EP2217708A1

EP2217708A1 - Maize with increased tolerance to fungal diseases

Info

Publication number: EP2217708A1
Application number: EP08853030A
Authority: EP
Inventors: Alain Murigneux; Jean-Pierre Martinant; Christophe Tatout; Bruno Grezes-Besset
Original assignee: Biogemma SAS
Current assignee: Biogemma SAS
Priority date: 2007-11-22
Filing date: 2008-11-19
Publication date: 2010-08-18
Also published as: WO2009065863A1; US20110252500A1; CA2709720C; CA2709720A1; FR2923985B1; FR2923985A1; AR069406A1; US8686231B2; AU2008327938B2; ZA201004395B; AU2008327938A1

Abstract

The present invention relates to the field of improving the digestibility of maize and the tolerance of maize to fungal pathogens, and in particular to Fusarium disease, by introgression of the G2092 allele.

Description

BUT WITH INCREASED TOLERANCE TO DISEASES

FUNGAL

The present invention relates to the field of maize improvement, in particular the improvement of maize digestibility, and the tolerance of maize to fungal pathogens and in particular to Fusarium wilt.

The present invention more specifically relates to the development of a particular allele of the CCoAOMT2 gene in corn. The presence of this allele results in an improvement of the digestibility (increased digestibility) and the tolerance to Fusarium wilt compared to an isogenic corn that does not have the allele.

The amount of lignin present in the plant is also decreased.

Lignin is one of the two major components of the plant wall with cellulose. The plant wall consisting mainly of cellulose, hemicellulose and lignin provides the cell a natural barrier against the outside. Many studies have shown that one of the responses to biotic stresses (pathogenic attacks) or abiotic (drought, wind ...) consists of a reinforcement of the plant wall, in particular with a higher lignin content. In addition, many agronomic or industrial sectors have their yields directly related to the lignin content and / or composition of the wall, including the paper industry, fuel production (notably biomass for biofuels) or production. silage.

For example, the quality of silage corn can be improved by lowering the lignin content or modifying the composition. Corn silage is an interesting feed: the yield in the field is relatively high, harvesting and storage are easy, the nutritional qualities are stable and can easily be supplemented with other feed silages or feedcakes. soy. An experiment conducted by Emile (1995, Annales de zootechnie) shows that feeding livestock with a more digestible corn can increase daily milk production and weight gain compared to a diet with a less digestible corn. Optimizing the qualities of corn silage thus to increase the net energy provided by this type of diet by improving its digestibility and thus by decreasing the lignin content.

Thus, the selection or obtaining of more digestible maize plants, in particular with modified lignin biosynthesis pathway is one of the preferred axes of improvement of maize. However, the selected plants should have good yields and be insensitive to the various stresses

(mechanical, hydric ...).

In addition, maize is subject to attack by many pathogens. Among these, we can mention viruses, bacteria, but also fungal pathogens, responsible for many diseases, and sometimes the presence of mycotoxins.

Thus, maize can be attacked by fungi responsible for fusariosis (due to Fusarium, including F. roseum, F. gramninearum, F. liseola, F. monoliform), coal (common or inflorescences, from to Ustilago zeae, Ustilago maydis), anthracnose (Colletotrichum graminicold), kabatiellosis, helminthosporiosis (Helminthosporium turcicum), rust (Puccinia maydis), late blight. In general, fungal attacks are responsible for drying and / or rotten plants, which are localized differently depending on the pathogen. Mushrooms of the genus Fusarium are responsible for Fusarium wilt. F. graminearum species and F. moniliforme maize pathogens, the importance of which varies with climatic conditions and the early maturity of maize varieties. Fusarium head blight can be distinguished from Fusarium wilt, the infectious processes being very different. Some pathogens, however, are common to both types of Fusarium. Several modes of contamination of the plant by the fungus are known, such as the penetration of infective mycelium into the plant by lesions due to insects and birds, or the direct penetration of the bristles of the spike leading to infection. seeds. In the case of Fusarium wilt, contamination can also occur via seeds or, more rarely, roots.

