EP2417252A1 - Novel yeast having increased content of sulfur-containing compound, screening method thereof, and culturing method thereof - Google Patents

Novel yeast having increased content of sulfur-containing compound, screening method thereof, and culturing method thereof

Info

Publication number
EP2417252A1
EP2417252A1 EP10708392A EP10708392A EP2417252A1 EP 2417252 A1 EP2417252 A1 EP 2417252A1 EP 10708392 A EP10708392 A EP 10708392A EP 10708392 A EP10708392 A EP 10708392A EP 2417252 A1 EP2417252 A1 EP 2417252A1
Authority
EP
European Patent Office
Prior art keywords
yeast
gene
strain
adenine
sulfur
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP10708392A
Other languages
German (de)
French (fr)
Inventor
Marina Gennadievna Tarutina
Tatjana Anatolievna Dutova
Hiroaki Nishiuchi
Sergey Pavlovich Sineoky
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ajinomoto Co Inc
Original Assignee
Ajinomoto Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ajinomoto Co Inc filed Critical Ajinomoto Co Inc
Publication of EP2417252A1 publication Critical patent/EP2417252A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/12Methionine; Cysteine; Cystine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • C12N1/18Baker's yeast; Brewer's yeast
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • C12N1/18Baker's yeast; Brewer's yeast
    • C12N1/185Saccharomyces isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1014Hydroxymethyl-, formyl-transferases (2.1.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1048Glycosyltransferases (2.4)
    • C12N9/1077Pentosyltransferases (2.4.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi
    • C12R2001/85Saccharomyces
    • C12R2001/865Saccharomyces cerevisiae

