EP2547772A1

EP2547772A1 - Method for modifying the blooming date of a plant

Info

Publication number: EP2547772A1
Application number: EP11708284A
Authority: EP
Inventors: Jean-Pierre Martinant; Christophe Tatout
Original assignee: Genoplante Valor SAS; Biogemma SAS
Current assignee: Genoplante Valor SAS; Biogemma SAS
Priority date: 2010-03-16
Filing date: 2011-03-15
Publication date: 2013-01-23
Also published as: US20130198892A1; EP2366791A1; WO2011113839A1; CA2793131A1

Abstract

The present invention applies to the field of plant improvements, in particular to the modification of the blooming date thereof, by manipulation of the Prec31 gene.

Description

METHOD FOR MODIFYING FLOWERING DATE OF A PLANT

The present invention relates to the field of plant breeding, in particular the modification of their date of flowering.

The development of plants is composed of a vegetative phase and a reproduction phase. Flowering represents the transition between these two phases.

Flowering is thus an essential event in the life cycle of plants and is of great importance for the selection of plants adapted to their environment.

The flowering date of a plant reflects its ability to adapt to its environment and especially to climatic conditions, and external stress.

Corn has a male organ and a female organ, which bloom asynchronously.

A large number of environmental cues (such as day length, temperature (vernalization), availability of nutrients, water or phytohormones) control the transition between vegetative and reproductive phases, and are therefore likely to influence the flowering date.

The flowering date of corn is also influenced by different genetic factors. Thus, Buckler et al (Science, 2009, 325, p 714-718) describe the identification of maize chromosomal regions (QTLs for Quantitative Trait Loci) influencing the flowering of these plants. These regions have been identified using a large population of plants. The authors point out that the differences observed between inbred lines are not caused by a few genes having a significant effect, but rather by the cumulative effect of several QTLs. Thus, the identified QTLs have rather minor effects (at most 1, 5 days of precocification.

In fact, there are at least 80 flowering genes in Arabidopsis (see Blazquez et al 2001 (EMBO Rep. 2001 Dec; 2 (12): 1078-82). The number of orthologues of these genes in maize is very important. Thus, Buckler et al. discuss 1000 Arabidopsis flowering genes with homologs in corn.

Different documents have described the identification of genes involved in flowering in other species. WO 2006/068432, which describes the genes OsMADS50, OsMADS51, OsMADS56, OsMADS14 (truncated), OsTRXI, OsVIN2, OsCOL.4, and OsCOL8. These different genes show an effect on the rice, autogamous plant. The inventors of the previous application have then studied in more detail the role of OsMADS51 (Kim et al., Plant Physiol., 2007 Dec; 145 (4): 1484-94), confirming the effects reported in WO 2006/068432, and specifying a genetic sequence (architecture) of flowering in rice.

The inventors have identified a gene coding for a protein which will be designated as Prec31 in the present application, and whose amino acid sequence is represented by SEQ ID No. 1.

In maize, a mutant in the gene encoding this protein has an early male and female flowering date compared to the non-mutant, non-mutant plant.

The present invention thus relates to a method for advancing the date of flowering of a plant, characterized in that the expression and / or the activity in said plant of a protein called Prec31 is totally or partially inhibited. whose polypeptide sequence has at least 75% identity with the sequence SEQ ID No. 1. For the purposes of this description, comparators

(advance of flowering date, earlier or later flowering date) are relative to quasi-isogenic plants, except for the purpose of the invention (inhibition of Prec31, presence of a mutation or a transgene for inhibiting Prec31). An almost isogenic plant has a genome at least 95% identical to the genome of the plant that is the subject of the invention, except for the presence of the Prec31 inhibiting elements. A quasi- isogenic line can be obtained by backcrossing the plant object of the invention with the line with which it is desired to establish the comparison.

The principle is recalled below: A series of backcrosses is performed between the line with which it is desired to make a comparison and the line bearing the Prec31 inhibiting element (s).

During backcrossing, individuals carrying Prec31 inhibitory element (s) can be selected, and recombining the smallest fragment of the donor line around this transgene. Indeed, thanks to the molecular markers, one selects the individuals having for the markers close to the gene, the genotype of the elite line. In addition, it is also possible to accelerate the return to the elite parent through molecular markers distributed throughout the genome. At each backcross, the individuals with the most fragments from the recurrent elite parent will be selected.

