EP2288709A1 - CONTROLLED cDNA OVEREXPRESSION SYSTEM IN ARABIDOPSIS - Google Patents

Abstract

The present invention provides a method for identifying genes being responsible for stress regulatory functions in Arabidopsis, comprising cloning an Arabidopsis cDNA library into a vector suitable for inducible expression of the introduced nucleic acid in a position allowing the expression of said nucleic acid, introducing the cloned cDNA library into wild-type Arabidopsis; regenerating plants comprising said expression vector carrying a cDNA insert as being produced; testing the plants regenerated for stress tolerance upon inducing said vector to express the cDNA insert, identifying plants with modified stress tolerance, and identifying the gene(s) being comprised in the cDNA insert of said expression vector produced in step a) being present in said stress tolerant plant as gene(s) capable of modifying the stress tolerance in Arabidopsis. The invention further provides novel genes involved in the stress regulatory functions identified by the present method, the uses thereof for enhancing the stress tolerance of plants, as well es kits to perform the method of the invention.

Description

CONTROLLED CDNA OVEREXPRE S SION SYSTEM IN ARABIDOPSIS

The present invention belongs to the field of plant molecular biology. In particular, the present invention provides a method for identifying genes being responsible for stress regulatory functions in Arabidopsis, comprising cloning an Arabidopsis cDNA library into a vector suitable for inducible expression of the introduced nucleic acid in a position allowing the expression of said nucleic acid, introducing the cloned cDNA library into wild-type Arabidopsis; regenerating plants comprising said expression vector carrying a cDNA insert as being produced; testing the plants regenerated for stress tolerance upon inducing said vector to express the cDNA insert, identifying plants with modified stress tolerance, and identifying the gene(s) being comprised in the cDNA insert of said expression vector produced in step a) being present in said stress tolerant plant as gene(s) capable of modifying the stress tolerance in Arabidopsis. The invention further provides novel genes involved in the stress regulatory functions identified by the present method, the uses thereof for enhancing the stress tolerance of plants, as well es kits to perform the method of the invention.

Adverse environmental conditions, such as drought, low temperature and high soil salinity are among the most challenging factors for plant growth and survival.

Adaptation to abiotic stress requires coordinate changes in metabolism, cell growth, division and differentiation, which depend on a large set of genes controlling complex regulatory mechanisms. Cloning of genes whose expression is upregulated by salt, cold or drought stress identified several targets and regulators of stress signalling (Serrano and Glaxiola, 1994, Ingram and Bartels, 1996, Hasegawa et al, 2000).

However, genetic approaches are better suited for the identification of regulatory genes than differential display techniques. In fact, the majority of gene functions controlling responses to high salinity, drought and cold were discovered using forward genetic screens of mutagenized Arabidopsis populations. For example, uncovering the Salt Overly Sensitive (SOS) signalling pathway, which controls NaCl homeostasis and salt tolerance (Zhu, 2002), was aided by the isolation of salt hypersensitive mutants assisting the characterization of key determinants of salt tolerance, including the SOSl Na⁺/H⁺ antiporter (Shi et al., 2000), the SnRK3 kinase 5052 (Guo et al, 2001) and the S0S2-interacting EF-hand Ca²⁺ binding protein

5053 (Halfter et al., 2000). Similarly, forward genetic approaches unraveled important components of drought, cold and ABA signalling pathways (see for reviews Thomashow, 1999, Finkelstein et al., 2002, Yamaguchi-Shinozaki and Shinozaki, 2006).

Genetic screens for deregulated expression of stress-responsive reporter gene constructs, such as RD29A-LUC, provide an alternative to isolate mutations in regulatory genes that either activate or repress the activity of the reporter (Xiong et al., 1999). Combined with non-destructive bio luminescence imaging, the RD29A- LUC reporter gene system was instrumental to identify regulatory components of salt, cold and ABA signalling pathways (Ishitani et al., 1997, Lee et al., 2002, Xiong et al., 2001, 2002, Zhu, 2002). As multiple regulatory networks control the expression of stress-induced genes (Yamaguchi-Shinozaki and Shinozaki, 2006), diverse reporter gene constructs are designed to dissect each of these regulatory cascades. Whereas chemical mutagenesis followed by map-based cloning provides a strategy for identification of weak mutant alleles of essential regulatory genes, wide- scale exploitation of T-DNA and transposon insertion mutagenesis facilitates the isolation of loss of function mutations affecting various stress responses (Koiwa et al., 2006). The utility of locus specific mutations is however limited when a phenotype is controlled by a multigene family. Activation tagging, employing strong enhancers or promoters to induce ectopic expression of genes adjacent to the insertion sites, is used for generation of dominant mutations that may reveal the functions of gene family members (Weigel et al., 2000, Nakazawa et al., 2003). Functional identification of the cytokinin receptor kinase (Kakimoto, 1996), various microRNA genes (Palatnik et al., 2003), and isolation of dominant mutations conferring enhanced salt tolerance (Koiwa et al., 2006) illustrate the potential of this experimental system. Nonetheless, a disadvantage of activation tagging is that gene activation might not be restricted to a single gene located in the vicinity of the T-DNA or transposon insertion site, and therefore multiple gene activation events may lead to complex and confusing phenotypes (Ichikawa et al., 2003). Combination of activation tagging with screening for induction (or repression) of promoter driven luciferase reporters provides a more specific technique for activation tagging of regulatory genes. Screening for enhanced luminescence of a pathogen responsive PRl -luciferase reporter gene was thus used for tagging of the Arabidopsis ADRl pathogen resistance gene (Grant et al., 2003). Analogous genetic screens are facilitated by the gene trapping systems that offer a collection of promoter trap insertions in stress-responsive genes that control the expression of GFP, GUS or luciferase reporters (Alvarado et al., 2004).

Expression of cDNA libraries in plants provides a further strategy to screen for gain of function phenotypes. This strategy is comparable to the so-called multicopy suppressor screen, which was first invented in yeast to identify functions suppressing salt sensitivity (Bender and Pringle, 1991; Masson and Ramotar, 1998). cDNA libraries driven by constitutive promoters have also been used to generate transgenic Arabidopsis and rice lines showing altered developmental traits (LeClere and Bartel, 2001, Ichikawa et al., 2006, Nakamura et al., 2007). Large-scale transformation of Arabidopsis roots with a cDNA library lead to the identification of the ESRl gene, overexpression of which stimulates cytokinin- independent plant regeneration (Banno et al., 2001). By screening a collection of cDNA overexpressing plants, Kuhn et al. (2006) found that protein phosphatase AtPP2AC plays an important regulatory role in ABA-controlled closure of gas exchange cells and thereby controls drought sensitivity.

The cDNA library transformation approach may also produce dominant loss of function phenotypes, which result from co-suppression of endogenous genes by overexpression of truncated or antisense cDNAs (LeClere and Bartel, 2001). Recently, this possible disadvantage has been overcome by the design of Full-length cDNA Over-eXpresser (FOX) gene hunting system (Ichikawa et al., 2006, Nakamura et al., 2007). Nevertheless, constitutive activation of stress regulatory genes can disturb cell proliferation and development resulting e.g. in dwarf and sterile plants (Kasuga et al., 1999, Gilmour et al., 2000). Accordingly, there is a need in the art to provide reliable, high through-put systems for screening and identifying genes involved in the response mechanism of plants to adverse environmental conditions, as well as identifying genes capable to help adapting plants for such conditions.

To address these needs, the present inventors developed a Controlled cDNA

Overexpression System (COS) by Gateway cloning of an Arabidopsis cDNA library into the chemically inducible XVE expression cassette of pER8 plant transformation vector. The cDNA library was introduced into wild-type Arabidopsis, as well as into an ADHl-LUC reporter line, to screen for salt tolerance, ABA insensitivity and activation of stress-responsive alcohol dehydrogenase (ADHl) promoter. The present system provides improved screening facilities for stress regulatory genes the expression of which may frequently disturb cell proliferation and development, therefore, practically makes it impossible to identify exactly those genes, which are relevant for this behavior by limiting the possibility to freely generate large enough sets of plants allowing the screening. This improvement comes from three major factors. First, the chemically inducible XVE expression cassette is used to drive the expression of the cloned cDNAs, a first for plant cDNA libraries. The chemical inducer, i. e. estradiol, is not a compound usually occurring in plants, therefore provides a precise, well defined means to control the expression of the genes cloned into the system. Second, the screening itself takes place in an environment controlled by the chemical inducer. The state of the art techniques usually employ inducible expression only after a gene was suspected as playing a role in stress regulation, therefore, as is apparent from the present invention, seriously limiting the pool of genes from which further testing is able to identify candidate genes involved in stress tolerance. Indeed, no inducible expression library was disclosed in the art for plants. Third, the present invention combines the screening process for stress related genes with the use of cell suspension culturing technique, which allows fast and high volume screening process to allow high-throughput analysis. In addition to the improvements of the library screening, the present invention further provides a set of cDNAs conferring dominant stress-tolerance phenotypes and initial characterization of three regulatory functions identified in the different genetic screens according to the present invention. The present data indicate that overexpression of HSPl 7.6 cDNA and overexpression of the At5g25160 gene confers ABA insensitivity, whereas overexpression of the 2-alkenal reductase 2AER and overexpression of the At4gl4520 gene results in improved salt tolerance, and induction of the RAP2.12 transcription factor stimulates the expression of ^' ADHl-LUC reporter gene. These examples illustrate that the COS technology can be exploited as a simple and versatile genetic tool to screen for regulators of stress responses.

Accordingly, the present invention provides a method for identifying genes being responsible for stress regulatory functions in Arabidopsis, comprising: a) cloning an Arabidopsis cDNA library into a vector suitable for inducible expression of the introduced nucleic acid in a position allowing the expression of said nucleic acid, b) introducing the cloned cDNA library into wild-type Arabidopsis; c) regenerating plants comprising said expression vector carrying a cDNA insert as being produced in step a), d) testing the plants regenerated for stress tolerance upon inducing said vector to express the cDNA insert, e) identifying plants with modified stress tolerance, f) identifying the gene(s) being comprised in the cDNA insert of said expression vector produced in step a) being present in said stress tolerant plant as gene(s) capable of modifying the stress tolerance in Arabidopsis.

In another embodiment, the present invention provides a method wherein said modification of stress tolerance is the enhancement of stress tolerance.

In another embodiment, the present invention provides method wherein said cDNA library is also introduced into an ADHl-LUC reporter Arabidopsis line in step b).

In another embodiment, the present invention provides a method wherein said plants are tested for salt tolerance, ABA insensitivity and/or activation of stress- responsive alcohol dehydrogenase (ADHl) promoter.

In another embodiment, the present invention provides a method wherein said cDNA library is prepared from plants held under stress conditions.

In another embodiment, the present invention provides a method wherein the cDNA introduced into the plant is expressed under inducible conditions during said testing in step d).

In another embodiment, the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 5, encoding the Arabidopsis gene HSP 17.6, conferring ABA insensitivity during germination. In another embodiment, the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 8, encoding the Arabidopsis gene At5g25160, conferring ABA insensitivity during germination.

In another embodiment, the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 15, encoding the Arabidopsis 2-alkenal reductase gene 2AER, resulting in improved salt tolerance.

In another embodiment, the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 17, encoding the Arabidopsis gene At4gl4520, resulting in improved salt tolerance.

In another embodiment, the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 27, encoding the Arabidopsis gene for RAP2.12 transcription factor, stimulating the expression of ADHl-LUC reporter gene. In another embodiment, the present invention provides an isolated nucleic acid, having a sequence at least 90% homologous to the sequence of any one of the above-refereed nucleic acids.

In another embodiment, the present invention provides an isolated nucleic acid that is complementary to any one of the above-refereed nucleic acids. In another embodiment, the present invention provides an isolated nucleic acid that is capable of hybridizing to any one of the above-refereed nucleic acids.

In another embodiment, the present invention provides a vector for expressing cDNA sequences, comprising

• chimaeric XVE fusion gene, encoding the chimaeric transcription activator for the pLexA promoter (XVE)

• recombination sites

• a resistance gene

• a marker for bacterial contraselection

• an Arabidopsis cDNA clone. In another embodiment, the present invention provides the use of the isolated nucleic acid according to the invention or the vector according to the invention for enhancing the stress tolerance of plants. In another embodiment, the present invention provides a kit for identifying genes being responsible for stress regulatory functions in a plant, comprising

• the vector according to the invention;

• instructions teaching the method according to the invention.

Detailed description

The Controlled cDNA Overexpression System (COS) according to the present invention offers a simple technology to screen for gene functions implicated in the regulation of specific stress responses, by providing a method for identifying genes being responsible for stress regulatory functions in Arabidopsis.

With respect to the present specification and claims, technical terms will be used in accordance with the below given definitions. With regard to the interpretation of the present invention, it shall be understood that the terms defined below are used in accordance with the given definitions even if said definitions might not be in perfect harmony with the usual interpretation of said technical term.

The term "gene" as used herein refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including its regulatory sequences. The term "native gene" refers to gene as found in nature. A "transgene" refers to a gene that has been introduced into the genome by transformation and is stably maintained. Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes. The term "endogenous gene" refers to a native gene in its natural location in the genome of an organism.

The term "promoter" refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. The term "promoter" includes a minimal promoter that is a short DNA sequence comprised of a TATA-box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. "Promoter" also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an "enhancer" is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.

