EP2547772A1 - Method for modifying the blooming date of a plant - Google Patents
Method for modifying the blooming date of a plantInfo
- Publication number
- EP2547772A1 EP2547772A1 EP11708284A EP11708284A EP2547772A1 EP 2547772 A1 EP2547772 A1 EP 2547772A1 EP 11708284 A EP11708284 A EP 11708284A EP 11708284 A EP11708284 A EP 11708284A EP 2547772 A1 EP2547772 A1 EP 2547772A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- prec31
- polynucleotide
- allele
- maize
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
Definitions
- the present invention relates to the field of plant breeding, in particular the modification of their date of flowering.
- the flowering date of a plant reflects its ability to adapt to its environment and especially to climatic conditions, and external stress.
- Corn has a male organ and a female organ, which bloom asynchronously.
- a large number of environmental cues (such as day length, temperature (vernalization), availability of nutrients, water or phytohormones) control the transition between vegetative and reproductive phases, and are therefore likely to influence the flowering date.
- WO 2006/068432 which describes the genes OsMADS50, OsMADS51, OsMADS56, OsMADS14 (truncated), OsTRXI, OsVIN2, OsCOL.4, and OsCOL8. These different genes show an effect on the rice, autogamous plant.
- the inventors of the previous application have then studied in more detail the role of OsMADS51 (Kim et al., Plant Physiol., 2007 Dec; 145 (4): 1484-94), confirming the effects reported in WO 2006/068432, and specifying a genetic sequence (architecture) of flowering in rice.
- the inventors have identified a gene coding for a protein which will be designated as Prec31 in the present application, and whose amino acid sequence is represented by SEQ ID No. 1.
- a mutant in the gene encoding this protein has an early male and female flowering date compared to the non-mutant, non-mutant plant.
- the present invention thus relates to a method for advancing the date of flowering of a plant, characterized in that the expression and / or the activity in said plant of a protein called Prec31 is totally or partially inhibited. whose polypeptide sequence has at least 75% identity with the sequence SEQ ID No. 1.
- comparators for the purposes of this description, comparators
- a quasi-isogenic plant has a genome at least 95% identical to the genome of the plant that is the subject of the invention, except for the presence of the Prec31 inhibiting elements.
- a quasi- isogenic line can be obtained by backcrossing the plant object of the invention with the line with which it is desired to establish the comparison.
- the fourth generation it is possible to obtain an almost isogenic line of the elite line, that is to say identical to the original elite line, but having integrated the element (s) inhibiting Prec31.
- the integrated fragment carries the Prec31 inhibitory element (s), as well as any flanking chromosomal regions derived from the starter corn (especially the well-known A188 or Hi-11 lines used for transformation, when evaluated. the effect of a transgene in corn).
- Said plant is in particular maize, rice, sorghum, millet, wheat and other straw cereals, or a forage plant.
- Pr31 is defined herein as any protein whose polypeptide sequence has at least 75%, preferably at least 85%, or at least 90%, advantageously at least 94%, and most preferably at least 95%, more preferably at least 97% identity with the sequence SEQ ID No. 1 on a widest comparison window possible, corresponding preferably to the entire sequence SEQ ID No. 1.
- the percentages of identity shown here are established using the BLAST2 software (ALTSCHUL et al., Nucleic Acids Res., 25, 3389-3402, 1997) using the default parameters (BLOSUM62 matrix for protein comparisons, with penalties of 1 1 for an open gap, 1 for an expansion gap, 50 for a x_dropoff gap, a random wait value of 10, a word size (word size) of 3, and no filter).
- Total or partial inhibition of the expression and / or activity of the Prec31 protein can be achieved in a variety of ways known to those skilled in the art.
- the expression of the gene coding for Prec31 is reduced by mutagenesis or by inhibition or modification of its transcription or translation.
- the Prec31 gene is understood to include the coding and non-coding regions (5 'or 3' untranslated regions, introns) of the gene.
- Mutagenesis of the gene coding for Prec31 can occur at the level of the coding sequence or expression regulation sequences, in particular promoter, or 3 'untranslated region (3'UTR). For example, it is possible to delete all or part of said gene and / or to insert an exogenous sequence.
- insertional mutagenesis a large number of individuals derived from an active plant for the transposition of a transposable element (AC element or Mutator in maize) are produced and selected by for example by PCR, plants in which an insertion was carried out in the Prec31 gene, or in the vicinity with consequent effect on translation or expression.
- any other method known in the art may also be used to inhibit the gene encoding Prec31.
- Physical or chemical mutagenesis can also be carried out, especially by the use of EMS, X-rays or ultraviolet (see in particular McCallum et al., Plant Physiol., 123, 439-442, 2000).
- the mutations of interest have the consequence of shifting the reading frame and / or of introducing a stop codon into the sequence and / or of modifying the level of transcription and / or translation of the gene and / or of making the enzyme less active than the wild-type protein.
- the plants thus mutated are screened for example by PCR, using primers located in the target gene.
- other screening methods such as Southern blots or AIMS screening described in WO 99/27085 (for detecting insertions) can also be used, using probes specific for the target genes, or methods of screening. detection of point mutations or small insertions / deletions using particular endonucleases (Cel I, Endo I) as described in WO 2006/010646.
- the inhibition is achieved by transforming the plant with a vector containing a sense or antisense construct of the target gene.
- RNAi RNA interference
- This method is well known to those skilled in the art and consists of transforming the plant with a construct producing, after transcription, a double-stranded duplex of RNA, one of whose strands is complementary to the mRNA of the gene.
- the present invention thus particularly relates to the use of at least one polynucleotide chosen from:
- RNAi RNA RNA
- said polynucleotide containing a polynucleotide X containing at least 12 nucleotides, preferably at least 15, advantageously at least 20, and at least 50 nucleotides capable of selectively hybridizing with a polynucleotide defined in a) and a complementary polynucleotide Y of said polynucleotide X
- a polynucleotide encoding Prec31 is a polynucleotide containing the genetic information for the synthesis of the Prec31 protein represented by SEQ ID No. 1, or a protein having at least 75%, preferably at least 85%, or at least 90%. %, advantageously at least 94%, and most preferably at least 95%, more preferably at least 97% identity with SEQ ID No. 1.
- genomic DNA whose sequence SEQ ID No. 2 represented in the appendix represents an allele, as well as the corresponding cDNA (SEQ ID No. 3).
- the coding portion comprises nucleotides 979-1674, 4667-4948 and 5712-5831 (STOP codon included) of SEQ ID NO: 2
- a specific fragment of polynucleotide a) or b) above is a fragment of said polynucleotide whose sequence is not found in other genes of the same plant.
- a polynucleotide capable of hybridizing selectively with polynucleotide a) or b) above is a polynucleotide which when hybridized under stringent conditions with a nucleic acid library of the same plant (especially a DNA library genomic, or cDNA) produces a detectable hybridization signal at least 2 times higher, and preferably at least 5 times higher than the background with said polynucleotide, but produces no detectable signal with other sequences of said bank.
- stringent conditions which depend on the size and base composition of the polynucleotide concerned, as well as the composition of the hybridization mixture (in particular pH and ionic strength).
- stringent conditions for a polynucleotide of given size and sequence, are obtained by operating at a temperature of about 5 ° C. to 10 ° C. below the melting point (Tm) of the hybrid formed, same reaction mixture, with this polynucleotide and its complement.
- the present invention relates in particular to a method for advancing the date of flowering of a plant, by total or partial inhibition of the endogenous prec31 protein of said plant, comprising the transformation of said plant with a recombinant DNA construct comprising a polynucleotide as defined above, placed in direction orientation or antisense orientation, or can be transcribed into double-stranded RNA, under transcriptional control of a suitable promoter.
- the invention also relates to a method for delaying the flowering date of a plant by overexpressing a Prec31 protein in said plant. This overexpression is achieved by transformation of said plant with a recombinant DNA construct comprising a polynucleotide as defined above under transcriptional control of a suitable promoter.
- the transgenic plants thus obtained are also the subject of the invention.
- the present invention also relates to recombinant DNA constructs comprising a polynucleotide as defined above.
- constructs are in particular expression cassettes, comprising a polynucleotide as defined above, under transcriptional control of a suitable promoter.
- expression cassettes may also contain other regulatory elements, in particular transcriptional regulatory elements such as terminators, amplifiers.
- Recombinant vectors which comprise polynucleotides as defined according to the invention or an expression cassette according to the invention are also objects of the invention.
- Such vectors may also comprise other elements, for example one or more selection markers, and may especially be used for obtaining transgenic plants.
- promoters that may be used in the context of the present invention, mention may be made of the constitutive promoters, such as the 35S promoter of cauliflower mosaic virus (CaMV), or its derivatives, the promoter Cassava vein mosaic virus (CsVMV) (WO 97/48819), ubiquitin promoter or actin-intron-actin promoter, rice (McEIroy et al., Mol. Gen. Genet., 231, 150-160, 1991; GenBank S 44221).
- constitutive promoters such as the 35S promoter of cauliflower mosaic virus (CaMV), or its derivatives, the promoter Cassava vein mosaic virus (CsVMV) (WO 97/48819), ubiquitin promoter or actin-intron-actin promoter, rice (McEIroy et al., Mol. Gen. Genet., 231, 150-160, 1991; GenBank S 44221).
- Inducible or tissue-specific promoters can also be used. This allows to induce the inhibition of Prec31 only at certain stages of the plant's development, under certain environmental conditions, or in certain target tissues, such as, for example, stems, leaves, seeds, spathes, the cortex or xylem.
- transcriptional regulatory elements such as terminators, and in particular the 3'NOS terminator of nopaline synthase (Depicker et al., J. Mol Appl. Genet., 1, 561 -573, 1982 ), or the 3'CaMV terminator (Franck et al Cell, 21, 285-294, 1980, GenBank V00141).
- the marker genes of selection that may be used in the context of the present invention are, in particular, genes conferring resistance to an antibiotic such as hygromycin, kanamycin, bleomycin or streptomycin, or to a herbicide (EP 0 242 246) such as glufosinate, glyphosate or bromoxynil.
- a herbicide EP 0 242 246
- Plant transformation can be carried out by many methods, known in themselves to those skilled in the art.
- the transformation can thus be carried out by transfer of the vectors according to the invention into protoplasts, in particular after incubation of the latter in a solution of polyethylene glycol (PG) in the presence of divalent cations (Ca 2+) according to the method described in the article.
- PG polyethylene glycol
- Ca 2+ divalent cations
- a gene gun which can be used to project, at very high speed, metal particles covered with the DNA sequences of interest, thereby delivering genes inside the cell nucleus, in particular according to the technique described in article by Finer and al. (Plant Cell Report, 11, 323-328, 1992) or cytoplasmic or nuclear microinjection.
- the method of transformation with Agrobacterium tumefaciens is preferably used, in particular according to the method described by Ishida et al. (1996, Nature Biotechnol 14, 745-50).
- the subject of the present invention is also the plant cells and the transgenic or mutant plants that can be obtained by a process according to the invention, and the cells and plants containing a recombinant polynucleotide or an expression cassette as defined above. above.
- the invention also relates to the plant cells and plants obtained after mutation of the coding gene of Prec31 so that it results in an inhibition of the expression and / or the activity of the protein.
- the present invention encompasses the plants derived from plants according to the invention, which are in particular the descendants, in particular the hybrids resulting from a cross involving at least one plant according to the invention, obtained by sowing or by vegetative propagation, of plants according to the invention or obtained directly or indirectly by a method according to the invention.