With a good implementation, from the fourth generation, it is possible to obtain an almost isogenic line of the elite line, that is to say identical to the original elite line, but having integrated the element (s) inhibiting Prec31. The integrated fragment carries the Prec31 inhibitory element (s), as well as any flanking chromosomal regions derived from the starter corn (especially the well-known A188 or Hi-11 lines used for transformation, when evaluated. the effect of a transgene in corn).

Said plant is in particular maize, rice, sorghum, millet, wheat and other straw cereals, or a forage plant.

Pr31 is defined herein as any protein whose polypeptide sequence has at least 75%, preferably at least 85%, or at least 90%, advantageously at least 94%, and most preferably at least 95%, more preferably at least 97% identity with the sequence SEQ ID No. 1 on a widest comparison window possible, corresponding preferably to the entire sequence SEQ ID No. 1. Unless stated otherwise, the percentages of identity shown here are established using the BLAST2 software (ALTSCHUL et al., Nucleic Acids Res., 25, 3389-3402, 1997) using the default parameters (BLOSUM62 matrix for protein comparisons, with penalties of 1 1 for an open gap, 1 for an expansion gap, 50 for a x_dropoff gap, a random wait value of 10, a word size (word size) of 3, and no filter).

Total or partial inhibition of the expression and / or activity of the Prec31 protein can be achieved in a variety of ways known to those skilled in the art.

Preferably, the expression of the gene coding for Prec31 is reduced by mutagenesis or by inhibition or modification of its transcription or translation.

The Prec31 gene is understood to include the coding and non-coding regions (5 'or 3' untranslated regions, introns) of the gene.

Mutagenesis of the gene coding for Prec31 can occur at the level of the coding sequence or expression regulation sequences, in particular promoter, or 3 'untranslated region (3'UTR). For example, it is possible to delete all or part of said gene and / or to insert an exogenous sequence. By way of example, mention may be made of insertional mutagenesis: a large number of individuals derived from an active plant for the transposition of a transposable element (AC element or Mutator in maize) are produced and selected by for example by PCR, plants in which an insertion was carried out in the Prec31 gene, or in the vicinity with consequent effect on translation or expression.

Any other method known in the art may also be used to inhibit the gene encoding Prec31. Thus, one can proceed to the mutation of the genes by insertion of a transposable element or a transfer DNA (T-DNA). Physical or chemical mutagenesis can also be carried out, especially by the use of EMS, X-rays or ultraviolet (see in particular McCallum et al., Plant Physiol., 123, 439-442, 2000). The mutations of interest have the consequence of shifting the reading frame and / or of introducing a stop codon into the sequence and / or of modifying the level of transcription and / or translation of the gene and / or of making the enzyme less active than the wild-type protein.

The plants thus mutated are screened for example by PCR, using primers located in the target gene. However, other screening methods, such as Southern blots or AIMS screening described in WO 99/27085 (for detecting insertions) can also be used, using probes specific for the target genes, or methods of screening. detection of point mutations or small insertions / deletions using particular endonucleases (Cel I, Endo I) as described in WO 2006/010646.

In another embodiment, the inhibition is achieved by transforming the plant with a vector containing a sense or antisense construct of the target gene. These two methods are known to allow, under certain conditions, the inhibition of the target gene. The method of RNA interference (RNAi) is also used which is particularly effective for the extinction of genes in plants. This method is well known to those skilled in the art and consists of transforming the plant with a construct producing, after transcription, a double-stranded duplex of RNA, one of whose strands is complementary to the mRNA of the gene. target (for review on post-transcriptional inhibition techniques, Chicas and Macino, EMBO reports, 21 (1 1), 992-996,2001, for review of the use of interfering RNAs, Hannon, Nature, 418,244-251 , 2002). The present invention thus particularly relates to the use of at least one polynucleotide chosen from:

a) a polynucleotide encoding a Prec31 protein as defined above;

b) a polynucleotide complementary to a polynucleotide a) above; c) a fragment of at least 12 consecutive nucleotides, a polynucleotide a) or b) above, or capable of hybridizing selectively with said polynucleotide;

d) a polynucleotide allowing the production of a duplex that can be used for the interference of RNA (RNAi), said polynucleotide containing a polynucleotide X containing at least 12 nucleotides, preferably at least 15, advantageously at least 20, and at least 50 nucleotides capable of selectively hybridizing with a polynucleotide defined in a) and a complementary polynucleotide Y of said polynucleotide X

to obtain a plant with an earlier flowering date.