The terms "transformed", "transformant" and "transgenic" refer to plants or calli that have been through the transformation process and contain a foreign gene extra-chromosomally or integrated into their chromosome. The term "untransformed" refers to normal plants that have not been through the transformation process. As used herein, "transgenic plant" includes reference to a plant, which comprises within its genome a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette. "Transgenic" is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered, as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation. The first step of the method according to the invention is the generation of cDNA library from samples of the Arabidopsis plant for cloning. This step can be schematically represented by the flow chart shown in Fig. 1. The library theoretically may be constructed from any kind of samples, without significant limitations. The library may be derived from single tissues, organs, plant parts, or conversely, a combination of tissues, organs or plant parts may be used as a source of the cDNA library. In addition, the samples may be derived from different development stages of the plant, or may be collected from plants held under specific environmental conditions. In a specific embodiment, since the method according to the invention being designed to identify genes being responsible for stress regulatory functions, the samples are taken from plants held under stress conditions. In further preferred embodiments, the stress condition may be salt tolerance, ABA insensitivity and/or activation of stress-responsive alcohol dehydrogenase (ADHl) promoter. The person skilled in the art will be readily able to determine the number, type and condition of samples he may seem necessary to obtain the best results when practicing the present invention. In the specific examples presented herein Arabidopsis (CoI-O) RNA samples were used, which were collected from ten different tissue sources, as shown in detail in Table 1 , Example 1.

An essential feature of the present invention is to use a vector suitable for inducible expression of the introduced nucleic acid. The rationale of opting for an inducible system is that constitutive overexpression of cDNAs encoding regulatory factors in stress signaling was observed to result frequently in severe developmental deficiencies. For example, constitutive overexpression of DREBl -type transcription factors resulted in growth retardation, abnormal development, late flowering and reduced fertility (Liu et al, 1998, Kasuga et al, 1999, Gilmour et al, 2000). Accordingly, the cDNA library used in the method of the invention is prepared in a chemically inducible expression vector, which offers precise transcriptional control and easy recloning of the cDNA inserts. Such vectors are generally available in the art of molecular biology, however, vectors should be carefully designed and tested for using them in plants, since the prior art contains no indication for the use of this type of vectors in plants. The average person skilled in the art will be capable to carry out the routine experiments required to optimize the functions of the vector.

A preferred vector according to the invention comprises the elements described in detail below. The inducible nature of the vector used according to the invention provided by chimaeric XVE fusion gene, encoding the chimaeric transcription activator for he pLexA promoter (XVE).

The vector according to the invention further comprises recombination sites for easy re-cloning of the inserted cDNA fragments. The person skilled in the art can select the necessary recombination sites from a wide set of well-known systems. The choice of the system is generally limited by the availability of the required recombinase enzyme to carry out the recombination. Techniques, however, are available to supply the necessary recombinase to the host plant, either provided on an introduced extra-chromosomal element, or in the genome itself. Therefore, the use of the state of the art recombination sites should not be limiting. Recombination may for example., be carried out using the so-called FRT site and variants thereof with the FIp recombinase or mutants thereof from Saccharomyces cerevisiae. However, other recombinase systems may equally well be used, including those of Cre recombinase and a variety of lox sites such as loxP from bacteriophage PI or variants or mutants thereof, e.g., Iox66, Iox71, Iox76, Iox75, Iox43, Iox44 and loxSll [C. Gorman and C. Bullock, Curr. Opinion in Biotechnology 2000, 11 : 455-460] or by using phage integrase ΦC31 or lambda integrase, which carries out recombination between the attP site and the attB site [A.C. Groth et al. PNAS 2000, 97: 5995-6000]. Further recombinase systems that could be utilized in the present invention are, but are not limited to, the p-recombinase-six system from bacterial plasmid pSM 19035, the Gin- gix system from bacteriophage Mu or the R-RS system from Zygosaccharomyces rouxii.

Suitable selection genes for use in plant cell expression include, but are not limited to, genes enabling for nutritional selection. Further selection markers are antimetabolite resistance genes conferring drug resistance, such as the neomycin phosphotransferase gene (neo) which can be selected for with kanamycin, the hygromycin B phosphotransferase (hyg, hph, hpt) gene which can be selected for with hygromycin, the chloramphenicol N-acetyl-transferase gene (cat) which can be selected with chloramphenicol or the Blasticidin S deaminase gene(Bsd) which can be selected with blasticidin, or beta-galactosidase (LacZ).

The vector further comprises a marker for bacterial contraselection, such as the ccdB suicide marker. In addition to the regulatory sequences according to the present invention, gene amplification signals and other regulatory sequences may be present on the vector. For an autonomous replication of the vector, furthermore, a replication origin is important. Polyadenilation sites are responsible for correct processing of the mRNA and splice signals for the RNA transcripts. The person skilled in the art will be readily able to design and prepare the most appropriate construction elements for the intended use.

In a preferred embodiment of the invention, the estradiol- inducible XVE/pER8 expression vector (Zuo et al., 2000) was therefore chosen as a starting point for construction of the COS library to secure conditional and controlled expression of cDNAs, in order to avoid potentially deleterious effects of their overexpression, which comprises all necessary elements to carry out the cloning and selection steps of the method of the present invention.

The cDNA library is cloned into the vector according to the invention in such a way that its position allows the expression of said nucleic acid. This is usually called that the cDNA inserted is operably linked to the regulatory elements present on the vector. As used herein, a regulatory element is "operably linked" to an expressed gene within a DNA construct if the regulatory sequence is able to influence the expression rate or manner of said structural gene under conditions suitable for the expression of said structural gene and for the functioning of said regulatory sequence. The person skilled art may use appropriate tools to design and prepare the connection region of the inserted cDNA and the regulatory elements for being operably linked.

In preferred embodiments, the method of the invention for identifying genes being responsible for stress regulatory functions may employ a second plant line to facilitate screening. Accordingly, the cDNA library is also introduced into an ADHl- LUC reporter Arabidopsis line. To generate and test an ADHl-LUC reporter gene construct, the person skilled in the art will be competent to select stae of the art methodologies, as well as may employ genes with similar functionality to achieve similar results to those described herein. An exemplary method is described in Example 1. Briefly, the promoter region of the Arabidopsis ADHl gene (AtI g77120) was amplified by PCR using gene specific primers. The amplified fragment contains the 5 '-region of the ADHl gene. Following sequence verification, the amplified promoter fragment is inserted into a promoter test vector to generating a transcriptional fusion with the firefly luciferase {LUC) reporter gene. The resulting ADHl-LUC reporter construct is introduced into Arabidopsis (for example, the CoI-O ecotype) by Agrobacterium-mediated gene transfer. Transformants are selected and tested for segregation of the kanamycin resistance marker in the T2 generation, as well as for the activity of ADHl-LUC reporter using bio luminescence imaging. Induction of ADHl-LUC by stress conditions can be tested with techniques and parameters given elsewhere in the present description, for example, by spraying seedlings with ABA solution or transferring seedlings on culture medium supplemented salts, sugars, or other agents known to induce the gene's expression, and measuring bio luminescence in time dependent fashion. The person skilled in the art can readily determine the necessary conditions for these above described steps. Flow chart of a preferred screening and testing procedure is depicted in Fig. 2.

In the next phases of the method according to the invention, the cDNA library is introduced into Arabidopsis plants, plants comprising the expression vector carrying a cDNA insert are regenerated, and screened for modified stress tolerance. Plant transformation, regeneration and screening procedures are generally well known in the art, non- limiting examples of which: transformation (Clough and Bent, 1998); screens for stress mutants (Ishitani et al, 1997, Xiong et al., 1999, Lee et al., 2002, Koiwa et al., 2006); large-scale transformation coupled with activation tagging and mutant selection (Kakimoto, 1996, Grant et al., 2003, Nakazawa et al., 2003). These steps may be carried out by any techniques known to the person skilled in the art. Once a DNA construct has been introduced into the plant cell, it may be needed to propagate and select those cells. To achieve this, the transgenic cells may be selected on appropriate media, then grown into calli by tissue culture methods. Shoot development may be induced from the calli on appropriate media, followed by regeneration of the whole plant. Certain parts of the plant (e.g. buds) can be transformed directly by Agrobacterium at a competent developmental stage. In this case seeds are selected to obtain transgenic progeny. Transgene constructs may be linked to selectable markers in order to differentiate between transformed and wild type genotypes. Useful markers are different antibiotics (e.g. kanamycin, G418, bleomycin, hygromycin, chloramfenicol, etc.) or some herbicides (e.g. BASTA). Components of DNA constructs introduced may derive from the same host plant (endogen), or from foreign organism (exogen origin). "Foreign" means that the DNA sequence is not found in the genome of the host plant. Heterologous constructs contain at least one region of foreign origin. The method of the invention comprises the identification of plants with modified stress tolerance. In a preferred embodiment, the modification is the enhancement of stress tolerance. Screening procedures for plants with modified stress tolerance are known for the person skilled in the art. The choice of the stress to screen for is non-limiting; the present method is suitable to identify plants with modified stress tolerance in respect of a wide variety of stresses. As exemplary stresses, the present description discloses three screening schemes, as detailed below, however, the person skilled in the art may select different stress regulatory functions to screen, but the specific protocols are generally follows the steps given below. Flow chart of an exemplary screening and testing protocol is provided in Fig. 2. The COS system was tested in several screening strategies, each of them aiming at a particular aspect of a stress response.

The method according to the invention utilizes facilitates high-through-put screening for phenotypes conferred by inducible overexpression of Arabidopsis transcripts in an Arabidopsis genetic background, and provides very efficient, easy-to- use and sensitive identification genes involved in the stress regulatory pathway tested. It is evident that application of the present COS technology is not restricted to intraspecies studies using Arabidopsis as a model but can also be extended to interspecies library screens, in which cDNAs from natural variants of drought, salt or cold tolerant plant species are tested in Arabidopsis or other model species. This extended COS approach provides the possibility for identification of natural sequence variations in known regulatory genes (i.e., based on cross-species sequence comparisons) that confer either increase or decrease in stress tolerance, or are associated with characteristically altered regulatory functions of signalling factors (i.e., transcription factors, protein kinases, protein phosphatases etc.) controlling a set of target genes in response to well-defined stress or hormonal stimuli.

In the following sections, three exemplary screening schemes are detailed that were employed during developing the present invention.

Screening for salt tolerance at seedling level permits the identification of genes which, upon overexpression, could enhance the germination rate or increase the survival of seedlings in saline environment. For salt tolerance in growth assays, Tl seeds are first germinated on a selective solid medium, then resistant seedlings are transferred onto selective medium supplemented with NaCl and estradiol. Plantlets that survives salt stress and remains green for at least two weeks under these conditions are rescued, transferred to non-selective medium for two weeks and subsequently into soil to produce seed. Alternatively, Tl seeds are germinated on selective (i.e., salt and estradiol containing) medium in the presence of claforan and salt tolerant seedlings are subsequently tested for hygromycin resistance.

Increased germination capacity on saline soils or during limited water availability can be an important feature of crop plants. Saline soils can be found in large areas in Hungary and in many other countries where salt ions are accumulating in top soils due to water shortages, excess irrigation, or effects of seawater. Water limitation can furthermore affect seed germination and plant growth in arid regions, or in temporal water shortages in spring or during dry summers. In such conditions, enhanced capacity to germinate and seedling survival can considerable improve yields. Therefore, the invention discloses genes identified by the method according to the invention, and that are useful in salt stressed conditions.

From the screened salt tolerant lines, line Nl 80 was identified as that overexpression of 2AER cDNA confers salt tolerance to transgenic plants. Previous studies document that the 2AER enzyme has a NADPH-dependent oxidoreductase activity, which probably plays a role in the detoxification of reactive carbonyls, and hence in the protection of cells against oxidative stress (Mano et al, 2005). As high salinity and drought is accompanied by enhanced production of reactive oxygen species (ROS; Price et al., 1989; Mittler, 2002), the functions of antioxidant enzymes, such as 2AER, are important in mounting salt tolerance by reducing the amount of reactive radicals (Jithesh et al., 2006). In fact, expression of Arabidopsis 2AER cDNA in yeast was found to confer tolerance to diamide, a drug that generates oxidative damage (Kushnir et al., 1995; Babiychuk et al., 1995), whereas 2AER overexpression in transgenic tobacco was reported to confer tolerance to photooxidative injury (Mano et al., 2005). Therefore, enhanced salt tolerance correlating with estadiol- induced expression of 2AER cDNA in the Nl 80 line indicates that low level transcription of 2AER in young wild-type seedlings is a limiting factor of salt tolerance, which is presumably related to the detoxification function of 2-alkenal reductase. Accordingly, the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 15, encoding the Arabidopsis 2-alkenal reductase gene 2AER, resulting in improved salt tolerance. Within the context of the present description, the term "isolated" means altered "by the hand of man" from natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living plant is not "isolated", but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term employed herein.

Another Arabidopsis line, line N33, also showed significantly increased germination capability on high salt medium. In this line PCR amplification and sequence analysis of the insert could identify the full length cDNA of the At4g 14520 gene. This gene encodes a previously uncharacterized protein, which, according to the TAIR Arabidopsis database is ,,DNA-directed RNA polymerase II-related; similar to RNA polymerase Rpb7 N-terminal domain-containing protein". The protein showed some similarity to RBP5 and RBP7 subunit of RNA Polymerase II, and had an Sl domain which was originally identified in ribosomal protein Sl and was implicated in RNA binding. The structure of the Sl domain is very similar to that of cold shock proteins. This suggests that they may both be derived from an ancient nucleic acid- binding protein. Accordingly, the insert of line N33 is a novel gene playing a specific role in regulating stress responses in Arabidopsis.

