EP2288709A1 - GESTEUERTES cDNA-ÜBEREXPRESSIONSSYSTEM IN ARABIDOPSIS - Google Patents

GESTEUERTES cDNA-ÜBEREXPRESSIONSSYSTEM IN ARABIDOPSIS

Info

Publication number
EP2288709A1
EP2288709A1 EP09738069A EP09738069A EP2288709A1 EP 2288709 A1 EP2288709 A1 EP 2288709A1 EP 09738069 A EP09738069 A EP 09738069A EP 09738069 A EP09738069 A EP 09738069A EP 2288709 A1 EP2288709 A1 EP 2288709A1
Authority
EP
European Patent Office
Prior art keywords
gene
arabidopsis
stress
cdna
plants
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP09738069A
Other languages
English (en)
French (fr)
Inventor
László SZABADOS
Csaba Koncz
Edit Temesvarine Abraham
Csaba Papdi
Mary Prathyba Joseph
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hungarian Academy of Sciences Biologic Research Center
Original Assignee
Hungarian Academy of Sciences Biologic Research Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from HU0800288A external-priority patent/HU0800288D0/hu
Priority claimed from HU0800351A external-priority patent/HUP0800351A2/hu
Application filed by Hungarian Academy of Sciences Biologic Research Center filed Critical Hungarian Academy of Sciences Biologic Research Center
Publication of EP2288709A1 publication Critical patent/EP2288709A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8237—Externally regulated expression systems
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Definitions