- the invention also includes plant cells and tissues, as well as organs or parts of plants, including leaves, stems, roots, flowers, fruits, and / or seeds obtained from a plant according to the invention.
- the invention applies to corn and cells and tissues derived from corn.
- the invention relates to maize or maize grain having an allele of the Prec31 gene, termed delta-Prec31 comprising an insertion of a transposon in the 3 'untranslated region, 297 nucleotides after the STOP codon of the translated region, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41706.
- the present invention also relates to a method of selecting maize, or to a method of identifying maize that can be used in a selection scheme intended to obtain a maize having an early flowering date (earlier than the average date of flowering of the maize used in the selection scheme), characterized in that it comprises the search for an allele of the Prec31 gene having a mutation resulting in an anticipated flowering date of said corn, compared to a maize not having this allele. This process is directly related to the demonstration of the role of Prec31 in the early flowering date.
- said mutation results in a total or partial inhibition of the expression and / or activity of Prec31.
- Said allele can be searched by direct detection of the mutation responsible for the inhibition; it can also be sought by detecting the allelic form associated with this mutation of a polymorphism in linkage disequilibrium therewith.
- mutant alleles thus identified can then be introgressed in selected lines, and in particular in elite lines, namely lines with significant agronomic and commercial potential.
- a localized polymorphism is sought at nucleotide 5089 of SEQ ID No. 2.
- the nucleotide is a T
- the flowering is advanced.
- the polymorphism is a deletion
- the bloom is later.
- a localized polymorphism is sought at nucleotide 5025 of SEQ ID No. 2.
- the nucleotide is a G
- the flowering is advanced.
- the nucleotide is T
- flowering is later.
- a localized polymorphism is sought at nucleotide 4961 of SEQ ID No. 2.
- the nucleotide is an A
- the flowering is advanced.
- the nucleotide is a C
- flowering is later.
- the presence of two polymorphisms is sought for nucleotides 5089 and 5025 of SEQ ID No. 2. In another embodiment, the presence of two polymorphisms is sought for nucleotides 5089 and 4961 of SEQ ID NO. 2. In another embodiment, the presence of two polymorphisms is sought for nucleotides 5025 and 4961 of SEQ ID NO: 2.
- the presence of the three polymorphisms is sought for nucleotides 4961, 5025 and 5089 of SEQ ID No. 2. It should be noted that the presence of two haplotypes A / G / T and C / T / - is often observed, corresponding to an early allele for the first, and a late allele for the second.
- the transgenic maize according to the invention is a maize
- Elite Those skilled in the art are familiar with the definition of elite maize. It is a corn intended to generate hybrids intended to be marketed by crossing with another elite corn. An elite maize is defined as such in relation to the territory envisaged for marketing, as well as the agronomic character (s) sought for hybrid offspring. This includes a corn that can be included in a reference catalog.
- the offspring is intended for animal feed, we will evaluate the characteristics of yield (search for a high and regular yield in dry matter tonnage per hectare), ingestibility and digestibility, when evaluates the "elite corn" nature. If the offspring is for the production of biofuels, such as biofuels or biogas, the maize with the highest energy efficiency after processing is evaluated.
- biofuels such as biofuels or biogas
- hybrids obtained from it are compared to commercial reference hybrids (sold for the same purpose in the same region), field trials, survey surveys, and control measures. agronomic traits appropriate to the objective sought.
- a corn is defined as elite if the results obtained parameters studied for a hybrid obtained by crossing said maize are greater than 90% to the results recorded for the same parameters of the reference hybrids.
- an elite maize is a corn gathering the maximum of agronomic characteristics necessary for an economic penetration of the target market.
- the evaluation of the elite character of maize is also done by the ability of the maize to combine / produce hybrids.
- the implementation of the present invention makes it possible to obtain an elite maize intended for marketing hybrids for any use, said maize having a precocious flowering period.
- This elite maize is homozygous for the delta-Prec31 allele.
- the invention makes it possible to obtain a hybrid maize obtained by crossing two homozygous parent lines, said hybrid maize having a delta-Prec31 allele.
- This hybrid corn can be homozygous (if each homozygous parent has the Delta-Prec31 allele) or heterozygote for the allele.
- transgenic or mutant may contain one or more transgenes in addition to Prec31 inhibitory elements and delta-Prec31 allele. Mention can be made of transgenes conferring male sterility, male fertility, resistance to a herbicide (especially glyphosate, glufosinate, imidazolinone, sulfonylurea, L-phosphinotricin, triazine, benzonitrile), insect resistance (including a transgene encoding Bacillus thuringiensis toxin), tolerance to water stress. These plants can be obtained by crossing said plants of the invention with other plants containing said transgenes. Alternatively, plants can be co-transformed with an expression cassette containing several different transgenes, including those inhibiting Prec31.
- the invention relates to a method for obtaining a corn having an early flowering date, comprising introgressing the Delta-Prec31 allele in said corn, comprising the steps of:
- the lessons can be used to identify usable maize in a selection scheme for selecting maize with a date flowering earlier than the average flowering date of the maize used in the selection scheme, by searching for the presence of the delta-Prec31 allele
- the invention relates to the use of a plant, and in particular a corn according to the invention for the preparation of a composition intended for human or animal consumption, or for the preparation of biofuels or any other industrial application, as well as methods using such plants for such applications.
- a corn line having an insertion of a transposable element after the G located in position 6125 of the reference sequence SEQ ID No. 2 is isolated.
- the resulting allele is called delta-Prec31.
- This method makes it possible very quickly to obtain quasi-isogenic lines differing only in the locus carrying the modified allele, the descendants being tested to have a ratio genome as close as possible to that of the elite parent while having the allele that the we want to introgress.
- These tests are assisted by molecular markers (well known techniques, microsatellites, AFLP ). To try to appreciate the effect of the insertion at the earliest (obtaining homozygous plants), self-fertilization is carried out at the different intermediate stages of backcross.
- the precocity is thus evaluated on BC3S1 plants (3 backcrosses in an elite line, 1 self-fertilization).
- FF Female flowering
- the mutation therefore gives rise to a precociation of about 4 to 5 days, both for male flowering and for female flowering.
- a pair of primers can be used:
- SEQ ID NO: 6 GATTGCAGGACTCGATCAA, upstream of the insertion, and a primer of SEQ ID NO: 7: TTTAAC C C AAAC AC AAC AG G, downstream of the insertion.
- the specific OMuA SEQ ID No. 8 CTTCGTCCATAATGGCAATTATCTC primer of the endogenous transposable element is used. This primer is directed to the "outside" of the transposon.
- primers amplify a region of 754 nucleotides ranging from nucleotide 4803 to nucleotide 5556 of SEQ ID No. 2.
- the SNP most associated with the precocity is located at position 4961 of the reference sequence SEQ ID No. 2. It is very significant (associated with a pvalue of 5.1 ⁇ 10 -4 ) and has a precocious allele A of 25.94 "day. a late C allele of 25.94 ° day. The percentage of phenotypic variance associated with this locus is 5%.
- the reference sequence SEQ ID No. 2 provided to enable the polymorphisms of the Prec31 gene to be located has the polymorphisms of haplotype 2, and is therefore associated with early flowering.
- Example 3 Expression of Prec31 Tissue samples (apex, inner part of the sheath and outer part of the sheath) were harvested at different leaf stages and in particular at the 6.3-leaf stage, ie the flower transition stage ("switch"). flowering) which corresponds to that of the transition from the vegetative stage to the flower stage.
- switch flower transition stage
- Prec31 has been shown to have differential transcriptional expression between the inner sheath portion and the outer exposed portion of light. At the 6.3-leaf stage, the Prec31 gene is more strongly expressed in the outer part.
- This expression profile is the opposite of that of the id1 gene (INDETERMINATE 1) in corn (Colasanti et al, Cell, May 15, 3 (4): 593-603, 1998) known to induce flowering.
Abstract
The present invention applies to the field of plant improvements, in particular to the modification of the blooming date thereof, by manipulation of the Prec31 gene.
Description
METHODE POUR MODIFIER LA DATE DE FLORAISON D'UNE PLANTE METHOD FOR MODIFYING FLOWERING DATE OF A PLANT
La présente invention se rapporte au domaine de l'amélioration des plantes, en particulier de la modification de leur date de floraison. The present invention relates to the field of plant breeding, in particular the modification of their date of flowering.
Le développement des plantes est composé d'une phase végétative et d'une phase de reproduction. La floraison représente la transition entre ces deux phases. The development of plants is composed of a vegetative phase and a reproduction phase. Flowering represents the transition between these two phases.
La floraison est ainsi un événement essentiel dans le cycle de vie des plantes et est d'une grande importance pour la sélection de plantes adaptées à leur environnement. Flowering is thus an essential event in the life cycle of plants and is of great importance for the selection of plants adapted to their environment.
La date de floraison d'une plante reflète sa capacité d'adaptation à son environnement et notamment aux conditions climatiques, et aux stress externes. The flowering date of a plant reflects its ability to adapt to its environment and especially to climatic conditions, and external stress.
Le maïs possède un organe mâle et un organe femelle, qui fleurissent de manière asynchrone. Corn has a male organ and a female organ, which bloom asynchronously.
Un nombre importants de signaux environnementaux (tels que la longueur du jour, la température (vernalisation), la disponibilité de nutriments, d'eau ou de phytohormones) contrôlent la transition entre les phases végétatives et reproductives, et sont donc susceptibles d'influencer la date de floraison. A large number of environmental cues (such as day length, temperature (vernalization), availability of nutrients, water or phytohormones) control the transition between vegetative and reproductive phases, and are therefore likely to influence the flowering date.
La date de floraison du maïs est également influencée par différents facteurs génétiques. Ainsi, Buckler et al (Science, 2009, 325, p 714-718) décrivent l'identification de régions chromosomiques du maïs (QTL pour Quantitative Trait Loci) influençant la floraison de ces plantes. Ces régions ont été identifiées en utilisant une grande population de plantes. Les auteurs précisent que les différences observées entre les lignées consanguines ne sont pas causées par quelques gènes ayant un effet important, mais plutôt par l'effet cumulatif de plusieurs QTL. Ainsi, les QTL identifiés présentent plutôt des effets mineurs (au maximum 1 ,5 jours de précocification. The flowering date of corn is also influenced by different genetic factors. Thus, Buckler et al (Science, 2009, 325, p 714-718) describe the identification of maize chromosomal regions (QTLs for Quantitative Trait Loci) influencing the flowering of these plants. These regions have been identified using a large population of plants. The authors point out that the differences observed between inbred lines are not caused by a few genes having a significant effect, but rather by the cumulative effect of several QTLs. Thus, the identified QTLs have rather minor effects (at most 1, 5 days of precocification.
De fait, il existe au moins 80 gènes de floraison chez Arabidopsis (voir Blazquez et al 2001 (EMBO Rep. 2001 Dec;2(12):1078-82). Le nombre d'orthologues de ces gènes chez le maïs est très important : ainsi, Buckler et al., parlent de 1000 gènes de floraison d'Arabidopsis ayant des homologues chez le maïs. In fact, there are at least 80 flowering genes in Arabidopsis (see Blazquez et al 2001 (EMBO Rep. 2001 Dec; 2 (12): 1078-82). The number of orthologues of these genes in maize is very important. Thus, Buckler et al. discuss 1000 Arabidopsis flowering genes with homologs in corn.
