CN112094922A - Detection and identification method for echinococcus nudus - Google Patents
Detection and identification method for echinococcus nudus Download PDFInfo
- Publication number
- CN112094922A CN112094922A CN202011054037.4A CN202011054037A CN112094922A CN 112094922 A CN112094922 A CN 112094922A CN 202011054037 A CN202011054037 A CN 202011054037A CN 112094922 A CN112094922 A CN 112094922A
- Authority
- CN
- China
- Prior art keywords
- nudus
- echinococcus
- ones
- echinocandis
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting and identifying echinocandis nudus, which comprises the following steps: collecting echinococcus nudus in a fish host according to morphological characteristics; extracting DNA of the polypide sample; performing agarose gel electrophoresis to detect the quality of the extracted DNA, and if the quality is qualified, establishing a reaction system for PCR amplification; and (3) carrying out sequence comparison on the sequencing result, and if the consistency is more than 99%, judging that the species is the echinococcus nudus. The identification method has the advantages of accurate and reliable experimental results.
Description
Technical Field
The invention belongs to the technical field of identification by combining traditional morphology and molecular biology detection, and particularly relates to a detection and identification method for echinococcus nudus.
Background
Echinocandis nudiflora (A. nudus)Echinorhynchus gymnocyprii) Belonging to Echinochida of Echinochaeles (Echinochytida)(Echinorhynchus) It is a parasitic worm that parasitizes native fish in Tibet. The fish has long mouth part and dense rhynchophyllus thereon, and the rhynchophyllus is drilled into the mucous membrane of the host intestine for parasitism in the digestive tract of the fish to destroy the intestinal wall of the host, so as to cause inflammation, and intestinal penetration can be caused by a large amount of parasitismThe large size of the pore is easy to cause intestinal blockage, so that the host is dead.
Fishery development is accompanied by combating various diseases of fish, and accurate identification of the infected parasites is necessary to enable the formulation of a reasonably effective treatment regimen, which is the basis and prerequisite for continued healthy development of the aquaculture industry. Morphological identification is a common method for identifying parasites, but parasites of the same genus are often similar in morphology, and the accuracy of species identification cannot be completely guaranteed only by morphological identification, and molecular biological methods are required for verification.
At present, no specific primer is used for molecular biological identification of echinococcus nudus, but a universal primer is designed aiming at a region with highly conserved base sequence of a certain gene of a certain family or a certain genus of known species, so that the condition that the consistency of sequencing results among different species of the same genus is more than 99 percent can occur when the universal primer is used for sequencing, and different species are judged to be the same species according to the result, and identification errors occur. That is, species cannot be distinguished effectively and accurately by using the universal primer identification, species cannot be determined, and targeted protection and prevention work cannot be carried out smoothly.
Disclosure of Invention
In order to solve the technical problems, the invention provides a method for detecting and identifying the echinococcus nudus, which has the advantages of quick experiment, accurate and reliable result.
The technical scheme adopted by the invention is as follows:
a detection and identification method for echinocandis nudus comprises the following steps:
A. collecting echinococcus nudus in a fish host according to morphological characteristics;
B. extracting DNA of the polypide sample;
C. performing agarose gel electrophoresis to detect the quality of the extracted DNA, and if the quality is qualified, establishing a reaction system for PCR amplification;
D. and (3) carrying out sequence comparison on the sequencing result, and if the consistency is more than 99%, judging that the species is the echinococcus nudus.
The echinocandis nudi disclosed by the invention is characterized by being bright in body color, mostly yellow, white, dark red and occasional yellow bottom color, and has individual bodies with orange annular patterns on the body surface and thicker body walls. The kiss end position is longer and cylindrical; the osculum has 13 rows, each row has 9 1 st slightly smaller ones, 2-6 ones are equal and largest ones, the last 3 ones are smaller than the first 6 ones, the last 2 ones are smaller than the last 3 ones, and all have roots; the rhynchosia is deep and is rod-shaped; the osculum is short and thick, and has a rod shape, and the length of the osculum is similar to that of the osculum. Oval eggs can be seen in the body cavity of the female insects and are distributed in a scattered way. The 2 testicles of the male are connected and are oval and basically equal in size; the mucous glands are located at the rear side of the testis, 6 mucous glands are in an inverted pear shape; the male insect joining sac can extend out of the body and is in a bell jar shape.
