EP2283161A2 - Procédé d'évaluation du cancer colorectal et compositions utilisables à cet effet - Google Patents

Procédé d'évaluation du cancer colorectal et compositions utilisables à cet effet

Info

Publication number
EP2283161A2
EP2283161A2 EP09747751A EP09747751A EP2283161A2 EP 2283161 A2 EP2283161 A2 EP 2283161A2 EP 09747751 A EP09747751 A EP 09747751A EP 09747751 A EP09747751 A EP 09747751A EP 2283161 A2 EP2283161 A2 EP 2283161A2
Authority
EP
European Patent Office
Prior art keywords
mir
expression
crc
seq
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP09747751A
Other languages
German (de)
English (en)
Other versions
EP2283161A4 (fr
Inventor
Mitch Raponi
Greg M. Arndt
Lesley Dossey
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Janssen Diagnostics LLC
Original Assignee
Janssen Diagnostics LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Janssen Diagnostics LLC filed Critical Janssen Diagnostics LLC
Publication of EP2283161A2 publication Critical patent/EP2283161A2/fr
Publication of EP2283161A4 publication Critical patent/EP2283161A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • This invention relates, in one embodiment, to a method for detecting and/or monitoring colorectal cancer (CRC) by observing regulatory changes in the production of select microRNA (miRNA) sequences. By observing up regulation or down regulation changes of specified sequences, both the presence of cancer cells as well as the stage of cancer may be determined.
  • CRC colorectal cancer
  • CRC Colorectal cancer
  • nt short 22 nucleotide non-coding RNAs
  • miRNAs microRNAs
  • the biogenesis of these small RNAs involves transcription by RNA polymerase II and processing of the primary transcript by the endonuclease Drosha to produce 60-70-nt precursor miRNAs (pre-miRNAs) with imperfect hairpin structures.
  • the pre-miRNA is transported into the cytoplasm through exportin 5 where it undergoes processing by the RNAse III enzyme Dicer to produce mature miRNAs that are then incorporated into a multiprotein complex.
  • These miRNA-containing complexes have been shown to bind to the 3' untranslated region (UTR) of multiple mRNAs through complementarity between the resident miRNA strand and the target sequence and, based on the degree of homology, direct either translational inhibition or mRNA degradation.
  • UTR 3' untranslated region
  • miRNAs may regulate as many as 30% of the human protein coding genes, suggesting that these small RNAs may act to coordinate the interplay between complex signal transduction pathways.
  • miRNAs have been identified as differentially expressed between normal and tumor tissues or cancer cell lines. (Calin, G. A. and Croce, C. M. MicroRNA signatures in human cancers. Nat Rev Cancer, 6: 857-866, 2006; Bandres, E., Cubedo, E., Agirre, X., Malumbres, R., Zarate, R., Ramirez, N., Abajo, A., Navarro, A., Moreno, L, Monzo, M., and Garcia-Foncillas, J.
  • the invention comprises, in one form thereof, a method for detecting the presence of colorectal cancer in a cell sample.
  • the invention is a method for diagnosing the stage of colorectal cancer in a cell sample.
  • Applicants have discovered certain miRNAs that are differentially regulated in colorectal cancers relative to wild type cells. By determining the degree of regulatory changes in such miRNAs, one can determine if a tissue sample includes colorectal cancer cells.
  • Applicants have discovered certain other miRNAs that are differentially regulated in late stage (stage III and IV) colorectal cancers relative to early stage (stage I and II) colorectal cancers. By monitoring these miRNAs, one can differentiate a late stage tumor sample from an early stage tumor sample without needing to rely on less dependable identifiers, such as cell morphology.
  • FIG. 1 Two-way hierarchical clustering of CRC and normal colorectal tissue using 41 differentially expressed miRNAs.
  • the geometric mean of the Log2 signal intensity was calculated across all samples using a Euclidean distance metric with complete linkage. Red and blue indicates miRNAs expressed at a relatively high or low level, respectively.
  • the miR-143-145 and miR- 17-92 clusters are indicated by vertical blue and red bars, respectively.
  • Samples are grouped into three main clusters: Cluster I primarily represents normal colorectal tissue, and Clusters II and III represent CRC samples. Replicate samples are indicated by the suffix "2".
  • FIG. 1 Correlation of miRNA expression comparing the mirVanaTM Bioarray and ABI TaqMan® platforms. Linear regression was performed on 19 mrRNAs that were measured on both platforms. Four different CRC samples were examined. Correlations ranged from 0.85 to 0.92.
  • A TaqMan® miRNA expression assays were performed on 26 miRNAs from 4 matched fresh frozen and FFPE samples.
  • FIGB Comparison of expression of 18 miRNAs from 2 matched fresh frozen and FFPE samples using the mirVanaTM Bioarray assay.
  • A The genomic region surrounding the miR-145 gene was PCR-amplified and cloned into pSilencerTM 4.1 under control of the CMV promoter. Mature miR-145 was detected by Northern analysis in a pooled population of SW620 cells following transfection. U6 snRNA was used as a loading control.
  • B A major distinguishing feature of the cell population over-expressing miR-145 was the change in cell morphology from the round single cells of SW620 to elongated cells with extended processes typical of f ⁇ broblast-like cells.
  • FIG. 7 Antisense-mediated reversion of miR-145 induced proliferation.
  • A Total RNA from treated samples showed that miR-145 was depleted in cells receiving the miR-145 specific 2'0me antisense RNA but not in the mock treated, or miR-145 sense treated controls.
  • B As expected, SW620/miR-145 expressing pools showed increased proliferation compared to vector controls in the presence (solid bars) or absence (open bars) of serum.
  • FIG. 8 Over-expression of miR-143 in the SW620 cell line affects cell morphology and proliferation.
  • miR-143 genomic DNA was cloned under control of the U6 promoter (in pSilencerTM 2.1) and transfected into SW620 cells. Seven stable SW620 clones were identified that expressed miR-143 (A4, B3, B5, B6, Cl, C5, and D2). U6 snRNA was used as a loading control.
  • B The seven SW620/miR-143 clones were examined for cell morphology compared to vector control.
