any such factor known to the person skilled in the art. More preferably, the term relates to growth differentiation factors (GDFs) like GDF1, GDF2, GDF3, GDF5, GDF6, GDF8, GDF9, GDF10, GDF11 and GDF15.
The term "immortalisation factors" as used herein relates to any factor, which provokes an absence of a sustained increase in the rate of mortality of a cell as a function of chronological age. Preferably, the term relates to any such factor known to the person skilled in the art. More preferably, the term relates to telomerase or large T-antigen.
The term "protein toxin" in the context of the present invention relates to any peptide or polypeptide/protein molecule, which is capable of causing disease or cell death on contact or absorption with body tissues by interacting with biological macromolecules such as enzymes or cellular receptors. Preferably, the term relates to any such factor known to the person skilled in the art. More preferably, the term relates to botulinum toxin, maurotoxin, agitoxin, charybdotoxin, margatoxin, slotoxin, scyllatoxin, calciseptine, taicatoxin and calcicludine.
Additional fusion constructs according to the present invention may be generated through the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and/or codon- shuffling (collectively referred to as "DNA shuffling"). DNA shuffling may be employed to modulate the activities or biological properties of polypeptides of the invention, such methods can be used to generate polypeptides with altered activity or properties, as well as agonists and antagonists of the polypeptides. DNA shuffling involves the assembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the polynucleotide sequence. In another embodiment, polynucleotides of the invention, or the encoded polypeptides, may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules as defined herein above.
In a further embodiment of the present invention the nucleic acid molecule as defined herein above, preferably the nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 or fragments or variants thereof as defined herein above or a nucleic acid molecule representing a fusion of said nucleotide sequences with SEQ ID NO: 3 or fragments thereof or fusion constructs as defined herein above, comprises sequential nucleotide deletions from either the 5 ' end and/or the 3 ' end. The term "sequential nucleotide deletion" refers to the diminishment of nucleic acids according to the present invention, by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or between 22 and about 75 nucleotides from the 5' or 3' end. Furthermore, such deletion at the 5 ' and 3 ' end may be combined in any suitable combination Preferably such nucleotide deletions have no or only marginal influence on the activity or properties of the encoded polypeptides or proteins.
Similarly, the present invention also relates to polypeptide molecules encoded by such deletion constructs. For instance, a polypeptide according to the present invention as defined herein above may have a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, any number of amino acids, ranging from 1- 60, preferably between about 1 and 5, can be deleted from the amino terminus. Similarly, any number of amino acids, ranging from 1-60, preferably between about 1 and 5 can be deleted from the carboxy terminus. Furthermore, any combination of the above mentioned amino and carboxy terminus deletions are preferred.
In another embodiment of the present invention the nucleic acid molecule as defined herein above is DNA or RNA. Alternatively, the nucleic acid molecule may also be PNA, CNA, ETNA, LNA or ANA or any other suitable nucleic acid format known to the person skilled in the art.
The term "PNA" as used herein relates to a peptide nucleic acid, i.e. an artificially synthesized polymer similar to DNA or RNA which is used in biological research and medical treatments, but which is not known to occur naturally. The PNA backbone is typically composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. The various purine and pyrimidine bases are linked to the backbone by methylene carbonyl bonds. PNAs are generally depicted like peptides, with the N- terminus at the first (left) position and the C-terminus at the right.
The term "CNA" as used herein relates to an aminocyclohexylethane acid nucleic acid. Furthermore, the term relates to a cyclopentane nucleic acid, i.e. a nucleic acid molecule comprising for example 2'-deoxycarbaguanosine.
The term "FiNA" as used herein relates to hexitol nucleic acids, i.e. DNA analogues which are built up from standard nucleobases and a phosphorylated 1,5-anhydrohexitol backbone.
The term "LNA" as used herein relates to locked nucleic acids. Typically, a locked nucleic acid is a modified and thus inaccessible RNA nucleotide. The ribose moiety of an LNA nucleotide may be modified with an extra bridge connecting the 2' and 4' carbons. Such a bridge locks the ribose in a 3'-endo structural conformation. The locked ribose conformation enhances base stacking and backbone pre-organization. This may significantly increase the thermal stability, i.e. melting temperature of the nucleic acid molecule.
The term "ANA" as used herein relates to arabinoic nucleic acids or derivatives thereof. A preferred ANA derivative in the context of the present invention is a 2'-deoxy-2'- fluoro-beta-D-arabinonucleoside (2'F-ANA).
In another aspect the present invention relates to a vector comprising the nucleic acid molecule as defined herein above, preferably the nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, 7, 8 or 9 or fragments or variants thereof as defined herein above or a nucleic acid molecule representing a fusion of said nucleotide sequences with SEQ ID NO: 3 or fragments thereof or fusion constructs as defined herein above or comprising the nucleotide sequence of SEQ ID NO: 4. A suitable vector according to the present invention may be, for example, a phage, plasmid, viral, or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in
complementing host cells.
Polynucleotides according to the present invention may be joined to a vector containing a selectable marker for propagation in a host. Furthermore, the polynucleotide insert may be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs. Other suitable promoters are known to the person skilled in the art. The expression constructs may further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. In particular, specific initiation signals may be required for efficient translation of inserted coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon may typically be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may further be enhanced by the inclusion of appropriate transcription enhancer elements etc.
In a particularly preferred embodiment the coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
The expression vectors will preferably include at least one selectable marker. Such markers include, for instance, dihydro folate reductase, G418, hygromycin or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria. Further selection markers include the herpes simplex virus thymidine kinase, hypoxanthine-guanine
phosphoribosyltransferase and adenine phosphoribosyltransferase. Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
Vectors preferred for use in bacteria include pQE70, pQE60 and pQE9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc.; pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech, Inc., and pET vectors available from Novagen. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG andpSVL available from Pharmacia. Preferred expression vectors for use in yeast systems include pYES2, pYDl, pTEFl/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-Sl, pPIC3.5K, pPIC9K, and PA0815. Other suitable vectors are known to the person skilled in the art.
In a further embodiment the present invention relates to a method of making a recombinant host cell, comprising introducing the nucleic acid molecule or the vector according to the present invention into a host cell. The term "host cell" as used herein refers to any suitable host cell known to the person skilled in the art. Representative examples of appropriate host cells include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g.,
Saccharomyces cerevisiae or Pichia pastoris); insect cells such as Drosophila melanogaster S2 and Spodoptera frugiperda Sf9 cells; and plant cells.
In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e. g. glycosylation) and processing (e. g. cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the posttranslational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the introduced protein expressed. To this end, eukaryotic host cells, which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product are preferred. Such mammalian host cells include HEK 293, Bowes melanoma cells, CHO, VERY, BHK, Hela, COS, MDCK, 293,3T3, W138, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such as, for example, CRL7030 and Hs578Bst.
For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the polypeptide of the present invention may be engineered according to standard procedures known to the person skilled in the art.
In a specific embodiment, the yeast Pichia pastoris may be used to express a
polypeptide according to the present invention. Pichia pastoris is a methylotrophic yeast, which can metabolize methanol as its sole carbon source. A main step in the methanol metabolization pathway is the oxidation of methanol to formaldehyde using 02. This reaction is catalyzed by the enzyme alcohol oxidase. In order to metabolize methanol as its sole carbon source, Pichia pastoris must generate high levels of alcohol oxidase due, in part, to the relatively low affinity of alcohol oxidase for 02.
Consequently, in a growth medium depending on methanol as a main carbon source, the promoter region of one of the two alcohol oxidase genes (AOXl) is highly active. In the presence of methanol, alcohol oxidase produced from the AOXl gene comprises up to approximately 30% of the total soluble protein in Pichia pastoris. Thus, a heterologous coding sequence, such as, for example, a polynucleotide according to the present invention as defined herein above, under the transcriptional regulation of all or part of the AOXl regulatory sequence is expressed at exceptionally high levels in Pichia yeast grown in the presence of methanol. In one example, the plasmid vector pPIC9K may be used to express DNA encoding a polypeptide of the invention, as set forth herein, in a Pichia yeast system essentially as described in "Pichia Protocols: Methods in Molecular Biology," (D. R. Higgins and J. Cregg, eds; The Humana Press, Totowa, NJ, 1998). This expression vector allows expression and secretion of a protein of the invention by virtue of the strong AOX1 promoter linked to the Pichia pastoris alkaline phosphatase (PHO) secretory signal peptide (i.e., leader) located upstream of a multiple cloning site. Several other yeast vectors could be used in place of pPIC9K, e.g. the yeast vectors mentioned herein above, as long as the proposed expression construct provides appropriately located signals for transcription, translation, secretion (if desired), and the like, including an in- frame AUG, as required. The term "introducing the nucleic acid molecule or the vector into a host cell" as used herein refers to any suitable cell nucleic acid introduction or transformation technique known to the person skilled in the art. For example, such introduction can be carried out by transfection, e.g. DEAE-dextran mediated transfection, electroporation,
microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, cationic lipid-mediated transfection, spheroplast fusion, etc. Further introduction technique contemplated by the present invention include the contacting with defective or attenuated retrovirals, microparticle bombardment, the use of coatings with lipids or cell-surface receptors or transfecting agents, the use of encapsulation in liposomes, microparticles, or microcapsules, for instance by administering them in linkage to a peptide which is known to enter the nucleus, or by administering it in linkage to a ligand subject to receptor-mediated endocytosis.
Typically, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may preferably be packaged in vitro using an appropriate packaging cell line and then transduced into host cells. These and numerous further techniques are known in the art for the introduction of nucleic acid molecules or vectors into cells and may be used in accordance with the present invention.
Following the introduction of the nucleic acid, engineered cells may be allowed to grow under suitable conditions as known to the person skilled in the art, e.g. for 1-2 days in an enriched media, and then are switched to a selective media. Appropriate culture media and conditions for the above described host cells and vectors are known in the art.
In a further aspect the present invention relates to a recombinant host cell obtained or obtainable according to the above described introduction techniques. Preferably, such recombinant host cells contain a nucleic acid molecule or a vector according to the present invention. In a particularly preferred embodiment the recombinant host cells express a polypeptide encoded by the nucleic acid molecule according to the present invention. Typically, recombinant host cells differ from naturally occurring cells or from known host cells by the presence of additional nucleic acid molecules or fragments thereof, which are not present in natural contexts or in the parental cells or cell lines. For example, recombinant host cells may comprise selection markers, duplicated or multimeric copies of naturally present genes or nucleic acids, heterologous elements like promoter sequences, terminator sequences etc. or genetic identification tags. These elements may preferably be used for the characterization of the recombinant host cells and for their distinguishing from natural contexts and from parental cells or cell lines.
The expression of introduced elements may be controlled by numerous standard gene expression tests known to the person skilled in the art. For instance, the transcription of an introduced nucleic acid may be tested in Northern analysis tests and/or the presence of correspondingly translated polypeptides may be tested via Western analysis tests. Further details and additional tests may be derived from qualified textbooks, e.g. from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
In another aspect the invention relates to a method of making a polypeptide encoded by a nucleic acid molecule according to the present invention as defined herein above comprising: (a) culturing the recombinant host cell as defined herein above such that the encoded polypeptide is expressed; and (b) recovering said polypeptide. Method for the culturing of recombinant host cells in order to express encoded polypeptides are widely known in the art. For example, if a regulable promoter is used, an inducing agent may be added to the culture or the appropriate, optimal conditions for working may be set, e.g. a specific temperature, pH, ion concentration etc.
The term "recovering" as used herein above refers to any suitable method for the extraction and/or purification of polypeptides from cells, cell suspensions or cell cultures known to the person skilled in the art. Typical recovering methods include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Preferably, high performance liquid chromatography (HPLC) may be employed for purification.
In another aspect the present invention relates to a polypeptide encoded by the nucleic acid molecule as defined herein above or obtainable by the method of making a polypeptide as defined herein above, with the proviso that the polypeptide has not the amino acid sequence of SEQ ID NO: 5. Depending upon the host employed in a recombinant production procedure, the polypeptides or proteins of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides or proteins of the invention may also include an initial modified methionine residue, in some cases as a result of hostmediated processes. Thus, it is well known in the art that the N- terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
Alternatively the polypeptide according to the present invention can also be recovered from products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures. In addition, a polypeptide according to the invention can be chemically synthesized using techniques known in the art (e.g. Creighton, 1983, Proteins: Structures and Molecular Principles, W. H. Freeman & Co., N. Y., and Hunkapiller et al, 1984, Nature, 310, 105-111). For example, a polypeptide or peptide of the invention can be synthesized by use of a peptide synthesizer.
In another aspect the present invention relates to an antibody or fragment thereof, that specifically binds to the polypeptide of the present invention as defined herein above or comprising the amino acid sequence of SEQ ID NO: 5. Preferably, said antibody specifically binds a polypeptide comprising parts or the entire sequence of exon 7 of LRP 1, more preferably said antibody specifically binds the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 or a polypeptide epitope of SEQ ID NO: 2, SEQ ID NO: 5 or SEQ ID NO: 10. The term "antibody" as used herein refers to immunoglobulin molecules and
immunologically active portions of immunoglobulin molecules, i. e. molecules that contain an antigen binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e. g., IgGl, IgG2, IgG3, lgG4, IgAl and IgA2) or subclass of immunoglobulin molecule.
In a preferred embodiment the antibody or fragment thereof as mentioned herein above comprises a human IgM heavy chain constant domain, a human IgGl heavy chain constant domain, a human IgG2 heavy chain constant domain, a human IgG3 heavy chain constant domain, a human IgG4 heavy chain constant domain, or a human IgA heavy chain constant domain.
In a further preferred embodiment of the present invention the antibody or fragment as defined herein above, in particular the antibody or fragment thereof comprising a human IgM heavy chain constant domain, a human IgGl heavy chain constant domain, a human IgG2 heavy chain constant domain, a human IgG3 heavy chain constant domain, a human IgG4 heavy chain constant domain, or a human IgA heavy chain constant domain as defined herein above, comprises a human Ig kappa light chain constant domain, or a human Ig lambda light chain constant domain.
The term "specifically binding" as used herein refers to the immunospecific detection and binding of an antibody to an antigenic epitope as defined herein above. The term "specifically binding" excludes non-specific binding but does not necessarily exclude cross-reactivity with other antigens, in particular with antigens comprising the same antigenic epitope detected by the present antibody. In a preferred embodiment antibodies of the invention include polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, Fab' fragments, fragments produced by a Fab expression library, F(ab')2, Fv, disulfide linked Fv, minibodies, diabodies, scFv, sc(Fv)2, whole immunoglobulin molecules, anti-idiotypic (anti-Id) antibodies (including, e. g., anti-Id antibodies to antibodies of the invention) and epitope-binding fragments of any of the above.
Most preferably the antibodies are human antigen-binding antibody fragments of the present invention and include Fab, Fab' and F (ab')2, Fv, single-chain Fvs (scFv), sc(Fv)2, single-chain antibodies, disulfide- linked Fvs (sdFv) and fragments comprising either a VL or VH domain.
The term "Fab fragment" as used herein refers to antibody fragments consisting of the first constant domain of the heavy chain (CHI), the constant domain of the light chain (CL), the variable domain of the heavy chain (VH) and the variable domain of the light chain (VL) of an intact immunoglobulin protein. Typically, Fab fragments are obtained by proteolytic cleavage by papain.
The term "F(ab')2" or "F(ab')2 fragment" as used herein refers to antibody fragments consisting of two first constant domains of the heavy chain (CHI), two constant domains of the light chain (CL), two variable domains of the heavy chain (VH) and two variable domains of the light chain (VL) of an intact immunoglobulin protein, i.e. it comprises two Fab fragments. Additionally, F(ab')2 molecules comprise a S-S linkage in the antibody hinge region wich combines the Fab fragments. Typically, F(ab')2 fragments are obtained by proteolytic cleavage by pepsin.
The term "Fab' fragment" as used herein refers to fragments derived from "F(ab')2" molecules, preferably fragments comprising the S-S linkage in the antibody hinge region.
The term "Fv fragments" as used herein refers to antibody fragments consisting of the two variable antibody domains VH and VL (details may be derived from Skerra and Pluckthun, 1988, Science, 240: 1038-1041).
The term "single chain Fv fragment (scFv)" as used herein relates to antibody fragments consisting of the two VH and VL domains linked together by a flexible peptide linker (details may be derived from Bird and Walker, 1991, Trends Biotechnol, 9: 132-137).
The term "diabody" as used herein refers to an antibody variant comprising a separated VH-VL and VL-VH fusion, wherein the fused domains are linked together by a flexible peptide linker. The linker may have a length of about 1 to 20 amino acids, preferably of between about 2 and 7 amino acids. Typically, small amino acids like glycine may be used for the linker. They may also be combined with other amino acids (details may be derived from Hudson and Kortt, 1999, J Immunol Methods, 231(1-2): 177-89).
The term "minibody" as used herein refers to a size reduced antibody, e.g. an antibody comprising solely variable domains or lacking constant domains, or comprising the variable heavy domain (details may be derived from Quiocho, 1993, Nature, 362(6418): 293-294 and Skerra and Pluckthun, 1988, Science, 240: 1038-1041).
Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entirety or a portion of the hinge region, CHI, CH2, and/or CH3 domains. Also included in the invention are antigen- binding fragments also comprising any combination of variable region(s) with a hinge region, CHI, CH2, and CH3 domains. The antibodies according to the invention may be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine (e. g., mouse and rat), donkey, monkey, rabbit, goat, guinea pig, camel, horse, or chicken.
The antibodies according to the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material.
Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which they recognize or specifically bind. The epitope(s) or polypeptide portion(s) may be specified as described herein. Preferred epitopes according to the present invention are set forth in SEQ ID NOs: 16 to 34.
Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. In a particularly preferred embodiment the present invention relates to antibodies that do not bind any other analog, ortholog, or homo log of a polypeptide of the present invention.
However, also antibodies that bind polypeptides with at least 95%, at least 90%>, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are included in the present invention. In a specific embodiment, antibodies of the present invention may cross-react with murine, rat and/or rabbit homo logs of human proteins and the corresponding epitopes thereof. Antibodies that do not bind polypeptides with less than 95%, less than 90%>, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In a specific embodiment, the above-described cross-reactivity is with respect to any single specific antigenic or immunogenic polypeptide, or
combination (s) of 2, 3, 4, 5, or more of the specific antigenic and/or immunogenic polypeptides disclosed herein. Further included in the present invention are antibodies, which bind polypeptides encoded by polynucleotides which hybridize to a
polynucleotide of the present invention under stringent hybridization conditions as defined herein above. Antibodies of the present invention may also be described or specified in terms of their binding affinity to a polypeptide of the invention. Preferred binding affinities include those with a dissociation constant or Kd less than 5 X 10~2 M, 10~2 M, 5 X 10"3 M, 10"3 M, 5 X 10"4 M, 10"4 M, 5 X 10"5 M, 5 X 10"6 M, 10"6 M, 5 X 10" 7 M, 10~7 M, 5 X 10"8 M, 10"8 M, 5 X 10~9 M, 10~9 M, 5 X 10"10 M, 10"10 M, 5 X 10"11 M, 10"11 M, 5 X 10~12 M, 10"12 M, 5 X 10"13 M, 10"13, 5 X 10"14 M, 10"14 M, 5 X 10"15 M, or 10"15 M. The invention also provides antibodies that may competitively inhibit binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, for example via immunoassays. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85 %, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.
In a further embodiment the antibodies of the invention include derivatives which are modified, for instance by the covalent attachment of any type of molecule to the antibody such that said covalent attachment does not prevent the antibody from spefically binding to the epitope or from generating an anti-idiotypic response. Typical examples of such modifications are glycosylation, acetylation, pegylation,
phosphylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Chemical modifications may be carried out by known techniques, including specific chemical cleavage, acetylation, formylation etc. Additionally, the derivative may contain one or more non-classical amino acids. Antibodies may be produced according to any suitable method known to the person skilled in the art.
Polyclonal antibodies may be produced by immunization of animals with the antigen of choice. For example, a polypeptide of the invention can be administered to various host animals including any eukaryotic, prokaryotic, or phage clone.
Monoclonal antibodies of defined specificity may be produced using, for instance, the hybridoma technology developed by Kohler and Milstein (Kohler and Milstein, 1976, Eur. J. Immunol., 6: 511-519). Typically, mice are immunized with a polypeptide of the invention or a cell expressing such peptide. Once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20.
Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.
Antibody fragments which recognize specific epitopes may be generated by known techniques. For example, Fab and F (ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F (ab') 2 fragments).
Alternatively, antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles, which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e. g., human or murine). Phages expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e. g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phages used in these methods are typically filamentous phages including Ml 3 binding domains expressed from a phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to produce antibodies according to the present invention include those disclosed in Brinkman et al, 1995, J. Immunol. Methods 182: 41-50 and Ames et al, 1995, J. Immunol. Methods 184: 177-186.
After phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria. For example, techniques to
recombinantly produce Fab, Fab' and F (ab') 2 fragments can also be employed using methods known in the art such as those disclosed WO 92/22324 or Mullinax et al, 1992, BioTechniques 12 (6): 864-869.
Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U. S. Patents 4,946,778 and 5,258,498; Huston et al, 1991, Methods in Enzymology 203: 46-88; and Skerra et al, 1988, Science 240: 1038-1040.
The term "chimeric antibody" as used herein above refers to a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. Further details may be derived from Morrison, 1985, Science 229:
1202; Oi et al, 1986, BioTechniques 4: 214 or Gillies et al, 1989, J. Immunol. Methods 125: 191-202.
The term "humanized antibody" as used herein above refers to antibody molecules, which bind the desired antigen having one or more complementarity determining regions (CDRs) from the nonhuman species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. Techniques for the production of humanized antibodies are known to the person skilled in the art. Further details may be derived from U. S. Patent No. 5,585,089 or from Riechmann et al, 1988, Nature 332: 323. Further techniques for the humanization of antibodies which may be used include CDR-grafting (see EP 239400), veneering or resurfacing (see EP 592106 or Studnicka et al, 1994, Protein Engineering 7 (6): 805- 814) and chain shuffling (see U. S. Patent No. 5,565,332).
The term "human antibody" as used herein refers to antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin. Human antibodies can be made by a variety of methods known in the art including phage display methods as described above using antibody libraries derived from human immunoglobulin sequences. Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes. For example, the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells.
Alternatively, the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes may be rendered nonfunctional separately or simultaneously with the introduction of human
immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring, which express human antibodies. The transgenic mice are immunized in the normal fashion with a selected antigen, e. g., all or a portion of a polypeptide of the invention. Subsequently, monoclonal antibodies directed against the antigen can be obtained from the
immunized, transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, by using such a technique it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. Further details may be derived from Lonberg and Huszar, 1995, Int. Rev. Immunol. 13: 65-93 or from U. S. Patent No. 5,939,598.
Alternatively, completely human antibodies which recognize a selected epitope can be generated using a technique referred to as guided selection. In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. Further details may be derived from Jespers et al, 1988, Biotechnology 12: 899-903. In a further embodiment of the present invention the antibody or fragment thereof as defined herein above is conjugated to a therapeutic or cytotoxic agent. The term
"therapeutic agent" refers to any compound, drug, small molecule or medicament, which is able to confer a therapeutic effect to a cell, a tissue or the entire organism. Examples of such agents are known to the person skilled in the art.
The term "cytotoxic agent" refers to any compound, drug, small molecule which is able to confer a toxic effect to a cell or a tissue. Such agents may, for example, comprise compounds which activate endogenous cytotoxic effector systems, as well as radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death. The term may also include radioisotopes known in the art, additional antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin. The term also refers to cytotoxic produgs. By "cytotoxic prodrug" is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may be used according to the invention include glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of doxorubicin. Further exemplary agents have been mentioned in the context of toxic proteins herein above.
In further embodiment of the present invention the antibody or fragment thereof as defined herein above may be biotinylated or labeled. The term "biotinylated" as used herein means that said antibody is covalently attached to the molecule biotin. Typically, biotin may be linked to primary amines, e.g. present as lysine side chains in epsilon-amines or N-terminal alpha-amines. Alternatively, the linkage may be performed via sulfhydryl groups, carboxyl groups, sugar groups or residues present on the antibody molecule. Furthemore, the biotinylation may be carried out as non-specific biotinylation.
The term "labeled" as used herein means that said antibody may comprise one or more labels at the C- or N-terminus of the antibody chains. Alternatively, said antibody may also comprise one or more labels at any position throughout the molecule. Preferably said antibody comprises between 1 and 10 labels, which may either be identical or different or any combination thereof. More preferably, the antibody may comprise between 1 and 5 labels, even more preferably one label. Said labels may be any suitable label known to the person skilled in the art, e.g. radioactive, fluorescent or
chemiluminescent labels.
In a particularly preferred embodiment said label is a radioactive label, an enzymatic label, a fluorescent label, a chemiluminescent or a bio luminescent label.
The term "enzymatic label" relates to labels, which comprise enzymatic activities. A typical, preferred example is the horseradish peroxidase enzyme (HRP), which may be tethered or attached to the antibody. This enzyme complex subsequently may catalyze the conversion of a suitable substrate, e.g. a chemiluminescent substrate into a sensitized reagent in the vicinity of the antibody which ultimatly lead to the emission of light or production of a color reaction. In particular, enhanced chemiluminescence, which may be used in this context, allows detection of minute quantities of labeled molecules.
The term "radioactive label" relates to labels emitting radioactive radiation, preferably composed of radioactive isotopes. The term "radioactive isotope" in the context of the label relates to any such factor known to the person skilled in the art. More preferably, the term relates to 3H, 14C, 32P, 33P, 35S or 125I.
The term "chemiluminescent label" relates to a label, which is capable of emitting light (luminescence) with a limited emission of heat as the result of a chemical reaction. Preferably, the term relates to luminol, cyalume, oxalyl chloride, TMAE (tetrakis (dimethylamino) ethylene), pyragallol, lucigenin, acridinumester or dioxetane.
The term "bio luminescent label" relates to a label, which is capable of emitting light due to a biochemical reaction. Typically, the term refers to the production of light due to the reaction of a luciferin and a luciferase. In such a reaction scheme, the luciferase catalyzes the oxidation of luciferin resulting in light and an inactive oxyluciferin. For example, an antibody according to the present invention may be linked to a luciferase. Alternatively, the antibody may also be labeld with luciferin. The luciferin and the luciferase as well as a co-factor such as oxygen, may be bound together to form a single photoprotein. This molecule may be linked to an antibody according to the present invention. A light emission may be triggered when a particular compound is present, e.g. a specific type of ion, preferably calcium. Examples of luciferin to be used in the context of the present invention include bacterial luciferin, dino flagellate luciferin, vargulin, coelenterazine and firefly luciferin. The term "fluorescent label" relates to chemically reactive derivatives of a fluorophores. Typically common reactive groups include amine reactive isothiocyanate derivatives such as FITC and TRITC (derivatives of fluorescein and rhodamine), amine reactive succinimidyl esters such as NHS-fluorescein, and sulfhydryl reactive maleimide activated fluors such as fluorescein-5-maleimide. Reaction of any of these reactive dyes with another molecule results in a stable covalent bond formed between a fluorophore and a labelled molecule. Following a fluorescent labeling reaction, it is often necessary to remove any nonreacted fluorophore from the labeled target molecule. A particular advantage of fluorescent labels is that signals from fluorescent labels do not disperse. Another advantage of fluorescent labels is that an easy multiple-color hybridization detection may be carried out, which permits direct quantitative determination of the relative abundance of the labeld molecule.
According to the present invention any suitable fluorescent label known to the person skilled in the art may be used. Preferably, the fluorescent labels FITC, Fluorescein, Fluorescein-5-EX, 5-SFX, Rhodamine Green-X, BodipyFL-X, Cy2, Cy2-OSu, Fluor X, Bodipy TMR-X, Rhodamine, Rhodamine Red-X, Texas Red, Texas Red-X, Bodipy TR- X, Cy3.5-OSu, Alexa f uors, Dylight f uors and/or Cy5.5-OSu may be used. In a more preferred embodiment of the present invention the fluorescent labels 6-FAM, HEX, TET, ROX, Cy3, Cy3-OSu, Cy5, Cy5-Osu, Texas Red or Rhodamine may be used.
Alternatively, antibodies may also be labeled or combined with fluorescent
polypeptides, e.g. green fluorescent protein (GFP) as well as derivates thereof known to the person skilled in the art. These labels may be used either individually or in groups in any combination.
In yet another aspect the present invention relates to a nucleic acid molecule encoding the antibody or fragment thereof as defined herein above. The invention also
encompasses nucleic acid molecules that hybridize under stringent or lower stringency hybridization conditions, e.g., as defined herein above, to nucleic acid molecules that encode an antibody. Preferably, the antibody encoded by such hybridizing molecules specifically binds to a polypeptide of the invention as defined herein above, more preferably to the polypeptide of SEQ ID NO: 2 or epitopes contained therein. The nucleic acid molecules may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e. g., as described in Kutmeier et al, 1994, BioTechniques 17: 242).