Fusarium head blight, which causes grain destruction, reduces the yield of corn crops. The pathogens in question are otherwise very damaging because they accumulate in kernels destroyed or not different mycotoxins (Zearalenone, Deoxynivalenol, Fumonisins), which have varying levels of toxicity depending on the animal species and are difficult to eliminate. Fungicide treatments are difficult to use and have only a limited effect against Fusarium. The best way to fight Fusarium head blight is the use of genetic resistance. Few hybrids currently possess such resistance, which, when it exists, is a partial resistance that remains moderate. It is therefore important to identify methods to increase fungal disease tolerance in maize.

The present application shows that the presence of the G2092 allele of the CCoAOMT2 corn gene makes it possible to obtain a corn that is both more digestible and has a better tolerance to fungal diseases, and in particular Fusarium wilt. This maize is also resistant to fungal diseases caused by fungal pathogens such as those described above.

The G2092 allele is an insertion mutant in the CCoAOMT2 gene of the phenylpropanoid pathway, and more particularly the lignin biosynthesis pathway. This pathway of phenylpropanoids leads, from phenylalanine, to the synthesis of a wide variety of substances such as anthocyanins, isoflavonoids, stilbenes, esters of hydroxycinnamic acids, or lignin. Lignin provides rigidity to cell walls and impermeability to conductive tissue.

Caffeoyl Coenzyme-A O-Methyl Transferase (CCoAOMT) is an important enzyme in the biosynthesis pathway of monolignols and more particularly G subunits. CCoAOMT appears to be involved in several steps of the lignin biosynthesis pathway. Thus, it would be involved in an alternative pathway of methylation of lignin biosynthesis in zinnia, and the CCoAOMT-mediated methylation pathway would likely be general pathways of lignin biosynthesis during plant growth and development.

In corn, two genes code for CCoAOMT: the CCoAOMTl gene (GenBank AJ242980), located on chromosome 6 and the CCoAOMT2 gene (GenBank AJ242981, SEQ ID No. 2), located on chromosome 9.

Patent applications WO9910498 and WOO134817 relate, inter alia, to the corn CCoAOMT1 gene.

In the application WO 03/054229, the inventors have demonstrated the colocalization of the gene CCoAOMT2, located on chromosome 9, with a QTL of digestibility and a QTL of lignin content of the walls. They further identified mutations in the CCoAOMT2 gene creating polymorphic alleles associated with corn digestibility. The use of CCoAOMT2 allelic variation to control the digestibility of corn silage is also described in Guillet-Claude et al. (Theor Appl Genet, 2004 Dec, 10 (1): 126-35).

The purpose of the present application is to provide a skilled artisan with corn that does have improved digestibility and increased tolerance to fungal pathogens by developing a favorable allele of CCoAOMT2 (referred to as G2092). insertion of a transposon having been carried out after nucleotide 1186 in the gene represented by SEQ ID No. 1, which corresponds to the genomic DNA for this enzyme. The application also describes a method for obtaining a corn having increased tolerance to a fungal pathogen, comprising introgressing the G2092 allele thus identified in said corn.

The sequence of a cDNA (GenBank AJ24981) is represented by SEQ ID NO: 2, the coding portion extending from nucleotides 70 to 865 for this sequence. It is clear that these sequences are given only as examples, and that the skilled person is able to identify himself the genomic and / or mRNA sequences of CCoAOMT2 for different varieties of corn. , especially in the GenBank database (sequences AY279004 to AY279035) or in Guillet-Claude et al (2004, op.cit.) The corn according to the invention has a quantitative and / or qualitative alteration of lignin synthesis, as well as a better tolerance to fungal pathogens.

By "quantitative alteration of the lignin synthesis" is meant a decrease in the amount of lignin in the modified maize according to the invention compared to a normal maize (unmodified control according to the invention), evaluated, for example by measuring Klason lignin or lignin obtained by acid detergent (lignin detergent acid) according to methods well known in the art (see for example Jung et al., J. Agric Food Chem., 1999 May; 47 (5): 2005-8 Jung et al., J. Dairy Sci., 1997 Aug; 80 (8): 1622-8).

By "qualitative alteration of the lignin synthesis" is meant a modification in the composition of the lignin of the plant modified according to the invention with respect to a control plant (not modified according to the invention), for example a variation of ratio of subunits S / G, or a change in the quality of ferulic acid. Methods for qualitative analysis of lignin are also known in the art. We can notably mention the NMR.

Among the fungal pathogens, we can cite in particular the genus

Fusarium, preferentially selected from F. graminearum, F. liseola, F. rosum and

F. monoliform. Maize also has a tolerance to the other fungal pathogens mentioned above, and in particular to pathogens of the genus

Helminthosporium, in particular H. turcicum.

Seeds with the G2092 allele were deposited at NCIMB Limited, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, Scotland, AB21 9YA, UK, on November 14, 2007, under the provisions of the Budapest Treaty, under the number NCIMB 41518.

The invention particularly relates to a corn plant, or a corn kernel having said G2092 allele.

The invention also relates to a maize or maize grain having both the G2092 allele and an allele of the CCR1 gene, designated Δ3318, said Δ3318 allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41236 on 23 July 2004, in accordance with the provisions of the Treaty of Budapest. This Δ3318 allele is described in application WO 2006/035045.

The invention also relates to a maize or maize grain having both the G2092 allele and an allele of the C4H gene, designated D1938, said D1938 allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41507 on 15 October 2007, in accordance with the provisions of the Treaty of

Budapest.

The invention also relates to a maize or maize grain having both the G2092 allele, the CCR1 gene allele designated Δ3318 and the C4H gene allele designated D1938.

Preferably, the corn according to the invention is an "elite" corn. Those skilled in the art are familiar with the definition of elite maize. Elite maize is corn intended to produce hybrids intended to be marketed by crossing with another elite maize. An elite maize is defined as such in relation to the territory envisaged for marketing, as well as the agronomic character (s) sought for hybrid offspring. This includes a corn that can be included in a reference catalog.

Thus, depending on whether the offspring is intended for human or animal consumption, for example a grain yield or a yield per hectare and a good digestibility, respectively, when the "elite maize" nature is evaluated.

In order to determine the elite character of a maize, hybrids obtained from it are compared to commercial reference hybrids (sold for the same purpose in the same region), field trials, survey surveys, and control measures. agronomic traits appropriate to the objective sought. A corn is defined as elite if the results obtained parameters studied for a hybrid obtained by crossing said maize are greater than 90% to the results recorded for the same parameters of the reference hybrids.

Thus, an elite maize is a corn gathering the maximum of agronomic characteristics necessary for an economic penetration of the target market. As the maize market is now a hybrid market, character evaluation Maize elite is also achieved by the ability of the maize to combine / produce hybrids.

Thus, the present invention relates preferentially to an elite corn intended for the marketing of hybrids for animal feed and silage, presenting the G2092 allele. This elite maize is homozygous for Pallèle G2092.

In another embodiment, the invention relates to a hybrid maize obtained by crossing two homozygous parent lines, said hybrid maize having a G2092 allele. This hybrid maize can be homozygous (if each homozygous parent has the G2092 allele) or heterozygous for the G2092 allele.

The invention also relates to corn or maize grain containing one or more transgenes in addition to the G2092 allele. Mention may be made of transgenes conferring male sterility, male fertility, resistance to a herbicide (in particular glyphosate, glufosinate, imidazolinone, sulfonylurea, L-phosphinotricin, triazine, benzonitrile), insect resistance (especially a transgene encoding a Bacillus thuήngiensis toxin), tolerance to water stress. These maize can be obtained by crossing a corn containing the G2092 allele with a corn containing said transgene. The implementation of backcrossing followed by self-fertilization produces an elite maize homozygous for the G2092 allele and the trangene. However, a hybrid corn containing both the G2092 allele and the transgene is also within the scope of the invention.

The present invention also provides those skilled in the art with the means to select corn plants having improved fungal pathogen tolerance characteristics. It suffices to carry out a PCR, or a Southern blot (genomic DNA hybridization on membrane) to monitor the presence of the insertion in the last exon of the gene coding for CCoAOMT2. Those skilled in the art can easily determine the primers and probes for identifying the presence of the G2092 allele. The invention thus also relates to a method for monitoring the G2092 allele, by molecular biology techniques, and in particular via PCR using the primers mentioned in the examples. The invention is also the subject of a process for obtaining corn plants having a tolerance to fungal pathogens improved with Pallele G2092.

The invention also relates to a method for obtaining a corn line with a better tolerance to fungal diseases, including the step of introgression of the G2092 allele, in a reference line, having a quality agronomic character. The introgression of the character is notably carried out by selection, according to methods known in the art (crosses and selfing). Plants are selected in particular using molecular markers.

The principle is recalled below:

A series of backcrosses is performed between the elite line and the line carrying the G2092 allele.

During backcrossing, individuals carrying the G2092 allele can be selected, and recombining the smallest fragment of the donor line around this allele. Indeed, thanks to the molecular markers, one selects the individuals having for the markers close to the gene, the genotype of the elite line.

In addition, it is also possible to accelerate the return to the elite parent through molecular markers distributed throughout the genome. At each backcross, the individuals with the most fragments from the recurrent elite parent will be selected.

With good implementation, from the fourth generation, it is possible to obtain an almost isogenic line of the elite line, that is to say identical to the original elite line, but having integrated the locus carrying the G2092 allele. In a first embodiment of the invention, for maize, it relates to a method for obtaining a maize with a tolerance to fungal pathogens, comprising: a) crossing a first maize line having the G2092 allele; with a second corn line not having said allele, b) genotyping the obtained offspring and selecting the progeny with the G2092 allele having the best genome ratio for said second line, c) backcrossing said descendants with said second corn line, d) repeating steps b) and c) if necessary until an isogenic line of said second corn line, having the G2092 allele, e) is obtained. optional, perform a self-fertilization to obtain a homozygous plant for the G2092 allele.

In another embodiment, the invention relates to a method for obtaining corn having increased digestibility, comprising introgressing the G2092 allele in said maize, comprising the steps of: a) crossing a first line of maize having the G2092 allele with a second maize not having said allele, b) genotyping the obtained progeny and selecting the progeny with the G2092 allele, and having the best genome ratio for said second maize, c ) backcrossing said descendants with said second elite corn line usable for the production of hybrids, d) repeating if necessary steps b) and c) until obtaining an isogenic line of said second maize, having the G2092 allele, e) optionally, perform a self-fertilization to obtain a homozygous plant for the G2092 allele.

The genotyping of step b) is preferably carried out using molecular markers (microsatellite markers for example), making it possible to define the share of each of the two parents in the offspring. Maize, which has the appropriate genetic character with respect to the G2092 allele, conventionally selected by molecular biology methods (such as PCR or Southern Blot) is also selected in the offspring.

The increased tolerance and / or digestibility of maize according to the present invention are relative to a quasi-isogenic corn not including the G2092 allele.

Surprisingly, it has been shown that the repetition of backcrosses between the lines selected in step b) and the second maize makes it possible to obtain the appearance of a much more marked phenotype within said second maize. Moreover, it is surprising to observe such a phenotype while the insertion is located in the stop codon of the gene coding for CCoAOMT2, and that the protein should thus be produced and operational.

The invention also relates to a method in which the Δ3318 allele is also introgressed in maize in which the G2092 allele is introgressed. Introgression of Δ3318 is in particular carried out according to the teachings of WO 2006/035045, using in particular the primers described in the examples of this application.

The introgression of the D 1938 allele can also be considered in parallel with the introgression of the G2092 allele or both G2092 and D 1938 alleles. Moreover, the agronomic results observed after multiple backcrossings (5 backcrosses and 2 self-fertilization) show no difference between the isogenic lines with the mutation and the control plants.