Definitions

  • the present invention relates to a yeast containing a sulfur-containing compound, a method of screening the yeast, and a method of culturing the yeast.
  • the yeast containing a sulfur-containing compound at a high content according to the present invention is useful in the fields of foods, drugs, chemical products, feed, and the like.
  • GSH glutathione
  • a GSH preparation is now classified as an antidote or an ophthalmic agent and applied for various kinds of addictions, a chronic hepatic disease, prevention of disorders due to side effects of anticancer agents and radiotherapy, a dermatosis, and a therapy for cataract or a corneal injury (Protein, Nucleic Acid and Enzyme 1988-7 Vol. 33 No. 9 ISSN003909450, extra edition "Epoch for research of glutathione" pi 626). [0003]
  • glutathione has been known as a substance which provides a rich taste to a food (Y.Ueda et al, Biosci. Biotech. Biochem., 61, 1977-1980 (1977)), and a yeast extract containing glutathione at a high content is used as a seasoning.
  • ⁇ -glutamylcysteine which is a dipeptide composed of glutamate and cysteine, is reported to be useful for food.
  • a yeast showing an adenine-auxotrophy has been known to develop red color
  • the mechanism of red coloration has been analyzed at gene level. That is, it is found that AIR or CAIR as an intermediate in the adenine biosynthesis, which is accumulated by a mutation of the ADE2 gene that encodes an enzyme catalyzing the sixth step of the purine biosynthesis and AIR intermediate) or the ADEl gene that encodes an enzyme catalyzing the seventh step of the purine biosynthesis and CAIR intermediate, binds to glutathione and is transferred to a vacuole, whereby a red color is developed (K.
  • An object of the present invention is to provide a yeast having an increased cellular content of a sulfur-containing compound, a method of screening the yeast efficiently, and a method of culturing the yeast while allowing the yeast to accumulate a sulfur-containing compound at a high content in the cells.
  • the inventors of the present invention have studied in detail on the report by Sharma et al. (Arch Microbiol (2003) 180:108-117), and had a hypothesis that because the adenine biosynthesis is involved in the ATP biosynthesis essential to organisms, in adenine-auxotrophic strains such as ADE2 gene- or ADEl gene-disrupted strain, the intermediate such as AIR or CAIR is accumulated sufficiently in the cells.
  • adenine-auxotrophic strains such as ADE2 gene- or ADEl gene-disrupted strain
  • the intermediate such as AIR or CAIR is accumulated sufficiently in the cells.
  • sulfur-containing compound is at least one compound selected from the group consisting of cysteine, ⁇ -glutamylcysteine, glutathione, and cystenylglycine.
  • Fig. 1 shows the time course change of the GSH content in Y-3256 strain.
  • Fig. 2 shows the scheme of constructing GSH2 gene disruption cassette.
  • the yeast used in the present invention is not particularly limited as long as the yeast shows selenic acid-sensitivity and develops a red color when it is cultured on a medium and thereby has an increased cellular content of a sulfur-containing compound.
  • Examples thereof include a yeast belonging to the genus Saccharomyces such as Saccharomyces cerevisiae, a yeast belonging to the genus Candida such as Candida utilis, a yeast belonging to the genus Pichia such as Pichia pastoris, and a yeast belonging to the genus Schizosaccharomyces such as Schizosaccharomyces pombe.
  • Saccharomyces cerevisiae and Candida utilis often used in the production of a sulfur-containing compound are preferred.
  • the yeast of the present invention may be a haploid, or may be diploid or more.
  • the medium to be used for the evaluation of red color development is not particularly limited as long as the medium is one in which the yeast can develop a red color when adenine in the yeast cells runs short.
  • Medium having adenine content of 25mg/L or less is exemplified, and specific examples thereof include YPD medium (Bacto-yeast extract 1%, Bacto-peptone 2% and glucose 2%: METHODS IN YEAST GENETICS 2000 Edition pl71 : ISBN 0-87969-588-9) and PGC medium (Casamine acid(vitamin free) 0.5%, Bacto-peptone 1% and glucose 2%).
  • PGC medium on which yeast can easily develops a red color with higher intensity by influence of a trace component, is preferred.
  • Yeast develops clearer red color when cadmium is added to a medium, and thus, cadmium is preferably added.
  • the medium is preferably supplemented with methionine.
  • An agar medium is preferably used rather than a liquid medium so that the strain forms red colony and red coloration can be evaluated based on the color of the colony.
  • the method to allow red color development is not particularly limited and specific examples thereof includes imparting adenine-auxotrophy and culturing on a minimum medium supplemented with methionine.
  • the phrase "showing an adenine-auxotrophy" means that the strain cannot form a colony on a solid medium which does not contain adenine or forms a small size colonies as Y-3219 strain on the medium.
  • a gene responsive for the adenine-auxotrophy may be or may not be specified, but it is preferable that a gene responsive for the adenine-auxotrophy is specified.
  • the gene responsive for the adenine-auxotrophy may be specified by analyzing the obtained adenine-auxotrophic strain with complementation analysis or sequence analysis.
  • the yeast of the present invention shows adenine-auxotrophy due to modification to inactivating at least one gene involved in adenine biosynthesis, such as ADE2 gene and ADEl gene, which directly influence on accumulation of intermediates including AIR and CAIR which binds to GSH.
  • the modification to inactivate a gene includes introduction of a mutation that eliminates the activity of the gene product into a gene and modification that eliminates the expression of the gene.
  • the phrase "subjected to a gene modification treatment” means that the nucleotide sequence of a parent strain is mutated.
  • Conventional mutation technology may be used and gene recombination technology may also be used.
  • Examples of conventional mutation technologies include a method of mutating a gene by irradiation with UV or a laser and a method using a mutagenizing agent such as EMS, MNNG, or DAPA (sodium 4-dimethylaminobenzene diazosulfonate).
  • a natural mutation which occurs while a microorganism is cultured, may also be included.
  • Adenine-auxotrophic strains can be obtained by mutating a yeast, and screening a strain which can grow in a medium containing adenine but cannot grow in a medium not containing adenine or grows poor in the medium. Further, a strain having a mutation in ADEl gene or ADE2 gene shows adenine-auxotrophy and develops a red color when it is cultured on a medium.
  • Modification with gene recombination technique includes a method of replacing a wild-type gene on a chromosome with a mutant-type gene (inactivated- or disrupted-type gene) by homologous recombination.
  • the above-mentioned gene substitution can be carried out as follows. That is, a yeast is transformed with a recombinant DNA containing a mutant ADEl gene to cause recombination between the mutant ADEl gene and a chromosomal ADEl gene. On this occasion, a marker gene inserted in the recombinant DNA depending on the characteristics such as auxotrophy of the host makes the manipulation easy. Furthermore, making the above-mentioned recombinant DNA linear, for example, by cleavage with a restriction enzyme and, in addition, removal of a replication control region that functions in yeasts from the recombinant DNA can efficiently give rise to a strain in which the recombinant DNA is integrated into the chromosome.
  • yeasts For the transformation of yeasts, those methods conventionally used in the transformation of yeasts, such as a protoplast method, a KU method, a KUR method, an electroporation method or the like can be employed.
  • the strain in which the recombinant DNA is integrated into the chromosome in the above-mentioned manner undergoes recombination between the mutant ADEl gene and the ADEl gene inherently existing on the chromosome, so that the two fusion genes, i.e., the wild type ADEl gene and the mutant ADEl gene, are inserted into the chromosome so that the other parts of the recombinant DNA (vector segment and marker gene) should be present between the two fusion genes.
  • one copy of the ADEl gene together with the vector segment (including also the marker gene) is removed from the chromosomal DNA by recombination of the two ADEl genes.
  • the wild type ADEl gene is left on the chromosomal DNA and the mutant ADEl gene is excised therefrom.
  • the mutant ADEl gene is left on the chromosomal DNA and the wild ADEl gene is excised.
  • the marker gene is removed so that the occurrence of a second recombination can be confirmed by phenotype corresponding to the marker gene.
  • the objected gene-substituted strain can be selected by amplifying the ADEl gene by a PCR method and examining its structure.
  • ADE4 or ADE8 gene is also mutated in the yeast of the present invention because the yeast having a mutation in ADE4 or ADE8 gene shows a normal white color, not a red color.
  • a strain having a mutation in ADE4 or ADE8 gene in addition to the ADEl gene or ADE2 gene can be obtained by, first, introducing a mutation into the ADEl gene or the ADE2 gene to select a strain having an increased content of a sulfur-containing compound based on the degree of the red color as an index, and then introducing a mutation into the ADE4 or ADE8 gene, thereby a white yeast containing the sulfur-containing compound at a high content can be obtained efficiently.
  • ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene may be genes of the same kind of yeast as the yeast to be modified.
  • ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene from Saccharomyces cerevisiae having the nucleotide sequence of SEQ ID NOS: 1, 3, 5 and 15, respectively may be used.
  • ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene are not limited to these genes as long as they have sufficient sequence homology enough to cause homologous recombination with the gene on the chromosome of the yeast to be modified.
  • ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene may be DNAs encoding amino acid sequences having sequence identity of not less than 80%, preferably not less than 90%, furthermore preferably not less than 95%, much more preferably not less than 98% to SEQ ID NO: 2, 4, 6 and 16, respectively.
  • ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene may be DNAs that hybridize with nucleotide sequence of SEQ ID NO: 1, 3, 5 and 15, respectively under stringent conditions. Stringent conditions are exemplified by the conditions wherein washing is performed once, preferably two or three times at a salt concentration corresponding to 0.1 xSSC, 0.1% SDS at 6O 0 C. [0020]
  • the phrase "having selenic acid-sensitivity" means that the yeast cannot form a colony on a medium containing seleic acid and methionine (e.g., a medium containing 5mM selenic acid and ImM methionine).
  • Selenic acid is a structural analogue of sulfuric acid and toxic to living body. Generally, uptake system of sulfuric acid is suppressed by organosulfur compounds such as methionine in yeast cells so that selenic acid is not taken up into cells and yeast can grow in the presence of selenic acid.
  • the selenic acid-sensitivity may be imparted by mutation treatment or by gene recombination.
  • selenic acid-sensitive strain may be obtained by mutating a yeast and screening a strain that cannot grow in a medium containing selenic acid and methionine.
  • selenic acid-sensitivity may also be imparted by gene recombination such as gene recombination to enhance the expression of MET25 gene that encodes O-acetylhomoserine sulfhydrylase as compared to a wild-type strain.
  • Expression of MET25 gene may be enhanced by increasing copy number of a MET25 gene with introduction of a plasmid carrying a MET25 gene or introduction of a MET25 gene into the chromosome of the yeast, or by replacing a promoter of MET25 gene with more potent promoter.
  • MET25 gene expression may also be enhanced by modifying a protein that regulates transcription of the MET25 gene.
  • the mechanism of the expression of the MET25 gene is considered as follows. That is, the MET4 gene product functions as a positive regulator for the expression of the MET25 gene.
  • the MET4 gene product forms a SCFMET30 complex together with the MET30 gene product and other several proteins, and the MET4 gene product is ubiquitinated and decomposed together with the MET30 gene product by a proteolytic system of 26S proteasome, thereby, the expression of the MET25 gene is suppressed.
  • a gene encoding MET4 in which serine at position 215 is replaced with proline and a gene encoding MET4 in which isoleucine at position 156 is replaced with serine are reported (Ohmura et al., FEBS Letters 387(1996) 179-183; JP10-33161A).
  • mutant MET30 gene that can enhance the expression of MET25 gene
  • genes encoding MET30 in which amino acid residues in WD40 repeat are mutated are reported.
  • a mutant MET30 gene encoding MET30 in which serine at position 569 is replaced with other amino acids such as phenylalanine is reported in JP2004-201677A.
  • MET25 gene, MET30 gene and MET4 gene may be genes of the same kind of yeast as the yeast to be modified.
  • MET25 gene, MET30 gene and MET4 from Saccharomyces cerevisiae having the nucleotide sequence of SEQ ID NOS: 9, 11, and 7, respectively may be used.
  • MET25 gene, MET30 gene and MET4 gene are not limited to these genes as long as MET25 gene encodes a protein having O-acetylhomoserine sulfhydrylase activity, and MET30 gene and MET4 gene encode a protein having the function of repressing the expression of MET25 gene.
  • MET25 gene, MET30 gene and MET4 gene may be DNAs encoding amino acid sequences having sequence identity of not less than 80%, preferably not less than 90%, furthermore preferably not less than 95%, much more preferably not less than 98% to SEQ ID NO: 10, 12 and 8, respectively.
  • MET25 gene, MET30 gene and MET4 gene may be DNAs that hybridize with nucleotide sequence of SEQ ID NO: 9, 11 and 7, respectively under stringent conditions. Stringent conditions are exemplified as described above. [0025]
  • the cellular content of the sulfur-containing compound in the yeast of the present invention is higher than a counterpart strain of the corresponding yeast which shows adenine-non-auxotrophy and selenic acid-sensitivity.
  • the sulfur-containing compound refers to a substance having -SH group in the chemical formula and may be a protein, a peptide, an amino acid, or another substance.
  • Metallothionein in which 30% of constituent amino acids is composed of cysteine residues is an example of the protein
  • glutathione, ⁇ -glutamylcysteine, and cysteinylglycine are examples of the peptide
  • cysteine is an example of as the amino acid
  • homocysteine is an example of the another substance, but the sulfur-containing compound is not limited thereto.
  • Glutathione, ⁇ -glutamylcysteine, and cysteine are preferable as sulfur-containing compounds because they are widely used in industries. [0026]
  • the yeast is further modified to enhance intracellular activity of glutathione synthetase and/or ⁇ -glutamylcysteine synthetase. Activities of these enzymes can be enhanced by increasing copy number of a gene(s) encoding these enzymes or replacing a promoter of the gene(s) with a more potent promoter.
  • Nucleotide sequence of ⁇ -glutamylcysteine synthetase gene derived from Saccharomyces cerevisiae and the nucleotide sequences of glutathione synthetase gene and ⁇ -glutamylcysteine synthetase gene derived from Candida utilis are shown in JP2005-073638.
  • the nucleotide sequence of glutathione synthetase gene derived from Saccharomyces cerevisiae and amino acid sequence encoded thereby are shown in SEQ ID NO: 13 and 14, respectively.
  • the yeast is further modified to decrease the intracellular activity of glutathione synthetase, and more preferable that the yeast is further modified to decrease the intracellular activity of glutathione synthetase and to enhance the intracellular activity of ⁇ -glutamylcysteine synthetase.
  • the glutathione synthetase activity can be decreased by disrupting a glutathione synthetase gene or introducing a mutation into a glutathione synthetase gene so that glutathione synthetase activity is decreased.
  • the mutation for decreasing glutathione synthetase activity is, for example, a mutation which replaces arginine at position 370 in amino acid sequence of SEQ ID: 14 with a termination codon.
  • the mutation may be a single mutation of (1) or (2) or any combination of (1) to (3), and preferably the combination of (1) and (3) or the combination of (2) and (3).
  • cysteine is formed by decomposition of ⁇ -glutamylcysteine
  • yeast having increased cellular content of cysteine can be obtained by heat-treatment of the yeast having increased cellular content of ⁇ -glutamylcysteine.
  • cysteinylglycine is accumulated as a sulfur-containing compound in cells of the yeast, it is preferable that the yeast is further modified to enhance the intracellular activity of ECM38 (Yeast. 2003 JuI 30;20(10):857-63).
  • a yeast having increased cellular content of sulfur-containing compound for example, glutathione and ⁇ -glutamylcysteine, can also be obtained by subjecting a yeast which shows rapamycin-resistance (WO2006/013736).
  • the above-mentioned yeast which shows adenine-auxotrophy and selenic acid-sensitivity can be made to contain more sulfur-containing compound by subjecting it to gene modification procedure, preferably, mutation treatment, then, spreading the modified yeast on a medium on which a yeast can turn red in case of adenine deficiency to form yeast colonies, and selecting a yeast colony which is redder as compared to before modification.
  • the medium to be used for the screening is not particularly limited as long as the medium is one in which the yeast can develop a red color when adenine in the yeast cells runs short.
  • Medium having adenine content of 25mg/L or less is exemplified, and specific examples thereof include YPD medium (Bacto-yeast extract 1%, Bacto-peptone 2% and glucose 2%: METHODS IN YEAST GENETICS 2000 Edition pl71: ISBN 0-87969-588-9) and PGC medium (Casamine acid(vitamin free) 0.5%, Bacto-peptone 1% and glucose 2%).
  • PGC medium on which yeast can easily develops a red color with higher intensity by influence of a trace component, is preferred.
  • Yeast develops clearer red color when cadmium is added to a medium, and thus, cadmium is preferably added.
  • An agar medium is preferably used rather than a liquid medium so that the strain is easily isolated to be used in the following steps.