Alternatively, a polynucleotide encoding an antibody may be generated from a nucleic acid from a suitable source. If, for example, a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a source like an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ R A, isolated from any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention. This may preferably be done by PCR amplification using suitable primers. Amplified nucleic acids generated by PCR may subsequently be cloned into replicable cloning vectors using any suitable method well known in the art.
Once the nucleotide sequence and corresponding amino acid sequence of the antibody is determined, the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e. g., recombinant DNA techniques, site directed mutagenesis, PCR, etc., to generate antibodies having a different or modified amino acid sequence or in order to create amino acid substitutions, deletions, and/or insertions.
In a further specific embodiment, the amino acid sequence of the heavy and/or light chain variable domains may be inspected to identify the sequences of the
complementarity determining regions (CDRs) by methods known in the art, e. g., by comparison to known amino acid sequences of other heavy and light chain variable regions to determine the regions of sequence hypervariability. Using routine recombinant DNA techniques, one or more of the CDRs may be inserted within framework regions, e.g., into human framework regions to humanize a non human antibody, as mentioned herein above. The framework regions may be naturally occurring or consensus framework regions, preferably human framework regions.
Preferably, the polynucleotide or nucleic acid generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds to a polypeptide of the invention, more preferably to the polypeptide of SEQ ID NO: 2 or epitopes contained therein. Furthermore, one or more amino acid substitutions may be made within the framework regions. Additionally, such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide as known to the person skilled in the art are also encompassed by the present invention.
In a further embodiment of the present invention a nucleic acid molecule encoding the antibody or fragment thereof as defined herein above may be used for recombinant antibody expression. Typically, such an approach requires the construction of an expression vector containing a polynucleotide that encodes the antibody, preferably an expression vector as defined herein above. Preferably, such expression vectors contain the antibody coding sequences and appropriate transcriptional and translational control signals. The vectors may either comprise coding sequences for the variable heavy chain or the variable light chain or for both. Such vectors may also include the nucleotide sequence encoding the constant regions of the antibody molecule.
In preferred embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in an appropriate host cell for expression of the entire immunoglobulin molecule.
In a preferred embodiment mammalian cells, more preferably Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus may be used as an effective expression system for antibodies.
In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed.
In a further embodiment the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced. pGEX vectors may also be used to express the antibody coding sequence as fusion proteins with glutathione S-transferase (GST). In general, corresponding fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads followed by elution in the presence of free
glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) may used as a vector to express antibody coding sequences. The virus grows in Spodoptera frugiperda cells. The antibody coding sequence may, for example, be cloned
individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter.
In another aspect the present invention relates to a cell that produces the antibody or fragment thereof as defined herein above. Such a cell may be a hybridoma cell as defined herein above or a cell, which expresses a nucleic acid molecule encoding an antibody according to the present invention. Particularly preferred are cells or cell lines, which stably express the antibody molecule. To this end host cells are preferably transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker, e.g. functional expression control elements as defined herein above. For example, a plasmid comprising the antibody encoding sequence may be stably integrated into a cellular chromosome. Growing foci may subsequently be cloned and expanded into antibody producing cell lines.
The expression levels of an antibody molecule in a suitable host cell may be increased by vector amplification. When a marker in the vector system expressing antibody is amplifiable, an increase in the level of inhibitor present in culture of a host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will correspondingly also increase.
In a further preferred embodiment the host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers, which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (for further details see, for example, Proudfoot, 1986, Nature 322: 52).
Once an antibody molecule of the invention has been produced, synthesized, or recombinantly expressed, it may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, preferably by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins known to the person skilled in the art.
In addition, the antibodies of the present invention or fragments thereof can be fused to any heterologous polypeptide sequence, preferably to those defined herein above, e.g. in order to facilitate antibody purification or to provide target means for the antibody. For example, the antibodies of the present invention may be fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention to generate fusion proteins. The fusion may be direct or occur through linker sequences. Corresponding antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors. Alternatively, antibodies according to the present invention, preferably antibodies specifically binding the polypeptide comprising amino acid sequence SEQ ID NO: 2 or peptides or epitopes derived therefrom may be fused to a ligand molecule, e.g. a receptor binding ligand and correspondingly be targeted to particular cell types, in particular to cell types expressing said receptor.
In another aspect the present invention relates to an antibody which has the antigen- specific binding characteristics of the R4B6G5 antibody produced by the hybridoma clone R4B6G5 being deposited at the DSMZ under the accession No. DSM ACC3000.
The term "hybridoma clone R4B6G5 being deposited at the DSMZ under the accession No. DSM ACC3000" relates to hybridoma cells deposited at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ) on 15 July 2009 and having the following deposit numbers: DSM ACC3000. The DSMZ is located at the InhoffenstraBe 7 B, 38124 Braunschweig, Germany. The aforementioned deposits were made pursuant to the terms of the Budapest treaty on the international recognition of the deposit of microorganisms for the purposes of patent procedures. The term "antibody having the antigen-specific binding characteristics of the R4B6G5 antibody" refers to the typical antigen-specific binding criteria known to a person skilled in the art or derivable form a suitable text book, e.g. from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York. Preferably, the term relates to the presence of heavy and/or light chain variable regions of the R4B6G5 antibody, more preferably the term relates to the presence of CDR1, CDR2 and/or CDR3 of the light chain and/or CDR1, CDR2 and/or CDR3 of the heavy chain of the R4B6G5 antibody. The antigen-specific binding characteristics may also be conveyed by amino acid sequences being homologous to CDR1, CDR2 and/or CDR3 of the light chain and/or CDR1, CDR2 and/or CDR3 of the heavy chain of the R4B6G5 antibody, e.g. sequences which are 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the CDR1, CDR2 and/or CDR3 of the light chain and/or CDR1 , CDR2 and/or CDR3 of the heavy chain of the R4B6G5 antibody, respectively. The elucidation of the sequence of the variable regions of the R4B6G5 antibody may be carried out according to standard procedures known to the person skilled in the art, e.g. according to techniques as described herein above.
In yet another aspect the present invention relates to an antibody produced by the hybridoma having DSMZ accession No. DSM ACC3000, i.e. antibody R4B6G5.
In a further aspect the present invention relates to an affinity ligand for an expression product which comprises a nucleotide sequence according to the present invention or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide according to the present invention or comprising the amino acid sequence of SEQ ID NO: 5.
The term "affinity ligand for an expression product which comprises a nucleotide sequence according to the present invention or comprising the nucleotide sequence of SEQ ID NO: 4" as used herein refers to a nucleic acid molecule being able to specifically bind to a transcript or nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or to the complementary sequence, or to a corresponding RNA or DNA molecule. The nucleic acid affinity ligand may also be able to specifically bind to a nucleic acid molecule being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in any one of SEQ ID NO: 1, 4, 7, 8 or 9, or a nucleic acid molecule encoding an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2, 5 or 10.
The term "affinity ligand for a polypeptide according to the present invention or comprising the amino acid sequence of SEQ ID NO: 5" as used herein preferably refers to a peptide molecule being able to specifically bind to a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10. The peptide affinity ligand may also be able to specifically bind to an amino acid sequence encoded by a DNA sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, 4, 7, 8 or 9, or to an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2, 5 or 10. The term "peptide" refers to any type of amino acid sequence comprising more than 5 amino acids, e.g. polypeptide structures, protein structures or functional derivatives thereof. Furthermore, the peptide may be combined with further chemical moieties or functionalities.
The term "expression product" as used herein refers to a transcript or a mRNA molecule generated by the expression of LRPl gene such that alternative exon 7 is spliced in. More preferably, the term relates to a processed LRPl transcript as defined herein above, e.g. a sequence corresponding to SEQ ID NO: 4 or comprising SEQ ID NO: 1.
In a preferred embodiment of the present invention the affinity ligand is an
oligonucleotide specific for the expression product, a probe specific for the expression product, an aptamer specific for the expression product or the polypeptide of the invention, a small molecule or peptidomimetic capable of specifically binding to the polypeptide of the invention or a non-coding RNA molecule specific for the expression product. In an even more preferred embodiment the affinity ligand is a miRNA or a siRNA molecule.
The term "oligonucleotide specific for the expression product" as used herein refers to a nucleotide sequence which is complementary to the sense- or antisense-strand of the alternative LRPl splice product according to the present invention, preferably to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7 or 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5. The oligonucleotide sequence may also be complementary to a nucleotide sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, 4, 7 or 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5. or a nucleic acid sequence encoding an amino acid sequence being at least 75%, 80%>, 85%, 90%>, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2 or 5.
The oligonucleotide may have any suitable length and sequence known to the person skilled in the art. Typically, the oligonucleotide may have a length of between 8 and 60 nucleotides, preferably of between 10 and 35 nucleotides, more preferably a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Oligonucleotide sequences specific for the alternative LRP1 splice product according to the present invention may be defined with the help of software tools known to the person skilled in the art, e.g. Autoprime (Wrobel et al, Genome Biology 2004, 5:P11) or Primer 3 (Rozen et al, 2000, Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bio informatics Methods and Protocols: Methods in Molecular Biology; Humana Press, Totowa, NJ, 365-386) or any other suitable software or bioinformatics tool. Examples of primer design protocols are provided in the Examples of the present application, in particular in Example 9.
In a preferred embodiment of the present invention the oligonucleotide has the sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13.
Also preferred are oligonucleotides binding to sequences of exon 1 (e.g. as forward primer) and to exon 7 or downstream sequences in the 3' region of exon 7, preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3* region of exon 7 (e.g. as reverse primer), as can be derived, for example, from the genomic LRP1 sequence, e.g. of SEQ ID NO: 11. Examples of such oligonucleotides may have the sequence as set forth in SEQ ID NOs: 37, 38, 39, 40, 41, 42 and 43, wherein
oligonucleotides of SEQ ID NOs: 37, 39, 41 and 42 may be used as exon 1 specific forward primers and oligonucleotides of SEQ ID NOs: 38, 40 and 43 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 37 and 38, 39 and 40, 41 and 38, 42 and 38, as well as 37 and 43.
Further preferred are oligonucleotides binding to sequences of exon 2 (e.g. as forward primer) and to exon 7 or downstream sequences in the 3' region of exon 7, preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3* region of exon 7 (e.g. as reverse primer), as can be derived, for example, from the genomic LRP1 sequence, e.g. of SEQ ID NO: 11. Examples of such oligonucleotides may have the sequence as set forth in SEQ ID NOs: 40, 44, 45, 46, 47, 48 and 49, wherein oligonucleotides of SEQ ID NOs: 44, 46, and 48 may be used as exon 2 specific forward primers and oligonucleotides of SEQ ID NOs: 40, 45, 47 and 49 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 44 and 45, 46 and 47, 44 and 47, 48 and 40, as well as 46 and 49.
Also preferred are oligonucleotides binding to sequences of exon 3 (e.g. as forward primer) and to exon 7 or downstream sequences in the 3' region of exon 7, preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3* region of exon 7 (e.g. as reverse primer), as can be derived, for example, from the genomic LRP1 sequence, e.g. of SEQ ID NO: 11. Examples of such oligonucleotides may have the sequence as set forth in SEQ ID NOs: 47, 50, 51, 53, 54, and 55, wherein
oligonucleotides of SEQ ID NOs: 50, 52, 53 and 55 may be used as exon 3 specific forward primers and oligonucleotides of SEQ ID NOs: 47, 51, and 54 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 50 and 51, 52 and 47, 53 and 47, 50 and 54, as well as 55 and 47.
Further preferred are oligonucleotides binding to sequences of exon 4 (e.g. as forward primer) and to exon 7 or downstream sequences in the 3' region of exon 7, preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3* region of exon 7 (e.g. as reverse primer), as can be derived, for example, from the genomic LRP1 sequence, e.g. of SEQ ID NO: 11. Examples of such oligonucleotides may have the sequence as set forth in SEQ ID NOs: 38, 40, 56, 57, 58, and 59, wherein oligonucleotides of SEQ ID NOs: 56, 57, 58 and 59 may be used as exon 4 specific forward primers and oligonucleotides of SEQ ID NOs: 38 and 40 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 56 and 40, 57 and 40, 56 and 38, 58 and 40, as well as 59 and 40.
Additionally preferred are oligonucleotides binding to sequences of exon 5 (e.g. as forward primer) and to exon 7 or downstream sequences in the 3' region of exon 7, preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3* region of exon 7 (e.g. as reverse primer), as can be derived, for example, from the genomic LRP1 sequence, e.g. of SEQ ID NO: 11. Examples of such oligonucleotides may have the sequence as set forth in SEQ ID NOs: 40, 45, 60, 61, and 62, wherein oligonucleotides of SEQ ID NOs: 60, 61, and 62 may be used as exon 5 specific forward primers and oligonucleotides of SEQ ID NOs: 40 and 45 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 60 and 40, 61 and 40, 62 and 40, 60 and 45, as well as 61 and 45.
Further preferred are oligonucleotides binding to sequences of exon 6 (e.g. as forward primer) and to exon 7 or downstream sequences in the 3' region of exon 7, preferably up to 50, 100, 150, 200, 250, 300, 400, 500, 750 or 1000 nucleotides in the 3* region of exon 7 (e.g. as reverse primer), as can be derived, for example, from the genomic LRP1 sequence, e.g. of SEQ ID NO: 11. Examples of such oligonucleotides may have the sequence as set forth in SEQ ID NOs: 47, 63, 64, 65, 66, 67, 68, 69 and 70, wherein oligonucleotides of SEQ ID NOs: 63, 65, 67 and 69 may be used as exon 6 specific forward primers and oligonucleotides of SEQ ID NOs: 47, 64, 66, 68 and 70 may be used as exon 7 specific reverse primers. Particularly preferred are combinations of SEQ ID NOs: 63 and 64, 65 and 66, 67 and 68, 69 and 47, as well as 63 and 70. Furthermore, any suitable combination of forward and reverse primer oligonucleotides selected form SEQ ID NO: 37 to 70 is envisaged by the present invention.
In a specific embodiment of the present invention any of these antibodies may be used for the detection of transcripts or sequences comprising alternative exon 7 of LRP 1 or corresponding sequences, and/or truncated LRP 1 transcripts or sequences, e.g. in PCR approaches.
The term "probe specific for the expression product" as used herein means a nucleotide sequence which is complementary to the sense- or antisense-strand of the alternative LPvPl splice product according to the present invention, preferably to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5. The probe sequence may also be complementary to a nucleic acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or a nucleic acid sequence encoding an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%o or 99% identical to the sequence as set forth in amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5.
The probe may have any suitable length and sequence known to the person skilled in the art. Typically, the probe may have a length of between 6 and 300 nucleotides, preferably of between 15 and 60 nucleotides, more preferably a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. Probe sequences specific for the alternative LRP1 splice product according to the present invention may be defined with the help of software tools known to the person skilled in the art, e.g. Autoprime (Wrobel et al, Genome Biology 2004, 5:P11) or Primer 3 (Rozen et al, 2000, Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, Misener (eds) Bioinformatics
Methods and Protocols: Methods in Molecular Biology; Humana Press, Totowa, NJ, 365-386) or any other suitable software or bioinformatics tool.
If the probe is to be used for quantitative PCR reactions, e.g. real time PCR, the probe may be designed such that it is localized at a position in between the binding positions of a forward and reverse primer. Preferably, the probe may be designed such that it is localized in the proximity of one of the primer oligonucleotides. More preferably, it may be localized in the proximity of the forward primer.
The term "aptamer specific for the expression product" as used herein refers to a short nucleic acid molecule, e.g. RNA, DNA, PNA, CNA, HNA, LNA or ANA or any other suitable nucleic acid format known to the person skilled in the art, being capable of very specifically binding to the LRP1 splice product according to the present invention, preferably to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5. More preferably, the nucleic acid aptamer molecule may specifically bind to a DNA sequence depicted in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or a double stranded derivative thereof. The nucleic acid aptamer according to the present invention may also bind to an RNA molecule corresponding to the LRP1 transcript, preferably an RNA molecule corresponding to the DNA sequence as set forth in SEQ ID NO: 1.
The nucleic acid aptamer may further be capable of specifically binding to a DNA sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or a nucleic acid sequence encoding an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2 or SEQ ID NO: 5 or RNA molecules corresponding to these sequences.
Nucleic acid aptamers may be generated according to any suitable method known to the person skilled in the art, e.g. by in vitro selection or SELEX methods. Preferably, nucleic acid apatamers may be generated and/or designed according to the guidance provided in Ellington and Szostak, 1990, Nature, 346:818-822; Brody and Gold, 2000, J. BiotechnoL, 74:5-13 or Mayer and Jenne, 2004, BioDrugs 18:351-359. A nucleic acid aptamer according to the present invention may further be combined with additional moieties, e.g. with interacting portions like biotin or enzymatic functionalities like ribozyme elements.
The term "aptamer specific for the polypeptide" as used herein refers to a short peptide capable of interacting and specifically binding the LRP1 protein comprising an alternative exon of the present invention as defined herein above, preferably a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5. The peptide aptamer may also be able to specifically bind to an amino acid sequence encoded by a nucleic acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 8 or to an amino acid sequence being at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence as set forth in SEQ ID NO: 2 or SEQ ID NO: 5. Typically, a peptide aptamer is a variable peptide loop, comprising for example, 10 to 20 amino acids. In the context of the present invention the peptide aptamer may preferably be attached at one or both ends to a scaffold structure. The scaffold structure may be any molecule, preferably a protein, which has good solubility and compacity properties. Suitable scaffold molecules would be known to the person skilled in the art. A preferred scaffold molecule to be used in the context of the present invention is the bacterial protein thioredoxin A. The aptamer peptide loop may preferably be inserted within a reducing active site of the scaffold molecule. Alternatively, staphylococcal protein A and domains thereof and derivatives of these domains, such as protein Z (details may be derived from Nord et al, 1997, Nat. BiotechnoL, 15:772-777);
lipocalins (details may be derived from Beste et al, 1999, PNAS, 96: 1898-1903); ankyrin repeat domains (details may be derived from Binz et al, 2003, J. MoT Biol. 332: 489-503); cellulose binding domains (CBD) (details may be derived from Smith et al, 1998, J. MoT Biol. 277: 317-332; Lehtio et al, 2000, Proteins, 41 :316-322); Y crystallines (details may be derived from WO 01/04144); green fluorescent protein (GFP) (details may be derived from Peelle et al, 2001, Chem. Biol, 8:521- 534);
human cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) (details may be derived from Hufton et al, 2000, FEBS Lett. 475: 225-231; Irving et al, 2001, J. Immunol. Meth. 248: 31-45); Knottin proteins (details may be derived from Wentzel et al. 2001, J. Bacteriol, 183: 7273-7284) and Kunitz domains (details may be derived from Roberts et al, 1992, Gene, 121 :9-15); PDZ domains (details may be derived from Schneider et al, 1999, Nat. BiotechnoL, 17: 170-175); trinectins (details may be derived from Koide et al, 1998, J. Mol. Biol, 284: 1141-1); or zinc fingers (details may be derived from Bianchi et al, 1995, J. Mol. Biol. 247: 154-160) may be used as scaffold structures in the context of the present invention.
Peptide aptamers may be generated according to any suitable method known to the person skilled in the art, typically via yeast two-hybrid approaches.
The term "small molecule capable of specifically binding to the polypeptide" in the context of the present invention refers to a small organic compound that is preferably biologically active, i.e. a biomolecule, but is preferably not a polymer. Such an organic compound may have any suitable form or chemical property. The compound may be a natural compound, e.g. a secondary metabolites or an artificial compound, which has been designed and generated de novo, or has been obtained via suitable screening approaches. Methods and techniques for the identification and preparation of small molecules as well as assays for the testing of small molecules are known to the person skilled in the art.
The term "peptidomimetic capable of specifically binding to the polypeptide" in the context of the present invention refers to a small protein-like chain designed to mimic a peptide. Such a peptidomimetic may arise from a modification of an existing peptide, e.g. a peptide or peptide aptamer as defined herein above, in order to alter the molecule's properties. A peptidomimetic may arise from a modification, which changes the molecule's stability or binding capability. These modifications typically involve changes to the peptide that will not occur naturally. For example, a peptidomimetic according to the present invention may have altered peptide backbones or may comprise non-natural amino acids. Preferably, a peptidomimetic according to the present invention may represent the LRPl protein comprising an alternative exon of the present invention as defined herein above, preferably a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 or an interacting or sequestering protein thereof.
Methods and techniques for the preparation of peptidomimetics as well as assays for the testing of peptidomimetics are known to the person skilled in the art.
The term "non-coding RNA molecule specific for the expression product" as used herein refers to a molecule, which does not function as polypeptide encoding mRNA transcripts, transfers RNAs (tRNAs) or ribosomal RNAs (rRNAs). Preferably, the term relates to a molecule, which does not function as a polypeptide encoding a full-length LRP1 mRNA transcript or a LRP1 variant mRNA transcript as defined herein above, e.g. transcripts corresponding to the sequence of SEQ ID NO: 1, 3 or 4. Typically, a non-coding RNA molecule specific for the expression product of the present invention shows a specific interaction with said expression product, e.g. a specific binding reaction, a specific interaction with processing procedures based on the expression product, a specific cleavage reaction, a specific editing reaction, a specific interaction with the translation of the transcript or the translocation of a translated protein or a specific interaction with the stability of the transcript etc. Such a specific interaction may lead to the degradation of the expression product, its modification, an enhanced or decreased stability of the expression product, or an enhanced or decreased translation efficiency etc. Non-coding RNA molecules according to the present invention may be identified and/or obtained by chemical or enzymatic sequencing (see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 636 and 637), by using specialized cDNA libraries (see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 637 to 639), by appropriate microarray analyses (see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 639 to 641), by genomic SELEX (see, for example, Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular page 641 to 642). Accordingly identified non-coding RNAs may subsequently be characterized, e.g. by functional RNomics approaches as described in Huttenhofer and Vogel, 2006, NAR, 34(2): 635- 646, in particular on page 643). Accordingly identified non-coding RNAs are also encompassed by the present invention. Furthermore, non-coding RNA molecules may, for example, be comprised in an ribo- nucleoprotein particle (RNP). Correspondingly associated protein factors may also be identified according to suitable methods, e.g. as described in Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, in particular on page 642. Accordingly identified proteins are also encompassed by the present invention.
Particularly preferred is the use of Ul adaptor molecules, e.g. as described by
Goraczniak et al, 2009, Nature Biotechnology, 27(3): 257-263. Ul adaptors are typically bifunctional oligonucleotides with a target domain complementary to a site in the target gene's terminal exon and a Ul domain that binds to the Ul small nuclear RNA component of the Ul small nuclear ribonucleoprotein (Ul snRNP) splicing factor. Ul adpators according to the present invention may, thus, be complementary to a site in alternative exon 7 of LRP 1, e.g. a stretch of between about 8 to 20 nucleotides, preferably 15 nucleotides of a nucleic acid having, comprising or consisting of the sequence of SEQ ID NO: 1, 4, 7 or 8, preferably stretches comprising alternative exon 7 of LRP 1 or 3' downstream regions, e.g. as derivable from the exon definition provided herein and the sequence of SEQ ID NO: 11. Alternatively, the complementary sequence thereof may be used. Typically, the ultimate portion of the transcript comprising alternative exon 7 of LRP 1 or its 3' downstream region as comprised in the 3' portion of SEQ ID NO: 8 may be used as target sequence. Furthermore, any different 3' terminal portions of LRP 1 transcripts may be used as target sequences, e.g. passages
corresponding to a stretch of between about 8 to 20 nucleotides, preferably 15 nucleotides of a nucleic acid having, comprising or consisting of the sequence of SEQ ID NO: 3. Alternatively, the complementary sequence thereof may be used. Typical examples of such LRP 1 transcripts comprise truncated LRP 1 transcripts, e.g.
transcripts comprising exons 1 or exons 1 and 2, or exons 1 to 3, or exons 1 to 4, or exons 1 to 5, or exons 1 to 6, or exons 1 to 7, or exons 1 to 8, or exons 1 to 9, or exons 1 to 10, or exons 1 to 11 etc. as defined herein above or any other truncated version of LRP 1, e.g. any of the hitherto known or yet unknown LRP 1 transcripts.
As Ul domain any suitable domain known to the person skilled in the art may be used, preferably a domain comprising or consisting of the sequence 5'-CAGGUAAGUA-3' (SEQ ID NO: 74). Alternatively, different U domains or any variation of the Ul domain may be used. The sequence may, thus, be extended by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides, deletions or additions in the sequence may be present, or any nucleotide may be changed or modified, as long as a hybridization with Ul sRNPs or any other suitable sRNP is possible. Preferred are adaptor molecules, which show a perfect match or between about 1 to 5 mismatches with the Ul sRNP complementary sequence or with any other suitable sRNPs.
Particularly preferred is the provision of plasmids comprising Ul complementary regions and target sit hybridzing regions, optionally also a poly A site. Such plasmids may be expression plasmids comprising any suitable type of promoter known to the person skilled in the art, e.g. constitutive or regulable promoters. Also preferred is the provision of Ul adaptor oligonucleotides comprising a Ul domain and a target domain complementary to the Ul snRNP and the target transcript, respectively (Goraczniak et al, 2009, Nature Biotechnology, 27(3): 257-263). Such oligonucleotides may be comprised of RNA, DNA or any other suitable nucleic acid as known to the person skilled in the art, e.g. as described herein. The oligonucleotide may be transferred into the cell or may be expressed therein as known to the person skilled in the art, e.g. as described herein.
Further preferred examples of noncoding RNA molecules according to the present invention are microRNAs or miRNAs. The term "miRNA" refers to a short single- stranded RNA molecule of typically 18-27 nucleotides in length, which regulate gene expression. miRNAs are encoded by genes from whose DNA they are transcribed but are not translated into a protein. In a natural context miRNAs are first transcribed as primary transcripts or pri-miRNA with a cap and poly-A tail and processed to short, 70- nucleotide stem-loop structures known as pre-miRNA in the cell nucleus. This processing is performed in animals by a protein complex known as the Microprocessor complex, consisting of the nuclease Drosha and the double-stranded RNA binding protein Pasha. These pre-miRNAs are then processed to mature miRNAs in the cytoplasm by interaction with the endonuclease Dicer, which also initiates the formation of the RNA-induced silencing complex (RISC). This complex is responsible for the gene silencing observed due to miRNA expression and RNA interference. Either the sense strand or antisense strand of DNA can function as templates to give rise to miRNA. Typically, efficient processing of pri-miRNA by Drosha requires the presence of extended single-stranded RNA on both 3'- and 5'-ends of hairpin molecule. These ssRNA motifs could be of different composition while their length is of high importance if processing is to take place at all. Generally, the Drosha complex cleaves the RNA molecule ~22 nucleotides away from the terminal loop. Pre-miRNAs may not have a perfect double-stranded RNA (dsRNA) structure topped by a terminal loop. When Dicer cleaves the pre-miRNA stem-loop, typically two complementary short RNA molecules are formed, but only one is integrated into the RISC complex. This strand is known as the guide strand and is typically selected by the argonaute protein, the catalytically active RNase in the RISC complex, on the basis of the stability of the 5' end. The remaining strand, known as the anti-guide or passenger strand, is typically degraded as a RISC complex substrate. After integration into an active RISC complex, miRNAs may base pair with their complementary mRNA molecules and inhibit translation or may induce mRNA degradation by the catalytically active members of the RISC complex, e.g. argonaute proteins.
Mature miRNA molecules are typically at least partially complementary to mRNA molecules corresponding to the expression product of the present invention, and fully or partially down-regulate gene expression. Preferably, miRNAs according to the present invention, for instance as identifiable and obtainable according to to assays and methods described in Huttenhofer and Vogel, 2006, NAR, 34(2): 635-646, may be 100% complementary to their target sequences. Alternatively, they may have 1, 2 or 3 mismatches, e.g. at the terminal residues or in the central portion of the molecule.
miRNA molecules according to the present invention may have a length of between about 18 to 27 nucleotides, e.g. 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides. Preferred are 21 to 23 mers.
miRNAs having 100% complementarity may preferably be used for the degradation of nucleic acids according to the present invention, whereas miRNAs showing less than 100% complementarity may preferably be used for the blocking of translational processes. miR As specific for the short transcript LRP1 marker obtained or identified according the above described methods may be used as markers themselves, in particular as cancer markers. Accordingly, the expression of miRNAs, their tissue distribution, the time course of their appearance etc. may be detected with the help of suitable tests and methods known to the person skilled in the art. Correspondingly accumulated information may be used for a diagnosis or prognostication of cancer or the progression of cancer.
The term "siRNA" refers to a particular type of antisense-molecules, namely small inhibitory RNA duplexes that induce the RNA interference (RNAi) pathway. These molecules can vary in length and may be between about 18-28 nucleotides in length, e.g. have a length of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides. Preferably, the molecule has a length of 21, 22 or 23 nucleotides. The siRNA molecule according to the present invention may contain varying degrees of complementarity to their target mRNA, preferably in the antisense strand. siRNAs may have unpaired overhanging bases on the 5' or 3' end of the sense strand and/or the antisense strand. The term "siRNA" includes duplexes of two separate strands, as well as single strands that can form hairpin structures comprising a duplex region. Preferably, the siRNA may be double-stranded wherein the double-stranded siRNA molecule comprises a first and a second strand, each strand of the siRNA molecule is about 18 to about 23 nucleotides in length, the first strand of the siRNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA via RNA interference, and the second strand of said siRNA molecule comprises nucleotide sequence that is complementary to the first strand.
Methods for designing suitable siRNAs directed to a given target nucleic acid are known to person skilled in the art, e.g. from Elbashir et al, 2001, Genes Dev. 15, 188- 200. Furthermore, antagonistic siRNA molecules may be obtained according to methods of identifying antagonists as described herein. In a particularly preferred embodiment a siR A molecule according to the present invention may be directed to a nucleic acid or transcript comprising the sequence of any one of SEQ ID NO: 1, 4, 7 or 8. Furthermore, a siRNA molecule according to the present invention may be directed to a nucleic acid or transcript comprising exon 2 of the LRP1 gene, e.g. as derivable from Genbank Accession No.: NM_002332 (version NM_002332.2, GI: 126012561 as of March 12 2009).