Therefore, the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 17, encoding the Arabidopsis gene At4g 14520, resulting in improved salt tolerance.

Screening for ABA insensitive germination aims at the identification of novel negative regulators of ABA signalling. Isolation of numerous lines displaying estradiol-dependent ABA insensitivity indicates that the COS technology could also effectively support this screening strategy. Screening for ABA insensitivity in germination assay is performed by germinating Tl seed on selective solid medium containing estradiol and ABA. A few days after sawing, germinated seedlings with emerged radicles and open green cotyledons are transferred to selective plates, and then two weeks later into soil.

Abscisic acid is a central regulator of stress responses in plants, and is implicated in stomata closing and root growth control during water stress, activation of numerous stress-responsive genes, seed maturation, dormancy and control of germination. Accordingly, targeted alteration of ABA sensitivity can be one way to modify and improve tolerance to such stress. Osmotic stress is a common component of water stress, dessication and salt stress, where ABA accumulation has been recorded. Engineering of ZFP3 activity can therefore be used to improve tolerance to these stresses at least at the germination level. Therefore, the invention discloses genes identified by the method according to the invention, and that are useful under conditions influenced by the ABA insensitivity of germination.

From the lines identified as being insensitive for ABA during germination, it was showed that regulated overexpression of small heat shock protein gene AtHSP 17.6A in line A26 conferred conditional ABA insensitivity, pointing to a novel function of this gene. It is well-documented that expression of small heat-shock proteins is induced by high temperature but some of them, including AtHSPl 7.6A, are also produced in developing seeds and in response to water stress (Vierling, 1991, Wehmeyer et al., 1996). In particular, AtHSPl 7.6A was reported to be highly expressed during seed maturation and its seed specific expression was shown to be dependent on the ABB transcription factor (Wehmeyer et al., 1996, Sun et al., 2001). Public transcript profiling data (http://www.genevestigator.ethz.ch/) suggest that AtHSP 17.6 A expression is strongly induced by heat-shock and several other environmental stresses, but only slightly influenced by ABA. Sun et al. (2001) reported that overexpression of AtHSP '17.6 A confers salt and drought tolerance in transgenic plants. In our assays, estradiol-dependent overexpression of HSP 17.6 A correlated with conditional ABA insensitivity of A26 seeds suggesting that this heat- shock protein is also implicated in the control of ABA sensitivity of seed germination, which is controlled by the transcription factors ABI3, ABI4 and ABI5 (Finkelstein et al., 2002). ABI5 is a basic leucin zipper (bZIP) transcription factor that regulates ABA signalling during seed development and germination by modulating the expression of a subset of AB A- induced genes. Transcription of ABI 5 is autoregulated and controlled by both ABI 3 and ABI4, and ABI5 shows also molecular interaction with ABI3 (Finkelstein et al., 2002, Brocard et al., 2002). Reduction of ABA- mediated induction of ABI5 by estradiol-dependent co-activation of HSPl 7.6A suggests that this small heat-shock protein interferes with transcriptional activation of ABI5, leading to a partial loss of function abi5 mutant phenotype and ABA- insensitivity of A26 seeds in the germination assay (Finkelstein et al., 2002). Accordingly, the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 5, encoding the Arabidopsis gene HSP17.6, conferring ABA insensitivity during germination.

Further, screening of ABA insensitive germination has lead to the identification of line A44. PCR amplification of the insert in this line lead to a single fragment whose nucleotide sequence coincided with the sequence of the gene At5g25160, encoding the C2H2 type Zinc finger protein ZFP3. The ZFP3 protein has a C2H2 domain, and belongs to a protein family, with several known members, which are implicated in transcription regulation. At present, no information on the function of the ZFP3 protein is available. Therefore, the gene cloned in line A44 is a novel regulator involved in Arabidopsis stress tolerance by modifying ABA sensitivity of the germination.

Accordingly, the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 8, encoding the Arabidopsis gene At5g25160, conferring ABA insensitivity during germination.

Screening for the activation of the ADHl-LUC reporter. The application of luciferase reporter gene constructs driven by different stress-induced promoters facilitates non-destructive detection of gene activation in mutant screens, as well as the identification of transcription factors controlling the expression of a particular target gene. Expression of the alcohol dehydrogenase gene ADHl is controlled by multiple regulatory pathways, including ABA and ethylene signalling (Jarillo et al., 1993, de Bruxelles et al., 1996, Peng et al., 2001). Whereas AtMYB2 is known to be a regulator of ADHl in response to hypoxia (Hoeren et al., 1998), the activation of ADHl by dehydration through ABA signalling is mediated by the G-boxl promoter element, which is independent of low-oxygen response (Dolferus et al., 1994, de Bruxelles et al., 1996). The screening is performed by transforming the characterized parental line (see Example 1) with the cDNA expression library. Subsequently, Tl seeds are germinated on selective plates resistant seedlings are assayed on estradiol- containing medium for luciferase activity. Seedlings showing enhanced luminescence are transferred onto non-selective medium for two weeks and then into soil to obtain T2 progeny. The data presented herein show that the estradiol-dependent overproduction of the AP2/ERF transcription factor RAP2.12 can also activate ADHl expression. The AP2/ERF transcription factor family includes key regulators of abiotic and biotic stress responses. AtEBP/RAP2.3 controls responses to heat and oxidative stress, and activates defense genes (Ogawa et al., 2005), while other AP2/ERF transcription factors control ethylene responses and activate PR gene promoters (Gu et al., 2000, Ogawa et al., 2005). The CBF/DREB subfamily of AP2/ERF factors is demonstrated to regulate transcription of cold and dehydration responsive genes through binding to conserved DRE promoter motives (Stockinger et al., 1997, Liu et al., 1998, Thomashow, 1999, Sakuma et al., 2002, Yamaguchi-Shinozaki and Shinozaki, 2006), and overexpression of several CBF/DREB factors is shown to confer enhanced tolerance to drought, salt stress and freezing (Liu et al., 1998, Kasuga et al., 1999, Gilmour et al., 2000). Whereas overexpression of RAP2.12 can activate the transcription of the ADHl gene, according to our data this transcription factor probably acts independently of ABA and ethylene regulation. Thus, RAP2.12 appears to perform a positive signalling function, which has not been linked so far to known regulators of ADHl transcription. Identification of RAP2.12 as novel regulator of ADHl promoter illustrates that the COS technology is also applicable to screen for promoter activation and identify response specific transcription factors.

Accordingly, the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 27, encoding the Arabidopsis gene for RAP2.12 transcription factor, stimulating the expression of ADHl-LUC reporter gene.

In preferred embodiments of the invention, isolated nucleic acids are provided that have substantially the same sequence as the isolated nucleic acids disclosed above, or they are highly homologous to each other. The terms "homologue" or "variant" or "homologous" with respect to nucleic acid sequences refer to a sequence having at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, and still more preferably at least 95% sequence identity with the said sequence. To determine whether the sequences are, say, at least 75% identical, algorithms and computerized embodiments thereof well known in the art may be used for the determination of this homology. For example, sequence homology searches may be performed using the TAIR BLAST service (http://www.arabidopsis.org/Blast/index.jsp).

In other preferred embodiments of the invention, further isolated nucleic acids are provided that are complementary to the above-mentioned isolated nucleic acids, or are capable of hybridizing thereto.

A nucleic acid molecule is regarded "hybridizable" with another nucleic acid molecule if it can specifically be bound to the other molecule (i.e., the binding can give rise to a signal that is distinguishable from the background noise and from the signal caused by the non-specific binding of any random sequenced nucleic acid molecule), preferably a nucleic acid molecule is regarded as hybridizable if it specifically binds to another nucleic acid molecule under stringent conditions. In a further aspect of the present invention, the use of the isolated nucleic acid or vector according to the invention according is provided for enhancing the stress tolerance of plants. As discussed above, application of the method according to the invention is not restricted to intraspecies studies using Arabidopsis as a model but can also be extended to interspecies library screens. cDNAs from natural variants of drought, salt or cold tolerant plant species may be tested in Arabidopsis or other model species. This approach provides the possibility for identification of natural sequence variations in known regulatory genes that confer either increase or decrease in stress tolerance. The genes thus identified may be put to use as a means for generating transgenic plants. The present invention also provides reagent kits to perform the methods according to the invention. Such kits may comprise the vector as described hereinabove, and instructions to carry out the method according to the invention. The kits optionally may contain any other devices, materials, solutions that are necessary to perform the specific protocol as devised in the spirit of the present invention.

Description of the figures Fig. 1. Strategy for generating the Controlled cDNA Overexpression library, and transgenic Arabidopsis plant populations carrying random cDNA inserts. 1) Isolation of total RNA from different Arabidopsis tissues. 2) Generation of cDNA with flanking Gateway attBl and attB2 recombination sites. 3) Creation of cDNA library in the Gateway Entry vector pDONR201. 4) Transfer of the cDNA library into the binary destination vector pER8GW. 5) Generation of an Agrobacterium pool harbouring pER8GW-cDNA clones and large-scale Agrobacterium-mediated Arabidopsis transformation. 6) Generation of transformed Tl seed populations to be used in various screening procedures to identify conditional stress response mutants. Fig. 2. Flow chart of the screening strategies employed for testing the COS technology and to identify stress regulatory functions in Arabidopsis. Consecutive steps of cDNA library transformation, different screening procedures, gene identification and characterization of the selected transgenic lines are illustrated schematically. Fig. 3. Gene identification and characterization of cDNAs conferring conditional activation of stress tolerance and reporter expression. 1) cDNA clones are amplified from genomic DNA of selected T2 plants using vector specific primers ER8A and ER8B. 2) The purified PCR fragment is sequenced with the ER8C and ER8B primers, and the identity of cDNA is defined by sequence homology search. The cDNA is cloned into pDONR201 vector using the Gateway BP reaction. 3) Sequence of the cloned insert can be verified using the M 13 forward and reverse primers that anneal to pDONR201 sequences. The cloned cDNA can be further moved into various destination vectors using the Gateway LR reaction. In order to confirm the phenotype identified in the primary genetic screen, the cDNA is inserted into a destination plant expression vector, such as pER8-GW or pMDC32 (Curtis and Grossniklaus, Plant Physiol 133:462-469). 4) For reconstruction and confirmation experiment, the resulting plant expression vector is used for an Agrobacterium- mediated plant transformation experiment.

Fig. 4. Characterization of the COS cDNA library. A) Schematic map of the T-DNA region of pER8GW vector. XVE: chimaeric XVE fusion gene, encoding the chimaeric transcription activator for the pLexA promoter (Zuo et al., 2000), HPT: hygromycin phosphotransferase gene, pLexA: LexA operator fused to a minimal promoter of Cauliflower Mosaic Virus 35S gene, attRl and attR2: Gateway recombination sites, CmR: Chloramphenicol resistance gene, ccdB: suicide marker for bacterial contraselection, T: RUBISCO rbcsS3A polyA sequence; RB and LB: T- DNA left and right border sequences, respectively. cDNA: randomly inserted cDNA clone; A and B: positions of T-DNA specific PCR primers used for amplification of inserted cDNAs. B) Comparison of size distribution of DNA fragments in the cDNA library and in the database of predicted full-length transcripts at TAIR (http://www.arabidopsis.org). Fragment sizes are indicated in kb.

Fig. 5. Sequence analysis of the A026 cDNA insert. A) The A026 cDNA sequence corresponds to the AT5G 12030 gene. Green color indicates the 5' UTR, yellow shows the open reading frame, and blue marks the 3'-UTR. The start and stop codons are highlighted in black. B) Amino acid sequence of A026 cDNA encoded HSP17.6A protein. The HSP20 domain is highlighted in grey color.

Fig. 6. Identification of Arabidopsis cDNAs conferring estradiol- inducible conditional ABA insensitivity. A) Screening for ABA insensitive seed germination in the presence of 2.5μM ABA and 4μM estradiol. Red arrow shows a germinated seedling within the non-germinating seed population. B) Testing ABA insensitivity of 25 T2 lines. Seeds were germinated on half strength MS medium containing 2.5μM ABA in the presence or absence of 4μM estradiol. Germination efficiencies were determined at day 14. C) ABA insensitivity phenotype of line A26. Seeds were germinated in the presence of 3μM ABA in the presence or absence of 4μM estradiol. Seedlings are shown 10 days (left) and 3 weeks (right) after germination. D) Comparison of germination efficiencies of wild-type (CoI-O) and A26 seeds in the presence and absence of estradiol on ABA-containing plates. The graph shows typical germination data derived from three independent experiments. E-G) Semi-quantitative RT-PCR analysis of HSPl 7.6A transcript levels in two weeks-old A26 seedlings using Actin2/8 as standard internal reference. E) Activation of HSPl 7.6A transcription by 4μM estradiol treatment with or without 50μM ABA. F) Induction of HSP '17.6 A transcription with heat-shock and salt stress in leaves of wild-type plants. G) Expression of HSPl 7.6 in different organs of wild-type Arabidopsis plants. RT-PCR analysis was performed with RNA templates prepared from roots (RO), rosette leaf (RL), cauline leaf (CL), stem (ST), unopened buds (BU), flowers (FL), young siliques (4 days after pollination, YS), developed, green siliques (10 days after pollination, GS), 3 and 8 days old seedlings growing in vitro on solid half strength MS medium under short day photoperiod (3S, 8S), and wilted rosette leaves (WL). Fig. 7. Comparison of regulation of ABI3, ABH and ABI 5 transcript levels in A26 seedlings (A: ABB, B: ABH, C: ABlS). Quantitative RT-PCR analysis was performed with RNA templates isolated from 3 days old A26 seedlings treated with either 20μM ABA, or 4μM estradiol, or their combination (A+E) for 3 and 8 hours. Ctr: untreated control. Relative values are shown using GAPDH2 as internal reference.