  • the present invention belongs to the field of plant molecular biology.
  • the present invention provides a method for identifying genes being responsible for stress regulatory functions in Arabidopsis, comprising cloning an Arabidopsis cDNA library into a vector suitable for inducible expression of the introduced nucleic acid in a position allowing the expression of said nucleic acid, introducing the cloned cDNA library into wild-type Arabidopsis; regenerating plants comprising said expression vector carrying a cDNA insert as being produced; testing the plants regenerated for stress tolerance upon inducing said vector to express the cDNA insert, identifying plants with modified stress tolerance, and identifying the gene(s) being comprised in the cDNA insert of said expression vector produced in step a) being present in said stress tolerant plant as gene(s) capable of modifying the stress tolerance in Arabidopsis.
  • the invention further provides novel genes involved in the stress regulatory functions identified by the present method, the uses thereof for enhancing the stress tolerance of plants, as well es kits to
  • Adaptation to abiotic stress requires coordinate changes in metabolism, cell growth, division and differentiation, which depend on a large set of genes controlling complex regulatory mechanisms. Cloning of genes whose expression is upregulated by salt, cold or drought stress identified several targets and regulators of stress signalling (Serrano and Glaxiola, 1994, Ingram and Bartels, 1996, Hasegawa et al, 2000).
  • RD29A-LUC stress-responsive reporter gene constructs
  • cytokinin receptor kinase Functional identification of the cytokinin receptor kinase (Kakimoto, 1996), various microRNA genes (Palatnik et al., 2003), and isolation of dominant mutations conferring enhanced salt tolerance (Koiwa et al., 2006) illustrate the potential of this experimental system. Nonetheless, a disadvantage of activation tagging is that gene activation might not be restricted to a single gene located in the vicinity of the T-DNA or transposon insertion site, and therefore multiple gene activation events may lead to complex and confusing phenotypes (Ichikawa et al., 2003). Combination of activation tagging with screening for induction (or repression) of promoter driven luciferase reporters provides a more specific technique for activation tagging of regulatory genes.
  • cDNA libraries driven by constitutive promoters have also been used to generate transgenic Arabidopsis and rice lines showing altered developmental traits (LeClere and Bartel, 2001, Ichikawa et al., 2006, Nakamura et al., 2007). Large-scale transformation of Arabidopsis roots with a cDNA library lead to the identification of the ESRl gene, overexpression of which stimulates cytokinin- independent plant regeneration (Banno et al., 2001).
  • Kuhn et al. (2006) found that protein phosphatase AtPP2AC plays an important regulatory role in ABA-controlled closure of gas exchange cells and thereby controls drought sensitivity.
  • the cDNA library transformation approach may also produce dominant loss of function phenotypes, which result from co-suppression of endogenous genes by overexpression of truncated or antisense cDNAs (LeClere and Bartel, 2001).
  • This possible disadvantage has been overcome by the design of Full-length cDNA Over-eXpresser (FOX) gene hunting system (Ichikawa et al., 2006, Nakamura et al., 2007). Nevertheless, constitutive activation of stress regulatory genes can disturb cell proliferation and development resulting e.g. in dwarf and sterile plants (Kasuga et al., 1999, Gilmour et al., 2000). Accordingly, there is a need in the art to provide reliable, high through-put systems for screening and identifying genes involved in the response mechanism of plants to adverse environmental conditions, as well as identifying genes capable to help adapting plants for such conditions.
  • Overexpression System COS
  • COS Overexpression System
  • the cDNA library was introduced into wild-type Arabidopsis, as well as into an ADHl-LUC reporter line, to screen for salt tolerance, ABA insensitivity and activation of stress-responsive alcohol dehydrogenase (ADHl) promoter.
  • ADHl stress-responsive alcohol dehydrogenase
  • the present system provides improved screening facilities for stress regulatory genes the expression of which may frequently disturb cell proliferation and development, therefore, practically makes it impossible to identify exactly those genes, which are relevant for this behavior by limiting the possibility to freely generate large enough sets of plants allowing the screening. This improvement comes from three major factors.
  • the chemically inducible XVE expression cassette is used to drive the expression of the cloned cDNAs, a first for plant cDNA libraries.
  • the chemical inducer i. e. estradiol
  • the chemical inducer is not a compound usually occurring in plants, therefore provides a precise, well defined means to control the expression of the genes cloned into the system.
  • the screening itself takes place in an environment controlled by the chemical inducer.
  • the state of the art techniques usually employ inducible expression only after a gene was suspected as playing a role in stress regulation, therefore, as is apparent from the present invention, seriously limiting the pool of genes from which further testing is able to identify candidate genes involved in stress tolerance. Indeed, no inducible expression library was disclosed in the art for plants.
  • the present invention combines the screening process for stress related genes with the use of cell suspension culturing technique, which allows fast and high volume screening process to allow high-throughput analysis.
  • the present invention further provides a set of cDNAs conferring dominant stress-tolerance phenotypes and initial characterization of three regulatory functions identified in the different genetic screens according to the present invention.
  • the present invention provides a method for identifying genes being responsible for stress regulatory functions in Arabidopsis, comprising: a) cloning an Arabidopsis cDNA library into a vector suitable for inducible expression of the introduced nucleic acid in a position allowing the expression of said nucleic acid, b) introducing the cloned cDNA library into wild-type Arabidopsis; c) regenerating plants comprising said expression vector carrying a cDNA insert as being produced in step a), d) testing the plants regenerated for stress tolerance upon inducing said vector to express the cDNA insert, e) identifying plants with modified stress tolerance, f) identifying the gene(s) being comprised in the cDNA insert of said expression vector produced in step a) being present in said stress tolerant plant as gene(s) capable of modifying the stress tolerance in Arabidopsis.
  • the present invention provides a method wherein said modification of stress tolerance is the enhancement of stress tolerance.
  • the present invention provides method wherein said cDNA library is also introduced into an ADHl-LUC reporter Arabidopsis line in step b).
  • the present invention provides a method wherein said plants are tested for salt tolerance, ABA insensitivity and/or activation of stress- responsive alcohol dehydrogenase (ADHl) promoter.
  • ADHl stress- responsive alcohol dehydrogenase
  • the present invention provides a method wherein said cDNA library is prepared from plants held under stress conditions.
  • the present invention provides a method wherein the cDNA introduced into the plant is expressed under inducible conditions during said testing in step d).
  • the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 5, encoding the Arabidopsis gene HSP 17.6, conferring ABA insensitivity during germination.
  • the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 8, encoding the Arabidopsis gene At5g25160, conferring ABA insensitivity during germination.
  • the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 15, encoding the Arabidopsis 2-alkenal reductase gene 2AER, resulting in improved salt tolerance.
  • the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 17, encoding the Arabidopsis gene At4gl4520, resulting in improved salt tolerance.
  • the present invention provides an isolated nucleic acid, obtainable by any of the methods of the invention, comprising the sequence according to Fig. 27, encoding the Arabidopsis gene for RAP2.12 transcription factor, stimulating the expression of ADHl-LUC reporter gene.
  • the present invention provides an isolated nucleic acid, having a sequence at least 90% homologous to the sequence of any one of the above-refereed nucleic acids.
  • the present invention provides an isolated nucleic acid that is complementary to any one of the above-refereed nucleic acids. In another embodiment, the present invention provides an isolated nucleic acid that is capable of hybridizing to any one of the above-refereed nucleic acids.
  • the present invention provides a vector for expressing cDNA sequences, comprising
  • the present invention provides the use of the isolated nucleic acid according to the invention or the vector according to the invention for enhancing the stress tolerance of plants.
  • the present invention provides a kit for identifying genes being responsible for stress regulatory functions in a plant, comprising
  • COS Controlled cDNA Overexpression System
  • gene refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including its regulatory sequences.
  • native gene refers to gene as found in nature.
  • transgene refers to a gene that has been introduced into the genome by transformation and is stably maintained. Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes.
  • endogenous gene refers to a native gene in its natural location in the genome of an organism.