The method for collecting the polypide sample comprises the steps of scraping contents and mucus of a fish digestive tract, placing the contents and the mucus in a glass plate, extruding the glass plate with the same size to disperse and unfold the contents and the mucus, observing the polypide shape by using a portable dissecting mirror, and collecting the sea carps.
Preferably, the glass plate is 10 x 10cm in size, which is suitable for the portable dissecting mirror used.
The invention adopts the 18S specific primer and the COX1 specific primer to carry out PCR amplification respectively, and the obtained PCR products can be confirmed after the sequence alignment consistency reaches more than 99 percent.
Preferably, the 18S-specific primers are:
an upstream primer: GTTCATCGTTGATGCACTTCAG
A downstream primer: GTAACGACAAACGATCGCTA are provided.
Preferably, the COX1 specific primers are:
an upstream primer: GTTGCTAGGTTTTGCGATAAG
A downstream primer: TGGAGACCCACCACCACAAG are provided.
Further preferably, the base sequence of ribosomal gene 18S for sequence alignment is seq id: no. 5.
Further preferably, the base sequence of COX1 used for sequence alignment is seq id: no. 6.
The invention has the beneficial effects that:
in the intensive study on Tibetan parasites, it is found that the phenomenon that the sequence of the same mitochondrial gene of the same species has larger variation due to the excessively fast evolution speed of some genes of the mitochondria is caused, and then the result is mutually proved with the result of COX1 gene sequencing by detecting the more conserved ribosomal gene 18S. The identification method is suitable for detecting the parasitic Gymnocypris przewalskii of the native Tibet fishes, has the accuracy rate which is obviously higher than that of identification only by means of morphology or by using a universal primer, has the advantages of accurate and reliable experimental results, and is convenient for the maintenance work of the native Tibet fishes and the accurate identification of the Gymnocypris przewalskii in the manual domestication process, thereby carrying out targeted control.
Drawings
FIG. 1 is a band diagram of agarose gel electrophoresis for detecting the quality of extracted DNA; the 1 st strip from left to right is DNA of Echinops gymnocypris parasitizing in the Glyptosternum maculatum digestive tract, the 2 nd strip is DNA of Echinops gymnocypris parasitizing in the plateau Gymnocypris digestive tract, and the 3 rd strip is Marker.
Detailed Description
In order to more clearly and specifically illustrate the technical solution of the present invention, the present invention is further described by the following embodiments. The following examples are intended to illustrate the practice of the present invention and are not intended to limit the scope of the invention.
Example 1
A detection and identification method for echinocandis nudus comprises the following steps:
A. collecting echinococcus nudus in a fish host according to morphological characteristics;
B. extracting DNA of the polypide sample;
C. performing agarose gel electrophoresis to detect the quality of the extracted DNA, establishing a reaction system and performing PCR amplification, wherein the quality is qualified;
D. and (3) carrying out sequence comparison on the sequencing result, and if the consistency is more than 99%, judging that the species is the echinococcus nudus.
Example 2
This example is based on example 1:
the method for collecting the polypide sample comprises the steps of scraping contents and mucus of a fish digestive tract, placing the contents and the mucus in a glass plate, extruding the glass plate with the same size to disperse and unfold the contents and the mucus, observing the polypide shape by using a portable dissecting mirror, and collecting the polypide sample.
The glass plate is 10 x 10cm in size, and is sized to fit the portable dissecting mirror used.
Example 3
This example is based on example 1:
the echinococcus nudus has the morphological characteristics of bright body color, more yellow color, white color, dark red color, yellow and occasional yellow with orange annular patterns at the bottom and thicker body wall. The kiss end position is longer and cylindrical; the osculum has 13 rows, each row has 9 1 st slightly smaller ones, 2-6 ones are equal and largest ones, the last 3 ones are smaller than the first 6 ones, the last 2 ones are smaller than the last 3 ones, and all have roots; the rhynchosia is deep and is rod-shaped; the osculum is short and thick, and has a rod shape, and the length of the osculum is similar to that of the osculum. Oval eggs can be seen in the body cavity of the female insects and are distributed in a scattered way. The 2 testicles of the male are connected and are oval and basically equal in size; the mucous glands are located at the rear side of the testis, 6 mucous glands are in an inverted pear shape; the male insect joining sac can extend out of the body and is in a bell jar shape.