Particularly preferred are siRNAs against LRP 1 , in particular the LRP 1 transcript comprising alternative exon 7 or a part thereof, e.g. comprising a nucleic acid or transcript having, comprising or consisting of the sequence of any one of SEQ ID NO: 1, 4, 7 or 8, which are provided in the form of short hairpin RNAs or hnRNAs. Such hnRNAs may be produced or designed according to any suitable method or technique known to the person skilled in the art, preferably as described in the Examples, e.g. in Example 10. For example, a tool like the one provided at http://www.molgyn.kgu.de/ genesilencer/genesilencer.html (Kappel et al, Nature Protocols, 2007, 2(12):3257-69), may be used in order to generate LRP 1 specific hnRNA molecules, in particular LRP 1 including exon 7 specific hnRNA molecules.
In a preferred embodiment of the present invention, such an hnRNA or hnRNA encoding molecule may comprise a first recombinant nucleic acid molecule, comprising at least a first sequence corresponding to a stretch of SEQ ID NO: 1, 4, 7 or 8 and at least a second sequence corresponding to the reverse complement of said first sequence. The stretch may comprise between 17 and 25 nucleotides, preferably between 18 and 22, more preferably 19 nucleotides. Additionally, or optionally, a loop sequence may be present between the two stretches of nucleic acid sequence. This loop sequence may have a length of between about 6 to 12 nucleotides, preferably a length of 9 nucleotides. Furthermore, the hnRNA or hnRNA encoding molecule may comprise a terminator signal and/or sequences comprising restriction sites for endonucleases, e.g. for BamHl or Hindlll. The at least first sequence corresponding to a stretch of SEQ ID NO: 1, 4, 7 or 8 and at least a second sequence corresponding to the reverse complement of said first sequence may be either entirely complementary to the sequence of SEQ ID NO: 1, 4, 7 or 8 or its reverse complement, or the sequences may comprise one or more mismatches, e.g. 1, 2, 3, 4, or 5 mismatches. Preferred is the presence of one mismatch.
Particularly preferred are hnRNA molecules having the sequence of SEQ ID NO: 77, 78 or 79, or complementary sequences thereof and/or DNA molecules corresponding to said sequences such as sequences having, comprising or consisting of the sequence of SEQ ID NO: 71, 72 or 73, or other nucleic acid molecules such as LNAs, ANAs etc. comprising said sequence, as described herein. Also preferred are plasmids or expression vectors capable of expressing said molecules as RNA molecules. Examples of such plasmids or vectors and of corresponding introduction or expression techniques would be known to the person skilled in the art.
In a further aspect the present invention relates to an antagonist of an expression product of the invention, preferably of an expression product comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, or 8. The term "antagonist of an expression product" refers to any molecule or compound which is capable of reducing the amount or stability of an expression product of the present invention. The term "reducing the amount of an expression product" means a diminishment of the amount of the expression product by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% in comparison to a control situation in which no antagonist is used. The term "reducing the stability of an expression product" means that the half-life of an expression product is diminished, preferably by factor 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 1000 or 10000 in comparison to a control situation in which no antagonist is used.
In an preferred embodiment of the invention said antagonist of an expression product according to the present invention is an antisense molecule against the nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRPl), more preferably against a nucleic acid comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, an aptamer specific for the expression product as defined herein above or a non-coding RNA molecule specific for the expression product as defined herein above. In a particularly preferred embodiment said antagonist of an expression product according to the present invention is a miR A or a siR A molecule as defined herein above or a catalytic RNA molecule. Also preferred are antagonists obtainable or obtained according to the method of identifying antagonists of the present invention, as described herein.
The term "antisense molecule" refers to nucleic acids corresponding to the sequences comprised in SEQ ID NO: 1, 4, 7, 8 or 9 or the complementary strand thereof.
Preferably, the antisense molecule of the invention comprises a sequence
complementary to at least a portion of an expression product according to the present invention. While antisense molecules complementary to the coding region sequence of the invention may be used, those complementary to the transcribed untranslated region are preferred.
Generally, antisense technology can be used to control, i.e. reduce or terminate gene expression through antisense DNA or RNA, or through triple-helix formation. In one embodiment, an antisense molecule may be generated internally by the organism, for example intracellularly by transcription from an exogenous sequence. A vector or a portion thereof may be transcribed, producing an antisense nucleic acid of the invention. Such a vector would contain a sequence encoding the antisense nucleic acid of the invention. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense molecule. Corresponding vectors can be constructed by recombinant DNA technology methods known to the person skilled in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells, e.g. vectors as defined herein above.
In another embodiment, the antisense molecule may be separately administered. As an example, the 5' coding portion of a nucleic acid according to the present invention, e.g. of the sequence of SEQ ID NO: 1 or 4 may be used to design an antisense RNA or DNA oligonucleotide of from about 6 to 50 nucleotides in length. Preferably, the
oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides in length. The antisense nucleic acids of the invention typically comprise a sequence
complementary to at least a portion of an R A transcript of a gene of interest. However, absolute complementarity, although preferred, is not required. A sequence
"complementary to at least a portion of an RNA transcript" as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex triplex formation in the case of double stranded antisense nucleic acids. The ability to hybridize will depend on both the degree of
complementarity and the length of the antisense nucleic acid Generally, the larger the hybridizing nucleic acid, the more base mismatches with a RNA sequence of the invention it may contain and still form a stable duplex or triplex. A person skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
Preferably antisense molecules complementary to the 5' end of the transcript, e.g., the 5' untranslated sequence up to and including the AUG initiation codon may be used in or for the inhibition of translocation. In a further preferred embodiment, sequences complementary to the 3' untranslated sequences of mRNAs may also be used.
An antisense molecule according to the present invention may be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. An antisense molecule, preferably an antisense olignucleotide or any further antisense nucleic acid molecule according to the present invention or a siRNA molecule according to the present invention or any other ncRNA molecule according to the present invention as defined herein above can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The molecule may include other appended groups such as peptides (e. g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-brain barrier hybridization triggered cleavage agents or intercalating agents. The molecule may accordingly be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent,
hybridization-triggered cleavage agent, etc. The molecule, preferably an antisense molecule or antisense oligonucleotide, a siR A molecule or any other ncR A molecule, may comprise at least one modified base moiety which is selected from the group including 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-
(carboxyhydroxylmethyl) uracil, 5-carboxymethyl-aminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methyl guanine, 3-methyl cytosine, 5-methylcytosine, N6-adenine, 7- methyl guanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2- methylthio-N6isopentenyladenine, uracil-5-oxyacetic acid, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino- 3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. The molecule may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose. In another embodiment, the molecule comprises alternatively or additionally at least one modified phosphate backbone, e.g. a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
In another embodiment, the antisense molecule, e.g. the antisense oligonucleotide may be an a-anomeric oligonucleotide, i.e. an oligonucleotide, which forms specific double- stranded hybrids with complementary RNA in which the strands run parallel to each other.
Potential antagonists of an expression product according to the invention also include non-coding RNA molecules specific for the expression product, e.g. the non-coding RNA molecules as defined herein above. Preferred are a miRNA molecule as defined herein above or a siR A molecule as defined herein above, as well as a catalytic R A molecule or riboyzme
The term "catalytic RNA" or "ribozyme" refers to a non-coding RNA molecule, which is capable of specifically binding to a target mRNA and of cutting or degrading said target mRNA, e.g. a transcript comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 9. Typically, ribozymes cleave mRNA at site specific recognition sequences and may be used to destroy mRNAs corresponding to the polynucleotides of the invention. Preferred examples of ribozymes are hammerhead ribozymes. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The construction and production of hammerhead ribozymes is known in the art and is described in Haseloff and Gerlach, 1988, Nature, 334: 585-591. There are numerous potential hammerhead ribozyme cleavage sites within each nucleotide sequence disclosed in the sequence listing. Preferably, the ribozyme may be engineered so that the cleavage recognition site is located near the 5' end of the mRNA corresponding to the polynucleotides of the invention.
Ribozymes or catalytic RNAs of the invention can be composed of modified
oligonucleotides and may be delivered to cells, which express the polynucleotides of the invention in vivo. DNA constructs encoding a ribozyme or catalytic RNA according to the present invention may be introduced into the cell according to suitable methods known to the person skilled in the art. A preferred method of delivery involves using a DNA construct encoding the ribozyme under the control of a strong constitutive promoter so that transfected cells will produce sufficient quantities of the ribozyme to destroy targeted messages and inhibit translation.
In a further aspect the present invention relates to an antagonist of the polypeptide of the invention, preferably of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10. The antagonist may be any suitable antagonist of the polypeptide of the invention known to the person skilled in the art. Preferably, it may be a compound directly modulating the activity of said polypeptide, a dominant negative variant of said polypeptide, a molecule closely related to the natural ligand of said polypeptide, a polypeptide related to the LRP1 protein as set forth in SEQ ID NO: 6, an antibody according to the present invention, e.g. as defined herein above or a small molecule or peptidomimetic capable of specifically binding to the polypeptide, e.g. as defined herein above.
The term "a compound directly modulating the activity of the polypeptide of the invention" as used herein refers to a compound which is capable of decreasing or increasing the activity of the polypeptide of the present invention, typically via a direct interaction with said polypeptide. Preferred is a decreasing effect on the polypeptide. Such a compound may be any direct interactor of the polypeptide, which has negative influence on the catalytic activity of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10. Such a compound may preferably be an allosteric antagonist of the catalytic activity of the polypeptide of the present invention, e.g. a heterotropic allosteric modulator.
The term "dominant negative variant of said polypeptide" as used herein refers to a variant of the polypeptide of the invention, preferably of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10, which comprises an antimorphic modification, in particular which adversely affects the polypeptide of the invention, i.e. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10 or derivatives thereof. Typically, such a behavior may occur if the antimorphic variant can interact with the polypeptide of the invention, i.e. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5 or 10, but blocks some aspect of its function.
Preferably, such variants may comprise or lack specific domains of the polypeptide comprising SEQ ID NO: 2, 5 or 10 or derivatives thereof, e.g. one or more protein- protein interacting or dimerization domains, complex assembly domains, one or more membrane-associated domains etc. Tests to identify dominant negative variants include appropriate genetic screenings, for instance readout-systems based on the expression of nucleic acids comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7 or 8 or the production of polypeptides comprising SEQ ID NO: 2, 5 or 10 or derivatives thereof. The term "molecule closely related to the natural ligand of said polypeptide" as used herein refers to molecules which show a similarity or high degree of identiy with the natural ligand of the polypeptide of the invention, e.g. with a polypeptide comprising SEQ ID NO: 2, or 10 or derivatives thereof or the LRP1 full-length polypeptide as defined in SEQ ID NO: 5 or derivatives thereof. Ligands of LRP1 comprise, for example, cellular prion protein, lactoferrin, alpha(2)-macroglobulin, ApoE, serpine- enzyme complexes, receptor-associated protein (RAP), protease nexin-1 (PN-1), blood clotting factor VIII, platelet-derived growth factor (PDGF-BB), transforming-growth factor-betal, amyloid precursor protein (APP) (TGF-betal), thrombospondin-1 (TSP-1), heat shock proteins (gp96, hsp90, hsp70) etc.; further ligands would be known to the person skilled in the art or can be derived from Lillis et al, 2008, Physiol Rev;
88(3):887-918. The term "high degree of identity" means that the molecules are at least about 70% to about 99.9%> identical to the mentioned ligands, preferably about 90%>, 95,%, 97%, 98% or 99%. The term "similarity" as used in this context means that the molecule shows a lower degree of identity, e.g. between about 50%> to about 70%>. Such molecule can be rationally designed using known techniques.
Antagonistic activity of such molecules may be tested with appropriate assays. For example, cells expressing the polypeptide of the invention may be provided and subsequently contacted with a test compound potentially containing an antagonistic molecule to observe binding, stimulation, or inhibition of activity of either the polypeptide or the molecule. The assay may further test binding of a candidate compound to the polypeptide of the invention, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to the polypeptide.
In a further aspect the present invention relates to the nucleic acid molecule comprising an alternative exon of LRPl or derivatives thereof as defined herein above, e.g. the nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or derivatives or variants thereof or the polypeptide encoded by an alternative exon of LRPl or derivatives thereof as defined herein above, e.g. the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5, or 10 or 9, or derivatives or variants thereof for use as a marker for cancer.
The term "marker" (or "marker unit", "short splice variant LRP1 marker", or "short splice variant LRP1 marker unit", which may be used synonymously), as used herein, relates to the mentioned nucleic acid molecules or polypeptides according to the present invention, i.e. a nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as defined herein above, e.g. the nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or derivatives or variants thereof, or a polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as defined herein above, e.g. the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5, or 10 or 9, or derivatives or variants thereof, whose expression level or amount is modified, preferably increased, in a cancerous cell or in cancerous tissue or in any type of sample comprising cancerous cells or cancerous tissues or portions or fragments thereof, in comparison to a control level or state.
The term "control level" (or "control state"), as used herein, relates to an expression level which may be determined at the same time as the test sample by using (a) sample(s) previously collected and stored from a subject/subjects whose disease state, e.g. non-cancerous, is/are known. The term "disease state" or "cancerous disease state" relates to any state or type of cellular or molecular condition between (and excluding) a non-cancerous cell state and (including) a terminal cancerous cell state. Preferably, the term includes different cancerous proliferation/developmental stages or levels of tumor development in the organism between (and excluding) a non-cancerous cell state and (including) a terminal cancerous cell state. Such developmental stages may include all stages of the TNM (Tumor, Node, Metastasis) classification system of malignant tumors as defined by the UICC, e.g. stages 0 and I to IV. The term also includes stages before TNM stage 0, e.g. developmental stages in which cancer biomarkers known to the person skilled in the art show a modified expression or expression pattern.
The term "cancerous" relates in the context of the present invention to a cancerous disease state as defined herein above. The term "non-cancerous" relates in the context of the present invention to a condition in which neither benign nor malign proliferation can be detected. Suitable means for the detection of such a condition are known in the art.
Alternatively, the control level may be determined by a statistical method based on the results obtained by analyzing previously determined expression level(s) of the nucleic acid molecule comprising an alternative exon of LRPl or derivatives thereof as defined herein above, e.g. the nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or derivatives or variants thereof or the polypeptide encoded by an alternative exon of LRPl or derivatives thereof as defined herein above, e.g. the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5, or 10 or 9, or derivatives or variants thereof in samples from subjects whose disease state is known. Furthermore, the control level can be derived from a database of expression patterns from previously tested subjects or cells. Moreover, the expression level of the short splice variant LRPl marker of the present invention in a biological sample to be tested may be compared to multiple control levels, whose control levels are determined from multiple reference samples. It is preferred to use a control level determined from a reference sample derived from a tissue type similar to that of the patient-derived biological sample. It is particularly preferred to use sample(s) derived from a subject/subjects whose disease state is non-cancerous or derived from a subject/subjects whose disease state is non-cancerous as defined herein above. Examples of such a reference sample from a subject/subjects whose disease state is non-cancerous comprise cells or tissue parts derived from pancreas, kidney, muscle, liver, lung, heart, brain, placenta, spleen, thymus, prostate, testis, ovary, intestine, colon, blood, lymph, e.g. peripheral leukocytes, mammary gland, stomach, thyroid, uterus or mammary tissue. Reference samples may also be derived from available panels, e.g. from human MTC panels, preferably MTC panels I or II (Clontech). Alternatively, reference samples may comprise material derived from cells lines, e.g. immortalized cancer cell lines, or derived from tissue xenografts. Preferably, material, tissue or cells derived from breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus carcinoma, brain tumors, stomach carcinoma, colon carcinoma, melanoma, fibrosarcoma or blood tumor may be used. A reference sample may, for example, comprise cells of at least one of the following tumor cell lines: MCF-7 (ACC 115), JIMT (ACC 589), MDA MB-231 (ATCC HTB-26), MDA MB-435, MDA MB-436 (ATCC HTB-130), LNCaP (ACC 256), PC-3 (ACC 465), Du-145 (ACC 261), OVCAR-3 (ATCC HTB 161), OVCAR-8, SKOV-3 (ATCC HTB 77), Colo-704 (ACC 198), SMKT-Rl, CAKI-2 (ACC 54), A549 (ACC 107), Colo 699 (ACC 196), HCC-15 (ACC 496), PA-TU-8988T (ACC 162), PANC-1 (ACC CRL-1469), 5637, ARK2, AN3-CA (ACC 267), 1321N1 (ECACC 86030102), LN405 (ACC 189), GOS-3 (ACC 408), SH-SY5Y (ACC 209), MKN-45 (ACC 409), SW480 (ACC 313), A357 (ACC CRL-1619), HT144 (ACC HTB-63), Bro, HT 1080 (ACC CCL-121).
Reference material or samples may also be derived from fetal tissue. Samples as comprised in human fetal MTC Panel test kit (Clontech) may, for instance, be used.
Moreover, it is preferred to use the standard value of the expression levels of the short splice variant LRPl marker as defined herein above in a population with a known disease state. The standard value may be obtained by any method known in the art. For example, a range of mean ± 2 SD (standard deviation) or mean ± 3 SD may be used as standard value.
Furthermore, the control level may also be determined at the same time with the test sample by using (a) sample(s) previously collected and stored from a subject/subjects whose disease state is/are known to be cancerous, i.e. who have independently been diagnosed to suffer from certain cancer type.
In the context of the present invention, a control level determined from a biological sample that is known not to be cancerous is called "normal control level". If the control level is determined from a cancerous biological sample, e.g. a sample from a subject for which was diagnosed independently, for breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma it may be designated as "cancerous control level". In a further aspect the present invention relates to the use of the short splice variant LRP1 marker as defined herein above for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer.
The term "diagnosing cancer" as used herein means that a subject or individual may be considered to be suffering from cancer, when the expression level of the short splice variant LRP1 marker of the present invention is modified, preferably increased or up- regulated, compared to a control level as defined herein above, preferably if compared to the normal control level as defined herein above. The term "diagnosing" also refers to the conclusion reached through that comparison process. The diagnosis may be carried out in vivo, or in vitro, or it may comprise steps carried out in vivo and steps carried out in vitro. The term "modified" or "modified expression level" in the context of the present invention thus denotes a change in the expression level. The term "expression level" refers to the amount of transcript comprising an alternative exon of LRP1 or derivatives thereof as defined herein above or the amount of subsequently translated, corresponding polypeptides. Expression levels are deemed to be "changed" when the expression of the short splice variant LRP1 marker, i.e. the presence of a nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as defined herein above, e.g. the nucleic acid molecule comprising the sequence of SEQ ID NO: 1, 4, 7, 8 or 9, or derivatives or variants thereof or the presence of a polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as defined herein above, e.g. the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, 5, or 10 or 9, or derivatives or variants thereof, e.g. in a sample to be analysed, differs by, for example, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, or more than 50% from a control level, or at least 0.1 fold, at least 0.2 fold, at least 1 fold, at least 2 fold, at least 5 fold, or at least 10 fold or more in comparison to a control level. The control level may either be a normal control level or a cancerous control level as defined herein above. If a comparison with a cancerous control level is to be carried out an additional comparison with a normal control level is preferred. Such an additional comparison allows for the determination of a tendency of the modification, i.e. an increase or a decrease of the expression level is observed.
The term "modified" relates preferably to an increase or up-regulation of the expression level of the short splice variant LRPl marker if a test sample is compared to a control level. The control level may either be a normal control level or a cancerous control level as defined herein above. The term "increased expression level" or "up-regulated expression level" or "increase of expression level" in the context of the present invention thus denotes a reduction of the expression level of the short splice variant LRPl marker between a situation to be analysed, e.g. a situation derivable from a patient's sample, and a reference point, which could either be a normal control level or cancerous control level derivable from any suitable cancer stage known to the person skilled in the art. Expression levels are deemed to be "increased" or "up-regulated" when the expression of the short splice variant LRPl marker increases by, for example, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, or more than 50% from a control level, or at least 0.1 fold, at least 0.2 fold, at least 1 fold, at least 2 fold, at least 5 fold, or at least 10 fold or more in comparison to a control level.
In a further embodiment, an additional similarity in the overall gene expression pattern between a sample obtained from a subject and a reference as defined herein above, which is cancerous, indicates that the subject is suffering from a cancer. In another embodiment of the present invention, the diagnosis may be combined with the elucidation of additional cancer biomarker expression levels. For example, the expression of biomarkers like MAGE antigen, a SSX antigen family member, NY-ESO- 1 , Melan- A/MART- 1 , gp 100, tyrosinase, tyrosinase-related protein 1 (TRP 1 ), TRP2, CEA, PSA, Her2/neu, p53, MUC1, PRAME, sarcosin (N-methylglycin), CA-125 (Carbophydrate antigen- 125) or survivin may be tested.
A cancer may be considered as being diagnosed when the expression level of the short splice variant LRPl marker of the present invention is modified, preferably increased or up-regulated, compared to the normal control level as defined herein above. In a particular preferred embodiment a breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma may considered as being diagnosed if the expression level of the short splice variant LRPl marker, as defined herein above, is increased by a value of between 20% to 80%, preferably by a value of 30%), 40%>, 50%>, 60%> or 70%> in a test sample in comparison to a control level. The control level may either be a normal control level or a cancerous control level.
The term "detecting cancer" as used herein means that the presence of a cancerous disease or disorder in an organism may be determined or that a cancerous disease or disorder may be identified in an organism. The determination or identification of a cancerous disease or disorder may be accomplished by a comparison of the expression level of the short splice variant LRPl marker of the present invention and the normal control level as defined herein above. A cancer may be detected when the expression level of the short splice variant LRPl marker is similar to a cancerous control level as defined herein above. In a preferred embodiment of the present invention a breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma may be detected if the expression level of the short splice variant LRPl marker is similar to a cancerous control level of an established
corresponding cancer cell line as mentioned herein above.
The term "monitoring cancer" as used herein relates to the accompaniment of a diagnosed or detected cancerous disease or disorder, e.g. during a treatment procedure or during a certain period of time, typically during 6 months, 1 year, 2 years, 3 years, 5 years, 10 years, or any other period of time. The term "accompaniment" means that states of disease as defined herein above and, in particular, changes of these sates of disease may be detected by comparing the expression level of the short splice variant LRPl marker of the present invention in a sample to a normal or a cancerous control level as defined herein above in any type of periodical time segment, e.g. every week, every 2 weeks, every month, every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, every 1.5 year, every 2, 3, 4, 5, 6, 7, 8,9 or 10 years, during any period of time, e.g. during 2 weeks, 3 weeks, 1, 2, 3, 4, 5, 6, 7,8, 9, 10, 11, 12 months, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 years, respectively. The cancerous control level may be derived from samples corresponding to different stages of cancer development, e.g. stages 0 and I to IV of the TNM classification system. In a preferred embodiment of the present invention the term relates to the accompaniment of a diagnosed breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma. In a further embodiment the monitoring may also be used for the accompaniment of such cancers, e.g. during a treatment procedure.
The term "prognosticating cancer" as used herein refers to the prediction of the course or outcome of a diagnosed or detected cancerous disease, e.g. during a certain period of time, during a treatment or after a treatment. The term may also refer to a determination of chance of survival or recovery from a disease, as well as to a prediction of the expected survival time of a subject. A prognosis may, specifically, involve establishing the likelihood for survival of a subject during a period of time into the future, such as 6 months, 1 year, 2 years, 3 years, 5 years, 10 years or any other period of time.
The term "progression of cancer" as used herein relates to a switch between different stages of cancer development, e.g. stages 0 and I to IV of the TNM classification, or any other stage or sub-stage, starting from a healthy condition up to a terminal cancer scenario. Typically such switches are accompanied by a modification of the expression level of the short splice variant LRP1 marker, preferably a decrease, in a test sample in comparison to a previous test sample from the same individual. A progression of cancer may considered as being detected or diagnosed if the short splice variant LRP1 marker expression level, as defined herein above, is increased by a value of between 3% to 50%, preferably by a value of 10%, 15%, 20% or 25% in a test sample in comparison to a previous test sample from the same individual. The modification may be detected over any period of time, preferably over 1, 2, 3, 4, 5, 6, 7, 8 9, 10, 11, 12 months, 1.5, 2, 3, 4,
5, 6, 7, 8, 9, 10, 15 or 20 years, i.e. the value indicated above may be calculated by comparing the expression level of the short splice variant LRP1 marker at a first point in time and at a second point in time after the above indicated period of time.
The modification may be detected over any period of time, preferably over 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12 months, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 years, i.e. the value indicated above may be calculated by comparing the expression level of the short splice variant LRPl marker at a first point in time and at a second point in time after the above indicated period of time.
In a further embodiment the present invention relates to the diagnosis and detection of a predisposition for developing cancer, preferably prostate cancer, more preferably hormone-resistant prostate cancer. A "predisposition for developing cancer" in the context of the present invention is a state of risk of developing cancer. Preferably a predisposition for developing cancer may be present in cases in which the short splice variant LRPl marker expression level as defined herein above is above a cancerous control level as defined herein above, i.e. a reference expression level derived from tissues or samples of a subject which evidently suffers from cancer. The term "above" in this context relates to an expression level of the short splice variant LRPl marker, which is increased by about 40 % to 80% in comparison to such a cancerous control level, preferably increased by about 50%>.
Alternatively, a predisposition for developing cancer in the context of the present invention may be given in situations in which the short splice variant LRPl marker expression level as defined herein above is above a cancerous control level as defined herein above, i.e. a reference expression level derived from tissues or samples of a subject which evidently suffers from cancer, preferably by about 20%> to 40%>, more preferably by about 30% and in which further, alternative cancer markers, e.g. PSA or CA-125, show no modification of expression level or a modification of the expression pattern. Suitable further cancer markers are known to the person skilled in the art. Thus, a predisposition for cancer may be considered as being diagnosed or detected if one of the above depicted situations is observed.
The difference between the expression levels of a test biological sample and a control level can be normalized to the expression level of further control nucleic acids or polypeptides, e.g. the expression products or produced amino acids of housekeeping genes whose expression levels are known not to differ depending on the cancerous or non-cancerous state of the cell. Exemplary control genes include inter alia beta-actin, glycerinaldehyde 3-phosphate dehydrogenase (GAPDH), and ribosomal protein PI . Further control nucleic acids or polypeptides comprise the full-length LRP1 gene, e.g. as depicted in the nucleotide sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 6, preferably portions of the full-length LRP1 transcript and polypeptide, which are not comprised in the nucleotide sequence of any one of SEQ ID NOs: 1, 4, 7 or 8 or in the polypeptide sequence of any one of SEQ ID NOs: 2 or 5, more preferably portions comprising exons 8 to 89 of full-length LRP1 as defined herein above or as derivable from Genbank Accession No. NM_002332.2 (as of 18 March 2009).
In a particularly preferred embodiment of the present invention the presence of full- length LRP1 transcripts may be detected by using oligonucleotide primers having the sequence of SEQ ID NO: 14 and 15.
In the context of the present invention, the terms "diagnosing" and "prognosticating" are also intended to encompass predictions and likelihood analyses. The short splice variant LRP1 marker of the present invention may accordingly be used clinically in making decisions concerning treatment modalities, including therapeutic intervention or diagnostic criteria such as a surveillance for the disease. According to the present invention, an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease. Alternatively, the present invention may be used to detect cancerous cells in a subject-derived tissue, and provide a doctor with useful information to diagnose that the subject suffers from the disease. A subject or individual to be diagnosed, monitored or in which a cancer, a progression of cancer or predisposition for cancer is to be detected or prognosticated according to the present invention is a mammal, preferably a human being. Further preferred are mammals such as dogs, cats, mice, rats, monkeys, rabbits, goats, sheep, pigs, guinea pigs, cattle, horses etc.
In a specific embodiment of the present invention the short splice variant LRP1 marker may be used as a marker for metastases or circulating tumor or cancerous cells, e.g. in body fluids like blood or the liquor. Due to the non-expression of the short splice variant LRP1 marker in blood cancer cells (see Example 3) non-hemato logic or non- blood cancer cells may easily be detected. The detection of such cells may be considered as indication for a metastasing cancer or tumor or the presence of disintegrating cancerous tissue. The detection may be carried out in vivo, or in vitro, or it may comprise steps carried out in vivo and steps carried out in vitro.
In a further aspect the present invention relates to a diagnostic composition comprising an affinity ligand for an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8. or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5. The diagnostic composition may be for use in vivo, or in vitro situations, for both.