Fig. 8.. Sequence analysis of the line A44. A) Sequence of the PCR fragment amplified from A44. B) Result of homology search (blastn) of the A44 sequence. Predicted ATG of the At5g25160 gene is highlighted by yellow. Fig. 9. ZFP3 cDNA in A44. A) Amino acid sequence of the ZFP3 protein, encoded by the full length insert of At5g25160 gene, in the line A44. C2H2 domain is highlighted by yellow. B) Phylogenetic relationship of the ZFP3 -related C2H2 protein family in Arabidopsis.

Fig. 10. Germination of A44 line and wild type CoI-O plants on ABA containing medium. A) 10 days-old seedlings on ABA-containing (3 μM) medium. B)

3 weeks-old plantlets on high ABA medium. C) Germination efficiency of A44, the

ABA insensitive abi3 mutant and CoI-O wild type plants on medium supplemented by

5μM ABA.

Fig. 11. Germination and growth of A44 line and wild type CoI-O plants on high salt medium. A) Germinated seedlings in the presence and absence of the estradiol inducer. B) Growing plantlets on medium supplemented by lethal concentration of NaCl

Fig. 12. Expression of At5g25160 gene. A) RT-PCR analysis of ZFP3 expression in line A44. At5g25160 is induced by estradiol in the A44 line. B) Quantitative RT-PCR analysis of ZFP3 in CoI-O wild type plants. High salt and ABA can induce temporary ZFP3 expression in wild type plants.

Fig. 13. T-DNA insertion mutant of the At5g25160 gene. A) Position of the identified T-DNA insertion in a GABI insertion line. B) Germination of the mutant is hypersensitive to ABA (red circle). Fig. 14. Identification of cDNAs conferring enhanced salt tolerance. A) The screening for enhanced salt tolerance in plant growth assays was performed in the presence of 225mM NaCl and 4μM estradiol. Red arrow indicate salt tolerant plants within the population of salt sensitive seedlings. B) Conditional salt tolerance of seed germination of 15 selected COS lines. Germination efficiencies are shown 7 days after sowing the seeds on half strength MS medium containing 225mM NaCl in the presence (+E) or absence of 4μM estradiol. C) Comparison of salt tolerance of N180 and wild-type (CoI-O) seedlings germinated in the presence of 225mM NaCl with or without estradiol. D) Salt tolerance test in plant growth assay. Seven days old wild- type (CoI-O) and Nl 80 seedlings were transferred from half strength MS medium to selective medium containing 175mM NaCl with or withouth estradiol and grown for additional 7 days. E) Quantitative analysis of germination efficiencies of Nl 80 and wild-type (CoI-O) seeds on half strength MS plates containing 225mM NaCl with (+E: 4μM) or without estradiol. The data represents values of a typical germination assay of three independent experiments.

Fig. 15. cDNA insert identified in line N180. A) Line N180 carried the cDNA sequence of gene At5gl6970. Color codes are the same as in Fig. 1. B) Amino acid sequence of Nl 80 cDNA encoded 2-alkenal reductase protein. The ADH_zinc-N domain, which represents the C-terminal domain of Zinc-binding alcohol dehydrogenases, is highlighted in grey color.

Fig. 16. Analysis of AER (2-alkenal reductase, At5gl6970) transcription by semiquantitative RT-PCR. A) Transcription of AER cDNA is induced by estradiol only in line Nl 80 but not in the control wild-type (CoI-O) seedlings. RT-PCR (30 cycles) was performed with RNA templates purified from 3 weeks old seedlings treated with 4μM estradiol for 6 or 24 hours. B) RT-PCR (35 cycles) comparison of AER transcript levels in different organs of wild-type (CoI-O) plants (for abbreviatons see Fig. 6G legend). C) Effects of paraquat (4μM) and NaCl (20OmM) treatments on the transcription of AER gene. The RNA templates were standardized for equal level of Actin2/8 mRNA as internal control.

Fig. 17. Sequence of the PCR fragment amplified from the N33 line. Blastn sequence homology search of the N33 sequence, showing high homology with the At4g 14520 gene. Predicted ATG site is highlighted with yellow.

Fig. 18. Sequence analysis and domain structure of the protein encoded by the At4gl4520 gene. The encoded protein has similarity to the RPB5 and RPB7 subunit of RNA Polymerase II. Fig. 19. Salt and ABA tolerance of N33 plants. A) Germination in the presence of 1 μM ABA or 25OmM NaCl. B) Plant growth on medium supplemented with 20OmM NaCl.

Fig. 20. Germination efficiencies of wild type and N33 seeds on media supplemented by high concentrations of ABA, NaCl and PEG. Note, that germination efficiency of the N33 line is superior in the presence of estradiol, which activates the expression of the inserted At4g 14520 cDNA.

Fig. 21. Expression of the At4gl4520 gene in N33 and in wild type plants. A) At4gl4520 expression is very low in wild type plants but can be enhanced in the N33 line by estradiol induction. B) Organ specific expression of At4gl4520. Note enhanced activity in wilted leaves. C) Induction of At4gl4520 in young wild type plants by high salt.

Fig. 22. Germination of the transformed lines expressing the cloned At4g 14520 gene. A) Germination on media containing lethal concentrations of salt and mannitol. Germination efficiencies of 10 independent lines on high salt (B) and high osmotic media (C).

Fig. 23. Sequence analysis of cDNA inserts and characterization of ABA and salt tolerance of four truncated COS lines. A) Sequence analysis of cDNA conferring ABA insensitivity in line A49. Line 49 carried a truncated sequence of cDNA Atlg71950 (printed in red). The translational start and stop codons defining the full- length and predicted truncated open reading frames are highlighted in black. Green and blue shading indicates 5 'and 3' UTR sequences, respectively. B) Predicted amino acid sequence and domain structure of Atlg71950 subtilase protein. Sequences marked by yellow color represent the truncated amino acid sequence, which is predicted to be synthesized in line A49 upon estradiol induction. The signal peptide and subtilisin N domains of AtI g71950 protein are framed with red and blue lines, respectively. C) Comparison of germination rates of control wild type (Col) and A49 seeds on 0.5 MS medium containing 2mM ABA in the presence or absence of 2mM estradiol (E). Fig. 24. Sequence analysis of cDNA conferring ABA insensitivity in line Al 7.

Nucleotide sequence of cDNA At2g47900 encoding the Tubby-like protein 3 (AtTLP3). Color code and labelling is the same as in Panel A. The truncated cDNA identified in line Al 7 (printed in red) encodes a short C-terminal domain of AtTLP3 (highlighted by yellow). Fig. 25. Characterization of the ADHl-LUC reporter construct. A) Schematic map of ADHl promoter and firefly luciferase reporter gene fusion. Position of the transcription start is +1, whereas the position of promoter junction is +39. B) Temporal changes of bio luminescence in the parental ADHl-LUC line during treatments with 20OmM NaCl, 40OmM sucrose and 20μM ABA for 2, 4 and 12 hours. C) Time kinetics of luciferase-mediated light emission in the ADHl-LUC line during treatments with 20μM ABA, 40OmM sucrose, 20OmM NaCl and 1OmM H₂O₂. Values of total light emission were recorded at every 30 minutes throughout a period of 18 hours. Relative luminescence values are shown, where 1 is the luminescence of untreated control at time 0.

Fig. 26. Identification of cDNAs conferring estradiol- inducible activation of ADHl-LUC reporter. A) Image of a COS cDNA transformed ADHl-LUC seedling showing enhanced bio luminescence in the presence of 4μM estradiol. B) Salt and estradiol-activation of luminescence in the parental ADHl-LUC (ADH) and pER8GW-cDNA transformed ADH121 lines after exposing the seedlings to 20OmM NaCl, 4μM estradiol, and combined salt and estradiol treatment for 10 hours. C) Time kinetics of luciferase activities in the parental ADHl-LUC (ADH) and ADH121 lines during 20OmM NaCl, 4μM estradiol, and combined salt and estradiol treatments. Light emission was recorded at every 30 minutes for 16 hours and the values were normalized to luminescence detected in untreated plants at time 0. D) Temporal changes of bio luminescence in line ADHl 21 following exposure to 20μM ABA, 4μM estradiol (EST) and combined ABA+estradiol spraying. Images were recorded 4, 8, 16 and 24 hours after the treatments. E) Quantitative RT-PCR analysis of endogenous ADHl transcript levels in line ADH121. Two weeks old seedlings were treated with 20μM ABA, 4μM estradiol, and 20μM ABA + 4μM estradiol. GAPDH2 served as internal qRT-PCR reference. F) Histochemical detection of ADH enzyme activity in roots of parental ADHl-LUC and ADH121 lines shows that estradiol (EST) induces ADHl expression only in the roots of ADH121 seedlings. G) Confirmatory experiment showing that estradiol- induction of RAP2.12 confers activation of the ADHl-LUC reporter. The rescued cDNA insertion from line ADH121 was recloned into ER8GW and retransformed into the parental ADHl-LUC line. Bio luminescence (LUC) of 10 days-old seedlings is shown after spraying with 4μM estradiol.

Fig. 27. Sequence of the ADH121 cDNA insert. A) The ADH121 cDNA corresponds to gene AT1G53910. The color coding is described in Fig. 1. The ADH121 cDNA lacks 72 bp of 3'-UTR reported in the database for AT1G53910 (shown in lower case without highlighting). B) Predicted amino acid sequence of the AT1G53910 RAP2.12 protein. The AP2 domain is highlighted in grey color. RAP2.12 is similar to the ethylene response factor ERF and belongs to the B-2 subfamily of ERF/AP2 transcription factors.

Fig. 28. RAP2.12 is a member of the B-2 subfamily of AP2/ERF transcription factors and shows ABA-independent transcriptional regulation. A) Multiple sequence alignment of B-2 subfamily of ERF family transcription factors. Region of the conserved AP domain is framed. B) RT-PCR (30 cycles) analysis of estradiol- induced activation of RAP2.12 transcription in line ADH121. Seedlings of the parental ADHl- LUC and the ADH121 line were treated by 20 μM ABA, 4μM estradiol, and both for 6 and 24 hours. Note that RAP2.12 transcription is induced by estradiol but not by ABA. C) Comparative RT-PCR (35 cycles) analysis of RAP2.12 transcript levels in various organs of wild-type (CoI-O) plants. Actin2/8 was used as internal control (For abbreviations see Fig. 6G legend).

Example 1. Materials and methods

Construction of the COS library

Flow chart of the cDNA library construction is shown in Fig. 1. The library was constructed from Arabidopsis (CoI-O) RNA samples, which were collected from ten different tissue sources (Table 1).

Table 1. List of Arabidopsis organs and tissues used for RNA isolation and construction of COS cDNA library.

RNA was isolated according to Chomczynski and Sacchi (1987). Equal amounts of RNA samples were pooled and used for cDNA synthesis following the protocol of Super SMART PCR cDNA Synthesis Kit (Clontech). PCR amplification of the primary cDNA was performed with the Advantage-2 polymerase mix and PCR PrimerIIA as recommended by the manufacturer (Ix 95°C/90sec, 65 °C/30sec, 68 °C/6 min, 18x 95 °C/10sec, 65 °C/10sec, 68 °C/6min, Ix 68 °C/10min). Using 10 μl aliquot as template, 5 further cycles of amplification were performed with a combination of ATTSMl and ATTSM2 primers (see Table 4). The PCR product was purified with QIAquick PCR purification kit (Qiagen) and then cloned into pDONR201 using an overnight BP Clonase reaction (Invitrogen) as recommended by the manufacturer. Aliquots of the reaction mix were transformed into electrocompetent E.coli DHlO cells. Plasmid DNA was isolated from one million colonies and aliquots were used for transferring cDNA inserts into the pER8GW vector using the LR Clonase reaction (Invitrogen). Upon transformation of the pER8GW cDNA library into E.coli DHlO, plasmid DNA was isolated from half million colonies and introduced in aliquots into electrocompetent Agrobacterium GV3101 (pMP90) cells (Koncz et al, 1994).

Generation and testing of ADHl-LUC reporter gene construct Promoter region of the Arabidopsis ADHl gene (AtI g77120) was amplified by

PCR using the gene specific primers ADH-I and ADH-2 (see Table 4). The amplified fragment contains the 5'-region of the ADHl gene extending from position -2385 to - 20 upstream of the ATG codon (position +39 downstream of the transcription start, Fig. 25A). Following sequence verification, the amplified promoter fragment was inserted into the Hindlll site of the promoter test vector pBinLuc+ (Mullineaux et al. 1990; a kind gift of F. Nagy, BRC, Szeged, Hungary) generating a transcriptional fusion with the firefly luciferase (LUC) reporter gene. The resulting ADHl-LUC reporter construct was introduced into Arabidopsis (CoI-O ecotype) by Agrobacterium-mediated gene transfer. Twenty independent transformants were selected and tested for segregation of the kanamycin resistance marker in the T2 generation, as well as for the activity of ADHl-LUC reporter using bio luminescence imaging (Alvarado et al., 2004). Induction of ADHl-LUC by ABA was performed by spraying seedlings with 50μM ABA solution or transferring seedlings on culture medium supplemented by 20OmM NaCl, 40OmM sucrose or 1OmM H₂O₂ and measuring bio luminescence in 30 minute intervals for 18 hours. Luminescence values were analysed with the Metaview software (Universal Imaging Corporation, Downingtown, PA, USA). For graphical presentation, luminescence values were normalized to background.