Différents documents ont décrit l'identification de gènes impliqués dans la floraison dans d'autres espèces. On peut notamment citer WO 2006/068432, qui décrit les gènes OsMADS50, OsMADS51 , OsMADS56, OsMADS14 (tronqué),
OsTRXI, OsVIN2, OsCOL.4, et OsCOL8. Ces différents gènes montrent un effet sur le riz, plante autogame. Les inventeurs de la demande précédente ont ensuite étudié plus en détail le rôle de OsMADS51 (Kim et al, Plant Physiol. 2007 Dec;145(4): 1484-94), confirmant les effets rapportés dans WO 2006/068432, et précisant une séquence (architecture) génétique de la floraison chez le riz. Different documents have described the identification of genes involved in flowering in other species. WO 2006/068432, which describes the genes OsMADS50, OsMADS51, OsMADS56, OsMADS14 (truncated), OsTRXI, OsVIN2, OsCOL.4, and OsCOL8. These different genes show an effect on the rice, autogamous plant. The inventors of the previous application have then studied in more detail the role of OsMADS51 (Kim et al., Plant Physiol., 2007 Dec; 145 (4): 1484-94), confirming the effects reported in WO 2006/068432, and specifying a genetic sequence (architecture) of flowering in rice.
Les inventeurs ont identifié un gène codant pour une protéine qui sera désignée en tant que Prec31 dans la présente demande, et dont la séquence d'acides aminés est représentée par SEQ ID N° 1 . The inventors have identified a gene coding for a protein which will be designated as Prec31 in the present application, and whose amino acid sequence is represented by SEQ ID No. 1.
Chez le maïs, un mutant dans le gène codant pour cette protéine présente une date de floraison mâle et femelle précoces par rapport à la plante quasi- isogénique non mutante. In maize, a mutant in the gene encoding this protein has an early male and female flowering date compared to the non-mutant, non-mutant plant.
La présente invention se rapporte ainsi à un procédé pour avancer la date de floraison d'une plante, caractérisé en ce que l'on inhibe totalement ou partiellement l'expression et/ou l'activité dans ladite plante, d'une protéine dénommée Prec31 , dont la séquence polypeptidique possède au moins 75% d'identité avec la séquence SEQ ID N° 1 . Dans le cadre de la présente description, les éléments de comparaisonThe present invention thus relates to a method for advancing the date of flowering of a plant, characterized in that the expression and / or the activity in said plant of a protein called Prec31 is totally or partially inhibited. whose polypeptide sequence has at least 75% identity with the sequence SEQ ID No. 1. For the purposes of this description, comparators
(avance de la date de floraison, date de floraison plus précoce ou plus tardive) le sont par rapport à des plantes quasi-isogéniques, sauf en ce qui concerne l'objet de l'invention (inhibition de Prec31 , présence d'une mutation ou d'un transgène destiné à inhiber Prec31 ). Une plante quasi isogénique possède un génome identique à au moins 95 % au génome de la plante objet de l'invention, sauf en ce qui concerne la présence des éléments inhibant Prec31. Une lignée quasi- isogénique peut être obtenue par rétrocroisement de la plante objet de l'invention avec la lignée avec laquelle on souhaite établir la comparaison. (advance of flowering date, earlier or later flowering date) are relative to quasi-isogenic plants, except for the purpose of the invention (inhibition of Prec31, presence of a mutation or a transgene for inhibiting Prec31). An almost isogenic plant has a genome at least 95% identical to the genome of the plant that is the subject of the invention, except for the presence of the Prec31 inhibiting elements. A quasi- isogenic line can be obtained by backcrossing the plant object of the invention with the line with which it is desired to establish the comparison.
Le principe en est rappelé ci-dessous : On réalise une série de rétrocroisements (back-cross) entre la lignée avec laquelle on souhaite effectuer une comparaison et la lignée portant le(s) élément(s) inhibant Prec31. The principle is recalled below: A series of backcrosses is performed between the line with which it is desired to make a comparison and the line bearing the Prec31 inhibiting element (s).
Au cours des rétrocroisements, on peut sélectionner les individus porteurs de(s) élément(s) inhibant Prec31 , et ayant recombiné le plus petit fragment de la lignée donneuse autour de ce transgène. En effet, grâce aux marqueurs moléculaires, on sélectionne les individus ayant pour les marqueurs proches du gène, le génotype de la lignée élite.
De plus, il est également possible d'accélérer le retour vers le parent élite grâce aux marqueurs moléculaires répartis sur l'ensemble du génome. A chaque rétrocroisement, seront choisis les individus ayant le plus de fragments issus du parent élite récurrent. During backcrossing, individuals carrying Prec31 inhibitory element (s) can be selected, and recombining the smallest fragment of the donor line around this transgene. Indeed, thanks to the molecular markers, one selects the individuals having for the markers close to the gene, the genotype of the elite line. In addition, it is also possible to accelerate the return to the elite parent through molecular markers distributed throughout the genome. At each backcross, the individuals with the most fragments from the recurrent elite parent will be selected.
Avec une bonne mise en œuvre, dès la quatrième génération, on peut obtenir une lignée quasi isogénique de la lignée élite, c'est-à-dire identique à la lignée élite de départ, mais ayant intégré le(s) élément(s) inhibant Prec31 . Le fragment intégré porte le(s) élément(s) inhibant Prec31 , ainsi que d'éventuelles régions chromosomiques flanquantes issues du maïs de départ (notamment les lignées bien connues A188 ou Hi-ll, utilisées pour la transformation, lorsque l'on évalue l'effet d'un transgène dans le maïs). With a good implementation, from the fourth generation, it is possible to obtain an almost isogenic line of the elite line, that is to say identical to the original elite line, but having integrated the element (s) inhibiting Prec31. The integrated fragment carries the Prec31 inhibitory element (s), as well as any flanking chromosomal regions derived from the starter corn (especially the well-known A188 or Hi-11 lines used for transformation, when evaluated. the effect of a transgene in corn).
Ladite plante est notamment le maïs, le riz, le sorgho, le millet, le blé et autres céréales à paille, ou une plante fourragère. Said plant is in particular maize, rice, sorghum, millet, wheat and other straw cereals, or a forage plant.
On définit ici comme protéine Prec31 , toute protéine dont la séquence polypeptidique présente au moins 75 %, de préférence au moins 85 %, ou au moins 90 %, avantageusement au moins 94 %, et de manière tout à fait préférée au moins 95 %, de manière plus préférée au moins 97 % d'identité avec la séquence SEQ ID N° 1 sur une fenêtre de comparaison la plus large possible, correspondant de préférence à la totalité de la séquence SEQ ID N° 1 . Sauf précision contraire, les pourcentages d'identité indiqués ici sont établis à l'aide du logiciel BLAST2 (ALTSCHUL et al., Nucleic Acids Res.,25, 3389- 3402,1997) en utilisant les paramètres par défaut (matrice BLOSUM62 pour les comparaisons de protéines, avec des pénalités de 1 1 pour un « gap » ouvert, 1 pour un « gap » d'extension, 50 pour un « gap x_dropoff », une valeur d'attente aléatoire de 10, une taille de mots (word size) de 3, et pas de filtre). Pr31 is defined herein as any protein whose polypeptide sequence has at least 75%, preferably at least 85%, or at least 90%, advantageously at least 94%, and most preferably at least 95%, more preferably at least 97% identity with the sequence SEQ ID No. 1 on a widest comparison window possible, corresponding preferably to the entire sequence SEQ ID No. 1. Unless stated otherwise, the percentages of identity shown here are established using the BLAST2 software (ALTSCHUL et al., Nucleic Acids Res., 25, 3389-3402, 1997) using the default parameters (BLOSUM62 matrix for protein comparisons, with penalties of 1 1 for an open gap, 1 for an expansion gap, 50 for a x_dropoff gap, a random wait value of 10, a word size (word size) of 3, and no filter).
L'inhibition totale ou partielle de l'expression et/ou de l'activité de la protéine Prec31 peut être obtenue de diverses manières, connues par l'homme du métier. Total or partial inhibition of the expression and / or activity of the Prec31 protein can be achieved in a variety of ways known to those skilled in the art.
De façon préférée, on diminue l'expression du gène codant pour Prec31 , par mutagenèse, ou bien par inhibition ou modification de sa transcription ou de sa traduction. Preferably, the expression of the gene coding for Prec31 is reduced by mutagenesis or by inhibition or modification of its transcription or translation.
Le gène Prec31 est entendu comme comprenant les régions codantes et non codantes (régions 5' ou 3' non traduites, introns) du gène. The Prec31 gene is understood to include the coding and non-coding regions (5 'or 3' untranslated regions, introns) of the gene.
La mutagenèse du gène codant pour Prec31 peut intervenir au niveau de la séquence codante ou des séquences de régulation de l'expression, notamment du
promoteur, ou de la région 3' non traduite (3'UTR). On peut par exemple procéder à la délétion de tout ou partie dudit gène et/ou à l'insertion d'une séquence exogène. A titre d'exemple, on citera la mutagenèse insertionnelle : on produit un grand nombre d'individus dérivant d'une plante active pour la transposition d'un élément transposable, (élément AC ou Mutator chez le maïs), et on sélectionne, par exemple par PCR, les plantes chez lesquelles une insertion s'est effectuée dans le gène de Prec31 , ou à proximité avec conséquence sur la traduction ou l'expression. Mutagenesis of the gene coding for Prec31 can occur at the level of the coding sequence or expression regulation sequences, in particular promoter, or 3 'untranslated region (3'UTR). For example, it is possible to delete all or part of said gene and / or to insert an exogenous sequence. By way of example, mention may be made of insertional mutagenesis: a large number of individuals derived from an active plant for the transposition of a transposable element (AC element or Mutator in maize) are produced and selected by for example by PCR, plants in which an insertion was carried out in the Prec31 gene, or in the vicinity with consequent effect on translation or expression.
On peut aussi utiliser toute autre méthode connue dans l'art pour inhiber le gène codant pour Prec31. Ainsi, on peut procéder à la mutation des gènes par insertion d'un élément transposable ou d'un ADN de transfert (T-DNA). On peut aussi effectuer une mutagenèse physique ou chimique, notamment par l'utilisation d'EMS, de rayons X ou d'ultraviolets (voir notamment McCallum et al, Plant Physiol.,123, 439-442, 2000). Les mutations intéressantes ont pour conséquence de décaler le cadre de lecture et/ou d'introduire un codon stop dans la séquence et/ou de modifier le niveau de la transcription et/ou de la traduction du gène et/ou de rendre l'enzyme moins active que la protéine sauvage. Any other method known in the art may also be used to inhibit the gene encoding Prec31. Thus, one can proceed to the mutation of the genes by insertion of a transposable element or a transfer DNA (T-DNA). Physical or chemical mutagenesis can also be carried out, especially by the use of EMS, X-rays or ultraviolet (see in particular McCallum et al., Plant Physiol., 123, 439-442, 2000). The mutations of interest have the consequence of shifting the reading frame and / or of introducing a stop codon into the sequence and / or of modifying the level of transcription and / or translation of the gene and / or of making the enzyme less active than the wild-type protein.
Les plantes ainsi mutées sont criblées par exemple par PCR, en utilisant des amorces situées dans le gène cible. Toutefois, on peut aussi utiliser d'autres méthodes de criblage, comme les Southern Blots ou un criblage via la méthode AIMS décrite dans WO 99/27085 (pour détecter les insertions), en utilisant des sondes spécifiques des gènes cibles, ou les méthodes de détection de mutations ponctuelles ou de petites insertions/délétions utilisant des endonucléases particulières (Cel I, Endo I) telles que décrites dans WO 2006/010646. The plants thus mutated are screened for example by PCR, using primers located in the target gene. However, other screening methods, such as Southern blots or AIMS screening described in WO 99/27085 (for detecting insertions) can also be used, using probes specific for the target genes, or methods of screening. detection of point mutations or small insertions / deletions using particular endonucleases (Cel I, Endo I) as described in WO 2006/010646.