In a further aspect the present invention relates to a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer or a predisposition for cancer in an individual comprising an affinity ligand for an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8. or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5. The diagnostic composition may be for use in vivo, or in vitro situations, for both. The terms "diagnosing", "detecting", "monitoring" and "prognosticating" have already been defined herein above and are used in this context with the same meaning. Affinity ligands to be comprised in diagnostic compositions according to the present invention have already been described herein above. Preferred affinity ligands to be used in a diagnostic composition of the present invention include an oligonucleotide or a set of oligonucleotides, typically in forward and reverse direction, specific for the expression product as defined herein above, preferably one or more oligonucleotides as defined herein above, a probe specific for the expression product as defined herein above, an aptamer specific for the expression product or the polypeptide as defined herein above, a small molecule or peptidomimetic capable of specifically binding to the polypeptide of the invention as defined herein above and an antibody against the polypeptide of the present invention as defined herein above. The diagnostic
composition may additionally comprise suitable control agents or compound. In a further preferred embodiment the diagnostic composition may comprise a set of oligonucleotides having the nucleotide sequences of SEQ ID NO: 12 and 13 or any suitable combination of forward and reverse primers selected from SEQ ID NOs: 37 to 70, as a control agent a set of oligonucleotides having the nucleotide sequence of SEQ ID NO: 14 and 15, and/or antibody R4B6G5 (produced by a hybridoma having DSMZ accession No. DSM ACC3000). In addition, a diagnostic composition according to the present invention may comprise accessory ingredients like PCR buffers, dNTPs, a polymerase, ions like bivalent cations or monovalent cations, hybridization solutions, secondary affinity ligands like, e.g. secondary antibodies, detection dyes and any other suitable compound or liquid necessary for the performance of a detection based on any of the affinity ligands as defined herein above, which is known to the person skilled in the art.
In another aspect the present invention relates to the use of a nucleic acid or peptide affinity ligand for an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5 for the preparation of a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer or a predisposition for cancer, as described herein above. The diagnosing, detecting, monitoring or prognosticating of cancer or of the progression of cancer or of a predisposition for cancer may be performed in vivo, or in vitro situations, or partially in vivo and in vitro. In a preferred embodiment the invention relates to the use of a oligonucleotide or a set of oligonucleotides, typically in forward and reverse direction, specific for the expression product as defined herein above, a probe specific for the expression product as defined herein above, an aptamer specific for the expression product or the polypeptide as defined herein above, a small molecule or peptidomimetic capable of specifically binding to the polypeptide of the invention as defined herein above and an antibody against the polypeptide of the present invention as defined herein above and optionally a control agent, e.g. a set of control
oligonucleotides for the preparation of a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer or a predisposition for cancer. In a more preferred embodiment the present invention relates to the use of a set of oligonucleotides having the nucleotide sequences of SEQ ID NO: 12 and 13 or any suitable combination of forward and reverse primers selected from SEQ ID NOs: 37 to 70, of a control agent comprising the oligonucleotides having the nucleotide sequence of SEQ ID NO: 14 and 15, and/or of antibody R4B6G5 (produced by a hybridoma having DSMZ accession No. DSM ACC3000) for the preparation of a diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer or a predisposition for cancer.
In a further aspect the present invention relates to a diagnostic kit, preferably for detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer. Such a kit may comprise an affinity ligand for an expression product which comprises a nucleic acid molecule of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 or for a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5. In a preferred embodiment the invention relates to a kit comprising an oligonucleotide or a set of oligonucleotides, typically in forward and reverse direction, specific for the expression product as defined herein above, preferably an oligonucleotide or set of oligonucleotides as defined herein above, a probe specific for the expression product as defined herein above, an aptamer specific for the expression product or the polypeptide as defined herein above, a small molecule or peptidomimetic capable of specifically binding to the polypeptide of the invention as defined herein above and an antibody against the polypeptide of the present invention as defined herein above and optionally a control agent, e.g. a set of control oligonucleotides. In a more preferred embodiment the present invention relates to a kit comprising a set of oligonucleotides having the nucleotide sequences of SEQ ID NO: 12 and 13, or any suitable combination of forward and reverse primers selected from SEQ ID NOs: 37 to 70, a control agent comprising the oligonucleotides having the nucleotide sequence of SEQ ID NO: 14 and 15, and/or antibody R4B6G5 (produced by a hybridoma having DSMZ accession No. DSM ACC3000). Particularly preferred are combinations of LRP 1 oligonucleotides comprising SEQ ID NOs: 37 and 38, 39 and 40, 41 and 38, 42 and 38, 37 and 43, 44 and 45, 46 and 47, 44 and 47, 48 and 40, 46 and 49, 50 and 51, 52 and 47, 53 and 47, 50 and 54, 55 and 47, 56 and 40, 57 and 40, 56 and 38, 58 and 40, 59 and 40, 60 and 40, 61 and 40, 62 and 40, 60 and 45, 61 and 45, 63 and 64, 65 and 66, 67 and 68, 69 and 47, as well as 63 and 70, or any groupings thereof.
Typically, the diagnostic kits of the present invention contain one or more agents allowing the specific detection of the short splice variant LRP1 marker. The agents or ingredients of a diagnostic kit may, according to the present invention, be comprised in one or more containers or separate entities. The nature of the agents is determined by the method of detection for which the kit is intended. Where detection at the short splice variant LRP1 marker mR A expression level, i.e. via the expression product comprising a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 is intended, the agents to be comprised may be a set of oligonucleotides specific for the short splice variant LRP1 marker and/or a probe specific for the short splice variant LRP1 marker as defined herein above, which may be optionally labeled according to methods known in the art, e.g. with labels described herein above. Where detection is at the short splice variant LRP1 marker protein level is intended, the agents to be comprised may be antibodies or compounds containing an antigen-binding fragment of an antibody or antibody variants as defined herein above, specific for an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5.
Preferably, a diagnostic kit of the present invention contains detection reagents for the expression product or the polypeptide of the invention. Such detection reagents comprise, for example, buffer solutions, labels or washing liquids etc. Furthermore, the kit may comprise an amount of a known nucleic acid molecule, which can be used for a calibration of the kit. Typically, a diagnostic kit for the detection of the expression products of the present invention may comprise accessory ingredients like a PCR buffers, dNTPs, a polymerase, ions like bivalent cations or monovalent cations, hybridization solutions etc. A diagnostic kit for the detection of proteins of the present invention may comprise accessory ingredients like secondary affinity ligands, e.g. secondary antibodies, detection dyes and any other suitable compound or liquid necessary for the performance of a protein detection based known to the person skilled in the art. Such ingredients are known to the person skilled in the art and may vary depending on the detection method carried out. Additionally, the kit may comprise an instruction leaflet.
In another aspect the present invention relates to a method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of determining the level of an expression product which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 or of a polypeptide of the present invention, i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5.
The term "determining the level of an expression product" refers to the determination of the presence and/or amount of short splice variant LRP1 marker expression products, e.g. short splice variant LRP1 marker transcript(s) which comprises a nucleotide sequence of the present invention, i.e. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 and/or the determination of the presence and/or amount of short splice variant LRP1 marker protein(s), i.e. an amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5. The determination the presence and/or amount of short splice variant LRP1 marker expression products, e.g. short splice variant LRP1 marker transcript(s) and/or short splice variant LRP1 marker protein(s) may be accomplished by any means known in the art.
In a preferred embodiment of the present invention said determination is accomplished by the measurement of nucleic acid or protein levels or by the determination of the biological activity of short splice variant LRP1 marker expression products. Thus, the short splice variant LRP1 marker expression level(s) may be determined by a method involving the detection of an mRNA encoded by the short splice variant LRP1 marker, the detection of the short splice variant LRP1 marker protein encoded by the short splice variant LRP1 marker transcript and/or the detection of the biological activity of the short splice variant LRP1 marker protein. For example, the measurement of the nucleic acid level of the LRPl marker expression may be assessed by separation of nucleic acid molecules (e.g. RNA or cDNA) obtained from the sample in agarose or poly aery lamide gels, followed by hybridization with short splice variant LRPl marker specific oligonucleotide probes, e.g. as defined herein above. Alternatively, the difference in expression level may be determined by the labeling of nucleic acid obtained from the sample followed by separation on a sequencing gel. Nucleic acid samples may be placed on the gel such that patient and control or standard nucleic acid are in adjacent lanes. Comparison of expression levels may be accomplished visually or by means of a densitometer. Methods for the detection of mRNA or expression products are known to the person skilled in the art or can be derived from standard textbooks, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, 2001, Cold Spring Harbor Laboratory Press. Typically, Northern blot analysis may be used for such a purpose.
Alternatively, the nucleic acid level of short splice variant LRPl marker expression may be detected in a microarray approach. Typically, sample nucleic acids derived from subjects to be tested are processed and labeled, preferably with a fluorescent label. Subsequently, such nucleic acid molecules may be used in a hybridization approach with immobilized capture probes corresponding to the short splice variant LRPl marker of the present invention or known biomarker or cancer marker genes. Suitable means for carrying out microarray analyses are known to the person skilled in the art.
Typically, microarray based expression profiling may be carried out, for example, by the method as disclosed in "Microarray Biochip Technology" (Schena M., Eaton Publishing, 2000).
In a standard setup a DNA array comprises immobilized high-density probes to detect number of genes. The probes on the array are complementary to one or more parts of the sequence of the marker gene, or to the entire coding region of the marker gene. In the present invention, any type of short splice variant LRPl marker associated polynucleotide may be used as probe for the DNA array, as long as the polynucleotide allows for a specific distinction between short splice variant LRPl marker expression and the expression of other genes. Typically, cDNAs, PCR products, and
oligonucleotides are useful as probes. Preferably, a probe involving the specific portions of alternative exon 7 LRPl, more preferably a probe derived of or comprising the sequence of SEQ ID NO: 1, 7 or 8 may be used as a probe. In addition to the determination of the short splice variant LRPl marker expression also the determination of the expression of other genes, e.g. additional biomarker or cancer marker genes may be accomplished.
A DNA array-based detection method typically comprises the following steps: (1) Isolating mRNA from a sample and optionally converting the mRNA to cDNA, and subsequently labeling this RNA or cDNA. Methods for isolating RNA, converting it into cDNA and for labeling nucleic acids are described in manuals for micro array technology. (2) Hybridizing the nucleic acids from step 1 with probes for the marker genes. The nucleic acids from a sample can be labeled with a dye, such as the fluorescent dyes Cy3 (red) or Cy5 (blue). Generally a control sample is labeled with a different dye. (3) Detecting the hybridization of the nucleic acids from the sample with the probes and determining at least qualitatively, and more particularly quantitatively, the amounts of mRNA in the sample for short splice variant LRPl marker and/or additional marker genes investigated. The difference in the expression level between sample and control can be estimated based on a difference in the signal intensity. This can be measured and analyzed by appropriate software such as, but not limited to the software provided for example by Affymetrix.
There is no limitation on the number of probes corresponding to the marker genes used, which are spotted on a DNA array. Also, a marker gene can be represented by two or more probes, the probes hybridizing to different parts of a gene. Probes are designed for each selected marker gene. Such a probe is typically an oligonucleotide comprising 5-50 nucleotide residues, preferably about 40 nucleotide residues. Longer DNAs can be synthesized by PCR or chemically. Methods for synthesizing such oligonucleotides and applying them on a substrate are well known in the field of micro-arrays. Genes other than the marker genes may be also spotted on the DNA array. For example, a probe for a gene whose expression level is not significantly altered may be spotted on the DNA array to normalize assay results or to compare assay results of multiple arrays or different assays.
In a specific embodiment of the present invention a DNA array may comprise exon and intron sequences of LRP 1 as defined herein above. Alternatively, a DNA array according to the present invention may comprise only exon sequences of LRPl as defined herein above. In a further alternative embodiment, a DNA array according to the present invention may comprise only intron sequences of LRP 1, preferably intron 1-2, intron 2-3, intron 3-4, intron 4-5,intron 5-6 or intron 6-7 as defined herein above. In a preferred embodiment of the present invention a DNA array may comprise oligonucleotide probes comprising sequences of exon 1 to alternative exon 7, more preferably of exon 2 to alternative exon 7, exon 3 to alternative exon 7, exon 4 to alternative exon 7, exon 5 to alternative exon 7, and most preferably exon 6 to alternative exon 7 of LRP 1, as defined herein above. Particularly preferred is the presence of sequences of alternative exon 7 and intron 6-7 of LRP 1 as well as of 3' downstream sequences of alternative exon 7 of LRP 1 as described herein above. The oligonucleotide may have any suitable length. Preferred is a length of between 30 and 70 nt, more preferred is a length of 50, more preferred is a length of 40 nucleotides. The oligonucleotide may comprise sense or antisense sequences of the LRP 1 exons and/or introns as defined herein above. Furthermore, the array may comprise any suitable type of control probes, e.g. match probes, mismatch probes, loading probes etc.
Alternatively, the nucleic acid level of short splice variant LRPl marker expression may be detected in a quantitative RT-PCR approach, preferably in a real-time PCR approach following the reverse transcription of the short splice variant LRPl marker mRNA transcript. Typically, as first step, a transcript is reverse transcribed into a cDNA molecule according to any suitable method known to the person skilled in the art, e.g. a method as derivable from standard textbooks like Sambrook et al, Molecular Cloning: A Laboratory Manual, 2001, Cold Spring Harbor Laboratory Press. A quantitative or real-time PCR approach may subsequently be carried out based on a first DNA strand obtained as described above. Typically, quantitative or real-time PCR approaches rely on the employment of FRET (fluorescent resonance energy transfer) interactions between a donor and an acceptor molecule, such as two fiuorophores or a fiuorophore and a quencher (further details may be derived from Didenko, 2001, Biotechniques, 31 (5): 1106-16, 1 118, 1120-1121; Chen et al, 1997, PNAS, 94: 10756-10762). The fluorescence emission spectrum of the donor normally overlaps the absorption or excitation spectrum of the acceptor. The excited-state energy of the fluorescent donor molecule is typically transferred to the acceptor molecule when they are brought into proximity (10 to 100 angstroms). If the acceptor molecule is fluorescent, signaling shifts to a longer wavelength. If the acceptor molecule is an effective quencher, fluorescent signaling is significantly diminished and may be essentially turned off.
Preferably, Taqman or Molecular Beacon probes as principal FRET-based probes of this type may be used for quantitative PCR detection. In both cases, the probes, preferably short splice variant LRPl marker probes as defined herein above, serve as internal probes which are used in conjunction with a pair of opposing primers that flank the target region of interest, preferably a set of short splice variant LRPl marker oligonucleotides as defined herein above. Upon amplification of a target segment, the probe may selectively bind to the products at an identifying sequence in between the primer sites, thereby causing increases in FRET signaling relative to increases in target frequency.
Preferably, a Taqman probe to be used for a quantitative PCR approach according to the present invention may comprises a short splice variant LRPl marker oligonucleotide as defined above of about 22 to 30 bases that is labeled on both ends with a FRET pair.
Typically, the 5' end will have a shorter wavelength fiuorophore such as fluorescein (e.g. FAM) and the 3' end is commonly labeled with a longer wavelength fluorescent quencher (e.g. TAMRA) or a non-fluorescent quencher compound (e.g. Black Hole Quencher). In solution, the probe normally coil in a random fashion or fold so that the labeled ends are in proximity and 5' fluorescent emissions are effectively quenched. Conversely, if the probe binds to an internal target sequence during the annealing step of PCR, the advancing Taq polymerase having 5 -3' exonuclease activity will degrade the bound probe and thus permanently release the components in solution. Once a 5' fluorophore is thereby released, it can emit fluorescent signaling, and thus the level of fluorescence that results is proportional to the frequency of amplified targets.
It is preferred that the probes to be used for quantitative PCR, in particular the short splice variant LRPl marker probes as defined herein above, have no guanine (G) at the 5' end adjacent to the reporter dye in order to avoid quenching of the reporter fluorescence after the probe is degraded.
Preferably, a Molecular Beacon probe to be used for a quantitative PCR approach according to the present invention uses FRET interactions to detect and quantify a PCR product, with each probe having a 5' fluorescent-labeled end and a 3' quencher-labeled end. Further details may be derived from US 5,925,517. Typically, Molecular Beacons include short artificial segments of 5 to 7 bases at each end that are complementary to one another but not complementary to the target. In the absence of target binding, these matching end sequences will bind together in solution, thereby bringing the quencher- labeled end in proximity to the fluorophore-labeled end so that fluorescent signaling is suppressed.
This hairpin or stem-loop configuration of the probe structure comprises preferably a stem with two short self-binding ends and a loop with a long internal target-specific region of about 20 to 30 bases. Due to this configuration and the relatively greater length of the target-specific region, Molecular Beacon probes according to the present invention may preferentially hybridize to available complementary targets, thereby causing the probes to straighten and extend. Consequently, with target binding, the labeled ends of the probe may separate from one another, thereby releasing fluorescent emissions. This mechanism typically does not depend on the degradation of the probe and may, thus, be employed in a variety of detection schemes in addition to PCR assays based on Taqman probes. Alternative detection mechanisms which may also be employed in the context of the present invention are directed to a probe fabricated with only a loop structure and without a short complementary stem regions (see, for example, US 5,691,146). An alternative FRET-based approach for quantitative PCR which may also be used in the context of the present invention is based on the use of two hybridization probes that bind to adjacent sites on the target wherein the first probe has a fluorescent donor label at the 3' end and the second probe has a fluorescent acceptor label at its 5' end (see, for example, Wittmer et al., 1997, Biotechniques, 22: 130-138). Another alterative FRET- based approach is based on Scorpion probes, which provide a FRET-based stem-loop detection mechanism similar to Molecular Beacons, except that the probe also has a segment attached that serves as an amplification primer (see Whitcombe et al, 1999, Nat BiotechnoL, 17(8): 804-7).
In another, preferred alternative approach the stem-loop structure may be cut into two units with one unit having four components, i.e., the 5' fluorophore, the target specific segment, the blocker and the primer, and with the other unit having the quencher and a probe segment.
In a particularly preferred embodiment PCR, in particular nested PCR or fluorescence PCR, may be employed for any detection steps based on the presence of the short splice variant LRPl marker expression product. These PCRs may be particularly useful in the context of the analysis of body fluid samples, e.g. blood samples. Corresponding techniques and strategies would be known to the person skilled in the art. The measurement of protein levels of the short splice variant LRPl marker protein may be carried out via any suitable detection technique known in the art. Preferably, the protein level of the short splice variant LRPl marker may be determined
immunologically, e.g. by using an antibody, preferably an antibody as defined herein above. Alternatively, antibody variants or fragments as defined herein above may be used. The present invention also envisages the use of peptide affinity ligands like aptamers specific for the short splice variant LRPl marker protein as defined herein above. Determination of the protein levels of the short splice variant LRPl marker protein can be accomplished, for example, by the separation of proteins from a sample on a polyacrylamide gel, followed by identification of the short splice variant LRPl marker protein using specifically binding antibodies in a Western blot analysis. Alternatively, proteins can be separated by two-dimensional gel electrophoresis systems. Two- dimensional gel electrophoresis is well known in the art and typically involves isoelectric focusing along a first dimension followed by SDS-PAGE electrophoresis along a second dimension. The analysis of 2D SDS-PAGE gels can be performed by determining the intensity of protein spots on the gel, or can be performed using immune detection. In other embodiments, protein samples are analyzed by mass spectroscopy.
Within the context of the present invention short splice variant LRPl marker protein specific antibodies may be placed on a support and be immobilized. Proteins derived from samples or tissues to be analyzed may subsequently be mixed with the antibodies. A detection reaction may then be carried out, e.g. with a second affinity ligand as defined herein above, preferably with a specific antibody.
Immunoassays which may be used in the context of the present invention, in particular for the diagnostic purposes of the present invention, include, for example, competitive and non-competitive assay systems using techniques such as western blots,
radioimmunoassay like RIA (radio-linked immunoassay), ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, e.g. latex agglutination, complement-fixation assays,
immunoradiometric assays, fluorescent immunoassays, e.g. FIA (fluorescence- linked immunoassay), chemiluminescence immunoassays, electrochemiluminescence immunoassay (ECLIA) and protein A immunoassays. Such assays are routine and well known to the person skilled in the art. Details may be derived from any qualified textbook, for example, from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York. For example, immunoprecipitation protocols may comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding a suitable antibody to the cell lysate, incubating for a period of time (e.g., 1 -4 hours) at 4°C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 4°C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis. Method parameters may suitable be modified by the person skilled in the art, for instance in order to increase the binding of the antibody to an antigen and/or decrease the background (e.g., by pre-clearing the cell lysate with sepharose beads or the like). Details may, for example, be derived from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
Western blot analysis may comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the
polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween 20), blocking the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a suitable secondary antibody (which recognizes the primary antibody), typically conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 32P or 125I) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen. Details may, for example, be derived from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
An ELISA (enzyme- linked immunosorbent assay) may be carried out by employing an antibody or antigen bound to a solid phase and an enzyme-antigen or enzyme-antibody conjugate to detect and quantify the amount of an antigen or antibody present in a sample. A description of the ELISA technique may found in any suitable textbook, e.g. in Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
Furthermore, the binding affinity of an antibody to an antigen and the off-rate of an antibody- antigen interaction may be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., 3H or 125I) with a suitable antibody in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen. The affinity of the antibody of interest for a particular antigen and the binding off- rates may be determined from the data by any suitable analysis approach, e.g. by a scatchard plot analysis. Competition with a second antibody may also be determined using radioimmunoassays. In this case, the antigen may be incubated with a suitable antibody conjugated to a labeled compound (e.g., 3H or 125I) in the presence of increasing amounts of an unlabeled second antibody. Details may, for example, be derived from Ausubel et al, eds, 2007, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York.
In addition, aptamers specific for the short splice variant LRP1 marker protein, preferably as defined herein above, may be used in a method of detecting short splice variant LRP1 marker proteins. Such aptamers may preferably be labeled in order to allow the detection of a protein- ligand interaction. Corresponding techniques are known to the person skilled in the art and may be derived from Ireson and Kelland, 2006, Mol Cancer Ther., 5(12): 2957-62.
The determination of the biological activity of the short splice variant LRP1 marker may be carried out by employing molecular or enzymatic assays specific to the corresponding function or functions of the short splice variant LRP1 marker. Such assays may also comprise the detection of changes or modifications of gene expression of non-LRP 1 genes, e.g. downstream targets known to the person skilled in the art, preferably via array approaches, e.g. nucleic acid/transcription microarray or protein/peptide arrays etc.
The level of short splice variant LRPl marker may also be detected in methods involving histological or cell-biological procedures. Typically, visual techniques, such as light microscopy or immunofluoresence microscopy, as well as flow cytometry or luminometry may be used. The presence of short splice variant LRPl marker protein in a cell may, for instance, be detected or determined by removing cells to be tested from samples as defined herein above. Also tissue sections or biopsy samples may be used for these metho ds .
Subsequently, affinity ligands for the short splice variant LRPl marker may be applied, preferably antibodies or aptamers. Typically, such affinity ligands are labeled, preferably with fluorescent labels as defined herein above. Such a procedure allows for the detection of the short splice variant LRPl marker, for its quantification and, in addition, allows to determine the distribution and relative level of expression thereof.
Such procedures involve the use of visualization methods. Suitable visualization methods are known to the person skilled in the art. Typical methods to be used comprise fluorometric, luminometric and/or enzymatic techniques. Fluorescence is normally detected and/or quantified by exposing fluorescent labels to light of a specific wavelength and thereafter detecting and/or quantifying the emitted light of a specific wavelength. The presence of a luminescently tagged affinity ligand may be detected and/or quantified by luminescence developed during a chemical reaction. Detection of an enzymatic reaction is due to a color shift in the sample arising from chemical reaction.
In a further embodiment of the present invention the method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprises additional steps, e.g. steps of comparing the level of short splice variant LRPl marker expression with a standard or control gene expression level as defined herein above, whereby modification, typically increase in the assayed expression level compared to the standard or control expression level is indicative of cancer. Corresponding approaches and the evaluation of obtainable or obtained results with respect to the presence of cancer or a predisposition of cancer etc. follow the definition of "detecting",
"diagnosing", "monitoring" and "prognosticating" as provided herein above in the context of the characterization of the short splice variant LRP1 marker. Thus, indications provided for determination of a cancerous sate or a predisposition therefore as defined in the context of the characterization of the "short splice variant LRP1 marker" also apply to the method of detecting, diagnosing, monitoring or
prognosticating cancer or the progression of cancer comprises additional step, in particular the steps of comparing the level of short splice variant LRP1 marker expression with a standard or control gene expression level as defined herein above. The method may be performed in vivo, or in vitro, or partially in vivo and in vitro. In case visual analysis determination steps are used, obtained values like luminescence intensity or brightness etc. may accordingly be compared to suitable standard or control values and, if suitable, subsequently provided in a numeric format. The obtained data, in particular said numeric format may preferably be used following the definition of "detecting", "diagnosing", "monitoring" and "prognosticating" as provided herein above in the context of the characterization of the short splice variant LRP1 marker.
Visual analysis results, in particular the obtention of colored or (differentially) labeled tumor pictures may be used for tumor imaging. Suitable procedures and software tools are known to the person skilled in the art.
In a further preferred embodiment of the present invention the short transcript LRP1 marker may be used for the detection, diagnosis or prognostication of tissue penetration of cancerous cells. The term "tissue penetration" as used herein refers to dispersion of cancerous cells inside a tissue or within a group of non-cancerous cells. Typically, the detection of expression of the short splice variant LRP1 marker, e.g. via any of the above described methods or approaches, in more than one cell derived from a tissue may be used for the localization of the cancerous cells. Thus, the absence of expression or the gradual reduction of expression in comparison to a cancerous control as defined herein above may be seen as indicative for the presence of healthy tissue or a departing from a cancer or tumor focus. Furthermore, by using several different cells or different tissue portions, e.g. between about 3 to 10 or more, an average value of short splice variant LRP1 marker expression may be calculated and compared to a normal and a cancerous control as defined herein above. Such a comparison allows a characterization of the infestion within the analysed tissue or organ. The method may be performed in vivo, or in vitro, or partially in vivo and in vitro. In a further aspect the present invention relates to a method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptides. The term "truncated LRP 1 expression product and/or a truncated LRP 1 polypeptides" as used herein refers to transcripts or RNA products derived from the LRP 1 gene (e.g. SEQ ID NO: 11 or derivatives, species homologues etc. thereof), which have not the full-length of wildtype LRP 1 as shown in SEQ ID NO: 3 (or species homologoues thereof) or the corresponding, encoded polypeptides. Such truncated expression products may preferably comprise LRP 1 transcripts which are derivable from additional or alternative splice processes on the LRP 1 full-length transcript and which do not result in the sequence of SEQ ID NO: 3. Correspondingly produced additional or alternative splice variants of LRP 1 may comprise one or more portions of the genomic sequence of LRP 1 (SEQ ID NO: 11) which comprise exonic or exon like sequences, wherein intron or intron-like sequences starting with the nucleotides GT in the genomic sequence of SEQ ID NO: 11 and ending with the nucleotides AG in the genomic sequence of SEQ ID NO: 11 are not present. Corresponding RNA molecules may comprise instead of GT the nucleotides GU. "Intron" or "intron-like" sequences in the context of the splice variants may be any stretches of the genomic sequence of LRP 1 or of SEQ ID NO: 11 which comprise in the 5'-portion the nucleotides GT (or GU in the case of RNAs) and in the 3'-portion the nucleotides AG, i.e. any sequence reaching from the combination GT (or GU) to the combination AG. In a specific embodiment of the present invention the intron or intron-like sequence may comprise near the 3' end a branch site, more preferably followed by a series of pyrimidines, or a polypyrimidine tract. Even more preferably the branch site may follow the consensus sequence yUnAy. In a further embodiment of the present invention the intron or intron-like sequence may comprise splicing silencers and/or splicing enhancers as known to the person skilled in the art. The method may be performed in vivo, or in vitro, or partially in vivo and in vitro.
In a preferred embodiment of the present invention such truncated expression products may comprise sequences spanning exon 1 to alternative exon 7 of LRP 1 as defined herein above. Truncated expression products may alternatively also comprise sequences of exon 2 to alternative exon 7 of LRP 1, exon 3 to alternative exon 7, exon 4 to alternative exon 7, exon 5 to alternative exon 7, exon 6 to alternative exon 7 or alternative exon 7 alone, as defined herein above. Furthermore, truncated expression products may also comprise sequences of exon 1 to exon 8 of LRP 1, exon 1 to exon 9 of LRP 1, exon 1 to exon 10 of LRP 1, exon 1 to exon 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26., 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 or 88 of LRP 1 as defined herein above. Furthermore, truncated expression products may also comprise sequences of exon 2, exon 3, exon 4, exon 5, exon 6, alternative exon 7 to exon 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26., 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 or 88 of LRP 1 as defined herein above. The presence of such truncated LRP 1 expression products and/or polypeptides may be indicative for the presence of cancer.