Plant transformation and screening procedures.

The pER8GW COS cDNA library was introduced into Arabidopsis (CoI-O) by large-scale in-planta transformation (Clough and Bent, 1998). Tl seed of 1000 infiltrated plants were collected in bulk. To select for estradiol- inducible dominant gain-of function phenotype, three selection schemes were employed. To select for salt tolerance in growth assays, Tl seeds were first germinated on agar-solidified half strength MS medium (0.5MS) containing 0.5% sucrose, 20mg/l hygromycin and lOOmg/1 claforan. Subsequently, 40,000 hygromycin resistant seedlings were transferred onto selective 0.5MS medium supplemented with 225mM NaCl and 4μM estradiol. Plantlets that survived salt stress and remained green for at least two weeks under these conditions were rescued, transferred to 0.5MS medium for two weeks and subsequently into soil to produce seed. Alternatively, Tl seeds were germinated on selective (i.e., salt and estradiol containing) medium in the presence of claforan and salt tolerant seedlings were subsequently tested for hygromycin resistance. Screening for ABA insensitivity in germination assay was performed by germinating Tl seed on solid 0.5MS medium containing 0.5% sucrose, lOOmg/1 claforan, 4μM estradiol and 2.5μM ABA. 5 days after sawing, germinated seedlings with emerged radicles and open green cotyledons were transferred to hygromycin-containing plates, and then two weeks later into soil. Based on the previously determined transformation frequencies, approximately 20,000 transformed seeds were screened in each of salt and ABA germination screens. To screen for activation of the ADHl-LUC reporter, the characterized parental line (see: Results) was transformed with the cDNA expression library. Subsequently, Tl seeds were germinated on hygromycin plates and 20,000 Hyg resistant seedlings were assayed on 4μM estradiol-containing medium for luciferase activity. Seedlings showing enhanced luminescence were transferred onto 0.5MS medium for two weeks and then into soil to obtain T2 progeny. Flow chart of the screening and testing procedure is depicted in Fig. 2.

Rescue ofcDNA Inserts from Transgenic Plants cDNAs carried by the pER8GW T-DNA inserts were rescued by PCR amplification using genomic DNA templates prepared from transgenic plants according to Dellaporta et al. (1983), and the ER8A and ER8B primers that are complementary to vector sequences flanking the attRl and attR2 sites (see Table 4). The cDNAs were sequenced with the same primer pair and the sequences were analyzed by BlastN homology searches. To verify the phenotype conferred by estradiol- inducible cDNA expression, the PCR amplified cDNA was cloned into pDONR201 vector using the Gateway BP Clonase reaction (Invitrogen) and then moved into the binary vector pER8GW by Gateway LR Clonase reaction. A flow chart of the cloning procedure is depicted in Fig. 3.

RT-PCR Analysis of Gene Expression

To monitor estradiol- induced production of cDNA encoded transcripts, either real-time or semiquantitative RT-PCR was performed. Hormone and stress treatments were carried out with 3 weeks old plants grown in sterile culture in vitro under short day photoperiod (8 h light/16h dark) by transferring them into liquid culture medium supplemented by different additives. If not stated otherwise, the following treatments were employed: 20μM ABA, 20OmM NaCl, 40OmM sucrose, 1OmM H₂O₂, 4μM paraquat in liquid half strength MS medium for 3 to 24h. Control plants were incubated for the same time period in half strength MS medium. Heat shock was performed at 37°C for 3 hours in a humid chamber, while control plants were kept under similar conditions at 22°C for the same time. To induce transcription of the inserted cDNAs, plants were sprayed with 4 μM 17-β-estradiol (Sigma, prepared in DMSO as 4mM stock and then diluted in water) and harvested at a defined time-point following the treatment. Control plants were sprayed with 0.1% DMSO in water. For comparative analysis of transcript levels in plant tissues and organs, the samples were harvested either at the same time or within the same light period of the day. Leaves were collected from 4 weeks-old greenhouse-grown plants. Siliques were removed from flowering plants 4 and 10 days after pollination. Wilted leaves were collected from 4 weeks-old greenhouse-grown plants, which were kept without watering for 5 days. Roots samples were collected from 4 weeks-old plants grown in the greenhouse.

Total RNA was isolated from plant tissues using the Tri-reagent method

(Chomczynski and Sacchi, 1987). 1 μg DNase-treated RNA was used for reverse transcription (High capacity cDNA reverse transcription kit, Applied Biosystems,

Foster City, CA, USA). Semi-quantitative PCR reactions were performed in 50μl volume with using lμl cDNA (1/20 volume of reverse transcriptase reaction) as template and Dupla-Taq™ polymerase (Zenon Bio, Szeged) employing the following protocol: one cycle of 94^°C/2min, 25 to 35 cycles of 94^°C/30sec, 60^°C/30sec, and 72^°C/30sec. Real time quantitative RT-PCR reactions were prepared with SYBR^® Green JumpStart™ Taq ReadyMix™ (Sigma) employing the following protocol: denaturation 95°C/10 min, 40 to 45 cycles of 95°C/10 sec and 60°C/l min, with ABI PRISM 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA). Gene specific primers, used for RT-PCR analysis, are described in (see Table 4). Actin2/8 (At3gl8780) and GAPDH2 (Atlgl3440) used as internal reference (An et al, 1996). Experiments were repeated at least twice.

ADH enzyme assay

Detection of ADHl enzyme by histochemical staining was performed as described (Baud and Graham, 2006). Three weeks old seedlings from the parental ADHl-LUC and pER8GW-cDNA transformed ADH121 lines were treated with liquid 0.5MS medium containing either 4 μM estradiol and 0.1% DMSO, or 0.1% DMSO as control, for 24 hours. Subsequently, the seedlings were transferred into the ADHl reaction buffer containing 100 mM sodium phosphate (pH 7.5), 400 μM NAD⁺, 100 μM Nitro Blue Tetrazolium (Sigma-Aldrich Co., St. Louis, USA) and 3% ethanol as substrate, and incubated at 30 ⁰C for 10 min. The enzyme reaction was subsequently stopped by removing the reaction mixture and rinsing the plants with distilled water.

Sequence Analyses

Sequence homology searches were performed using the TAIR BLAST service (http://www.arabidopsis.org/Blast/index.jsp). PCR primers were designed with the Primer3 software (http://biotools.umassmed.edu/bioapps/primer3_www.cgi). Multiple sequence alignments were generated using the ClustalW program (http://www.ebi.ac.uk/clustalw/index.html). Protein domain analyses were performed using the SMART service (http://smart.embl-heidelberg.de/). Analysis of publicly available transcript profiling data was performed using the Genevestigator service and database (http://www.genevestigator.ethz.ch/).

Example 2. Construction and testing of the Controlled cDNA Overexpression System (COS)

An Arabidopsis cDNA library was constructed in the pDONR201 vector using a Super SMART cDNA Synthesis system (Clontech; Fig. 1) in combination with the GATEWAY cloning technology and RNA templates from different Arabidopsis organs, dark-grown, green and salt-stressed seedlings, and cultured cells (Table 1). The cDNA library was subsequently transferred into pER8GW, a GATEWAY- version of estradiol- indicuble expression vector pER8 (Zuo et al., 2000), which carries an attRl and attR2 recombination cassette between Xhol and Spel cloning sites of pER8 (I. Sommsich and B. Ulker, MPIZ (Cologne), Fig. 4A). In the resulting COS cDNA library each clone carried a cDNA and the average insert size was 1.1 kb, similarly to the cDNA expression library of LeClere and Bartel (2001). The size distribution of cDNA inserts in the COS library and full-length cDNA sequences deposited in the TAIR database were similar to that described for the full-length FOX cDNA library (Fig. 4B, Ichikawa et al., 2006). Random sequencing of 50 cDNA clones indicated that about 60% of clones carried full-length cDNAs, whereas in the library of LeClere and Bartel (2001) this ratio was 43%. The COS library was introduced into Agrobacterium GV3101 (pMP90) (Koncz and Schell, 1986) by electroporation and used subsequently for transformation of wild-type Arabidopsis (CoI-O) plants, as well as a transgenic line carrying the ADHl-LUC reporter gene construct. Ti progeny of infiltrated plant populations was used for the subsequent screening procedures. To test the utility of the COS system, three screening strategies were employed by selecting for transformants showing ABA insensitivity in germination screens, salt tolerance in seedling growth assays, and activation of a stress-inducible ADHl-LUC reporter gene in seedlings (Fig. 2). Twenty to forty thousand transgenic seeds and seedlings were screened in each of these assays using estradiol in the growth medium for transient induction of cDNA expression. Upon selection, the transgenic plants were transferred into estradiol- free medium and then into soil to set seed. The segregation of selected phenotype in the T2 offspring was recurrently assayed by germinating and growing seedlings both in the presence and absence of estradiol, and testing for co-segregation of estradiol- induced conditional phenotype with the hygromycin resistance marker of pER8GW T-DNA insert. Subsequently, cDNA inserts present in the selected Arabidopsis lines were isolated by PCR amplification from genomic DNA templates using the ER8A and ER8B primers that anneal to the pER8 vector T-DNA sequences flanking the attB recombination sites (Fig. 3, Table 4). Subsequently, the isolated cDNAs were sequenced and characterized by performing BLAST homology searches with the Arabidopsis sequence database (www.arabidopsis.org). As each cDNA was flanked by attBl and attB2 recombination sites, their PCR fragments could easily be recloned in the GATEWAY entry vector pDONR201 and subsequently into pER8GW for recurrent transformation of Arabidopsis to confirm the phenotype conferred by their estradiol- inducible expression (Fig. 3). Using the Gateway technology, the rescue, identification and subsequent confirmatory recloning of cDNAs required less than two weeks providing a high-through-put technology for functional analysis.

Example 3. Identification of factors affecting ABA-sensitivity of seed germination

To identify cDNAs that confer ABA-insensitive seed germination when expressed conditionally during estradiol induction, one million of Tl seeds containing about 20,000 transformants were plated on half strength MS agar medium containing 2.5μM ABA and 4μM estradiol. Under this selective condition, the germination of wild-type seeds was completely blocked. ABA-insensitive seeds, which germinated within 7 to 10 days producing seedlings with open green cotyledons and emerged radicles, were transferred onto ABA and estradiol free, hygromycin containing medium (Fig. 6A). 74 ABA-insensitive, hygromycin resistant plants were identified. T2 progeny of these plants was retested for the ABA insensitive seed germination phenotype in the presence and absence of estradiol along with parallel scoring for single locus segregation of the T-DNA-encoded hygromycin resistance marker. For further analysis, we chose 25 lines, which showed different degree of estradiol- dependent ABA insensitivity in the germination assay (Fig. 6B). From these, ABA insensitive germination of 19 lines was completely estradiol-dependent, whereas 6 lines displayed some degree of ABA insensitive germination also in the absence of estradiol. From a subset of selected lines, we have rescued and sequenced 11 cDNAs, and found that they code for proteins that were previously reported to play various roles in different abiotic stress responses, including a glutathione-S-transferase, a SNFl -related kinase regulatory subunit, a lipid transfer protein, a subtilase, and a dehydrin type protein (Table 2, A-lines).