A polynucleotide encoding Prec31 is a polynucleotide containing the genetic information for the synthesis of the Prec31 protein represented by SEQ ID No. 1, or a protein having at least 75%, preferably at least 85%, or at least 90%. %, advantageously at least 94%, and most preferably at least 95%, more preferably at least 97% identity with SEQ ID No. 1.

This includes in particular genomic DNA, whose sequence SEQ ID No. 2 represented in the appendix represents an allele, as well as the corresponding cDNA (SEQ ID No. 3). The coding portion comprises nucleotides 979-1674, 4667-4948 and 5712-5831 (STOP codon included) of SEQ ID NO: 2

A specific fragment of polynucleotide a) or b) above is a fragment of said polynucleotide whose sequence is not found in other genes of the same plant.

A polynucleotide capable of hybridizing selectively with polynucleotide a) or b) above, is a polynucleotide which when hybridized under stringent conditions with a nucleic acid library of the same plant (especially a DNA library genomic, or cDNA) produces a detectable hybridization signal at least 2 times higher, and preferably at least 5 times higher than the background with said polynucleotide, but produces no detectable signal with other sequences of said bank.

Those skilled in the art are able to define the stringency of the hybridization conditions, which depend on the size and base composition of the polynucleotide concerned, as well as the composition of the hybridization mixture (in particular pH and ionic strength). Generally, stringent conditions, for a polynucleotide of given size and sequence, are obtained by operating at a temperature of about 5 ° C. to 10 ° C. below the melting point (Tm) of the hybrid formed, same reaction mixture, with this polynucleotide and its complement.

The present invention relates in particular to a method for advancing the date of flowering of a plant, by total or partial inhibition of the endogenous prec31 protein of said plant, comprising the transformation of said plant with a recombinant DNA construct comprising a polynucleotide as defined above, placed in direction orientation or antisense orientation, or can be transcribed into double-stranded RNA, under transcriptional control of a suitable promoter.

The invention also relates to a method for delaying the flowering date of a plant by overexpressing a Prec31 protein in said plant. This overexpression is achieved by transformation of said plant with a recombinant DNA construct comprising a polynucleotide as defined above under transcriptional control of a suitable promoter. The transgenic plants thus obtained are also the subject of the invention.

The present invention also relates to recombinant DNA constructs comprising a polynucleotide as defined above. These constructs are in particular expression cassettes, comprising a polynucleotide as defined above, under transcriptional control of a suitable promoter. These expression cassettes may also contain other regulatory elements, in particular transcriptional regulatory elements such as terminators, amplifiers.

Recombinant vectors which comprise polynucleotides as defined according to the invention or an expression cassette according to the invention are also objects of the invention. Such vectors may also comprise other elements, for example one or more selection markers, and may especially be used for obtaining transgenic plants.

As non-limiting examples of promoters that may be used in the context of the present invention, mention may be made of the constitutive promoters, such as the 35S promoter of cauliflower mosaic virus (CaMV), or its derivatives, the promoter Cassava vein mosaic virus (CsVMV) (WO 97/48819), ubiquitin promoter or actin-intron-actin promoter, rice (McEIroy et al., Mol. Gen. Genet., 231, 150-160, 1991; GenBank S 44221).

Inducible or tissue-specific promoters can also be used. This allows to induce the inhibition of Prec31 only at certain stages of the plant's development, under certain environmental conditions, or in certain target tissues, such as, for example, stems, leaves, seeds, spathes, the cortex or xylem.

Advantageously, other transcriptional regulatory elements such as terminators, and in particular the 3'NOS terminator of nopaline synthase (Depicker et al., J. Mol Appl. Genet., 1, 561 -573, 1982 ), or the 3'CaMV terminator (Franck et al Cell, 21, 285-294, 1980, GenBank V00141).