  • C Western analysis of the SW620/miR-143 clones and control cells show the steady-state levels of E-cadherin.
  • E-cadherin ratios were calculated using ⁇ -actin as a normalization control.
  • D SW620/miR-143 clones were assayed for proliferation/metabolic activity compared with vector control when grown in the absence (open bars) or presence of serum (solid bars).
  • E The same clones were examined for anchorage-independent cell growth in the rapid soft agar assay in the presence of serum. Two independent experiments were performed, p ⁇ 0.01, p ⁇ 0.001.
  • Figure 9 Correlation between miR-143 andmiR-145 expression. Linear regression analysis was performed comparing the normalized expression intensity (Iog2) for the miR-143 andmiR-145 genes. The correlation between the miRNAs was 0.95.
  • FIG. 10 Shows the interaction map for miR-17-92.
  • Figure 11 Over-expression of miR- 17-92 cluster and miR-20a alone in the S W620 cell line affects cell morphology and proliferation.
  • the genomic region containing the chromosome 13 -based miR-17-92 cluster and the genomic region containing the miR-20a pre-miRNA were PCR-amplified, cloned under control of the CMV promoter in the retrofviral vector pQCXIN and delivered to the HCTl 16 colon cancer cell line.
  • the HCTl 16/miR- 17-92 cluster clones (4-1 and 4-17) were screened for miR-20a, miR-92, miR-18a, and miR-19a over-expression using Northern blot analysis.
  • B Histogram of miR-17-92 component miRNA expression levels calculated from Northern blot. Expression levels were normalized to U6 snRNA.
  • C Several HCTl 16 clones over- expressing miR-20a (9-3, 9-9, 9-12, 9-13) or the miR-17-92 cluster (4-1,4-7) were examined for cell proliferation/metabolic activity in the presence (solid bar) or absence of serum (open bar).
  • D The same clones were examined for anchorage-independent cell growth in the rapid soft agar assay (in the presence of serum), p ⁇ 0.05, p ⁇ 0.01, PO.001.
  • MircroRNAs are short non-coding RNAs that control protein expression through various mechanisms. Their altered expression has been shown to be associated with various cancers.
  • a method is described here that profiles miRNA expression in CRC and analyzes the function of specific mrRNAs in CRC cells.
  • mirVanaTM miRNA Bioarrays were used to determine the miRNA expression profile in eight CRC cell line models, 45 human CRC samples of different stages, and four normal colon tissue samples. 11 common miRNAs that were differentially expressed between normal colon and CRC in both the cell line models and clinical samples were identified. It has now been shown that many of these miRNAs are related to different stages of CRC tumor progression including miR- 145, which is greatly reduced in CRC.
  • miRNAs can be targets for CRC therapies and diagnostic and prognostic analytes.
  • a biomarker is any indicia of the level of expression of an indicated marker gene.
  • the indicia can be direct or indirect and measure over- or under- expression of the gene given the physiologic parameters and in comparison to an internal control, normal tissue or another carcinoma.
  • Biomarkers include, without limitation, nucleic acids (both over- and under- expression and direct and indirect).
  • nucleic acids as Biomarkers can include any method known in the art including without limitation measuring DNA amplification, RNA, microRNA, loss of heterozygosity (LOH), single nucleotide polymorphisms (SNPs), microsatellite DNA, DNA hypo- or hyper-methylation.
  • Biomarkers includes any method known in the art including, without limitation, measuring amount, activity, modifications such as glycosylation, phosphyorylation, ADP-ribosylation, ubiquitination, etc., or immunohistochemistry (IHC).
  • Other biomarkers include imaging, cell count and apoptosis markers.
  • the indicated genes or miRNAs provided herein are those associated with a particular tumor or tissue type. Numerous genes associated with one or more cancers are known in the art.
  • the present invention provides preferred Marker genes and even more preferred Marker gene combinations. These are described herein in detail.
  • a Marker gene corresponds to the sequence designated by a SEQ ID NO when it contains that sequence or its complement.
  • a gene segment or fragment corresponds to the sequence of such gene when it contains a portion of the referenced sequence or its complement sufficient to distinguish it as being the sequence of the gene.
  • a gene expression product corresponds to such sequence when its RNA, mRNA, miRNA or cDNA hybridizes to the composition having such sequence (e.g. a probe) or, in the case of a peptide or protein, it is encoded by such mRNA.
  • a segment or fragment of a gene expression product corresponds to the sequence of such gene or gene expression product when it contains a portion of the referenced gene expression product or its complement sufficient to distinguish it as being the sequence of the gene or gene expression product.
  • Marker or “Marker gene” is used throughout this specification to refer to genes and gene expression products that correspond with any gene the over- or under-expression of which is associated with a tumor or tissue type.
  • the preferred Marker genes are described in more detail herein. All sequences discussed herein are described herein and provided in the Sequence Listing.
  • the present invention further provides kits for conducting an assay according to the methods provided herein and further containing Biomarker detection reagents.
  • the present invention further provides microarrays or gene chips for performing the methods described herein.
  • the present invention further provides diagnostic/prognostic portfolios containing isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes as described herein where the combination is sufficient to measure or characterize gene expression in a biological sample having metastatic cells relative to cells from different carcinomas or normal tissue.
  • Any method described in the present invention can further include measuring expression of at least one gene constitutively expressed in the sample.
  • the invention further provides a method for providing direction of therapy by determining the status of a CRC according to the methods described herein and identifying the appropriate treatment therefor.