Example 4
This example is based on example 1:
respectively carrying out PCR amplification by adopting an 18S specific primer and a COX1 specific primer, and confirming that the obtained PCR products have more than 99% of sequence comparison consistency.
Example 5
This example is based on example 4:
the 18S specific primer is as follows:
an upstream primer: GTTCATCGTTGATGCACTTCAG
A downstream primer: GTAACGACAAACGATCGCTA are provided.
The base sequence of ribosomal gene 18S for sequence alignment is seq id: no. 5.
Example 6
This example is based on example 4:
the COX1 specific primers are as follows:
an upstream primer: GTTGCTAGGTTTTGCGATAAG
A downstream primer: TGGAGACCCACCACCACAAG
The base sequence of COX1 used for sequence alignment is SEQ ID: no. 6.
Example 7
Cutting off the digestive tract (including stomach and intestinal tract) of Glyptosternum maculatum and the digestive tract (only intestinal tract) of Gymnocypris przewalskii in plateau with scissors, respectively collecting suspected insect species samples according to morphological characteristics of Gymnocypris przewalskii, cleaning with 0.65% sodium chloride solution, and storing in pure alcohol.
DNA extraction
Taking the polypide out of pure alcohol, washing the polypide clean with distilled water, putting the polypide into a PCR tube, sucking the redundant distilled water, and extracting the DNA of a sample by using a tissue cell genome DNA rapid extraction kit (Beijing Edley Biotechnology Co., Ltd.). After extraction, the quality of the DNA was checked by gel electrophoresis, see FIG. 1, without degradation and without other impurities, and subsequent experiments were performed. The procedures were carried out exactly as described in the kit.
Specific primer design
The echinocandin nudus ribosome gene 18S variable region collected by Tibet aquatic research institute is analyzed, simultaneously, the obtained proximal parasite is utilized, after comparison is carried out by Clustal X, a region which is greatly different from other species of the same genus is selected to design a primer, the designed primer is a specific primer aiming at the variable region, and the echinocandin nudus has high specificity. By the primer, the base sequence SEQID of the echinocandis nudus is successfully amplified: no.5 is used for the alignment identification after the sequencing of the echinocandis.
The primer sequences are as follows:
18S primer:
an upstream primer: GTTCATCGTTGATGCACTTCAG
A downstream primer: GTAACGACAAACGATCGCTA
The mitochondrial gene COX1 is designed by the same method, and the base sequence SEQID of the echinococcus nudus is successfully amplified: no.6 is used for the alignment identification after the sequencing of the echinocandis.
COX1 primer:
an upstream primer: GTTGCTAGGTTTTGCGATAAG
A downstream primer: TGGAGACCCACCACCACAAG
PCR identification
Centrifuge, PCR instrument, constant temperature water bath, refrigerator, power supply for six electrophoresis instruments, pipette (10 μ L, 100 μ L, 1000 μ L), suction head (10 μ L, 100 μ L, 1000 μ L), PCR reaction tube; rTaq polymerase (250U, Takara), ddH 2O.
Determination of total volume of reaction system of 20 mu l of PCR amplification reaction system and conditions
The method comprises the following steps:
7.4 mu l double distilled water
10 μ l 2 XPCR buffer (Mg2+, dNTP plus, Takara, Dalian, China)
0.6 mu l of each primer
0.4 μ l rTaq polymerase (250U, Takara)
1 μ l of DNA template.
Amplification conditions:
pre-denaturation at 98 ℃ for 2 min
And (4) circulating for 40 times:
98°C for 10 s
48–60°C* for 15 s
68°C for 1 min/kb
finally, extension at 68 ℃ for 10 min.