  • promoter refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription.
  • promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA-box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression.
  • Promoter also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • an "enhancer” is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
  • transgenic plant includes reference to a plant, which comprises within its genome a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette.
  • Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered, as well as those created by sexual crosses or asexual propagation from the initial transgenic.
  • the term “transgenic” as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
  • the first step of the method according to the invention is the generation of cDNA library from samples of the Arabidopsis plant for cloning.
  • the library theoretically may be constructed from any kind of samples, without significant limitations.
  • the library may be derived from single tissues, organs, plant parts, or conversely, a combination of tissues, organs or plant parts may be used as a source of the cDNA library.
  • the samples may be derived from different development stages of the plant, or may be collected from plants held under specific environmental conditions.
  • the stress condition may be salt tolerance, ABA insensitivity and/or activation of stress-responsive alcohol dehydrogenase (ADHl) promoter.
  • An essential feature of the present invention is to use a vector suitable for inducible expression of the introduced nucleic acid.
  • the rationale of opting for an inducible system is that constitutive overexpression of cDNAs encoding regulatory factors in stress signaling was observed to result frequently in severe developmental deficiencies. For example, constitutive overexpression of DREBl -type transcription factors resulted in growth retardation, abnormal development, late flowering and reduced fertility (Liu et al, 1998, Kasuga et al, 1999, Gilmour et al, 2000). Accordingly, the cDNA library used in the method of the invention is prepared in a chemically inducible expression vector, which offers precise transcriptional control and easy recloning of the cDNA inserts.
  • a preferred vector according to the invention comprises the elements described in detail below.
  • the inducible nature of the vector used according to the invention provided by chimaeric XVE fusion gene, encoding the chimaeric transcription activator for he pLexA promoter (XVE).
  • the vector according to the invention further comprises recombination sites for easy re-cloning of the inserted cDNA fragments.
  • the person skilled in the art can select the necessary recombination sites from a wide set of well-known systems. The choice of the system is generally limited by the availability of the required recombinase enzyme to carry out the recombination. Techniques, however, are available to supply the necessary recombinase to the host plant, either provided on an introduced extra-chromosomal element, or in the genome itself. Therefore, the use of the state of the art recombination sites should not be limiting.
  • Recombination may for example., be carried out using the so-called FRT site and variants thereof with the FIp recombinase or mutants thereof from Saccharomyces cerevisiae.
  • FRT site and variants thereof with the FIp recombinase or mutants thereof from Saccharomyces cerevisiae.
  • other recombinase systems may equally well be used, including those of Cre recombinase and a variety of lox sites such as loxP from bacteriophage PI or variants or mutants thereof, e.g., Iox66, Iox71, Iox76, Iox75, Iox43, Iox44 and loxSll [C. Gorman and C. Bullock, Curr.
  • Suitable selection genes for use in plant cell expression include, but are not limited to, genes enabling for nutritional selection.
  • Further selection markers are antimetabolite resistance genes conferring drug resistance, such as the neomycin phosphotransferase gene (neo) which can be selected for with kanamycin, the hygromycin B phosphotransferase (hyg, hph, hpt) gene which can be selected for with hygromycin, the chloramphenicol N-acetyl-transferase gene (cat) which can be selected with chloramphenicol or the Blasticidin S deaminase gene(Bsd) which can be selected with blasticidin, or beta-galactosidase (LacZ).
  • neo neomycin phosphotransferase gene
  • hygromycin B phosphotransferase hyg, hph, hpt
  • cat chloramphenicol N-acetyl-
  • the vector further comprises a marker for bacterial contraselection, such as the ccdB suicide marker.
  • a marker for bacterial contraselection such as the ccdB suicide marker.
  • gene amplification signals and other regulatory sequences may be present on the vector.
  • a replication origin is important for Polyadenilation sites are responsible for correct processing of the mRNA and splice signals for the RNA transcripts. The person skilled in the art will be readily able to design and prepare the most appropriate construction elements for the intended use.
  • estradiol- inducible XVE/pER8 expression vector (Zuo et al., 2000) was therefore chosen as a starting point for construction of the COS library to secure conditional and controlled expression of cDNAs, in order to avoid potentially deleterious effects of their overexpression, which comprises all necessary elements to carry out the cloning and selection steps of the method of the present invention.
  • the cDNA library is cloned into the vector according to the invention in such a way that its position allows the expression of said nucleic acid. This is usually called that the cDNA inserted is operably linked to the regulatory elements present on the vector.
  • a regulatory element is "operably linked" to an expressed gene within a DNA construct if the regulatory sequence is able to influence the expression rate or manner of said structural gene under conditions suitable for the expression of said structural gene and for the functioning of said regulatory sequence.
  • the person skilled art may use appropriate tools to design and prepare the connection region of the inserted cDNA and the regulatory elements for being operably linked.
  • the method of the invention for identifying genes being responsible for stress regulatory functions may employ a second plant line to facilitate screening.
  • the cDNA library is also introduced into an ADHl- LUC reporter Arabidopsis line.
  • ADHl-LUC reporter gene construct To generate and test an ADHl-LUC reporter gene construct, the person skilled in the art will be competent to select stae of the art methodologies, as well as may employ genes with similar functionality to achieve similar results to those described herein.
  • An exemplary method is described in Example 1. Briefly, the promoter region of the Arabidopsis ADHl gene (AtI g77120) was amplified by PCR using gene specific primers. The amplified fragment contains the 5 '-region of the ADHl gene.
  • the amplified promoter fragment is inserted into a promoter test vector to generating a transcriptional fusion with the firefly luciferase ⁇ LUC) reporter gene.
  • the resulting ADHl-LUC reporter construct is introduced into Arabidopsis (for example, the CoI-O ecotype) by Agrobacterium-mediated gene transfer. Transformants are selected and tested for segregation of the kanamycin resistance marker in the T2 generation, as well as for the activity of ADHl-LUC reporter using bio luminescence imaging.
  • Induction of ADHl-LUC by stress conditions can be tested with techniques and parameters given elsewhere in the present description, for example, by spraying seedlings with ABA solution or transferring seedlings on culture medium supplemented salts, sugars, or other agents known to induce the gene's expression, and measuring bio luminescence in time dependent fashion.
  • the person skilled in the art can readily determine the necessary conditions for these above described steps.
  • Flow chart of a preferred screening and testing procedure is depicted in Fig. 2.
  • the cDNA library is introduced into Arabidopsis plants, plants comprising the expression vector carrying a cDNA insert are regenerated, and screened for modified stress tolerance.
  • Plant transformation, regeneration and screening procedures are generally well known in the art, non- limiting examples of which: transformation (Clough and Bent, 1998); screens for stress mutants (Ishitani et al, 1997, Xiong et al., 1999, Lee et al., 2002, Koiwa et al., 2006); large-scale transformation coupled with activation tagging and mutant selection (Kakimoto, 1996, Grant et al., 2003, Nakazawa et al., 2003).
  • transgenic cells may be selected on appropriate media, then grown into calli by tissue culture methods. Shoot development may be induced from the calli on appropriate media, followed by regeneration of the whole plant. Certain parts of the plant (e.g. buds) can be transformed directly by Agrobacterium at a competent developmental stage. In this case seeds are selected to obtain transgenic progeny.
  • Transgene constructs may be linked to selectable markers in order to differentiate between transformed and wild type genotypes. Useful markers are different antibiotics (e.g.
  • the method of the invention comprises the identification of plants with modified stress tolerance.
  • the modification is the enhancement of stress tolerance. Screening procedures for plants with modified stress tolerance are known for the person skilled in the art.
  • the choice of the stress to screen for is non-limiting; the present method is suitable to identify plants with modified stress tolerance in respect of a wide variety of stresses.
  • the present description discloses three screening schemes, as detailed below, however, the person skilled in the art may select different stress regulatory functions to screen, but the specific protocols are generally follows the steps given below.