  • the yeast is cultured on the medium at 20 to 3O 0 C for about one week.
  • a yeast having increased cellular content of sulfur-containing compound can also be obtained by subjecting a yeast which shows selenic acid-sensitivity to gene modification procedure, preferably, mutation treatment, then, spreading the modified yeast on a minimum medium supplemented with methionine to form yeast colonies, and selecting a yeast colony which is redder as compared to before modification.
  • a medium to be used for this screening method may be a methionine-containing medium which mimics adenine-auxotrophic conditions, preferably a minimal medium supplemented with methionine in absence of biotin, and a specific example thereof include min-met(+)-biotin(-) plate as described below.
  • Yeast having increased cellular content of a sulfur-containing compound can be produced by culturing the yeast of the present invention.
  • the yeast is cultured in a medium containing sufficient amount of adenine (adenine-rich condition) to proliferate the yeast and then cultured in a medium where adenine content is limited (adenine-poor condition) to increase the cellular content of the sulfur-containing compound.
  • adenine-rich condition adenine-rich condition
  • a medium where adenine content is limited adenine-poor condition
  • the "sufficient amount” can be determined, for example, by measuring experimentally an amount of adenine required to obtain a predetermined amount of cells, and calculating the amount of adenine required to obtain the desired amount of cells.
  • the "sufficient amount” may be not less than lOOmg/L.
  • the culture medium and culture conditions other than adenine amount can be appropriately selected based on conventional medium and conditions used for normal yeast culture. Necessary nutrients may optionally be added to the medium depending on the characteristics of the yeast to be used.
  • the yeast are cultured in a medium in which adenine amount is limited.
  • a medium in which adenine amount is limited.
  • a medium has an adenine content of 25mg/L or less.
  • Cellular content of sulfur-containing compound increases during the culture in the medium in which adenine amount is limited.
  • cultivation is terminated when the amount of accumulated sulfur-containing compound has reached a desired amount.
  • the cultivation time is 10 to 30 hours, preferably, 15 to 27 hours.
  • the obtained cultured cells or the fractionated product thereof contains sulfur-containing compounds.
  • the cultured cells may be a culture medium containing the yeast cells, or yeast cells collected from the culture medium.
  • a fractionated product containing sulfur-containing compounds may be cell homogenates or yeast extract.
  • Preparation of a yeast extract and the like may be performed in the same way as a conventional method for preparing a yeast extract.
  • the yeast extract may be obtained by treating the yeast cells with hot water, or by treating the yeast cells with enzyme digestion.
  • the sulfur-containing compounds can be isolated from the above-described yeast cells.
  • the sulfur-containing compounds as well as yeast cells or fractionated product thereof containing the sulfur-containing compounds can be used for producing foods, pharmaceuticals, chemical products, animal feeds, etc. Examples of foods include alcoholic beverages; bread foods; and fermented food flavoring materials. Foods can be produced by mixing the sulfur-containing compounds, the cultured cells or the fractionated product thereof with raw materials of the foods, and processing the mixture into foods.
  • a diploid strain of Saccharomyces cerevisiae was obtained by mating the haploid AJ 14819 strain that carries mutant MET30 gene (MAT alpha type) and the haploid AJ 14810 strain (MAT a type) .
  • the AJ 14819 strain which is a selenic acid-sensitive strain, was deposited at International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Tsukuba Central 6, 1-1, Higashi 1-chome, Tsukuba-shi, Ibaraki-ken 305-8566, Japan) on October 1, 2003 under the provisions of the Budapest Treaty and given an accession number of FERM BP-8502.
  • the AJ14810 strain was deposited at International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology on November 1, 2002 under the provisions of the Budapest Treaty and given an accession number of FERM BP-8229. Then, the diploid strain was made to form spores, and the following haploid strains were obtained by tetrad analysis.
  • the expression level of MET25 gene in the obtained 4 strains was evaluated. Based on the methods described in Example 1 of JP2004-201677, the expression level of MET25 gene in these strains was determined as follows. Each strain was inoculated into YPD medium (50 mL in 500 mL Scale Sakaguchi Flask) and cultivated at 3O 0 C with shaking. At the logarithmic growth phase, cells were collected from each strain and RNA was extracted from the cells, the expression of MET25 gene was quantified using ACTl gene as an internal standard. The quantification was performed with PCR5700 (Applied Biosystems) and TaqMan One-Step RT-PCR Kit (Applied Biosystems) .
  • ACT 1 -986T and MET25- 1077T were used as TaqMan Probes (Applied Biosystems)
  • ACT1-963F and ACT1-1039R JP2004-201677
  • MET25-1056F and MET25- 1134R JP2004-201677
  • VKPM National Collection of Industrial Microorganisms
  • the Y-3218 strain a strain having a mutation in ADEl gene, was treated with mutagen MNNG so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on PGC plate or YPD plate and cultured at 3O 0 C for about one week. Colonies that showed more intensive red color than Y-3218 strain were selected, and their GSH contents were compared with AJ 14889 strain (starting strain) and Y-3218 strain. That is, the selected strains as well as AJ14889 strain and Y-3218 strain were respectively inoculated into 5 mL of YPD liquid medium and cultured at 3O 0 C with shaking at 250 rpm for 24 hours.
  • the same kind of experiments was performed using the Y-3219 strain, a strain having a mutation in ADE2 gene, instead of Y-3218 strain.
  • the Y-3219 strain was treated with mutagen MNNG so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on PGC plate or YPD plate and cultured at 3O 0 C for about one week. Colonies that showed more intensive red color than Y-3219 strain were selected, and their GSH contents were compared with AJ14889 strain (starting strain) and Y-3219 strain.
  • the selected strains as well as AJ14889 strain and Y-3219 strain were respectively inoculated into 5 mL of YPD liquid medium and cultured at 3O 0 C with shaking at 250 rpm for 24 hours. Then, the obtained culture of each strain were inoculated into 50 mL of YPD liquid medium and cultured at 3O 0 C with shaking at 250 rpm for 24 hours.
  • GSH contents of each strain were measured according to a conventional procedure and as a result, it was found that the GSH content of Y-3219 strain was higher than that of AJ14889 strain (Table 2). It was also found that ten of the selected strains (total 118 strains) had higher GSH contents than Y-3219 strain (Table 2). [0041]
  • a color of wild type yeast strain is not red but white or cream yellow. So the inventors tried to isolate a strain which forms normal color colony from the obtained mutants with intensive red color.
  • the Y-3219 strain was treated with mutagen MNNG as the same way described in EXAMPLE 2 and the treated cells were spread on PGC plate or YPD plate to obtain a mutant with more intensive red color.
  • Y-3219-20 strain shown in Table 3 was obtained as the same way described in EXAMPLE2. Then Y-3219-20 strain was treated with mutagen MNNG so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on PGC plate and cultured at 3O 0 C for about one week.
  • the white colonies were genetically analyzed using tester strains. As a result, it was found that the Y-3219-20-52 strain which has decreased GSH content had lost adenine-auxotrophy. On the other hand, the Y-3219-20-56 strain which maintained high GSH content has a mutation in ADE4 gene in addition to a mutation in ADE2 gene; the Y-3219-20-53 has a mutation in ADE8 gene in addition to a mutation in ADE2 gene. From this result, it was found that an adenine auxotrophic strain which forms a red colony can be made to a strain which forms a normal white colony by mutating ADE4 gene or ADE8 gene. The Y-3219-20-56 strain was deposited at the Russian National Collection of Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Russia) on December 23,
  • Table 4 shows the time course of GSH content. [0047] Table 4
  • GSH content in the adenine auxotrophic Y-3256 strain is in inverse proportion to the adenine concentration in the medium. It should be noted that Y-3256 strain can grow in YPD medium with no adenine supplementation (Ade 0mg/L) because YPD medium contains a trace amount of adenine (adenine content of YPD medium was analyzed to be about 10mg/L) .
  • Y-3256 strain was cultivated in Jar fermentor and time course of GSH content in the Y-3256 strain was evaluated.
  • Cells of the strain was picked up from YPD agar medium and inoculated into three of 50 mL YPD liquid medium contained in 750 mL-scale conical flask, and cultivated at 3O 0 C with shaking at 250rpm for 20 hours.
  • the obtained seed culture 120 mL was inoculated into 1.2L of main culture medium (YPD medium) contained in 3L-scale Jar fermentor and cultivation was performed at 3O 0 C with shaking at 1 , 1 OOrpm.
  • the medium was aerated at 1/lwm, and pH was adjusted to be 6.0 with aqueous ammonia.
  • Feed medium was fed at 1.5 ml/hour within 0 to 24 hours, and then at 1.8 mL/hour.
  • the composition of the feed medium was glucose 60Og, Bacto-yeast extract 1Og, corn extract 1Og, Bacto-peptone 1Og, (NILO 2 SO 4 0.274g, KH 2 PO 4 0.1 Ig, KCl 0.732g, MgSO 4 0.466g, CuSO 4 0.0012g, ZnSO 4 0.014g, MnSO 4 0.00334g, NaMoO 4 0.00012g, KCl 0.002g, H 3 BO 3 0.00004g, CoSO 4 O.OOOlg, CaCl 2 0.28g, FeSO 4 0.2g, biotin 0.05mg, riboflavin 0.2mg, and thiamine 0.5mg per IL.
  • Fig 1 shows the time course of GSH content of Y-3256 strain.
  • homodiploid strain of Y-3219-20-53 strain was prepared. Experimental conditions were as follows. The Y-3219-20-53 strain was treated with mutagen MNNG so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on YPD agar medium so that 100 to 200 colonies should appear. After cultivation at 3O 0 C for five days, colonies were replicated to SD agar medium supplemented with adenine and YPD agar medium, and a strain which could grow on the YPD medium but could not grow on the SD medium supplemented with adenine was selected.
  • Auxotrophy other than adenine was determined and Y-3219-20-53-auxl strain and Y-3219-20-53-aux2 strain which had different auxotrophy with each other were obtained.
  • the Y-3219-20-53-auxl strain was streaked in a vertical line on SD agar medium supplemented with adenine
  • Y-3219-20-53-aux2 strain was streaked in a horizontal line on the same SD agar medium supplemented with adenine so that the vertical line and the horizontal line crossed at one point.
  • This SD agar medium supplemented with adenine was incubated at 3O 0 C for 20 days and a colony that appeared on the crossed point was selected.
  • adenine auxotrophic diploid strain D 1-3 was obtained.
  • the D 1-3 strain was deposited at the Russian National Collection of Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Russia) on December 23, 2008 under the provisions of the Budapest Treaty and given accession number of VKPM Y-3309.
  • VKPM Russian National Collection of Industrial Microorganisms
  • the D 1-3 strain was streaked on SD agar medium supplemented with adenine and cultivated at 3O 0 C for 5 days, colonies were formed, so that it was confirmed that auxotrophy other than adenine-auxotrophy was not imparted to the strain.
  • a diploid Dip strain was obtained as a control adenine non-auxotrophic strain by mating AJ14889 strain and AJ14890 strain.
  • the D 1-3 strain and the Dip strain were inoculated into 5 mL of YPD liquid medium contained in test tube and cultivated at 3O 0 C for 24 hours with shaking at 250rpm.
  • the obtained culture was inoculated into 50 mL of each of the medium shown in Table 5 and cultivation was performed at 3O 0 C for 24 hours with shaking at 250rpm.
  • GSH contents of each of the strains cultivated in each of the media was measured. The results are shown in Table 6. [0051] Table 5
  • GSH2 gene disruption cassette PCR was performed by using primers of SEQ ID NOS: 17-22 and genome DNA of S.
  • GSH2 ORF was amplified from the X2180-1B (S. cerevisiae wild type strain: Available from ATCC as an accession number ATCC204505) genomic DNA to obtain GSH2 -upstream fragment using GSH2-up-F primer (SEQ ID NO: 17) and GSH2-up-R primer (SEQ ID NO: 18).
  • GSH2-upstream fragment has Bpil restriction enzyme site sequence on its one terminal and has conl sequence for fusion PCR, which was described later, on its other terminal by the design of GSH2-up-F primer and GSH2-up-R primer.
  • about 300bp downstream region from GSH2 ORF was amplified from the X2180-1B S.
  • GSH2 -downstream fragment has con2 sequence for fusion PCR, which was described later, on its one terminal and has Bpil restriction enzyme site sequence on its other terminal by the design of GSH2-down-F primer and GSH2-down-R primer.
  • KanMX gene was PCR-amplified from the pFA6a-KanMX6 plasmid using Marker-F primer (SEQ ID NO: 21) and Marker-R primer (SEQ ID NO: 22).
  • This PCR-amplified KanMX gene fragment has conl sequence on its one terminal and con2 sequence on its other terminal for fusion PCR by the design of Marker-F primer and Marker-R primer.
  • These three PCR amplifications were performed at the following conditions.
  • PCR was performed by repeating a cycle of "94 0 C for 30 seconds, 5O 0 C for 30 seconds and 68 0 C for 3 minutes 30 times.
  • GSH2 gene disruption cassette by fusion PCR.
  • Fusion PCR was performed using GSH2-up-F primer and Marker-R primer as PCR primers and GSH2-upstream fragment and KanMX gene fragment as templates. Since GSH2-upstream fragment and KanMX gene fragment have the same conl sequence on their one terminal, GSH2-upstream fragment and KanMX gene fragment were ligated and GSH2-upstream-KanMX fragment was obtained by this fusion PCR. This fusion PCR was performed with the same mixture of DNA polymerases.
  • PCR was performed by repeating a cycle of "94 0 C for 30 seconds, 61 0 C for 30 seconds and 68 0 C for 4.5 minutes” 5 times, and then repeating a cycle of "94 0 C for 30 seconds, 5O 0 C for 30 seconds and 68 0 C for 4.5 minutes” 25 times. Then other fusion PCR was performed using GSH2-up-F primer and GSH2-down-R primer as PCR primers and GSH2-upstream-KanMX fragment and GSH2-downstream fragment as templates.
  • GSH2-upstream-KanMX fragment and GSH2-downstream fragment have the same con2 sequence on their one terminal, GSH2-upstream-KanMX fragment and GSH2-downstream fragment were ligated and GSH2 gene disruption cassette was obtained.
  • This fusion PCR was performed with the same mixture of DNA polymerases. PCR was performed by repeating a cycle of "94 0 C for 30 seconds, 61 0 C for 30 seconds and 68 0 C for 5.3 minutes" 5 times, and then repeating a cycle of "94 0 C for 30 seconds, 5O 0 C for 30 seconds and 68 0 C for 5.3 minutes" 25 times.
  • PCR primers were as follows. (1) GSH2-up-F, CCGAAGACCTTCGTTTGGTGTTATGGT (SEQ ID NO: 17)
  • the Y-3256 strain was transformed with the GSH2 disruption cassette to cause homologous recombination and the transformants were spread on YPD agar medium containing G418 (50 ⁇ . g/ml). Among the appeared colonies, N8 ⁇ GSH2 strain where GSH2 gene was disrupted was obtained.
  • YPD medium D-glucose 20g/L, Bact Peptone 20g/L, Yeast Extract 10g/L
  • ⁇ -glutamylcysteine concentration was measured according to a conventional method. Table 7 shows the time course of ⁇ -glutamylcysteine content. It was found that ⁇ -glutamylcysteine content could be enhanced by imparting adenine-auxotrophy. [0059] Table 7
  • Example 8 Evaluation on a medium which mimics adenine-auxotrophic conditions
  • AJ 14889 strain was treated with mutagen MNNG so that survival rate became about 10%, and the treated cells were spread on min-met(+)-biotin(-) agar plate which contains the components shown in Table 8 and methionine at 150mg/L so that not more than 350 colonies should appear. After cultivation at 3O 0 C for eight to ten days, 106 colonies that colored light pink to red were picked up among colonies appeared on 30 plates.
  • intracellular GSH content of the selected strains and AJ 14889 strain was measured by culturing them in YPD medium. That is, the selected strains as well as AJ14889 strain that had been cultured on YPD plate were respectively inoculated into 5 mL of YPD liquid medium contained in a test tube and cultured at 30 0 C with shaking at 250 rpm for 24 hours. Then, the obtained culture of each strain were inoculated into 50 mL of YPD liquid medium contained in 750ml-volume conical flask so that absorbance at 600nm became 0.1 and cultured at 3O 0 C with shaking at 250 rpm for 24 and 48 hours, respectively.
  • 89-6 strain, 89-28 strain and 89-31 strain were selected among the eight strains and their growth and GSH content were compared together with AJ 14889 strain. These strains were cultured as described above except that cells were inoculated so that absorbance at 600nm became 0.3. The growth was measured based on the change in dry cell weight (DCW). As shown in Table 10, the three strains showed almost the same growth as AJ 14889 strain and higher GSH content than AJ14889 strain at 24 and 48 hours. [0064] Table 10
  • the three strains and AJ 14889 strain were inoculated into SD medium and their growth was evaluated. Specifically, the strains that had been cultured on YPD plate were respectively inoculated into 5 mL of SD medium contained in a test tube and cultured at 3O 0 C with shaking at 250 rpm for 24 and 48 hours, respectively. As a result, it was found that the growth of the three strains were almost the same as AJ14889 strain on SD medium (Table 11), which indicated that unexpected nutrient-auxotrophic property was not imparted to these three strains.
  • an adenine-auxotrophic yeast having an increased content of a sulfur-containing compound in the cells a method of screening the yeast, and a method of culturing the yeast are provided.
  • the present invention can be used widely in fields of food, drugs, chemical products, animal feeds, and the like.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A yeast having increased cellular content of sulfur-containing compounds such as γ-glutamylcysteine and glutathione can be obtained by combining selenic acid sensitivity and the property of red color development. The method to allow red color development includes imparting adenine-auxotrophy and culturing on a minimum medium supplemented with methionine.