Finally, the invention relates to the use of a maize according to the invention, for the preparation of a composition intended for animal feed, to a method for the preparation of a composition intended for animal feed comprising the ensilage of a corn according to the invention, as well as the composition intended for animal feed, thus obtained. In particular, said corn is particularly useful for feeding livestock.

DESCRIPTION OF THE FIGURES

Figure 1: Schematic representation of the insertion of the transposable element

Mutator in the last exon of the CCoAOMT2 gene. The gray blocks correspond to the exons, the lines correspond to the introns.

EXAMPLES

Example 1. Identification of a corn having an insertion in the gene

CCoAOMT2

A corn line having an insertion of a transposable element at position 1186 of the reference sequence SEQ ID No. 1 is isolated (FIG. 1). The allele thus obtained is called G2092. The insertion of the transposable element is in the TGA triplet (coding for the stop codon of the CCoAOMT2 protein) in the last exon of the CCoAOMT2 gene (FIG. 1). This insertion may affect the conformation and / or stability of the mRNA. In order to determine whether the insertion is in homozygous or heterozygous form, a pair of primers has been defined: CCoA2-intspé-21 sense primer of sequence SEQ ID No. 3: GACCTCGTGGCGGACAAG and an antisense primer CCoA2_16 of sequence SEQ ID No. 4: CCAAGAAAGAGCCAGAGCCG.

In addition to these two primers the OMuA primer (SEQ ID No. 5): CTTCGTCCATAATGGCAATTATCTC specific endogenous transposable element is used. This primer is directed towards the end of the transposon.

These three primers can be used simultaneously in a PCR amplification experiment from genomic DNA (Hybridization temperature = 58 ° C.). The gel deposition of the amplification products reveals: the obtaining of a single band about 500 bp long for so-called wild plants at this locus (ie not having the mutation);

obtaining two bands of approximately 200 bp and 400 bp for mutant homozygous plants, corresponding to the amplifications obtained with the primers present in the gene and in the transposon (because of the insertion, the amplification with the primers CCoA2-intspé-21 and CCoA2_16 is impossible because too long);

or obtaining all three bands for heterozygous plants.

Example 2: Phenotypic analysis of mutant G2092 for resistance to fungal diseases

A homozygous mutant plant and a wild-type homozygous control are available for each insertion event. Given the advanced stages of introgression of the mutation, the mutant and the wild can be considered to differ only in the presence or absence of the mutation. The experiment is carried out according to the following protocol: • 2 places • 3 repetitions per place

• Artificial inoculation of Fusarium monoliforme

• Notation of symptoms observed on the ears (score from 1 to 7). It is a visual notation of the intensity of attack on the ears: the attack intensity score is calculated from the percentage of the surface of the epic attacked by the pathogen (Reid et alAgriculture and Agri- Food Canada, Ottawa, ON Technical Bulletin 1996-5E 40 pp). The notes correspond to: 1 = 0% attacked; 2 = 1-3%; 3 = 4-10%; 4 = 11-25%; 5 = 26-50%; 6 = 51-75%; 7 = 76-100%.

• Possibly dosing of mycotoxins (fumonisins)

In the examples below, the "place" repetitions have been converted to "simple repetitions" in order to perform a simple statistical analysis. Statistical analysis was performed on each mutant to determine whether there is a difference between mutant (M) and wild-type or control (S). The results demonstrate that insertion of a transposon into the CCoAOMT2 gene involved in the pathway of phenylpropanoid and lignin metabolism increases tolerance to Fusarium monoliform infection. This effect is reproducible according to the places of culture. Mutant G2092 CCoAOMT2

* statistically significant difference.

Mutant more resistant than wild; moderate effect

Example 3: Phenotypic analysis of the mutant G2092 for digestibility In order to study more precisely the effect of the insertion observed in the CCoAOMT2 gene in an elite maize, successive backcrosses are carried out with an elite line of maize.