10 Table 2. Identification of COS cDNAs conferring estradiol-dependent ABA insensitivity, NaCl tolerance and activation of the ADHl-LUC reporter gene

line Gene encoded protein scree 5' end from iiisc n ATG (bp)

■■11 Atig7S380 glutathione S-transferase 8 (ATGSTU19) ABA -69 0.97

L14 Atl g6736Q Rubber Elongation Factor (REF) family protein ABA -178 1.19

Λ7 At2g4790U Tubby Like Protein 3 (ATTLP3) ABA +768 0.4

L 18 At5g59960 unknown expressed protein ABA -49 1.42

.26 AtSgI 2030 cytosolic small heat shock protein (ATHSP17.6A) ABA -54 0.63

.44 At5g25160 ^ ABA -36 0.95

.49 Atlg71950 subtilase family protein ABA +67 0.61

.53 At3g48530 SNF 1 -related prot. kinase γ regulatory subunit (AKING 1 ) ABA -118 1.56

.57 At2gl7690 F-box family protein ABA +860 0.4

L62 At2g4518Q seed storage/lipid transfer protein (LTP) ABA -26 0.65

L64 Atlg7195ύ subtilase family protein ABA +67 0.61

L66 Atljj544_lO dehydrin family protein, similar to aldose 1-epimerase ABA -62 0.62

TJH121 At! g539 ! 0 ERF/AP2 transcription factor family (RAP2.12) LUC -98 1.42

.DH242 At3g46ϋ8ϋ zinc finger (C2H2 type) protein, similar to ZAT7 LUC +1 0.49

[022 At3gO5θ3θ serine/threonine kinase, similar to CRKl protein NaCl -274 2.08

[33 At4gl4520 Unknown protein, similar to RNA polymerase Rpb7 NaCl -28 1.0

[075 At2g45180 seed storage/lipid transfer protein (LTP) NaCl -30 0.65

[121a At4gO132Q CAAX protease (ATSTE24) NaCl -300 1.56 ri21b At2g3086U glutathione S-transferase class phi 9 (ATGSTF9) NaCl +1 0.83

[125 Atljj_l 3_520 unknown protein NaCl -24 1.26

[162 AtI «27020 unknown protein NaCl +527 0.67

[168 At4j^j2222ϋ iron-sulfur cluster assembly protein (ATISUl) NaCl -50 0.84 ri74 At3g22230 60S ribosomal protein L27 (RPL27B) NaCl +114 0.46 ri80 At5gJ_.697O_, 2-alkenal reductase (AT-2AER) NaCl -45 1.2 [183 Al4gl5550 indole-3 -acetate beta-D-glucosyltransferase (IAGLU) NaCl +659 1.05 ri84 At3j2j_.742g glyoxysomal protein kinase 1 (GPKl) NaCl +528 0.52

[186 At2gl9310 heat-shock protein, similar to HSPl 8.2 NaCl -13 0.6

[187 At3g53740 60S ribosomal protein L36 (RPL36B) NaCl -179 0.6 π 88 At2g25450 unknown protein, similar to ACC oxidase NaCl +1150 0.3

Line A26 carried a full-length cDNA of class II small heat-shock protein 17.6A (HSP17.6A, At5gl2030) gene, including a 5 '-untranslated leader of 53bp and 3'-UTR sequences of 127bp (Fig. 5). As Hspl7.6A has not been implicated so far in 5 the control of ABA-response of seed germination, we have performed further characterization of line A26. In the T2 generation, the conditional ABA insensitivity of line A26 was dominant, and 3:1 segregation of hygromycin resistant and sensitive offspring indicated that this trait is linked to a single T-DNA insertion. A26 seeds germinated in the presence of 3μM ABA and 4μM estradiol, while their ABA

10 sensitivity was similar to wild-type seeds in the absence of estradiol (Fig. 6C,D). Semiquantitative RT-PCR analysis confirmed that HSP 17.6 A expression in line A26 was indeed induced only by estradiol, but not by ABA (Fig. 6E). As expected, HSP 17.6 A transcription was activated by heat-shock and salt stress in wild-type plants (Fig. 6F). HSP 17.6 A showed very low expression in most organs except for roots and

15 wilted leaves (Fig. 6G).

ABA sensitivity of seed germination is controlled by the transcription factors ABB, ABI4 and AB 5 (Finkelstein et al, 2002). Therefore, we tested the transcript levels of these key transcription factors in A26 plants treated with or without ABA and estradiol. As in wild-type, ABA treatment of A26 seeds lead to the induction of

20 expression of ABI3, ABI4 and ABI5 genes, whereas estradiol-treatment alone had no effect on their transcription. However, combined ABA and estradiol treatment, triggering co-expression of HSP17.6A with these transcription factors, resulted in 85% reduction of ABI5 transcription compared to ABA treatment alone, and resulted in 15 to 25% lower ABI3 and ABI4 transcript levels (Fig. 7). Nevertheless, heat stress

25 and salt treatment (15OmM NaCl) did not suppress or enhance the capability of line A26 to germinate in the presence of ABA and estradiol, whereas 3μM ABA in combination with heat or salt stress inhibited similarly the germination of wild-type and A26 seeds in the absence of estradiol (data not shown; see Materials and methods). Further, screening of ABA insensitive germination has lead to the identification of line A44. PCR amplification of the insert in this line lead to a single fragment whose nucleotide sequence coincided with the sequence of the gene At5g25160, encoding the C2H2 type Zinc finger protein ZFP3 (Fig. 8). The ZFP3 protein has a C2H2 domain, and belongs to a protein family, with several known members, which are implicated in transcription regulation (Fig. 9, Table 3). At present, no information on the function of the ZFP3 protein is available. Therefore, the gene cloned in line A44 is a novel regulator involved in Arabidopsis stress tolerance by modifying ABA sensitivity of the germination.

Whereas germination of Arabidopsis seeds is completely blocked in the presence of 3mM ABA, when A44 and wild type seeds were germinated on high ABA medium, A44 seeds could germinate only in the peresence of estradiol, suggesting that enhanced expression of the inserted gene is responsible for ABA insensitivity (Fig. 10). Germination of A44 seeds tolerant to 5mM ABA, which seriously delayed the well known ABA insensitive abi3 mutant. A44 showed some degree of salt tolerance at the germination level (Fig. 11), but this tolerance was less when compared to N33 line (see Example 4). ABA and salt tolerance depended on estradiol treatment, which could enhance the activity of the At5g25160 gene in A44 line, but not in wild type plants (Fig. 12). Transcript analysis showed that At5g25160 gene expression is responsive to salt and ABA treatments in wild type plants. Conditional At5g25160 gene activation could therefore convert germination insensitive to ABA inhibition. In order to examine the effect of loss-of function At5g25160 mutants, we have identified T-DNA insertion mutants in public mutant collections. Germination of zfp3 mutants was more sensitive to ABA inhibition (Fig. 13). All these data suggested that the ZFP3 protein, encoded by the At5g25160 gene is implicated in ABA signal transduction, and functions as negative regulator of ABA action during germination.

Although most ABA insensitive lines carried full-length cDNA inserts, several of them were truncated at the 5' end. Lines A17 and A49 (as well as lines N174 and N 183 identified in salt stress experiments, see Example 4 for details) illustrate that estradiol- inducible expression of truncated cDNA may also confer specific alterations in stress responses. All four examined COS lines showed 3:1 segregation of hygromycin resistance marker of pER8 T-DNA suggesting that they likely carried T- DNA insertions at single loci. PCR amplification of cDNAs from each of these lines resulted in unique DNA fragments, which were subsequently sequenced to annotate the cloned cDNAs. The sequence analysis indicated that expression of partial cDNAs may lead to the synthesis of truncated protein products. Although the production of predicted truncated proteins could not be confirmed in the absence of available antibodies, estradiol- induced expression of all examined cDNAs resulted in similar segregation ratios of ABA and salt tolerance versus sensitivity phenotypes in repeated experiments. ABA insensitivity of lines A17 and A47 and salt tolerance of lines N174 and Nl 83 were tested in three independent germination assays and could only be detected only in the presence of estradiol (Fig. 23, Fig. 24).

Example 4. Identification of a cDNA conferring increased salt tolerance

To screen for enhanced salt tolerance of seed germination and seedling growth, a population of 40,000 transgenic Tl seed was germinated on plates containing hygromycin, and resistant plantlets were transferred to selective half strength MS agar plates supplemented with 225mM NaCl and 4μM estradiol. Alternatively, 20,000 seeds were germinated on half strength MS agar plates containing 225mM NaCl and 4μM estradiol. Under this condition, wild type seeds either did not germinate or the seedlings died after germination. Lines displaying salt tolerant germination and subsequent development of green seedlings within 15 to 20 days on the selective medium (Fig. 14A) were transferred to soil to set seed. Salt tolerance of T2 offspring of selected lines was recurrently tested in germination and growth assays using salt selection in the presence or absence of 4μM estradiol. Estradiol-dependent conditional salt tolerance characterized by at least two-fold higher germination rate compared to wild-type seeds was confirmed for 14 lines (Fig. 14B), from which the cDNA inserts were subsequently PCR amplified. Nine from the sequenced cDNAs carried full-length coding regions of a CDK2 -related serine/threonine kinase, a seed storage/lipid transfer protein (LTP), AtSTE24 CAAX protease, AtISUl (Iron-sulfur cluster assembly complex protein), 60S ribosomal protein L27 (RPL27B) and several unknown proteins (Table 2, N-lines). 5 lines carried inserts with 5' truncated cDNAs (Fig. 23, Fig. 24). From this population, line Nl 80 showing high salt tolerance and 3:1 segregation of hygromycin resistance marker of a single copy pER8GW T-DNA insert was characterized. In the presence of estradiol and 225mM NaCl the T2 offspring of line Nl 80 germinated at least two days earlier than wild-type and estradiol-untreated Nl 80 seeds, and the germination efficiency reached nearly 100% already 10 days after sawing. By contrast, line Nl 80 displayed only the emergence of radicles and similar germination efficiency as control wild-type seed on estradiol- free selective medium containing 225mM NaCl (Fig. 14C, E). When 5 days-old seedlings were germinated on half strength MS medium and were transferred to medium containing 175mM NaCl, Nl 80 plantlets continued to grow only in the presence of estradiol (Fig. 14D). From line Nl 80 a single cDNA insert was PCR amplified and proved to carry the full-length coding region of At5gl6970 2-alkenal reductase enzyme (2AER, EC 1.3.1.74, Fig. 15). Compared to wild-type and estradiol-untreated Nl 80 seedlings, semi-quantitative RT-PCR analysis indicated that the transcription of 2AER is estradiol- induced and correlates with conditional salt tolerance of line N180 (Fig. 16A). However, upon increasing the sensitivity of RT-PCR detection (i.e., higher cycle number) transcription of the 2AER gene could also be detected in all tested organs with highest abundance in cauline and rosette leaves, wilted leaves, and developed siliques (Fig. 16B).

Oxidative stress imposed by 4 μM paraquat treatment for 3 and 8 hours on 14 days-old, in-vitro germinated wild type seedlings (plantlets with 4 leaves), as well as treatment of similar seedlings with 20OmM NaCl for 3 and 8 hours, resulted in moderate increase of 2AER transcript levels (Fig. 16C). Similarly to our results, inspection of public transcript profiling data (http://www.genevestigator.ethz.ch) indicated that transcription of the 2AER At5gl6970 gene is upregulated by hydrogen peroxide, senescence and wounding. Screening for ABA insensitivity and salt tolerance has also resulted in the identification of several lines carrying truncated cDNA inserts (Table 2). As in all other cases examined, the estradiol-dependent ABA insensitivity and salt tolerance phenotypes of four of these lines were repeatedly tested in three independent experiments. Sequence analysis showed that the identified cDNA inserts contained in frame ATG codons for potential translation of N-terminally truncated proteins carrying some functionally important regulatory domains (Fig. 23, Fig. 24). However, in the absence of suitable antibodies against these proteins, it remained an open question whether the observed estradiol-dependent dominant stress tolerance phenotypes resulted from overproduction of truncated proteins, or from dominant co- suppression mediated by the corresponding truncated transcripts as suggested by LeClere and Bartel (2001), or both.

Another Arabidopsis line, line N33, also showed significantly increased germination capability on high salt medium. In this line PCR amplification and sequence analysis of the insert could identify the full length cDNA of the At4g 14520 gene (Fig. 17). This gene encodes a previously uncharacterized protein (Fig. 18), which, according to the TAIR Arabidopsis database is ,,DNA-directed RNA polymerase II-related; similar to RNA polymerase Rpb7 N-terminal domain- containing protein". The protein showed some similarity to RBP5 and RBP7 subunit of RNA Polymerase II, and had an Sl domain which was originally identified in ribosomal protein Sl and was implicated in RNA binding. The structure of the Sl domain is very similar to that of cold shock proteins (Fig. 18). This suggests that they may both be derived from an ancient nucleic acid-binding protein. Accordingly, the insert of line N33 is a novel gene playing a specific role in regulating stress responses in Arabidopsis. Estradiol-induced overexpression of the At4gl4520 gene lead to increased germination and growth on media supplemented by lethal concentration of salt (25OmM NaCl, Fig. 19, Fig. 20). Improved germination in the presence of ABA and polyethylene glycol (used to generate of high osmotic stress) was also observed Fig. 19, Fig. 20). Stress tolerance depended on estradiol treatment, suggesting that this feature derives from overexpression of the inserted DNA fragment. In fact, RT-PCR analysis of At4gl4520 transcription has confirmed the estradiol-dependent activation of this gene in N33 line, which was not the case in wild type (CoI-O) and non-treated plants (Fig. 21A). Analysis of At4gl4520 expression in wild type plants revealed the presence of low transcript levels in all tested organs, with higher levels in wilted leaves (Fig. 21B) and in salt-treated plants (Fig. 21C). These results suggest, that the At4g 14520 gene expression is enhanced by some type of stress (dessication, leading to wilting and salt stress), suggesting that the gene's function can be related to stress responses. In order to confirm that the identified gene indeed is capable to generate the observed phenotype, the full length cDNA was cloned into the pER8GW expression vector, used originally for the construction of the cDNA library, and introduced again into wild type Arabidopsis. Several transgenic lines showed estradiol-dependent germination on high salt (25OmM NaCl) and high osmotic medium (50OmM mannitol), confirming that enhanced level of At4gl4520 expression can create increased stress tolerance (Fig. 22).