Dans un autre mode de réalisation, l'inhibition est obtenue par transformation de la plante avec un vecteur contenant un construit sens ou antisens du gène cible. Ces deux méthodes sont connues pour permettre, dans certaines conditions, l'inhibition du gène cible. On utilise également la méthode de l'interférence d'ARN (RNAi) qui est particulièrement efficace pour l'extinction de gènes dans les plantes. Cette méthode est bien connue de l'homme du métier et consiste en la transformation de la plante avec un construit produisant, après transcription, un duplex double-brin d'ARN, dont l'un des brins est complémentaire à l'ARNm du gène cible (pour revue sur les techniques d'inhibition post- transcriptionnelles, Chicas et Macino, EMBO reports, 21 (1 1 ), 992-996,2001 ; pour revue sur l'utilisation des ARN interférents, Hannon, Nature, 418,244-251 , 2002).
La présente invention a ainsi notamment pour objet l'utilisation d'au moins un polynucléotide choisi parmi : In another embodiment, the inhibition is achieved by transforming the plant with a vector containing a sense or antisense construct of the target gene. These two methods are known to allow, under certain conditions, the inhibition of the target gene. The method of RNA interference (RNAi) is also used which is particularly effective for the extinction of genes in plants. This method is well known to those skilled in the art and consists of transforming the plant with a construct producing, after transcription, a double-stranded duplex of RNA, one of whose strands is complementary to the mRNA of the gene. target (for review on post-transcriptional inhibition techniques, Chicas and Macino, EMBO reports, 21 (1 1), 992-996,2001, for review of the use of interfering RNAs, Hannon, Nature, 418,244-251 , 2002). The present invention thus particularly relates to the use of at least one polynucleotide chosen from:
a) un polynucléotide codant pour une protéine Prec31 telle que définie ci- dessus ; a) a polynucleotide encoding a Prec31 protein as defined above;
b) un polynucléotide complémentaire d'un polynucléotide a) ci-dessus ; c) un fragment d'au moins 12 nucléotides consécutifs, d'un polynucléotide a) ou b) ci-dessus, ou capable de s'hybrider sélectivement avec ledit polynucléotide ; b) a polynucleotide complementary to a polynucleotide a) above; c) a fragment of at least 12 consecutive nucleotides, a polynucleotide a) or b) above, or capable of hybridizing selectively with said polynucleotide;
d) un polynucléotide permettant la production d'un duplex utilisable pour l'interférence d'ARN (RNAi), ledit un polynucléotide contenant un polynucléotide X contenant au moins 12 nucléotides, de préférence au moins 15, avantageusement au moins 20, et de manière tout à fait préférée au moins 50 nucléotides capable de s'hybrider sélectivement avec un polynucléotide défini en a), ainsi qu'un polynucléotide Y complémentaire dudit polynucléotide X d) a polynucleotide allowing the production of a duplex that can be used for the interference of RNA (RNAi), said polynucleotide containing a polynucleotide X containing at least 12 nucleotides, preferably at least 15, advantageously at least 20, and at least 50 nucleotides capable of selectively hybridizing with a polynucleotide defined in a) and a complementary polynucleotide Y of said polynucleotide X
pour obtenir une plante présentant une date de floraison plus précoce. to obtain a plant with an earlier flowering date.
Un polynucléotide codant pour Prec31 est un polynucléotide contenant l'information génétique permettant la synthèse de la protéine Prec31 représentée par SEQ ID N° 1 , ou d'une protéine présentant au moins 75 %, de préférence au moins 85 %, ou au moins 90 %, avantageusement au moins 94 %, et de manière tout à fait préférée au moins 95 %, de manière plus préférée au moins 97 % d'identité avec SEQ ID N° 1 . A polynucleotide encoding Prec31 is a polynucleotide containing the genetic information for the synthesis of the Prec31 protein represented by SEQ ID No. 1, or a protein having at least 75%, preferably at least 85%, or at least 90%. %, advantageously at least 94%, and most preferably at least 95%, more preferably at least 97% identity with SEQ ID No. 1.
Ceci englobe notamment l'ADN génomique, dont la séquence SEQ ID N° 2 représentée en annexe représente un allèle, ainsi que l'ADNc correspondant (SEQ ID N° 3). La partie codante comprend les nucléotides 979-1674, 4667-4948 et 5712-5831 (codon STOP inclus) de SEQ ID N° 2 This includes in particular genomic DNA, whose sequence SEQ ID No. 2 represented in the appendix represents an allele, as well as the corresponding cDNA (SEQ ID No. 3). The coding portion comprises nucleotides 979-1674, 4667-4948 and 5712-5831 (STOP codon included) of SEQ ID NO: 2
Un fragment spécifique d'un polynucléotide a) ou b) ci-dessus est un fragment dudit polynucléotide dont la séquence n'est pas trouvée dans d'autres gènes de la même plante. A specific fragment of polynucleotide a) or b) above is a fragment of said polynucleotide whose sequence is not found in other genes of the same plant.
Un polynucléotide capable de s'hybrider sélectivement avec un polynucléotide a) ou b) ci-dessus, est un polynucléotide qui lorsqu'il est hybridé en conditions stringentes avec une banque d'acide nucléique de la même plante (notamment une banque d'ADN génomique, ou d'ADNc) produit un signal d'hybridation détectable au moins 2 fois supérieur, et de préférence au moins 5
fois supérieur au bruit de fond avec ledit polynucléotide, mais ne produit aucun signal détectable avec d'autres séquences de ladite banque. A polynucleotide capable of hybridizing selectively with polynucleotide a) or b) above, is a polynucleotide which when hybridized under stringent conditions with a nucleic acid library of the same plant (especially a DNA library genomic, or cDNA) produces a detectable hybridization signal at least 2 times higher, and preferably at least 5 times higher than the background with said polynucleotide, but produces no detectable signal with other sequences of said bank.
L'homme du métier est capable de définir la stringence des conditions d'hybridation, qui dépendent de la taille et de la composition en bases du polynucléotide concerné, ainsi que de la composition du mélange d'hybridation (notamment pH et force ionique). Généralement, des conditions stringentes, pour un polynucléotide de taille et de séquence données, sont obtenues en opérant à une température inférieure d'environ 5 °C à 10 °C à la température de fusion (Tm) de l'hybride formé, dans le même mélange réactionnel, par ce polynucléotide et son complémentaire. Those skilled in the art are able to define the stringency of the hybridization conditions, which depend on the size and base composition of the polynucleotide concerned, as well as the composition of the hybridization mixture (in particular pH and ionic strength). Generally, stringent conditions, for a polynucleotide of given size and sequence, are obtained by operating at a temperature of about 5 ° C. to 10 ° C. below the melting point (Tm) of the hybrid formed, same reaction mixture, with this polynucleotide and its complement.
La présente invention concerne en particulier pour objet un procédé pour avancer la date de floraison d'une plante, par inhibition totale ou partielle de la protéine Prec31 endogène de ladite plante, comprenant la transformation de ladite plante avec une construction d'ADN recombinant comprenant un polynucléotide tel que défini ci-dessus, placé en orientation sens ou en orientation antisens, ou pouvant être transcrit en ARN double brin, sous contrôle transcriptionnel d'un promoteur approprié. The present invention relates in particular to a method for advancing the date of flowering of a plant, by total or partial inhibition of the endogenous prec31 protein of said plant, comprising the transformation of said plant with a recombinant DNA construct comprising a polynucleotide as defined above, placed in direction orientation or antisense orientation, or can be transcribed into double-stranded RNA, under transcriptional control of a suitable promoter.
L'invention se rapporte également à une méthode pour retarder la date de floraison d'une plante, par surexpression d'une protéine Prec31 dans ladite plante. Cette surexpression est réalisée par transformation de ladite plante avec une construction d'ADN recombinant comprenant un polynucléotide tel que défini ci- dessus sous contrôle transcriptionnel d'un promoteur approprié. Les plantes transgéniques ainsi obtenues sont également objet de l'invention. The invention also relates to a method for delaying the flowering date of a plant by overexpressing a Prec31 protein in said plant. This overexpression is achieved by transformation of said plant with a recombinant DNA construct comprising a polynucleotide as defined above under transcriptional control of a suitable promoter. The transgenic plants thus obtained are also the subject of the invention.
La présente invention a également pour objet des constructions d'ADN recombinant, comprenant un polynucléotide tel que défini ci-dessus. Ces constructions sont notamment des cassettes d'expression, comprenant un polynucléotide tel que défini ci-dessus, sous contrôle transcriptionnel d'un promoteur approprié. Ces cassettes d'expression peuvent également contenir d'autres éléments de régulation, en particulier des éléments de régulation de la transcription tels que des terminateurs, amplificateurs. The present invention also relates to recombinant DNA constructs comprising a polynucleotide as defined above. These constructs are in particular expression cassettes, comprising a polynucleotide as defined above, under transcriptional control of a suitable promoter. These expression cassettes may also contain other regulatory elements, in particular transcriptional regulatory elements such as terminators, amplifiers.
Des vecteurs recombinants qui comprennent des polynucléotides tels que définis selon l'invention ou une cassette d'expression selon l'invention sont également objets de l'invention.
De tels vecteurs peuvent également comprendre d'autres éléments, par exemple un ou plusieurs marqueurs de sélection, et sont notamment utilisables pour l'obtention de plantes transgéniques. Recombinant vectors which comprise polynucleotides as defined according to the invention or an expression cassette according to the invention are also objects of the invention. Such vectors may also comprise other elements, for example one or more selection markers, and may especially be used for obtaining transgenic plants.
A titre d'exemples non-limitatifs de promoteurs utilisables dans le cadre de la présente invention, on peut citer les promoteurs constitutifs, tels que le promoteur 35S du virus de la mosaïque du chou-fleur (CaMV), ou ses dérivés, le promoteur du virus de la mosaïque des nervures de manioc (CsVMV) (WO 97/48819), le promoteur de l'ubiquitine ou le promoteur Actine-lntron-actine, du riz (McEIroy et.al., Mol. Gen. Genet.,231 , 150-160,1991 ; GenBank S 44221 ). As non-limiting examples of promoters that may be used in the context of the present invention, mention may be made of the constitutive promoters, such as the 35S promoter of cauliflower mosaic virus (CaMV), or its derivatives, the promoter Cassava vein mosaic virus (CsVMV) (WO 97/48819), ubiquitin promoter or actin-intron-actin promoter, rice (McEIroy et al., Mol. Gen. Genet., 231, 150-160, 1991; GenBank S 44221).
Des promoteurs inductibles ou tissu-spécifiques peuvent également être utilisés. Ceci permet de n'induire l'inhibition de Prec31 qu'à certains stades du développement de la plante, dans certaines conditions environnementales, ou dans certains tissus cibles, comme par exemple, les tiges, les feuilles, les graines, les spathes, le cortex ou le xylème. Inducible or tissue-specific promoters can also be used. This allows to induce the inhibition of Prec31 only at certain stages of the plant's development, under certain environmental conditions, or in certain target tissues, such as, for example, stems, leaves, seeds, spathes, the cortex or xylem.