Preparing 1.0% agarose (containing 100 muL/L fluorescent dye) by using 1 XTAE electrophoresis buffer solution, adding the electrophoresis buffer solution into an electrophoresis tank to ensure that the liquid level just exceeds the gel level, adding 5 muL PCR product into a sample hole, adjusting the voltage to 120V by using DLmarker2000 as a contrast during electrophoresis, and carrying out electrophoresis for 0.5 h; and observing the electrophoresis result under a gel imager, photographing and recording the result. The target band was detected and sent to the manufacturer (bioengineering (Shanghai) Co., Ltd.) for sequencing followed by alignment with the gene sequences SEQID: NO.5 and SEQID: NO. 6. The consistency of the sequencing results of the two groups of Glyptosternum maculatum and plateau Gymnocypris przewalskii can reach 99%, and the Gymnocypris przewalskii is confirmed.
The above-mentioned embodiments only express the specific embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention.
Sequence listing
<110> institute of aquatic science of academy of agriculture and animal husbandry in autonomous region of Tibet
<120> detection and identification method for echinococcus nudus
<130> 2020
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> 18S upstream primer ()
<400> 1
gttcatcgtt gatgcacttc ag 22
<210> 2
<211> 20
<212> DNA
<213> 18S downstream primer ()
<400> 2
gtaacgacaa acgatcgcta 20
<210> 3
<211> 21
<212> DNA
<213> COX1 upstream primer ()
<400> 3
gttgctaggt tttgcgataa g 21
<210> 4
<211> 20
<212> DNA
<213> COX1 downstream primer ()
<400> 4
tggagaccca ccaccacaag 20
<210> 5
<211> 670
<212> DNA
<213> Echinochloa carpio (Echinorhynchus gynocyprii)
<400> 5
gttcatcgtt gatgcacttc agtgtgtgtc gcggtagaag gtcaatgtca ctttgagaaa 60
attagtgtgc tcaacgcagg ctttatgctt gtataatgct gcatgagatg acggaatagg 120
gcctcggttc cgtttcgttg gtttacgaaa gcagaggtca tgattaatcg ggacagacgg 180
gggcattcgt attgcggtgc tagaagtgaa attctgtgac catcgcaaga cgaacaactg 240
cgaaagcatt tgccaagaat gttctcatta atcaagaacg aaagttagag gatcgaagac 300
gattagatac cgtcctagtt ctaactgtaa actatgccga ctggggattc gccagtgcaa 360
ttgagcttgg cgagcaccct ccgggaaacc aaagtgattg ggttccgggg ggagtatggt 420
tgcaaaatcg aaacttaaag gaattgacgg aggggcacac cagaagtgga gcctgcggct 480
caatttgact caacgcacga aagcttactc ggtccgaaca ccgtgaggat tgacaggttg 540
aaagctcttt cttgatccgg tgggtagcgg tgcatggccg ttcgtagttg gtgaagtgat 600
ttgtctggtt tattccgata acgaacgaga ctctagccta ctaattagcg tagcgatcgt 660
ttgtcgttac 670
<210> 6
<211> 601
<212> DNA
<213> Echinochloa carpio (Echinorhynchus gynocyprii)
<400> 6
gttgctaggt tttgcgataa gaatcattat tcggttagaa ttggggatgg ggggtcaatg 60
attgggtagg gagtctatat ataatgttat agttacaagt catgctttaa taatagtttt 120
ctttttagta atgccagttt ttataggtgg ttttgggaat tggttattac cagtaatatt 180
agggctagga gatatagcct taccgcggat gaataatctt agattaatcc ttttacttgt 240
aagactatca ttgataggcg tttcattaat tcttggtggg ggaggggcag ggtgaacaat 300
atacccaccc ctgatgttaa gggattttag gtctggtgtc tctgttgata ttataatttt 360
aagcttacat gttgcaggtt tatcatctat tttaggttca attaatattt tagtaacagt 420
tgctattggg gtgaagagtt cctatactgt agagcaaatc ccattgtttg tctgggcctt 480
aggagtgaca gcaggtttag tggtgctgac agttccagta ctagcagctg ctttaactat 540
gcttttaata gatcgtaatt tatcttctag attctttaac ccttgtggtg gtgggtctcc 600
a 601
Claims (9)
1. A detection and identification method for echinocandis nudus is characterized by comprising the following steps:
A. collecting echinococcus nudus in a fish host according to morphological characteristics;
B. extracting DNA of the polypide sample;
C. performing agarose gel electrophoresis to detect the quality of the extracted DNA, and if the quality is qualified, establishing a reaction system for PCR amplification;
D. and (3) carrying out sequence comparison on the sequencing result, and if the consistency is more than 99%, judging that the species is the echinococcus nudus.