  • Flow chart of an exemplary screening and testing protocol is provided in Fig. 2. The COS system was tested in several screening strategies, each of them aiming at a particular aspect of a stress response.
  • the method according to the invention utilizes facilitates high-through-put screening for phenotypes conferred by inducible overexpression of Arabidopsis transcripts in an Arabidopsis genetic background, and provides very efficient, easy-to- use and sensitive identification genes involved in the stress regulatory pathway tested. It is evident that application of the present COS technology is not restricted to intraspecies studies using Arabidopsis as a model but can also be extended to interspecies library screens, in which cDNAs from natural variants of drought, salt or cold tolerant plant species are tested in Arabidopsis or other model species.
  • This extended COS approach provides the possibility for identification of natural sequence variations in known regulatory genes (i.e., based on cross-species sequence comparisons) that confer either increase or decrease in stress tolerance, or are associated with characteristically altered regulatory functions of signalling factors (i.e., transcription factors, protein kinases, protein phosphatases etc.) controlling a set of target genes in response to well-defined stress or hormonal stimuli.
  • signalling factors i.e., transcription factors, protein kinases, protein phosphatases etc.
  • Tl seeds are first germinated on a selective solid medium, then resistant seedlings are transferred onto selective medium supplemented with NaCl and estradiol. Plantlets that survives salt stress and remains green for at least two weeks under these conditions are rescued, transferred to non-selective medium for two weeks and subsequently into soil to produce seed.
  • Tl seeds are germinated on selective (i.e., salt and estradiol containing) medium in the presence of claforan and salt tolerant seedlings are subsequently tested for hygromycin resistance.
  • line Nl 80 was identified as that overexpression of 2AER cDNA confers salt tolerance to transgenic plants.
  • the 2AER enzyme has a NADPH-dependent oxidoreductase activity, which probably plays a role in the detoxification of reactive carbonyls, and hence in the protection of cells against oxidative stress (Mano et al, 2005).
  • ROS reactive oxygen species
  • the functions of antioxidant enzymes, such as 2AER are important in mounting salt tolerance by reducing the amount of reactive radicals (Jithesh et al., 2006).
  • the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 15, encoding the Arabidopsis 2-alkenal reductase gene 2AER, resulting in improved salt tolerance.
  • isolated means altered “by the hand of man” from natural state. If an "isolated” composition or substance occurs in nature, it has been changed or removed from its original environment, or both.
  • a polynucleotide or a polypeptide naturally present in a living plant is not “isolated”, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated", as the term employed herein.
  • Another Arabidopsis line, line N33 also showed significantly increased germination capability on high salt medium.
  • PCR amplification and sequence analysis of the insert could identify the full length cDNA of the At4g 14520 gene.
  • This gene encodes a previously uncharacterized protein, which, according to the TAIR Arabidopsis database is ,,DNA-directed RNA polymerase II-related; similar to RNA polymerase Rpb7 N-terminal domain-containing protein".
  • the protein showed some similarity to RBP5 and RBP7 subunit of RNA Polymerase II, and had an Sl domain which was originally identified in ribosomal protein Sl and was implicated in RNA binding.
  • the structure of the Sl domain is very similar to that of cold shock proteins. This suggests that they may both be derived from an ancient nucleic acid- binding protein.
  • the insert of line N33 is a novel gene playing a specific role in regulating stress responses in Arabidopsis.
  • the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 17, encoding the Arabidopsis gene At4g 14520, resulting in improved salt tolerance.
  • Screening for ABA insensitive germination aims at the identification of novel negative regulators of ABA signalling. Isolation of numerous lines displaying estradiol-dependent ABA insensitivity indicates that the COS technology could also effectively support this screening strategy.
  • Screening for ABA insensitivity in germination assay is performed by germinating Tl seed on selective solid medium containing estradiol and ABA. A few days after sawing, germinated seedlings with emerged radicles and open green cotyledons are transferred to selective plates, and then two weeks later into soil.
  • Abscisic acid is a central regulator of stress responses in plants, and is implicated in stomata closing and root growth control during water stress, activation of numerous stress-responsive genes, seed maturation, dormancy and control of germination. Accordingly, targeted alteration of ABA sensitivity can be one way to modify and improve tolerance to such stress.
  • Osmotic stress is a common component of water stress, dessication and salt stress, where ABA accumulation has been recorded.
  • Engineering of ZFP3 activity can therefore be used to improve tolerance to these stresses at least at the germination level. Therefore, the invention discloses genes identified by the method according to the invention, and that are useful under conditions influenced by the ABA insensitivity of germination.
  • ABI5 is a basic leucin zipper (bZIP) transcription factor that regulates ABA signalling during seed development and germination by modulating the expression of a subset of AB A- induced genes. Transcription of ABI 5 is autoregulated and controlled by both ABI 3 and ABI4, and ABI5 shows also molecular interaction with ABI3 (Finkelstein et al., 2002, Brocard et al., 2002).
  • bZIP basic leucin zipper
  • the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 5, encoding the Arabidopsis gene HSP17.6, conferring ABA insensitivity during germination.
  • line A44 Screening of ABA insensitive germination has lead to the identification of line A44.
  • PCR amplification of the insert in this line lead to a single fragment whose nucleotide sequence coincided with the sequence of the gene At5g25160, encoding the C2H2 type Zinc finger protein ZFP3.
  • the ZFP3 protein has a C2H2 domain, and belongs to a protein family, with several known members, which are implicated in transcription regulation. At present, no information on the function of the ZFP3 protein is available. Therefore, the gene cloned in line A44 is a novel regulator involved in Arabidopsis stress tolerance by modifying ABA sensitivity of the germination.
  • the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 8, encoding the Arabidopsis gene At5g25160, conferring ABA insensitivity during germination.
  • luciferase reporter gene constructs driven by different stress-induced promoters facilitates non-destructive detection of gene activation in mutant screens, as well as the identification of transcription factors controlling the expression of a particular target gene.
  • Expression of the alcohol dehydrogenase gene ADHl is controlled by multiple regulatory pathways, including ABA and ethylene signalling (Jarillo et al., 1993, de developer et al., 1996, Peng et al., 2001).
  • AtMYB2 is known to be a regulator of ADHl in response to hypoxia (Hoeren et al., 1998)
  • the activation of ADHl by dehydration through ABA signalling is mediated by the G-boxl promoter element, which is independent of low-oxygen response (Dolferus et al., 1994, de sheep et al., 1996).
  • the screening is performed by transforming the characterized parental line (see Example 1) with the cDNA expression library. Subsequently, Tl seeds are germinated on selective plates resistant seedlings are assayed on estradiol- containing medium for luciferase activity.
  • Seedlings showing enhanced luminescence are transferred onto non-selective medium for two weeks and then into soil to obtain T2 progeny.
  • the data presented herein show that the estradiol-dependent overproduction of the AP2/ERF transcription factor RAP2.12 can also activate ADHl expression.
  • the AP2/ERF transcription factor family includes key regulators of abiotic and biotic stress responses. AtEBP/RAP2.3 controls responses to heat and oxidative stress, and activates defense genes (Ogawa et al., 2005), while other AP2/ERF transcription factors control ethylene responses and activate PR gene promoters (Gu et al., 2000, Ogawa et al., 2005).
  • the CBF/DREB subfamily of AP2/ERF factors is demonstrated to regulate transcription of cold and dehydration responsive genes through binding to conserved DRE promoter motives (Stockinger et al., 1997, Liu et al., 1998, Thomashow, 1999, Sakuma et al., 2002, Yamaguchi-Shinozaki and Shinozaki, 2006), and overexpression of several CBF/DREB factors is shown to confer enhanced tolerance to drought, salt stress and freezing (Liu et al., 1998, Kasuga et al., 1999, Gilmour et al., 2000). Whereas overexpression of RAP2.12 can activate the transcription of the ADHl gene, according to our data this transcription factor probably acts independently of ABA and ethylene regulation.
  • RAP2.12 appears to perform a positive signalling function, which has not been linked so far to known regulators of ADHl transcription.
  • Identification of RAP2.12 as novel regulator of ADHl promoter illustrates that the COS technology is also applicable to screen for promoter activation and identify response specific transcription factors.
  • the present invention provides an isolated nucleic acid, obtainable by the method of the invention, comprising the sequence according to Fig. 27, encoding the Arabidopsis gene for RAP2.12 transcription factor, stimulating the expression of ADHl-LUC reporter gene.