On utilise également avantageusement d'autres éléments de régulation de la transcription tels des terminateurs, et notamment le terminateur 3'NOS de la nopaline synthase (Depicker et al., J. Mol. Appl. Genêt., 1 , 561 -573,1982), ou le terminateur 3'CaMV (Franck et al. Cell, 21 ,285-294,1980 ; GenBank V00141 ). Advantageously, other transcriptional regulatory elements such as terminators, and in particular the 3'NOS terminator of nopaline synthase (Depicker et al., J. Mol Appl. Genet., 1, 561 -573, 1982 ), or the 3'CaMV terminator (Franck et al Cell, 21, 285-294, 1980, GenBank V00141).
Les gènes marqueurs de sélection utilisables dans le cadre de la présente invention sont notamment des gènes conférant une résistance à un antibiotique tel que l'hygromycine, la kanamycine, la bléomycine ou la streptomycine, ou à un herbicide (EP 0 242 246) tel que le glufosinate, le glyphosate ou la bromoxynil. Le gène nptll qui confère la résistance à la kanamyine peut ainsi être utilisé. The marker genes of selection that may be used in the context of the present invention are, in particular, genes conferring resistance to an antibiotic such as hygromycin, kanamycin, bleomycin or streptomycin, or to a herbicide (EP 0 242 246) such as glufosinate, glyphosate or bromoxynil. The nptll gene which confers resistance to kanamyine can thus be used.
La transformation des plantes peut s'effectuer par de nombreuses méthodes, connues en elles-mêmes de l'homme du métier. Plant transformation can be carried out by many methods, known in themselves to those skilled in the art.
On peut par exemple transformer des cellules végétales, des protoplastes ou des explants, et régénérer une plante entière à partir du matériel transformé. La transformation peut ainsi être réalisée, par transfert des vecteurs conformes à l'invention dans des protoplastes, notamment après incubation de ces derniers dans une solution de polyéthylèneglycol (PG) en présence de cations divalents (Ca2+) selon la méthode décrite dans l'article de Krens et al. (Nature, 296,72- 74,1982) ou par électroporation notamment selon la méthode décrite dans l'article de Fromm et al. (Nature, 319,791 -793, 1986). On peut également utiliser un canon à gène permettant la projection, à très grande vitesse, de particules métalliques recouvertes des séquences d'ADN d'intérêt, délivrant ainsi des gènes à l'intérieur du noyau cellulaire, notamment selon la technique décrite dans l'article de Finer et
al. (Plant Cell Report, 1 1 ,323- 328,1992) ou la micro-injection cytoplasmique ou nucléaire. For example, it is possible to transform plant cells, protoplasts or explants, and to regenerate an entire plant from the transformed material. The transformation can thus be carried out by transfer of the vectors according to the invention into protoplasts, in particular after incubation of the latter in a solution of polyethylene glycol (PG) in the presence of divalent cations (Ca 2+) according to the method described in the article. Krens et al. (Nature, 296, 72-74, 1982) or by electroporation notably according to the method described in the article by Fromm et al. (Nature, 319, 791-793, 1986). It is also possible to use a gene gun which can be used to project, at very high speed, metal particles covered with the DNA sequences of interest, thereby delivering genes inside the cell nucleus, in particular according to the technique described in article by Finer and al. (Plant Cell Report, 11, 323-328, 1992) or cytoplasmic or nuclear microinjection.
On utilise préférentiellement la méthode de transformation par Agrobacterium tumefaciens, notamment selon la méthode décrite par Ishida et al. (1996, Nature Biotechnol. 14, 745-50). The method of transformation with Agrobacterium tumefaciens is preferably used, in particular according to the method described by Ishida et al. (1996, Nature Biotechnol 14, 745-50).
La présente invention a également pour objet les cellules végétales et les plantes transgéniques ou mutantes susceptibles d'être obtenues par un procédé conforme à l'invention, et les cellules et plantes contenant un polynucléotide recombinant ou une cassette d'expression tels que définis ci-dessus. L'invention se rapporte également aux cellules végétales et aux plantes obtenues après mutation du gène codant de Prec31 de telle sorte qu'il en résulte une inhibition de l'expression et/ou l'activité de la protéine. The subject of the present invention is also the plant cells and the transgenic or mutant plants that can be obtained by a process according to the invention, and the cells and plants containing a recombinant polynucleotide or an expression cassette as defined above. above. The invention also relates to the plant cells and plants obtained after mutation of the coding gene of Prec31 so that it results in an inhibition of the expression and / or the activity of the protein.
Bien entendu, la présente invention englobe les plantes dérivées de plantes selon l'invention, qui sont notamment les descendants, notamment les hybrides issus d'un croisement impliquant au moins une plante selon l'invention, obtenus par semis ou par multiplication végétative, des plantes selon l'invention ou obtenues directement ou indirectement par un procédé selon l'invention. Of course, the present invention encompasses the plants derived from plants according to the invention, which are in particular the descendants, in particular the hybrids resulting from a cross involving at least one plant according to the invention, obtained by sowing or by vegetative propagation, of plants according to the invention or obtained directly or indirectly by a method according to the invention.
L'invention comprend également les cellules et tissus végétaux, ainsi que les organes ou parties de plantes, y compris feuilles, tiges, racines, fleurs, fruits, et/ou graines obtenues à partir d'une plante conforme à l'invention. The invention also includes plant cells and tissues, as well as organs or parts of plants, including leaves, stems, roots, flowers, fruits, and / or seeds obtained from a plant according to the invention.
De façon préférée, l'invention s'applique au maïs et aux cellules et tissus issus de maïs. L'invention se rapporte en particulier à un maïs ou un grain de maïs présentant un allèle du gène Prec31 , appelé delta-Prec31 comprenant une insertion d'un transposon dans la région 3' non-traduite, 297 nucléotides après la codon STOP de la région traduite, ledit allèle étant présent dans un échantillon représentatif de graines déposées au NCIMB sous le numéro NCIMB 41706. Preferably, the invention applies to corn and cells and tissues derived from corn. In particular, the invention relates to maize or maize grain having an allele of the Prec31 gene, termed delta-Prec31 comprising an insertion of a transposon in the 3 'untranslated region, 297 nucleotides after the STOP codon of the translated region, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41706.
Des graines possédant l'allèle delta-Prec31 ont été déposées au NCIMB Limited, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, Scotland, AB21 9YA, UK, le 15 mars 2010, selon les dispositions du Traité de Budapest, sous le numéro NCIMB 41706.
La présente invention a aussi pour objet un procédé de sélection de maïs, ou à un procédé d'identification d'un maïs utilisable dans un schéma de sélection destiné à obtenir un maïs présentant une date de floraison précoce (plus précoce que la date moyenne de floraison des maïs utilisés dans le schéma de sélection), caractérisé en ce qu'il comprend la recherche d'un allèle du gène de Prec31 possédant une mutation résultant en une date de floraison anticipée dudit maïs, par rapport à un maïs ne possédant pas cet allèle. Ce procédé est directement lié à la démonstration du rôle de Prec31 dans la précocité de la date dé floraison. Seeds with the delta-Prec31 allele were deposited at NCIMB Limited, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, Scotland, AB21 9YA, UK, on March 15, 2010, under the provisions of the Budapest Treaty, under the number NCIMB 41706. The present invention also relates to a method of selecting maize, or to a method of identifying maize that can be used in a selection scheme intended to obtain a maize having an early flowering date (earlier than the average date of flowering of the maize used in the selection scheme), characterized in that it comprises the search for an allele of the Prec31 gene having a mutation resulting in an anticipated flowering date of said corn, compared to a maize not having this allele. This process is directly related to the demonstration of the role of Prec31 in the early flowering date.
. Dans un cas préféré, ladite mutation résulte en une inhibition totale ou partielle de l'expression et/ou de l'activité de Prec31 . . In a preferred case, said mutation results in a total or partial inhibition of the expression and / or activity of Prec31.
Ledit allèle peut être recherché par détection directe de la mutation responsable de l'inhibition; il peut également être recherché par détection de la forme allélique associée à cette mutation d'un polymorphisme en déséquilibre de liaison avec celle-ci. Said allele can be searched by direct detection of the mutation responsible for the inhibition; it can also be sought by detecting the allelic form associated with this mutation of a polymorphism in linkage disequilibrium therewith.
Ces allèles mutants ainsi identifiés peuvent ensuite être introgressés dans des lignées choisies, et notamment dans des lignées élites à savoir des lignées présentant un potentiel agronomique et commercial important. These mutant alleles thus identified can then be introgressed in selected lines, and in particular in elite lines, namely lines with significant agronomic and commercial potential.
Dans un mode de réalisation particulier, on recherche un polymorphisme localisé au nucléotide 5089 de SEQ ID N° 2. Lorsque le nucléotide est un T, la floraison est avancée. Lorsque le polymorphisme est une délétion, la floraison est plus tardive. In a particular embodiment, a localized polymorphism is sought at nucleotide 5089 of SEQ ID No. 2. When the nucleotide is a T, the flowering is advanced. When the polymorphism is a deletion, the bloom is later.
Dans un mode de réalisation particulier, on recherche un polymorphisme localisé au nucléotide 5025 de SEQ ID N° 2. Lorsque le nucléotide est un G, la floraison est avancée. Lorsque le nucléotide est un T, la floraison est plus tardive. In a particular embodiment, a localized polymorphism is sought at nucleotide 5025 of SEQ ID No. 2. When the nucleotide is a G, the flowering is advanced. When the nucleotide is T, flowering is later.
Dans un mode de réalisation particulier, on recherche un polymorphisme localisé au nucléotide 4961 de SEQ ID N° 2. Lorsque le nucléotide est un A, la floraison est avancée. Lorsque le nucléotide est un C, la floraison est plus tardive. In a particular embodiment, a localized polymorphism is sought at nucleotide 4961 of SEQ ID No. 2. When the nucleotide is an A, the flowering is advanced. When the nucleotide is a C, flowering is later.
Dans un mode de réalisation particulier, on recherche la présence de deux polymorphismes aux nucléotides 5089 et 5025 de SEQ ID N° 2. Dans un autre mode de réalisation, on recherche la présence de deux polymorphismes aux nucléotides 5089 et 4961 de SEQ ID N° 2. Dans un autre mode de réalisation, on recherche la présence de deux polymorphismes aux nucléotides 5025 et 4961 de SEQ ID N° 2. In a particular embodiment, the presence of two polymorphisms is sought for nucleotides 5089 and 5025 of SEQ ID No. 2. In another embodiment, the presence of two polymorphisms is sought for nucleotides 5089 and 4961 of SEQ ID NO. 2. In another embodiment, the presence of two polymorphisms is sought for nucleotides 5025 and 4961 of SEQ ID NO: 2.
Dans un autre mode de réalisation, on recherche la présence des trois polymorphismes aux nucléotides 4961 , 5025 et 5089 de SEQ ID N° 2.
Il est à noter que l'on observe souvent la présence de deux haplotypes A / G / T, et C / T / -, correspondant à un allèle précoce pour le premier, et un allèle tardif pour le second. De façon préférée, le maïs transgénique selon l'invention est un maïsIn another embodiment, the presence of the three polymorphisms is sought for nucleotides 4961, 5025 and 5089 of SEQ ID No. 2. It should be noted that the presence of two haplotypes A / G / T and C / T / - is often observed, corresponding to an early allele for the first, and a late allele for the second. Preferably, the transgenic maize according to the invention is a maize
« élite ». L'homme du métier connaît bien la définition d'un maïs élite. Il s'agit d'un maïs destiné à générer des hybrides destinés à être commercialisés par croisement avec un autre maïs élite. Un maïs élite est défini comme tel en relation avec le territoire envisagé pour la commercialisation, ainsi que le(s) caractère(s) agronomique(s) recherché(s) pour la descendance hybride. Il s'agit notamment d'un maïs pouvant être inscrit dans un catalogue de référence. "Elite". Those skilled in the art are familiar with the definition of elite maize. It is a corn intended to generate hybrids intended to be marketed by crossing with another elite corn. An elite maize is defined as such in relation to the territory envisaged for marketing, as well as the agronomic character (s) sought for hybrid offspring. This includes a corn that can be included in a reference catalog.