2. The method according to claim 1, wherein the method for collecting the polypide echinocandis nudus sample comprises scraping the contents and mucus of the digestive tract of fish, placing the scraped contents and mucus in the center of a glass plate, pressing the glass plate with the same size to spread the contents and mucus, observing the shape of polypide with a portable dissecting mirror, and collecting the suspected polypide.
3. The method according to claim 2, wherein the size of the glass plate is 10 x 10 cm.
4. The method according to claim 1, wherein the echinocandis nudi has a vivid body color, more than yellow, white, dark red, and occasionally yellow background, and the body surface of the individual has an orange ring pattern, thicker body wall, longer lip end, and cylindrical shape; the osculum has 13 rows, each row has 9 1 st slightly smaller ones, 2-6 ones are equal and largest ones, the last 3 ones are smaller than the first 6 ones, the last 2 ones are smaller than the last 3 ones, and all have roots; the rhynchosia is deep and is rod-shaped; the osculum is short and thick, is rod-shaped, has the length similar to that of the osculum, elliptical eggs can be seen in the female worm body cavity, and are distributed, 2 testis of male worm are connected and are elliptical, and basically equal in size; the mucous glands are located at the rear side of the testis, 6 mucous glands are in an inverted pear shape; the male insect joining sac can extend out of the body and is in a bell jar shape.
5. The method for detecting and identifying echinococcus nudus according to claim 1, wherein 18S specific primer and COX1 specific primer are used for PCR amplification respectively, and the obtained PCR products are compared in sequence to confirm that the consistency is more than 99%.
6. The method for detecting and identifying echinocandis nudi according to claim 5, wherein the 18S specific primers are:
an upstream primer: GTTCATCGTTGATGCACTTCAG downstream primer: GTAACGACAAACGATCGCTA are provided.
7. The method for detecting and identifying echinocandis nudi according to claim 5, wherein the COX1 specific primers are:
an upstream primer: GTTGCTAGGTTTTGCGATAAG downstream primer: TGGAGACCCACCACCACAAG are provided.
8. The method for detecting and identifying echinococcus of claim 6, wherein the base sequence of ribosomal gene 18S used for sequence alignment is SEQ ID: no. 5.
9. The method for detecting and identifying echinococcus of claim 7, wherein the base sequence of COX1 used for sequence alignment is SEQ ID: no. 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011054037.4A CN112094922A (en) | 2020-09-29 | 2020-09-29 | Detection and identification method for echinococcus nudus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011054037.4A CN112094922A (en) | 2020-09-29 | 2020-09-29 | Detection and identification method for echinococcus nudus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112094922A true CN112094922A (en) | 2020-12-18 |
Family
ID=73783722
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011054037.4A Pending CN112094922A (en) | 2020-09-29 | 2020-09-29 | Detection and identification method for echinococcus nudus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112094922A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005208A (en) * | 2021-04-30 | 2021-06-22 | 南京大学 | Universal macro-barcode amplification primer for mollusks and application method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006296328A (en) * | 2005-04-22 | 2006-11-02 | National Fisheries Univ | Method for discriminating species and/or genealogy of aquatic animal |
| WO2009095729A1 (en) * | 2008-01-30 | 2009-08-06 | Parco Tecnologico Padano Srl | Methods for the detection and quantification of nematode parasites in fish and fish products |
| CN106086167A (en) * | 2016-06-07 | 2016-11-09 | 江苏省海洋水产研究所 | A kind of Rapid identification Carnis Pseudosciaenae, Carnis Pseudosciaenae and the primer sequence of Collichthys lucidus and method |
-
2020