  • isolated nucleic acids are provided that have substantially the same sequence as the isolated nucleic acids disclosed above, or they are highly homologous to each other.
  • the terms "homologue” or “variant” or “homologous” with respect to nucleic acid sequences refer to a sequence having at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, and still more preferably at least 95% sequence identity with the said sequence.
  • algorithms and computerized embodiments thereof well known in the art may be used for the determination of this homology. For example, sequence homology searches may be performed using the TAIR BLAST service (http://www.arabidopsis.org/Blast/index.jsp).
  • nucleic acids are provided that are complementary to the above-mentioned isolated nucleic acids, or are capable of hybridizing thereto.
  • a nucleic acid molecule is regarded "hybridizable" with another nucleic acid molecule if it can specifically be bound to the other molecule (i.e., the binding can give rise to a signal that is distinguishable from the background noise and from the signal caused by the non-specific binding of any random sequenced nucleic acid molecule), preferably a nucleic acid molecule is regarded as hybridizable if it specifically binds to another nucleic acid molecule under stringent conditions.
  • the use of the isolated nucleic acid or vector according to the invention according is provided for enhancing the stress tolerance of plants.
  • kits to perform the methods according to the invention.
  • Such kits may comprise the vector as described hereinabove, and instructions to carry out the method according to the invention.
  • the kits optionally may contain any other devices, materials, solutions that are necessary to perform the specific protocol as devised in the spirit of the present invention.
  • Fig. 1 Strategy for generating the Controlled cDNA Overexpression library, and transgenic Arabidopsis plant populations carrying random cDNA inserts.
  • 1) Isolation of total RNA from different Arabidopsis tissues.
  • 2) Generation of cDNA with flanking Gateway attBl and attB2 recombination sites.
  • 3) Creation of cDNA library in the Gateway Entry vector pDONR201.
  • 4) Transfer of the cDNA library into the binary destination vector pER8GW.
  • Fig. 2. Strategy for generating the Controlled cDNA Overexpression library, and transgenic Arabidopsis plant populations carrying random cDNA inserts.
  • 1) Isolation of total RNA from different Arabidopsis tissues.
  • 2) Generation of c
  • cDNA clones are amplified from genomic DNA of selected T2 plants using vector specific primers ER8A and ER8B. 2) The purified PCR fragment is sequenced with the ER8C and ER8B primers, and the identity of cDNA is defined by sequence homology search. The cDNA is cloned into pDONR201 vector using the Gateway BP reaction.
  • cloned insert can be verified using the M 13 forward and reverse primers that anneal to pDONR201 sequences.
  • the cloned cDNA can be further moved into various destination vectors using the Gateway LR reaction.
  • the cDNA is inserted into a destination plant expression vector, such as pER8-GW or pMDC32 (Curtis and Grossniklaus, Plant Physiol 133:462-469).
  • a destination plant expression vector such as pER8-GW or pMDC32 (Curtis and Grossniklaus, Plant Physiol 133:462-469).
  • FIG. 4 Characterization of the COS cDNA library.
  • XVE chimaeric XVE fusion gene, encoding the chimaeric transcription activator for the pLexA promoter (Zuo et al., 2000), HPT: hygromycin phosphotransferase gene, pLexA: LexA operator fused to a minimal promoter of Cauliflower Mosaic Virus 35S gene, attRl and attR2: Gateway recombination sites, CmR: Chloramphenicol resistance gene, ccdB: suicide marker for bacterial contraselection, T: RUBISCO rbcsS3A polyA sequence; RB and LB: T- DNA left and right border sequences, respectively.
  • cDNA randomly inserted cDNA clone; A and B: positions of T-DNA specific PCR primers used for amplification of inserted cDNAs.
  • Fig. 5 Sequence analysis of the A026 cDNA insert.
  • Fig. 6 Identification of Arabidopsis cDNAs conferring estradiol- inducible conditional ABA insensitivity.
  • Seedlings are shown 10 days (left) and 3 weeks (right) after germination.
  • D Comparison of germination efficiencies of wild-type (CoI-O) and A26 seeds in the presence and absence of estradiol on ABA-containing plates. The graph shows typical germination data derived from three independent experiments.
  • E-G Semi-quantitative RT-PCR analysis of HSPl 7.6A transcript levels in two weeks-old A26 seedlings using Actin2/8 as standard internal reference.
  • E Activation of HSPl 7.6A transcription by 4 ⁇ M estradiol treatment with or without 50 ⁇ M ABA.
  • F Induction of HSP '17.6 A transcription with heat-shock and salt stress in leaves of wild-type plants.
  • RNA templates prepared from roots (RO), rosette leaf (RL), cauline leaf (CL), stem (ST), unopened buds (BU), flowers (FL), young siliques (4 days after pollination, YS), developed, green siliques (10 days after pollination, GS), 3 and 8 days old seedlings growing in vitro on solid half strength MS medium under short day photoperiod (3S, 8S), and wilted rosette leaves (WL).
  • Fig. 7 Comparison of regulation of ABI3, ABH and ABI 5 transcript levels in A26 seedlings (A: ABB, B: ABH, C: ABlS).
  • Quantitative RT-PCR analysis was performed with RNA templates isolated from 3 days old A26 seedlings treated with either 20 ⁇ M ABA, or 4 ⁇ M estradiol, or their combination (A+E) for 3 and 8 hours. Ctr: untreated control. Relative values are shown using GAPDH2 as internal reference.
  • Fig. 8. Sequence analysis of the line A44.
  • Fig. 10 Germination of A44 line and wild type CoI-O plants on ABA containing medium.
  • Fig. 11 Germination and growth of A44 line and wild type CoI-O plants on high salt medium.
  • A) Germinated seedlings in the presence and absence of the estradiol inducer.
  • B) Growing plantlets on medium supplemented by lethal concentration of NaCl
  • FIG. 12 Expression of At5g25160 gene.
  • Fig. 13 T-DNA insertion mutant of the At5g25160 gene.
  • Fig. 15. cDNA insert identified in line N180.
  • A) Line N180 carried the cDNA sequence of gene At5gl6970. Color codes are the same as in Fig. 1.
  • Fig. 16 Analysis of AER (2-alkenal reductase, At5gl6970) transcription by semiquantitative RT-PCR.
  • Fig. 17 Sequence of the PCR fragment amplified from the N33 line. Blastn sequence homology search of the N33 sequence, showing high homology with the At4g 14520 gene. Predicted ATG site is highlighted with yellow.
  • Fig. 18 Sequence analysis and domain structure of the protein encoded by the At4gl4520 gene.
  • the encoded protein has similarity to the RPB5 and RPB7 subunit of RNA Polymerase II.
  • Fig. 20 Germination efficiencies of wild type and N33 seeds on media supplemented by high concentrations of ABA, NaCl and PEG. Note, that germination efficiency of the N33 line is superior in the presence of estradiol, which activates the expression of the inserted At4g 14520 cDNA.
  • Fig. 21 Expression of the At4gl4520 gene in N33 and in wild type plants.
  • Fig. 22 Germination of the transformed lines expressing the cloned At4g 14520 gene.
  • A) Germination on media containing lethal concentrations of salt and mannitol.
  • Fig. 23 Sequence analysis of cDNA inserts and characterization of ABA and salt tolerance of four truncated COS lines.
  • A) Sequence analysis of cDNA conferring ABA insensitivity in line A49.
  • Line 49 carried a truncated sequence of cDNA Atlg71950 (printed in red). The translational start and stop codons defining the full- length and predicted truncated open reading frames are highlighted in black. Green and blue shading indicates 5 'and 3' UTR sequences, respectively.
  • Fig. 26 Identification of cDNAs conferring estradiol- inducible activation of ADHl-LUC reporter.
  • Fig. 27 Sequence of the ADH121 cDNA insert.
  • A) The ADH121 cDNA corresponds to gene AT1G53910. The color coding is described in Fig. 1. The ADH121 cDNA lacks 72 bp of 3'-UTR reported in the database for AT1G53910 (shown in lower case without highlighting).
  • RAP2.12 is similar to the ethylene response factor ERF and belongs to the B-2 subfamily of ERF/AP2 transcription factors.
  • RAP2.12 is a member of the B-2 subfamily of AP2/ERF transcription factors and shows ABA-independent transcriptional regulation.
  • Fig. 1 Flow chart of the cDNA library construction is shown in Fig. 1.
  • the library was constructed from Arabidopsis (CoI-O) RNA samples, which were collected from ten different tissue sources (Table 1).
  • Table 1 List of Arabidopsis organs and tissues used for RNA isolation and construction of COS cDNA library.
  • PCR product was purified with QIAquick PCR purification kit (Qiagen) and then cloned into pDONR201 using an overnight BP Clonase reaction (Invitrogen) as recommended by the manufacturer. Aliquots of the reaction mix were transformed into electrocompetent E.coli DHlO cells. Plasmid DNA was isolated from one million colonies and aliquots were used for transferring cDNA inserts into the pER8GW vector using the LR Clonase reaction (Invitrogen).
  • plasmid DNA was isolated from half million colonies and introduced in aliquots into electrocompetent Agrobacterium GV3101 (pMP90) cells (Koncz et al, 1994).
  • the amplified fragment contains the 5'-region of the ADHl gene extending from position -2385 to - 20 upstream of the ATG codon (position +39 downstream of the transcription start, Fig. 25A).
  • the amplified promoter fragment was inserted into the Hindlll site of the promoter test vector pBinLuc+ (Mullineaux et al. 1990; a kind gift of F. Nagy, BRC, Szeged, Hungary) generating a transcriptional fusion with the firefly luciferase (LUC) reporter gene.
  • ADHl-LUC reporter construct was introduced into Arabidopsis (CoI-O ecotype) by Agrobacterium-mediated gene transfer. Twenty independent transformants were selected and tested for segregation of the kanamycin resistance marker in the T2 generation, as well as for the activity of ADHl-LUC reporter using bio luminescence imaging (Alvarado et al., 2004). Induction of ADHl-LUC by ABA was performed by spraying seedlings with 50 ⁇ M ABA solution or transferring seedlings on culture medium supplemented by 20OmM NaCl, 40OmM sucrose or 1OmM H 2 O 2 and measuring bio luminescence in 30 minute intervals for 18 hours. Luminescence values were analysed with the Metaview software (Universal Imaging Corporation, Downingtown, PA, USA). For graphical presentation, luminescence values were normalized to background.
  • the pER8GW COS cDNA library was introduced into Arabidopsis (CoI-O) by large-scale in-planta transformation (Clough and Bent, 1998). Tl seed of 1000 infiltrated plants were collected in bulk. To select for estradiol- inducible dominant gain-of function phenotype, three selection schemes were employed. To select for salt tolerance in growth assays, Tl seeds were first germinated on agar-solidified half strength MS medium (0.5MS) containing 0.5% sucrose, 20mg/l hygromycin and lOOmg/1 claforan.
  • MS medium 0.5MS
  • hygromycin resistant seedlings were transferred onto selective 0.5MS medium supplemented with 225mM NaCl and 4 ⁇ M estradiol. Plantlets that survived salt stress and remained green for at least two weeks under these conditions were rescued, transferred to 0.5MS medium for two weeks and subsequently into soil to produce seed.
  • Tl seeds were germinated on selective (i.e., salt and estradiol containing) medium in the presence of claforan and salt tolerant seedlings were subsequently tested for hygromycin resistance.
  • Tl seeds were germinated on hygromycin plates and 20,000 Hyg resistant seedlings were assayed on 4 ⁇ M estradiol-containing medium for luciferase activity. Seedlings showing enhanced luminescence were transferred onto 0.5MS medium for two weeks and then into soil to obtain T2 progeny. Flow chart of the screening and testing procedure is depicted in Fig. 2.
  • cDNAs carried by the pER8GW T-DNA inserts were rescued by PCR amplification using genomic DNA templates prepared from transgenic plants according to Dellaporta et al. (1983), and the ER8A and ER8B primers that are complementary to vector sequences flanking the attRl and attR2 sites (see Table 4).
  • the cDNAs were sequenced with the same primer pair and the sequences were analyzed by BlastN homology searches.
  • the PCR amplified cDNA was cloned into pDONR201 vector using the Gateway BP Clonase reaction (Invitrogen) and then moved into the binary vector pER8GW by Gateway LR Clonase reaction.
  • Fig. 3 A flow chart of the cloning procedure is depicted in Fig. 3.
  • RT-PCR To monitor estradiol- induced production of cDNA encoded transcripts, either real-time or semiquantitative RT-PCR was performed. Hormone and stress treatments were carried out with 3 weeks old plants grown in sterile culture in vitro under short day photoperiod (8 h light/16h dark) by transferring them into liquid culture medium supplemented by different additives. If not stated otherwise, the following treatments were employed: 20 ⁇ M ABA, 20OmM NaCl, 40OmM sucrose, 1OmM H 2 O 2 , 4 ⁇ M paraquat in liquid half strength MS medium for 3 to 24h. Control plants were incubated for the same time period in half strength MS medium.
  • Heat shock was performed at 37°C for 3 hours in a humid chamber, while control plants were kept under similar conditions at 22°C for the same time.
  • plants were sprayed with 4 ⁇ M 17- ⁇ -estradiol (Sigma, prepared in DMSO as 4mM stock and then diluted in water) and harvested at a defined time-point following the treatment.
  • Control plants were sprayed with 0.1% DMSO in water.
  • the samples were harvested either at the same time or within the same light period of the day.
  • Leaves were collected from 4 weeks-old greenhouse-grown plants. Siliques were removed from flowering plants 4 and 10 days after pollination. Wilted leaves were collected from 4 weeks-old greenhouse-grown plants, which were kept without watering for 5 days. Roots samples were collected from 4 weeks-old plants grown in the greenhouse.
  • Real time quantitative RT-PCR reactions were prepared with SYBR ® Green JumpStartTM Taq ReadyMixTM (Sigma) employing the following protocol: denaturation 95°C/10 min, 40 to 45 cycles of 95°C/10 sec and 60°C/l min, with ABI PRISM 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA). Gene specific primers, used for RT-PCR analysis, are described in (see Table 4). Actin2/8 (At3gl8780) and GAPDH2 (Atlgl3440) used as internal reference (An et al, 1996). Experiments were repeated at least twice.
  • ADHl enzyme by histochemical staining was performed as described (Baud and Graham, 2006). Three weeks old seedlings from the parental ADHl-LUC and pER8GW-cDNA transformed ADH121 lines were treated with liquid 0.5MS medium containing either 4 ⁇ M estradiol and 0.1% DMSO, or 0.1% DMSO as control, for 24 hours. Subsequently, the seedlings were transferred into the ADHl reaction buffer containing 100 mM sodium phosphate (pH 7.5), 400 ⁇ M NAD + , 100 ⁇ M Nitro Blue Tetrazolium (Sigma-Aldrich Co., St. Louis, USA) and 3% ethanol as substrate, and incubated at 30 0 C for 10 min. The enzyme reaction was subsequently stopped by removing the reaction mixture and rinsing the plants with distilled water.
  • Sequence homology searches were performed using the TAIR BLAST service (http://www.arabidopsis.org/Blast/index.jsp). PCR primers were designed with the Primer3 software (http://biotools.umassmed.edu/bioapps/primer3_www.cgi). Multiple sequence alignments were generated using the ClustalW program (http://www.ebi.ac.uk/clustalw/index.html). Protein domain analyses were performed using the SMART service (http://smart.embl-heidelberg.de/). Analysis of publicly available transcript profiling data was performed using the Genevestigator service and database (http://www.genevestigator.ethz.ch/).
  • An Arabidopsis cDNA library was constructed in the pDONR201 vector using a Super SMART cDNA Synthesis system (Clontech; Fig. 1) in combination with the GATEWAY cloning technology and RNA templates from different Arabidopsis organs, dark-grown, green and salt-stressed seedlings, and cultured cells (Table 1).
  • the cDNA library was subsequently transferred into pER8GW, a GATEWAY- version of estradiol- indicuble expression vector pER8 (Zuo et al., 2000), which carries an attRl and attR2 recombination cassette between Xhol and Spel cloning sites of pER8 (I. Sommsich and B.
  • the COS library was introduced into Agrobacterium GV3101 (pMP90) (Koncz and Schell, 1986) by electroporation and used subsequently for transformation of wild-type Arabidopsis (CoI-O) plants, as well as a transgenic line carrying the ADHl-LUC reporter gene construct. Ti progeny of infiltrated plant populations was used for the subsequent screening procedures.
  • three screening strategies were employed by selecting for transformants showing ABA insensitivity in germination screens, salt tolerance in seedling growth assays, and activation of a stress-inducible ADHl-LUC reporter gene in seedlings (Fig. 2).
  • transgenic plants Twenty to forty thousand transgenic seeds and seedlings were screened in each of these assays using estradiol in the growth medium for transient induction of cDNA expression. Upon selection, the transgenic plants were transferred into estradiol- free medium and then into soil to set seed. The segregation of selected phenotype in the T2 offspring was recurrently assayed by germinating and growing seedlings both in the presence and absence of estradiol, and testing for co-segregation of estradiol- induced conditional phenotype with the hygromycin resistance marker of pER8GW T-DNA insert.
  • cDNA inserts present in the selected Arabidopsis lines were isolated by PCR amplification from genomic DNA templates using the ER8A and ER8B primers that anneal to the pER8 vector T-DNA sequences flanking the attB recombination sites (Fig. 3, Table 4). Subsequently, the isolated cDNAs were sequenced and characterized by performing BLAST homology searches with the Arabidopsis sequence database (www.arabidopsis.org).
  • T2 progeny of these plants was retested for the ABA insensitive seed germination phenotype in the presence and absence of estradiol along with parallel scoring for single locus segregation of the T-DNA-encoded hygromycin resistance marker.
  • Fig. 6B For further analysis, we chose 25 lines, which showed different degree of estradiol- dependent ABA insensitivity in the germination assay (Fig. 6B). From these, ABA insensitive germination of 19 lines was completely estradiol-dependent, whereas 6 lines displayed some degree of ABA insensitive germination also in the absence of estradiol.
  • At4gl4520 Unknown protein, similar to RNA polymerase Rpb7 NaCl -28 1.0
  • At4gO132Q CAAX protease (ATSTE24) NaCl -300 1.56 ri21b At2g3086U glutathione S-transferase class phi 9 (ATGSTF9) NaCl +1 0.83
  • Line A26 carried a full-length cDNA of class II small heat-shock protein 17.6A (HSP17.6A, At5gl2030) gene, including a 5 '-untranslated leader of 53bp and 3'-UTR sequences of 127bp (Fig. 5).
  • Hspl7.6A has not been implicated so far in 5 the control of ABA-response of seed germination, we have performed further characterization of line A26.
  • the conditional ABA insensitivity of line A26 was dominant, and 3:1 segregation of hygromycin resistant and sensitive offspring indicated that this trait is linked to a single T-DNA insertion.
  • A26 seeds germinated in the presence of 3 ⁇ M ABA and 4 ⁇ M estradiol, while their ABA
  • HSP 17.6 A expression in line A26 was indeed induced only by estradiol, but not by ABA (Fig. 6E).
  • HSP 17.6 A transcription was activated by heat-shock and salt stress in wild-type plants (Fig. 6F).
  • HSP 17.6 A showed very low expression in most organs except for roots and