Example 5. Identification of factors conferring trans-activation of the ADHl-LUC reporter gene

To test the applicability of COS technology in screening for factors that confer trans-activation of a stress-regulated promoter, we have constructed an ADHl-LUC luciferase reporter gene, the activation of which can be monitored using nondestructive low light imaging (Alvarado et al, 2004). Transcription of the Arabidopsis ADHl gene (Atlg77120) is induced by both ABA-dependent (dehydration, high salinity) and independent (cold and anoxia) regulatory pathways (de Bruxelles et al., 1996). The 2358bp long ADHl promoter, which have previously been characterized by site-specific mutagenesis and in vivo footprinting studies (Dolferus et al., 1994), was fused to a promoterless firefly luciferase Fβuc+ reporter gene in pBINluc⁺ (Fig. 25 A, Mullineaux et al., 1990) to generate an ADHl-LUC reporter construct, which was introduced into Arabidopsis. Lines carrying single locus insertions of ADHl-LUC reporter in homozygous form were obtained and tested for basal level of ADHl-LUC conferred light emission in seedlings and various organs of developing plants (data not shown). In the parental line chosen for COS library transformation, low light imaging showed that the ADHl-LUC activity was low, but detectable, under standard culture conditions (e.g., germination and growth on half strength MS medium), whereas treatment of seedlings with either 50μM ABA, or 20OmM NaCl or 40OmM sucrose resulted in reproducible, high level induction of light emission conferred by the activation of ADHl-LUC reporter (Fig. 25B). Due to non-destructive nature of bio luminescence detection, temporal changes in luciferase activity could be measured using a series of automatic exposures. Standard monitoring the induction kinetics indicated that activation of ADHl-LUC by either 20OmM NaCl or 40OmM sucrose has reached its maximum 3 to 5 hours after initiation of the treatment leading to nearly 100-fold increase of measured luminescence levels (Fig. 25C). Activation of ADHl-LUC was considerably faster by ABA than by salt or sugar, supporting the view that ABA is a mediator of sugar and salt stress responses (Finkelstein et al., 2002). Analogously, hydrogen peroxide treatment resulted in fast (about 2 hours) but rather moderate (i.e., 10 to 20-fold) activation of ADHl-LUC reporter. Upon transformation of ADHl-LUC reporter line with the COS cDNA library, we screened 20,000 hygromycin resistant Tl seedlings and identified 11 plants displaying enhanced LUC activity in the presence of 4μM estradiol (Fig. 26A). Recurrent assays confirmed estradiol-dependent LUC activation in the T2 progeny of two lines (Table 2, ADH-lines), whereas all other candidates found in the primary screen showed constitutive estradiol- independent LUC activity. One of the two estradiol- inducible lines, ADH 121, showed 3:1 segregation of hygromycin resistant versus sensitive progeny, and inducible expression of the ADHl-LUC reporter in all hygromycin resistant T2 seedlings.

Whereas estradiol did not induce the ADHl-LUC reporter in the parental control plants, the ADH121 line showed gradually increasing bio luminescence after estradiol treatment (Fig. 26B,C). In the absence of estradiol, transfer of the parental ADHl-LUC and ADH121 seedlings to medium containing 20OmM NaCl led to transient increase of bio luminescence within 3 to 4 hours followed by gradual decrease of ADHl-LUC expression (Fig. 26B,C). Whereas the parental ADHl-LUC seedlings showed a similar pattern of luciferase expression also in response to combined treatment with both estradiol and 20OmM NaCl, the COS cDNA transformed ADH121 line displayed persistent maintenance of high level luciferase expression for at least 16 hours (Fig. 26B,C).

Similarly to salt treatment, spraying of ADH121 plantlets with 50μM ABA in the absence of estradiol yielded a transient luminescence peak within 4 hours in leaves and roots followed by a gradual decline of LUC activity. This reflected normal ABA-mediated activation of the ADHl-LUC reporter. By contrast, the parental ADH- LUC line showed no response to estradiol induction, whereas treatment of ADH121 seedlings with 4 μM estradiol triggered gradual increase and long-term maintenance of LUC activity in roots but not in leaves. Combined ABA and estradiol treatment of line ADH121 resulted in sustained LUC activation without apparent decline of light emission for at least 24 hours (Fig. 26D). These results indicated that activation of a cDNA encoded function conferred root specific activation of the ADHl-LUC reporter in the ADH121 line, which was superimposed onto the ABA and salt induced activation pattern of ADH-LUC (i.e., leaves and roots) in plants subjected to combined treatment with estradiol and ABA or salt.

To compare the induction of endogenous ADHl gene with activation of the ADHl-LUC reporter, we have monitored the ABA and estradiol induced changes in ADHl mRNA levels by quantitative RT-PCR in the ADH121 line. In seedlings harvested 6 hours after treatment with 50μM ABA a 3-fold increase of ADHl transcript levels was observed, but following 24 hours the ADHl mRNA levels declined and were comparable to those of untreated control plants. Upon estradiol treatment, the endogenous ADHl transcript level was increased 1.8 to 2-fold and remained at the same level also 24 hours following the treatment. This indicated that estradiol induced expression of a cDNA in line ADH121 conferred limited activation of the endogenous ADHl gene. Combination of estradiol with ABA treatment resulted in 3-fold increase of ADHl mRNA levels as seen upon ABA induction, but the transcript levels failed to decline even 24 hours after the induction (i.e., due to synergistic effect of estradiol- induced cDNA overexpression; Fig. 26E).

To confirm that estradiol-mediated induction of a cDNA construct in ADH121 also leads to root specific activation of endogenous ADHl gene (i.e., as seen for estradiol- induced activation of the ADH-LUC reported in the ADH121 line in Fig. 26D), we have compared the ADH enzyme activities in roots of parental ADHl- LUC and cDNA transformed ADH121 lines using a histochemical assay (Baud and Graham, 2006). Whereas estradiol-treatment failed to stimulate endogenous ADH activity in roots of parental ADHl-LUC plants, strong histochemical staining revealed estradiol- induced activation of the ADH enzyme in roots of cDNA transformed ADH121 seedlings (Fig. 26F).

PCR amplification and sequence analysis revealed that a single pER8GW T- DNA insert in the ADH121 line carried a full-length cDNA of Atlg53910 gene encoding RAP2.12, a yet uncharacterized member of the AP2/ERF (ethylene responsive element binding factor) transcription factor family (Fig. 27). AP2/ERF- like transcription factors carry one or two AP2-type DNA binding domains and are represented by 122 genes in Arabidopsis (Nakano et al, 2006). RAP2.12 has a single AP2 domain and belongs to the B-2 subfamily, which includes five members sharing high sequence identity, some of them known to control stress responses (Fig. 28 A, Sakuma et al., 2002). AtEBP/RAP2.3, which is closely related to RAP2.12, is thus known to confer resistance to H₂O₂ and heat stress, and to activate a number of defense genes (Ogawa et al., 2005). Other AP2/ERF transcription factors recognize so-called GCC-box sequences and control ethylene responsiveness of several PR gene promoters (Gu et al., 2000, Ogawa et al., 2005). To test ethylene-dependent activation of ADHl-LUC reporter in the parental and ADH121 lines, four days-old seedlings and two weeks-old plantlets were treated with 100 μM ethephon in the presence or absence of 4 μM estradiol. Ethephon treatment had no effect on luciferase activity in either line. In dark germination assays, ethephon treatment triggered similar triple ethylene response of etiolated seedlings of both parental and ADH121 lines and estradiol-dependent activation of RAP2.12 in ADH121 had no effect on the ethylene- induced triple response (data not shown).

To determine whether RAP2.12 expression correlates with the induction of ADHl-LUC reporter, we monitored the RAP2.12 mRNA levels in the parental ADHl- LUC and pER8-cDNA transformed ADH121 lines by RT-PCR. High levels of RAP2.12 transcript was exclusively detected in estradiol-treated ADH121 seedlings, whereas in the absence of estradiol or in the presence of ABA only very low levels of RAP2.12 RNA could be detected in ADH121 seedlings and the parental ADHl-LUC line (Fig. 28B). This data thus showed that RAP2.12 transcription was not induced by ABA and could only be activated by estradiol treatment in ADH121. At higher sensitivity, the RAP2.12 transcript was detected in all organs of wild-type plants, showing the highest levels in roots, flower buds and stems. The fact that the RAP2.12 mRNA level was somewhat higher in leaves of wilted than well watered plants suggested possible drought regulation of RAP2.12 (Fig. 28C). These results well agreed with the available transcript profiling data (http://www.genevestigator.ethz.ch) indicating that transcription of RAP2.12 (Atlg53910) gene is not affected by ABA, ethylene and other plant hormones, and is only slightly upregulated by senescence and osmotic stress.

To confirm that estradiol- inducible activation of RAP2.12 transcription was indeed responsible for activation of the ADHl-LUC reporter in the ADH121 line, we have recloned the isolated cDNA into the pDONR201 plasmid, and upon moving it into the pER8GW vector (Fig. 3) we introduced it by transformation into the parental ADHl-LUC line again. Most of the ADHl-LUC transformants (10 out of 13) carrying the pER8GW-RAP2.12 construct showed estradiol- inducible luciferase activity, which was similar to the activity of the ADH 121 line described above (Fig. 26G). In conclusion, this reconstruction experiment confirmed that RAP2.12 is a positive regulator of the ADHl gene, which is known to be induced in Arabidopsis by anoxia, high salinity, cold, and drought stress.

References

Alvarado MC, Zsigmond LM, Kovacs I, Cseplδ A, Koncz C, Szabados LM

(2004) Gene trapping with firefly luciferase in Arabidopsis. Tagging of stress- responsive genes. Plant Physiol 134: 18-27

An YQ, McDowell JM, Huang S, McKinney EC, Chambliss S, Meagher RB (1996) Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J 10: 107-121

Babiychuk E, Kushnir S, Belles-Boix E, Van Montagu M, Inze D (1995) Arabidopsis thaliana NADPH oxidoreductase homo logs confer tolerance of yeasts toward the thiol-oxidizing drug diamide. J Biol Chem 270: 26224-26231

Banno H, Ikeda Y, Niu QW, Chua NH (2001) Overexpression of Arabidopsis ESRl induces initiation of shoot regeneration. Plant Cell 13: 2609-2618 Baud S, Graham IA (2006) A spatiotemporal analysis of enzymatic activities associated with carbon metabolism in wild-type and mutant embryos of Arabidopsis using in situ histochemistry. Plant J 46: 155-169 Bender A, Pringle JR (1991) Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae. MoI Cell Biol 11: 1295-1305

Brocard IM, Lynch TJ, Finkelstein RR (2002) Regulation and role of the Arabidopsis Abscisic acid-Insensitive 5 gene in abscisic acid, sugar and stress response. Plant Physiol 129: 1533-1543 de Bruxelles GL, Peacock WJ, Dennis ES, Dolferus R (1996) Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol 111: 381-391 Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156- 159

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: vesion II.

Plant MoI. Biol. Rep. 1: 19-21 Dolferus R, Jacobs M, Peacock WJ, Dennis ES (1994) Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene. Plant Physiol 105: 1075-1078 Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell (Suppl) 14: S15-S45 Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol 124: 1854- 1865

Grant JJ, Chini A, Basu D, Loake GJ (2003) Targeted activation tagging of the Arabidopsis NBS-LRR gene, ADRl, conveys resistance to virulent pathogens.

MoI Plant Microbe Interact 16: 669-680

Gu YQ, Yang C, Thara VK, Zhou J, Martin GB (2000) Pti4 is induced by ethylene and salicylic acid, and its product is phosphorylated by Pto kinase. Plant Cell 12: 771-786 Guo Y, Haftner U, Ishitani M, Zhu JK (2001) Molecular characterization of functional domains in the protein kinase S0S2 that is required for plant salt tolerance. Plant Cell 13: 1383-1399

Halfter U, Ishitani M, Zhu JK (2000) The Arabidopsis S0S2 protein kinase physically interacts with and is activated by the calcium-binding protein S0S3.

Proc Natl Acad Sci USA 97: 3735-3740 Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ (2000) Plant cellular and molecular responses to high salinity. Annu Rev Plant Physiol Plant MoI Biol 51:

463-499 Hoeren FU, Dolferus R, Wu Y, Peacock WJ, Dennis ES (1998) Evidence for a role for AtMYB2 in the induction of the Arabidopsis alcohol dehydrogenase gene

(ADHl) by low oxygen. Genetics 149: 479-490 Ichikawa T, Nakazawa M, Kawashima M, Muto S, Gohda K, Suzuki K,

Ishikawa A, Kobayashi H, Yoshizumi T, Tsumoto Y, Tsuhara Y, Iizumi H, Goto Y, Matsui M (2003) Sequence database of 1172 T-DNA insertion sites in

Arabidopsis activation-tagging lines that showed phenotypes in Tl generation.

Plant J 36: 421-429 Ichikawa T, Nakazawa M, Kawashima M, Iizumi H, Kuroda H, Kondou Y,

Tsuhara Y, Suzuki K, Ishikawa A, Seki M, Fujita M, Motohashi R, Nagata N, Takagi T, Shinozaki K, Matsui M (2006) The FOX hunting system: an alternative gain-of- function gene hunting technique. Plant J 48: 974-985 Ingram J, Bartels D (1996) The molecular basis of dehydration tolerance in plants.