- 2020-09-29 CN CN202011054037.4A patent/CN112094922A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006296328A (en) * | 2005-04-22 | 2006-11-02 | National Fisheries Univ | Method for discriminating species and/or genealogy of aquatic animal |
| WO2009095729A1 (en) * | 2008-01-30 | 2009-08-06 | Parco Tecnologico Padano Srl | Methods for the detection and quantification of nematode parasites in fish and fish products |
| CN106086167A (en) * | 2016-06-07 | 2016-11-09 | 江苏省海洋水产研究所 | A kind of Rapid identification Carnis Pseudosciaenae, Carnis Pseudosciaenae and the primer sequence of Collichthys lucidus and method |
Non-Patent Citations (1)
| Title |
|---|
| MENG TONG LEI ET AL.: "Prevalence and genetic diversity of Echinorhynchus gymnocyprii (Acanthocephala: Echinorhynchidae) in schizothoracine fishes (Cyprinidae: Schizothoracinae) in Qinghai Tibetan Plateau, China", 《PARASIT & VECTORS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005208A (en) * | 2021-04-30 | 2021-06-22 | 南京大学 | Universal macro-barcode amplification primer for mollusks and application method thereof |
| CN113005208B (en) * | 2021-04-30 | 2024-03-19 | 南京大学 | Universal macro-barcode amplification primer for mollusks and application method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Birkbeck et al. | Identification of Francisella sp. from Atlantic salmon, Salmo salar L., in Chile. | |
| CN112662787B (en) | PCR primer, kit and method for poultry sex identification | |
| CN105483261A (en) | Specific gene and molecular identification method of culicoides cyancus | |
| CN105543249A (en) | Culicoides bellulus specific gene and molecular identification method thereof | |
| CN112094922A (en) | Detection and identification method for echinococcus nudus | |
| CN105368948A (en) | Primer for sex identification of Nile tilapia and PCR (polymerase chain reaction) identification method | |
| CN105176980B (en) | A kind of multiple PCR method that can synchronously detect 7 kinds of fishes virus | |
| CN113151430A (en) | Penaeus chinensis female specific primer and application thereof | |
| CN112746070A (en) | Primer pair and kit for early sex identification of chicken and application of primer pair and kit | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN110607376A (en) | Patinopecten yessoensis living body sex identification method based on DNA molecular marker | |
| CN112029873A (en) | Detection and identification method of new echinococcus | |
| Rakhshandehroo et al. | An investigation on the helminth parasites of Caspian turtle (Mauremys caspica) with a taxonomic note on recovered Falcaustra Lane, 1915 (Nematoda: Kathlaniidae) and Spiroxys Schneider, 1866 species (Nematoda: Gnathostomatidae) | |
| CN109988870B (en) | Triple fluorescence PCR detection kit for shrimp mortem nodavirus, blood cell iridovirus and nodavirus and application thereof | |
| CN110396552B (en) | Molecular marker, primer and method for identifying pseudocercospora fusca based on PCR | |
| CN112695101A (en) | Method for identifying early sex of quail, matched kit and special primer pair | |
| CN112029874A (en) | Method for detecting and identifying caenorhabditis elegans | |
| CN113699224A (en) | Molecular marker C2 for sex identification of Chinese prawn and application thereof | |
| Kurihara et al. | Avipoxvirus infection in two captive Japanese cormorants (Phalacrocorax capillatus) | |
| Mirzazadeh et al. | Atypical manifestation of cutaneous fowlpox in broiler chickens associated with high condemnation at a processing plant | |
| CN114045347B (en) | PCR primer, kit and method for sex identification of special poultry | |
| KR20130095593A (en) | A primer for scuticociliate and a method for detecting scuticociliate using the same | |
| CN112501331B (en) | Identification method and identification product for octopus parasites | |
| CN116334231A (en) | Detection and identification method for Tibetan fish parasitic caenorhabditis elegans | |
| Nielsen et al. | Comparative analysis of 18S rRNA genes from Myxobolus aeglefini Auerbach, 1906 isolated from cod (Gadus morhua), plaice (Pleuronectes platessa) and dab (Limanda limanda), using PCR-RFLP |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |