EP2240599A1 - Methods for the detection and quantification of nematode parasites in fish and fish products - Google Patents

Methods for the detection and quantification of nematode parasites in fish and fish products

Info

Publication number
EP2240599A1
EP2240599A1 EP08702344A EP08702344A EP2240599A1 EP 2240599 A1 EP2240599 A1 EP 2240599A1 EP 08702344 A EP08702344 A EP 08702344A EP 08702344 A EP08702344 A EP 08702344A EP 2240599 A1 EP2240599 A1 EP 2240599A1
Authority
EP
European Patent Office
Prior art keywords
fish
dna
anisakid
species
real time
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP08702344A
Other languages
German (de)
French (fr)
Inventor
Elisabetta Giuffra
Giuliana Piccolo
Chiara Mossali
Claudio Genchi
Stefano D'amelio
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Parco Tecnologico Padano SRL
Original Assignee
Parco Tecnologico Padano SRL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Parco Tecnologico Padano SRL filed Critical Parco Tecnologico Padano SRL
Publication of EP2240599A1 publication Critical patent/EP2240599A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms

Definitions

  • the present invention relates to methods for the detection and quantification of nematode parasites in fish and fish products.
  • the present invention relates to molecular tests through which the presence of a group of species of nematode parasites, belonging to the genera Anisakis and Pseudoterranova, can be detected and quantified in fish and fish products using DNA-based techniques.
  • Anisakid nematodes represent an homogeneous group of parasites whose adult stages are recovered in fish, fish- eating birds and marine mammals, while third stage larvae are often present in the body cavity and muscle of numerous fish species and also in cephalopods and crustaceans worldwide.
  • A. simplex larvae have been found in more than 80% of commercialised Atlantic Salmon stocks in the US (Deardorff TL and Kent ML 1989, Journal of Wildlife Diseases, 25- 3: 416-419) and in 78 - 97% of herrings fished in the English Channel (Beldsoe GE and Oria MP 2001, Journal of Food Science Vol. Suppl. 66-7: 1100-1103).
  • Anisakidae belonging to the genera Anisakis and Pseudoterranova are implicated in acute or chronic human infections (anisakiasis) caused by the ingestion of larval nematodes in raw seafood dishes such as sushi, sashimi, ceviche, and pickled herring.
  • Symptoms of anisakiasis include abdominal pain, nausea, vomiting, and diarrhea. Because symptoms are vague, this condition is often misdiagnosed as appendicitis, acute abdomen, stomach ulcers, or ileitis (Sakanari JA and McKerrow JH 1989, Clin Microbiol Rev 2(3): 278-284).
  • Anisakiasis is quite common in countries where raw fish is an important component of the traditional cuisine (e.g. in Japan) but more and more cases are being reported in Western countries, where consumption of raw fish is increasing.
  • Adequate freezing and/or cooking kills anisakid larvae; however, killed or inactivated larvae can still cause sensitization and IgE-dependent hypersensitivity in humans; also non-IgE mediated mechanisms, such as the involvement of other immunoglobulin isotypes (IgG4), or non-immunological events have been described (eg. Moneo I et al. 2007, Parasitol Res. 101(4): 1051-1055).
  • the nematode worms that have been implicated in fish-borne infections can be identified at the molecular level.
  • each species has a specific distribution area and range of hosts, thus identifying these parasites at the species level is crucial in reducing the risk for the consumer. Measures taken may include avoiding particular fishing areas, sizes of fish, or even particular species of fish.
  • the molecular approaches in the study of the systematics of anisakid nematodes have mainly focused on variable and conserved regions of the nuclear ribosomal DNA and, to a lesser extent, on mitochondrial genes.
  • the ribosomal RNA repeats are an extensively studied repetitive gene family. Each repeat unit contains three ribosomal RNA (rRNA) genes, the large subunit (LSU), small subunit (SSU), and 5.8S rRNA genes, as well as two transcribed spacers (the ITSl and ITS2 ) and a large intergenic spacer (IGS).
  • rRNA ribosomal RNA
  • LSU large subunit
  • SSU small subunit
  • IGS intergenic spacer
  • another rRNA gene, the 5S may be present within the IGS.Ribosomal DNA copy number varies widely. In most eukaryotes it is between 30 and 30,000 copies and the repeats are organized tandemly at one or more sites per haploid genome.
  • Anisakis simplex complex A. simplex s.s., A. pegreffii and A. simplex C
  • A. physeteri ⁇ A. brevispiculata, A. paggiae, A. typica, A. ziphidarum
  • Anisakis sp. A D'Amelio S et al. 2000, Int J Parasitol. 30(2): 223-226, and unpublished results
  • five species within the Pseudoterranova decipiens complex from seals P. krabbei, P.
  • decipiens s.s., P. bulbosa, P. azara ⁇ i and P. decipiens E. five cryptic species within the Contracaecum osculatum complex from seals (A, B, C, D and E) plus one species from the Baikal seal (Contracaecum baicalensis) ; three species within the Contracaecum rudolphii complex from birds (A, B and C), plus other species of the genus (C. microcephalum, C. multipapillatum) .
  • variable region of the nuclear ribosomal DNA i.e. the ITS-I and ITS-2 regions
  • markers in the ITS-I region have also been used for multiplex — based detection of single species (Umehara A et al. 2008, Parasitology International 57: 49-53, Epub Aug. 2007).
  • Mitochondrial markers have also been widely used in population genetics and species identification; for example, a real time PCR method using the cytochrome c oxidase II gene has been used to detect and quantify A. simplex contaminating fish-derived products.
  • Identifying the etiological agents of these infestations at the species or genotype level is important for various purposes . For example, this can aid physicians in diagnosis and treatment, in tracing the source of the infestation, in determining the area of origin of the contaminated food, and in developing the most appropriate measures for controlling contamination at all phases of food production, from fishing, hunting, or breeding to processing and post-processing of fish products.
  • fish are used as meat component in a variety of products, either fresh or frozen, e.g. canned fish, "surimi” (minced, processed fish used in the preparation of imitation seafood, especially imitation shellfish and crustaceans), fish sticks, baby food (easily chewed food products for infants produced in multiple varieties and tastes, and produced by many manifacturers) etc.
  • surimi minced, processed fish used in the preparation of imitation seafood, especially imitation shellfish and crustaceans
  • baby food easily chewed food products for infants produced in multiple varieties and tastes, and produced by many manifacturers
  • Document WO-A-93/14400 discloses a method for examining an edible product, such as fresh fish flesh, for dielectric inclusions, such as encysted parasites.
  • the product is subjected to a current flow, which may be perturbed or deviated by any hidden inclusions.
  • Document US-A-5213830 discloses a method for quality control of meat products, especially fish flesh, with regard to the presence of worms.
  • the product to be subjected to quality control, or a sample thereof, is exposed to electromagnetic radiation within the range of about 800-1800 nm, and the irradiation transmitted through said product or sample as a result of this irradiation is analyzed for identification of characteristic absorption by worms in said product or sample.
  • the present invention aims to provide a new method for the detection and quantification of a group of nematode parasites (Anisakis spp. and Pseudoterranova spp.) typically contaminating fishery species, and consequently fish products, by means of a real time PCR assay which exploits the conserved features of the ITS-I region of the Anisakid genome, optimized on standardized DNA samples, as disclosed in claim 1.