Description

DESCRIPTION
NOVEL YEAST HAVING INCREASED CONTENT OF SULFUR-CONTAINING COMPOUND, SCREENING METHOD THEREOF, AND CULTURING METHOD THEREOF
[Technical Field] [0001]
The present invention relates to a yeast containing a sulfur-containing compound, a method of screening the yeast, and a method of culturing the yeast. The yeast containing a sulfur-containing compound at a high content according to the present invention is useful in the fields of foods, drugs, chemical products, feed, and the like. [Background Art] [0002]
So far, sulfur-containing compounds are widely used in the fields of foods, drugs, chemical products, and the like. For example, glutathione (GSH), which is a tripepetide composed of glutamate, cysteine, and glycine, has been known to have a pharmaceutical effect. A GSH preparation is now classified as an antidote or an ophthalmic agent and applied for various kinds of addictions, a chronic hepatic disease, prevention of disorders due to side effects of anticancer agents and radiotherapy, a dermatosis, and a therapy for cataract or a corneal injury (Protein, Nucleic Acid and Enzyme 1988-7 Vol. 33 No. 9 ISSN003909450, extra edition "Epoch for research of glutathione" pi 626). [0003]
On the other hand, glutathione has been known as a substance which provides a rich taste to a food (Y.Ueda et al, Biosci. Biotech. Biochem., 61, 1977-1980 (1977)), and a yeast extract containing glutathione at a high content is used as a seasoning. In addition, γ-glutamylcysteine, which is a dipeptide composed of glutamate and cysteine, is reported to be useful for food. [0004]
As described above, sulfur-containing compounds have wide industrial utility, and hence various studies on obtaining a microorganism which produces the compounds efficiently. For example, there have been reports that disclose a method comprising estimating a target enzyme in the biosynthetic pathway of a sulfur-containing compound and increasing the content of the sulfur-containing compound in cells by modifying its function. For example, it is reported that the content of glutathione in the cells increases by introducing, into a yeast, a γ-glutamylcysteine synthase gene of E. coli (Yasuyuki OHTAKE et al, Agric. Biol. Chem., 52(11), 2753-2762, 1988) or a glutathione synthase gene of E. coli (Yasuyuki OHTAKΕ et al, Journal of FERMENTATION AND BIOENGINEERTNG, Vol. 68, No. 6, 390-394, 1989). [0005]
There is also reported a method of increasing the content of glutathione by introducing an enzyme involved in the glutathione synthesis into a yeast (JP 61-52299 A, JP 62-275685 A, JP 63-129985 A, and JP 04-179484 A). [0006]
There have also been reported methods of screening a microorganism having an increased cellular content of a sulfur-containing compound comprising mutating a microorganism, and spreading the mutated strains on a medium containing various kinds of agents; and selecting a strain capable of growing on the medium (drug-resistant strain) or a strain incapable of growing on the medium (drug-sensitive strain) with a replica method. For example, there are reported a method comprising mutating a yeast belonging to Candida and screening a strain capable of growing in a medium containing ethionine and sulfite (JP 59-151894 A, JP 03-18872 A, and JP 10-191963 A) and a method comprising mutating a yeast belonging to Saccharomyces and screening a strain having enhanced zinc resistance (JP 02-295480 A). In addition to these methods, various agents have been studied to increase cellular content of sulfur-containing compounds (JP 06-70752 A and JP 08-70884 A). [0007]
Furthermore, recently, it has been reported that strains of Saccharomyces cerevisiae containing 5 wt% or more of glutathione in the cells were obtained by random mutation (JP 2004-180509 A). In this document, the contents of glutathione in the mutants were measured one by one to obtain strains producing glutathione at high content. Although the document said that the method enabled rapid evaluation of a large number of strains, when the method described in the document was studied by the inventor of the present invention, the number of strains that one person can evaluate per day was found to be about 100 strains at most. Therefore, it is evident that the operations disclosed in the document are very complex and need high cost and long time.
[0008]
By the way, a yeast showing an adenine-auxotrophy, particularly a yeast having a mutation in ADEl gene or ADE2 gene, has been known to develop red color, hi recent years, the mechanism of red coloration has been analyzed at gene level. That is, it is found that AIR or CAIR as an intermediate in the adenine biosynthesis, which is accumulated by a mutation of the ADE2 gene that encodes an enzyme catalyzing the sixth step of the purine biosynthesis and AIR intermediate) or the ADEl gene that encodes an enzyme catalyzing the seventh step of the purine biosynthesis and CAIR intermediate, binds to glutathione and is transferred to a vacuole, whereby a red color is developed (K. G Sharma et al, Arch Microbiol (2003) 180:108-117). However, this document reported that when GSH 1 gene encoding a rate-limiting enzyme in GSH biosynthesis was overexpressed, there was no change in red color level. Thus, one of ordinal skill in the art could not have such an idea that the adenine-auxotrophy is used for screening of a yeast containing GSH at high content. [0009]
SUMMARY OF INVENTION
An object of the present invention is to provide a yeast having an increased cellular content of a sulfur-containing compound, a method of screening the yeast efficiently, and a method of culturing the yeast while allowing the yeast to accumulate a sulfur-containing compound at a high content in the cells. [0010]
The inventors of the present invention have studied in detail on the report by Sharma et al. (Arch Microbiol (2003) 180:108-117), and had a hypothesis that because the adenine biosynthesis is involved in the ATP biosynthesis essential to organisms, in adenine-auxotrophic strains such as ADE2 gene- or ADEl gene-disrupted strain, the intermediate such as AIR or CAIR is accumulated sufficiently in the cells. The inventors considered that, if the hypothesis is correct, the cellular content of the glutathione controls development of red color of the yeast, and a yeast which develops a red color with higher intensity might have higher content of glutathione. As a result of extensive studies, unlike assumption of Sharma et al., the inventors found that a yeast containing glutathione at a high content can be screened by using the red color as an index, and found that cellular content of sulfur-containing compound including glutathione can be increased by combining selenic acid-sensitivity and the property of red color development due to imparting adenine-auxotrophy or culturing on a minimum medium supplemented with methionine, thereby completed the present invention. [0011]
It is one aspect of the present invention to provide a yeast which has increased cellular content of a sulfur-containing compound, wherein said yeast shows selenic acid-sensitivity and develops a red color when it is cultured on a medium.
It is another aspect of the present invention to provide the yeast as described above, wherein said medium contains methionine.
It is another aspect of the present invention to provide the yeast as described above, wherein said yeast develops a red color by imparting adenine-auxotrophy.
It is another aspect of the present invention to provide the yeast as described above, wherein said adenine-auxotrophy is imparted by modification of ADEl gene or ADE2 gene.
It is another aspect of the present invention to provide the yeast as described above, wherein said yeast further has a mutation in ADE4 gene or ADE8 gene, and thereby develops white color when it is cultured on the medium.
It is another aspect of the present invention to provide the yeast as described above, wherein said selenic acid-sensitivity is imparted by the modification to enhance the expression of MET25 gene.
It is another aspect of the present invention to provide the yeast as described above, wherein said sulfur-containing compound is at least one compound selected from the group consisting of cysteine, γ-glutamylcysteine, glutathione, and cystenylglycine.
It is another aspect of the present invention to provide a method for culturing the yeast as described above, comprising culturing said yeast under an adenine-rich condition to increase yeast cells, and then culturing said yeast under an adenine-poor condition to increase cellular content of the sulfur-containing compound.
It is another aspect of the present invention to provide a method of screening a yeast having increased cellular content of a sulfur-containing compound, comprising subjecting a yeast which shows adenine-auxotrophy and selenic acid-sensitivity to gene modification treatment, spreading the modified yeast on a medium on which a yeast can turn red in case of adenine deficiency to form yeast colonies, and selecting a yeast colony which is redder as compared to before modification.
It is another aspect of the present invention to provide a method of screening a yeast having increased cellular content of a sulfur-containing compound, comprising subjecting a yeast which shows selenic acid-sensitivity to gene modification treatment, spreading the modified yeast on a minimum medium supplemented with methionine to form yeast colonies, and selecting a yeast colony which is redder as compared to before modification.
It is another aspect of the present invention to provide the method as described above, wherein said sulfur-containing compound is at least one compound selected from the group consisting of cysteine, γ-glutamylcysteine, glutathione, and cystenylglycine. [0012]
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows the time course change of the GSH content in Y-3256 strain. Fig. 2 shows the scheme of constructing GSH2 gene disruption cassette. [0013] Description of the preferred embodiments
The yeast used in the present invention is not particularly limited as long as the yeast shows selenic acid-sensitivity and develops a red color when it is cultured on a medium and thereby has an increased cellular content of a sulfur-containing compound. Examples thereof include a yeast belonging to the genus Saccharomyces such as Saccharomyces cerevisiae, a yeast belonging to the genus Candida such as Candida utilis, a yeast belonging to the genus Pichia such as Pichia pastoris, and a yeast belonging to the genus Schizosaccharomyces such as Schizosaccharomyces pombe. Among them, Saccharomyces cerevisiae and Candida utilis often used in the production of a sulfur-containing compound are preferred. The yeast of the present invention may be a haploid, or may be diploid or more.
The medium to be used for the evaluation of red color development is not particularly limited as long as the medium is one in which the yeast can develop a red color when adenine in the yeast cells runs short. Medium having adenine content of 25mg/L or less is exemplified, and specific examples thereof include YPD medium (Bacto-yeast extract 1%, Bacto-peptone 2% and glucose 2%: METHODS IN YEAST GENETICS 2000 Edition pl71 : ISBN 0-87969-588-9) and PGC medium (Casamine acid(vitamin free) 0.5%, Bacto-peptone 1% and glucose 2%). PGC medium, on which yeast can easily develops a red color with higher intensity by influence of a trace component, is preferred. Yeast develops clearer red color when cadmium is added to a medium, and thus, cadmium is preferably added. The medium is preferably supplemented with methionine. An agar medium is preferably used rather than a liquid medium so that the strain forms red colony and red coloration can be evaluated based on the color of the colony. The method to allow red color development is not particularly limited and specific examples thereof includes imparting adenine-auxotrophy and culturing on a minimum medium supplemented with methionine. [0014]
In the present invention, the phrase "showing an adenine-auxotrophy" means that the strain cannot form a colony on a solid medium which does not contain adenine or forms a small size colonies as Y-3219 strain on the medium. A gene responsive for the adenine-auxotrophy may be or may not be specified, but it is preferable that a gene responsive for the adenine-auxotrophy is specified. The gene responsive for the adenine-auxotrophy may be specified by analyzing the obtained adenine-auxotrophic strain with complementation analysis or sequence analysis. Preferably, the yeast of the present invention shows adenine-auxotrophy due to modification to inactivating at least one gene involved in adenine biosynthesis, such as ADE2 gene and ADEl gene, which directly influence on accumulation of intermediates including AIR and CAIR which binds to GSH. In the present invention, the modification to inactivate a gene includes introduction of a mutation that eliminates the activity of the gene product into a gene and modification that eliminates the expression of the gene. [0015]