Annu Rev Plant Physiol Plant MoI Biol 47: 377-403

Ishitani M, Xiong L, Stevenson B, Zhu JK (1997) Genetic analysis of osmotic and cold stress signal transduction in Arabidopsis: Interactions and convergence of abscisic acid-dependent and abscisic acid-independent pathways. Plant Cell 9:

1935-1949 Jarillo JA, Leyva A, Salinas J, Martinez-Zapater JM (1993). Low temperature induces the accumulation of alcohol dehydrogenase mRNA in Arabidopsis thaliana, a chilling-tolerant plant. Plant Physiol 101 : 833-837

Jithesh MN, Prashanth SR, Sivaprakash KR, Parida AK (2006) Antioxidative response mechanisms in halophytes: their role in stress defence. J Genet 85: 237-

254 Kakimoto T (1996) CKIl, a histidine kinase ho mo log implicated in cytokinin signal transduction. Science 74: 982-985

Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999) Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol 17: 287-291

Koiwa H, Bressan RA, Hasegawa PM (2006) Identification of plant stress- responsive determinants in Arabidopsis by large-scale forward genetic screens. J Exp Bot 57: 1119-1128

Koncz, C. and Schell, J. (1986) The promoter of TL-DNA gene 5 controls the tissue specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. MoI Gen Genet 204: 383-396.

Koncz C, Martini N, Szabados L, Hrouda M, Bachmair A, Schell J (1994) Specializied vectors for gene tagging and expression studies. In SB Gelvin, RA Schilperoort, DPS Verma, eds, Plant Molecular Biology Manual, Ed 2 VoI B. Kluwer Academic Publisher, Dordrecht, pp 1-22.

Kuhn JM, Boisson-Dernier A, Dizon MB, Maktabi MH, Schroeder JI (2006) The protein phosphatase AtPP2CA negatively regulates abscisic acid signal transduction in Arabidopsis, and effects of abhl on AtPP2CA mRNA. Plant Physiol 140: 127-139 Kushnir S, Babiychuk E, Kampfenkel K, Belles-Boix E, Van Montagu M, Inze D (1995) Characterization of Arabidopsis thaliana cDNAs that render yeasts tolerant toward the thiol-oxidizing drug diamide. Proc Natl Acad Sci USA 92: 10580- 10584

LeClere S, Bartel B (2001) A library of Arabidopsis 35S-cDNA lines for identifying novel mutants. Plant MoI Biol 46: 695-703

Lee H, Guo Y, Ohta M, Xiong L, Stevenson B, Zhu JK (2002) LOS2, a genetic locus required for cold-responsive gene transcription encodes a bi-functional enolase. EMBO Journal 21: 2692-2702

Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998) Two transcription factors, DREBl and DREB2, with an

EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10: 1391-406

Mano J, Belles-Boix E, Babiychuk E, Inze D, Torii Y, Hiraoka E, Takimoto K, Slooten L, Asada K, Kushnir S (2005) Protection against photooxidative injury of tobacco leaves by 2-alkenal reductase. Detoxication of lipid peroxide-derived reactive carbonyls. Plant Physiol 139: 1773-1783

Masson JY, Ramotar D (1998) The transcriptional activator Imp2p maintains ion homeostasis in Saccharomyces cerevisiae. Genetics 149: 893-901

Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci

7: 405-410

Mullineaux PM, Guerineau F, Accotto GP. (1990) Processing of complementary sense RNAs of Digitaria streak virus in its host and in transgenic tobacco. Nucleic Acids Res 18: 7259-7265.

Nakamura H, Hakata M, Amano K, Miyao A, Toki N, Kajikawa M, Pang J,

Higashi N, Ando S, Toki S, et al (2007) A genome-wide gain-of- function analysis of rice genes using the FOX-hunting system. Plant MoI Biol 65: 357-371 Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol 140: 411-432

Nakazawa M, Ichikawa T, Ishikawa A, Kobayashi H, Tsuhara Y, Kawashima M,

Suzuki K, Muto S, Matsui M (2003) Activation tagging, a novel tool to dissect the functions of a gene family. Plant J 34: 741-750

Ogawa T, Pan L, Kawai-Yamada M, Yu LH, Yamamura S, Koyama T, Kitajima S, Ohme-Takagi M, Sato F, Uchimiya H (2005) Functional analysis of

Arabidopsis ethylene-responsive element binding protein conferring resistance to bax and abiotic stress-induced plant cell death. Plant Physiol 138: 1436-1445 Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC, Weigel D

(2003) Control of leaf morphogenesis by microRNAs. Nature 425: 257-263 Peng HP, Chan CS, Shih MC, Yang SF (2001) Signaling events in the hypoxic induction of alcohol dehydrogenase gene in Arabidopsis. Plant Physiol 126: 742-

749 Price AH, Atherton NM, Hendry GAF (1989) Plants under drought-stress generate activated oxygen. Free Rad Res Commun 8: 61-66 Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K

(2002) DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold- inducible gene expression.

Biochem Biophys Res Commun 290: 998-1009 Serrano R, Gaxiola R (1994) Microbial models and salt stress tolerance in plants. Crit Rev Plant Sci 13: 121-138

Shi H, Ishitani M, Kim C, Zhu JK (2000) The Arabidopsis thaliana salt tolerance gene SOSl encodes a putative Na+/H+ antiporter. Proc Natl Acad Sci USA 97: 6896-6901 Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana CBFl encodes an AP2 domain-containing transcriptional activator that binds to the C- repeat/DRE, a cώ-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc Natl Acad Sci USA 94: 1035— 1040 Sun W, Bernard C, van de Cotte B, Van Montagu M, Verbruggen N (2001) At- HSF '17.6 A, encoding a small heat-shock protein in Arabidopsis, can enhance osmotolerance upon overexpression. Plant J 27: 407-415 Thomashow MF (1999) Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol Plant MoI Biol 50: 571-99 Vierling E (1991) The roles of heat shock proteins in plants. Annu Rev Plant Physiol

Plant MoI Biol 42: 579-620

Wehmeyer N, Hernandez LD, Finkelstein RR, Vierling E (1996) Synthesis of small heat-shock proteins is part of the developmental program of late seed maturation. Plant Physiol 112: 747-757 Weigel D, Ahn JH, Blazquez MA, Borevitz JO, Christensen SK, Fankhauser C, Ferrandiz C, Kardailsky I, Malancharuvil EJ, Neff MM, et al (2000) Activation tagging in Arabidopsis. Plant Physiol 122: 1003-1013 Xiong L, David L, Stevenson B, Zhu JK (1999) High throughput screening of signal transduction mutants with luciferase imaging. Plant MoI Biol Reporter 17: 159- 170

Xiong L, Lee BH, Ishitani M, Lee H, Zhang C, Zhu JK (2001) FIERYl encoding an inositol polyphosphate 1 -phosphatase is a negative regulator of abscisic acid and stress signalling in Arabidopsis . Genes and Development 15: 1971-1984

Xiong L, Lee H, Ishitani M, Zhu JK (2002) Regulation of osmotic stress-responsive gene expression by the LOS6/ABA1 locus in Arabidopsis. J Biol Chem 277:

8588-8596

Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol 57: 781-803 Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant

Biol 53: 247-273 Zuo J, Niu QW, Chua NH (2000) An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant J 24: 265- 273

Table 4. List of oligonucleotides used in this study.

Code 5' - 3' sequence Use

ATTSMl GGGGACAAGTTTGTACAAAAAAGCAGGCTCAACGCAGAGTACGCGGG cDNA amplification

ATTSM2 GGGGACCACTTTGTACAAGAAAGCTGGGTCAACGCAGAGTACTTTTTTTTTTTTT cDNA amplification

BD Univ. Primer A CTAATACGACTCACTATAGGGC cDNA library preparation

BD SMART II™ A AAGCAGTGGTATCAACGCAGAGTACGCGGG cDNA library preparation

3'CDS primer AAGCAGTGGTATCAACGCAGAGTAC(T)3 OVN cDNA library preparation

5'-RACE CDS Primer TTTTTTTTTTTTTTTTTTTTTTTTTVN cDNA library preparation

ER8A GCTTGGGCTGCAGGTCGAGGCTAA amplification of inserts in pER8 vector

ER8B CTGGTGTGTGGGCAATGAAACTGATGC amplification of inserts in pER8 vector

ER8C ATAAGGAAGTTCATTTCATTTGGAGAGGAC sequencing of inserts in pER8 vector

M13for GTAAAACGACGGCCAG sequencing primer in pDONR plasmids

M13rev CAGGAAACAGCTATGAC sequencing primer in pDONR plasmids

ADH-A ATTGGATCCTCATACTAACAGTCGTGGG amplification of ADHl promoter, 5' end,

ADH-B GAGAAGCTTTTGATCTTTTGTTAGTTTTGTG amplification of ADHl promoter, 3' end

HSP.17.6AF ATGGATTTGGAGTTTGGAA RT-PCR analysis of HSP17.6A gene Ul

O

HSP.17.6AR TAGTTGCTTATCGATTACAT RT-PCR analysis of HSP17.6A gene

ADHRTF AGCTGCTGTGGCATGGGA RT-PCR analysis of ADHl gene

ADHRTR TCTGCGGTGGAGCAACCT RT-PCR analysis of ADHl gene

N180RTF ATTTGGTGAAGTCACGAGAATCAA RT-PCR analysis of At5g 16970 gene

N180RTR ATTCTAGACACTCCATACCCTTGGA RT-PCR analysis of At5g 16970 gene

N180seql CGCATTTCAAGATCCAACATACTG sequencing primer for At5g 16970

N180Seq2 CAATCTTGAGAACCAGGAAGGTGT sequencing primer for At5g 16970

ACTIN2F GGTAACATTGTGCTCAGTGGTGG RT-PCR of actin2/8 genes (control)

ACTIN2R AACGACCTTAATCTTCATGCTGC RT-PCR of actin2/8 genes (control)

GAPDH2-F AATGGAAAATTGACCGGAATGT RT-PCR of GAPDH2 genes (control)

GAPDH2-R CGGTGAGATCAACAACTGAGACA RT-PCR of GAPDH2 genes (control)

RAP12A: AAGATGCTGTAACGACTCAGGACAATGG RT-PCR analysis of RAP2.12 gene

RAP12B: CTTCATCACAACTACCCTCAAGATAGA RT-PCR analysis of RAP2.12 gene

RAP-Seql GGATGGGGACGCTGAGAAATCTGC sequencing of RAP2.12 cDNA

RAP-Seq2 GGAGCGATCAAGCTCCGATAACTCC sequencing of RAP2.12 cDNA

RAP-Seq3 TGTTGTTGTAAGGTGTCTCGAAAT sequencing of RAP2.12 cDNA

Claims

Claims

1. Method for identifying genes being responsible for stress regulatory functions in Arabidopsis, comprising: a) cloning an Arabidopsis cDNA library into a vector suitable for inducible expression of the introduced nucleic acid in a position allowing the expression of said nucleic acid, b) introducing the cloned cDNA library into wild-type Arabidopsis; c) regenerating plants comprising said expression vector carrying a cDNA insert as being produced in step a), d) testing the plants regenerated for stress tolerance upon inducing said vector to express the cDNA insert, e) identifying plants with modified stress tolerance, f) identifying the gene(s) being comprised in the cDNA insert of said expression vector produced in step a) being present in said stress tolerant plant as gene(s) capable of modifying the stress tolerance in Arabidopsis.

2. The method according to claim 1, wherein said modification of stress tolerance is the enhancement of stress tolerance.

3. The method according to claim 1 or 2, wherein said cDNA library is also introduced into an ADHl-LUC reporter Arabidopsis line in step b).

4. The method according to claim 1 to 3, wherein said plants are tested for salt tolerance, ABA insensitivity and/or activation of stress-responsive alcohol dehydrogenase (ADHl) promoter.

5. The method according to claim 1 to 4, wherein said cDNA library is prepared from plants held under stress conditions.

6. The method according to claim 1 to 5, wherein the cDNA introduced into the plant is expressed under inducible conditions during said testing in step d).

7. Isolated nucleic acid, obtainable by any of methods of claims 1-5, comprising the sequence according to Fig. 5, encoding the Arabidopsis gene HSP 17.6, conferring ABA insensitivity during germination.

8. Isolated nucleic acid, obtainable by any of methods of claims 1-5, comprising the sequence according to Fig. 8, encoding the Arabidopsis gene At5g25160, conferring ABA insensitivity during germination.

9. Isolated nucleic acid, obtainable by any of methods of claims 1-5, comprising the sequence according to Fig. 15, encoding the Arabidopsis 2-alkenal reductase gene 2AER, resulting in improved salt tolerance.

10. Isolated nucleic acid, obtainable by any of methods of claims 1-5, comprising the sequence according to Fig. 17, encoding the Arabidopsis gene At4g 14520, resulting in improved salt tolerance.

11. Isolated nucleic acid, obtainable by any of methods of claims 1-5, comprising the sequence according to Fig. 27, encoding the Arabidopsis gene for RAP2.12 transcription factor, stimulating the expression of ADHl-LUC reporter gene.

12. Isolated nucleic acid, having a sequence at least 90% homologous to the sequence according to any one of claims 7 to 11.

13. Isolated nucleic acid that is complementary to the nucleic acid according to claim 12.

14. Isolated nucleic acid that is capable of hybridizing to the nucleic acid according to claim 12 or 13.

15. Vector for expressing cDNA sequences, comprising • chimaeric XVE fusion gene, encoding the chimaeric transcription activator for the pLexA promoter (XVE)

• recombination sites

• a resistance gene

• a marker for bacterial contraselection • an Arabidopsis cDNA clone.

16. Use of the isolated nucleic acid according to any one of claims 7 to 14 or the vector according to claim 15 for enhancing the stress tolerance of plants.

17. Kit for identifying genes being responsible for stress regulatory functions in a plant, comprising • the vector according to claim 15;

• instructions teaching the method according to any one of claims 1 to 6.