  • the present invention aims to provide a new method for discriminating two close Anisakid species (A. simplex and A. pegreffii) with the aim to provide a tool for testing the geographic provenance of Anisakid-containing fish captured either in the North Atlantic ocean or in the South Atlantic ocean and Mediterranean sea. This is obtained by carrying out a method having the features described in claim 4.
  • the first method according to the present invention is useful to detect the presence of a group of nematode species in fish and fish products and to quantify the level of their contamination, while the second method is able to detect and distinguish two of the most common species , so to be used as a method to identify the origin of fishery (and fish derived) fresh or processed products.
  • the first method is particularly useful for food producers, such as babyfood factories, to define thresholds of maximum Anisakid contents (as maximum allergenic load), as well for chain markets and food producers to perform periodic quality checking of fish fillet suppliers.
  • Fig. 1 shows amplification of eukaryotic DNAs (18S);
  • Fig. 2 shows specific amplification of Anisakis spp. and Pseudoterranova spp.;
  • Fig. 3 shows standard curves obtained with ANIKIT and EUKA probes on an ANI sample;
  • Fig. 4 shows standard curves obtained with ANIKIT and EUKA probes on a DNA + ANI sample series; - Fig. 5 shows the sensitivity of the ANIKIT probe;
  • Fig. 6 shows standard curves obtained with the
  • Fig. 7 shows the repeatability of real time PCRs of
  • Fig. 8 shows the sequence and position of primers and probes on the ITS-I region of A. simplex and A. pegreffii;
  • Fig. 9 shows the amplification products of primers SimPeg
  • Fig. 10 shows standard curves obtained with EUKA probe on serial dilutions
  • Fig. 11 shows the sensitivity of the MGB — sim probe assay on samples from different species and at different dilutions
  • Fig. 12 shows the standard curves obtained with the
  • Fig. 13 shows MGB — peg probe assay on samples from different species and at different dilutions; - Fig. 14 shows standard curves obtained with the MGB
  • Fig. 15 shows an example of standard curves obtained with the ANIKIT and EUKA probes on serial dilutions of control sample
  • - Fig. 16 shows another example of standard curves obtained with the ANIKIT and EUKA probes on serial dilutions of control sample
  • Fig. 17 shows yet another example of standard curves obtained with the ANIKIT and EUKA probes on serial dilutions of control samples X (1. ANISAKIS) and Y (2. EUKA).
  • Fig. 18 shows a further example of standard curves obtained with the MGB — sim and MGB - peg probes on serial dilutions of control samples.
  • a first embodiment of the present invention relates to the relative quantification of anisakids in fish extracts by real time PCR. This is accomplished as follows.
  • the amplicon to detect and quantify Anisakids presence and for amplifying the total DNA of the sample were based on the following criteria.
  • Anisakids ANIKIT primers and probe: 1.Ability to identify all species belonging to
  • the amplicon chosen for Anisakid quantification allows amplification of Anisakis and Pseudoterranova spp., but not of Contracaecum spp. and Ascaris spp. (alignments provided in Appendix. 1 ) .
  • the amplicon is very short (56 bp) and located within the redundant ITS-I ribosomal repeat region, thus providing more power to detect the PCR product in degraded samples.
  • the amplicon was designed in order to contain the 18S probe commercialized by Applied Biosystem (USA).
  • the amplicon is located on a redundant genomic regions (ribosomal DNA).
  • ANIKIT F 5'- GAACAACGGTGACCAATTTGG - 3'(Tm 59C; GC% : 48)
  • ANIKIT R 5'- GACGGTCCAGGCAGAAGCT- 3'(Tm 59C; GC%: 63)
  • Probe ANIKIT VIC-TACGCCGTATCTAGCTTC- MGB Amplicon size: 56 bp.
  • EUKA F 5 '- GGTGTCAGAAAAGTTACCACAGG - 3 ' ; EUKA R: 5'- AGTGGGTGAACAATCCACG - 3').
  • Both ANIKIT and EUKA primer pairs were tested in the same PCR conditions on reference samples provided by Univ. Roma La Sapienza from various species of nematodes: A. pegreffii, hybrids A.pegreffii/A. simplex, A. typica, A. brevispiculata, A. physeteris, Pseudoterranova complex. Reactions were carried out in final volume of 10 ⁇ l of IX PCR buffer (Promega), with DNA template final concentration of 0.25 ng/ ⁇ l, and contained: 0.2 mM dNTPs, 0.5 pitiol of each primer, 0.025 U of Taq Polimerase (Promega).
  • Thermal cycling profiles were: 94C for 2 min; 94C for 30 sec, 6OC for 45 sec, 72C for 1 min 30 sec for 35 times; 72C for 4 min. Amplified products were visualised by gel electrophoresis (4% agarose, TBE buffer; Figs. 1 and 2).
  • DNA ladder lOObp DNA Ladder Plus*. ( * ) Fermentas Int. Inc . , Canada
  • the ANIKIT primers and probe allow detection of Anisak ⁇ s and Pseudoterranova species complex, as predicted from sequence alignment without cross- amplification of other nematodes species that don't contaminate the fish and products target of this study.
  • the EUKA primers and probe allow detection of any- organic component of eukaryotic origin and thus allow the most objective relative quantification of Anisakids.
  • Negative control for ANIKIT: cod DNA (cod: 20 ng/ul).
  • A DNA obtained from lmg of Anisakid larva + 100 gr cod.
  • Reference samples for Methods 1 and 2 were homogeneized using a Braun 600 watt device and DNAs were extracted using the REDExtraction-N-Amp tissue PCR Kit (Sigma- Aldrich, USA).
  • the DNA quality was assessed by both PCR and gel electrophoresis using the EUKA primers.
  • the same method of extraction was used for fish, either fresh or as frozen fillets (see Examples 1 and 2).
  • the fish were carefully washed with water to remove any viscera contamination, then heads, fins and tails were removed and fillets were finely homogeneized. About 10-20 mg of tissue homogenate were used for DNA extraction.
  • DNA concentration of these samples were determined using a ND-1000 spectrophotometer (Nanodrop Technologies, USA) in order to prepare and store aliquots of similar concentration (about 20 ng/ul).
  • Baby food, surimi, fish sticks, and canned tuna products from different brands were purchased in the markets and extracted using the Kit "Wizard Magnetic DNA Purification System for Food” (Promega, USA) .
  • Real time PCR set up Reactions were prepared and performed in 384 optical well plates using a TECAN FREEDOM EVO-150 liquid handling workstation (Tecan Trading AG, Mannedorf, CH) and an ABI 7900HT real-time PCR instrument (Applied Biosystems) using the GeneAmp 7900HT sequence detection system software (PerkinElmer Corp., Foster City, CA, USA).
  • the real-time reaction mixture (total of 20 ⁇ l) contained:
  • Samples were cycled as follows: 1 min at 50 0 C, then 10 min at 95°C followed by 40 cycles of 95 0 C for 15 s and 6O 0 C for 1 min.
  • the amount of Anisakid DNA in each sample is first normalised versus the amount of total DNA (EUKA) . Then, the reference sample is used as a calibrator.
  • the method relies on the assumption that the expected concentration of Anisakid DNA in fish muscles (and other samples) is irrelevant compared to the total DNA amount detected by the EUKA probe. Moreover, the final quantification of larval mass in the fish sample is calculated versus a known reference (B: 1 mg larva + 10 mg of fish).
  • ANIKIT mean Ct values increase linearly as a result of decreased concentration of the component of Anisakid DNA while the EUKA probe detects constant amount of total DNA in each sample.
  • Ct mean values follow correctly the dilution series from C (the most concentrated in Anisakid DNA) to A (the most diluted in Anisakid DNA) (Fig. 5 and Fig. 6). Moreover, Ct values are proportional to the subsequent dilution of each sample (2.0, 0.2, 0.02 ng/ul). For the cod DNA (negative control: cod) all the cod DNA (negative control: cod) all the cod DNA (negative control: cod)
  • Ct mean values equal to the total number of PCR cycles (40).
  • Ct mean values of approximately 37 are obtained for sample B (0.02 ng/ul; log ng/ul: -1.7) and for sample A (0.2 ng/ul; log ng/ul: -0.7).
  • PCR reaction (or: the real time PCR assay of the ANIKIT probe can still detect Anisakid DNA diluted 10 5 times in fish DNA - sample A - in 1 ng of total DNA of the PCR reaction), i.e. when about 10 fg of larvae DNA are present.
  • Figure 7 shows that the standard deviations of Ct mean values within and between replicates of each probe are extremely low, highlighting the precision of the assay.
  • Another embodiment of the present invention relates to real time PCT for the distinction of two Anisakid species. This is accomplished as follows. 2. a Design of amplicons and real time probes:
  • the primer pairs were tested by PCR on samples of A. simplex, A. pegreffii, A. typica, interspecific hybrids A. simplex X A. pegreffii provided by Univ. Roma La
  • Sapienza and on three fish samples known to be contaminated by Anisakids are DNA from non contaminated fish (cod).
  • the negative control is DNA from non contaminated fish (cod). Reactions were carried out in final volume of 10 ⁇ l of IX PCR buffer (Promega) with 25 ng of DNA template and contained: 0.2 mM dNTPs, 0.5 pmol of each primer, 0.025 U of Taq Polimerase (Promega).
  • the thermal profile was as follows: 94 0 C for 2 min;
  • DNA ladder lOObp DNA Ladder Plus*.; 2. cod;
  • DNA samples were prepared: 1 mg of each larva of A. simplex, A. pegreffii, A. simplex X A. pegreffii and A. typica (negative control for SimPeg primers) was individually homogeneized with 0.5 g of non contaminated fish (cod) using a Braun 600 watt device and DNAs were extracted using the kit REDExtraction-N-Amp tissue (Sigma) as previously- described. DNA concentration were determined using a ND- 1000 spectrophotometer (Nanodrop Technologies, USA) in order to prepare and store 20 ng/ul aliquots. For each individual sample, three serial dilutions were obtained: 1: 10, 1: 100, and 1: 1,000.
  • the thermal prof ile dif fered in the annealing temperature for primers that was increased to 63°C in order to obtain the maximum specificity of the assay.
  • the EUKA probe correctly detects the serial dilutions of each mix (Fig. 10, which shows the standard curves obtained with EUKA probe on serial dilutions (1:10, 1: 100, 1: 1,000) of A. pegreffii, A. simplex, A. typica and Hybrid mixes with cod DNA.
  • the X axis reports the loglO values of the concentration of Anisakid DNA in each sample).
  • the MGB — sim shows strong specificity for A . simplex, and very high Ct values for A. pregreffi, very close to non amplification (Fig. 11) as well illustrated by the regressions calculated shown in Fig. 12.
  • the MGB - peg probe show perfect specificity for A. pegreffii and on average stronger sensitivity (lower Ct values at comparable dilutions) (Fig. 13 and 14).
  • Both probes detects the hybrid A. pegreffii X A. simplex.
  • Example 1 to assess the presence and relative quantity of Anisakids in fish samples of unknown contamination from the fish market.
  • the fish were eviscerated, and the viscera were left at room temperature for about 15 minutes on a polystirol plate. In these conditions, it is known that Anisakid larvae migrate out of the viscera, making it possible to visually assess the general degree of contamination of a fish. After counting of larvae, the samples were classified as follows: Mackerels : MkI: 11 larvae Mk2 : 22 larvae Mk3: 2 larvae Mk4 : 4 larvae Anchovies (pool of 10 fish): 15 larvae.
  • the negative control was DNA from a non contaminated fish (cod; see Method 1).
  • the positive control was sample B previously described in Method 1 (1 mg larva + 10 mg of fish), used with serial dilutions: (1:10, 1:100 e 1:1000) (see Method 1).
  • Table 1 relative amounts of ANIKIT and EUKA in fish market samples (Example 2). The last column reports an estimation of the larvae concentration in fillets based 10 on reference B.
  • Aim to assess the presence and relative quantity of 15 Anisakids in fish samples of unknown contamination from the fish market. After counting of larvae , the fish with the same number of larvae were pooled for DNA extractions.
  • Example 1 The other treatments and DNA extractions were performed as in Example 1.
  • the real time PCR assay was implemented following the protocol described in Method 1 and in previous Example.
  • Aim to detect the presence of Anisakid larvae residues in baby food and other products containing fish (surimi, fish sticks).
  • the negative control was DNA from a non contaminated fish (cod; see Method 1).
  • Aim to assess the relative quantity of Anisakids in baby food and other products containing fish (surimi, fish sticks) . DNA extractions were repeated (to obtain a better yield) for a subset of samples previously found positive or negative for Anisakid contamination (Tab. 3).
  • surimi IP, 2P; for baby food: 3P, 4P, 5P, 6P, 7P, 8P, 9P; moreover, two new additional baby food samples (both containing European hake) were purchased and added to the panel: 2A_CA (from brand C) and 2B_CA (from Brand D).
  • ANIKIT X Positive control series
  • EUKA Y Positive series
  • A DNA from baby foods
  • B DNA from surimi and fish sticks.
  • the negative control was DNA from a non contaminated fish (cod; see Method 1).
  • the positive controls were X and Y series, and were different for baby food (A) and other products (B) .
  • Sample 2P was confirmed to be positive for Anisakis contamination, with extreme high values of Anisakid DNA detected (about 1,800 fg, i.e. 1-2 picograms).
  • Table 4 relative amounts of ANIKIT and EUKA in baby food and other products (Example 3). The last column reports an estimation of the Anisakid DNA concentration based on reference X (A) . (*) calculations referred to X(B) 0.1 dil.
  • Aim to ascertain the macro-geographic origin of fishery product based on the differen ti al detection of contaminating Anisakid species .
  • Example 15 A. simplex is naturally distributed in North Atlantic ocean, while A. pegreffii is naturally distributed in the Mediterranean sea and in the Southern Atlantic ocean.
  • the samples and treatments are the same of Example 1 ( four mackerels, provenance: Atlantic ocean; ten anchovies, provenance: Mediterranean sea). It is thus expected that contaminated mackerels will be positive for the MGB — sim probe, while anchovies will be positive for the MGB — peg probe .
  • Each DNA sample was tested without dilution (5 ul per reaction: about 100 ng).
  • the negative control was DNA from a non contaminated fish (cod; see Method 1).
  • the annealing temperature was set at 63 0 C (for maximum specificity of the assay) .
  • the standard curves for the MGB — sim and the MGB - peg probe were calculated for the specific reaction plate on serial dilutions of the positive controls (fish DNA mixed with A. simplex, A. pegreffii) (Fig. 18). The two probes could discriminate the presence of only A. simplex or A. pegreffii in positive samples as expected based on the geographic provenance (Table 5).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A molecular method based on real time PCR for the detection of the presence of Anisakis spp. and Pseudoterranova spp. parasites in fish fillets and fish- derived food products, such as babyfood, surimi, fish slices, fish sticks and the like, as well as for performing a relative quantification of nematode larvae content, comprises the steps of: - preparing a first amplicon from the ITS-I region specifically able to identify all species belonging to Anisakis and Pseudoterranova species, and a second amplicon able to amplify DNA from any host DNA, such as fish, and from any organic component or foodstuff, said amplicons being located on redundant genomic regions providing more power to detect a PCR product in degraded samples; - testing the primer pairs in the same real time PCR conditions on reference samples made from various mixtures of Anisakid nematodes and fish; - for fish fillets (not products): quantifying the larval mass in the fish sample by calculation versus a known reference; - for fish fillets and products: calculating the amount of Anisakid DNA versus the amount of total DNA in each sample. A mo lecular method based on real time PCR f or discriminating dif f erent Anis akid species in order to test the geographic provenance of Anisakid-containing f ish, comprises : - aligning the ITS l sequences of dif f erent Anisakid species typical of dif ferent predetermined seas, - designing a real time PCR assay based on detection of sequence variations, - determining whether a fish (and product containing fish) coming from a predetermined sea is contaminated by a given Anisakid species.

Description

Methods for the detection and quantification of nematode parasites in fish and fish products
* * * * *
DESCRIPTION
The present invention relates to methods for the detection and quantification of nematode parasites in fish and fish products.
More particularly, the present invention relates to molecular tests through which the presence of a group of species of nematode parasites, belonging to the genera Anisakis and Pseudoterranova, can be detected and quantified in fish and fish products using DNA-based techniques.
BACKGROUND ART
Anisakid nematodes represent an homogeneous group of parasites whose adult stages are recovered in fish, fish- eating birds and marine mammals, while third stage larvae are often present in the body cavity and muscle of numerous fish species and also in cephalopods and crustaceans worldwide. For example, A. simplex larvae have been found in more than 80% of commercialised Atlantic Salmon stocks in the US (Deardorff TL and Kent ML 1989, Journal of Wildlife Diseases, 25- 3: 416-419) and in 78 - 97% of herrings fished in the English Channel (Beldsoe GE and Oria MP 2001, Journal of Food Science Vol. Suppl. 66-7: 1100-1103).
Due to the risk of, often massive, presence of larvae, the most important commercial fish species are classified in terms of Anisakids prevalence in stocks: e.g. both anchovies and cods are ranked as "high risk" species.
Members of the family Anisakidae belonging to the genera Anisakis and Pseudoterranova are implicated in acute or chronic human infections (anisakiasis) caused by the ingestion of larval nematodes in raw seafood dishes such as sushi, sashimi, ceviche, and pickled herring.
Symptoms of anisakiasis include abdominal pain, nausea, vomiting, and diarrhea. Because symptoms are vague, this condition is often misdiagnosed as appendicitis, acute abdomen, stomach ulcers, or ileitis (Sakanari JA and McKerrow JH 1989, Clin Microbiol Rev 2(3): 278-284).
Anisakiasis is quite common in countries where raw fish is an important component of the traditional cuisine (e.g. in Japan) but more and more cases are being reported in Western countries, where consumption of raw fish is increasing.
Adequate freezing and/or cooking kills anisakid larvae; however, killed or inactivated larvae can still cause sensitization and IgE-dependent hypersensitivity in humans; also non-IgE mediated mechanisms, such as the involvement of other immunoglobulin isotypes (IgG4), or non-immunological events have been described (eg. Moneo I et al. 2007, Parasitol Res. 101(4): 1051-1055).
Heat- and/or pepsin-resistant allergens from A. simplex could explain reactions and symptoms after the ingestion of well-cooked or canned fish (Caballero ML and Moneo I. 2004, Parasitol Res. 93(3): 248-51). Moreover, evidence has been provided, based on in vivo and in vitro tests, that subjects highly sensitized to A. simplex can react to the presence of anisakid species allergens in chicken meat; indeed, chicken feed usually has a high proportion of fishmeal, which might possibly be contaminated by this nematode (Armentia A et al. 2006, J Investig Allergol Clin Immunol. 16(4) :258- 63).
The allergic hypersensitivity symptoms in gastroallergic anisakiasis are clinical events accompanying a wide range of immunologic reactions as a host response against a ubiquitous parasite, but other frequent allergic disorders like chronic urticaria are now being studied for a possible relationship with A. simplex parasitism (Daschner A and Pascual CY 2005, Curr Opin Allergy Clin Immunol. 5(3): 281-5).
Occupational hypersensitivity to A. simplex could occur in humans handling contaminated fish, e.g. in frozen-fish factories. Several case reports show allergy and anaphylactic reactions to the fish parasite Anisakis in the domestic and occupational setting (Nieuwenhuizen N et al. 2006, J Allergy Clin Immunol. 2006 117(5): 1098- 105).
Many studies have identified at least five potential allergenic allergens present in Anisakid L3 larvae (Kobayashi Y et al. 2007, Parasitol Res. 100(6): 1233- 41). The first to be described was a 21 kDa protein with strong homology to nematode troponins (Arrieta I et al. 2000, MoI Biochem Parasitol. 107(2): 263-8). Recently, it has been suggested that the allergen Ani s 4, a heat resistant protein known for its importance in the clinical history of sensitised patients, is the first nematode cystatin that is a human allergen (Rodriguez-Mahillo AI et al. 2007, Int J Parasitol. 37(8-9): 907-17).
The nematode worms that have been implicated in fish-borne infections, specifically those belonging to the genera Anisakis spp. , and Pseudoterranova spp. , can be identified at the molecular level. The species belonging to the genera Anisakis and Pseudoterranova, group as complexes of morphologically indistinguishable (or "cryptic") species which infect, at the larval stage, fish, cephalopods, and shrimp, and, at the adult stage, fish, fish-eating birds, and marine mammals .
However, each species has a specific distribution area and range of hosts, thus identifying these parasites at the species level is crucial in reducing the risk for the consumer. Measures taken may include avoiding particular fishing areas, sizes of fish, or even particular species of fish.
Moreover, whether or not a fish is infested with these parasites can depend on the methods of capturing, like handling and times of storage procedures , which can also affect the number of parasites present.
All marine fish, cephalopods, and probably crustaceans are potential reservoirs of infective larvae (i.e., third-stage larvae, L3), which, although unable to develop to the adult stage in humans, can induce a variety of symptoms , depending on where they are located in the human body (i.e., gastric, intestinal, or extragastric- intestinal symptoms ) .
Furthermore, in previously sensitized persons, severe allergic reactions can occur.
The molecular approaches in the study of the systematics of anisakid nematodes have mainly focused on variable and conserved regions of the nuclear ribosomal DNA and, to a lesser extent, on mitochondrial genes. The ribosomal RNA repeats (rDNA) are an extensively studied repetitive gene family. Each repeat unit contains three ribosomal RNA (rRNA) genes, the large subunit (LSU), small subunit (SSU), and 5.8S rRNA genes, as well as two transcribed spacers (the ITSl and ITS2 ) and a large intergenic spacer (IGS). Variably, another rRNA gene, the 5S, may be present within the IGS.Ribosomal DNA copy number varies widely. In most eukaryotes it is between 30 and 30,000 copies and the repeats are organized tandemly at one or more sites per haploid genome.
Molecular markers based on nuclear ribosomal DNA are available for the identification of the following anisakid species: three members of the Anisakis simplex complex (A. simplex s.s., A. pegreffii and A. simplex C), A. physeteriε, A. brevispiculata, A. paggiae, A. typica, A. ziphidarum, plus one undescribed species provisionally named Anisakis sp. A (D'Amelio S et al. 2000, Int J Parasitol. 30(2): 223-226, and unpublished results); five species within the Pseudoterranova decipiens complex from seals (P. krabbei, P. decipiens s.s., P. bulbosa, P. azaraεi and P. decipiens E.); five cryptic species within the Contracaecum osculatum complex from seals (A, B, C, D and E) plus one species from the Baikal seal (Contracaecum baicalensis) ; three species within the Contracaecum rudolphii complex from birds (A, B and C), plus other species of the genus (C. microcephalum, C. multipapillatum) .
In all these species the variable region of the nuclear ribosomal DNA, i.e. the ITS-I and ITS-2 regions, have proved fruitful for the establishment of genetic markers for their identification at species level; markers in the ITS-I region have also been used for multiplex — based detection of single species (Umehara A et al. 2008, Parasitology International 57: 49-53, Epub Aug. 2007).
Mitochondrial markers have also been widely used in population genetics and species identification; for example, a real time PCR method using the cytochrome c oxidase II gene has been used to detect and quantify A. simplex contaminating fish-derived products.
So far, no methods exploiting the conserved ITS regions of the nuclear ribosomal DNA have been described for the detection and relative quantification of the group of Anisakis and Pseudoterranova spp.
Identifying the etiological agents of these infestations at the species or genotype level is important for various purposes . For example, this can aid physicians in diagnosis and treatment, in tracing the source of the infestation, in determining the area of origin of the contaminated food, and in developing the most appropriate measures for controlling contamination at all phases of food production, from fishing, hunting, or breeding to processing and post-processing of fish products.
Current procedures for veterinary control of infestation in fresh marine fish are based on visual inspection of larvae present in viscera on a subset of animals, and this subset will be then removed from the market .
No methods are available to check the possible presence of larvae in frozen fish (in this case, larvae would be still, as killed by freezing). It should also be noted that larvae show a moderate tolerance to low temperatures and that a process of manufacture and use of brines have been validated to eliminate the anisakiosis risk of frozen fish.
Moreover, fish are used as meat component in a variety of products, either fresh or frozen, e.g. canned fish, "surimi" (minced, processed fish used in the preparation of imitation seafood, especially imitation shellfish and crustaceans), fish sticks, baby food (easily chewed food products for infants produced in multiple varieties and tastes, and produced by many manifacturers) etc.
For these derived products, no methods are currently available to detect and quantify the presence of larvae residuals, that still carry allergen properties; moreover, such methods should allow identification of only the residuals of anisakid larvae and not of other nematodes which potentially contaminate foods.
Document WO-A-93/14400 discloses a method for examining an edible product, such as fresh fish flesh, for dielectric inclusions, such as encysted parasites. The product is subjected to a current flow, which may be perturbed or deviated by any hidden inclusions.
Document US-A-5213830 discloses a method for quality control of meat products, especially fish flesh, with regard to the presence of worms. The product to be subjected to quality control, or a sample thereof, is exposed to electromagnetic radiation within the range of about 800-1800 nm, and the irradiation transmitted through said product or sample as a result of this irradiation is analyzed for identification of characteristic absorption by worms in said product or sample.
DESCRIPTION OF THE INVENTION
According to a first aspect, the present invention aims to provide a new method for the detection and quantification of a group of nematode parasites (Anisakis spp. and Pseudoterranova spp.) typically contaminating fishery species, and consequently fish products, by means of a real time PCR assay which exploits the conserved features of the ITS-I region of the Anisakid genome, optimized on standardized DNA samples, as disclosed in claim 1. According to a second aspect, the present invention aims to provide a new method for discriminating two close Anisakid species (A. simplex and A. pegreffii) with the aim to provide a tool for testing the geographic provenance of Anisakid-containing fish captured either in the North Atlantic ocean or in the South Atlantic ocean and Mediterranean sea. This is obtained by carrying out a method having the features described in claim 4.
Summing up, the first method according to the present invention is useful to detect the presence of a group of nematode species in fish and fish products and to quantify the level of their contamination, while the second method is able to detect and distinguish two of the most common species , so to be used as a method to identify the origin of fishery (and fish derived) fresh or processed products.
The first method is particularly useful for food producers, such as babyfood factories, to define thresholds of maximum Anisakid contents (as maximum allergenic load), as well for chain markets and food producers to perform periodic quality checking of fish fillet suppliers.
ILLUSTRATION OF DRAWINGS
Other features and advantages of the present invention will become apparent upon reading the following description of some forms of embodiment of the present invention, given as non-limiting examples, with the help of the figures shown in the attached drawings, where:
Fig. 1 shows amplification of eukaryotic DNAs (18S); Fig. 2 shows specific amplification of Anisakis spp. and Pseudoterranova spp.; Fig. 3 shows standard curves obtained with ANIKIT and EUKA probes on an ANI sample;
Fig. 4 shows standard curves obtained with ANIKIT and EUKA probes on a DNA + ANI sample series; - Fig. 5 shows the sensitivity of the ANIKIT probe;
Fig. 6 shows standard curves obtained with the
ANIKIT probe;
Fig. 7 shows the repeatability of real time PCRs of
EUKA (A) and ANIKIT (B) probes within and between replicates and between different runs of the assay;
Fig. 8 shows the sequence and position of primers and probes on the ITS-I region of A. simplex and A. pegreffii;
Fig. 9 shows the amplification products of primers SimPeg;
Fig. 10 shows standard curves obtained with EUKA probe on serial dilutions;
Fig. 11 shows the sensitivity of the MGB — sim probe assay on samples from different species and at different dilutions;
Fig. 12 shows the standard curves obtained with the
MGB — sim probe;
Fig. 13 shows MGB — peg probe assay on samples from different species and at different dilutions; - Fig. 14 shows standard curves obtained with the MGB
— peg probe;
Fig. 15 shows an example of standard curves obtained with the ANIKIT and EUKA probes on serial dilutions of control sample; - Fig. 16 shows another example of standard curves obtained with the ANIKIT and EUKA probes on serial dilutions of control sample;
Fig. 17 shows yet another example of standard curves obtained with the ANIKIT and EUKA probes on serial dilutions of control samples X (1. ANISAKIS) and Y (2. EUKA).
Fig. 18 shows a further example of standard curves obtained with the MGB — sim and MGB - peg probes on serial dilutions of control samples.
DESCRIPTION OF SOME FORMS OF EMBODIMENT OF THE INVENTION
1. A first embodiment of the present invention relates to the relative quantification of anisakids in fish extracts by real time PCR. This is accomplished as follows.
l.a Design of amplicons and real time probes:
The amplicon to detect and quantify Anisakids presence and for amplifying the total DNA of the sample were based on the following criteria. For Anisakids (ANIKIT primers and probe): 1.Ability to identify all species belonging to
Anisakis and Pseudoterranova species.
2.No amplification from the host organisms (fish) and from other nematodes that possibly contaminate foodstuff from other sources than fish (ex. Ascaris spp) .
For total eukaryotic DNA relative quantification (EUKA primers and probe) :
1. Ability to amplify DNA from any host DNA (fish, other components ) . 2. Ability to amplify DNA from any organic component of foodstuff. 3. Suitability for real time PCR MGB probe design. The amplicon chosen for Anisakid quantification allows amplification of Anisakis and Pseudoterranova spp., but not of Contracaecum spp. and Ascaris spp. (alignments provided in Appendix. 1 ) . The amplicon is very short (56 bp) and located within the redundant ITS-I ribosomal repeat region, thus providing more power to detect the PCR product in degraded samples.
For relative quantification, the amplicon was designed in order to contain the 18S probe commercialized by Applied Biosystem (USA).
As in the previous case, the amplicon is located on a redundant genomic regions (ribosomal DNA).
ANIKIT F: 5'- GAACAACGGTGACCAATTTGG - 3'(Tm 59C; GC% : 48) ANIKIT R: 5'- GACGGTCCAGGCAGAAGCT- 3'(Tm 59C; GC%: 63) Probe ANIKIT: VIC-TACGCCGTATCTAGCTTC- MGB Amplicon size: 56 bp.
EUKA: Human 18S rRNA 2OX Pre-developed TaqMan Assay,
AppliedBiosystem (VIC-MGB)
Amplicon size:, 139 bp
(primer sequences contained in the assay are:
EUKA F: 5 '- GGTGTCAGAAAAGTTACCACAGG - 3 ' ; EUKA R: 5'- AGTGGGTGAACAATCCACG - 3').
Both ANIKIT and EUKA primer pairs were tested in the same PCR conditions on reference samples provided by Univ. Roma La Sapienza from various species of nematodes: A. pegreffii, hybrids A.pegreffii/A. simplex, A. typica, A. brevispiculata, A. physeteris, Pseudoterranova complex. Reactions were carried out in final volume of 10 μl of IX PCR buffer (Promega), with DNA template final concentration of 0.25 ng/ μl, and contained: 0.2 mM dNTPs, 0.5 pitiol of each primer, 0.025 U of Taq Polimerase (Promega). Thermal cycling profiles were: 94C for 2 min; 94C for 30 sec, 6OC for 45 sec, 72C for 1 min 30 sec for 35 times; 72C for 4 min. Amplified products were visualised by gel electrophoresis (4% agarose, TBE buffer; Figs. 1 and 2).
In fig. 1 the amplification of eukaryotic DNAs (18S) shows : 1. DNA ladder: lOObp DNA Ladder Plus*;
2. A. simplex;
3. A. pegreffii;
4. A. typica;
5. A. brevispiculata; 6. Aεcaris spp . ;
7. Pseudoterranova spp.;
8. Contracaecum spp.;
9. 10, 11. Hybrid: A. pegreffi X A. simplex;
12. Blank (water); 13. DNA ladder: lOObp DNA Ladder Plus*
In fig. 2 the specific amplification of Anisakis spp. and Pseudoterranova spp. shows: 1. DNA ladder: lOObp DNA Ladder Plus* 2. cod;
3. A. simplex;
4. A. pegreffii;
5. A. typica;
6. A. brevispiculata; 7. Ascaris spp.;
8. Pseudoterranova spp.;
9. Contracaecum spp.;
10. 11, 12. Hybrid: A. pegreffi X A. simplex;
13. DNA ladder: lOObp DNA Ladder Plus*. ( * ) Fermentas Int. Inc . , Canada
The ANIKIT primers and probe allow detection of Anisak±s and Pseudoterranova species complex, as predicted from sequence alignment without cross- amplification of other nematodes species that don't contaminate the fish and products target of this study.
The EUKA primers and probe allow detection of any- organic component of eukaryotic origin and thus allow the most objective relative quantification of Anisakids.
l.b Real time PCRs
- A number of reference DNA samples were prepared: Positive control (ANIKIT and EUKA): DNA extracted from anisakid larvae (Ani: 20 ng/ul).
Positive control series: the total DNA concentration is fixed (cod DNA + Anisakid DNA= 20 ng/ul), but the relative proportion of Anisakid DNA decreases (DNA + Ani) as: 20 ng/ul, 2 ng/ul, 0.2 ng/ul and 0.02 ng/ul.
Negative control (for ANIKIT): cod DNA (cod: 20 ng/ul).
C: DNA obtained from lmg of Anisakid larva + 0.5 gr cod.
B: DNA obtained from lmg of Anisakid larva + 10 gr cod.
A: DNA obtained from lmg of Anisakid larva + 100 gr cod.
- Methods of DNA extraction:
Reference samples for Methods 1 and 2 were homogeneized using a Braun 600 watt device and DNAs were extracted using the REDExtraction-N-Amp tissue PCR Kit (Sigma- Aldrich, USA).
The protocol is available at http://www.sigmaaldrich.com/sigma/bulletin/xnatsbul.pdf.
The DNA quality was assessed by both PCR and gel electrophoresis using the EUKA primers. The same method of extraction was used for fish, either fresh or as frozen fillets (see Examples 1 and 2). In the case of fresh fish: after counting of larvae, the fish were carefully washed with water to remove any viscera contamination, then heads, fins and tails were removed and fillets were finely homogeneized. About 10-20 mg of tissue homogenate were used for DNA extraction.
The DNA concentration of these samples were determined using a ND-1000 spectrophotometer (Nanodrop Technologies, USA) in order to prepare and store aliquots of similar concentration (about 20 ng/ul).