Ainsi, si la descendance est destinée à l'alimentation animale, on évaluera les caractères de rendement (recherche d'un rendement élevé et régulier en tonnage de matière sèche à l'hectare), d'ingestibilité et de digestibilité, lorsque l'on évalue la nature « élite du maïs ». Si la descendance est destinée à la production de biocarburants, tels les biofuels ou les biogaz, on évalue les maïs présentant le meilleur rendement énergétique après transformation. Thus, if the offspring is intended for animal feed, we will evaluate the characteristics of yield (search for a high and regular yield in dry matter tonnage per hectare), ingestibility and digestibility, when evaluates the "elite corn" nature. If the offspring is for the production of biofuels, such as biofuels or biogas, the maize with the highest energy efficiency after processing is evaluated.
Afin de déterminer le caractère élite d'un maïs, on compare des hybrides obtenus à partir de celui-ci aux hybrides commerciaux de référence (vendus pour le même objectif dans la même région), par des essais en champs, par relevé et mesures de caractères agronomiques appropriés à l'objectif recherché. Un maïs est défini comme élite si les résultats obtenus paramètres étudiés pour un hybride obtenu par croisement dudit maïs sont supérieurs à 90 % aux résultats relevés pour les mêmes paramètres des hybrides de référence. In order to determine the elite character of a maize, hybrids obtained from it are compared to commercial reference hybrids (sold for the same purpose in the same region), field trials, survey surveys, and control measures. agronomic traits appropriate to the objective sought. A corn is defined as elite if the results obtained parameters studied for a hybrid obtained by crossing said maize are greater than 90% to the results recorded for the same parameters of the reference hybrids.
Ainsi, un maïs élite est un maïs rassemblant le maximum de caractéristiques agronomiques nécessaires pour une pénétration économique du marché visé. Le marché du maïs étant aujourd'hui un marché d'hybrides, l'évaluation du caractère élite d'un maïs s'effectue également par l'aptitude dudit maïs à la combinaison/production d'hybrides. Thus, an elite maize is a corn gathering the maximum of agronomic characteristics necessary for an economic penetration of the target market. As the corn market is now a hybrid market, the evaluation of the elite character of maize is also done by the ability of the maize to combine / produce hybrids.
Ainsi, la mise en œuvre de la présente invention permet d'obtenir un maïs élite destiné à la commercialisation d'hybrides pour toute utilisation, ledit maïs présentant une précocité de floraison. Ce maïs élite est donc homozygote pour l'allèle delta-Prec31 . Thus, the implementation of the present invention makes it possible to obtain an elite maize intended for marketing hybrids for any use, said maize having a precocious flowering period. This elite maize is homozygous for the delta-Prec31 allele.
Dans un autre mode de réalisation, l'invention permet d'obtenir un maïs hybride obtenu par croisement de deux lignées parentes homozygotes, ledit maïs hybride présentant un allèle delta-Prec31 . Ce maïs hybride peut être homozygote
(si chaque parent homozygote présente l'allèle delta-Prec31 ) ou hétérozygote pour l'allèle. In another embodiment, the invention makes it possible to obtain a hybrid maize obtained by crossing two homozygous parent lines, said hybrid maize having a delta-Prec31 allele. This hybrid corn can be homozygous (if each homozygous parent has the Delta-Prec31 allele) or heterozygote for the allele.
Toute plante telle que décrite plus haut (transgénique ou mutante) peut contenir un ou plusieurs transgènes en plus des éléments inhibant Prec31 et de l'allèle delta-Prec31 . On peut citer des transgènes conférant une stérilité mâle, une fertilité mâle, la résistance à un herbicide (notamment le glyphosate, le glufosinate, l'imidazolinone, la sulfonylurée, la L-phosphinotricine, la triazine, le benzonitrile), la résistance aux insectes (notamment un transgène codant pour une toxine de Bacillus thuringiensis), la tolérance au stress hydrique. Ces plantes peuvent être obtenus en croisant lesdites plantes de l'invention avec d'autres plantes contenant lesdits transgènes. Alternativement, on peut co-transformer des plantes avec une cassette d'expression contenant plusieurs transgènes différents, dont ceux inhibant Prec31 . Any plant as described above (transgenic or mutant) may contain one or more transgenes in addition to Prec31 inhibitory elements and delta-Prec31 allele. Mention can be made of transgenes conferring male sterility, male fertility, resistance to a herbicide (especially glyphosate, glufosinate, imidazolinone, sulfonylurea, L-phosphinotricin, triazine, benzonitrile), insect resistance (including a transgene encoding Bacillus thuringiensis toxin), tolerance to water stress. These plants can be obtained by crossing said plants of the invention with other plants containing said transgenes. Alternatively, plants can be co-transformed with an expression cassette containing several different transgenes, including those inhibiting Prec31.
L'invention se rapporte en particulier à une méthode pour obtenir un maïs présentant une date de floraison précoce, comprenant l'introgression de l'allèle delta-Prec31 dans ledit maïs, comprenant les étapes consistant à : In particular, the invention relates to a method for obtaining a corn having an early flowering date, comprising introgressing the Delta-Prec31 allele in said corn, comprising the steps of:
a) croiser une première lignée de maïs présentant l'allèle delta-Prec31 avec un second maïs ne présentant pas ledit allèle, a) crossing a first maize line having the delta-Prec31 allele with a second maize not having said allele,
b) effectuer un génotypage de la descendance obtenue et sélectionner les descendants présentant l'allèle delta-Prec31 , et optionnellement ayant le meilleur génome ratio pour ce qui est dudit second maïs, c) effectuer un rétrocroisement desdits descendants avec ladite seconde lignée de maïs élite utilisable pour la production d'hybrides, d) répéter si nécessaire les étapes b) et c) jusqu'à obtenir une lignée isogénique dudit second maïs, présentant l'allèle delta-Prec31 , e) de façon optionnelle, effectuer une auto-fécondation afin d'obtenir une plante homozygote pour l'allèle delta-Prec31. b) genotyping the obtained progeny and selecting progeny with the delta-Prec31 allele, and optionally having the best genome ratio for said second maize, c) backcrossing said progeny with said second elite maize line usable for the production of hybrids, d) if necessary repeat steps b) and c) until obtaining an isogenic line of said second maize, having the delta-Prec31 allele, e) optionally, perform self-fertilization to obtain a homozygous plant for the delta-Prec31 allele.
Lorsque la lignée de maïs présentant l'allèle delta-Prec31 est homozygote pour cet allèle, il n'est pas besoin de réaliser le génotypage prévu à l'étape b) après le premier croisement prévu à l'étape a). When the maize line having the delta-Prec31 allele is homozygous for this allele, there is no need to carry out the genotyping provided for in step b) after the first crossing provided in step a).
Ainsi, on peut utiliser les enseignements pour identifier des maïs utilisables dans un schéma de sélection destiné à sélectionner des maïs présentant une date
de floraison plus précoce que la date moyenne de floraison des maïs utilisés dans de schéma de sélection, par recherche de la présence de l'allèle delta-Prec31 Thus, the lessons can be used to identify usable maize in a selection scheme for selecting maize with a date flowering earlier than the average flowering date of the maize used in the selection scheme, by searching for the presence of the delta-Prec31 allele
Enfin, l'invention se rapporte à l'utilisation d'une plante, et notamment d'un maïs selon l'invention pour la préparation d'une composition destinée à l'alimentation humaine ou animale, ou à la préparation de biocarburants ou à toute autre application industrielle, ainsi qu'aux méthodes utilisant de telles plantes pour de telles applications. EXEMPLES Finally, the invention relates to the use of a plant, and in particular a corn according to the invention for the preparation of a composition intended for human or animal consumption, or for the preparation of biofuels or any other industrial application, as well as methods using such plants for such applications. EXAMPLES
Exemple 1 : caractérisation du mutant delta Prec31 Example 1 Characterization of the Delta Prec31 Mutant
Une lignée de maïs présentant une insertion d'un élément transposable après le G situé en position 6125 de la séquence de référence SEQ ID N° 2 est isolée. L'allèle ainsi obtenu est appelé delta-Prec31 . A corn line having an insertion of a transposable element after the G located in position 6125 of the reference sequence SEQ ID No. 2 is isolated. The resulting allele is called delta-Prec31.
Bien que présente dans la région 3' non traduite du gène, on suppose que cette insertion a pour conséquence de déréguler la transcription et/ou la traduction du gène Prec31 , ou la stabilité de l'ARNm de Prec31 , menant à une diminution de l'activité de la protéine en présence de l'allèle delta-Prec31 . Although present in the 3 'untranslated region of the gene, it is assumed that this insertion has the effect of deregulating the transcription and / or translation of the Prec31 gene, or the stability of the Prec31 mRNA, leading to a decrease in activity of the protein in the presence of the delta-Prec31 allele.
Afin d'étudier plus précisément l'effet de l'insertion observée dans le gène In order to study more precisely the effect of the observed insertion in the gene
Prec31 dans un maïs élite, on effectue des back-cross (rétrocroisements) successifs avec une lignée élite de maïs. Prec31 in an elite maize, we carry out backcrosses with an elite line of maize.
Cette méthode permet très rapidement d'obtenir des lignées quasi isogéniques ne différant que par le locus portant l'allèle modifié, les descendants étant testés pour posséder un ratio génome le plus proche possible de celui du parent élite tout en ayant l'allèle que l'on désire introgresser. Ces tests sont assistés par marqueurs moléculaires (techniques bien connues, microsatellites, AFLP...). Pour essayer d'apprécier l'effet de l'insertion au plus tôt (obtention de plantes homozygotes), des autofécondations sont réalisées aux différents stades intermédiaires de back cross. This method makes it possible very quickly to obtain quasi-isogenic lines differing only in the locus carrying the modified allele, the descendants being tested to have a ratio genome as close as possible to that of the elite parent while having the allele that the we want to introgress. These tests are assisted by molecular markers (well known techniques, microsatellites, AFLP ...). To try to appreciate the effect of the insertion at the earliest (obtaining homozygous plants), self-fertilization is carried out at the different intermediate stages of backcross.
On évalue ainsi la précocité sur les plantes BC3S1 (3 rétrocroisements dans une lignée élite, 1 auto-fécondation). The precocity is thus evaluated on BC3S1 plants (3 backcrosses in an elite line, 1 self-fertilization).
On observe les résultats suivants The following results are observed
Floraison mâle (FM) : Précocification significative à l'état homozygote mutant par rapport à l'homozygote sauvage quasi-isogénique. L'effet est très net : P value =
0,0046 et différence significative de 5 jours entre les moyennes de floraison des homozygotes mutants comparées aux moyennes de floraison des homozygotes sauvages. Male flowering (FM): Significant precociation in the homozygous mutant state compared to the quasi-isogenic wild homozygote. The effect is very clear: P value = 0.0046 and a significant difference of 5 days between flowering averages of mutant homozygotes compared to flowering averages of wild homozygotes.