The marker genes of selection that may be used in the context of the present invention are, in particular, genes conferring resistance to an antibiotic such as hygromycin, kanamycin, bleomycin or streptomycin, or to a herbicide (EP 0 242 246) such as glufosinate, glyphosate or bromoxynil. The nptll gene which confers resistance to kanamyine can thus be used.

Plant transformation can be carried out by many methods, known in themselves to those skilled in the art.

For example, it is possible to transform plant cells, protoplasts or explants, and to regenerate an entire plant from the transformed material. The transformation can thus be carried out by transfer of the vectors according to the invention into protoplasts, in particular after incubation of the latter in a solution of polyethylene glycol (PG) in the presence of divalent cations (Ca 2+) according to the method described in the article. Krens et al. (Nature, 296, 72-74, 1982) or by electroporation notably according to the method described in the article by Fromm et al. (Nature, 319, 791-793, 1986). It is also possible to use a gene gun which can be used to project, at very high speed, metal particles covered with the DNA sequences of interest, thereby delivering genes inside the cell nucleus, in particular according to the technique described in article by Finer and al. (Plant Cell Report, 11, 323-328, 1992) or cytoplasmic or nuclear microinjection.

The method of transformation with Agrobacterium tumefaciens is preferably used, in particular according to the method described by Ishida et al. (1996, Nature Biotechnol 14, 745-50).

The subject of the present invention is also the plant cells and the transgenic or mutant plants that can be obtained by a process according to the invention, and the cells and plants containing a recombinant polynucleotide or an expression cassette as defined above. above. The invention also relates to the plant cells and plants obtained after mutation of the coding gene of Prec31 so that it results in an inhibition of the expression and / or the activity of the protein.

Of course, the present invention encompasses the plants derived from plants according to the invention, which are in particular the descendants, in particular the hybrids resulting from a cross involving at least one plant according to the invention, obtained by sowing or by vegetative propagation, of plants according to the invention or obtained directly or indirectly by a method according to the invention.

The invention also includes plant cells and tissues, as well as organs or parts of plants, including leaves, stems, roots, flowers, fruits, and / or seeds obtained from a plant according to the invention.

Preferably, the invention applies to corn and cells and tissues derived from corn. In particular, the invention relates to maize or maize grain having an allele of the Prec31 gene, termed delta-Prec31 comprising an insertion of a transposon in the 3 'untranslated region, 297 nucleotides after the STOP codon of the translated region, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41706.

Seeds with the delta-Prec31 allele were deposited at NCIMB Limited, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, Scotland, AB21 9YA, UK, on March 15, 2010, under the provisions of the Budapest Treaty, under the number NCIMB 41706. The present invention also relates to a method of selecting maize, or to a method of identifying maize that can be used in a selection scheme intended to obtain a maize having an early flowering date (earlier than the average date of flowering of the maize used in the selection scheme), characterized in that it comprises the search for an allele of the Prec31 gene having a mutation resulting in an anticipated flowering date of said corn, compared to a maize not having this allele. This process is directly related to the demonstration of the role of Prec31 in the early flowering date.

. In a preferred case, said mutation results in a total or partial inhibition of the expression and / or activity of Prec31.

Said allele can be searched by direct detection of the mutation responsible for the inhibition; it can also be sought by detecting the allelic form associated with this mutation of a polymorphism in linkage disequilibrium therewith.

These mutant alleles thus identified can then be introgressed in selected lines, and in particular in elite lines, namely lines with significant agronomic and commercial potential.

In a particular embodiment, a localized polymorphism is sought at nucleotide 5089 of SEQ ID No. 2. When the nucleotide is a T, the flowering is advanced. When the polymorphism is a deletion, the bloom is later.

In a particular embodiment, a localized polymorphism is sought at nucleotide 5025 of SEQ ID No. 2. When the nucleotide is a G, the flowering is advanced. When the nucleotide is T, flowering is later.

In a particular embodiment, a localized polymorphism is sought at nucleotide 4961 of SEQ ID No. 2. When the nucleotide is an A, the flowering is advanced. When the nucleotide is a C, flowering is later.