Baby food, surimi, fish sticks, and canned tuna products from different brands were purchased in the markets and extracted using the Kit "Wizard Magnetic DNA Purification System for Food" (Promega, USA) .
For extraction of DNA from baby food, the extraction was performed on large scale (from 1 g of starting material ) , while for other products the extractions were performed from 200 mg of starting material. The related protocols are available at http: //www.promega.com/tbs/tb284/tb284.pdf .
The DNA concentration of these samples were quickly determined using a ND-1000 spectrophotometer (Nanodrop
Technologies, USA) only to check that DNA was present in solution and in sufficient amount to proceed with the real time assay.
In order to circumvent the potential problem of false positive due to DNA contaminations, extractions were carried out in a Plant Genomics laboratory (at Parco Tecnologico Padano, Lodi) where no animal samples had been previously processed.
Real time PCR set up: Reactions were prepared and performed in 384 optical well plates using a TECAN FREEDOM EVO-150 liquid handling workstation (Tecan Trading AG, Mannedorf, CH) and an ABI 7900HT real-time PCR instrument (Applied Biosystems) using the GeneAmp 7900HT sequence detection system software (PerkinElmer Corp., Foster City, CA, USA).
Each sample (reference sample, control sample, unknown sample) was tested in triplicates.
The real-time reaction mixture (total of 20 μl) contained:
IX final TaqMan Master Mix
Primers and probes: for the EUKA amplicon, 4 ul of EUKA assay mix were added, while for the ANIKIT amplicon primers and probe were added to a final concentration of 300 nM (primers) and 250 nM (probe).
5 μl of DNA template: reference samples were diluted
1:10, 1:100 and 1:100, while water was used as negative control. DNAs extracted from fresh or frozen fillets
(using REDExtraction-N-Amp tissue PCR Kit, Sigma-Aldrich) were used at concentrations of about 20 ng/ul (total DNA amount in reaction: about 100 ng), while all the DNAs extracted by the Wizard Magnetic DNA Purification System for Food (Promega) were tested without dilutions.
Samples were cycled as follows: 1 min at 500C, then 10 min at 95°C followed by 40 cycles of 950C for 15 s and 6O0C for 1 min.
Relative quantification of Anisakid DNA:
Calculations were performed using an approximation of the "standard curve method" for relative U
quantification previously described for gene expression (ABI PRISM 7700 Sequence Detection System, Applied Biosystems, User Bulletin #2, 1997).
By this method (see fig. 3), the amount of Anisakid DNA in each sample (ANIKIT) is first normalised versus the amount of total DNA (EUKA) . Then, the reference sample is used as a calibrator.
It should be stressed that when estimating by this method the relative amount of contamination, the anisakid DNA cannot be discriminated from the total DNA of the sample.
However, the method relies on the assumption that the expected concentration of Anisakid DNA in fish muscles (and other samples) is irrelevant compared to the total DNA amount detected by the EUKA probe. Moreover, the final quantification of larval mass in the fish sample is calculated versus a known reference (B: 1 mg larva + 10 mg of fish).
When using the DNA + Ani sample series (20, 2, 0.2 and 0.02 ng/ul of Anisakid DNA in a total DNA amount of
20 ng/ul) at a dilution 1:10, it is expected that only the ANIKIT probe will show signals of fluorescence increasing as a function of the Anisakid DNA concentration, as shown in Fig. 4, where the X axis reports the loglO values of the concentration of Anisakid
DNA in each sample.
ANIKIT mean Ct values increase linearly as a result of decreased concentration of the component of Anisakid DNA while the EUKA probe detects constant amount of total DNA in each sample.
When using only the ANIKIT probe set, Ct mean values follow correctly the dilution series from C (the most concentrated in Anisakid DNA) to A (the most diluted in Anisakid DNA) (Fig. 5 and Fig. 6). Moreover, Ct values are proportional to the subsequent dilution of each sample (2.0, 0.2, 0.02 ng/ul). For the cod DNA (negative control: cod) all the
Ct mean values equal to the total number of PCR cycles (40).
Ct mean values of approximately 37 are obtained for sample B (0.02 ng/ul; log ng/ul: -1.7) and for sample A (0.2 ng/ul; log ng/ul: -0.7).
Therefore, the real time PCR assay of the ANIKIT probe can still detect Anisakid DNA diluted 1: 104 times in fish DNA (= sample B) in 0,1 ng of total DNA of the
PCR reaction (or: the real time PCR assay of the ANIKIT probe can still detect Anisakid DNA diluted 105 times in fish DNA - sample A - in 1 ng of total DNA of the PCR reaction), i.e. when about 10 fg of larvae DNA are present.
In order to assess the repeatability of the assay, the same experiment was repeated three times, in different days. Each replicate included the set up of new dilutions and the implementation of new real time PCR assays.
Results
Figure 7 (a, b) shows that the standard deviations of Ct mean values within and between replicates of each probe are extremely low, highlighting the precision of the assay.
* * * * *
2. Another embodiment of the present invention relates to real time PCT for the distinction of two Anisakid species. This is accomplished as follows. 2. a Design of amplicons and real time probes:
A real time PCR assay able to discriminate each A. simplex, A. pegreffii and interspecific hybrids A. simplex X A. pegreffii was designed on the basis of ITS-I alignments (Fig. 8):
Primer SimPeg F: 5'- TGTTTTGGCTGCTAATCATCATTG- 3' Primer SimPeg R: 5'- GCCACCTAGCGTGGCTCAT- 3' Probe MGB-simp: VIC- AGGCAGAGTTGAGCAGA- MGB Probe MGB-peg: FAM- AGGCAGAGTCGAGCAGA-MGB
The primer pairs were tested by PCR on samples of A. simplex, A. pegreffii, A. typica, interspecific hybrids A. simplex X A. pegreffii provided by Univ. Roma La
Sapienza and on three fish samples known to be contaminated by Anisakids (see Examples section). The negative control is DNA from non contaminated fish (cod). Reactions were carried out in final volume of 10 μl of IX PCR buffer (Promega) with 25 ng of DNA template and contained: 0.2 mM dNTPs, 0.5 pmol of each primer, 0.025 U of Taq Polimerase (Promega).
The thermal profile was as follows: 940C for 2 min;
94°C for 30 sec, 600C for 45 sec, 720C for 1 min 30 sec for 35 times; 72°C for 4 min.
Amplified products were visualised by gel electrophoresis (4% agarose, TBE buffer). Fig. 9 respectively shows:
1. DNA ladder: lOObp DNA Ladder Plus*.; 2. cod;
3. A. simplex;
4. A. pegreffii;
5. A. typica;
6 - 11. contaminated fish samples; 12. DNA ladder: lOObp DNA Ladder Plus*.
2.b Real time PCR
The following DNA samples were prepared: 1 mg of each larva of A. simplex, A. pegreffii, A. simplex X A. pegreffii and A. typica (negative control for SimPeg primers) was individually homogeneized with 0.5 g of non contaminated fish (cod) using a Braun 600 watt device and DNAs were extracted using the kit REDExtraction-N-Amp tissue (Sigma) as previously- described. DNA concentration were determined using a ND- 1000 spectrophotometer (Nanodrop Technologies, USA) in order to prepare and store 20 ng/ul aliquots. For each individual sample, three serial dilutions were obtained: 1: 10, 1: 100, and 1: 1,000.
- Real time PCR set up:
Real time PCR were prepared following the same protocol previously described; primers and probes (either MGB — sim or MGB — peg) were added to a final concentration of 300 nM (primers) and 250 nM (probe). For the EUKA real time PCR, 4 ul of EUKA assay mix were added.
The thermal prof ile dif fered in the annealing temperature for primers , that was increased to 63°C in order to obtain the maximum specificity of the assay.
Results
The EUKA probe correctly detects the serial dilutions of each mix (Fig. 10, which shows the standard curves obtained with EUKA probe on serial dilutions (1:10, 1: 100, 1: 1,000) of A. pegreffii, A. simplex, A. typica and Hybrid mixes with cod DNA. The X axis reports the loglO values of the concentration of Anisakid DNA in each sample).
The MGB — sim shows strong specificity for A . simplex, and very high Ct values for A. pregreffi, very close to non amplification (Fig. 11) as well illustrated by the regressions calculated shown in Fig. 12. The MGB - peg probe show perfect specificity for A. pegreffii and on average stronger sensitivity (lower Ct values at comparable dilutions) (Fig. 13 and 14).
Both probes detects the hybrid A. pegreffii X A. simplex.
* * * * *
Examples
Real time PCR detection of Anisakids : 1. Fresh fish fillets from the market.
Example 1. Aim: to assess the presence and relative quantity of Anisakids in fish samples of unknown contamination from the fish market.
Four mackerels (provenance: Atlantic ocean) and ten anchovies (provenance: Mediterranean sea).
The fish were eviscerated, and the viscera were left at room temperature for about 15 minutes on a polystirol plate. In these conditions, it is known that Anisakid larvae migrate out of the viscera, making it possible to visually assess the general degree of contamination of a fish. After counting of larvae, the samples were classified as follows: Mackerels : MkI: 11 larvae Mk2 : 22 larvae Mk3: 2 larvae Mk4 : 4 larvae Anchovies (pool of 10 fish): 15 larvae.
A real time PCR assay was implemented following the protocol described in Method 1:
- Each DNA sample was tested without dilution (5 ul per reaction) .
- The negative control was DNA from a non contaminated fish (cod; see Method 1). - The positive control (Control +) was sample B previously described in Method 1 (1 mg larva + 10 mg of fish), used with serial dilutions: (1:10, 1:100 e 1:1000) (see Method 1).
- All samples were amplified in triplicates.
Results
The standard curves for both ANIKIT and EUKA probes were calculated for the specific reaction plate on serial dilutions of the positive control (B) (Fig. 15).
The presence of Anisakid DNA was detected in all market samples, as shown in the following Table 1. In the case of sample Mk2, the elevated number of Anisakid larvae counted in the viscera (22) corresponds to the highest values of fillet contamination (0.26 g/Kg), which is more than the double of reference B.
By reference to the B control sample, it is possible to infer that thέ contamination of samples varies between 5 10 — 260 mg of Anisakid larvae per Kg of fish.
Table 1. relative amounts of ANIKIT and EUKA in fish market samples (Example 2). The last column reports an estimation of the larvae concentration in fillets based 10 on reference B.
(*) 15 larvae in a total of 10 anchovies in pool.
Example 2.
Aim: to assess the presence and relative quantity of 15 Anisakids in fish samples of unknown contamination from the fish market. After counting of larvae , the fish with the same number of larvae were pooled for DNA extractions.
20 Ten herrings and ten anchovies (provenance: Mediterranean sea) were pooled as follows: Sample N. fish N. larvae/fish
Herr 13 herrings 4 Herr 23 herrings 3
Herr 33 herrings 2
Herr 41 herring 4
Anch. . 1 4 anchovies 9
Anch. , 2 3 anchovies 8 Anch. . 3 3 anchovies 5
The other treatments and DNA extractions were performed as in Example 1. The real time PCR assay was implemented following the protocol described in Method 1 and in previous Example.
Results
The standard curves for both ANIKIT and EUKA probes were calculated for the specific reaction plate on serial dilutions of the positive control (B) (Fig. 16).
The presence of Anisakid DNA was detected in two herrings and in one anchovies samples (Table 2).
For both fish species there was a correspondence between the counts of larvae and the Anisakis DNA detection. In the case of herrings, only the samples with 4 larvae counted were detectable, either as a pool (Herr 1) or as an individual fish (Herr 4). For anchovies, only the most contaminated pooled sample (Anch. 1) was detectable. In the case of Herr 1 and Herr 4 samples, the inferred values of fillet contamination were respectively 10 and 15 mg of Anisakid larvae per Kg of fish (about 1/10 compared to B reference), while for Anch. 1 the inferred value was much lower (2.4 mg of Anisakid larvae per Kg of fish).
Table 2. relative amounts of ANIKIT and EUKA in fish market samples (Example 2). The last column reports an estimation of the larvae concentration in fillets based on reference B.
2. Baby food and other derived products
10
Example 3
Aim: to detect the presence of Anisakid larvae residues in baby food and other products containing fish (surimi, fish sticks).
15
A number of food products were purchased at various commercial markets. The products were chosen in a way to represent the main fish species normally used (the indication of label declares the fish species and its
20 percentage amount, usually 20%) and to be from different commercial brands (listed from from A to J).
A real time PCR assay was implemented following the protocol described in Method 1 : - Each DNA sample was tested without dilution and in triplicates (5 ul per reaction).
- The negative control was DNA from a non contaminated fish (cod; see Method 1).
Results
Table 3 reports the mean Ct values (and standard deviations) of EUKA and ANIKIT probes and the main features of each sample. Baby food:
For about 1/3 of the most "difficult" baby food samples, the EUKA Ct values were above a threshold of about 31-32. This could be due to various causes, like that the product had undergone extensive degradation, and/or the percentage of fish DNA was lower than declared on label, and/or the specific DNA extraction didn't work properly. In these cases, it is impossible to assess if larvae are effectively absent from the product. On the other side, non-contaminated samples showed no signal of Anisakid DNA in all replicates, but also medium-high concentrations of total DNA.
Four baby food samples (out of the 19 for which EUKA Ct was lower than 30) showed clear evidence of contamination. These products contained plaice and European hake, both species representing common fishery products and naturally prone to Anisakid infection. For the hake species, extensive Anisakid contamination have been extensively reported.
On the other side, the baby food samples containing sea bream and sea bass, which are typically produced by aquaculture (i.e. not easily infected by Anisakis, unless grown in extensive aquaculture systems), were not contaminated, as expected. Surimi and fish sticks: 4 out of the 7 "minced fish" products analyzed were found contaminated, with ANIKIT Ct values even below 30. For only two of the contaminated products the label was informative concerning the fish species (cod) .
The massive presence of Anisakid in these products point to the possibility that low quality fish stocks, perhaps previously discarded from the fresh and frozen fillets market, are normally used for the preparation of these products.
Table 3. Fish product samples used in Example 3.
Nd: no amplification or doubtful result. Example 4
Aim: to assess the relative quantity of Anisakids in baby food and other products containing fish (surimi, fish sticks) . DNA extractions were repeated (to obtain a better yield) for a subset of samples previously found positive or negative for Anisakid contamination (Tab. 3). For surimi: IP, 2P; for baby food: 3P, 4P, 5P, 6P, 7P, 8P, 9P; moreover, two new additional baby food samples (both containing European hake) were purchased and added to the panel: 2A_CA (from brand C) and 2B_CA (from Brand D).
Sample ID Fish Brand
Baby food 3P Salmon B
4P Salmon C
5P Plaice C
6P Sea bream ( * ) C
7P European hake D
8P European hake A
9P European hake C
2A_CA European hake C
2B_CA European hake D
3B_CO Sea bream ( * ) D
Surimi IP Alaskan Pollack A
2P Not specified A
In order to refer each signal to the most appropriate standard, new reference DNA samples were prepared for the specific purpose of relative DNA quantification of baby food (A) and of "other" products (B) :
X Positive control series (ANIKIT) : the total DNA concentration is fixed (20 ng/ul of cod DNA) but the relative proportion of Anisakid DNA decreases from 0.1 ng/ul to 1 fg/ul.
Y Positive series (EUKA): total DNA is used undiluted and diluted 10 and 100 times.
Two different X and Y positive series of pooled DNAs are prepared;
A — DNA from baby foods B — DNA from surimi and fish sticks.
The real time PCR assay was implemented following the protocol described in Method 1:
- Each DNA unknown sample was tested without dilution in four triplicates for the ANIKIT probe and in three replicates for the EUKA probe (5 ul per reaction) . All standard samples were amplified in triplicates.
- The negative control was DNA from a non contaminated fish (cod; see Method 1).
- The positive controls were X and Y series, and were different for baby food (A) and other products (B) .
Results The standard curves for both ANIKIT and EUKA probes were calculated for the specif ic reaction plate on serial dilutions of the positive controls (Fig . 17 ) .
Baby food:
The presence of Anisakid in 7P and 8P (containing European hake) was confirmed also in the new experiment (new DNA extraction and PCR) albeit at a low relative larvae DNA concentration (Table 4). One of the two new samples containing the same fish species (2B_CA) was found positive
After the new DNA extraction (a much better DNA yield was obtained), the samples 5P (containing plaice) and 9P (containing European hake) were found strongly positive (relative quantification of larvae DNA: about 100-150 fg), while 3P and 4P (containing salmon) and 6P (containing sea bream) were confirmed to be negative.
Surimi :
Sample 2P was confirmed to be positive for Anisakis contamination, with extreme high values of Anisakid DNA detected (about 1,800 fg, i.e. 1-2 picograms).
Table 4. relative amounts of ANIKIT and EUKA in baby food and other products (Example 3). The last column reports an estimation of the Anisakid DNA concentration based on reference X (A) . (*) calculations referred to X(B) 0.1 dil.
Fish traceability
10
Example 4
Aim: to ascertain the macro-geographic origin of fishery product based on the differen ti al detection of contaminating Anisakid species .
15 A. simplex is naturally distributed in North Atlantic ocean, while A. pegreffii is naturally distributed in the Mediterranean sea and in the Southern Atlantic ocean. The samples and treatments are the same of Example 1 ( four mackerels, provenance: Atlantic ocean; ten anchovies, provenance: Mediterranean sea). It is thus expected that contaminated mackerels will be positive for the MGB — sim probe, while anchovies will be positive for the MGB — peg probe .
A real time PCR assay was implemented following the protocol described in Method 2 :
Each DNA sample was tested without dilution (5 ul per reaction: about 100 ng). - The negative control was DNA from a non contaminated fish (cod; see Method 1).
The positive controls were the same used in Method 2
(fish DNA mixed with A. simplex, A. pegreffii) , with the same dilutions (1: 10, 1: 100, and 1: 1,000). - As samples were already used in Example 1, the EUKA probe is not tested.
All samples were amplified in triplicates.
As in Method 2, in the thermal profile the annealing temperature was set at 630C (for maximum specificity of the assay) .
Results
The standard curves for the MGB — sim and the MGB - peg probe were calculated for the specific reaction plate on serial dilutions of the positive controls (fish DNA mixed with A. simplex, A. pegreffii) (Fig. 18). The two probes could discriminate the presence of only A. simplex or A. pegreffii in positive samples as expected based on the geographic provenance (Table 5).
In the case of samples mackerel 3 and 4, the MGB — sim probe gave very low Ct values, barely detectable (Ct mean= 39.5 and 38.2, respectively). However, the result were considered consistent because no signals at all were detected in these samples by the MGB — peg probe.
Table 5. detection of A. simplex and A. pegreffii on samples of known geographic origin (cfr. Example 1).