In the present invention, the phrase "subjected to a gene modification treatment" means that the nucleotide sequence of a parent strain is mutated. Conventional mutation technology may be used and gene recombination technology may also be used. Examples of conventional mutation technologies include a method of mutating a gene by irradiation with UV or a laser and a method using a mutagenizing agent such as EMS, MNNG, or DAPA (sodium 4-dimethylaminobenzene diazosulfonate). In addition, a natural mutation, which occurs while a microorganism is cultured, may also be included. Adenine-auxotrophic strains can be obtained by mutating a yeast, and screening a strain which can grow in a medium containing adenine but cannot grow in a medium not containing adenine or grows poor in the medium. Further, a strain having a mutation in ADEl gene or ADE2 gene shows adenine-auxotrophy and develops a red color when it is cultured on a medium. [0016]
Modification with gene recombination technique includes a method of replacing a wild-type gene on a chromosome with a mutant-type gene (inactivated- or disrupted-type gene) by homologous recombination. [0017]
The above-mentioned gene substitution can be carried out as follows. That is, a yeast is transformed with a recombinant DNA containing a mutant ADEl gene to cause recombination between the mutant ADEl gene and a chromosomal ADEl gene. On this occasion, a marker gene inserted in the recombinant DNA depending on the characteristics such as auxotrophy of the host makes the manipulation easy. Furthermore, making the above-mentioned recombinant DNA linear, for example, by cleavage with a restriction enzyme and, in addition, removal of a replication control region that functions in yeasts from the recombinant DNA can efficiently give rise to a strain in which the recombinant DNA is integrated into the chromosome.
For the transformation of yeasts, those methods conventionally used in the transformation of yeasts, such as a protoplast method, a KU method, a KUR method, an electroporation method or the like can be employed. The strain in which the recombinant DNA is integrated into the chromosome in the above-mentioned manner undergoes recombination between the mutant ADEl gene and the ADEl gene inherently existing on the chromosome, so that the two fusion genes, i.e., the wild type ADEl gene and the mutant ADEl gene, are inserted into the chromosome so that the other parts of the recombinant DNA (vector segment and marker gene) should be present between the two fusion genes. Next, to leave only the mutant ADEl gene on the chromosomal DNA, one copy of the ADEl gene together with the vector segment (including also the marker gene) is removed from the chromosomal DNA by recombination of the two ADEl genes. On this occasion, there are two cases. In one case, the wild type ADEl gene is left on the chromosomal DNA and the mutant ADEl gene is excised therefrom. In another case, on the contrary, the mutant ADEl gene is left on the chromosomal DNA and the wild ADEl gene is excised. In both cases, the marker gene is removed so that the occurrence of a second recombination can be confirmed by phenotype corresponding to the marker gene. The objected gene-substituted strain can be selected by amplifying the ADEl gene by a PCR method and examining its structure.
Although the gene substitution are explained by referring to ADEl gene, other genes including ADE2 gene may also be modified in the same way. [0018]
It is preferable that ADE4 or ADE8 gene is also mutated in the yeast of the present invention because the yeast having a mutation in ADE4 or ADE8 gene shows a normal white color, not a red color. A strain having a mutation in ADE4 or ADE8 gene in addition to the ADEl gene or ADE2 gene can be obtained by, first, introducing a mutation into the ADEl gene or the ADE2 gene to select a strain having an increased content of a sulfur-containing compound based on the degree of the red color as an index, and then introducing a mutation into the ADE4 or ADE8 gene, thereby a white yeast containing the sulfur-containing compound at a high content can be obtained efficiently.
Introduction of a mutation into the ADE4 or ADE8 gene can be performed in the same manner as the ADEl gene and ADE2 gene described above. [0019]
ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene may be genes of the same kind of yeast as the yeast to be modified. For example, ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene from Saccharomyces cerevisiae having the nucleotide sequence of SEQ ID NOS: 1, 3, 5 and 15, respectively may be used. ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene are not limited to these genes as long as they have sufficient sequence homology enough to cause homologous recombination with the gene on the chromosome of the yeast to be modified. Therefore, ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene may be DNAs encoding amino acid sequences having sequence identity of not less than 80%, preferably not less than 90%, furthermore preferably not less than 95%, much more preferably not less than 98% to SEQ ID NO: 2, 4, 6 and 16, respectively. ADEl gene, ADE2 gene, ADE4 gene and ADE8 gene may be DNAs that hybridize with nucleotide sequence of SEQ ID NO: 1, 3, 5 and 15, respectively under stringent conditions. Stringent conditions are exemplified by the conditions wherein washing is performed once, preferably two or three times at a salt concentration corresponding to 0.1 xSSC, 0.1% SDS at 6O0C. [0020]
In the present invention, the phrase "having selenic acid-sensitivity" means that the yeast cannot form a colony on a medium containing seleic acid and methionine (e.g., a medium containing 5mM selenic acid and ImM methionine). Selenic acid is a structural analogue of sulfuric acid and toxic to living body. Generally, uptake system of sulfuric acid is suppressed by organosulfur compounds such as methionine in yeast cells so that selenic acid is not taken up into cells and yeast can grow in the presence of selenic acid. On the other hand, in a selenic acid-sensitive strain, uptake system of sulfuric acid is not suppressed by organosulfur compounds and selenic acid is taken up into cells. Since uptake system of sulfuric acid is not suppressed, production of sulfur-containing compounds is enhanced in a selenic acid-sensitive strain as compared to a wild-type strain (MOLLECULAR AND CELLUAR BIOLOGY Dec, 1995, p6526-6534). [0021]
The selenic acid-sensitivity may be imparted by mutation treatment or by gene recombination. For example, selenic acid-sensitive strain may be obtained by mutating a yeast and screening a strain that cannot grow in a medium containing selenic acid and methionine. [0022]
On the other hand, selenic acid-sensitivity may also be imparted by gene recombination such as gene recombination to enhance the expression of MET25 gene that encodes O-acetylhomoserine sulfhydrylase as compared to a wild-type strain. Expression of MET25 gene may be enhanced by increasing copy number of a MET25 gene with introduction of a plasmid carrying a MET25 gene or introduction of a MET25 gene into the chromosome of the yeast, or by replacing a promoter of MET25 gene with more potent promoter. [0023]
MET25 gene expression may also be enhanced by modifying a protein that regulates transcription of the MET25 gene. The mechanism of the expression of the MET25 gene is considered as follows. That is, the MET4 gene product functions as a positive regulator for the expression of the MET25 gene. In general, the MET4 gene product forms a SCFMET30 complex together with the MET30 gene product and other several proteins, and the MET4 gene product is ubiquitinated and decomposed together with the MET30 gene product by a proteolytic system of 26S proteasome, thereby, the expression of the MET25 gene is suppressed. On the other hand, when the function of the SCFMET30 complex is deteriorated, the MET4 gene product and the MET30 gene product are not decomposed and the MET25 gene is expressed (Patton et al., Genes Dev. 12: 692-705, 1998 and Rouillon et al., EMBO Journal 19: 282-294, 2000). Therefore, expression of the MET25 gene can be enhanced by introducing a mutation into MET4 gene or MET30 gene.
As a mutant MET4 gene that can enhance the expression of MET25 gene, a gene encoding MET4 in which serine at position 215 is replaced with proline and a gene encoding MET4 in which isoleucine at position 156 is replaced with serine are reported (Ohmura et al., FEBS Letters 387(1996) 179-183; JP10-33161A).
As a mutant MET30 gene that can enhance the expression of MET25 gene, genes encoding MET30 in which amino acid residues in WD40 repeat are mutated are reported. Furthermore, a mutant MET30 gene encoding MET30 in which serine at position 569 is replaced with other amino acids such as phenylalanine is reported in JP2004-201677A.
By replacing a wild-type gene on the chromosome with these mutant type genes, expression of MET25 gene can be enhanced, thereby, selenic acid-sensitivity can be imparted. [0024]
MET25 gene, MET30 gene and MET4 gene may be genes of the same kind of yeast as the yeast to be modified. For example, MET25 gene, MET30 gene and MET4 from Saccharomyces cerevisiae having the nucleotide sequence of SEQ ID NOS: 9, 11, and 7, respectively may be used. MET25 gene, MET30 gene and MET4 gene are not limited to these genes as long as MET25 gene encodes a protein having O-acetylhomoserine sulfhydrylase activity, and MET30 gene and MET4 gene encode a protein having the function of repressing the expression of MET25 gene. Therefore, MET25 gene, MET30 gene and MET4 gene may be DNAs encoding amino acid sequences having sequence identity of not less than 80%, preferably not less than 90%, furthermore preferably not less than 95%, much more preferably not less than 98% to SEQ ID NO: 10, 12 and 8, respectively. MET25 gene, MET30 gene and MET4 gene may be DNAs that hybridize with nucleotide sequence of SEQ ID NO: 9, 11 and 7, respectively under stringent conditions. Stringent conditions are exemplified as described above. [0025]
Due to the combination of adenine-auxotrophy and selenic acid-sensitivity, the cellular content of the sulfur-containing compound in the yeast of the present invention is higher than a counterpart strain of the corresponding yeast which shows adenine-non-auxotrophy and selenic acid-sensitivity.
In the present invention, the sulfur-containing compound refers to a substance having -SH group in the chemical formula and may be a protein, a peptide, an amino acid, or another substance. Metallothionein in which 30% of constituent amino acids is composed of cysteine residues is an example of the protein, glutathione, γ-glutamylcysteine, and cysteinylglycine are examples of the peptide, cysteine is an example of as the amino acid, and homocysteine is an example of the another substance, but the sulfur-containing compound is not limited thereto. Glutathione, γ-glutamylcysteine, and cysteine are preferable as sulfur-containing compounds because they are widely used in industries. [0026]
When glutathione is accumulated as a sulfur-containing compound in cells of the yeast, it is preferable that the yeast is further modified to enhance intracellular activity of glutathione synthetase and/or γ-glutamylcysteine synthetase. Activities of these enzymes can be enhanced by increasing copy number of a gene(s) encoding these enzymes or replacing a promoter of the gene(s) with a more potent promoter. Nucleotide sequence of γ-glutamylcysteine synthetase gene derived from Saccharomyces cerevisiae, and the nucleotide sequences of glutathione synthetase gene and γ-glutamylcysteine synthetase gene derived from Candida utilis are shown in JP2005-073638. The nucleotide sequence of glutathione synthetase gene derived from Saccharomyces cerevisiae and amino acid sequence encoded thereby are shown in SEQ ID NO: 13 and 14, respectively.
[0027]
When γ-glutamylcysteine is accumulated as a sulfur-containing compound in cells of the yeast, it is preferable that the yeast is further modified to decrease the intracellular activity of glutathione synthetase, and more preferable that the yeast is further modified to decrease the intracellular activity of glutathione synthetase and to enhance the intracellular activity of γ-glutamylcysteine synthetase. The glutathione synthetase activity can be decreased by disrupting a glutathione synthetase gene or introducing a mutation into a glutathione synthetase gene so that glutathione synthetase activity is decreased.
The mutation for decreasing glutathione synthetase activity is, for example, a mutation which replaces arginine at position 370 in amino acid sequence of SEQ ID: 14 with a termination codon.
Other examples of mutations for decreasing glutathione synthetase activity include the followings (WO 03/046155):
(I) A mutation which replaces threonine at position 47 in amino acid sequence of SEQ ID: 14 with isoleucine.
(2) A mutation which replaces glycine at position 387 in amino acid sequence of SEQ ID: 14 with aspartic acid.
(3) A mutation which replaces proline at position 54 in amino acid sequence of SEQ ID: 14 with leucine.
The mutation may be a single mutation of (1) or (2) or any combination of (1) to (3), and preferably the combination of (1) and (3) or the combination of (2) and (3).
Since cysteine is formed by decomposition of γ-glutamylcysteine, yeast having increased cellular content of cysteine can be obtained by heat-treatment of the yeast having increased cellular content of γ-glutamylcysteine.