The presence of truncated LRP 1 expression products may be determined according to any suitable method known to the person skilled in the art. For example, PCR reactions with primer oligonucleotides binding to exon 1 and alternative exon 7, exon 2 an alternative exon 7, exon 3 and alternative exon 7, exon 4 and alternative exon 7, exon 5 and alternative exon 7, exon 6 and alternative exon 7 may be carried out. Suitable primers for such PCR reactions are described in Example 9, below. Furthermore, polydT -primers and/or other typical ingredients and/or strategies for cDNA analysis and amplification may be used. Preferably, such primers may have the sequences of SEQ ID NO: 37 to 70. Further methods for the determination of truncated LRP 1 expression products may comprise microarray hybridization techniques, specific hybridization techniques. For the determination of truncated polypeptides specific antibodies, ELISA tests, 2D gel electrophoresis etc. may be used.
A cancer, a predisposition for cancer or the progression of cancer may be considered as being detected if at least one truncated LRP 1 expression product has been identified. Furthermore, a predisposition for cancer or the progression of cancer may be considered as being detected if more than one, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 etc different truncated LRP 1 expression products have been identified.
In a preferred embodiment of the present invention the method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptides additionally comprises the measurement of the nucleic acid level of said truncated LRP 1 expression product and/or the measurement of the protein level or biological activity of said truncated LRP 1 polypeptide. The amount of the nucleic acid level of said truncated LRP 1 expression product and/or the measurement of the protein level or biological activity may be determined according to any suitable method known to the person skilled in the art, preferably according to the methods as described herein above.
A cancer, a predisposition for cancer or the progression of cancer may be considered as being detected if the amount of at least one truncated LRP 1 expression product comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 95, 99 or 100% of the amount of all LRP 1 transcripts, i.e. of the sum of LRP 1 wildtype transcripts and truncated LRP 1 expression products. Preferably a cancer, a predisposition for cancer or the progression of cancer may be considered as being detected if the amount of all truncated LRP 1 expression products comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 95, 99 or 100% of the amount of all LRP 1 transcripts, i.e. of the sum of LRP 1 wildtype transcripts and all truncated LRP 1 expression products. In a further preferred embodiment of the present invention said truncated LRP 1 expression product comprises a nucleic acid molecule as defined herein above or comprises the nucleotide sequence of SEQ ID NO: 4 and/or said truncated LRP 1 polypeptide comprises a polypeptide as defined herein above or comprises the amino acid sequence of SEQ ID NO: 5. In a particularly preferred embodiment, said truncated LRP 1 expression product comprises the sequence of SEQ ID NO: 1, 7 or 8, or fragments or portions thereof or derivatives thereof. In a further particularly preferred embodiment of the present invention said truncated LRP 1 polypeptide comprises the sequence of SEQ ID NO: 2 or 10 fragments or portions thereof or derivatives thereof.
In a preferred embodiment of the present invention the diagnosing, detecting, monitoring or prognosticating as mentioned above is to be carried out on a sample obtained from an individual. The term "sample obtained from an individual" as used herein relates to any biological material obtained via suitable methods known to the person skilled in the art from an individual. The sample used in the context of the present invention should generally be collected in a clinically acceptable manner, preferably in a way that nucleic acids (in particular RNA) or proteins are preserved.
The biological samples may include body tissues and fluids, such as an urine sample, an urine sediment sample, a blood sample, e.g. a serum sample or a plasma sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells as well as feces or stool samples. The term "condensed respiration or exhalation sample" as used herein refers to samples comprising cells in exhaled air, e.g. cells present in exhaled air due to abrasion or attrition in pulmonary or airway tissues.
Furthermore, the biological sample may contain a cell extract derived from or a cell population including an epithelial cell, preferably a cancerous epithelial cell or an epithelial cell derived from tissue suspected to be cancerous. Additionally, cells may be purified from obtained body tissues and fluids if necessary, and then used as the biological sample. Samples, in particular after initial processing may be pooled. However, also non-pooled samples may be used.
In a specific embodiment of the present invention the content of a biological sample may also be submitted to an enrichment step. For instance, a sample may be contacted with ligands specific for the cell membrane or organelles of certain cell types, e.g. breast, prostate, ovarian, renal, lung, pancreas, urinary bladder, uterus, brain, stomach, colon, skin, or muscle cells, functionalized for example with magnetic particles. The material concentrated by the magnetic particles may subsequently be used for detection and analysis steps.
In a specific embodiment of the invention, biopsy or resections samples may be obtained and/or used. Such samples may comprise cells or cell lysates.
Furthermore, cells, e.g. tumor cells, may be enriched via filtration processes of fluid or liquid samples, e.g. blood, urine, sweat etc. Such filtration processes may also be combined with enrichment steps based on ligand specific interactions as described herein above.
In a particularly preferred embodiment of the present invention a sample is a tissue sample, an urine sample, an urine sediment sample, a blood sample, e.g. a serum sample or a plasma sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells.
Due to the non-expression of the short splice variant LRPl marker in blood cancer cells (see Example 3) the use of blood samples may in a particularly preferred embodiment be used for the detection of circulating tumor or cancerous cells or metastasing tumor or cancerous cells without the necessity of carrying out cell separation steps.
In another aspect the present invention relates to a method of identifying antagonists of the polypeptide of the present invention, e.g. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5, comprising the steps of: (a) producing cells which express said polypeptide either as secreted protein or on the cell membrane; (b) contacting the polypeptide produced in step (a) with a test sample comprising a potential antagonist; and (c) identifying an antagonist by observing binding and/or inhibition of activity of said polypeptide.
Typically, a polypeptide of the present invention, e.g. polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5, or a fragment thereof, may be used to screen for potentially antagonistic molecules that bind to the polypeptide or for potentially antagonistic molecules to which the polypeptide binds. The binding of the polypeptide and the potentially antagonistic molecule may inhibit or decrease the amount and/or activity of the polypeptide of the present invention.
Preferably, the screening for such molecules involves producing appropriate cells, which express the polypeptide of the present invention, either as a secreted protein or on the cell membrane. Preferred cells include cells from mammals, yeast, Drosophila, or E. coli. In order to enhance or facilitate the expression of the polypeptide of the present invention as secreted protein or membrane protein suitable functional domains may be added or fused to the polypeptide. For instance, the polypeptide may be provided with a suitable signal peptide sequence and, optionally, additional target or processing signals in order to allow its secretion or its presence in certain cell compartments. Alternatively, the polypeptide may be fused to a functional domain providing or allowing membrane localization, e.g. a transmembrane domain. Preferably, the polypeptide according to the present invention may be fused in way that the amino acid sequence comprising the sequence of SEQ ID NO: 2 or 5 or a fragment thereof is located intracellulary or extracellularly, more preferably extracellulary. Suitable means and methods would be known to the person skilled in the art.
Cells expressing the polypeptide or cell membranes or membrane fractions containing the expressed polypeptide may subsequently be contacted with a potential antagonist to observe binding, stimulation, and/or inhibition of activity of the polypeptide. A corresponding assay may test the binding of a potential antagonist to the polypeptide, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the potential antagonist results in a signal generated by binding to the polypeptide to the present invention.
Alternatively, the assay can be carried out using cell-free preparations. The assay may also comprise the steps of mixing a potential antagonist with a solution containing a polypeptide, measuring polypeptide/molecule activity or binding, and comparing the polypeptide/molecule activity or binding to a standard.
For example, an ELISA assay may be used for such a purpose, which can measure polypeptide level or activity in a sample (e. g., biological sample) using an appropriate monoclonal or polyclonal antibody. The antibody can measure polypeptide level or activity by either binding, directly or indirectly, to the polypeptide or by competing with the polypeptide for a substrate. Additionally, the interactor to which a polypeptide of the invention binds can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting.
Furthermore, for the screening of potential antagonists, the polypeptide of the present invention or a functional fragment thereof may be used in a bound form, e.g. bound to a carrier. Example of carriers that may be used for binding the polypeptides include insoluble polysaccharides, such as agarose, cellulose and dextran; and synthetic resins, such as polyacrylamide, polystyrene and silicon; preferably commercially available beads and plates (e.g., multi-well plates, biosensor chip, etc.) prepared from the above materials may be used. When using beads, they may be filled into a column.
Alternatively, the use of magnetic beads is also known in the art, and enables to readily isolate polypeptides and agents bound on the beads via magnetism.
The binding of a polypeptide to a carrier may be conducted according to routine methods, such as chemical bonding and physical adsorption. Alternatively, a polypeptide may be bound to a carrier via antibodies specifically recognizing the protein. Moreover, binding of a polypeptide to a carrier can also be conducted by means of interacting molecules, such as the combination of avidin and biotin.
Screening methods using such carrier-bound polypeptides of the invention or functional fragments thereof include, for example, the steps of contacting a test agent or potential antagonist to the carrier-bound polypeptide, incubating the mixture, washing the carrier, and detecting and/or measuring the potential antagonist to the carrier. The binding may be carried out in buffer, for example, phosphate buffer and Tris buffer, as long as the buffer does not inhibit the binding.
An exemplary screening method wherein such carrier-bound polypeptide of the preset invention or fragments thereof and a composition (e.g., cell extracts, cell lysates, etc.) are used as the test agent includes affinity chromatography. For example, the polypeptide of the present invention may be immobilized on a carrier of an affinity column, and a potential antagonist, containing a substance capable of binding to the polypeptide, is applied to the column. After loading the potential antagonist, the column is washed, and then the substance bound to the polypeptide is eluted with an appropriate buffer.
In a further embodiment, a biosensor, e.g. a BIAcore sensor, using surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound potential antagonist in the present invention. When such a biosensor is used, the interaction between the polypeptide of the present invention and a test agent can be observed real-time as a surface plasmon resonance signal, using only a minute amount of the polypeptide and without labeling.
Additionally, this invention provides a method of screening potential agonists to identify those, which modulate the action of the polypeptide of the present invention. An example of such an assay comprises combining a mammalian fibroblast cell, the polypeptide of the present invention, the compound to be screened and 3H thymidine under cell culture conditions where the fibroblast cell would normally proliferate. A control assay may be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of 3H thymidine in each case. The amount of fibroblast cell proliferation is measured by liquid scintillation chromatography which measures the incorporation of 3H-1 thymidine. By this procedure at least antagonist compounds may be identified. Furthermore, any other suitable screening approach may be performed, e.g. any suitable proliferation approach known to the person skilled in the art.
Alternatively, the response of a known second messenger system following interaction of a compound to be screened and the polypeptide of the present invention, e.g. a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5, may be measured and the ability of the compound to bind to polypeptide and elicit a second messenger response may be measured to determine if the compound is a potential antagonist. Such second messenger systems may include cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.
In a further, preferred embodiment of the present invention antagonists of the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, may be identified by using cancer cells expressing and producing said polypeptide, e.g. cells derived from samples obtained from patients or derived from established tumor cell lines like, for example, MCF-7 (ACC 115), JIMT (ACC 589), MDA MB-231 (ATCC HTB-26), MDA MB-435, MDA MB-436 (ATCC HTB-130), LNCaP (ACC 256), PC-3 (ACC 465), Du-145 (ACC 261), OVCAR-3 (ATCC HTB 161), OVCAR-8, SKOV-3 (ATCC HTB 77), Colo-704 (ACC 198), SMKT-Rl, CAKI-2 (ACC 54), A549 (ACC 107), Colo 699 (ACC 196), HCC-15 (ACC 496), PA-TU-8988T (ACC 162), PANC-1 (ACC CRL-1469), 5637, ARK2, AN3-CA (ACC 267), 1321N1 (ECACC 86030102), LN405 (ACC 189), GOS-3 (ACC 408), SH-SY5Y (ACC 209), MKN-45 (ACC 409), SW480 (ACC 313), A357 (ACC CRL-1619), HT144 (ACC HTB- 63), Bro, or HT 1080 (ACC CCL-121). These cells may be contacted with a test sample comprising a potential antagonist and an antagonist may be identified by observing (a) the activity of said polypeptide, and/or (b) the presence and/or amount of said polypeptide and/or (c) the proliferation and molecular behavior of the cells. An antagonist to be identified may, for example, be expected to have an inhibitory effect on the proliferation of the tested cancer or tumor cell. It may, alternatively, have a cytotoxic effect on the tumor cell, preferably a specific cyotoxic effect on a tumor cell expressing the polypeptide of the present invention.
In another aspect the present invention relates to a method of identifying a binding partner to the polypeptide of according to the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5 comprising: (a) contacting said polypeptide with a potential binding partner; and (b) determining whether a binding interaction between both molecules takes place.
A binding interaction according to this method may be determined according to any of the above identified binding techniques, preferably via the use of biosensors or by employing carrier-bound entities as described herein. Furthermore, immunoprecipitation techniques may be used for the determination of binding interactions. Typically, an immune complex may be formed by contacting an antibody (recognizing the polypeptide of the present invention or a functional fragment thereof or an epitope tagged to the polypeptide or fragment) to the reaction mixture comprising the polypeptide of the present invention and the potential binding partner. If the potential binding partner has the ability to bind the polypeptide, then the formed immune complex will be composed of the polypeptide of the present invention, the potential binding partner, and the antibody. On the contrary, if the potential binding partner is devoid of such ability, then the formed immune complex only includes the polypeptide of the present invention and the antibody. Therefore, the binding ability of a potential binding partner to a polypeptide of the present invention can be examined by, for example, measuring the size of the formed immune complex. Any method for detecting the size of a substance can be used, including chromatography, electrophoresis, and such. For example, when mouse IgG antibody is used for the detection, Protein A or Protein G sepharose can be used for quantifying the immune complex formed. Alternatively, a two-hybrid system utilizing cells may be used. In a two-hybrid system, the polypeptide of the present invention or a fragment thereof is fused to the SRF- binding region or GAL4-binding region and expressed in yeast cells. A cDNA library is prepared from cells expected to express at least one protein binding to the polypeptide of the present invention, such that the library, when expressed, is fused to the VP 16 or GAL4 transcriptional activation region. The cDNA library is then introduced into a suitable yeast cell and the cDNA derived from the library may be isolated from the positive clones detected.
Immunoprecipitation and two-hybrid methods may also be used in the context of a method of antagonists of the polypeptide of the present invention. An identified binding partner may, for example, be tested with respect to an inhibitory effect on the activity of the polypeptide of the present invention.
In another aspect the present invention relates to a method of identifying antagonists of an expression product comprising a sequence of the present invention, e.g. a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8, comprising the steps of: (a) contacting a test sample comprising a potential antagonist with one or more cells expressing said sequence of the present invention; (b) detecting the expression level(s) of said sequence; and (c) identifying an antagonist by observing reduction of the expression level of said sequence as compared to that detected in the absence of the potential antagonist.
The cell to be employed in this method may be any suitable cell. Preferred cells include cells from mammals, yeast, Drosophila, or E. coli. The expression may be induced, .e.g. by a heterologous vector expressing a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8, or naturally occurring. A "naturally occurring" expression may, for instance, be present in tumor cells expressing a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8, e.g. obtained from a patient, or in established tumor cell lines like, for example, MCF-7 (ACC 115), JIMT (ACC 589), MDA MB-231 (ATCC HTB-26), MDA MB-435, MDA MB-436 (ATCC HTB-130), LNCaP (ACC 256), PC-3 (ACC 465), Du-145 (ACC 261), OVCAR-3 (ATCC HTB 161), OVCAR-8, SKOV-3 (ATCC HTB 77), Colo-704 (ACC 198), SMKT-Rl, CAKI-2 (ACC 54), A549 (ACC 107), Colo 699 (ACC 196), HCC-15 (ACC 496), PA-TU-8988T (ACC 162), PANC-1 (ACC CRL-1469), 5637, ARK2, AN3-CA (ACC 267), 1321N1 (ECACC 86030102), LN405 (ACC 189), GOS-3 (ACC 408), SH-SY5Y (ACC 209), MKN-45 (ACC 409), SW480 (ACC 313), A357 (ACC CRL-1619), HT144 (ACC HTB- 63), Bro, or HT 1080 (ACC CCL-121).
The expression of said sequence may be determined by any suitable method known to the person skilled in the art, e.g. via any of the methods described herein above.
Preferably, a Northern analysis or a microarray based hybridization technique as described herein above may be employed.
A decrease in the expression level of the expressing of a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8 as compared to a control level in the absence of the test compound indicates that an antagonist has been found.
Alternatively or additionally, the proliferation and molecular behavior of used tumor cells may be observed. An antagonist with an anti- cancerous potential to be identified may, for example, be expected to have an inhibitory effect on the proliferation of the tested cancer or tumor cell. It may, alternatively, have a cytotoxic effect on the tumor cell, preferably a specific cytotoxic effect on a tumor cell expressing a nucleotide sequence comprising the sequence of SEQ ID NO: 1, 4, 7, or 8.
The term "potential antagonist", "potentially antagonistic molecule" or "potential binding partner" as used herein refers to any type of organic or anorganic, biological, chemical or physical compound or entity. Typcial examples of potentially antagonistic molecules or binding partners include molecules as described herein above, e.g.
antibodies, oligonucleotides, proteins, aptamers, ncRNAs such as siRNAs, ribozymes or miRNAs, peptidomimetics or small molecules. The potentially antagonistic molecules or binding partners may be provided individually or in libraries, e.g. in the form of commercially available compound libraries comprising natural products, bioactive lipids, ligands etc.
Potentially antagonistic molecules or binding partners may further be derived from cell extracts, cell culture supernatant, or be products of fermenting microorganisms, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic compounds (including nucleic acid constructs, such as antisense R A, siR A, ribozymes, etc.) and natural compounds. These molecules can also be used in the screening methods of the present invention. A potentially antagonistic molecule or binding partner of the present invention can also be obtained using any of the numerous approaches in combinatorial library methods known in the art, including, but not limited to (1) the use of biological libraries, (2) the use of spatially addressable parallel solid phase or solution phase libraries, (3) the use of synthetic library methods requiring deconvolution, (4) the use of a "one-bead one-compound" library method and (5) the use of synthetic library methods using affinity chromatography selection etc. The biological library methods using affinity chromatography selection may be limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (see Lam, L., 1997, Anticancer Drug Des 12, 145-167). Examples of methods for the synthesis of molecular libraries can be found in the art (e.g. in DeWitt, K. et al, 1993, Proc. Natl. Acad. Sci. USA 90, 6909-6913). Libraries of compounds may, for example, be presented in solution, on beads, chips, bacteria, spores, plasmids or phages. In the context of the present invention, agents to be identified through the present screening methods may be any compound or composition, including several compounds. Furthermore, the test agent exposed to a cell or protein according to the screening methods of the present invention may be a single compound or a combination of compounds. When a combination of compounds is used in the methods, the compounds may be contacted sequentially or simultaneously.
In a further aspect the present invention relates to an antagonist or binding partner identified by, obtainable by or obtained by one the above defined methods. Correspondingly identified binding partner may additionally be tested for their ability to function as antagonist, or in a specific embodiment, as agonist of the polypeptide of the present invention.
Correspondingly identified antagonists may further be analyzed with respect to their ability to prevent cancer cell growth in animal models or test subjects or in clinical trials and for their pharmaceutical usability including the occurrence of secondary or adverse effects according to suitable procedures known to the person skilled in the art.
In another aspect the present invention relates to a method of making cytotoxic T lymphocytes (CTLs) specific for the polypeptide of the present invention, e.g.
comprising the amino acid sequence of SEQ ID NO: 2 or 5.
The term "CTL" or "cytotoxic T lymphocyte" as used herein refers to a CD4+ T lymphocyte, a CD8+ T lymphocyte or a natural killer cell. Preferably, the term refers to a CD8+ T lymphocyte or a natural killer cell. The term "making CTLs specific for the polypeptide of the present invention" as used herein refers to an approach for the generation of a CTL, which specifically detects a polypeptide according to the present invention, preferably a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5. Subsequently, such a CTL may perform a cytotoxic reaction, e.g. via the release of the cytotoxins perforin and granulysin, or induce an appoptotic cell reaction, e.g. via the interaction with cell-surface molecules, e.g. Fas proteins expressed on a target cell. The making of CTLs typically comprises the presentation of antigens, preferably of MHC I specific antigenic peptides, to T cells, preferably to CD8+ T cells. Preferably, a peptide sequence as set forth in SEQ ID NO: 16 to 26 may be used. Preferably, the antigen or antigenic peptide may be presented by a dendritic cell (DC), more preferably by a MHC I molecule present on a dendritic cell.
Positively reacting T lymphocytes may subsequently be selected, enriched and/or expanded according to suitable methods known to the person skilled in the art. T cells to be used for the production of CTLs according to the present invention may be derived from lymphoid tissue, preferably they may be obtained from a peripheral blood mononuclear cell (PBMC) cell fraction. Typically, PBMCs may be extracted from whole blood using ficoll. Alternatively, PBMC may be extracted from whole blood using a hypotonic lysis. Any other suitable method known to the person skilled in the art may also be used.
PBMCs to be used may be derived from blood obtained from blood donors.
Alternatively, autologous PBMCs may be used. For the extraction of autologous cells any suitable method known to the person skilled in the art may be used.
In a preferred embodiment the present invention relates to a method of making cytotoxic T lymphocytes (CTLs) specific for the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, which comprises the step of stimulating autologous T cells in vitro with dendritic cells loaded with a peptide derived from the polypeptide according to the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, or a fragment thereof. This procedure may be carried out according to any suitable procedure known in the art.
Typically, the following procedure may be used: non-adherent PBMCs (preferably in an amount of 2 x 106 ml) may be co-cultered in a suitable medium, e.g. in human serum, preferably in Aim-V medium supplemented with 10% pooled human serum, with mature dendritic cells preincubated with peptides derived from the polypeptide of the present invention, preferably with peptides derived from the amino acid sequence of SEQ ID NO: 2 or 5. The co-cultivation may be carried out according to suitable parameters, e.g. for 7-10 days. The preincubation with the peptides may also be carried out according to any suitable parameters known to the person skilled in the art.
Preferably, the peptide may be used in a concentration of 50μg/ml.
Subsequently, T cells may be collected and preferably restimulated with dendritic cells loaded with peptides derived from the amino acid sequence of SEQ ID NO: 2 or 5. The restimulation may preferably be carried out once in a week. Furthermore, the medium may be supplemented with additional factors, e.g. with IL-2, IL-7 and/or IL-15.
After a repetition of the stimulation cycle, preferably by 3 to 5 times T-cell lines may be established by limiting-dilutions. Subsequently, T-cell line clones may be expanded in T-cell medium comprising IL-2, IL-7 and/or IL-15, e.g. during 2 weeks. The CTLs may additionally be tested for their biological activity according to known methods, e.g. a cytotoxicity test.
Accordingly obtained CTLs may be stored or further expanded or be used for the preparation of medicaments of pharmaceutical compositions.
Any suitable deviation from this protocol based on the knowledge of the skilled person is also envisaged by the present invention.
In a further preferred embodiment the present invention relates to the stimulation of natural killer cells by LRP 1 peptides, preferably by peptides encoded by portions of exon 7 of LRP 1, more preferably by a peptide sequence as set forth in SEQ ID NO: 16 to 26. The term "natural killer cell" or "NK cell" as used herein refers to cytotoxic lymphocytes of the innate immune system. NK cells kill by releasing small cytoplasmic granules of perforin and granzyme that cause the target cell to die by apoptosis. NK- cells typically are large granular lymphocytes (LGL) and constitute a cell type differentiated from the common lymphoid progenitor generating B and T lymphocytes. They typically do not express T-cell antigen receptors (TCR) or Pan T marker CD3 or surface immunoglobulins (Ig) B cell receptor but that usually express surface markers CD 16 (Fc gamma RIII) and CD56 in humans, and NK1.1/NK1.2 in certain strains of mice. The great majority of NK cells expresses CD8. The stimulation may be carried out according to the above described stimulation of CTLs or according to any other suitable method known to the person skilled in the art. In a further aspect the present invention relates to a CTL obtainable or obtained by the above described method. Such a CTL may preferably be able to recognize an antigen derived from the polypeptide of the present invention, or a poypeptide of the present invention or a fragment or peptide thereof.
In a specific embodiment, the present invention relates to a CTL which is specific for an antigen derived from the polypeptide of the present invention, or which is specific for a polypeptide of the present invention or a fragment thereof, e.g. for a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 5 or a fragment thereof.
In another aspect the present invention relates to a pharmaceutical composition comprising the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10., the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiably according to the present invention as defined herein above or a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention.
In addition to the mentioned ingredients, a pharmaceutical composition may also, e.g. optionally, comprise a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" as used herein means approved by a regulatory agency or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
The term "carrier" as used herein refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such a carrier is pharmaceutically acceptable, i.e. is generally non-toxic to a recipient at the dosage and concentration employed. It is preferably isotonic, hypotonic or weakly hypertonic and has a relatively low ionic strength, such as provided by a sucrose solution. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers. Suitable pharmaceutical excipients include starch, glucose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium ion, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of, e.g., solutions, suspensions, emulsion, powders, sustained-release formulations and the like. Examples of suitable pharmaceutical carriers are described in "Remington's
Pharmaceutical Sciences" by E.W. Martin. Some other examples of substances which can serve as pharmaceutical carriers are sugars, such as glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethycellulose, ethylcellulose and cellulose acetates; powdered tragancanth; malt; gelatin; talc; stearic acids; magnesium stearate; calcium sulfate; calcium carbonate; vegetable oils, such as peanut oils, cotton seed oil, sesame oil, olive oil, corn oil and oil of theobroma; polyols such as propylene glycol, glycerine, sorbitol, manitol, and polyethylene glycol; agar; alginic acids; pyrogen-free water; isotonic saline;
cranberry extracts and phosphate buffer solution; skim milk powder; as well as other non-toxic compatible substances used in pharmaceutical formulations such as Vitamin C, estrogen and echinacea, for example. Wetting agents and lubricants such as sodium lauryl sulfate, as well as coloring agents, flavoring agents, lubricants, excipients, tabletting agents, stabilizers and anti-oxidants can also be present. It is also envisaged by the present invention to administer the active ingredients of the pharmaceutical composition in encapsulated form, e.g. as cellulose encapsulation, in gelatine, with polyamides, niosomes, wax matrices, with cyclodextrins or liposomally encapsulated.
Generally, the ingredients may be supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilised powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. In a specific embodiment, the pharmaceutical composition, vaccine or kit may be formulated in accordance with routine procedures adapted for intravenous
administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
The pharmaceutical composition can also be formulated as neutral or salt forms.
Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
The pharmaceutical composition of the present invention can also comprise a preservative. Preservatives according to certain compositions of the invention include butylparaben, ethylparaben, imidazolidinyl urea, methylparaben, O-phenylphenol, propylparaben, quaternium-14, quaternium-15, sodium dehydro acetate, zinc pyrithione, thimerosal and the like. The preservatives may be used, for example, in amounts effective to prevent or retard microbial growth. Generally, the preservatives are used in amounts of about 0.1 % to about 1 % by weight of the total composition with about 0.1% to about 0.8%) being preferred and about 0.1%> to about 0.5%> being most preferred.
In a further embodiment of the present invention the pharmaceutical composition may comprise or be mixed with at least one suitable adjuvant. Adjuvants may be used to enhance the effectiveness of the pharmaceutical composition. Such adjuvants include, for example, chloroquine, protic polar compounds, such as propylene glycol, polyethylene glycol, glycerol, EtOH, 1 -methyl L-2-pyrrolidone or their derivatives, or aprotic polar compounds such as dimethylsulfoxide (DMSO), diethylsulfoxide, di-n- propylsulfoxide, dimethylsulfone, sulfolane, dimethylformamide, dimethylacetamide, tetra-methylurea, acetonitrile or their derivatives.
A pharmaceutical composition according to the present invention may be administered to a patient, subject or individual with the help of any suitable delivery system known to the person skilled in the art, e.g., via encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor- mediated endocytosis, construction of a nucleic acid as part of a retroviral or other vector, etc. Methods of introduction may be any suitable method known, including topical, enteral or parenteral introduction. The methods of introduction may also include intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, inhalational, epidural, and oral routes. The composition may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) or by inhalation and may be administered together with other biologically active agents.
Administration can be systemic or local. In addition, it may be desirable to introduce the pharmaceutical compounds or compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection;
intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary or inhalational administration can be employed, e.g., via the use of an inhaler or nebulizer, and a concomitant formulation with an aerosolizing agent.
In a specific embodiment, it may be desirable to administer the pharmaceutical compounds or compositions of the invention locally to the area in need of treatment; this may be achieved by, for example, local infusion, e.g. during surgery, topical application, e. g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. A preferred method of local administration is by direct injection. Preferably, any ingredient of the pharmaceutical composition of the present invention as defined herein above may be complexed with a delivery vehicle to be administered by direct injection into or locally within the area of arteries. Administration of a composition locally within the area of arteries refers to injecting the composition centimeters and preferably, millimeters within arteries. Another method of local administration is to contact a pharmaceutical composition of the present invention in or around a surgical wound. For example, a patient can undergo surgery and the pharmaceutical composition can be coated on the surface of tissue inside the wound or the pharmaceutical composition can be injected into areas of tissue inside the wound.
For systemic administration, ingredients of the pharmaceutical composition of the present invention as defined herein above can be complexed to a targeted delivery vehicle. Suitable delivery vehicles for use with systemic administration comprise liposomes comprising ligands for targeting the vehicle to a particular site. Preferred methods of systemic administration, include intravenous injection, aerosol, oral and percutaneous (topical) delivery. Intravenous injections can be performed using methods standard in the art. Aerosol delivery can also be performed using standard methods in the art (see, for example, Stribling et al, 1992, PNAS, 189: 11277-11281).