Floraison femelle (FF) : Précocification également significative à l'état homozygote mutant par rapport à l'homozygote sauvage quasi-isogénique. P value = 0,0221 et différence significative de 4 jours entre les moyennes de floraison des homozygotes mutants comparées aux moyennes de floraison des homozygotes sauvages. Female flowering (FF): Precociation also significant in the homozygous mutant state compared to the quasi-isogenic wild homozygote. P value = 0.0221 and a significant difference of 4 days between flowering averages of mutant homozygotes compared to flowering averages of wild homozygotes.
La mutation engendre donc une précocification de l'ordre de 4 à 5 jours, tant pour la floraison mâle que pour la floraison femelle. The mutation therefore gives rise to a precociation of about 4 to 5 days, both for male flowering and for female flowering.
Afin de déterminer si l'insertion est sous forme homozygote ou hétérozygote, on peut utiliser un couple d'amorces : In order to determine whether the insertion is in homozygous or heterozygous form, a pair of primers can be used:
SEQ ID N° 6 : GATTGCAGGACTCGATCAA, en amont de l'insertion, et une amorce de séquence SEQ ID N° 7 : TTTAAC C C AAAC AC AAC AG G , en aval de l'insertion. SEQ ID NO: 6: GATTGCAGGACTCGATCAA, upstream of the insertion, and a primer of SEQ ID NO: 7: TTTAAC C C AAAC AC AAC AG G, downstream of the insertion.
En plus de ces deux amorces l'amorce OMuA SEQ ID N°8 CTTCGTCCATAATGGCAATTATCTC spécifique de l'élément transposable endogène est utilisée. Cette amorce est dirigée vers « l'extérieur » du transposon. Ces trois amorces peuvent être utilisées simultanément dans une expérience d'amplification PCR à partir d'ADN génomique (Température d'hybridation = 58°C). Le dépôt sur gel des produits d'amplification révèle : In addition to these two primers, the specific OMuA SEQ ID No. 8 CTTCGTCCATAATGGCAATTATCTC primer of the endogenous transposable element is used. This primer is directed to the "outside" of the transposon. These three primers can be used simultaneously in a PCR amplification experiment from genomic DNA (Hybridization temperature = 58 ° C.). The gel deposition of the amplification products reveals:
- l'obtention d'une seule bande d'environ 450 pb de long pour des plantes dites sauvages à ce locus (c'est à dire n'ayant pas la mutation) ; - Obtaining a single band of about 450 bp long for so-called wild plants at this locus (ie not having the mutation);
- l'obtention d'une bande de l'ordre de 500 pb pour des plantes homozygotes mutantes obtaining a band of the order of 500 bp for homozygous mutant plants
- ou l'obtention des deux bandes pour des plantes hétérozygotes. or obtaining the two bands for heterozygous plants.
Exemple 2 : recherche d'autres mutations dans le gène Prec31 Example 2: Search for Other Mutations in the Prec31 Gene
On utilise les amorces TGAGTGGACATGCTTGACC (SEQ ID N° 4) et CGTATAACACGGAAGCTGAC (SEQ ID N° 5) pour amplifier une région chevauchant la fin du second exon et le début du second intron du gène Prec31. Primers TGAGTGGACATGCTTGACC (SEQ ID NO: 4) and CGTATAACACGGAAGCTGAC (SEQ ID NO: 5) were used to amplify a region overlapping the end of the second exon and the beginning of the second intron of the Prec31 gene.
Ces amorces amplifient une région de 754 nucléotides allant du nucléotide 4803 au nucléotide 5556 de SEQ ID N°2. These primers amplify a region of 754 nucleotides ranging from nucleotide 4803 to nucleotide 5556 of SEQ ID No. 2.
On observe la présence de 3 polymorphismes, localisés à 4961 , 5025 et 5089 de SEQ ID N° 2. The presence of 3 polymorphisms located at 4961, 5025 and 5089 of SEQ ID No. 2 is observed.
Ces nucléotides présentent l'effet suivant sur la date de floraison :
Polymorphisme Allèlel Effet Allèle 2 EffetThese nucleotides have the following effect on the flowering date: Polymorphism Allelel Effect Allele 2 Effect
4961 C 25,94 A - 25,944961 C 25.94 A - 25.94
5025 T 25,77 G -25,775025 T 25.77G -25.77
5089 - 25,57 T -25,57 5089 - 25.57 T -25.57
Les effets sont indiqués en degré-jours. De fait, lorsque la variabilité interannuelle des températures est grande, on évalue la durée des cycles de développement, non pas en nombre de jours, mais en somme de degrés-jour. De façon simplifiée, la somme des degrés-jours correspond à la somme des températures journalières moyennes. Dans le cas présent, la température observée lors de la floraison étant de l'ordre de 20°C, les polymorphismes précocifient ou retardent la date de floraison d'un peu plus d'une journée. La comparaison est effectuée par rapport à la moyenne des dates de floraison pour l'ensemble des lignées d'un panel de 374 lignées de maïs représentant une large diversité génétique. Les dates retenues pour chacun des polymorphismes correspondent à la moyenne des dates de floraison pour toutes les lignées contenant ledit polymorphisme. Effects are indicated in degree-days. In fact, when the interannual variability of the temperatures is great, the duration of the cycles of development is evaluated, not in number of days, but in sum of degree-days. In a simplified way, the sum of the degree-days corresponds to the sum of the average daily temperatures. In this case, the temperature observed during flowering being of the order of 20 ° C, polymorphisms precociate or delay the date of flowering a little more than a day. The comparison is made with respect to the average flowering dates for all the lines of a panel of 374 maize lines representing a wide genetic diversity. The dates used for each of the polymorphisms correspond to the average of the flowering dates for all the lines containing said polymorphism.
Du fait de la grande variabilité entre les lignées utilisées, cette méthode permet de minimiser l'effet des autres loci génétiques pouvant être impliqués dans la floraison. Because of the great variability between the lines used, this method makes it possible to minimize the effect of other genetic loci that may be involved in flowering.
Le SNP le plus associé à la précocité est situé en position 4961 de la séquence de référence SEQ ID N° 2. Il est très significatif (associé avec une pvalue de 5.1 10"4) et présente un allèle précocifiant A de 25.94 "jour et un allèle tardifiant C de 25.94°jour. Le pourcentage de variance phénotypique associé à ce locus est de 5%. The SNP most associated with the precocity is located at position 4961 of the reference sequence SEQ ID No. 2. It is very significant (associated with a pvalue of 5.1 × 10 -4 ) and has a precocious allele A of 25.94 "day. a late C allele of 25.94 ° day. The percentage of phenotypic variance associated with this locus is 5%.
Il est à noter que la séquence de référence SEQ ID N° 2 fournie pour permettre de localiser les polymorphismes du gène Prec31 possède les polymorphismes de l'haplotype 2, et est donc associée à une floraison précoce. It should be noted that the reference sequence SEQ ID No. 2 provided to enable the polymorphisms of the Prec31 gene to be located has the polymorphisms of haplotype 2, and is therefore associated with early flowering.
Ces résultats confirment l'implication du gène Prec31 dans le mécanisme de floraison. These results confirm the involvement of the Prec31 gene in the flowering mechanism.
Exemple 3 : expression de Prec31
Des échantillons tissulaires (apex, partie interne de la gaine et partie externe de la gaine) ont été récoltés à différents stades foliaire et notamment au stade 6,3 feuilles, c'est-à-dire le stade de transition florale (« switch » de la floraison) qui correspond à celui du passage du stade végétatif au stade floral. Example 3: Expression of Prec31 Tissue samples (apex, inner part of the sheath and outer part of the sheath) were harvested at different leaf stages and in particular at the 6.3-leaf stage, ie the flower transition stage ("switch"). flowering) which corresponds to that of the transition from the vegetative stage to the flower stage.
On a pu montrer que Prec31 a une expression transcriptionnelle différentielle entre la partie interne de gaine et la partie externe exposée à la lumière. Au stade 6,3 feuilles, le gène Prec31 est plus fortement exprimé dans la partie extérieure. Prec31 has been shown to have differential transcriptional expression between the inner sheath portion and the outer exposed portion of light. At the 6.3-leaf stage, the Prec31 gene is more strongly expressed in the outer part.
Ce profil d'expression est inverse celui du gène id1 (INDETERMINATE 1 ) chez le maïs (Colasanti et al, Cell, may 15,3(4) :593-603, 1998) connu pour induire la floraison. This expression profile is the opposite of that of the id1 gene (INDETERMINATE 1) in corn (Colasanti et al, Cell, May 15, 3 (4): 593-603, 1998) known to induce flowering.
Ces résultats, ajoutés au fait que le gène Prec31 colocalise avec un QTL de précocité de la floraison localisé sur le chromosome 8 (QTL au bin 8.05), confirment l'implication du gène Prec31 dans le mécanisme de floraison.
These results, coupled with the fact that the Prec31 gene colocalises with a QTL of early flowering localized on chromosome 8 (QTL bin 8.05), confirm the involvement of the Prec31 gene in the flowering mechanism.
Claims
Revendications claims
Procédé pour avancer la date de floraison d'une plante, caractérisé en ce que l'on inhibe totalement ou partiellement l'expression et/ou l'activité dans ladite plante, d'une protéine dénommée Prec31 , dont la séquence polypeptidique possède au moins 75% d'identité avec la séquence SEQ ID N° 1 . Process for advancing the flowering date of a plant, characterized in that the expression and / or activity in said plant of a protein called Prec31, whose polypeptide sequence has at least 75% identity with the sequence SEQ ID No. 1.
Procédé selon la revendication 1 , caractérisé en ce que ladite plante est le maïs. Process according to claim 1, characterized in that said plant is maize.
Utilisation d'au moins un polynucléotide choisi parmi : Use of at least one polynucleotide chosen from:
a) un polynucléotide codant pour une protéine Prec31 telle que définie dans la revendication 1 ; a) a polynucleotide encoding a Prec31 protein as defined in claim 1;
b) un polynucléotide complémentaire d'un polynucléotide a) ci-dessus ; c) un fragment d'au moins 12 nucléotides consécutifs, d'un polynucléotide a) ou b) ci-dessus, ou capable de s'hybrider sélectivement avec ledit polynucléotide ; b) a polynucleotide complementary to a polynucleotide a) above; c) a fragment of at least 12 consecutive nucleotides, a polynucleotide a) or b) above, or capable of hybridizing selectively with said polynucleotide;
d) un polynucléotide permettant la production d'un duplex utilisable pour l'interférence d'ARN (RNAi), ledit un polynucléotide contenant un polynucléotide X contenant au moins 12 nucléotides, de préférence au moins 15, avantageusement au moins 20, et de manière tout à fait préférée au moins 50 nucléotides capable de s'hybrider sélectivement avec un polynucléotide défini en a), ainsi qu'un polynucléotide Y complémentaire dudit polynucléotide X pour la mise en œuvre d'un procédé selon l'une des revendications 1 ou 2. d) a polynucleotide allowing the production of a duplex that can be used for the interference of RNA (RNAi), said polynucleotide containing a polynucleotide X containing at least 12 nucleotides, preferably at least 15, advantageously at least 20, and at least 50 nucleotides capable of hybridizing selectively with a polynucleotide defined in a) and a complementary polynucleotide Y of said polynucleotide X for the implementation of a method according to one of claims 1 or 2 are most preferably .
Procédé selon une quelconque des revendications 1 ou 2, caractérisé en ce que l'inhibition de l'expression et/ou de l'activité de l'enzyme Prec31 est obtenue par mutagenèse du gène codant pour ladite enzyme [ledit gène étant entendu comme comprenant les régions codantes et non codantes (5', 3', introns) du gène]. Process according to either of Claims 1 and 2, characterized in that the inhibition of the expression and / or activity of the Prec31 enzyme is obtained by mutagenesis of the gene encoding said enzyme [said gene being understood as comprising the coding and non-coding regions (5 ', 3', introns) of the gene].