Furthermore, when cysteinylglycine is accumulated as a sulfur-containing compound in cells of the yeast, it is preferable that the yeast is further modified to enhance the intracellular activity of ECM38 (Yeast. 2003 JuI 30;20(10):857-63).
A yeast having increased cellular content of sulfur-containing compound, for example, glutathione and γ-glutamylcysteine, can also be obtained by subjecting a yeast which shows rapamycin-resistance (WO2006/013736).
[0028]
The above-mentioned yeast which shows adenine-auxotrophy and selenic acid-sensitivity can be made to contain more sulfur-containing compound by subjecting it to gene modification procedure, preferably, mutation treatment, then, spreading the modified yeast on a medium on which a yeast can turn red in case of adenine deficiency to form yeast colonies, and selecting a yeast colony which is redder as compared to before modification.
In the present invention, the medium to be used for the screening is not particularly limited as long as the medium is one in which the yeast can develop a red color when adenine in the yeast cells runs short. Medium having adenine content of 25mg/L or less is exemplified, and specific examples thereof include YPD medium (Bacto-yeast extract 1%, Bacto-peptone 2% and glucose 2%: METHODS IN YEAST GENETICS 2000 Edition pl71: ISBN 0-87969-588-9) and PGC medium (Casamine acid(vitamin free) 0.5%, Bacto-peptone 1% and glucose 2%). PGC medium, on which yeast can easily develops a red color with higher intensity by influence of a trace component, is preferred. Yeast develops clearer red color when cadmium is added to a medium, and thus, cadmium is preferably added. An agar medium is preferably used rather than a liquid medium so that the strain is easily isolated to be used in the following steps. For the purpose of clearly observing the degree of color development, it is preferable that the yeast is cultured on the medium at 20 to 3O0C for about one week. [0029]
A yeast having increased cellular content of sulfur-containing compound can also be obtained by subjecting a yeast which shows selenic acid-sensitivity to gene modification procedure, preferably, mutation treatment, then, spreading the modified yeast on a minimum medium supplemented with methionine to form yeast colonies, and selecting a yeast colony which is redder as compared to before modification. A medium to be used for this screening method may be a methionine-containing medium which mimics adenine-auxotrophic conditions, preferably a minimal medium supplemented with methionine in absence of biotin, and a specific example thereof include min-met(+)-biotin(-) plate as described below. [0030]
Yeast having increased cellular content of a sulfur-containing compound can be produced by culturing the yeast of the present invention. Preferably, the yeast is cultured in a medium containing sufficient amount of adenine (adenine-rich condition) to proliferate the yeast and then cultured in a medium where adenine content is limited (adenine-poor condition) to increase the cellular content of the sulfur-containing compound. Thereby, a yeast in which a sulfur-containing compound is accumulated can be efficiently produced.
The "sufficient amount" can be determined, for example, by measuring experimentally an amount of adenine required to obtain a predetermined amount of cells, and calculating the amount of adenine required to obtain the desired amount of cells. For example, the "sufficient amount" may be not less than lOOmg/L.
The culture medium and culture conditions other than adenine amount can be appropriately selected based on conventional medium and conditions used for normal yeast culture. Necessary nutrients may optionally be added to the medium depending on the characteristics of the yeast to be used. [0031]
After sufficient amount of cells are obtained, the yeast are cultured in a medium in which adenine amount is limited. Preferably, such a medium has an adenine content of 25mg/L or less. Cellular content of sulfur-containing compound increases during the culture in the medium in which adenine amount is limited.
Preferably, cultivation is terminated when the amount of accumulated sulfur-containing compound has reached a desired amount. Generally, the cultivation time is 10 to 30 hours, preferably, 15 to 27 hours. [0032]
The obtained cultured cells or the fractionated product thereof contains sulfur-containing compounds. The cultured cells may be a culture medium containing the yeast cells, or yeast cells collected from the culture medium. A fractionated product containing sulfur-containing compounds may be cell homogenates or yeast extract. Preparation of a yeast extract and the like may be performed in the same way as a conventional method for preparing a yeast extract. The yeast extract may be obtained by treating the yeast cells with hot water, or by treating the yeast cells with enzyme digestion. [0033]
The sulfur-containing compounds can be isolated from the above-described yeast cells. The sulfur-containing compounds as well as yeast cells or fractionated product thereof containing the sulfur-containing compounds can be used for producing foods, pharmaceuticals, chemical products, animal feeds, etc. Examples of foods include alcoholic beverages; bread foods; and fermented food flavoring materials. Foods can be produced by mixing the sulfur-containing compounds, the cultured cells or the fractionated product thereof with raw materials of the foods, and processing the mixture into foods.
EXAMPLES [0034]
Hereinafter, the present invention is described with reference to the Examples. But, the present invention is not limited to these Examples. [0035]
EXAMPLE 1 (Isolation of Adenine auxotrophic yeasts)
A diploid strain of Saccharomyces cerevisiae was obtained by mating the haploid AJ 14819 strain that carries mutant MET30 gene (MAT alpha type) and the haploid AJ 14810 strain (MAT a type) . The AJ 14819 strain, which is a selenic acid-sensitive strain, was deposited at International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Tsukuba Central 6, 1-1, Higashi 1-chome, Tsukuba-shi, Ibaraki-ken 305-8566, Japan) on October 1, 2003 under the provisions of the Budapest Treaty and given an accession number of FERM BP-8502. The AJ14810 strain was deposited at International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology on November 1, 2002 under the provisions of the Budapest Treaty and given an accession number of FERM BP-8229. Then, the diploid strain was made to form spores, and the following haploid strains were obtained by tetrad analysis.
A : MAT a type haploid with mutated MET30
B : MAT alpha type haploid with mutated MET30 C : MAT a type haploid with wild type MET30
D : MAT alpha type haploid with wild type MET30 [0036]
The expression level of MET25 gene in the obtained 4 strains was evaluated. Based on the methods described in Example 1 of JP2004-201677, the expression level of MET25 gene in these strains was determined as follows. Each strain was inoculated into YPD medium (50 mL in 500 mL Scale Sakaguchi Flask) and cultivated at 3O0C with shaking. At the logarithmic growth phase, cells were collected from each strain and RNA was extracted from the cells, the expression of MET25 gene was quantified using ACTl gene as an internal standard. The quantification was performed with PCR5700 (Applied Biosystems) and TaqMan One-Step RT-PCR Kit (Applied Biosystems) . ACT 1 -986T and MET25- 1077T (JP2004-201677) were used as TaqMan Probes (Applied Biosystems) , and ACT1-963F and ACT1-1039R (JP2004-201677) for ACTl amplification, and MET25-1056F and MET25- 1134R (JP2004-201677) for MET25 amplification were used as primers. As a result, it was confirmed that the expression level of MET25 gene in Strain A and Strain B, both of which possessed mutant MET30 gene and selenic acid sensitivity, was higher than that in Strain C and Strain D, both of which did not possess mutant MET30 gene. The Strain B was given a private number AJ14889 and the Strain A was given a private number AJ14890. [0037]
Then, AJ14889 strain was treated with mutagen MNNG
(l-metyl-3-nitro-l-nitrosoguanidine) so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on YPD plates and cultured at 3O0C for about one week. Among appeared colonies, colonies with red color were selected. Complementation analysis was performed about the adenine-auxotrophy of the obtained strains according to a conventional method. As a result, two strains were obtained, one of which was Nl strain that is auxotrophic for adenine due to the ADEl gene mutation, and the other of which was N2 strain that is leaky for adenine due to the ADE2 gene mutation. The Nl and N2 strains were deposited at the Russian National Collection of Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Russia) on December 23, 2008 under the provisions of the Budapest Treaty and given accession numbers of VKPM Y-3218 and VKPM Y-3219, respectively.
[0038]
EXAMPLE 2
(Screening of high GSH accumulating mutants with intensive red coloration)
The Y-3218 strain, a strain having a mutation in ADEl gene, was treated with mutagen MNNG so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on PGC plate or YPD plate and cultured at 3O0C for about one week. Colonies that showed more intensive red color than Y-3218 strain were selected, and their GSH contents were compared with AJ 14889 strain (starting strain) and Y-3218 strain. That is, the selected strains as well as AJ14889 strain and Y-3218 strain were respectively inoculated into 5 mL of YPD liquid medium and cultured at 3O0C with shaking at 250 rpm for 24 hours. Then, the obtained culture of each strain were inoculated into 50 mL of YPD liquid medium and cultured at 3O0C with shaking at 250 rpm for 24 hours. GSH contents of each strain were measured according to a conventional procedure and as a result, it was found that the GSH content of Y-3218 strain was higher than that of AJ14889 strain (Table 1). It was also found that seven strains among the selected strains (total 180 strains) had higher GSH contents than Y-3218 strain (Table 1). [0039]
Table 1
[0040]
The same kind of experiments was performed using the Y-3219 strain, a strain having a mutation in ADE2 gene, instead of Y-3218 strain. The Y-3219 strain was treated with mutagen MNNG so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on PGC plate or YPD plate and cultured at 3O0C for about one week. Colonies that showed more intensive red color than Y-3219 strain were selected, and their GSH contents were compared with AJ14889 strain (starting strain) and Y-3219 strain. That is, the selected strains as well as AJ14889 strain and Y-3219 strain were respectively inoculated into 5 mL of YPD liquid medium and cultured at 3O0C with shaking at 250 rpm for 24 hours. Then, the obtained culture of each strain were inoculated into 50 mL of YPD liquid medium and cultured at 3O0C with shaking at 250 rpm for 24 hours. GSH contents of each strain were measured according to a conventional procedure and as a result, it was found that the GSH content of Y-3219 strain was higher than that of AJ14889 strain (Table 2). It was also found that ten of the selected strains (total 118 strains) had higher GSH contents than Y-3219 strain (Table 2). [0041]
Table 2
[0042]
Table 1 and Table 2 showed that it was possible to isolate mutants with higher GSH contents using intensive red coloration of the adenine-auxotrophy as an index. [0043]
EXAMPLE 3 (Isolation of white colony having high GSH content)
A color of wild type yeast strain is not red but white or cream yellow. So the inventors tried to isolate a strain which forms normal color colony from the obtained mutants with intensive red color. First, the Y-3219 strain was treated with mutagen MNNG as the same way described in EXAMPLE 2 and the treated cells were spread on PGC plate or YPD plate to obtain a mutant with more intensive red color. Y-3219-20 strain shown in Table 3 was obtained as the same way described in EXAMPLE2. Then Y-3219-20 strain was treated with mutagen MNNG so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on PGC plate and cultured at 3O0C for about one week. Among appeared colonies, three white colonies (Y-3219-20-52, Y-3219-20-53, Y-3219-20-56) and one red colony (Y-3219-20-1) were selected, and their GSH contents were compared with Y-3219 strain and Y-3219-20 strain. That is, the selected strains as well as Y-3219 and Y-3219-20 strains were respectively inoculated into 5 mL of YPD liquid medium and cultured at 3O0C with shaking at 250 rpm for 24 hours. Then, the obtained culture of each strain were inoculated into 50 mL of YPD liquid medium and cultured at 3O0C with shaking at 250 rpm for 24 hours. GSH contents of each strain were measured according to a conventional procedure. The results are shown in Table 3. [0044] Table 3
[0045]
The white colonies were genetically analyzed using tester strains. As a result, it was found that the Y-3219-20-52 strain which has decreased GSH content had lost adenine-auxotrophy. On the other hand, the Y-3219-20-56 strain which maintained high GSH content has a mutation in ADE4 gene in addition to a mutation in ADE2 gene; the Y-3219-20-53 has a mutation in ADE8 gene in addition to a mutation in ADE2 gene. From this result, it was found that an adenine auxotrophic strain which forms a red colony can be made to a strain which forms a normal white colony by mutating ADE4 gene or ADE8 gene. The Y-3219-20-56 strain was deposited at the Russian National Collection of Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Russia) on December 23,