  • ABA sensitivity of seed germination is controlled by the transcription factors ABB, ABI4 and AB 5 (Finkelstein et al, 2002). Therefore, we tested the transcript levels of these key transcription factors in A26 plants treated with or without ABA and estradiol. As in wild-type, ABA treatment of A26 seeds lead to the induction of
  • the ZFP3 protein has a C2H2 domain, and belongs to a protein family, with several known members, which are implicated in transcription regulation (Fig. 9, Table 3). At present, no information on the function of the ZFP3 protein is available. Therefore, the gene cloned in line A44 is a novel regulator involved in Arabidopsis stress tolerance by modifying ABA sensitivity of the germination.
  • At5g25160 gene expression is responsive to salt and ABA treatments in wild type plants. Conditional At5g25160 gene activation could therefore convert germination insensitive to ABA inhibition.
  • T-DNA insertion mutants in public mutant collections. Germination of zfp3 mutants was more sensitive to ABA inhibition (Fig. 13). All these data suggested that the ZFP3 protein, encoded by the At5g25160 gene is implicated in ABA signal transduction, and functions as negative regulator of ABA action during germination.
  • transgenic Tl seed was germinated on plates containing hygromycin, and resistant plantlets were transferred to selective half strength MS agar plates supplemented with 225mM NaCl and 4 ⁇ M estradiol.
  • 20,000 seeds were germinated on half strength MS agar plates containing 225mM NaCl and 4 ⁇ M estradiol. Under this condition, wild type seeds either did not germinate or the seedlings died after germination.
  • Lines displaying salt tolerant germination and subsequent development of green seedlings within 15 to 20 days on the selective medium (Fig. 14A) were transferred to soil to set seed.
  • Salt tolerance of T2 offspring of selected lines was recurrently tested in germination and growth assays using salt selection in the presence or absence of 4 ⁇ M estradiol.
  • Estradiol-dependent conditional salt tolerance characterized by at least two-fold higher germination rate compared to wild-type seeds was confirmed for 14 lines (Fig. 14B), from which the cDNA inserts were subsequently PCR amplified.
  • inspection of public transcript profiling data http://www.genevestigator.ethz.ch) indicated that transcription of the 2AER At5gl6970 gene is upregulated by hydrogen peroxide, senescence and wounding. Screening for ABA insensitivity and salt tolerance has also resulted in the identification of several lines carrying truncated cDNA inserts (Table 2).
  • estradiol-dependent ABA insensitivity and salt tolerance phenotypes of four of these lines were repeatedly tested in three independent experiments. Sequence analysis showed that the identified cDNA inserts contained in frame ATG codons for potential translation of N-terminally truncated proteins carrying some functionally important regulatory domains (Fig. 23, Fig. 24). However, in the absence of suitable antibodies against these proteins, it remained an open question whether the observed estradiol-dependent dominant stress tolerance phenotypes resulted from overproduction of truncated proteins, or from dominant co- suppression mediated by the corresponding truncated transcripts as suggested by LeClere and Bartel (2001), or both.
  • FIG. 17 Another Arabidopsis line, line N33, also showed significantly increased germination capability on high salt medium.
  • PCR amplification and sequence analysis of the insert could identify the full length cDNA of the At4g 14520 gene (Fig. 17).
  • This gene encodes a previously uncharacterized protein (Fig. 18), which, according to the TAIR Arabidopsis database is ,,DNA-directed RNA polymerase II-related; similar to RNA polymerase Rpb7 N-terminal domain- containing protein".
  • the protein showed some similarity to RBP5 and RBP7 subunit of RNA Polymerase II, and had an Sl domain which was originally identified in ribosomal protein Sl and was implicated in RNA binding.
  • the structure of the Sl domain is very similar to that of cold shock proteins (Fig. 18). This suggests that they may both be derived from an ancient nucleic acid-binding protein. Accordingly, the insert of line N33 is a novel gene playing a specific role in regulating stress responses in Arabidopsis. Estradiol-induced overexpression of the At4gl4520 gene lead to increased germination and growth on media supplemented by lethal concentration of salt (25OmM NaCl, Fig. 19, Fig. 20). Improved germination in the presence of ABA and polyethylene glycol (used to generate of high osmotic stress) was also observed Fig. 19, Fig. 20).
  • At4gl4520 transcription has confirmed the estradiol-dependent activation of this gene in N33 line, which was not the case in wild type (CoI-O) and non-treated plants (Fig. 21A).
  • Analysis of At4gl4520 expression in wild type plants revealed the presence of low transcript levels in all tested organs, with higher levels in wilted leaves (Fig. 21B) and in salt-treated plants (Fig. 21C).
  • the full length cDNA was cloned into the pER8GW expression vector, used originally for the construction of the cDNA library, and introduced again into wild type Arabidopsis.
  • Several transgenic lines showed estradiol-dependent germination on high salt (25OmM NaCl) and high osmotic medium (50OmM mannitol), confirming that enhanced level of At4gl4520 expression can create increased stress tolerance (Fig. 22).
  • the 2358bp long ADHl promoter which have previously been characterized by site-specific mutagenesis and in vivo footprinting studies (Dolferus et al., 1994), was fused to a promoterless firefly luciferase F ⁇ uc+ reporter gene in pBINluc + (Fig. 25 A, Mullineaux et al., 1990) to generate an ADHl-LUC reporter construct, which was introduced into Arabidopsis. Lines carrying single locus insertions of ADHl-LUC reporter in homozygous form were obtained and tested for basal level of ADHl-LUC conferred light emission in seedlings and various organs of developing plants (data not shown).
  • estradiol did not induce the ADHl-LUC reporter in the parental control plants
  • the ADH121 line showed gradually increasing bio luminescence after estradiol treatment (Fig. 26B,C).
  • transfer of the parental ADHl-LUC and ADH121 seedlings to medium containing 20OmM NaCl led to transient increase of bio luminescence within 3 to 4 hours followed by gradual decrease of ADHl-LUC expression (Fig. 26B,C).
  • the COS cDNA transformed ADH121 line displayed persistent maintenance of high level luciferase expression for at least 16 hours (Fig. 26B,C).
  • estradiol-mediated induction of a cDNA construct in ADH121 also leads to root specific activation of endogenous ADHl gene (i.e., as seen for estradiol- induced activation of the ADH-LUC reported in the ADH121 line in Fig. 26D)
  • estradiol-induced activation of the ADH-LUC reported in the ADH121 line in Fig. 26D
  • we have compared the ADH enzyme activities in roots of parental ADHl- LUC and cDNA transformed ADH121 lines using a histochemical assay (Baud and Graham, 2006). Whereas estradiol-treatment failed to stimulate endogenous ADH activity in roots of parental ADHl-LUC plants, strong histochemical staining revealed estradiol- induced activation of the ADH enzyme in roots of cDNA transformed ADH121 seedlings (Fig. 26F).
  • PCR amplification and sequence analysis revealed that a single pER8GW T- DNA insert in the ADH121 line carried a full-length cDNA of Atlg53910 gene encoding RAP2.12, a yet uncharacterized member of the AP2/ERF (ethylene responsive element binding factor) transcription factor family (Fig. 27).
  • AP2/ERF- like transcription factors carry one or two AP2-type DNA binding domains and are represented by 122 genes in Arabidopsis (Nakano et al, 2006).
  • RAP2.12 has a single AP2 domain and belongs to the B-2 subfamily, which includes five members sharing high sequence identity, some of them known to control stress responses (Fig. 28 A, Sakuma et al., 2002).
  • AtEBP/RAP2.3 which is closely related to RAP2.12, is thus known to confer resistance to H 2 O 2 and heat stress, and to activate a number of defense genes (Ogawa et al., 2005).
  • Other AP2/ERF transcription factors recognize so-called GCC-box sequences and control ethylene responsiveness of several PR gene promoters (Gu et al., 2000, Ogawa et al., 2005).
  • RAP2.12 expression correlates with the induction of ADHl-LUC reporter.
  • High levels of RAP2.12 transcript was exclusively detected in estradiol-treated ADH121 seedlings, whereas in the absence of estradiol or in the presence of ABA only very low levels of RAP2.12 RNA could be detected in ADH121 seedlings and the parental ADHl-LUC line (Fig. 28B). This data thus showed that RAP2.12 transcription was not induced by ABA and could only be activated by estradiol treatment in ADH121.
  • Floral dip a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: vesion II.
  • Plant MoI. Biol. Rep. 1: 19-21 Dolferus R, Jacobs M, Peacock WJ, Dennis ES (1994) Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene. Plant Physiol 105: 1075-1078 Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell (Suppl) 14: S15-S45 Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol 124: 1854- 1865
  • EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10: 1391-406
  • Arabidopsis thaliana salt tolerance gene SOSl encodes a putative Na+/H+ antiporter. Proc Natl Acad Sci USA 97: 6896-6901 Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana CBFl encodes an AP2 domain-containing transcriptional activator that binds to the C- repeat/DRE, a c ⁇ -acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit.
  • HSP.17.6AR TAGTTGCTTATCGATTACAT RT-PCR analysis of HSP17.6A gene
  • RAP12A AAGATGCTGTAACGACTCAGGACAATGG RT-PCR analysis of RAP2.12 gene
  • RAP12B CTTCATCACAACTACCCTCAAGATAGA RT-PCR analysis of RAP2.12 gene