In a particular embodiment, the presence of two polymorphisms is sought for nucleotides 5089 and 5025 of SEQ ID No. 2. In another embodiment, the presence of two polymorphisms is sought for nucleotides 5089 and 4961 of SEQ ID NO. 2. In another embodiment, the presence of two polymorphisms is sought for nucleotides 5025 and 4961 of SEQ ID NO: 2.

In another embodiment, the presence of the three polymorphisms is sought for nucleotides 4961, 5025 and 5089 of SEQ ID No. 2. It should be noted that the presence of two haplotypes A / G / T and C / T / - is often observed, corresponding to an early allele for the first, and a late allele for the second. Preferably, the transgenic maize according to the invention is a maize

"Elite". Those skilled in the art are familiar with the definition of elite maize. It is a corn intended to generate hybrids intended to be marketed by crossing with another elite corn. An elite maize is defined as such in relation to the territory envisaged for marketing, as well as the agronomic character (s) sought for hybrid offspring. This includes a corn that can be included in a reference catalog.

Thus, if the offspring is intended for animal feed, we will evaluate the characteristics of yield (search for a high and regular yield in dry matter tonnage per hectare), ingestibility and digestibility, when evaluates the "elite corn" nature. If the offspring is for the production of biofuels, such as biofuels or biogas, the maize with the highest energy efficiency after processing is evaluated.

In order to determine the elite character of a maize, hybrids obtained from it are compared to commercial reference hybrids (sold for the same purpose in the same region), field trials, survey surveys, and control measures. agronomic traits appropriate to the objective sought. A corn is defined as elite if the results obtained parameters studied for a hybrid obtained by crossing said maize are greater than 90% to the results recorded for the same parameters of the reference hybrids.

Thus, an elite maize is a corn gathering the maximum of agronomic characteristics necessary for an economic penetration of the target market. As the corn market is now a hybrid market, the evaluation of the elite character of maize is also done by the ability of the maize to combine / produce hybrids.

Thus, the implementation of the present invention makes it possible to obtain an elite maize intended for marketing hybrids for any use, said maize having a precocious flowering period. This elite maize is homozygous for the delta-Prec31 allele.

In another embodiment, the invention makes it possible to obtain a hybrid maize obtained by crossing two homozygous parent lines, said hybrid maize having a delta-Prec31 allele. This hybrid corn can be homozygous (if each homozygous parent has the Delta-Prec31 allele) or heterozygote for the allele.

Any plant as described above (transgenic or mutant) may contain one or more transgenes in addition to Prec31 inhibitory elements and delta-Prec31 allele. Mention can be made of transgenes conferring male sterility, male fertility, resistance to a herbicide (especially glyphosate, glufosinate, imidazolinone, sulfonylurea, L-phosphinotricin, triazine, benzonitrile), insect resistance (including a transgene encoding Bacillus thuringiensis toxin), tolerance to water stress. These plants can be obtained by crossing said plants of the invention with other plants containing said transgenes. Alternatively, plants can be co-transformed with an expression cassette containing several different transgenes, including those inhibiting Prec31.

In particular, the invention relates to a method for obtaining a corn having an early flowering date, comprising introgressing the Delta-Prec31 allele in said corn, comprising the steps of:

a) crossing a first maize line having the delta-Prec31 allele with a second maize not having said allele,

b) genotyping the obtained progeny and selecting progeny with the delta-Prec31 allele, and optionally having the best genome ratio for said second maize, c) backcrossing said progeny with said second elite maize line usable for the production of hybrids, d) if necessary repeat steps b) and c) until obtaining an isogenic line of said second maize, having the delta-Prec31 allele, e) optionally, perform self-fertilization to obtain a homozygous plant for the delta-Prec31 allele.

When the maize line having the delta-Prec31 allele is homozygous for this allele, there is no need to carry out the genotyping provided for in step b) after the first crossing provided in step a).

Thus, the lessons can be used to identify usable maize in a selection scheme for selecting maize with a date flowering earlier than the average flowering date of the maize used in the selection scheme, by searching for the presence of the delta-Prec31 allele

Finally, the invention relates to the use of a plant, and in particular a corn according to the invention for the preparation of a composition intended for human or animal consumption, or for the preparation of biofuels or any other industrial application, as well as methods using such plants for such applications. EXAMPLES

Example 1 Characterization of the Delta Prec31 Mutant

A corn line having an insertion of a transposable element after the G located in position 6125 of the reference sequence SEQ ID No. 2 is isolated. The resulting allele is called delta-Prec31.