  • the invention further provides a method for providing a prognosis by determining the status of a CRC according to the methods described herein and identifying the corresponding prognosis therefor.
  • compositions comprising at least one isolated sequence selected from SEQ ID Nos: 1-34.
  • the invention further provides kits, articles, microarrays or gene chip, diagnostic/prognostic portfolios for conducting the assays described herein and patient reports for reporting the results obtained by the present methods.
  • the mere presence or absence of particular nucleic acid sequences in a tissue sample has only rarely been found to have diagnostic or prognostic value.
  • Information about the expression of various proteins, peptides, miRNA or mRNA is increasingly viewed as important.
  • the mere presence of nucleic acid sequences having the potential to express proteins, peptides, miRNA or mRNA (such sequences referred to as "genes") within the genome by itself is not determinative of whether a protein, peptide, or mRNA is expressed in a given cell.
  • the gene expression profiles of this invention are used to provide a diagnosis and treat patients for CRC. Sample preparation requires the collection of patient samples. Patient samples used in the inventive method are those that are suspected of containing diseased cells such as cells taken from a nodule in a fine needle aspirate (FNA) of tissue.
  • FNA fine needle aspirate
  • LCM laser capture microdissection
  • Samples can also comprise circulating epithelial cells extracted from peripheral blood. These can be obtained according to a number of methods but the most preferred method is the magnetic separation technique described in 6136182. Once the sample containing the cells of interest has been obtained, a gene expression profile is obtained using a Biomarker, for genes in the appropriate portfolios.
  • Preferred methods for establishing gene expression profiles include determining the amount of RNA that is produced by a gene either mRNA or miRNA. This is accomplished by reverse transcriptase PCR (RT-PCR), competitive RT-PCR, real time RT-PCR, differential display RT-PCR, Northern Blot analysis and other related tests. While it is possible to conduct these techniques using individual PCR reactions, it is best to amplify complementary DNA (cDNA) or complementary RNA (cRNA) produced from mRNA or miRNA and analyze it via microarray or other suitable method.
  • RT-PCR reverse transcriptase PCR
  • competitive RT-PCR competitive RT-PCR
  • real time RT-PCR real time RT-PCR
  • differential display RT-PCR differential display RT-PCR
  • Northern Blot analysis and other related tests. While it is possible to conduct these techniques using individual PCR reactions, it is best to amplify complementary DNA (cDNA) or complementary RNA (cRNA) produced from mRNA or miRNA and analyze it via microarray or other suitable method.
  • Microarray technology allows for measuring the steady-state mRNA level of thousands of genes simultaneously providing a powerful tool for identifying effects such as the onset, arrest, or modulation of uncontrolled cell proliferation.
  • Several microarray technologies are currently in wide use, mirVanaTM Bioarray, cDNA arrays and oligonucleotide arrays. Although differences exist in the construction of these chips, essentially all downstream data analysis and output are the same.
  • the product of these analyses are typically measurements of the intensity of the signal received from a labeled probe used to detect a cDNA sequence from the sample that hybridizes to a nucleic acid sequence at a known location on the microarray.
  • the intensity of the signal is proportional to the quantity of cDNA, and thus mRNA or miRNA, expressed in the sample cells.
  • Preferred methods for determining gene expression can be found in 6271002; 6218122; 6218114; and 6004755. Analysis of expression levels is conducted by comparing such signal intensities. This is best done by generating a ratio matrix of the expression intensities of genes in a test sample versus those in a control sample. For instance, the gene expression intensities from a diseased tissue can be compared with the expression intensities generated from benign or normal tissue of the same type. A ratio of these expression intensities indicates the fold- change in gene expression between the test and control samples.
  • the selection can be based on statistical tests that produce ranked lists related to the evidence of significance for each gene's differential expression between factors related to the tumorigenesis. Examples of such tests include ANOVA and Kruskal-Wallis.
  • the rankings can be used as weightings in a model designed to interpret the summation of such weights, up to a cutoff, as the preponderance of evidence in favor of one class over another. Previous evidence as described in the literature may also be used to adjust the weightings.
  • Gene expression profiles can be displayed in a number of ways. The most common is to arrange raw fluorescence intensities or ratio matrix into a graphical dendogram where columns indicate test samples and rows indicate genes. The data are arranged so genes that have similar expression profiles are proximal to each other. The expression ratio for each gene is visualized as a color. For example, a ratio less than one (down-regulation) appears in the blue portion of the spectrum while a ratio greater than one (up-regulation) appears in the red portion of the spectrum.
  • RNA species are collected from primary tumors or metastatic tumors from biological samples. These readings along with clinical records including, but not limited to, a patient's age, gender, site of origin of primary tumor, and site of metastasis (if applicable) are used to generate a relational database. The database is used to select miRNA transcripts and clinical factors that can be used as marker variables to determine the presence, prognosis or status of CRC.
  • protein levels can be measured by binding to an antibody or antibody fragment specific for the protein and measuring the amount of antibody-bound protein.
  • Antibodies can be labeled by radioactive, fluorescent or other detectable reagents to facilitate detection. Methods of detection include, without limitation, enzyme-linked immunosorbent assay (ELISA) and immunoblot techniques.
  • ELISA enzyme-linked immunosorbent assay
  • Modulated genes used in the methods of the invention are described in the Examples.
  • the genes that are differentially expressed are either up- or down-regulated in patients with CRC relative to those without CRC or different CRC status or progression.
  • Up- and down- regulation are relative terms meaning that a detectable difference (beyond the contribution of noise in the system used to measure it) is found in the amount of expression of the genes relative to some baseline.
  • the genes of interest in the diseased cells are then either up- or down-regulated relative to the baseline level using the same measurement method.
  • Diseased in this context, refers to an alteration of the state of a body that interrupts or disturbs, or has the potential to disturb, proper performance of bodily functions as occurs with the uncontrolled proliferation of cells.
  • the act of conducting a diagnosis or prognosis may include the determination of disease/status issues such as determining the likelihood of relapse, type of therapy and therapy monitoring.
  • therapy monitoring clinical judgments are made regarding the effect of a given course of therapy by comparing the expression of genes over time to determine whether the gene expression profiles have changed or are changing to patterns more consistent with normal tissue.
  • Genes can be grouped so that information obtained about the set of genes in the group provides a sound basis for making a clinically relevant judgment such as a diagnosis, prognosis, or treatment choice. These sets of genes make up the portfolios of the invention. As with most diagnostic Markers, it is often desirable to use the fewest number of Markers sufficient to make a correct medical judgment. This prevents a delay in treatment pending further analysis as well as unproductive use of time and resources.
  • the process of selecting a portfolio can also include the application of heuristic rules. Preferably, such rules are formulated based on biology and an understanding of the technology used to produce clinical results. More preferably, they are applied to output from the optimization method.
  • the mean variance method of portfolio selection can be applied to microarray data for a number of genes differentially expressed in subjects with cancer. Output from the method would be an optimized set of genes that could include some genes that are expressed in peripheral blood as well as in diseased tissue. If samples used in the testing method are obtained from peripheral blood and certain genes differentially expressed in instances of cancer could also be differentially expressed in peripheral blood, then a heuristic rule can be applied in which a portfolio is selected from the efficient frontier excluding those that are differentially expressed in peripheral blood. Of course, the rule can be applied prior to the formation of the efficient frontier by, for example, applying the rule during data preselection.
  • One method of establishing gene expression portfolios is through the use of optimization algorithms such as the mean variance algorithm widely used in establishing stock portfolios. This method is described in detail in 20030194734. Essentially, the method calls for the establishment of a set of inputs (stocks in financial applications, expression as measured by intensity here) that will optimize the return (e.g., signal that is generated) one receives for using it while minimizing the variability of the return. Many commercial software programs are available to conduct such operations. "Wagner Associates Mean- Variance Optimization Application,” referred to as “Wagner Software” throughout this specification, is preferred. This software uses functions from the “Wagner Associates Mean- Variance Optimization Library" to determine an efficient frontier and optimal portfolios in the Markowitz sense is preferred. Markowitz (1952). Use of this type of software requires that microarray data be transformed so that it can be treated as an input in the way stock return and risk measurements are used when the software is used for its intended financial analysis purposes.
  • the process of selecting a portfolio can also include the application of heuristic rules.
  • such rules are formulated based on biology and an understanding of the technology used to produce clinical results. More preferably, they are applied to output from the optimization method.
  • the mean variance method of portfolio selection can be applied to microarray data for a number of genes differentially expressed in subjects with cancer. Output from the method would be an optimized set of genes that could include some genes that are expressed in peripheral blood as well as in diseased tissue. If samples used in the testing method are obtained from peripheral blood and certain genes differentially expressed in instances of cancer could also be differentially expressed in peripheral blood, then a heuristic rule can be applied in which a portfolio is selected from the efficient frontier excluding those that are differentially expressed in peripheral blood.
  • the rule can be applied prior to the formation of the efficient frontier by, for example, applying the rule during data pre-selection.
  • heuristic rules can be applied that are not necessarily related to the biology in question. For example, one can apply a rule that only a prescribed percentage of the portfolio can be represented by a particular gene or group of genes.
  • Commercially available software such as the Wagner Software readily accommodates these types of heuristics. This can be useful, for example, when factors other than accuracy and precision (e.g., anticipated licensing fees) have an impact on the desirability of including one or more genes.
  • the gene expression profiles of this invention can also be used in conjunction with other non-genetic diagnostic methods useful in cancer diagnosis, prognosis, or treatment monitoring.
  • CA 27.29 Cancer Antigen 27.29
  • blood is periodically taken from a treated patient and then subjected to an enzyme immunoassay for one of the serum Markers described above.
  • an enzyme immunoassay for one of the serum Markers described above When the concentration of the Marker suggests the return of tumors or failure of therapy, a sample source amenable to gene expression analysis is taken. Where a suspicious mass exists, a fine needle aspirate (FNA) is taken and gene expression profiles of cells taken from the mass are then analyzed as described above.
  • tissue samples may be taken from areas adjacent to the tissue from which a tumor was previously removed. This approach can be particularly useful when other testing produces ambiguous results.
  • Kits made according to the invention include formatted assays for determining the gene expression profiles. These can include all or some of the materials needed to conduct the assays such as reagents and instructions and a medium through which Biomarkers are assayed.
  • Articles of this invention include representations of the gene expression profiles useful for treating, diagnosing, prognosticating, and otherwise assessing diseases. These profile representations are reduced to a medium that can be automatically read by a machine such as computer readable media (magnetic, optical, and the like).
  • the articles can also include instructions for assessing the gene expression profiles in such media.
  • the articles may comprise a CD ROM having computer instructions for comparing gene expression profiles of the portfolios of genes described above.
  • the articles may also have gene expression profiles digitally recorded therein so that they may be compared with gene expression data from patient samples. Alternatively, the profiles can be recorded in different representational format. A graphical recordation is one such format. Clustering algorithms such as those incorporated in "DISCOVERY” and "INFER” software from Partek, Inc. mentioned above can best assist in the visualization of such data.
  • Kits made according to the invention include formatted assays for determining the gene expression profiles. These can include all or some of the materials needed to conduct the assays such as reagents and instructions and a medium through which Biomarkers are assayed.
  • Articles of this invention include representations of the gene expression profiles useful for treating, diagnosing, prognosticating, and otherwise assessing diseases. These profile representations are reduced to a medium that can be automatically read by a machine such as computer readable media (magnetic, optical, and the like).
  • the articles can also include instructions for assessing the gene expression profiles in such media.
  • the articles may comprise a CD ROM having computer instructions for comparing gene expression profiles of the portfolios of genes described above.
  • the articles may also have gene expression profiles digitally recorded therein so that they may be compared with gene expression data from patient samples. Alternatively, the profiles can be recorded in different representational format. A graphical recordation is one such format. Clustering algorithms such as those incorporated in "DISCOVERY” and "INFER” software from Partek, Inc. mentioned above can best assist in the visualization of such data.
  • articles of manufacture according to the invention are media or formatted assays used to reveal gene expression profiles. These can comprise, for example, microarrays in which sequence complements or probes are affixed to a matrix to which the sequences indicative of the genes of interest combine creating a readable determinant of their presence.
  • articles according to the invention can be fashioned into reagent kits for conducting hybridization, amplification, and signal generation indicative of the level of expression of the genes of interest. The following examples are meant to illustrate but not limit the present invention. All references cited herein are hereby incorporated by reference.
  • Example 1 Methods Cell lines SW620, SW480, HCTl 16 and HT29 cell lines were obtained from the ATCC. KM20L2 and KM12C were provided by the NCI-Frederick Cancer DCT Tumor Repository, while cell lines KM20 and KM 12SM were supplied by Dr Royce J. Fidler (The University of Texas MD Anderson Cancer Center). SW620 and SW480 cells were grown in Dulbecco's Modified Eagle Medium (D-MEM) (Gibco). HCTl 16 cells were grown in McCoys 5 A Media (Gibco) and KM20, KM20L2, KM12C, KM12SM and HT29 cells were grown in RPMI Media 1640 (Gibco).
  • D-MEM Dulbecco's Modified Eagle Medium
  • CRC samples were obtained from Genomics Collaborative Inc. (GCI, Cambridge MA) or Clinomics Bioscience, Inc. (Pittsfield, MA), including 4 normal colon, 4 Stage I, 19 Stage II, 20 Stage III and 2 Stage IV (Table 1).
  • 8 matched formalin fixed paraffin embedded (FFPE) samples (3 Stage II, 4 Stage III and 1 Stage IV) were obtained.
  • the median tumor content of all CRC samples was 70% with no significant difference in tumor content between early stage (I and II) versus late stage (III and IV) disease.
  • the mirVanaTM Bioarray (Ambion, version 1) that contains 287 human miRNA probes was employed to identify CRC miRNA signatures. Shingara et al. (2005). miRNA was isolated from 5 ⁇ g of total RNA from colorectal samples using the mirVanaTM isolation kit (Ambion) for snap-frozen samples and the RecoverAllTM Total Nucleic Acid Isolation Kit for FFPE samples (Ambion). All samples were then fractionated by polyacrylamide gel electrophoresis (flashPAGETM, Ambion) and small RNAs ( ⁇ 40nt) were recovered by ethanol precipitation with linear acrylamide. Quantitative RT-PCR (QPCR) of miR-16 was used to confirm miRNA enrichment prior to miRNA array analysis.
  • QPCR Quantitative RT-PCR
  • RNAs from all samples were subject to poly(A) polymerase reaction where amine modified uridines were incorporated (Ambion).
  • the tailed samples were then fiuorescently labeled using the amine-reactive Cy3 or Cy5 (Invitrogen).
  • One-or two-color hybridizations were performed for the clinical CRC or cell line profiling experiments, respectively.
  • cell line miRNA was directly compared to normal colon RNA (Ambion).
  • the fiuorescently labeled RNAs were purified using a glass-fiber filter and eluted (Ambion). Each sample was then hybridized to the Bioarray slides for 14 hours at 42°C (Ambion).
  • the data were analyzed using the R software package. The data were quantile normalized prior to determining differential gene expression. Replicate samples and probe values were averaged and the Student t-test was performed to find genes that vary significantly across sample groups. Genes were selected if the median normalized signal th intensity was greater than 100 (75 percentile of median signal) for at least one group, with a mean change > 1.5-fold and a p-value ⁇ 0.05. A one-way ANOVA was used to evaluate miRNA expression level. QPCR was performed using the ABI miRNA TaqMan® reagents to verify miRNA expression profiles. Chen et al. (2005).
  • QPCR was performed using a standard TaqMan® PCR kit protocol on an Applied Biosystems 7900HT Sequence Detection System.
  • the 10 ⁇ l PCR reaction included ⁇ .66 ⁇ l RT product, 1 ⁇ l TaqMan® microRNA assay primer and probe mix, 5 ⁇ l TaqMan® 2x Universal PCR master mix (No Amperase UNG) and 3.34 ⁇ l water. The reactions were incubated in a 384 well plate at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, and 60 0 C for 2 min. All QPCR reactions included a no cDNA control and all reactions were performed in triplicate. Plasmid constructs The plasmid pSilencerTM 2.1 (Ambion) was modified within the multiple cloning site to introduce unique restriction sites and a RNA polymerase III transcriptional terminator (TTTTTT).
  • TTTTTTTTTT RNA polymerase III transcriptional terminator
  • oligonucleotides were synthesized (Sigma), annealed and ligated to pSilencerTM 2.1, pre-digested with BamHI and Hindlll, to produced pSilencerTM 2.1Term: pSilU ⁇ upper 5'GATCCCTCGAGTCTAGATTTTTTGGAAA (SEQ ID NO: 1) and pSilU ⁇ lower 5AGCTTTTCCAAAAAATCTAGACTCGAGG (SEQ ID NO: 2).
  • the DNA encoding pre-miR-143 or pre-miR-145 was PCR-amplified from human genomic DNA using primers 143F (5'CGGGATCCCGGAGAGGTGGAGCCCAGGTC (SEQ ID NO: 3)) and 143R (5'GCTCTAGACAGCATCACAAGTGGCTGA (SEQ ID NO: 4)), digested with BamHI and Xbal and ligated to pSilencerTM 2.1Term to produce the miR-143 expression plasmid.
  • genomic DNA was recovered as a PCR amplicon using primers 145F (5'CGGGATCCCAGAGCAATAAGCCACATCC (SEQ ID NO: 5)) and 145R (5'GCTCTAGACTCTTACCTCCAGGGACAGC (SEQ ID NO: 6)), digested with BamHI and Xbal and ligated into pSilencerTM 4.1 under control of the CMV promoter.
  • primers 145F 5'CGGGATCCCAGAGCAATAAGCCACATCC (SEQ ID NO: 5)
  • 145R 5'GCTCTAGACTCTTACCTCCAGGGACAGC
  • the PCR primers used for miR-20a were miR- 2OF (5'CGGGATCCCGATGGTGGCCTGCTATTTCC (SEQ ID NO: 7)) and miR-20aR (5'CGGAATTCTCACACAGCTGGATGCAAA (SEQ ID NO: 8)), while those used to amplify the miR- 17-92 cluster were miRcF (5'CGGGATCCCGTCCCCATTAGGGATTATGC (SEQ ID NO: 9)) and miRcR (5'CGGAATTCCCAAATCTGACACGCAACC (SEQ ID NO: 10)).
  • miR- 2OF 5'CGGGATCCCGATGGTGGCCTGCTATTTCC (SEQ ID NO: 7)
  • miR-20aR 5'CGGAATTCTCACACAGCTGGATGCAAA (SEQ ID NO: 8)
  • miRcF 5'CGGGATCCCGTCCCCATTAGGGATTATGC (SEQ ID NO: 9)
  • miRcR 5'CGGAATTCCCA
  • plasmids 1-5x10 cells (HCTl 16, SW480, SW620) were seeded in a single well of a 6- well plate. Upon reaching 80-90% confluence, cells were transfected with 4 ⁇ g plasmid DNA using LipofectamineTM 2000 (Invitrogen) according to the manufacturer's instructions. Cells were diluted and plated in fresh medium containing 500 ⁇ g/ml hygromycin. After 14 days of selection, independent clones were picked, expanded and screened for expression of the specific miRNA(s) encoded by the transfected plasmid (Example 2).
  • retroviral packaging cell lines AmphopackTM HEK 293 (BD Biosciences) and PG 13 were mixed at a ratio of 10: 1 before trans fection with 10 ⁇ g of pQCXIN-based vectors using calcium phosphate.
  • virus-containing media was harvested and used to transduce HCTl 16 cells.
  • 400 ⁇ g/ml G418 was added to the culture medium and clones selected for two weeks. Characterization of the independent clones was as described above for plasmid transfection. Antisense experiments
  • Biotinylated 2'-O-methyl antisense miR-145 RNA or controls were delivered to SW620 using LipofectamineTM 2000 (Invitrogen) as detailed in Example 2. Transfection efficiency was at least 80% in all experiments. All experiments were performed in triplicate.
  • CellTiter-BlueTM proliferation assay SW620 cells (3x10 cells/well) and HCTl 16 cells (2x10 cells/well) were seeded in 96-well plates in serum-containing media. Cell viability analysis was conducted on day 0 (day of seeding) and on day 5. A total of 20 ⁇ L of CellTiter-BlueTM reagent (Promega) was added to each well and the plate incubated at 37°C for 2 hours.
  • SW620/miR-145 cell population was the change from the round single cells of SW620 to elongated cells with extended processes typical of fibroblast-like cells (Fig. 6B).
  • the SW620/miR-145 cells also showed a 50% to 95% increase in cell proliferation/metabolic activity when grown in the presence or absence of serum, respectively (Fig. 6C).
  • Fig. 6C A two-fold increase in anchorage-independent growth when grown in the presence of serum was also observed ( Figure 6C).
  • the epithelial cell marker E-cadherin was also reduced by 50% in SW620/miR-145 cells compared to controls (Fig. 6D), which is consistent with the mesenchymal-like cell morphology and increased proliferation observed for SW620/miR-145 cells.
  • over-expression of miR- 145 in SW620 cells did not alter the growth profile of tumors in an in vivo mouse model.
  • miR-145 is expressed from the same genomic locus as miR-143 and the latter miRNA was also down-regulated in CRC
  • Fig. 8 we investigated the phenotype of SW620 CRC cells over-expressing miR-143 (Fig. 8). Seven stable clones expressing miR-143 were isolated and each displayed altered morphology, which was associated with increased E-cadherin protein expression (Fig. 8A-C). No difference in cell proliferation rates were observed, however, reduced anchorage-independent growth was demonstrated in all clones (Fig. 8D). These data suggest that over-expression of miR-143 has the opposite effect on anchorage-independent cell growth than that of cells ectopically expressing miR-145. We suggest that coordinated expression is important in avoiding potential miR-143 -mediated growth inhibition.
  • FIG. 10 shows an interaction map for miR-17-92. Blenkiron et al. (2007). The genomic region containing the chromosome 13 -based miR-17-92 cluster was PCR- amplified and cloned under control of the CMV promoter in the retroviral vector pQCXIN and delivered to the HCTl 16 colon cancer cell line. HCTl 16 was chosen since it displayed low endogenous levels of the miR-17-92 cluster members compared to other cell lines screened (Fig. 5).
  • the miR-17-92 over-expressing clones, 4-1 and 4-7 showed a 50% to 60% reduction in cell proliferation/metabolic activity when grown in serum- free medium (Fig. HC). However, when grown in the presence of serum a less significant reduction in proliferation was found. No alteration in cell morphology was found in either clone over-expressing the miR-17-92 cluster. In contrast to other studies, the above results suggest that further increases in expression of the miR- 17-92 cluster can reduce cell proliferation/metabolic activity in cells when grown in the absence of serum.
  • miR-20a is an active component of the miR- 17-92 cluster
  • HCT116/miR-20a clones displayed altered cell morphology. However, as for the HCT116/miR-
  • miR-143 re-expression reduced colony formation and up-regulated E- cadherin (a marker of epithelial cell differentiation), suggesting that miR-143 displayed tumor suppressor effects on CRC cells under these conditions.
  • Akao et al. (2006) reported a dose-dependent reduction in cell viability upon delivery of synthetic pre- miR-143 to DLDl or SW480 CRC cell lines.
  • Borralho et al. (2007) reported that miR- 143 over-expression in HCTl 16, LoVo, SW480 and SW620 cells resulted in reduced cell viability and increased apoptosis, suggesting that miR-143 plays a pro-apoptotic role in normal mucosa.
  • miR-145 increased cell proliferation, anchorage-independent growth, and reduced E-cadherin levels. These effects were enhanced when cells were grown in serum-free medium suggesting that cell growth factors may affect the activity of these miRNAs.
  • expression of miR-145 in a late stage CRC cell line promotes cell proliferation and/or acts to block normal signals for apoptosis.
  • our observations on re-expressing miR-145 differ with the single study examining a functional role for this miRNA, which reported loss of cell viability in DLDl or SW480 cells following introduction of synthetic pre-miR-145. Akao et al. (2006). Besides the method of introducing the miR-145, our study also differs in that we used later stage CRC cells and were unable to achieve high steady expression levels of miR-145.
  • miR-143 can be expressed at high levels in single clones, but to achieve physiological expression levels of miR-145 requires co-expression with miR-143. Importantly, our results also highlight that delivery of miR-143, in isolation, can be a potential therapeutic strategy for CRC.
  • miR-17-92 and miR-20a can act as a tumor suppressor when over-expressed in rapidly dividing HCTl 16 cells.
  • an increase in anchorage-independent growth was seen in some miR-17-92 and miR-20a clones.
  • the miRNAs encoded by this cluster are also highly expressed in lymphoma, colon, lung, pancreas and prostate cancers. Volinia et al. (2006); Hayashita et al. (2005); and He et al. (2005). Wang et al. (2006) identified miR- 17-92 as a potential oncogene using retroviral mutagenesis in mice which resulted in the formation of lymphoma. Furthermore, over-expression of the miR- 17-92 cluster was shown to accelerate B- cell lymphoma in a mouse model and increase in vitro cell proliferation in a lung cancer cell line. Hayashita et al.
  • a total of 100 nM of biotinylated 2'-O-methyl antisense miR-145 RNA (5AAGGGAUUCCUGGGAAAACUGGAC3' (SEQ ID NO: H)) (IDT) or the reverse control (5'CAGGUCAAAAGGGUCCUUAGGGAAS' (SEQ ID NO: 12)) (IDT) were transfected with
  • the beads were separated from the RNA solution using a magnetic separation apparatus (Promega) and the solution (containing the depleted RNA) was removed from the beads.
  • the depleted RNA was ethanol precipitated and analyzed for miR-145 and U6 snRNA expression by Northern analysis. Transfection efficiency of the FAM-labeled 2'O-methyl antisense miR-145 RNA oligonucleotide was conducted in parallel with the depletion experiments.
  • a total of 100 nM of FAM-labeled 2'O-methyl antisense miR-145 RNA (IDT) was transfected with LipofectamineTM 2000 (Invitrogen) into 1.2x10 SW620 cells expressing miR-145.
  • Membranes were pre-hyb ⁇ dized in 10 mL Express hybridization solution (Clontech) at 37°C
  • the Starfire® oligonucleotide probe was boiled for 1 minute and then added to the hybridization solution After overnight hybridization at 37°C, the hybridization solution was removed and the membrane rinsed three times with 2X SSC/0 1% SDS and further washed with 2X SSC/0 1% SDS solution at 37°C for 15 minutes
  • the membrane was exposed to a Storage Phosphor Screen (GE Healthcare) overnight and imaged using the Typhoon Trio machine (GE Healthcare)
  • the membrane was stripped of the bound probe by pouring boiling 0 1% SDS directly onto the membrane and then allowing the solution to slowly cool over a 30 minute period
  • Custom Starfire® oligonucleotide probes were synthesized by Integrated DNA
  • the lyophihzed oligonucleotide probes were diluted to 100 ⁇ M stock solution in IX TE pH 8 0
  • the labeling reaction included IX exo reaction buffer (NEB), 1 ⁇ L Starfire® Universal template oligonucleotide (IDT) and 0 5 pmol Starfire® oligonucleotide probe
  • the reaction mix was boiled for 1 minute and then allowed to cool to room temperature for 5 minutes before adding 50 ⁇ Ci ⁇ -"P-dATP (10 mCi/mL, 6000 Ci/mmol) (Perkin-Elmer) and 5 U exo Klenow DNA polymerase (NEB) and incubating at room temperature for 90 minutes
  • the reaction was stopped by the addition of 40 ⁇ L 10 mM EDTA
  • the unincorporated ⁇ - P- dATP was removed from the reaction mix using MicroSpin G-25 columns (GE Healthcare) according to manufacturer's instructions Prior to use, the probe was boiled for 1 minute
  • the U6 snRNA oligonucleotide probe (5' AACGCTTCACGAATTTGCGT 3' (SEQ ID NO: 34)) was end labeled using 20 pmole oligonucleotide probe, IX T4 polynucleotide buffer (NEB), 50 ⁇ Ci ⁇ - 32 P-dATP (10 mCi/mL, 6000 Ci/mmol) (Perkin Elmer) and 10 U T4 polynucleotide kinase (NEB), in a final volume of 20 ⁇ L. The probe was incubated for 30 minutes at 37°C. The reaction was stopped by the addition of 40 ⁇ L 10 mM EDTA. The unincorporated ⁇ - P-dATP was removed from the reaction mix using MicroSpin G-25 columns (GE Healthcare) according to manufacturer's instructions. Prior to use, the probe was boiled for 5 minutes.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract
EP09747751A 2008-05-16 2009-05-18 Procédé d'évaluation du cancer colorectal et compositions utilisables à cet effet Withdrawn EP2283161A4 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US5376008P 2008-05-16 2008-05-16
PCT/US2009/044282 WO2009140670A2 (fr) 2008-05-16 2009-05-18 Procédé d'évaluation du cancer colorectal et compositions utilisables à cet effet