2008 under the provisions of the Budapest Treaty and given accession number of VKPM
Y-3256.
[0046]
EXAMPLE 4
(High GSH accumulation caused by adenine insufficiency)
The relation between GSH content and adenine sufficiency was investigated. Y-3256 strain was cultivated in 50 mL of YPD medium (D-glucose 20g/LN Bact Peptone 20g/L, Yeast Extract lOg/L) contained in 500 mL Scale Sakaguchi flask at 3O0C with shaking at 120rpm for 24 hours and the obtained culture was inoculated into 50 mL of YPD medium contained in 50OmL Scale Sakaguchi flask supplied with different concentration of adenine (final adenine concentration 0mg/L, lOmg/L, or 20mg/L) so as to make the initial Absorbance at 660nm = 0.1 , and cultivated at 3O0C with shaking at 120rpm. Table 4 shows the time course of GSH content. [0047] Table 4
[0048]
These results indicate that GSH content in the adenine auxotrophic Y-3256 strain is in inverse proportion to the adenine concentration in the medium. It should be noted that Y-3256 strain can grow in YPD medium with no adenine supplementation (Ade 0mg/L) because YPD medium contains a trace amount of adenine (adenine content of YPD medium was analyzed to be about 10mg/L) . [0049]
EXAMPLE 5 (Evaluation at Jar Fermentor)
Y-3256 strain was cultivated in Jar fermentor and time course of GSH content in the Y-3256 strain was evaluated. Cells of the strain was picked up from YPD agar medium and inoculated into three of 50 mL YPD liquid medium contained in 750 mL-scale conical flask, and cultivated at 3O0C with shaking at 250rpm for 20 hours. The obtained seed culture (120 mL) was inoculated into 1.2L of main culture medium (YPD medium) contained in 3L-scale Jar fermentor and cultivation was performed at 3O0C with shaking at 1 , 1 OOrpm. The medium was aerated at 1/lwm, and pH was adjusted to be 6.0 with aqueous ammonia. Feed medium was fed at 1.5 ml/hour within 0 to 24 hours, and then at 1.8 mL/hour. The composition of the feed medium was glucose 60Og, Bacto-yeast extract 1Og, corn extract 1Og, Bacto-peptone 1Og, (NILO2SO4 0.274g, KH2PO4 0.1 Ig, KCl 0.732g, MgSO4 0.466g, CuSO4 0.0012g, ZnSO4 0.014g, MnSO4 0.00334g, NaMoO4 0.00012g, KCl 0.002g, H3BO3 0.00004g, CoSO4 O.OOOlg, CaCl2 0.28g, FeSO4 0.2g, biotin 0.05mg, riboflavin 0.2mg, and thiamine 0.5mg per IL. Fig 1 shows the time course of GSH content of Y-3256 strain. [0050]
EXAMPLE 6 (Breeding a diploid strain and investigation of the medium composition)
According to a conventional method, homodiploid strain of Y-3219-20-53 strain was prepared. Experimental conditions were as follows. The Y-3219-20-53 strain was treated with mutagen MNNG so that survival rate became 5 to 10% according to a conventional method, and the treated cells were spread on YPD agar medium so that 100 to 200 colonies should appear. After cultivation at 3O0C for five days, colonies were replicated to SD agar medium supplemented with adenine and YPD agar medium, and a strain which could grow on the YPD medium but could not grow on the SD medium supplemented with adenine was selected. Auxotrophy other than adenine was determined and Y-3219-20-53-auxl strain and Y-3219-20-53-aux2 strain which had different auxotrophy with each other were obtained. The Y-3219-20-53-auxl strain was streaked in a vertical line on SD agar medium supplemented with adenine, and Y-3219-20-53-aux2 strain was streaked in a horizontal line on the same SD agar medium supplemented with adenine so that the vertical line and the horizontal line crossed at one point. This SD agar medium supplemented with adenine was incubated at 3O0C for 20 days and a colony that appeared on the crossed point was selected. Thereby, adenine auxotrophic diploid strain D 1-3 was obtained. The D 1-3 strain was deposited at the Russian National Collection of Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Russia) on December 23, 2008 under the provisions of the Budapest Treaty and given accession number of VKPM Y-3309. When the D 1-3 strain was streaked on SD agar medium supplemented with adenine and cultivated at 3O0C for 5 days, colonies were formed, so that it was confirmed that auxotrophy other than adenine-auxotrophy was not imparted to the strain.
A diploid Dip strain was obtained as a control adenine non-auxotrophic strain by mating AJ14889 strain and AJ14890 strain.
The D 1-3 strain and the Dip strain were inoculated into 5 mL of YPD liquid medium contained in test tube and cultivated at 3O0C for 24 hours with shaking at 250rpm. The obtained culture was inoculated into 50 mL of each of the medium shown in Table 5 and cultivation was performed at 3O0C for 24 hours with shaking at 250rpm. GSH contents of each of the strains cultivated in each of the media was measured. The results are shown in Table 6. [0051] Table 5
[0052] Table 6
[0053]
These data show that adenine-auxotrophy could increase GSH content at each medium. [0054]
EXAMPLE 7
(Breeding high γ-glutamylcysteine containing adenine auxotrophic yeast and evaluation of increased γ-glutamylcysteine content) A GSH2 gene encoding glutathione synthetase was disrupted in the Y-3256 strain obtained in EXAMPLE 3 to obtain a haploid strain that accumulates γ-glutamylcysteine. In order to construct GSH2 gene disruption cassette, PCR was performed by using primers of SEQ ID NOS: 17-22 and genome DNA of S. cerevisiae (wild type strain) and pFA6a-KanMX6 plasmid (Chiara et al., Yeast 2000; 16:1089- 1097) as templates (Fig. 2). The detail conditions were as follows. [0055]
First, about 400bp upstream region from GSH2 ORF was amplified from the X2180-1B (S. cerevisiae wild type strain: Available from ATCC as an accession number ATCC204505) genomic DNA to obtain GSH2 -upstream fragment using GSH2-up-F primer (SEQ ID NO: 17) and GSH2-up-R primer (SEQ ID NO: 18). GSH2-upstream fragment has Bpil restriction enzyme site sequence on its one terminal and has conl sequence for fusion PCR, which was described later, on its other terminal by the design of GSH2-up-F primer and GSH2-up-R primer. Also, about 300bp downstream region from GSH2 ORF was amplified from the X2180-1B S. cerevisiae genomic DNA to obtain GSH2-downstream fragment using GSH2-down-F primer (SEQ ID NO: 19) and GSH2-down-R primer (SEQ ID NO: 20). GSH2 -downstream fragment has con2 sequence for fusion PCR, which was described later, on its one terminal and has Bpil restriction enzyme site sequence on its other terminal by the design of GSH2-down-F primer and GSH2-down-R primer. Then the KanMX gene was PCR-amplified from the pFA6a-KanMX6 plasmid using Marker-F primer (SEQ ID NO: 21) and Marker-R primer (SEQ ID NO: 22). This PCR-amplified KanMX gene fragment has conl sequence on its one terminal and con2 sequence on its other terminal for fusion PCR by the design of Marker-F primer and Marker-R primer. These three PCR amplifications were performed at the following conditions. A mixture of DNA polymerases (Pfu : Taq = 1 : 10, both available from Fermentas, Lithuania) was used for each reactions. PCR was performed by repeating a cycle of "940C for 30 seconds, 5O0C for 30 seconds and 680C for 3 minutes 30 times. [0056]
Then, these obtained three fragments were ligated to obtain GSH2 gene disruption cassette by fusion PCR. Fusion PCR was performed using GSH2-up-F primer and Marker-R primer as PCR primers and GSH2-upstream fragment and KanMX gene fragment as templates. Since GSH2-upstream fragment and KanMX gene fragment have the same conl sequence on their one terminal, GSH2-upstream fragment and KanMX gene fragment were ligated and GSH2-upstream-KanMX fragment was obtained by this fusion PCR. This fusion PCR was performed with the same mixture of DNA polymerases. PCR was performed by repeating a cycle of "940C for 30 seconds, 610C for 30 seconds and 680C for 4.5 minutes" 5 times, and then repeating a cycle of "940C for 30 seconds, 5O0C for 30 seconds and 680C for 4.5 minutes" 25 times. Then other fusion PCR was performed using GSH2-up-F primer and GSH2-down-R primer as PCR primers and GSH2-upstream-KanMX fragment and GSH2-downstream fragment as templates. Since GSH2-upstream-KanMX fragment and GSH2-downstream fragment have the same con2 sequence on their one terminal, GSH2-upstream-KanMX fragment and GSH2-downstream fragment were ligated and GSH2 gene disruption cassette was obtained. This fusion PCR was performed with the same mixture of DNA polymerases. PCR was performed by repeating a cycle of "940C for 30 seconds, 610C for 30 seconds and 680C for 5.3 minutes" 5 times, and then repeating a cycle of "940C for 30 seconds, 5O0C for 30 seconds and 680C for 5.3 minutes" 25 times. [0057]
The sequence of PCR primers were as follows. (1) GSH2-up-F, CCGAAGACCTTCGTTTGGTGTTATGGT (SEQ ID NO: 17)
(2) GSH2-up-R, GΛGΛGGGGGGGGGΓGGGGGGAAGGTGGATAGTGTGCC (SEQ ID
NO: 18)
(3) GSH2-down-F, CCrCCrCCCCCCGCCCΛCGGCAGGATTCGGATGTTTG (SEQ ID NO: 19)
(4) GSH2-down-R, CGAAGACTCAGTACGAGCATTACGCAA (SEQ ID NO: 20)
(5) Marker-F,
5 -CCCC^CCCCCCCCCrCrCTACCGTTCGTATAATGTATGCTATACGAAGTTATACTG GATGGCGGCGTTAG (SEQ ID NO: 21)
(6) Marker-R,
GΓGGGCGGGGGGΛGGΛGGTACCGTTCGTATAGCATACATTATACGAAGTTATGTTTA GCTTGCCTCGTCC (SEQ ID NO: 22) [0058]
The Y-3256 strain was transformed with the GSH2 disruption cassette to cause homologous recombination and the transformants were spread on YPD agar medium containing G418 (50 μ. g/ml). Among the appeared colonies, N8ΔGSH2 strain where GSH2 gene was disrupted was obtained.
The N8ΔGSH2 strain was cultivated in 50 ml of YPD medium (D-glucose 20g/L, Bact Peptone 20g/L, Yeast Extract 10g/L) contained in 500 ml Scale Sakaguchi flask at 3O0C with shaking at 120rpm for 24 hours and the obtained culture was inoculated into 50 ml of YPD medium contained in 500 mL Scale Sakaguchi flask supplied with different concentration of adenine (final adenine concentration Omg/L, 10mg/L, or 20mg/L) so as to make the initial Absorbance at 660nm = 0.1, and cultivated at 3O0C with shaking at 120rpm. γ-glutamylcysteine concentration was measured according to a conventional method. Table 7 shows the time course of γ-glutamylcysteine content. It was found that γ-glutamylcysteine content could be enhanced by imparting adenine-auxotrophy. [0059] Table 7
[0060] Example 8 (Evaluation on a medium which mimics adenine-auxotrophic conditions)
According to a conventional method, AJ 14889 strain was treated with mutagen MNNG so that survival rate became about 10%, and the treated cells were spread on min-met(+)-biotin(-) agar plate which contains the components shown in Table 8 and methionine at 150mg/L so that not more than 350 colonies should appear. After cultivation at 3O0C for eight to ten days, 106 colonies that colored light pink to red were picked up among colonies appeared on 30 plates.
Then, intracellular GSH content of the selected strains and AJ 14889 strain (starting strain) was measured by culturing them in YPD medium. That is, the selected strains as well as AJ14889 strain that had been cultured on YPD plate were respectively inoculated into 5 mL of YPD liquid medium contained in a test tube and cultured at 300C with shaking at 250 rpm for 24 hours. Then, the obtained culture of each strain were inoculated into 50 mL of YPD liquid medium contained in 750ml-volume conical flask so that absorbance at 600nm became 0.1 and cultured at 3O0C with shaking at 250 rpm for 24 and 48 hours, respectively. As a result, it was found that among the selected 106 strains, eight strains showed the GSH content higher than that of AJ14889 strain (Table 9) at 24 and/or 48 hours. This screening method was found very effective for obtaining a strain having high GSH content since eight strains among 108 strains showed increased GSH content. [0061] Table 8
[0062] Table 9
[0063]
Then, 89-6 strain, 89-28 strain and 89-31 strain were selected among the eight strains and their growth and GSH content were compared together with AJ 14889 strain. These strains were cultured as described above except that cells were inoculated so that absorbance at 600nm became 0.3. The growth was measured based on the change in dry cell weight (DCW). As shown in Table 10, the three strains showed almost the same growth as AJ 14889 strain and higher GSH content than AJ14889 strain at 24 and 48 hours. [0064] Table 10
[0065]
In order to investigate the possibility that unexpected nutrient-auxotrophic property might be imparted to these three strains, the three strains and AJ 14889 strain were inoculated into SD medium and their growth was evaluated. Specifically, the strains that had been cultured on YPD plate were respectively inoculated into 5 mL of SD medium contained in a test tube and cultured at 3O0C with shaking at 250 rpm for 24 and 48 hours, respectively. As a result, it was found that the growth of the three strains were almost the same as AJ14889 strain on SD medium (Table 11), which indicated that unexpected nutrient-auxotrophic property was not imparted to these three strains.
[0066]
Table 11
[0067]
INDUSTRIAL APPLICABILITY
According to the present invention, an adenine-auxotrophic yeast having an increased content of a sulfur-containing compound in the cells, a method of screening the yeast, and a method of culturing the yeast are provided. The present invention can be used widely in fields of food, drugs, chemical products, animal feeds, and the like.