Oral delivery can be performed by complexing ingredients of the pharmaceutical composition of the present invention as defined herein above to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers include plastic capsules or tablets, such as those known in the art. Topical delivery can be performed, for instance, by mixing a polynucleotide construct of the present invention with a lipophilic reagent (e.g., DMSO) that is capable of passing into the skin.
In another embodiment of the present invention the pharmaceutical composition may be delivered directly to internal organs, body cavities and the like by use of imaging devices used to guide an injecting needle directly to the site of interest. The
pharmaceutical composition may also be administered to disease sites at the time of surgical intervention. In another embodiment, the pharmaceutical composition may be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249, 1527-1533; Treat et al, 1989 in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365; Lopez-Berestein, ibid., pp. 317-327). In yet another embodiment, the composition can be delivered in a controlled release system. In one embodiment, a pump may be used. In another embodiment, polymeric materials can be use. In yet another embodiment, a controlled release system can be placed in proximity of a therapeutic target, e.g. the brain, lymphatic organs etc. thus requiring only a fraction of the systemic dose.
Preferably the pharmaceutical composition is in a form, which is suitable for oral, local or systemic administration. In a preferred embodiment the pharmaceutical composition is administered locally, orally or systemically.
The composition of the present invention can be administered to a mammal. The term "mammal" as used herein is intended to have the same meaning as commonly understood by one of ordinary skill in the art. Particularly, the term "mammal" encompasses human beings. Also encompassed are mammals such as dogs, cats, mice, rats, monkeys, rabbits, goats, sheep, pigs, guinea pigs, cattle, horses etc.
The term "administered" as used herein means administration of a therapeutically effective dose of the pharmaceutical composition. By "therapeutically effective amount" is meant a dose that produces the effects for which it is administered, preferably this effect is reduction of the expression or amount of the short splice variant LRP1, more preferably the destruction of cancerous cells or the inhibition of cancerous growth. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As is known in the art adjustments for systemic versus localized delivery, age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art. The pharmaceutical composition may be used in both human therapy and veterinary therapy, preferably in human therapy. The compounds described herein having the desired therapeutic activity may be administered in a physiologically acceptable carrier to a patient, as described herein. The concentration of the therapeutically active compound in the formulation may vary from about 0.00001-100 wt %.
The concentration of the active ingredients or compounds of a pharmaceutical composition according to the present invention may be further adjusted to the intended dosage regimen, the intended usage duration, the exact amount and ratio of all ingredients of the composition and further factors and parameter known to the person skilled in the art.
Topical administration of the pharmaceutical composition of the present invention is useful when the desired treatment involves areas or organs readily accessible by topical administration. For a topically application, e.g. to the skin, mucous membrane, the pharmaceutical composition is preferably formulated with a suitable paste, ointment, lotion, cream, gel or transdermal patches. The pharmaceutical preparations can, depending on the field of use, also be in the form of a foam, gel spray, mousse, suspensions or powder, e.g. if used for topical administration. A suitable paste comprises the active ingredient suspended in a carrier. Such carriers may include petroleum, soft white paraffin, yellow petroleum jelly and glycerol. The pharmaceutical composition may also be formulated with a suitable ointment comprising the active components suspended or dissolved in a carrier. Such carriers may include one or more of glycerol, mineral oil, liquid oil, liquid petroleum, white petroleum, yellow petroleum jelly, propylene glycol, alcohols, triglycerides, fatty acid esters such as cetyl ester, polyoxy ethylene polyoxypropylene compound, waxes such as white wax and yellow beeswax, fatty acid alcohols such as cetyl alcohol, stearyl alcohol and
cetylstearylalcohol, fatty acids such as stearic acid, cetyl stearate, lanolin, magnesium hydroxide, kaolin and water.
Alternatively, the pharmaceutical composition may also be formulated with a suitable lotion or cream comprising the active components suspended or dissolved in a carrier. Such carriers may include one or more of mineral oil such as paraffin, vegetable oils such as castor oil, castor seed oil and hydrogenated castor oil, sorbitan monostearat, polysorbat, fatty acid esters such as cetyl ester, wax, fatty acid alcohols such as cetyl alcohol, stearyl alcohol, 2-octyldodecanol, benzyl alcohol, alcohols, triglycerides and water.
Alternatively, the pharmaceutical composition may also be formulated with a suitable gel comprising the active components suspended or dissolved in a carrier. Such carriers include, but are not limited to, one or more of water, glycerol, propyleneglycole, liquid paraffin, polyethylene, fatty oils, cellulose derivatives, bentonite and colloidal silicon dioxide.
The pharmaceutical composition according to the invention may generally comprise further auxiliaries as are customarily used in such preparations, e.g. preservatives, perfumes, antifoams, dyes, pigments, thickeners, surface-active substances, emulsifiers, emollients, finishing agents, fats, oils, waxes or other customary constituents of a dermato logical formulation, such as alcohols, polyols, polymers, foam stabilizers, solubility promoters, electrolytes, organic acids, organic solvents, or silicone derivatives. The pharmaceutical composition according to the invention may also comprise emollients. Emollients may be used in amounts, which are effective to prevent or relieve dryness. Useful emollients include, without limitation: hydrocarbon oils and waxes; silicone oils; triglyceride esters; acetoglyceride esters; ethoxylated glyceride; alkyl esters; alkenyl esters; fatty acids; fatty alcohols; fatty alcohol ethers; etheresters; lanolin and derivatives; polyhydric alcohols (polyols) and polyether derivatives; polyhydric alcohol (polyol) esters; wax esters; beeswax derivatives; vegetable waxes;
phospholipids; sterols; and amides.
Thus, for example, typical emollients include mineral oil, especially mineral oils having a viscosity in the range of 50 to 500 SUS, lanolin oil, mink oil, coconut oil, cocoa butter, olive oil, almond oil, macadamia nut oil, aloa extract, jojoba oil, safflower oil, corn oil, liquid lanolin, cottonseed oil, peanut oil, purcellin oil, perhydrosqualene (squalene), caster oil, polybutene, odorless mineral spirits, sweet almond oil, avocado oil, calophyllum oil, ricin oil, vitamin E acetate, olive oil, mineral spirits, cetearyl alcohol (mixture of fatty alcohols consisting predominantly of cetyl and stearyl alcohols), linolenic alcohol, oleyl alcohol, octyl dodecanol, the oil of cereal germs such as the oil of wheat germ cetearyl octanoate (ester of cetearyl alcohol and 2- ethylhexanoic acid), cetyl palmitate, diisopropyl adipate, isopropyl palmitate, octyl palmitate, isopropyl myristate, butyl myristate, glyceryl stearate, hexadecyl stearate, isocetyl stearate, octyl stearate, octylhydroxy stearate, propylene glycol stearate, butyl stearate, decyl oleate, glyceryl oleate, acetyl glycerides, the octanoates and benzoates of (C12-C15) alcohols, the octanoates and decanoates of alcohols and polyalcohols such as those of glycol and glycerol, and ricin- oleates of alcohols and poly alcohols such as those of isopropyl adipate, hexyl laurate, octyl dodecanoate, dimethicone copolyol, dimethiconol, lanolin, lanolin alcohol, lanolin wax, hydrogenated lanolin, hydroxylated lanolin, acetylated lanolin, petrolatum, isopropyl lanolate, cetyl myristate, glyceryl myristate, myristyl myristate, myristyl lactate, cetyl alcohol, isostearyl alcohol stearyl alcohol, and isocetyl lanolate, and the like.
Moreover, the pharmaceutical composition according to the invention may also comprise emulsifiers. Emulsifiers (i.e., emulsifying agents) are preferably used in amounts effective to provide uniform blending of ingredients of the composition. Useful emulsifiers include (i) anionics such as fatty acid soaps, e.g., potassium stearate, sodium stearate, ammonium stearate, and triethanolamine stearate; polyol fatty acid monoesters containing fatty acid soaps, e.g., glycerol monostearate containing either potassium or sodium salt; sulfuric esters (sodium salts), e.g., sodium lauryl 5 sulfate, and sodium cetyl sulfate; and polyol fatty acid monoesters containing sulfuric esters, e.g., glyceryl monostearate containing sodium lauryl surfate; (ii) cationics chloride such as N(stearoyl colamino formylmethyl) pyridium; N-soya-N-ethyl morpholinium ethosulfate; alkyl dimethyl benzyl ammonium chloride; diisobutylphenoxytheoxyethyl dimethyl benzyl ammonium chloride; and cetyl pyridium chloride; and (iii) nonionics such as polyoxy ethylene fatty alcohol ethers, e.g., monostearate; polyoxy ethylene lauryl alcohol; polyoxypropylene fatty alcohol ethers, e.g., propoxylated oleyl alcohol;
polyoxy ethylene fatty acid esters, e.g., polyoxyethylene stearate; polyoxyethylene sorbitan fatty acid esters, e.g., polyoxyethylene sorbitan monostearate; sorbitan fatty acid esters, e.g., sorbitan; polyoxyethylene glycol fatty acid esters, e.g., polyoxy ethylene glycol monostearate; and polyol fatty acid esters, e.g., glyceryl monostearate and propylene glycol monostearate; and ethoxylated lanolin derivatives, e.g., ethoxylated lanolins, ethoxylated lanolin alcohols and ethoxylated cholesterol. The selection of emulsifiers is exemplarily described in Schrader, Hiithig Buch Verlag, Heidelberg, 2nd edition, 1989, 3rd part.
The pharmaceutical composition according to the invention may also include a surfactant. Suitable surfactants may include, for example, those surfactants generally grouped as cleansing agents, emulsifying agents, foam boosters, hydrotropes, solubilizing agents, suspending agents and nonsurfactants (facilitates the dispersion of solids in liquids).
The surfactants are usually classified as amphoteric, anionic, cationic and nonionic surfactants. Amphoteric surfactants include acylamino acids and derivatives and N- alkylamino acids. Anionic surfactants include: acylamino acids and salts, such as, acylglutamates, acylpeptides, acylsarcosinates, and acyltaurates; carboxylic acids and salts, such as, alkanoic acids, ester carboxylic acids, and ether carboxylic acids; sulfonic acids and salts, such as, acyl isethionates, alkylaryl sulfonates, alkyl sulfonates, and sulfosuccinates; sulfuric acid esters, such as, alkyl ether sulfates and alkyl sulfates. Cationic surfactants include: alkylamines, alkyl imidazolines, ethoxylated amines, and quaternaries (such as, alkylbenzyldimethylammonium salts, alkyl betaines, heterocyclic ammonium salts, and tetra alkylammonium salts). And nonionic surfactants include: alcohols, such as primary alcohols containing 8 to 18 carbon atoms; alkanolamides such as alkanolamine derived amides and ethoxylated amides; amine oxides; esters such as ethoxylated carboxylic acids, ethoxylated glycerides, glycol esters and derivatives, monoglycerides, polyglyceryl esters, polyhydric alcohol esters and ethers,
sorbitan/sorbitol esters, and triesters of phosphoric acid; and ethers such as ethoxylated alcohols, ethoxylated lanolin, ethoxylated polysiloxanes, and propoxylated
polyoxy ethylene ethers.
Furthermore, a pharmaceutical composition according to the invention may also comprise a film former. Suitable film formers which are used in accordance with the invention keep the composition smooth and even and include, without limitation: acrylamide/sodium acrylate copolymer; ammonium acrylates copolymer; Balsam Peru; cellulose gum; ethylene/maleic anhydride copolymer; hydroxyethylcellulose;
hydroxypropylcellulose; polyacrylamide; polyethylene; polyvinyl alcohol; pvm/MA copolymer (polyvinyl methylether/maleic anhydride); PVP (polyvinylpyrrolidone); maleic anhydride copolymer such as PA- 18 available from Gulf Science and
Technology; PVP/hexadecene copolymer such as Ganex V-216 available from GAF Corporation; acryliclacrylate copolymer; and the like.
Generally, film formers can be used in amounts of about 0.1% to about 10% by weight of the total composition with about 1% to about 8% being preferred and about 0.1 DEG/O to about 5% being most preferred. Humectants can also be used in effective amounts, including: fructose; glucose; glulamic acid; glycerin; honey; maltitol; methyl gluceth-10; methyl gluceth-20; propylene glycol; sodium lactate; sucrose; and the like. Other ingredients which can be added or used in a pharmaceutical composition according to the invention in amounts effective for their intended use, include:
biological additives to enhance performance or consumer appeal such as amino acids, proteins, vanilla, aloe extract, bioflavinoids, and the like; buffering agents, chelating agents such as EDTA; emulsion stabilizers; pH adjusters; opacifying agents; and propellants such as butane carbon dioxide, ethane, hydrochlorofluorocarbons 22 and 142b, hydro fluoro carbon 152a, isobutane, isopentane, nitrogen, nitrous oxide, pentane, propane, and the like.
Furthermore, the pharmaceutical composition according to the invention may also comprise compounds, which have an antioxidative, free-radical scavenger,
antierythematous, antiinflammatory or antiallergic action, in order to supplement or enhance their action. In particular, these compounds can be chosen from the group of vitamins, plant extracts, alpha- and beta-hydroxy acids, ceramides, antiinflammatory, antimicrobial or UV-filtering substances, and derivatives thereof and mixtures thereof. The lipid phase is advantageously chosen from the group of substances of mineral oils, mineral waxes, branched and/or unbranched hydrocarbons and hydrocarbon waxes, triglycerides of saturated and/or unsaturated, branched and/or unbranched C8-C24- alkanecarboxylic acids; they can be chosen from synthetic, semisynthetic or natural oils, such as olive oil, palm oil, almond oil or mixtures; oils, fats or waxes, esters of saturated and/or unsaturated, branched and/or unbranched C3-C3o-alkane carboxylic acids and saturated and/or unsaturated, branched and/or unbranched C3-C3o-alcohols, from aromatic carboxylic acids and saturated and/or unsaturated, branched and/or unbranched C3-C3o-alcohols, for example isopropyl myristate, isopropyl stearate, hexyldecyl stearate, oleyl oleate; and also synthetic, semisynthetic and natural mixtures of such esters, such as jojoba oil, alkyl benzoates or silicone oils, such as, for example, cyclomethicone, dimethylpolysiloxane, diethylpolysiloxane, octamethylcyclo- tetrasiloxane and mixtures thereof or dialkyl ethers.
In one specific embodiment of the present invention a pharmaceutical composition may comprise nucleic acids according to the present invention which are provided via living therapeutics. The term "living therapeutic" means that said nucleic acids are expressed in any suitable live carrier. Accordingly, the present invention relates to corresponding polynucleotides, which are suitable for expression in a living cell. The present invention also relates to vectors containing such polynucleotides, appropriate host cells, and the production of polypeptides by recombinant techniques in said host cells.
The term "live carrier" relates to any appropriate living host cell or virus known to the person skilled in the art. Representative examples of appropriate hosts include bacterial cells such as Escherichia coli or Lactobacillus, fungal cells, such as yeast cells, protozoa, insect cells, or animal cells. Preferably, the term relates to attenuated bacteria, attenuated fungal cells or attenuated protozoa. Representative examples of appropriate viruses include viruses of the group of adenoviruses, retrovirues or lentirviruses, preferably attenuated viruses of the group of adenoviruses, retroviruses or lentirviruses.
In a preferred embodiment, probiotic bacterial cells, in particular probiotic Escherichia coli or Lactobacillus cells may be used. More preferably, cells of Escherichia coli Nissle 1973 and even more preferably cells of Lactobacillus casei or Lactobacillus zeae 393 may be used. Such bacterial cells, in particular the Lactobacillus cells, may be used at a suitable location, preferably in the gastrointestinal tract. The bacterial cells may be administered to a patient in any suitable form known to the person skilled in the art, preferably orally.
Accordingly, the cells may be cultured ex vivo, e.g. under laboratory conditions.
Appropriate culture media and conditions for the above-described host cells are known in the art. Subsequently the cells may be transformed with suitable expression vectors. Particularly preferred expression vectors for use in Lactobacillus systems may include pGhost4, pGhost5 and pGhost6 available from Appligene-Oncor, Illkirch, France.
Further, pIAb8, pIAV7, pPSC22, pH2515, pLP3537 and pUCL287 may be used. Other suitable vectors will be known to the skilled person
If the pharmaceutical composition according to the present invention is to be
administered in the form of a live cell or living therapeutic as defined herein above, or if the pharmaceutical composition comprises a CTL according to the present invention transformed and/or prepared cells may be administered to a patient in any suitable form known to the person skilled in the art. Preferably living therapeutics or CTLs may be administered in the form of a composition comprising a microorganism, e.g. a
Lactobacillus or a CTL as described above, in an amount between 10^ to 1012 cells, preferably 10^ to 10^ cells. Such a composition may be solid. In case of a liquid form of compositions, the amount of the microorganisms or CTLs may be between 10^ to 10^ cells per ml. However, for specific compositions the amount of the microorganism or CTL may be different and/or adjusted according to suitable parameters known to the person skilled in the art. In a further preferred embodiment of the present invention the ratio between ingredients in the pharmaceutical composition or medicament may be suitably adjusted according to the skilled person's knowledge. Likewise, a ratio similar ratio between components of a kit may be adjusted according to the skilled person's knowledge. Assays, e.g. those based on tests described herein above or derivable from known and qualified textbooks of the prior art, may optionally be employed to help identify optimal ratios and/or dosage ranges for ingredients of pharmaceutical compositions of the present invention. The precise dose and the ratio between the ingredients of the pharmaceutical composition as defined herein above to be employed in the formulation will also depend on the route of administration, and the exact type of disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses or ingredient ratios may be extrapolated from dose-response curves derived from in vitro or (animal) model test systems.
Typically, the attending physician and clinical factors may determine the dosage regimen. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. A typical dose can be, for example, in the range of 0.001 to 1000 μg; however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors. For example, a pharmaceutical composition may preferably be given once a week, more preferably 2 times, 3 times, 4 times, 5 times or 6 times a week and most preferably daily and or 2 times a day or more often, unless otherwise indicated. During progression of the treatment the dosages may be given in much longer time intervals and in need can be given in much shorter time intervals, e.g., several times a day. In a further aspect the present invention relates to a pharmaceutical composition as described herein above for the or for use in the treatment or prevention of cancer. The term "cancer" refers to a class of diseases in which a group of cells may display uncontrolled growth, i.e. division beyond the normal limits, invasion, i.e. intrusion on and destruction of adjacent tissues, and in certain cases metastasis, i.e. a spread to other locations in the body typically via lymph or blood. In a specific embodiment the term also includes tumors. The term "tumor" as used herein refers to a neoplastic, abnormal growth of cells, typically in the form of swellings or lesions. Examples of tumors are a benign, a pre-malignant or a malignant tumor. Preferably, a pre-malignant and most preferably a malignant tumor may be treated with a pharmaceutical composition according to the present invention. The term "prevention of cancer" as used herein refers to a therapeutic approach which is started before a cancerous state is detectable, preferably is histologically detectable, e.g. in the form of visible swellings, lesions etc., i.e. a very early disease state or pre-disease state. Preferably, the term refers to a blocking or stopping of such an early or pre-disease state. Such a therapeutic approach, i.e. the administration of a pharmaceutical composition according to the present invention for preventive purposes, may be based on diagnostic, detection, monitoring or prognostication results, preferably diagnostic, detection, monitoring or prognostication results, based on the expression of the short splice variant LRP1 marker as defined herein above. Also independent results obtained via alternative diagnostic approaches known to the person skilled in the art may be used.
In a further aspect the present invention relates to the use of a nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above or a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention for the preparation of a pharmaceutical composition for the or for use in the treatment or prevention of cancer. In yet another aspect the present invention relates to a medical kit comprising at least one element selected from the group consisting of: the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above or a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention.
In another aspect the present invention relates to a medical kit for the or for use in the treatment or prevention of cancer. Said kit preferably comprises at least one element selected from the group consisting of: the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above or a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention.
In an embodiment of the present invention, a medical kit that can be used in the context of the administration of the pharmaceutical composition as defined herein above. A medical kit may accordingly be formulated and administered similar to a
pharmaceutical composition or comprise carriers, adjuvants etc. as defined for a pharmaceutical composition herein above.
The ingredients of a medical kit may, according to the present invention, be comprised in one or more containers or separate entities. They may preferably be formulated as pharmaceutical compositions or medicaments, more preferably they may be formulated as has been described herein above in the context of the pharmaceutical compositions of the present invention, e.g. they may comprise suitable pharmaceutical carriers etc. Particularly preferred are formulations for topical, intravenous, subcutaneous, intranasal, inhalational, epidural, intramuscular, intramuscular in combination with electoporation, or oral routes administration as mentioned herein above in the context of pharmaceutical compositions of the invention. The formulation may further be made dependent on the ingredient, concentration, intended mode of action etc. For example, in case of ex vivo generated CTLs or NKs formulations for intravenous or subcutaneous are preferred. The medical kit according to the present invention may optionally also comprise a documentation, which indicates the use or employment of the medical kit and its components. Preferably, instructions comprised in the medical kit of the present invention may comprise recommended treatment options, dosage regimens etc. The medical kit may also comprise an instruction leaflet. The medical kit of the present invention may be administered to a patient according to any suitable dosage regimen known to the person skilled in the art. The medical kit or kit components may preferably be given once a week, more preferably 2 times, 3 times, 4 times, 5 times or 6 times a week and most preferably daily and or 2 times a day or more often, unless otherwise indicated. During progression of the treatment the dosages may be given in much longer time intervals and in need can be given in much shorter time intervals, e.g., several times a day. In a preferred case a response to the treatment may be monitored using herein described methods and further methods known to those skilled in the art and dosages may accordingly be optimized, e.g., in time, amount and/or composition. Progress can be monitored by periodic assessment.
In another aspect the present invention relates to a method of treatment or prevention of cancer comprising administering to an individual a therapeutically effective amount of the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above or a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention. The mentioned ingredients may be formulated in the form of a
pharmaceutical composition as defined herein above and administered, prepared and used according to the specifications provided in the context of pharmaceutical compositions herein above.
In another aspect the present invention relates to a vaccine comprising the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above, a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention or an anti-idiotypic antibody against an antibody of the invention as defined herein above. Thus, a vaccine according to the present invention may, for example, comprise polypeptides or proteins of varying length comprising the amino acids sequence of SEQ ID NO: 2, nucleotide sequences encoding such a polypeptide, in particular expression vectors capable of expressing the polypeptide, e.g. DNA plasmid vectors, viral vectors etc. as described herein above, host cells expressing the such a polypeptide as described herein above, preferably host cells expressing the polypeptide at the surface of the cell, or secrete the polypeptide. These components or ingredients may be present either separately or in combination or in any sub-grouping or sub-combination of the mentioned items. The components may be delivered using the same or different vehicles. Additionally, the components may be organized in the form of a kit, e.g. comprising additional kit ingredients as mentioned herein above in the context of the diagnostic or medical kit, e.g. a leaflet etc.
The polypeptide comprised in the vaccine may comprise one epitope or various epitopes, e.g. a MHC I and/or a MHC II epitope or two or more copies of each or combinations thereof. Corresponding, i.e. encoding nucleic acid molecules, may be provided, preferably in the form of DNA or RNA molecules, e.g. DNA vectors or expression vectors. Such vectors may preferably be DNA plasmids or viral vectors. Vectors, in particular viral vectors may be capable of replication or be replication- impaired or non-replicating. The term "non-replicating" or "replication-impaired" as used herein means not capable of replication to any significant extent in the majority of normal mammalian cells or normal human cells. Viruses which are non-replicating or replication-impaired may have become so naturally (i.e. they may be isolated as such from nature) or artificially e.g. by breeding in vitro or by genetic manipulation, for example deletion of a gene which is critical for replication. Suitable viral vectors for use in a vaccine according to the present invention include non-replicating adenoviruses such as El deletion mutants, vectors based on herpes virus and Venezuelan equine encephalitis virus (VEE). Suitable bacterial vectors include recombinant BCG and recombinant Salmonella and Salmonella transformed with plasmid DNA (see Darji et al., 1997, Cell 91 : 765-775). Alternative suitable non-viral vectors include lipid-tailed peptides known as lipopeptides, peptides fused to carrier proteins such as KLH either as fusion proteins or by chemical linkage.
In a preferred embodiment a vaccinia virus vector such as MVA or NYVAC may be used. Most preferred is the vaccinia strain modified virus ankara (MVA) or a strain derived therefrom. MVA is a replication impaired vaccinia strain with a good safety record. In most cell types and normal human tissues, MVA does not replicate; limited replication of MVA is observed in a few transformed cell types such as BHK21 cells. Alternatives to vaccinia vectors include pox virus vectors, e.g. avipox vectors such as fowl pox or canarypox vectors. Particularly suitable as an avipox vector is a strain of canarypox known as ALVAC, and strains derived therefrom. The vaccine may alternatively or additionally comprise any of the CTLs defined herein above, e.g.
specifically recognizing a polypeptide of the present invention.
Also envisaged is the presence of an anti- idiotypic antibody against an antibody of the invention as defined herein above in the vaccine. The term "anti-idiotypic antibody" relates to an antibody, the activity of which is directed specifically against the antigenic determinants (idiotope) of a particular immunoglobulin molecule, e.g. another antibody. Preferably, an anti-idiotypic antibody of the present invention may be specifically binding to an antibody, which in turn specifically binds to an epitope of the present invention. The term "anti-idiotypic antibody against an antibody of the invention as defined herein above" thus refers to an antibody which recognizes the idiotype of an antibody which is directed against a polypeptide of the present invention, in particular against a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, or variants thereof, e.g. present on the amino acid sequence of SEQ ID NO: 2 or comprising said sequence, more preferably against an epitope as set forth in SEQ ID NO: 16 to 34. In this manner, an epitope of a polypeptide of the present invention may be formed on the paratope of the anti-idiotypic antibody as a mimic for the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or an epitope derived therefrom, since it has been found that anti-idiotypic antibodies that bind to the antigen-combining sites of antibodies can effectively mimic the three-dimensional structures and functions of the external antigens and can be used as surrogate antigens for active specific
immunotherapy. Corresponding antibodies may be obtained according to techniques known to the person skilled in the art, e.g. from Bhattacharya-Chatterjee et al, 2006, Cancer Drug Discovery and Development, Immunotherapy of Cancer, Humana Press, 139-149, Greenspan & Bona, 1989, FASEB J. 7 (5): 437-444; or Nissinoff, 1991, J. Immunol. 147 (8): 2429-2438.
In a particularly preferred embodiment an anti-idiotypic antibody against antibody R4B6G5 or an antibody produced by hybridoma clone R4B6G5 or by the hybridoma having DSMZ accession No. DSM ACC3000 may be employed.
In a preferred embodiment the vaccine comprises an epitope derived from a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, or variants thereof as described herein above. Such an epitope may be of varying length. It may be a B-cell, T-cell,
MHC I specific, or MHC II specific epitope. It may preferably have a length of about 8 to 10 amino acids in the case of a MHC I specific epitope, e.g. 8, 9 or 10 amino acids, it may preferably have a length of about 13 to 17 amino acids in the case of a MHC II epitope, e.g. 13, 14, 15, 16 ro 17 amino acids. The epitope may be capable of eliciting B-cell or T-cell immune responses. The epitope may alternatively be capable of eliciting CTL or cytotoxic reactions. For T-helper cell response, the presentation by MHC II molecules may be required. For T-cell response, the presentation by MHC I molecules may be required. Peptides or epitopes according to the present invention, e.g. as defined herein above or below, may also stimulate NK-cell (natural killer cells) that are effective tumor killing cells and may be used for such an approach. Peptides or epitopes according to the present invention, e.g. as defined herein above or below, may also stimulate dendritic cells for enhancing antigenic stimulation of lymphocytes and may be used for such an approach. The activation of cells, e.g. T-cells, NK cells or dendritic cells, may be tested with suitable tests known to the person skilled in the art. For the detection of T-cell activation an ELISPOT assay as known to the person skilled in the art, preferably as described in Example 8, may be used. In a particular embodiment the present invention also envisages peptides or epitopes derived from a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, or variants thereof as described herein above which can be identified according to activation tests, e.g. ELISPOT tests. Particularly preferred are peptides or epitopes, which show a cell activation in such tests, more preferably a significant cell activation, e.g. a significant T-cell activation, a significant NK-cell activation or a significant activation of dendritic cells.
In a particularly preferred embodiment the following epitopes may be used or employed in, for or in the context of the present vaccine:
RRSRKRAQ (SEQ ID NO: 16)
RSRKRAQE (SEQ ID NO: 17)
SRKRAQEN (SEQ ID NO: 18)
RKRAQENE (SEQ ID NO: 19)
KRAQENEV (SEQ ID NO: 20)
RAQENEVT (SEQ ID NO: 21)
AQENEVTT (SEQ ID NO: 22)
QENEVTTQ (SEQ ID NO: 23) ENEVTTQH (SEQ ID NO: 24)
NEVTTQHG (SEQ ID NO: 25)
EVTTQHGC (SEQ ID NO: 26)
RRSRKRAQENEVT (SEQ ID NO: 27)
RSRKRAQENEVTT (SEQ ID NO: 28)
SRKRAQENEVTTQ (SEQ ID NO: 29)
RKRAQENEVTTQH (SEQ ID NO: 30)
KRAQENEVTTQHG (SEQ ID NO: 31) KRAQENEVTTQHGC (SEQ ID NO: 32) RRSRKRAQENEVTTQHG (SEQ ID NO: 33) and/or
RRSRKRAQENEVTTQHGC (SEQ ID NO: 34).
The epitopes of the present invention, in particular as defined herein above or set forth in SEQ ID NO: 16 to 34, may be present in a peptide, polypeptide, protein, polyprotein or particle comprising as two or more epitopes, or as a recombinant string of epitopes or in the context of the native target antigen, or in the form of a mixture or combination of the mentioned entities. The term "polyprotein" refers to two or more proteins which may be the same, or preferably different, linked together. Particularly preferred in this embodiment is a recombinant proteinaceous particle such as a Ty virus-like particle (VLP) (see Burns et al. 1994, Molec. Biotechnol. 1 : 137-145).
The term "epitope string" as used herein refers to a juxtaposition or combination of one or more epitopes, e.g. of2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more epitopes. Such a string may comprise solely MHC I specific epitopes or MHC II specific epitopes or a combination of both. The epitopes in a string of epitopes or of multiple epitopes may be linked together without intervening sequences so that unnecessary nucleic acid and/or amino acid material is avoided. Alternatively, the epitopes in a string of epitopes or of multiple epitopes may be linked together with intervening sequences. Such intervening sequences may have a length of 1 to 10 amino acids, preferably 2 to 5 amino acids. They may comprise amino acids without influence on the overall structure of the string, e.g. glycine.
In addition, the string of epitopes or multiple epitopes may include one or more epitopes recognised by T helper cells, to augment the immune response generated by the epitope string. Particularly suitable T helper cell epitopes are ones, which are active in individuals of different HLA types, for example T helper epitopes from tetanus (against which most individuals will already be primed). Particularly preferred is a combination of three T helper epitopes and an eptioppe according to the present invention.
Additionally or alternatvely, the epitope string may also include one or more B cell epitopes for stimulating B cell responses and antibody production. Suitable T helper and B cell epitopes are known to the person skilled in the art.
In a further aspect the present invention relates to a vaccine comprising the nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above, a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention or an anti-idiotypic antibody against an antibody of the invention as defined herein above for the or for use in the treatment or prevention of cancer.