Although present in the 3 'untranslated region of the gene, it is assumed that this insertion has the effect of deregulating the transcription and / or translation of the Prec31 gene, or the stability of the Prec31 mRNA, leading to a decrease in activity of the protein in the presence of the delta-Prec31 allele.

In order to study more precisely the effect of the observed insertion in the gene

Prec31 in an elite maize, we carry out backcrosses with an elite line of maize.

This method makes it possible very quickly to obtain quasi-isogenic lines differing only in the locus carrying the modified allele, the descendants being tested to have a ratio genome as close as possible to that of the elite parent while having the allele that the we want to introgress. These tests are assisted by molecular markers (well known techniques, microsatellites, AFLP ...). To try to appreciate the effect of the insertion at the earliest (obtaining homozygous plants), self-fertilization is carried out at the different intermediate stages of backcross.

The precocity is thus evaluated on BC3S1 plants (3 backcrosses in an elite line, 1 self-fertilization).

The following results are observed

Male flowering (FM): Significant precociation in the homozygous mutant state compared to the quasi-isogenic wild homozygote. The effect is very clear: P value = 0.0046 and a significant difference of 5 days between flowering averages of mutant homozygotes compared to flowering averages of wild homozygotes.

Female flowering (FF): Precociation also significant in the homozygous mutant state compared to the quasi-isogenic wild homozygote. P value = 0.0221 and a significant difference of 4 days between flowering averages of mutant homozygotes compared to flowering averages of wild homozygotes.

The mutation therefore gives rise to a precociation of about 4 to 5 days, both for male flowering and for female flowering.

In order to determine whether the insertion is in homozygous or heterozygous form, a pair of primers can be used:

SEQ ID NO: 6: GATTGCAGGACTCGATCAA, upstream of the insertion, and a primer of SEQ ID NO: 7: TTTAAC C C AAAC AC AAC AG G, downstream of the insertion.

In addition to these two primers, the specific OMuA SEQ ID No. 8 CTTCGTCCATAATGGCAATTATCTC primer of the endogenous transposable element is used. This primer is directed to the "outside" of the transposon. These three primers can be used simultaneously in a PCR amplification experiment from genomic DNA (Hybridization temperature = 58 ° C.). The gel deposition of the amplification products reveals:

- Obtaining a single band of about 450 bp long for so-called wild plants at this locus (ie not having the mutation);

obtaining a band of the order of 500 bp for homozygous mutant plants

or obtaining the two bands for heterozygous plants.

Example 2: Search for Other Mutations in the Prec31 Gene

Primers TGAGTGGACATGCTTGACC (SEQ ID NO: 4) and CGTATAACACGGAAGCTGAC (SEQ ID NO: 5) were used to amplify a region overlapping the end of the second exon and the beginning of the second intron of the Prec31 gene.

These primers amplify a region of 754 nucleotides ranging from nucleotide 4803 to nucleotide 5556 of SEQ ID No. 2.

The presence of 3 polymorphisms located at 4961, 5025 and 5089 of SEQ ID No. 2 is observed.

These nucleotides have the following effect on the flowering date: Polymorphism Allelel Effect Allele 2 Effect

4961 C 25.94 A - 25.94

5025 T 25.77G -25.77

5089 - 25.57 T -25.57

Effects are indicated in degree-days. In fact, when the interannual variability of the temperatures is great, the duration of the cycles of development is evaluated, not in number of days, but in sum of degree-days. In a simplified way, the sum of the degree-days corresponds to the sum of the average daily temperatures. In this case, the temperature observed during flowering being of the order of 20 ° C, polymorphisms precociate or delay the date of flowering a little more than a day. The comparison is made with respect to the average flowering dates for all the lines of a panel of 374 maize lines representing a wide genetic diversity. The dates used for each of the polymorphisms correspond to the average of the flowering dates for all the lines containing said polymorphism.

Because of the great variability between the lines used, this method makes it possible to minimize the effect of other genetic loci that may be involved in flowering.