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP09738069A 2008-04-30 2009-04-24 GESTEUERTES cDNA-ÜBEREXPRESSIONSSYSTEM IN ARABIDOPSIS Withdrawn EP2288709A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
HU0800288A HU0800288D0 (en) 2008-04-30 2008-04-30 Controlled cdna overexpression system in arabidopsis useful for identifying regulatory genes
HU0800351A HUP0800351A2 (hu) 2008-05-30 2008-05-30 Szabályozott cDNS expressziós rendszer Arabidopsis-ban
PCT/EP2009/054946 WO2009133025A1 (en) 2008-04-30 2009-04-24 Controlled cdna overexpression system in arabidopsis

Publications (1)

Publication Number Publication Date
EP2288709A1 true EP2288709A1 (de) 2011-03-02

Family

ID=89988313

Family Applications (1)

Application Number Title Priority Date Filing Date
EP09738069A Withdrawn EP2288709A1 (de) 2008-04-30 2009-04-24 GESTEUERTES cDNA-ÜBEREXPRESSIONSSYSTEM IN ARABIDOPSIS

Country Status (2)

Country Link
EP (1) EP2288709A1 (de)
WO (1) WO2009133025A1 (de)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102516377A (zh) * 2012-01-12 2012-06-27 吉林大学 一种大豆erf转录因子及其编码基因与耐盐应用
CN110256545B (zh) * 2019-06-19 2020-12-29 中国农业大学 ZmAER蛋白及其编码基因和应用
CN114836432A (zh) * 2022-04-13 2022-08-02 江西农业大学 一种提高种子在黑暗和盐胁迫条件下萌发率的拟南芥pif1基因及其应用

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2009133025A1 *

Also Published As

Publication number Publication date
WO2009133025A1 (en) 2009-11-05

Similar Documents

Publication Publication Date Title
Papdi et al. Functional identification of Arabidopsis stress regulatory genes using the controlled cDNA overexpression system
Fujita et al. A dehydration‐induced NAC protein, RD26, is involved in a novel ABA‐dependent stress‐signaling pathway
US8030546B2 (en) Biotic and abiotic stress tolerance in plants
RU2558249C2 (ru) Белок-фактор транскрипции dst с доменом "цинковые пальцы" риса и его применение для регуляции устойчивости к засухе и к действию солей
US7576263B2 (en) Gene OSISAP1 of rice confers tolerance to stresses and a method thereof
US20050086718A1 (en) Plant transcriptional regulators of abiotic stress
US20090265813A1 (en) Stress tolerance in plants
US7186563B2 (en) Methods and compositions for regulating plant stress tolerance
Bang et al. Characterization of the stress-inducible OsNCED3 promoter in different transgenic rice organs and over three homozygous generations
AU2003222646B2 (en) ICE1, a regulator of cold induced transcriptome and freezing tolerance in plants
WO2015007240A1 (en) Transgenic maize
Park et al. ATHB17 is a positive regulator of abscisic acid response during early seedling growth
AU2019261797A1 (en) Plants having enhanced abiotic stress resistance
US10975384B2 (en) PYL9 and uses thereof
WO2000009724A9 (en) Transgenic plants expressing a mapkkk protein kinase domain
WO2008157157A2 (en) Drought-resistant plants and method for producing the plants
WO2009133025A1 (en) Controlled cdna overexpression system in arabidopsis
US20100281580A1 (en) Use of a gene encoding a histidine protein kinase to create drought resistant plants
AU2012222855B2 (en) Stress responsive expression
US11618903B2 (en) Methods for improving plant abiotic stress tolerance and yield
KR101439761B1 (ko) 가뭄 스트레스에 대한 저항성을 증진시키는 식물의 신규 전사조절인자 ａｎａｃ０９６
Joseph Identification & functional characterization of the Arabidopsis ZINC FINGER PROTEIN 3
Neff Molecular genetic analysis of activation-tagged transcription factors thought to be involved in photomorphogenesis

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20101124

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA RS

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20121001

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140207