If a vaccine according to the present invention is for the or for use in the treatment or prevention of cancer, it may preferably comprise, in addition to antigens or epitopes comprising the polypeptide of the invention, in particular SEQ ID NO: 2, as mentioned above, additional antigens or epitopes derived from or representing known tumor associated antigens (TAAs). Furthermore the string of epitopes or multiple epitopes of a corresponding vaccine may include one or more epitopes derived from or representing a known tumor associated antigen (TAA). Examples of such as TAAs which may be included in vaccines of the present invention are MAGE antigen, a SSX antigen family member, NY-ESO-1, Melan-A/MART-1, gplOO, tyrosinase, tyrosinase-related protein 1 (TRPl), TRP2, CEA, PSA, Her2/neu, p53, MUCl, PRAME, sarcosin (N-methylglycin), CA-125 (Carbophydrate antigen- 125) or survivin. The sequence and identity of these and further suitable TAAs would be known to the person skilled in the art; e.g. from Gires and Seliger ed., 2009, Tumor- Associated Antigens, Identification,
Characterization and Clinical Applications, Wiley- VCH.
In a further aspect the present invention relates to the use of a nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above, a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention or an anti-idiotypic antibody against an antibody of the invention as defined herein above of a vaccine for the or for use in the treatment or prevention of cancer. Preferably, a vaccine as defined herein above may be used for the preparation of a vaccine for the or for use in the treatment or prevention of cancer.
In yet another aspect the present invention relates to a method of inducing an immune response in an individual comprising administering to said subject a therapeutically effective amount of a nucleic acid molecule of the present invention, e.g. comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above, a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention or an anti-idiotypic antibody against an antibody of the invention as defined herein above. The term "immune response" refers to a therapeutic immune response beneficial for the subject or individual. Such an immune response may be a passive or active immunization, or it may be a short-term or long-term immunoprotection.
Preferably the immune response is an immune response against cancer. The term
"immune response against cancer" means that a cancerous cell or tissue may be attacked by components of the immune system, e.g. by CTLs or antibodies as defined herein above, that a cancerous cell or tissue may be reduced in its size or modified in its structure by the mentioned entities or that the cancerous cell or tissue may be eliminated by the mentioned entities.
A vaccine according to the present invention or vaccine compounds or ingredients as defined herein above, i.e. a nucleic acid molecule of the present invention, e.g.
comprising the nucleotide sequence of SEQ ID NO: 1, 4, 7, 8 or 10, the vector as defined herein above, the host cell as defined herein above, the polypeptide of the present invention, e.g. comprising the amino acid sequence of SEQ ID NO: 2 or 5, the antibody as defined herein above, an antagonist as defined herein above or as obtained according to the methods of the present invention, a binding partner identifiable according to the present invention as defined herein above, a CTL obtainable according to the method of the present invention or specific for an antigen derived from the polypeptide of the present invention or an anti-idiotypic antibody against an antibody of the invention as defined herein above may be given or administered, e.g. in the course of a method for immunization as described herein above, once or more than one time, e.g. 2, 3, 4, 5, 6 or more times, preferably 2, 3 or 4 times according to any suitable vaccination scheme known in the art. In case a vaccine or vaccine ingredients are given or administered more than once a prime and boost administration may be pursued, e.g. a "prime" administration is followed by one or more "boosts" to achieve the desired effects. The same composition or vaccine ingredient can be administered as the prime and as the one or more boosts. Alternatively, different compositions or vaccine ingredients can be used for priming and boosting. Furthermore, priming and boosting compositions or vaccines may comprise different combinations of vaccine ingredients, e.g. first a combination of a DNA plasmid and peptide or polypeptide, followed by a combination of a DNA plasmid and an anti-idiotypic antibody or vice versa etc. Furthermore, prime and boost compositions may be different in terms of vectors to be used. In a preferred example, the priming composition may be a viral vector and the boosting composition may also be a viral vector, however derived from a different virus. Alternatively, a prime composition may comprise a DNA or plasmid vector and the boost composition may comprise a viral vector, or vice versa. Further preferred are prime boost schemes in which at least one of the vectors is replication-impaired or non- replicating.
Carriers and further ingredients for the formulation of a composition, which may also be used for vaccines, have already been mentioned in the context of pharmaceutical compositions herein above. A preferred carrier for vaccines is a molecule that does not itself induce the production of antibodies harmful to the individual receiving the vaccine. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycollic acids, polymeric amino acids, amino acid copolymers, lipid aggregates, and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Furthermore, the
polypeptide of the present invention may be conjugated to carrier elements such as a bacterial toxoid, such as toxoid from diphtheria, tetanus, cholera, etc.
The vaccine used according to the invention may also be provided in frozen, freez-dried or lyophilized form, which may be thawed, or reconstituted, respectively, when needed.
In a further embodiment of the present invention the vaccine may comprise or be mixed with at least one suitable adjuvant. Adjuvants which are preferred, e.g. for vaccines, kits, compositions etc., comprise 1018 ISS, aluminium salts, such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, Amplivax, AS 15, BCG, CP- 870893, CpG7909, CyaA, dSLIM, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM- 174, OM-197-MP-EC, SAF, RAS, ONTAK, PepTel vector system, PLG microparticles, resiquimod, SRL1 72, Virosomes and other Virus-like particles, YF-17DBCG, Aquila's QS21 stimulon, Detox Quil, Superfos, Complete Freunds Adjuvant (CFA) and
Incomplete Freunds Adjuvant, pertussis toxin (PT), E. coli heat-labile toxin (LT), particularly LT-K63 (where lysine is substituted for the wild-type amino acid at position 63) LT-R72 (where arginine is substituted for the wild-type amino acid at position 72), CT-S 109 (where serine is substituted for the wild-type amino acid at position 109), and PT-K9/G129, MF59, saponin adjuvants such as Stimulon and cytokines, such as interleukins (IL-1, IL-2, etc.), M-CSF, GM-CSF, TNF, etc., as well as muramyl peptides like N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), Nacteyl- normuramyl-L-alanyl-D-isogluatme (nor-MDP), N-acetylmuramyl-L-alanyl-D- isogluatminyl-L-alanine-2-( -2'-dipalmitoyl-sn-glycero-3-huydroxy-phosphoryloxy)- ethylamine (MTP-PE), etc. Adjuvants may be combined in any suitable form and amount with the pharmaceutical composition, kit or vaccine of the present invention. The use of an adjuvant may be adjusted to the concrete purpose of the treatment. Such a use may vary depending on the target cell or tissue, the administration way, treatment scheme etc. A vaccine or immunological formulation may contain the immunogenic active substance at any suitable concentration, preferably at low concentrations, such as in an immunogenic amount ranging from 0.01 μg to 10 mg. Depending on the nature of the antigen, epitope, vector, vehicle, antibody etc. or on the presence of additional agents such a carriers or adjuvants, a suitable immunogenic dose may be chosen, e.g. in the range of from 0.01 μg to 750 μg, preferably 100 μg to 500 μg. In a further embodiment the vaccine according to the present invention may be provided in the form of a depot vaccine which is to be delivered to the organism over an extended period of time may. In such a case, the amount of ingredients may be higher such as from at least 1 mg to up to more than 10 mg.
A vaccine usually may be provided, for example, in ready-to-use syringes having a volume of from 0.01 to 1 ml, preferably 0.1 to 0.75 ml, of the concentrated solution, or suspension, respectively.
For a passive immunization, the present invention further provides a vaccine formulation comprising the antibodies against the short splice variant LRP1 as defined herein above in a range of from 1 mg to 10 g, preferably from 10 mg to 1 g.
The present invention further envisages a vaccination or administration employing a short splice variant LRP1 -peptide or -protein, preferably a peptide or protein comprising or consisting of parts or the entire sequence of exon 7 of LRP 1, more preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 coupled to a suitable heat shock protein or part thereof, preferably a chaperone HSP protein, more preferably a chaperon HSP110 protein. The coupling, which is mainly based on the application of heat shocks or a temperature increase, may be carried out according to any suitable method known to the person skilled in the art. Particularly preferred is the method or technique described in Manjili et al, 2002, Cancer Research, 62, 1737-1742. Accordingly prepared coupled proteins or peptides may further be combined with any suitable additional elements, e.g. buffers, additional proteins, adjuvants etc. as desecribed herein. The present invention further envisages a vaccination or administration employing a short splice variant LRP1 -peptide or -protein, preferably a peptide or protein comprising or consisting of parts or the entire sequence of exon 7 of LRP 1, more preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 coupled to one or more Ii-Key functional groups of LRMK or one or more suitable derivatives thereof. The coupling may be based on any suitable covalent or non- covalent binding. Examples are a binding via a polymethylene linker. The use of Ii-Key functional groups of LRMK may be based on any suitable method known to the person skilled in the art. Particularly preferred is the method or technique described in
Kallinteris et al, 2005, Journal of Immunotherapy, 28(4): 352-358. Accordingly prepared coupled proteins or peptides may further be combined with any suitable additional elements, e.g. buffers, additional proteins, adjuvants etc. as desecribed herein.
Vaccines of the present invention may be administered to a subject or individual by any suitable method, preferably via injection using either a conventional syringe or a gene gun, such as the Accell® gene delivery system. Delivery of DNA into cells of the epidermis is particularly preferred as this mode of administration provides access to skin-associated lymphoid cells and provides for a transient presence of DNA in the recipient. Both, nucleic acids and/or peptides and/or antibodies can be injected either subcutaneously, epidermally, intradermally, intramuco sally such as nasally, rectally and vaginally, intraperitoneally, intravenously, orally or intramuscularly. Other modes of administration include oral and pulmonary administration, suppositories, needle-less injection, transcutaneous and transdermal applications. If solids are employed as auxiliary agents for the vaccine formulation, e.g. an adsorbate or a suspended mixture of vaccine ingredient with the auxiliary agent is administered. In special embodiments, the vaccine is administered as a solution, or liquid vaccine, respectively, in an aqueous solvent.
Dosage treatment may be a single dose schedule or a multiple dose schedule.
Administration of nucleic acids may also be combined with administration of peptides or other substances. The active agents or compounds, e.g. the pharmaceutical composition, kit or vaccine according to the present invention may be administered alone or in combination with other treatments. It is, for example, envisaged that the pharmaceutical composition, kit or vaccine is employed in co-therapy approaches, i.e. in co-administration with other medicaments or drugs, for example antibiotics, antiviral medicaments or IgG or IgA immunoglobulins, preferably anticancer medicaments or chemotherapeutic
medicaments as known to the person skilled in the art. Furthermore, the pharmaceutical composition, kit or vaccine may be employed in co-therapy with anti-TGF-beta medicaments, e.g. with neutralizing anti-TGF-beta antibodies and/or with orally applied proteases that diminish TGF-betal levels in humans and/or with anti-Her2/neu monoclonal antibodies and/or with the immunoadjuvant granulocyte macrophage colony-stimulating factor (GM-CSF). In a particularly preferred embodiment the pharmaceutical composition, kit or vaccine of the present invention may be
administered in the context of an anti-cancer treatment, e.g. during, before or after chemotherapy or before tumors are detectable, i.e. in preventative anticancer approaches or via preventative anticancer vaccines.
In a further embodiment the pharmaceutical composition, kit or vaccine according to the present invention may be administered in combination with an elements, protein, peptide, composition, drug, small molecule etc., which leads to an increase of the expression of LRP 1. Alternatively, the pharmaceutical composition, kit or vaccine according to the present invention may comprise such elements, proteins, peptides, compositions, drugs, small molecules etc., which lead to an increase of the expression of LRP 1. Particularly preferred is the use or co-administration of transformed alpha2- macroglobulin (A2M*), which is known to lead to an increase of the expression of LRP 1, or the preparation of compositions, kits or vaccines according to the present invention which additionally comprise transformed alpha2-macroglobulin (A2M*). Elements, proteins, peptides, compositions, drugs, small molecules etc. which lead to an increase of the expression of LRP 1 may be used in any suitable form or concentration. Details on corresponding elements and/or techniques etc. may be derived, for example, from Calderwood et al, 2007, Methods, 43(3): 199-206. In a further preferred embodiment of the present invention a short splice variant LRP1- peptide or -protein as defined herein above, preferably a peptide or protein comprising or consisting of parts or the entire sequence of exon 7 of LRP 1, more preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 may be directly coupled to, combinded to or fused to alpha2-macroglobulin (A2M*). Alternatively, a short splice variant LRP 1 -peptide or -protein as defined herein above, preferably a peptide or protein comprising or consisting of parts or the entire sequence of exon 7 of LRP 1, more preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 may be directly coupled to, combinded to or fused to other elements, in particular peptides or proteins which lead to an increase of the expression of LRP 1.
In a further embodiment of the present invention a method is envisaged directed to the detection of variations in one or two copies of the LRP1 gene, wherein said variations are at positions being is in strong linkage disequilibrium (99.5%) with a SNP in a region comprising positions 55,825,400 to 55,829,950 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), preferably of a single nucleotide polymorphism at position 55,829,839 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). Such variations are preferably in a region comprising 3,000 bp upstream and downstream of positions
55,825,400 to 55,829,950 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009), more preferably in a region comprising 3,000 bp upstream and downstream of position 55,829,839 of human chromosome 12 (human genome assembly variant 53 (Ensembl) as of 18 March 2009). The method may be carried out in vivi, or in vitro, e.g. based on a sample, or may comprise steps carried out in vivo and steps carried out in vivo.
The term "linkage disequilibrium" refers to a situation in which some combinations of genetic markers occur more or less frequently in the population than would be expected from their distance apart. It implies that a group of markers has been inherited coordinately. It can result from reduced recombination in the region or from a founder effect, in which there has been insufficient time to reach equilibrium since one of the markers was introduced into the population. Variations at the SNP position indicated above may be identified and characterized according to any suitable method, including single-strand conformation polymorphism analysis, heteroduplex analysis by denaturing high-performance liquid chromatography (DHPLC) or direct DNA sequencing and computational methods. For instance, such a variation may be assayed using Allele Specific Amplification (ASA). For the process at least 3 primers are required. A common primer is used in reverse complement to the polymorphism being assayed. This common primer can be between 50 and 1500 bp from the polymorphic base. The other two (or more) primers are identical to each other except that the final 3 ' base wobbles to match one of the two (or more) alleles that make up the polymorphism. Two (or more) PCR reactions are then conducted on sample DNA, each using the common primer and one of the Allele Specific Primers. If sequence information is accessible in public databases, computational tools can be used to align independently submitted sequences for a given gene.
Particularly preferred are methods including hybridization, primer extension and cleavage methods. Each of these methods must be connected to an appropriate detection system. Detection technologies include fluorescent polarization, luminometric detection of pyrophosphate release (pyro sequencing), fluorescence resonance energy transfer (FRET)-based cleavage assays and mass spectrometry. Further preferred is the detection of the polymorphism by means of the INVADER™ technology (available from Third Wave Technologies Inc. Madison, WI). In this assay, a specific upstream "invader" oligonucleotide and a partially overlapping downstream probe together form a specific structure when bound to complementary DNA template. This structure is recognized and cut at a specific site by the Cleavase enzyme, resulting in the release of the 5' flap of the probe oligonucleotide. This fragment then serves as the "invader" oligonucleotide with respect to synthetic secondary targets and secondary fluorescently-labeled signal probes contained in the reaction mixture. This results in specific cleavage of the secondary signal probes by the Cleavase enzyme. Fluorescence signal is generated when this secondary probe, labeled with dye molecules capable of fluorescence resonance energy transfer, is cleaved. Cleavases have stringent requirements relative to the structure formed by the overlapping DNAsequences or flaps and can, therefore, be used to specifically detect single base pair mismatches immediately upstream of the cleavage site on the downstream DNA strand. Further details may be derived from Ryan et al, 1999, Molecular Diagnosis, Vol. 4, No 2: 135-144.
In a further embodiment the present invention relates to a kit for the detection of SNP variations, comprising a set of genotyping oligonucleotides as described hereina above, as well as additional components like polymerases, dNTPs, buffer, ions etc.
In a preferred embodiment of the present invention the cancer to be detected, diagnosed, prognosticated, monitored, treated, prevented etc. according to the herein above described aspects and embodiments of the present invention is breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma. Preferably, it is a brain tumor selected from the group of astrocytoma and glioma.
The following examples and figures are provided for illustrative purposes. It is thus understood that the example and figures are not to be construed as limiting. The skilled person in the art will clearly be able to envisage further modifications of the principles laid out herein.
EXAMPLES
Example 1 Peptide sequence, chemical synthesis and coupling to protein carriers cDNA and Peptide sequence
The peptide sequence of the marker was derived from the nucleotide sequence from the inclusion of the new last exon:
Marker Seq. corresponding to the new exon
The following marker sequence corresponding to the new exon was used:
CGC AGG AGC AGG AAG AGA GCC CAG GAG AAC GAG GTG ACA CAA CAC GGC TAA (SEQ ID NO: 1)
Marker Peptide
The following marker peptide was used:
R R S R K R A Q E N E V T Q H G C (SEQ ID NO: 10) An additional C-terminal cysteine (bold) residue was introduced to facilitate the coupling processes. This peptide was chemically synthesized, purified by HPLC and the mass was determined by Mass-Spectrometry (Maldi-TOF). The calculated mass was as 2055 Da which is close to the theoretical value Peptide conjugation
Covalent coupling of the peptide to carrier protein was accomplished by cross-linking using N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP) (Pierce, Bonn, Germany). Thus, 0.34 mg SPDP dissolved in ΙΟΟμΙ ethanol, was reacted with 5 mg keyhole hemocyanin (Sigma H8283, Lot 121K7405) or bovine serum albumin (Sigma ) in 2 ml 50 mM sodium phosphate buffer pH 7.0 at 20°C for 2 h followed by incubation at 4°c overnight. After dialysis against reaction buffer, 20 mg peptide was added. The reaction was monitored spectrophotometrically at 343 nm for 1 h. The calculated degree of substitution (ε = 8,08* 103 M_1cm_1 for release of mercaptopyridin) was 44 mol peptide/mol hemocyanine and 12 mol peptide/mole BSA, respectively. The conjugate was ultrafiltrated using a filter with a cutoff of 10.000 (Life Science) to remove unbound peptide.
Example 2
RT-PCR of marker transcript in tumor-derived cell lines and normal human tissues/organs
R A was isolated from normal human tissues/organs and tumor- derived cell lines, reverse transcribed and amplified using the following primers and conditions: Marker Transcript
Product size: amplicon size 447
Forward Primer: 5 -CCTGTGCTGTTGATAGCCAA (SEQ ID NO: 12)
Revers Primer: 5 '- GAGATGGCGGAGAGTCTGAG (SEQ ID NO: 13) Control Transcript (full length LRP1
PCR Product size: amplicon size 209 bp
Forward Primer: GCCGGAGTGGTATTCTGGTA (SEQ ID NO: 14)
Reverse Primer: TACACGGGGTTGGTGAAGTT (SEQ ID NO: 15) beta-Actin
PCR Product size: amplicon size 395 bp
Forward Primer: AGAAAATCTGGCACCACACC (SEQ ID NO: 35)
Reverse Primer: CTCCTTAATGTCACGCACGA (SEQ ID NO: 36)
The control transcript was obtained by RT-PCR from the consensus parental transcript (full length LRPl) coding for a receptor protein (consensus spliced form of the marker).
The transcript of beta-actin was used as positive and loading control.
PCR-Conditions:
The following PCR conditions were used: the PCR mix consisted of 2.5 μΐ 10 x puffer complete (Bioron, Ludwigshafen, Germany), 1.25 u DFS Taq DNA polymerase
(Bioron, Ludwigshafen, Germany), 0.25 mM dNTPs (Larova, Teltow, Germany), 1 μΐ cDNA and 0.4 μΜ of each primer. The reactions were run with the following parameters: denaturation for one cycle at 95°C for 1 min, 30 cycles of 95°C 30 s, 57°C 30 s and 72°C 30 s and as final step 72°C for 10 min.
RNA preparation
Total RNA was isolated from cell pellets or tissues using the TRIzol reagent (Sigma, Deisenhofen, Germany). The concentration of total RNA was determined by measuring the absorbance at 260 nm in a spectrophotometer.
Generation of cDNA
1 μg total RNA was denatured in 6.75 μΐ sterile nuclease free water at 70°C for 5 min before quenching on ice. Reverse transcription was performed by the addition of 2.5 μΐ 5x transcriptase buffer, 15 Units AMV reverse transcriptase (Promega, Mannheim, Germany), 20 U RNase inhibitor (RNasin, Promega), 8 μΜ oligo dT primer (Metabion, Martinsried, Germany) and 0.5 mM dNTPs (Larova, Teltow, Germany) in a final volume of 12.5 μΐ and incubated at 42°C for 60 min. The reaction was stopped by heating at 70°C for 10 min. 1 μΐ of each cDNA was used for PCR.
Agarose gel electrophoresis
PCR products were separated on a 2% agarose gel (SeaKem LE Agarose, Lonza, Rockland, USA) containing 500 μg/ml ethidium bromide. The gel was run at 100 V and visualised under UV light. DNA molecular standard was from Invitrogen (1 Kb Plus DNA Ladder Cat.No. 10787-018).
As can be derived from Fig. 1 and 2 the new tumor marker obtained by alternative splicing is present only in cancer cells, it is absent or below the detection limit in different non-cancerous organs investigated. This is in contrast to the unspliced parental transcript, which appears to be ubiquitary expressed.
Example 3
A. Detection of marker mRNA in normal human tissues
Commercial Tissue Panel Kits (Invitrogen) and tissues samples from surgery were screened for the presence of marker mRNA by RT-PCR. ^g cDNA was used for PCR reaction described in Example 2. beta-actin-RNA was used for calibration. The term "negative" as used in the table below means "below the detection limit" of the method applied.
The following tests were carried out:
RNA was prepared from tissue material as described above and first-strand cDNA was prepared by reverse transcription.
B. Detection of marker mRNA in human fetal tissue
The following tests were carried out:
The samples were provided by the Human fetal MTC Panel Test kit (Cat.No 636747; Clontech). The results in A and B show that (i) the marker is not expressed (below the detection limit) in all tissues investigated; (ii) no marker expression could be observed in fetal human tissues, indicating that the marker is not an oncofetal protein and (iii) no positive signal could be detected in normal peripheral mononucleated blood cells. C. Detection of marker mRNA in tumor cell lines
Commercially available tumor cell lines were screened for the presence of marker mRNA by RT-PCR. 1 μg cDNA was used for PCR reaction described above, beta-actin RNA was used for calibration. Relative expression is described as high (+++), medium (++) and low (+) according to the band appearance in agarose gel.
The following tests were carried out:
The above provided results show that the marker is expressed in all cell lines derived from epithelial precursor cells. No expression (below the detection limit) could be observed in tumors derived from blood cells.
Example 4
Immunogenicity of the peptide derived from the marker sequence The synthetic peptide described in Example 1 (SEQ ID NO: 10) was used for immunisation of rabbits for antibody production. After finishing the immunisation process, rabbit serum was obtained and the immunoglobulin fraction was prepared by protein- A-immunoabsorption according to known procedures. 96-well titer plates were coated with pure peptide (l(^g/ml) (see Fig. 3: 1, 4), peptide-BSA conjugate (40μg/ml) (see Fig. 3: 2) and as an antigenic control, female human serum
(10μg/ml) (see Fig. 3: 3) in coating buffer overnight (0.1 M sodium carbonate). The isolated rabbit Ig-fraction ^g/ml) was mixed with PBS-T buffer and added at the titer plate. A polyclonal anti-PSA-Ig (rabbit) antibody (irrelevant antibody) was used as antibody control (see Fig. 3: 4). After lh at 37°C the plate was washed and incubated with goat anti-rabbit Ig-HRP (1 : 1000)(1.5 h, 22°C). Finally, the reaction was visualized by incubation with H202 and DAB.
As can be derived from Fig. 3 the used marker peptide is immunogenic and elicits the production of polyclonal antibodies. The antibodies are specific as no reactivity with serum components is observed and irrelevant antibodies do not react with the peptide.
In an additional experiment a titer plate was coated with rabbit anti-peptide Ig (2μg/ml). Whole human serum (1 : 10 diluted) was incubated with peptide-BSA (100μg/ml), with BSA alone (100μg/ml) and loaded onto the titer plate (ΙΟΟμΙ each) and incubated for 1.5 h (lh, 37°). Plate was washed with washing buffer (PBS-T) and the cavities were incubated with rabbit anti-BSA Ig-HRP and developed as described above. The plate was recorded in a spectrophotometer at 492 nm.
The results are given in Fig. 4. Lanes 1 to 4 correspond to the following: 1 :
Peptide-BSA (10(^g/ml) in serum; 2: Serum alone; 3: Peptide-BSA in PBS-T
(10(^g/ml); 4: BSA in serum (10(^g/ml). All buffers contained Tween 20 (0.1%) to prevent nonspecific adsorption. As can be derived from Fig. 4 the used marker peptide (SEQ ID NO: 10) can be detected in whole human serum by ELISA without interference of serum proteins.
In a further approach the marker peptide was coated to keyhole hemocyanin and used for immunization of BALB/c mice according to standard procedures.
Spleen cells were fused with SP2/0 myeloma cells and antibody-producing cell clones were screened. Highly active clones were selected, propagated and monoclonal antibodies were prepared from their supernatant.
Titer plates were coated with the peptide (10μg/ml) (see Fig. 5: 1, 3, 4, 6) and peptide-BSA conjugate (40μg/ml) (see Fig. 5: 2, 5), incubated with different monoclonal antibodies (10μg/ml) or buffer (see Fig. 5: 3, 6) and anti-mouse-Ig-HRP (1 : 1000) as secondary antibody. The plate was recorded in a spectrophotometer at 492 run.
In lanes 1-2 of Fig. 5 the following is indicated: Clon 4/B 2A anti-peptide monoclonal antibody (10μg/ml); In lanes 4-5 of Fig. 5 the following is indicated: anti-peptide monoclonal antibody R4B6G5 (10μg/ml).
As can be derived from Fig. 5 the used marker peptide is immunogenic in mice, elicits monoclonal antibodies which are reactive with the peptide.
Furthermore, malignant cells were immunostained for analysing the marker sequence (SEQ ID NO: 10).
Fixed 1321N1 astrocytoma were stained with anti-peptide-monoclonal antibody R4B6G5 (^g/ml) in TBS-T, 5% BSA overnight. Cells were washed and incubated with goat anti-mouse Ig-Cy3 for 1.5h. Slides were analysed by means of a fluorescence microscope. The slide shows immunoreactivity in cytoplasma and cell membrane. Nuclei are counterstained with DAPI.
As can be derived from Fig. 6 polypeptide containing the marker peptide (SEQ ID NO: 10) shows a cytoplasmic localisation with accumulation in the plasma membrane of 132 IN 1 astrocytoma cells. The marker can thus be used to detect malignant transformation in cells of tissue sections
Example 5
Detection of cancerous metastatic cells in blood samples
In order to detect cancerous metastatic cells in blood samples 100.000 prostate carcinoma cells Du-145 are seeded in 5 ml normal heparinized human blood and mixed with 125μ1 antibody-coated Dynabeads™ (Dynabead Epithelial Enrich Kit Cat.No. 161- 02, Invitrogen, USA). The enriched cells are lysed with the lysis buffer supplied in the Dynabeads® mRNA DIRECT™ Micro Kit (Cat.No. 610-11; Invitrogen). mRNA is captured by Oligo (TT)- beads and reversed described. The cDNA loaded beads are used as templates for PCR. The samples are processed according to the manual of the manufacturer.
Detection of the marker is performed by PCR reaction followed by agarose gel electrophoresis. The PCR-product (447 bp) of the marker is recognized in Du-145 cancer cells, and whole blood sample mixed with cancer cells but is absent in the whole blood sample (not mixed with cancer cells) as well as in the water control. The size of the PCR products is compared against the 100 bp ladder.
This approach may provide the information that (i) seeding cancer cells can be detected in human whole blood by RT-PCR of the marker-RNA, and that (ii) normal blood cells do not interfere with marker detection. The presence of secondary leukemic tumor cells does not interfer the testing because the marker is not expressed in tumors derived from blood cells (see also Example 3, supra). Example 6
Evaluation of tissue penetration of a human glioma tumor The tissue penetration of a human glioma tumor was tested in an agarose gel electrophoresis approach for separation of marker PCR products.
Tumor material was obtained from a patient suffering from a glioma tumor. R A was prepared from tissue material obtained from the tumor center, margin and non-tumor neighborhood and analysed by RT-PCR of the marker, ^g cDNA was used for PCR reaction.
In lane 1 of Fig. 7 the following is indicated: 1321N1 astrocytoma cells. In lane 2 of Fig. 7 the following is indicated: a tissue sample prepared from the tumor margin. In lanes 3 of Fig. 7 the following is indicated: a tissue sample prepared from the tumor center. In lanes 4 of Fig. 7 the following is indicated: tissue sample prepared from non- tumor brain tissue.
As can be derived from Fig. 7 marker expression is lower at tumor margin and absent outside the tumor. Analysis of marker expression allows evaluation of tissue penetration of tumor cells.
Example 7
Evaluation of drugs affecting the expression of the marker
Drugs affecting the expression of the marker can be evaluated according to the following test:
Human astrocytoma cells (1321 Nl; ECACC no. 86030102) are cultured in DMEM (Gibco, No. 41966-092), 10% FCS, containing penicillin/streptomycin (100 units of penicillin/ml; 100 μg streptomycin/ml, Gibco; no. 15140/122) in the presence of 10%> fetal calf serum (Biochrom, SOI 13/5), 2 mM L-glutamine, (Gibco, No. 25030-024) at 37°C, 5% C02 in 70ml culture flasks up to 60 %. The supernatant is removed, cells are washed with PBS and incubated in culture medium without FCS for 24h. Afterward, the medium is replaced by fresh medium containing increasing concentrations of test substances (growth factors, cytokines, chemical drugs, plant extracts etc.) and the incubation is continued for further 24 h.
Cells are harvested by trypsination with trypsin/EDTA and pelleted after two washings with PBS. R A is extracted, reverse transcribed into cDNA according to standard protocols. cDNA is subjected to PCR using specific primers for the marker (arrow). PCR products are subsequently normalised to beta-actin.
The appearance or disappearance of the marker expression can be evaluated to show which substance may affect expression of the marker and may thus relate to transition of cells to various stages of differentiation.
Example 8 Elispot assay of human PBMC stimulated by the marker peptide
Furthermore, an Elispot assay of human PBMC (peripheral blood lymphocyte) stimulated by a peptide having the sequence of SEQ ID NO: 10 was performed to evaluate immune regulatory effects.
The assay was carried out for 24h according to MultiScreenHTS Filter Plate (Millipore, Billerica, MA, USA) technical notes for interferon gamma (IFN-gamma) ELISPOT (Millipore Corporation. IFN-gamma Elispot Assays on MultiScreen IP. A Publication of Technical Services. Lit.No.: TN1003EN00). Both IFN-gamma capture and detection antibody were purchased from Mabtech (Stockholm, Sweden). Perforin antibodies were provided by AID (Autoimmun Diagnostika, Strassberg, Germany). PBMCs from 3 healthy volunteers were resuspended in RPMI medium with 1% L- glutamine, HEPES and 10% fetal bovine serum (PAA Laboratories, Pasching,
Germany) and plated at 150 000 PBMCs/well in duplicate for increasing concentrations of the peptide (2.5 μg to 10 μg/ml) and controls (PBS resp. PMA(phorbol myristate acetate). ELISPOT plates were incubated at 37°C for 24 h in the presence of 5% C02. Plate analysis and enumeration of cell counts was done using an AID EliSpot 04 HR Reader and appropriate AID reader software, release 4.0 (AID).
As can be derived from Fig. 8A IFN-gamma could not be observed as indicator of a T cell directed immunogeneity. The peptide has a low capacity to induce an immune response directed to the peptide.
As can be derived from Fig. 8B, in NK cells and cytotoxic T cells a dose dependent stimulation of perforin secretion is induced. This could be connected with an anti-tumor activity of these cells.
Example 9
Protocols for the generation of LRPl primers
Primers for the LRP1 gene, sequence or transcripts thereof were designed according to the following indications:
1) Primers for portions of LRP 1 comprising exon 1 to exon 7
3) Primers for portions of LRP 1 comprising exon 3 to exon 7
Example 10
Design of shRNA-coding constructs against the LRP1 splice variant Short hairpin R A (shRNA) coding constructs were designed against the LRP 1 transcript variant of SEQ ID NO: 4. These constructs lead after the expression of the shRNA to RNA interference (see Paddison et al., 2002, Genes & Development; 16: 948-958). The constructs were generated with the help of online-tool
http://www.molgyn.kgu.de/genesilencer/genesilencer.html (see Kappel et al, 2007, Nature Protocols, 2(12):3257-69).
Accordingly, the coding sequence of alternative exon 7 (position 1314 to 1363 of SEQ ID NO: 4) was used as template for the algorithm. Due to the short template sequence only one potential specific 19 nt long target sequence (positions 1344 to 1363 of SEQ ID NO: 4) was identified:
CGAGGTGACACAACACGGCTAA (SEQ ID NO: 76)
For the expression as shRNA the identified siRNA sequence (sense) was combined via a loop sequence with the reverse complementary siRNA sequence (antisense). On the 5' and 3' termini specific restriction sites for endonucleases (BamHI and Hindlll) were added in order to allow directed cloning in an expression vector:
The expression of artificial shR A may be carried out with a HI- or an U6 promoter (both polymerase III) (Brummelkamp et al., 2002 Science,296: 550-553; Paddison et al., 2002, Genes & Development; 16: 948-958). A further siRNA against LRP 1 transcript variant of SEQ ID NO: 4 was designed, which comprises at position 10 of the siRNA (SEQ ID NO: 73) a different nucleotide, i.e. A was exchanged for T. This modification increases the incorporation of the antisense strand into the RISC complex. Furthermore, this modified siRNA avoids activation of intracellular signal pathways in reaction to double stranded RNAs (Cullen, 2006, Nature Methods ;3(9):677-81).