The SNP most associated with the precocity is located at position 4961 of the reference sequence SEQ ID No. 2. It is very significant (associated with a pvalue of 5.1 × 10 ^-4 ) and has a precocious allele A of 25.94 "day. a late C allele of 25.94 ° day. The percentage of phenotypic variance associated with this locus is 5%.

It should be noted that the reference sequence SEQ ID No. 2 provided to enable the polymorphisms of the Prec31 gene to be located has the polymorphisms of haplotype 2, and is therefore associated with early flowering.

These results confirm the involvement of the Prec31 gene in the flowering mechanism.

Example 3: Expression of Prec31 Tissue samples (apex, inner part of the sheath and outer part of the sheath) were harvested at different leaf stages and in particular at the 6.3-leaf stage, ie the flower transition stage ("switch"). flowering) which corresponds to that of the transition from the vegetative stage to the flower stage.

Prec31 has been shown to have differential transcriptional expression between the inner sheath portion and the outer exposed portion of light. At the 6.3-leaf stage, the Prec31 gene is more strongly expressed in the outer part.

This expression profile is the opposite of that of the id1 gene (INDETERMINATE 1) in corn (Colasanti et al, Cell, May 15, 3 (4): 593-603, 1998) known to induce flowering.

These results, coupled with the fact that the Prec31 gene colocalises with a QTL of early flowering localized on chromosome 8 (QTL bin 8.05), confirm the involvement of the Prec31 gene in the flowering mechanism.

Claims

claims

Process for advancing the flowering date of a plant, characterized in that the expression and / or activity in said plant of a protein called Prec31, whose polypeptide sequence has at least 75% identity with the sequence SEQ ID No. 1.

Process according to claim 1, characterized in that said plant is maize.

Use of at least one polynucleotide chosen from:

a) a polynucleotide encoding a Prec31 protein as defined in claim 1;

d) a polynucleotide allowing the production of a duplex that can be used for the interference of RNA (RNAi), said polynucleotide containing a polynucleotide X containing at least 12 nucleotides, preferably at least 15, advantageously at least 20, and at least 50 nucleotides capable of hybridizing selectively with a polynucleotide defined in a) and a complementary polynucleotide Y of said polynucleotide X for the implementation of a method according to one of claims 1 or 2 are most preferably .

Process according to either of Claims 1 and 2, characterized in that the inhibition of the expression and / or activity of the Prec31 enzyme is obtained by mutagenesis of the gene encoding said enzyme [said gene being understood as comprising the coding and non-coding regions (5 ', 3', introns) of the gene].

Process according to either of Claims 1 and 2, characterized in that it comprises the transformation of said plant with a construction recombinant DNA construct comprising a polynucleotide as defined in claim 3, under transcriptional control of a suitable promoter.

An expression cassette comprising a polynucleotide as defined in claim 3, under transcriptional control of a suitable promoter.

Recombinant vector containing an expression cassette according to claim 6.

A plant obtainable by the process according to claim 4, and having a mutation in the gene encoding the Prec31 protein whose sequence has at least 75% identity with SEQ ID No. 1, said mutation resulting in inhibition of the expression and / or activity of Prec31.

A genetically modified plant obtainable by a process according to claim 5.

Plant according to one of claims 8 or 9, characterized in that it is a corn.

A method of selecting maize, characterized in that it comprises searching for a gene allele of the Prec31 protein having a mutation resulting in an anticipated flowering date of said maize compared to a maize not having this allele.

Process according to claim 10, characterized in that said allele is represented by SEQ ID No. 2.

A corn having an allele of the Prec31 gene, termed delta-Prec31 comprising an insertion of a transposon in the 3 'untranslated region of the Prec31 gene, said insertion being located after the G located in position 6125 of the reference sequence SEQ ID N ° 2, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41706. Corn grain having a Prec31 gene allele, designated delta-Prec31 comprising an insertion of a transposon in the 3 'untranslated region of the Prec31 gene, said insertion being located after the G located at position 6125 of the SEQ reference sequence ID No. 2, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41706.

A method for obtaining a corn having an early flowering date, comprising introgressing the Delta-Prec31 allele in said corn, comprising the steps of:

Use of a maize according to one of claims 10 or 13, or obtained according to the method of claim 15 for the preparation of a composition intended for human or animal consumption, or for the preparation of biofuels or any other industrial application.