Publications (2)

Publication Number Publication Date
EP2283161A2 true EP2283161A2 (fr) 2011-02-16
EP2283161A4 EP2283161A4 (fr) 2012-03-28

Family

ID=41319374

Family Applications (1)

Application Number Title Priority Date Filing Date
EP09747751A Withdrawn EP2283161A4 (fr) 2008-05-16 2009-05-18 Procédé d'évaluation du cancer colorectal et compositions utilisables à cet effet

Country Status (8)

Country Link
EP (1) EP2283161A4 (fr)
JP (1) JP2011520454A (fr)
KR (1) KR20110015013A (fr)
BR (1) BRPI0911972A2 (fr)
CA (1) CA2725477A1 (fr)
IL (1) IL209078A0 (fr)
MX (1) MX2010012542A (fr)
WO (1) WO2009140670A2 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2625293A4 (fr) * 2010-10-08 2014-03-19 Baylor Res Inst Microarn (miarn) en tant que biomarqueurs pour l'identification du cancer colorectal familial et non-familial
EP2942403B1 (fr) * 2010-12-01 2017-04-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédé de prévision du résultat d'un cancer par l'analyse de l'expression du miarn
EP2778237A1 (fr) * 2011-01-13 2014-09-17 Industrial Technology Research Institute Biomarqueurs de prédiction de la récurrence du cancer colorectal
NO3051026T3 (fr) * 2011-10-21 2018-07-28
JP6156621B2 (ja) * 2012-02-14 2017-07-05 国立大学法人 岡山大学 Ａｔｌｌの診断のためのデータ取得方法、ａｔｌｌ診断用キットおよびａｔｌｌ診断システム
WO2013160474A2 (fr) * 2012-04-26 2013-10-31 Instituto Aragonés De Ciencias De La Salud Expression de miarn dans les maladies hématologiques
US10260105B2 (en) 2014-02-18 2019-04-16 Baylor Research Institute MiR-320e and colorectal cancer

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009059026A1 (fr) * 2007-10-30 2009-05-07 Veridex, Llc Procédé de surveillance du cancer colorectal

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009059026A1 (fr) * 2007-10-30 2009-05-07 Veridex, Llc Procédé de surveillance du cancer colorectal

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ARNDT GREG M ET AL: "Characterization of global microRNA expression reveals oncogenic potential of miR-145 in metastatic colorectal cancer", BMC CANCER, BIOMED CENTRAL, LONDON, GB, vol. 9, no. 1, 20 October 2009 (2009-10-20), page 374, XP021062713, ISSN: 1471-2407, DOI: 10.1186/1471-2407-9-374 *
BANDRÉS E ET AL: "Identification by Real-time PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues", MOLECULAR CANCER, BIOMED CENTRAL, LONDON, GB, vol. 5, 19 July 2006 (2006-07-19), page 29, XP002460700, ISSN: 1476-4598, DOI: 10.1186/1476-4598-5-29 *
JAY CHRIS ET AL: "miRNA profiling for diagnosis and prognosis of human cancer", DNA AND CELL BIOLOGY, MARY ANN LIEBERT, NEW YORK, NY, US, vol. 26, no. 5, 1 May 2007 (2007-05-01), pages 293-300, XP002510058, ISSN: 1044-5498, DOI: 10.1089/DNA.2006.0554 *

Also Published As

Publication number Publication date
MX2010012542A (es) 2010-12-21
CA2725477A1 (fr) 2009-11-19
EP2283161A4 (fr) 2012-03-28
BRPI0911972A2 (pt) 2019-09-24
JP2011520454A (ja) 2011-07-21
WO2009140670A9 (fr) 2010-03-18
IL209078A0 (en) 2011-01-31
WO2009140670A2 (fr) 2009-11-19
KR20110015013A (ko) 2011-02-14

Similar Documents

Publication Publication Date Title
Heneghan et al. MicroRNAs as novel biomarkers for breast cancer
Arndt et al. Characterization of global microRNA expression reveals oncogenic potential of miR-145 in metastatic colorectal cancer
EP2799557B1 (fr) Antagonistes de miR-32 pour augmenter la sensibilité des cellules cancéreuses de la prostate à l'apoptose
Vriens et al. MicroRNA expression profiling is a potential diagnostic tool for thyroid cancer
AU2014203339B2 (en) Ultraconserved regions encoding ncRNAs
Guan et al. MiRNA-196 is upregulated in glioblastoma but not in anaplastic astrocytoma and has prognostic significance
AU2018202963B2 (en) Biomarkers useful for detection of types, grades and stages of human breast cancer
Gandellini et al. Emerging role of microRNAs in prostate cancer: implications for personalized medicine
JP2011501949A (ja) 特定の癌の診断及び予後診断
JP6140352B2 (ja) 肺癌を分類するための方法
JP2011501966A (ja) 結腸直腸癌監視のためのプロセス
WO2008125883A1 (fr) Marqueurs du cancer pour le pronostic et le criblage d'agents anticancéreux
WO2014085906A1 (fr) Biomarqueurs micro-arn pour le cancer de la prostate
EP2283161A2 (fr) Procédé d'évaluation du cancer colorectal et compositions utilisables à cet effet
CN110055333B (zh) Rp11-116o18.1作为分子标志物在肺癌中的应用
US8828963B2 (en) Diagnosis and treatment of chronic lymphocytic leukemia (CLL)
Li et al. Predictive capacity and functional significance of MicroRNA in human melanoma
Scarpati New biomolecular prognostic and predictive factors of response to treatments in colo-rectal cancer
Itesako et al. The MicroRNA Expression Signature of Bladder Cancer by Deep Sequencing: The

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20101216

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA RS

RAX Requested extension states of the european patent have changed

Extension state: AL

Payment date: 20101216

A4 Supplementary search report drawn up and despatched

Effective date: 20120223

RIC1 Information provided on ipc code assigned before grant

Ipc: C12Q 1/68 20060101AFI20120217BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120925