Procédé selon une quelconque des revendications 1 ou 2, caractérisé en ce qu'il comprend la transformation de ladite plante avec une construction
d'ADN recombinant comprenant un polynucléotide tel que défini dans la revendication 3, sous contrôle transcriptionnel d'un promoteur approprié. Process according to either of Claims 1 and 2, characterized in that it comprises the transformation of said plant with a construction recombinant DNA construct comprising a polynucleotide as defined in claim 3, under transcriptional control of a suitable promoter.
Cassette d'expression comprenant un polynucléotide tel que défini dans la revendication 3, sous contrôle transcriptionnel d'un promoteur approprié. An expression cassette comprising a polynucleotide as defined in claim 3, under transcriptional control of a suitable promoter.
Vecteur recombinant contenant une cassette d'expression selon la revendication 6. Recombinant vector containing an expression cassette according to claim 6.
Plante susceptible d'être obtenu par le procédé selon la revendication 4, et présentant une mutation dans le gène codant pour la protéine Prec31 dont la séquence possède au moins 75 % d'identité avec SEQ ID N° 1 , ladite mutation résultant en une inhibition de l'expression et/ou l'activité de Prec31 . A plant obtainable by the process according to claim 4, and having a mutation in the gene encoding the Prec31 protein whose sequence has at least 75% identity with SEQ ID No. 1, said mutation resulting in inhibition of the expression and / or activity of Prec31.
Plante génétiquement modifiée, susceptible d'être obtenue par un procédé selon la revendication 5. A genetically modified plant obtainable by a process according to claim 5.
Plante selon l'une des revendications 8 ou 9, caractérisée en ce qu'il s'agit d'un maïs. Plant according to one of claims 8 or 9, characterized in that it is a corn.
Procédé de sélection de maïs, caractérisé en ce qu'il comprend la recherche d'un allèle du gène de la protéine Prec31 possédant une mutation résultant en une date de floraison anticipée dudit maïs par rapport à un maïs ne possédant pas cet allèle. A method of selecting maize, characterized in that it comprises searching for a gene allele of the Prec31 protein having a mutation resulting in an anticipated flowering date of said maize compared to a maize not having this allele.
Procédé selon la revendication 10, caractérisé ce que ledit allèle est représenté par SEQ ID N° 2. Process according to claim 10, characterized in that said allele is represented by SEQ ID No. 2.
Maïs présentant un allèle du gène Prec31 , appelé delta-Prec31 comprenant une insertion d'un transposon dans la région 3' non-traduite du gène Prec31 , ladite insertion étant localisée après le G situé en position 6125 de la séquence de référence SEQ ID N° 2, ledit allèle étant présent dans un échantillon représentatif de graines déposées au NCIMB sous le numéro NCIMB 41706.
Grain de maïs présentant un allèle du gène Prec31 , appelé delta-Prec31 comprenant une insertion d'un transposon dans la région 3' non-traduite du gène Prec31 , ladite insertion étant localisée après le G situé en position 6125 de la séquence de référence SEQ ID N° 2, ledit allèle étant présent dans un échantillon représentatif de graines déposées au NCIMB sous le numéro NCIMB 41706. A corn having an allele of the Prec31 gene, termed delta-Prec31 comprising an insertion of a transposon in the 3 'untranslated region of the Prec31 gene, said insertion being located after the G located in position 6125 of the reference sequence SEQ ID N ° 2, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41706. Corn grain having a Prec31 gene allele, designated delta-Prec31 comprising an insertion of a transposon in the 3 'untranslated region of the Prec31 gene, said insertion being located after the G located at position 6125 of the SEQ reference sequence ID No. 2, said allele being present in a representative sample of seeds deposited at NCIMB under the number NCIMB 41706.
Méthode pour obtenir un maïs présentant une date de floraison précoce, comprenant l'introgression de l'allèle delta-Prec31 dans ledit maïs, comprenant les étapes consistant à : A method for obtaining a corn having an early flowering date, comprising introgressing the Delta-Prec31 allele in said corn, comprising the steps of:
a) croiser une première lignée de maïs présentant l'allèle delta-Prec31 avec un second maïs ne présentant pas ledit allèle, a) crossing a first maize line having the delta-Prec31 allele with a second maize not having said allele,
b) effectuer un génotypage de la descendance obtenue et sélectionner les descendants présentant l'allèle delta-Prec31 , et optionnellement ayant le meilleur génome ratio pour ce qui est dudit second maïs, c) effectuer un rétrocroisement desdits descendants avec ladite seconde lignée de maïs élite utilisable pour la production d'hybrides, d) répéter si nécessaire les étapes b) et c) jusqu'à obtenir une lignée isogénique dudit second maïs, présentant l'allèle delta-Prec31 , e) de façon optionnelle, effectuer une auto-fécondation afin d'obtenir une plante homozygote pour l'allèle delta-Prec31. b) genotyping the obtained progeny and selecting progeny with the delta-Prec31 allele, and optionally having the best genome ratio for said second maize, c) backcrossing said progeny with said second elite maize line usable for the production of hybrids, d) if necessary repeat steps b) and c) until obtaining an isogenic line of said second maize, having the delta-Prec31 allele, e) optionally, perform self-fertilization to obtain a homozygous plant for the delta-Prec31 allele.
Utilisation d'un maïs selon l'une des revendications 10 ou 13, ou obtenu selon la méthode de la revendication 15 pour la préparation d'une composition destinée à l'alimentation humaine ou animale, ou à la préparation de biocarburants ou à toute autre application industrielle.
Use of a maize according to one of claims 10 or 13, or obtained according to the method of claim 15 for the preparation of a composition intended for human or animal consumption, or for the preparation of biofuels or any other industrial application.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP11708284A EP2547772A1 (en) | 2010-03-16 | 2011-03-15 | Method for modifying the blooming date of a plant |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP10305259A EP2366791A1 (en) | 2010-03-16 | 2010-03-16 | Method for modifying the flowering date of a plant |
PCT/EP2011/053908 WO2011113839A1 (en) | 2010-03-16 | 2011-03-15 | Method for modifying the blooming date of a plant |
EP11708284A EP2547772A1 (en) | 2010-03-16 | 2011-03-15 | Method for modifying the blooming date of a plant |
Publications (1)
Publication Number | Publication Date |
---|---|
EP2547772A1 true EP2547772A1 (en) | 2013-01-23 |
Family
ID=42562948
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP10305259A Ceased EP2366791A1 (en) | 2010-03-16 | 2010-03-16 | Method for modifying the flowering date of a plant |
EP11708284A Withdrawn EP2547772A1 (en) | 2010-03-16 | 2011-03-15 | Method for modifying the blooming date of a plant |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP10305259A Ceased EP2366791A1 (en) | 2010-03-16 | 2010-03-16 | Method for modifying the flowering date of a plant |
Country Status (4)
Country | Link |
---|---|
US (1) | US20130198892A1 (en) |
EP (2) | EP2366791A1 (en) |
CA (1) | CA2793131A1 (en) |
WO (1) | WO2011113839A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112646015B (en) * | 2021-01-22 | 2021-12-24 | 华中农业大学 | Gene and method for changing flowering period of corn |
Family Cites Families (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE3765449D1 (en) | 1986-03-11 | 1990-11-15 | Plant Genetic Systems Nv | PLANT CELLS RESISTED BY GENE TECHNOLOGY AND RESISTANT TO GLUTAMINE SYNTHETASE INHIBITORS. |
CA2258565C (en) | 1996-06-20 | 2011-11-22 | The Scripps Research Institute | Cassava vein mosaic virus promoters and uses thereof |
DE69839525D1 (en) | 1997-11-25 | 2008-07-03 | Oryzon Genomics Sa | METHOD FOR PARALLEL FINDING OF INSERTION MUTANES AND REAGENTS TO OBTAIN THIS |
CA2805455A1 (en) * | 2004-07-29 | 2006-02-09 | Pioneer Hi-Bred International, Inc. | Methods and compositions for modulating flowering and maturity in plants |
CN102604914A (en) | 2004-07-30 | 2012-07-25 | 法国植物基因组研究计划-华莱 | Method for Producing Highly Sensitive Endonucleases, Novel Preparations of Endonucleases and Uses Thereof |
EP2119787B1 (en) | 2004-12-22 | 2012-08-15 | Posco | Regulator for flowering time, transgenic plant transformed with the same, and method for regulating flowering time |
US7994398B2 (en) * | 2007-06-15 | 2011-08-09 | Pioneer Hi-Bred International, Inc. | Secondary wall forming genes from maize and uses thereof |
US8362325B2 (en) * | 2007-10-03 | 2013-01-29 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics |
-
2010
- 2010-03-16 EP EP10305259A patent/EP2366791A1/en not_active Ceased
-
2011
- 2011-03-15 WO PCT/EP2011/053908 patent/WO2011113839A1/en active Application Filing
- 2011-03-15 US US13/635,280 patent/US20130198892A1/en not_active Abandoned
- 2011-03-15 EP EP11708284A patent/EP2547772A1/en not_active Withdrawn
- 2011-03-15 CA CA2793131A patent/CA2793131A1/en not_active Abandoned
Non-Patent Citations (1)
Title |
---|
See references of WO2011113839A1 * |
Also Published As
Publication number | Publication date |
---|---|
US20130198892A1 (en) | 2013-08-01 |
EP2366791A1 (en) | 2011-09-21 |
WO2011113839A1 (en) | 2011-09-22 |
CA2793131A1 (en) | 2011-09-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1453980A2 (en) | Maize ccoaomt2 gene polymorphism, and uses thereof to enhance plant digestibility | |
EP1395667B1 (en) | Method for obtaining a monocotyledon plant containing a gene of interest free of foreign ancillary sequence | |
WO2013038376A1 (en) | Increase in meiotic recombination in plants by inhibiting the fancm protein | |
FR2919465A1 (en) | BUT HAVING AN IMPROVED DIGESTIBILITY | |
EP3110832B1 (en) | Plants with increased yield and method for producing said plants | |
EP2087122B1 (en) | Maize with good digestibility and disease resistant | |
EP2547772A1 (en) | Method for modifying the blooming date of a plant | |
EP1276870B1 (en) | Method for obtaining plants exhibiting enhanced resistance to water stress | |
WO2009156496A1 (en) | Plant improvement method | |
EP1556495A1 (en) | Ppr peptide sequences capable of restoring male fertility of plants bearing a male sterility-inducing cytoplasm | |
FR2852326A1 (en) | Improving digestibility of plants, particularly of fodder maize, by at least partial inhibition of peroxidase Pox3/U19, also related genetically modified plants | |
FR2828694A1 (en) | USE OF ASSOCIATIONS BETWEEN AT LEAST ONE NUCLEIC SEQUENCE POLYMORPHISM OF THE SH2 GENE AND AT LEAST ONE SEED QUALITY CHARACTERISTIC, IN PLANT SELECTION PROCESSES | |
FR2816320A1 (en) | Inducing or increasing resistance to pathogens in plants e.g. industrial scale flowers and vegetables, by introducing a nucleic acid that encodes the AKIN11 peptide | |
WO2001055407A1 (en) | Novel sgs2 plant gene and use thereof | |
FR2796395A1 (en) | NEW PLANT SGS3 GENE AND ITS USE |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20120925 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
DAX | Request for extension of the european patent (deleted) | ||
17Q | First examination report despatched |
Effective date: 20160407 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20160818 |