This method makes it possible very quickly to obtain quasi-isogenic lines differing only in the locus carrying the modified Pallele, the descendants being tested to have a ratio genome as close as possible to that of the elite parent while having the allele that one wants to introgress. These tests are assisted by molecular markers (well known techniques, microsatellites, AFLP ...). To try to appreciate the effect of the insertion at the earliest (obtaining homozygous plants), self fertilizations are carried out at the different intermediate stages of backcross.

The introgression of the G2092 allele makes it possible to obtain a decrease in the amount of lignin (Lignin Acid Detergent) after wall isolation (Neutral Detergent Fibers), according to the methods known to those skilled in the art.

Example 4 Use of the G2092 Allele in Varietal Selection

The G2092 allele is used in varietal selection. The genetic mixing between the resistant variety and varieties with other agronomic qualities such as high yields, high protein content, resistance to standing germination, allows selection of new varieties including all desired characters. The G2092 allele conferring resistance to Fusarium wilt is followed by molecular labeling during this varietal selection process.

This varietal selection scheme may also include selection of varieties also comprising the allele of the CCR1 gene, designated Δ3318, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41236 and / or, an allele of the gene C4H, designated D1938, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41507.

Claims

claims

A corn having an allele of the CCoAOMT2 gene, designated G2092, comprising an insertion of a transposon into the last exon of the CCoAOMT2 gene, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41518.

2. Corn according to claim 1, characterized in that it also comprises an allele of the CCR1 gene, called Δ3318, said allele being present in a representative sample of seeds deposited at the NCIMB under the number

NCIMB 41236 and / or, an allele of the C4H gene, designated D 1938, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41507.

3. Corn grain having an allele of the CCoAOMT2 gene, designated G2092 comprising an insertion of a transposon into the last exon of said gene, said allele being present in seeds deposited at NCIMB under the number NCIMB 41518.

Corn grain according to claim 3, characterized in that it also comprises an allele of the CCR1 gene, called Δ3318, said allele being present in a representative sample of seeds deposited at the NCIMB under the number NCIMB 41236 and / or, a allele of the C4H gene, designated D1938, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41507.

5. A method for obtaining a corn having increased tolerance to a fungal pathogen, comprising introgressing the G2092 allele of the CCoAOMT2 gene, present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41518, in said corn, comprising the steps of: a) cross a first maize line presenting the G2092 allele with a second maize that does not have said allele, b) perform a genotyping of the obtained progeny and select the progeny with the G2092 allele, and having the best genome ratio for this which is said second maize, c) backcrossing said descendants with said second elite maize line usable for the production of hybrids, d) if necessary repeat steps b) and c) to obtain an isogenic line of said second maize , presenting the G2092 allele, e) optionally, perform self-fertilization to obtain a homozygous plant for the G2092 allele.

A method for obtaining corn having increased digestibility, comprising introgressing the G2092 allele of the CCoAOMT2 gene, present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41518, in said corn, comprising the steps of : a) cross a first maize line with the G2092 allele with a second maize that does not have the said allele, b) perform a genotyping of the obtained progeny and select the progeny with the G2092 allele, and with the best genome ratio for what is said second maize, c) backcrossing said descendants with said second elite maize line usable for the production of hybrids, d) repeating if necessary steps b) and c) to obtain an isogenic line of said second maize maize, presenting the G2092 allele, e) optionally, perform self-fertilization to obtain a homozygous plant for the allele G2092.

7. Method according to claim 5, characterized in that said fungal pathogen is of the genus Fusarium.

8. Method according to one of claims 5 to 7, also comprising the introgression of Δ3318 Pallèle CCRl gene, present in a representative sample of NCIMB deposited seed under the number NCIMB 41236, and / or the allele D 1938 of the C4H gene, present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41507, in said corn.

9. Use of a maize according to claim 1 or 2 for the preparation of a composition for animal feed.

A method for the preparation of a feed composition comprising corn silage according to claim 1 or 2.