Claims

1. Molecular method based on real time PCR for the detection of the presence of Anisakis spp . and Pseudoterranova spp. parasites in fish fillets and fish- derived food products, such as babyfood, surimi, fish slices, fish sticks and the like, as well as for performing a relative quantification of nematode larvae content, comprising the steps of: - preparing a first amplicon from the ITS-I region specifically able to identify all species belonging to Anisakis and Pseudoterranova species, and a second amplicon able to amplify DNA from any host DNA, such as fish, and from any organic component or foodstuff, said amplicons being located on redundant genomic regions providing more power to detect a PCR product in degraded samples;
- testing the primer pairs in the same real time PCR conditions on reference samples made from various mixtures of Anisakid nematodes and fish;
- for fish fillets (not products): quantifying the larval mass in the fish sample by calculation versus a known reference;
- for fish fillets and products: calculating the amount of Anisakid DNA versus the amount of total DNA in each sample.
2 . The method of claim 1 , whereby the amplif ied product s are vi sua l i z ed , pre f erably by ge l electrophoresis .
3 . The method of claim 1 , whereby the real time probe detects Anisakid DNA contained in a proportion of 1 : 105 in 1 ng of total DNA.
4 . The method of claim 3 , whereby the real time reactions are prepared and performed in a number of optical well plates using a liquid handling workstation and running a sequence detection system software .
5. A molecular method based on real time PCR for discriminating different Anisakid species in order to test the geographic provenance of Anisakid-containing fish, comprising - aligning the ITSl sequences of different Anisakid species typical of different predetermined seas,
- designing a real time PCR assay based on detection of sequence variations,
- determining whether a fish (and product containing fish) coming from a predetermined sea is contaminated by a given Anisakid species.
5. The molecular method of claim 4, in which the Anisakid species are A. simplex, which presence is typical of North Atlantic Ocean, and A. pegreffii, which presence is typical of the South Atlantic ocean and Mediterranean Sea.
EP08702344A 2008-01-30 2008-01-30 Methods for the detection and quantification of nematode parasites in fish and fish products Withdrawn EP2240599A1 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2008/000212 WO2009095729A1 (en) 2008-01-30 2008-01-30 Methods for the detection and quantification of nematode parasites in fish and fish products

Publications (1)

Publication Number Publication Date
EP2240599A1 true EP2240599A1 (en) 2010-10-20

Family

ID=39672680

Family Applications (1)

Application Number Title Priority Date Filing Date
EP08702344A Withdrawn EP2240599A1 (en) 2008-01-30 2008-01-30 Methods for the detection and quantification of nematode parasites in fish and fish products

Country Status (2)

Country Link
EP (1) EP2240599A1 (en)
WO (1) WO2009095729A1 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103361401A (en) * 2012-03-30 2013-10-23 舟山市疾病预防控制中心 TagMan PCR detection method for anisakis simplexes in marine products
CN103224982A (en) * 2013-02-02 2013-07-31 中国水产科学研究院淡水渔业研究中心 Detection and expelling method for coilia ectenes heteromazocraes lingmueni based on molecular marker technology
CN104561265B (en) * 2014-11-21 2017-01-11 深圳市疾病预防控制中心 Real-time fluorescence PCR detection kit and detection method of anisakis
CN110589981B (en) * 2019-10-15 2024-06-07 上源环工生态环境科技(苏州)有限公司 Combined three-dimensional ecological floating bed for riverway restoration and purification
CN112094922A (en) * 2020-09-29 2020-12-18 西藏自治区农牧科学院水产科学研究所 Detection and identification method for echinococcus nudus

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SE460563B (en) 1988-10-19 1989-10-23 Lumetech As MAKE TO DETECT MASK IN COAT
US5289123A (en) 1992-01-14 1994-02-22 University Of Alaska Detection of defects in food by detecting pattern of current flow

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2009095729A1 *

Also Published As

Publication number Publication date
WO2009095729A1 (en) 2009-08-06

Similar Documents

Publication Publication Date Title
Tanabe et al. PCR method of detecting pork in foods for verifying allergen labeling and for identifying hidden pork ingredients in processed foods
Teletchea Molecular identification methods of fish species: reassessment and possible applications
Rasmussen et al. DNA‐based methods for the identification of commercial fish and seafood species
El Sheikha et al. How to determine the geographical origin of seafood?
Mossali et al. Sensitive detection and quantification of anisakid parasite residues in food products
Herrero et al. Detection of anisakids in fish and seafood products by real-time PCR
Rellstab et al. Analysis of trematode parasite communities in fish eye lenses by pyrosequencing of naturally pooled DNA
Bachand et al. Serological and molecular detection of Toxoplasma gondii in terrestrial and marine wildlife harvested for food in Nunavik, Canada
Gazzonis et al. Toxoplasma gondii infection and biosecurity levels in fattening pigs and sows: serological and molecular epidemiology in the intensive pig industry (Lombardy, Northern Italy)
Cavallero et al. Survey of Anisakis sp. and Hysterothylacium sp. in sardines and anchovies from the North Adriatic Sea
Jabbar et al. Molecular characterization of anisakid nematode larvae from 13 species of fish from Western Australia
Cammilleri et al. Presence of Anisakis pegreffii in farmed sea bass (Dicentrarchus labrax L.) commercialized in Southern Italy: A first report
Eischeid Development and evaluation of a real-time PCR assay for detection of lobster, a crustacean shellfish allergen
Dahl et al. Genotyping confirms significant cannibalism in northern Gulf of Mexico invasive red lionfish, Pterois volitans
Espiñeira et al. Detection and identification of anisakids in seafood by fragment length polymorphism analysis and PCR–RFLP of ITS-1 region
EP2240599A1 (en) Methods for the detection and quantification of nematode parasites in fish and fish products
Levin et al. DNA-based technique: Polymerase chain reaction (PCR)
Vergara et al. Toxoplasma gondii lineages circulating in slaughtered industrial pigs and potential risk for consumers
DeMone et al. Application of next generation sequencing for detection of protozoan pathogens in shellfish
Guardone et al. Assessment of a sampling plan based on visual inspection for the detection of anisakid larvae in fresh anchovies (Engraulis encrasicolus). A first step towards official validation?
Cipriani et al. Occurrence of larval ascaridoid nematodes in the Argentinean short-finned squid Illex argentinus from the Southwest Atlantic Ocean (off Falkland Islands)
Godínez-González et al. Quantitative SYBR Green qPCR technique for the detection of the nematode parasite Anisakis in commercial fish-derived food
Chawhan et al. Prevalence and molecular epidemiology of porcine cysticercosis in naturally infected pigs (Sus scrofa) in Punjab, India
Rodrigues et al. Proteomics in aquaculture: Quality and safety
Geba et al. Development of cytochrome-c-oxidase 1 specific primers for genetic discrimination of the European eel Anguilla anguilla (Linnaeus, 1758).

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20100810

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA MK RS

DAX Request for extension of the european patent (deleted)
GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120329