Claims

1. A yeast which has increased cellular content of a sulfur-containing compound, wherein said yeast shows selenic acid-sensitivity and develops a red color when it is cultured on a medium.
2. The yeast according to claim 1, wherein said medium contains methionine.
3. The yeast according to claim 1 or 2, wherein said yeast develops a red color by imparting adenine-auxotrophy.
4. The yeast according to claim 3, wherein said adenine-auxotrophy is imparted by modification of ADEl gene or ADE2 gene.
5. The yeast according to claim 3 or 4, wherein said yeast further has a mutation in ADE4 gene or ADE8 gene, and thereby develops a white color when it is cultured on the medium.
6. The yeast according to claims 1 to 5, wherein said selenic acid-sensitivity is imparted by the modification to enhance the expression of MET25 gene.
7. The yeast according to claims 1 to 6, wherein said sulfur-containing compound is at least one compound selected from the group consisting of cysteine, γ-glutamylcysteine, glutathione, and cystenylglycine.
8. A method for culturing the yeast according to claims 1 to 7, comprising culturing said yeast under an adenine-rich condition to increase yeast cells, and then culturing said yeast under an adenine-poor condition to increase cellular content of the sulfur-containing compound.
9. A method of screening a yeast having increased cellular content of a sulfur-containing compound, comprising subjecting a yeast which shows adenine-auxotrophy and selenic acid-sensitivity to gene modification treatment, spreading the modified yeast on a medium on which a yeast can turn red in case of adenine deficiency to form yeast colonies, and selecting a yeast colony which is redder as compared to before modification.
10. A method of screening a yeast having increased cellular content of a sulfur-containing compound, comprising subjecting a yeast which shows selenic acid-sensitivity to gene modification treatment, spreading the modified yeast on a minimum medium supplemented with methionine to form yeast colonies, and selecting a yeast colony which is redder as compared to before modification.
11. The method according to claim 9 or 10, wherein said sulfur-containing compound is at least one compound selected from the group consisting of cysteine, γ-glutamylcysteine, glutathione, and cystenylglycine.
EP10708392A 2009-04-08 2010-02-26 Novel yeast having increased content of sulfur-containing compound, screening method thereof, and culturing method thereof Withdrawn EP2417252A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
RU2009113205/10A RU2009113205A (en) 2009-04-08 2009-04-08 YEAST HAVING AN INCREASED CONTENT OF THE SULFUR CONTAINING METHOD, A METHOD FOR SCREENING SUCH YEAST AND A METHOD FOR THEIR CULTIVATION
PCT/JP2010/053695 WO2010116833A1 (en) 2009-04-08 2010-02-26 Novel yeast having increased content of sulfur-containing compound, screening method thereof, and culturing method thereof

Publications (1)

Publication Number Publication Date
EP2417252A1 true EP2417252A1 (en) 2012-02-15

Family

ID=42174706

Family Applications (1)

Application Number Title Priority Date Filing Date
EP10708392A Withdrawn EP2417252A1 (en) 2009-04-08 2010-02-26 Novel yeast having increased content of sulfur-containing compound, screening method thereof, and culturing method thereof

Country Status (4)

Country Link
EP (1) EP2417252A1 (en)
JP (1) JP5673669B2 (en)
RU (1) RU2009113205A (en)
WO (1) WO2010116833A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5954178B2 (en) 2010-10-05 2016-07-20 味の素株式会社 Yeast and yeast extract containing γ-Glu-Abu, and methods for producing them
DE102013209274A1 (en) 2013-05-17 2014-11-20 Wacker Chemie Ag Microorganism and method for fermentative overproduction of gamma-glutamylcysteine and derivatives of this dipeptide

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS59151894A (en) 1983-02-18 1984-08-30 Kohjin Co Ltd Production of yeast of high glutathione content
JPS6152299A (en) 1984-08-21 1986-03-14 Kanegafuchi Chem Ind Co Ltd Preparation of glutathione by yeast
JPS62275685A (en) 1986-02-04 1987-11-30 Asahi Breweries Ltd Novel recombinant plasmid participating in glutathione synthesis and production of glutathione using yeast containing said recombinant plasmid
JPS63129985A (en) 1986-11-19 1988-06-02 Asahi Breweries Ltd Novel promoter probe vector produced by gene recombination and novel promoter produced by using said vector
JP2830042B2 (en) 1989-05-09 1998-12-02 味の素株式会社 Glutathione-rich yeast and method for producing the same
JPH0318872A (en) 1989-06-16 1991-01-28 Seiko Epson Corp Electrophoretic image pickup device
JPH04179484A (en) 1990-11-11 1992-06-26 Ajinomoto Co Inc Gene capable of coding glutathione s-transferase
JPH0753102B2 (en) 1992-06-23 1995-06-07 アサヒビール株式会社 Yeast high in glutathione and method for producing the same
JPH0870884A (en) 1994-09-02 1996-03-19 Kyowa Hakko Kogyo Co Ltd Glutathione manufacturing method
JPH1033161A (en) 1996-07-24 1998-02-10 Suntory Ltd Yeast having a mutant transcription factor
JPH10191963A (en) 1997-01-17 1998-07-28 Kohjin Co Ltd Dna and yeast having high content of glutathione
JP3639853B2 (en) * 2000-03-28 2005-04-20 北海道ティー・エル・オー株式会社 How to detect mutations
JP2002136288A (en) * 2000-11-06 2002-05-14 National Cancer Center-Japan A method for estimating the function of eukaryotic genes using yeast
JP4273689B2 (en) 2001-11-26 2009-06-03 味の素株式会社 γ-glutamylcysteine-producing yeast
JP4228644B2 (en) * 2002-09-27 2009-02-25 味の素株式会社 Method for producing γ-glutamylcysteine
JP4243950B2 (en) 2002-11-29 2009-03-25 株式会社カネカ Glutathione-rich yeast and food or medicine obtained by culturing the yeast, or cosmetic material
JP4352877B2 (en) 2002-12-13 2009-10-28 味の素株式会社 Method for producing γ-glutamylcysteine
ATE405637T1 (en) * 2002-12-13 2008-09-15 Ajinomoto Kk METHOD FOR THE PRODUCTION OF GAMMA-GLUTAMYLCYSTEIN
JP2005073638A (en) 2003-09-02 2005-03-24 Ajinomoto Co Inc Glutathione synthetase-coding gene of candida utilis
KR101167345B1 (en) 2004-08-02 2012-07-19 아사히 그룹 홀딩스 가부시키가이샤 Mutant yeast, method of producing glutathione-rich yeast, culture thereof, fraction thereof, yeast extract and glutathione-containing foods and drinks
JP5315600B2 (en) * 2006-09-05 2013-10-16 味の素株式会社 Y-glutamylcysteine-producing yeast and use thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CUTTS N S ET AL: "Methionine and the formation of pigment by yeasts.", NATURE 30 DEC 1950, vol. 166, no. 4235, 30 December 1950 (1950-12-30), pages 1117, ISSN: 0028-0836 *
DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; 30 December 1950 (1950-12-30), CUTTS N S ET AL: "Methionine and the formation of pigment by yeasts.", Database accession no. NLM14796721 *
See also references of WO2010116833A1 *
UGOLINI SIMONE ET AL: "The red/white colony color assay in the yeast Saccharomyces cerevisiae: Epistatic growth advantage of white ade8-18, ade2 cells over red ade2 cells", CURRENT GENETICS, NEW YORK, NY, US, vol. 30, no. 6, 1 December 1996 (1996-12-01), pages 485 - 492, XP008122963, ISSN: 0172-8083, [retrieved on 19961209], DOI: 10.1007/S002940050160 *

Also Published As

Publication number Publication date
JP2012523230A (en) 2012-10-04
RU2009113205A (en) 2010-10-20
WO2010116833A1 (en) 2010-10-14
JP5673669B2 (en) 2015-02-18

Similar Documents

Publication Publication Date Title
EP2558588B1 (en) A YEAST EXTRACT CONTAINING gamma-Glu-X OR gamma-Glu-X-Gly AND A METHOD FOR PRODUCING THE SAME
JP6799738B2 (en) How to make glutathione
CN102812119B (en) Yeast culture method
JP2012213376A (en) METHOD FOR PRODUCING YEAST EXTRACT CONTAINING γ-GLUTAMYL COMPOUND, AND YEAST USED FOR THE METHOD
DK2256184T3 (en) Mutants of Saccharomyces cerevisiae as well as the process for the preparation of yeast with high RNA content using the mutants
JPWO2009110624A1 (en) Method for producing γ-glutamylcysteine-producing yeast and yeast extract
JP6489014B2 (en) Yeast high in Abu, γ-Glu-Abu, and / or γ-Glu-Abu-Gly
JPWO2012046731A1 (en) Yeast and yeast extract containing γ-Glu-Abu, and methods for producing them
JP5315600B2 (en) Y-glutamylcysteine-producing yeast and use thereof
WO2010116833A1 (en) Novel yeast having increased content of sulfur-containing compound, screening method thereof, and culturing method thereof
FR2877011A1 (en) GENETICALLY MODIFIED YEAST STRAIN HAVING EXTENDED PRODUCTION AND EXCRETION OF S-ADENOSYLMETHIONINE (SAM)
CN113166711B (en) Method for producing yeast containing kokumi-taste imparting substance and method for producing yeast extract containing kokumi-taste imparting substance
CN112639117A (en) Method for producing glutathione
TW201540832A (en) Method for producing [gamma]-Glu-Abu and method for producing yeast extract containing [Gamma]-Glu-Abu
EP1428873B1 (en) Method for producing gamma-glutamylcysteine
RU2557292C2 (en) Yeast having higher sulphur content, method for sampling and cultivation thereof
JP4228644B2 (en) Method for producing γ-glutamylcysteine
JP2004201677A (en) METHOD FOR PRODUCING gamma-GLUTAMYLCYCTEINE
JP5634051B2 (en) Glutathione-producing yeast and its use
JP2003159048A (en) gamma-GLUTAMYLCYSTEINE PRODUCING YEAST AND METHOD FOR SCREENING THE SAME
JP2016049074A (en) YEAST WITH HIGH CONTENTS OF γ-GLU-ABU AND/OR γ-GLU-ABU-GLY

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20111107

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20130617

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

RIC1 Information provided on ipc code assigned before grant

Ipc: C12R 1/865 20060101ALN20161205BHEP

Ipc: C12N 9/88 20060101ALI20161205BHEP

Ipc: C12N 9/00 20060101ALI20161205BHEP

Ipc: C12N 1/18 20060101AFI20161205BHEP

INTG Intention to grant announced

Effective date: 20161220

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20170208