Claims

A nucleic acid molecule comprising an alternative exon of low density lipoprotein-related protein 1 (LRPl) or derivatives thereof, comprising a polynucleotide having a nucleotide sequence selected from the group consisting of:
(a) a polynucleotide having the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9;
(b) a polynucleotide fragment of SEQ ID NO: 1 , SEQ ID NO: 7,
SEQ ID NO: 8 or SEQ ID NO: 9;
(c) a polynucleotide encoding a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10;
(d) a polynucleotide encoding the polypeptide of SEQ ID NO: 2 or
SEQ ID NO: 10;
(e) a polynucleotide encoding a polypeptide domain of SEQ ID NO: 2 or SEQ ID NO: 10;
(f) a polynucleotide encoding a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10;
(g) a polynucleotide which is a variant of SEQ ID NO: 1 , SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9;
(h) a polynucleotide encoding a variant of SEQ ID NO: 2 or SEQ ID NO: 10;
(i) a polynucleotide which is an allelic variant of SEQ ID NO: 1 ,
SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9;
(j) a polynucleotide encoding an allelic variant of SEQ ID NO: 2 or SEQ ID NO: 10;
(k) a polynucleotide which is a species homologue of SEQ ID NO:
1, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9;
(1) a polynucleotide encoding a species homologue of SEQ ID
NO: 2 or SEQ ID NO: 10; (m) a polynucleotide which is at least 70%, 80%, 90% or 95 % identical to a polynucleotide as defined in any one of (a) to (1);
(n) a polynucleotide encoding a polypeptide having an amino acid sequence at least 70%, 80%, 90% or 95 % identical to the amino acid sequence of a polypeptide encoded by a polynucleotide of any one of (a) to (m); and
(o) a polynucleotide capable of hybridizing under stringent
conditions to any one of the polynucleotides specified in (a) to
(n);
or the complementary strand of polynucleotide (a) to (o).
The nucleic acid molecule of claim 1 , wherein the nucleotide sequence is fused at the 3 ' end or at the 5 ' end to the nucleotide sequence encoding wildtype LRP1 as set forth in SEQ ID NO: 3 or to fragments thereof, with the proviso that the nucleic acid sequence is not the sequence as set forth in SEQ ID NO: 4 or a sequence encoding the amino acid sequence of SEQ ID NO: 5.
The nucleic acid molecule of claim 1 or 2, wherein the nucleotide sequence is fused at the 3' end or at the 5' end to a heterologous nucleotide sequence.
A vector comprising the nucleic acid molecule of any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4.
A method of making a recombinant host cell, comprising introducing the nucleic acid molecule of any one of claims 1 to 3, or the vector of claim 4 into a host cell. A recombinant host cell containing the nucleic acid molecule of any one of claims 1 to 3 or the vector of claim 4 or produced according to the method of claim 5, preferably expressing a polypeptide encoded by the nucleic acid molecule of any one of claims 1 to 3.
A method of making a polypeptide encoded by the nucleic acid molecule of any one of claims 1 to 3 comprising:
(a) culturing the recombinant host cell of claim 6 under conditions such that said polypeptide is expressed; and
(b) recovering said polypeptide.
A polypeptide encoded by the nucleic acid molecule of any one of claims 1 to 3, or obtainable by the method of claim 7, with the proviso that the polypeptide has not the amino acid sequence of SEQ ID NO: 5.
A polypeptide encoded by an alternative exon of LRP1 or derivatives thereof, comprising a polypeptide selected from the group consisting of :
(a) a polypeptide of SEQ ID NO: 2 or SEQ ID NO: 10;
(b) a polypeptide fragment of SEQ ID NO: 2 or SEQ ID NO: 10;
(c) a polypeptide domain of SEQ ID NO: 2 or SEQ ID NO: 10;
(d) a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10;
(e) a polypeptide variant of SEQ ID NO: 2 or SEQ ID NO: 10;
(f) an allelic variant of SEQ ID NO: 2 or SEQ ID NO: 10;
(g) a species homologue of SEQ ID NO: 2 or SEQ ID NO: 10; and
(h) a polypeptide which is at least 70%, 80%, 90% or 95%
identical to a polypeptide as defined in any one of (a) to (g). The polypeptide of claim 9, wherein the amino acid sequence is fused at the N-terminus or at the C-terminus to the wildtype LRPl protein as set forth in SEQ ID NO: 6 or to fragments thereof, with the proviso that the amino acid sequence has not the sequence of SEQ ID NO: 5.
An antibody or fragment thereof, that specifically binds to the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5.
The antibody of claim 11 , which specifically binds to a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 or a polypeptide epitope of SEQ ID NO: 2 or SEQ ID NO: 10.
The antibody or fragment thereof of claim 11 or 12, which is a polyclonal antibody, a monoclonal antibody, a human antibody, a chimeric antibody, a humanized antibody, a whole immunoglobulin molecule, an scFv, a Fab fragment, a Fab' fragment, an F(ab')2, an Fv, a disulfide linked Fv, a diabody or a sc(Fv)2.
The antibody or fragment thereof of any one of claims 11 to 13, which is conjugated to a therapeutic or cytotoxic agent, labeled or biotinylated, preferably labeled with a radioactive label, an enzymatic label, a fluorescent label, a chemiluminescent label, or a bioluminescent label.
A cell that produces the antibody or fragment thereof of any one of claims 11 to 13.
16. A nucleic acid molecule encoding the antibody or fragment thereof of any one of claims 11 to 13. An antibody which has the antigen-specific binding characteristics of the R4B6G5 antibody produced by the hybridoma having DSMZ accession No. DSM ACC3000.
An antibody produced by the hybridoma having DSMZ accession No. DSM ACC3000.
An affinity ligand for an expression product which comprises a nucleotide sequence as defined in any one claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as defined in any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, preferably an oligonucleotide specific for the expression product, a probe specific for the expression product, an aptamer specific for the expression product or the polypeptide, a small molecule or peptido mimetic capable of specifically binding to the polypeptide or a non-coding RNA molecule specific for the expression product, preferably a miRNA molecule or a siRNA molecule.
An antagonist of an expression product which comprises a nucleotide sequence as defined in any one claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, wherein said antagonist comprises an antisense molecule against the nucleic acid molecule of any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, an aptamer specific for the expression product, or a non- coding RNA molecule specific for the expression product, preferably a catalytic RNA molecule, a miRNA molecule or a siRNA molecule.
21. An antagonist of the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, wherein said antagonist comprises a compound directly modulating the activity of said polypeptide, a dominant negative variant of said polypeptide, a molecule closely related to the natural ligand of said polypeptide, a polypeptide related to the LRP1 protein as set forth in SEQ ID NO: 6, an antibody as defined in any one of claims 11 to 14, 17 or 18, or a small molecule or peptidomimetic capable of specifically binding to the polypeptide.
22. The nucleic acid molecule comprising an alternative exon of LRP1 or derivatives thereof as defined in any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4 or the polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as defined in any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5 for use as a marker for cancer.
23. Use of the nucleic acid molecule comprising an alternative exon of
LRP1 or derivatives thereof as defined in any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4 or the polypeptide encoded by an alternative exon of LRP1 or derivatives thereof as defined in any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5 as a marker for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer.
24. A diagnostic composition comprising an affinity ligand for an
expression product which comprises a nucleotide sequence as defined in any one claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as defined in any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5.
A diagnostic composition for diagnosing, detecting, monitoring or prognosticating cancer or the progression of cancer, comprising an affinity ligand for an expression product which comprises a sequence as defined in any one claims 1 to 3 or comprises the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as defined in any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5.
A diagnostic kit for detecting, diagnosing, monitoring or
prognosticating cancer or the progression of cancer, comprising an affinity ligand for an expression product which comprises a nucleic acid molecule as defined in any one claims 1 to 3 or comprises the nucleotide sequence of SEQ ID NO: 4 or for a polypeptide as defined in any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5.
The diagnostic composition of claim 24 or 25, or the diagnostic kit of claim 26, wherein said affinity ligand is a set of oligonucleotides specific for the expression product, a probe specific for the expression product, an aptamer specific for the expression product or the polypeptide or an antibody as defined in any one of claims 11 to 14, 17 or 18.
The use of claim 23, wherein the diagnosing, detecting, monitoring or prognosticating is to be carried out on a sample obtained from an individual. A method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of determining the level of an expression product comprising a nucleic acid molecule as defined in any one claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4 or of a polypeptide as defined in any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5.
The method of claim 29, wherein the determining step is accomplished by the measurement of the nucleic acid level of an expression product comprising a nucleic acid molecule as defined in any one claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, or of the protein level or biological activity of a polypeptide as defined in any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5.
A method of detecting, diagnosing, monitoring or prognosticating cancer or the progression of cancer comprising the step of identifying a truncated LRP 1 expression product and/or a truncated LRP 1 polypeptide.
The method of claim 31, wherein said method additionally comprises the measurement of the nucleic acid level of said truncated LRP 1 expression product and/or the measurement of the protein level or biological activity of said truncated LRP 1 polypeptide. The method of claim 31 or 32, wherein said truncated LRP 1 expression product comprises a nucleic acid molecule as defined in any one of claims 1 to 3 or comprises the nucleotide sequence of SEQ ID NO: 4 and/or wherein said truncated LRP 1 polypeptide comprises a polypeptide as defined in any one of claims 8 to 10 or comprises the amino acid sequence of SEQ ID NO: 5.
The method of any one of claims 29 to 33, wherein the method is to be performed with a sample obtained from an individual.
The use of claim 28 or the method of claim 34, wherein said sample is a tissue sample, an urine sample, an urine sediment sample, a blood sample, a saliva sample, a semen sample, a sputum sample, a condensed respiration or exhalation sample, a sample derived from a biopsy or a sample comprising circulating tumor cells.
A method of identifying antagonists of the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, comprising the steps of:
(a) producing cells which express said polypeptide either as
secreted protein or on the cell membrane;
(b) contacting the polypeptide produced in step (a) with a test sample comprising a potential antagonist; and
(c) identifying an antagonist by observing binding and/or
inhibition of activity of said polypeptide.
A method of identifying antagonists of an expression product comprising a sequence as defined in any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, comprising the steps of:
(a) contacting a test sample comprising a potential antagonist with one or more cells expressing the sequence as defined in any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4 ;
(b) detecting the expression level(s) of said sequence; and
(c) identifying an antagonist by observing reduction of the
expression level of said sequence as compared to that detected in the absence of the potential antagonist.
38. An antagonist obtainable by the method of claim 36 or 37.
A method of identifying a binding partner to the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5 comprising:
(a) contacting the polypeptide of any one claims 8 to 10 or
comprising the amino acid sequence of SEQ ID NO: 5 with a potential binding partner; and
(b) determining whether a binding interaction between both
molecules takes place.
40. A binding partner to the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, obtainable by the method of claim 36. A method of making cytotoxic T lymphocytes (CTLs) specific for the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5.
A CTL specific for an antigen derived from a polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, or obtainable by the method of claim 41.
A pharmaceutical composition comprising the nucleic acid molecule of any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4., the vector of claim 4, the host cell of claim 6 or 7, the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, the antibody of any one of claims 11 to 14, 17 and 18, the antagonist of any one of claim 20, 21 or 38, the binding partner of claim 40 or the CTL of claim 42.
A pharmaceutical composition comprising the nucleic acid molecule of any one of claims 1 to 3 or or comprising the nucleotide sequence of SEQ ID NO: 4, the vector of claim 4, the host cell of claim 6 or 7, the polypeptide of any one of claims 8 to 10 or or comprising the amino acid sequence of SEQ ID NO: 5, the antibody of any one of claims 1 1 to 14, 17 and 18, the antagonist of any one of claim 20, 21 or 38, the binding partner of claim 40 or the CTL of claim 42 for the treatment or prevention of cancer.
A medical kit for the treatment or prevention of cancer, comprising at least one element selected from the group consisting of: the nucleic acid molecule of any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, the vector of claim 4, the host cell of claim 6 or 7, the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, the antibody of any one of claims 11 to 14, 17 and 18, the antagonist of any one of claims 20, 21 or 38, the binding partner of claim 40 and the CTL of claim 42.
A vaccine comprising the nucleic acid molecule of any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, the vector of claim 4, the host cell of claim 6 or 7, the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, the CTL of claim 42 or an anti-idiotypic antibody against the antibody of any one of claims 11 to 14, 17 and 18.
A vaccine comprising the nucleic acid molecule of any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, the vector of claim 4, the host cell of claim 6 or 7, the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, the CTL of claim 42 or an anti-idiotypic antibody against the antibody of any one of claims 11 to 14, 17 and 18 for the treatment or prevention of cancer.
A method of inducing an immune response against cancer in an individual comprising administering to said subject a therapeutically effective amount of the nucleic acid molecule of any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, the vector of claim 4, the host cell of claim 6 or 7 the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, the CTL of claim 42 or an anti- idiotypic antibody against the antibody of any one of claims 11 to 14, 17 and 18.
A method of treatment or prevention of cancer comprising
administering to an individual a therapeutically effective amount of the nucleic acid molecule of any one of claims 1 to 3 or comprising the nucleotide sequence of SEQ ID NO: 4, the vector of claim 4, the host cell of claim 6 or 7, the polypeptide of any one of claims 8 to 10 or comprising the amino acid sequence of SEQ ID NO: 5, the antibody of any one of claims 11 to 14, 17 and 18, the antagonist of claim 20, 21 or 38, the binding partner of claim 40, the CTL of claim 42 or the vaccine of claim 46or 47.
The nucleic acid molecule of claim 22, the use of any one of claims 22, 28 or 31, the diagnostic composition of claim 25 or 27, the diagnostic kit of claim 26 or 27, the method of any one of claims 29, 30, 32, 48 or 49, , the pharmaceutical composition of claim 44, the medical kit of claim 45, or the vaccine of claim 47, wherein said cancer is breast cancer, prostate cancer, ovarian cancer, renal cancer, lung cancer, pancreas cancer, urinary bladder cancer, uterus cancer, brain cancer, stomach cancer, colon cancer, melanoma or fibrosarcoma, preferably a brain tumor selected from the group of astrocytoma and glioma.
EP10766044A 2009-10-14 2010-10-14 A low density lipoprotein-related protein 1 splice variant as cancer marker Withdrawn EP2488548A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP10766044A EP2488548A1 (en) 2009-10-14 2010-10-14 A low density lipoprotein-related protein 1 splice variant as cancer marker

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP09173001 2009-10-14
PCT/EP2010/065417 WO2011054644A1 (en) 2009-10-14 2010-10-14 A low density lipoprotein-related protein 1 splice variant as cancer marker
EP10766044A EP2488548A1 (en) 2009-10-14 2010-10-14 A low density lipoprotein-related protein 1 splice variant as cancer marker

Publications (1)

Publication Number Publication Date
EP2488548A1 true EP2488548A1 (en) 2012-08-22

Family

ID=43085853

Family Applications (1)

Application Number Title Priority Date Filing Date
EP10766044A Withdrawn EP2488548A1 (en) 2009-10-14 2010-10-14 A low density lipoprotein-related protein 1 splice variant as cancer marker

Country Status (2)

Country Link
EP (1) EP2488548A1 (en)
WO (1) WO2011054644A1 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102011115480A1 (en) * 2011-10-06 2013-04-11 Biostep Gmbh Substrate useful for chemiluminescence detection using enhancers or enhanced chemiluminescence reactions on carriers, comprises luminophore luminol, where e.g. enhancer concentration is optimized with respect to luminol concentration
WO2016069578A1 (en) 2014-10-27 2016-05-06 Tensha Therapeutics, Inc. Bromodomain inhibitors
KR101952649B1 (en) * 2016-05-17 2019-02-27 울산대학교 산학협력단 Biomarker composition for diagnosing radiation resistant cancer or predicting prognosis of radiation therapy comprising LRP-1
WO2017200263A1 (en) * 2016-05-17 2017-11-23 울산대학교 산학협력단 Biomarker composition comprising lrp-1 as active ingredient, for diagnosis of radiation-resistant cancer or prediction of radiation therapy prognosis
CN110650751A (en) 2017-03-22 2020-01-03 儿童医学中心公司 LRP1 binding agents and uses thereof
AU2018240306A1 (en) * 2017-03-22 2019-10-10 Children's Medical Center Corporation PRSS2 inhibition

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8607679D0 (en) 1986-03-27 1986-04-30 Winter G P Recombinant dna product
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
JP3068180B2 (en) 1990-01-12 2000-07-24 アブジェニックス インコーポレイテッド Generation of heterologous antibodies
WO1992022324A1 (en) 1991-06-14 1992-12-23 Xoma Corporation Microbially-produced antibody fragments and their conjugates
ES2136092T3 (en) 1991-09-23 1999-11-16 Medical Res Council PROCEDURES FOR THE PRODUCTION OF HUMANIZED ANTIBODIES.
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US5925517A (en) 1993-11-12 1999-07-20 The Public Health Research Institute Of The City Of New York, Inc. Detectably labeled dual conformation oligonucleotide probes, assays and kits
WO1996034983A1 (en) 1995-05-05 1996-11-07 The Perkin-Elmer Corporation Methods and reagents for combined pcr amplification and hybridization probing assay
DE19932688B4 (en) 1999-07-13 2009-10-08 Scil Proteins Gmbh Design of beta-sheet proteins of gamma-II-crystalline antibody-like
AU2006304605A1 (en) * 2005-10-17 2007-04-26 Institute For Systems Biology Tissue-and serum-derived glycoproteins and methods of their use
WO2009026116A2 (en) * 2007-08-16 2009-02-26 Genizon Biosciences, Inc. Genemap of the human genes associated with longevity
EP2045266A1 (en) * 2007-10-02 2009-04-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for treating and diagnosing a cancer secreting cath-D or Alzheimer's disease.

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] 1 February 2003 (2003-02-01), "Homo sapiens low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor), mRNA (cDNA clone IMAGE:4859182), complete cds.", retrieved from EBI accession no. EM_HUM:BC045107 Database accession no. BC045107 *
DATABASE EMBL [online] 13 February 2010 (2010-02-13), "Transcriptome Microarray Technology and Methods of Using the Same.", retrieved from EBI accession no. EM_PAT:FU311672 Database accession no. FU311672 *
DATABASE EMBL [online] 21 May 2003 (2003-05-21), "Homo sapiens low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor), mRNA (cDNA clone IMAGE:6575284), complete cds.", retrieved from EBI accession no. EM_HUM:BC052593 Database accession no. BC052593 *
DATABASE EMBL [online] 27 March 2002 (2002-03-27), "UI-H-ED0-awx-i-02-0-UI.s1 NCI_CGAP_ED0 Homo sapiens cDNA clone IMAGE:5824969 3', mRNA sequence.", retrieved from EBI accession no. EM_EST:BM996932 Database accession no. BM996932 *
DATABASE EMBL [online] 3 June 2004 (2004-06-03), "Homo sapiens low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor), mRNA (cDNA clone IMAGE:6384902), complete cds.", retrieved from EBI accession no. EM_HUM:BC072015 Database accession no. BC072015 *
DATABASE GENESEQ [online] 24 January 2008 (2008-01-24), "Human tissue-derived serum glycoprotein SEQ ID NO:8721.", retrieved from EBI accession no. GSP:AJL93066 Database accession no. AJL93066 *
See also references of WO2011054644A1 *

Also Published As

Publication number Publication date
WO2011054644A1 (en) 2011-05-12

Similar Documents

Publication Publication Date Title
US10927169B2 (en) Treatment of fibrosis with Interleukin-11 receptor alpha antibody
EP1203239B1 (en) Use of a polypeptide for detecting a pathological condition associated with multiple sclerosis
JP6381519B2 (en) Methods for prognosis and treatment of cancer metastasis
JP6037593B2 (en) Identification of tumor-associated antigens for diagnosis and treatment
US20210189342A1 (en) Compositions and methods for modulating monocyte and macrophage inflammatory phenotypes and immunotherapy uses thereof
ES2397441T3 (en) Polynucleotide and polypeptide sequences involved in the bone remodeling process
JP2001510987A (en) Methods and compositions for inhibiting inflammation and angiogenesis comprising a mammalian CD97α subunit
EP2488548A1 (en) A low density lipoprotein-related protein 1 splice variant as cancer marker
JP5756014B2 (en) VHZ for cancer diagnosis and treatment
US20060078913A1 (en) Compositions, splice variants and methods relating to cancer specific genes and proteins
KR102720360B1 (en) Treatment of fibrosis
US20050142572A1 (en) Compositions, splice variants and methods relating to lung specific nucleic acids and proteins
FR2841787A1 (en) Detecting, preventing and treating degenerative, neurological and autoimmune diseases, particularly multiple sclerosis, using specified polypeptides or related nucleic acid or ligand

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20120508

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20140729

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20141209