WO2001055407A1

WO2001055407A1 - Novel sgs2 plant gene and use thereof

Info

Publication number: WO2001055407A1
Application number: PCT/FR2001/000246
Authority: WO
Inventors: Christophe Beclin; Taline Elmayan; Philippe Mourrain; Hervé Vaucheret
Original assignee: Rhobio; Institut National Recherche Agronomique
Priority date: 2000-01-26
Filing date: 2001-01-26
Publication date: 2001-08-02
Also published as: FR2804128A1; AU2001235607A1

Abstract

The invention concerns novel polynucleotides, in particular isolated or purified, comprising the <i>SGS2</i> plant gene involved in post-transcriptional inactivation phenomena in transgenic plants and in the resistance of plants to viral infections, and their use for preparing genetically modified plants.

Description

New plant SGS2 gene and its use

The present invention relates to a new plant SGS2 gene and its use for the preparation of genetically modified plants. Methods for integrating heterologous genes into the genome of plants of different species are known from the state of the art. The level ^of heterologous gene expression will depend on various factors, including the locus of integration of the heterologous gene in the genome of the transformed plant and so-called phenomena of ^"silencing". It is indeed known to ^the state of the art as the expression of a heterologous gene in a plant can be inhibited completely or partly in the progeny of the transformed plants regenerated, even said the gene s ^is expressed correctly in the regenerated plant coming directly from the transformed cell. The introduced heterologous gene can sometimes undergo epigenetic inactivation (inactivation ^being accompanied ^by any change in sequence). When the genes have homologies with genes of the host organism, the inactivation can also affect the expression of these host genes and cause deleterious effects for the organism (co-inactivation). Two distinct mechanisms of inactivation have been demonstrated in higher plants, resulting either in blocking transcription (transcriptional inactivation) or in degradation of RNA (post-transcriptional inactivation). In addition, post-transcriptional inactivation mechanisms have also been demonstrated in the resistance of plants to viruses.

These inactivation phenomena, accidentally revealed by transgenesis, therefore certainly reflect fundamental processes of epigenetic control of gene expression. The highlighting of these phenomena also raises many questions about the use of transgenic plants both for varietal improvement programs and for molecular physiology studies. Indeed, the phenomena of post-transcriptional inactivation constitute an important obstacle to the stability of the expression of transgenes in plants. These phenomena of suppression of the expression of the transgene are particularly frequent in the context of highly expressed transgenes and therefore limit the expression of recombinant proteins in plants.

At the molecular level, the mechanisms involved in post-transcriptional inactivation remain unknown. Several models have been proposed to explain the sequence specificity of this mechanism (for a review see Kooter et al., Trends in Plant Science, 4: 340-347, 1999). It is often postulated that post-transcriptional inactivation is initiated by the synthesis of an aberrant RNA. The synthesis of an aberrant RNA would be caused by the particular structure of the transgenic locus or would occur naturally due to a particularly high level of transcription. This aberrant RNA would then be recognized by an RNA dependent RNA polymerase called RdRp (RNA dependent RNA polymerase). This aberrant RNA would then serve as a substrate for the RdRp to synthesize a complementary RNA. The aberrant RNA paired with its complement would then be degraded by an RNAse specific for double-stranded RNA. However, this model remains very speculative and incomplete. More recently, the qdel gene from Neurospora crassa involved in the phenomenon of "quelling" analogous to post-transcriptional inactivation has been cloned and characterized (Cogoni and Macino, Nature. 399: 166-169,

1999). This gene codes for a protein exhibiting homologies with an RdRp. On the other hand, genes presenting homologies with RdRp have been identified in different organisms and in particular in tomatoes (Schiebel et al., Plant Cell 10: 2087-2101, 1998). The great diversity of these RdRp and their weak sequence homology however suggest that these RdRp could play very varied roles in eukaryotic cells. In plants, the role of the different RdRp, their possible implication in post-transcriptional inactivation and in virus resistance have not been determined. We therefore understand that it is now essential to identify the genes involved in post-transcriptional inactivation in order to improve on the one hand the stability of the expression of transgenes and on the other hand the production of recombinant proteins in plants. The identification of these genes is also of great interest because of their role in the resistance of plants to viral infections.

The present invention relates to a new plant gene, called SGS2, involved in the phenomena of post-transcriptional inactivation in transgenic plants and in the resistance of plants to viral infections. The SGS2 gene of the invention complements a mutant affected in post-transcriptional inactivation. In addition, the inactivation of the SGS2 gene leads to the inhibition of post-transcriptional inactivation phenomena, in particular in transgenic plants. Analysis of the sequence homologies shows that the SGS2 gene belongs to the RdRp family although its homology with the qdel gene of Neurospora crassa involved in a phenomenon analogous to post-transcriptional inactivation is very weak. The present invention therefore relates to a new plant RdRp involved in post-transcriptional inactivation as well as mutants and methods for identifying RdRp involved in the phenomenon of post-transcriptional inactivation in plants. The invention also relates to transgenic plants in which the SGS2 gene is inactivated or inhibited to allow a more stable and greater expression of certain transgenes, in particular for the production of recombinant proteins in plants. The present invention also relates to the overexpression of the SGS2 gene for the preparation of plants more resistant to viral infections. Description of the figures

FIGURE 1: Mutants sgs2

Description of the sequence list

SEQ ID NO.1: SGS2 gene from Arabidopsis thaliana

SEQ ID NO. 2: cDNA of the SGS2 gene from Arabidopsis thaliana

SEQ ID NO. 3: Polypeptide SGS2 d ¹ Arabidopsis thaliana

Description of the invention

The present invention relates to SGS2 polynucleotides, in particular to polynucleotides comprising a plant SGS2 gene. Preferably, the polynucleotides of the present invention comprise the coding sequence of a plant SGS2 gene. The SGS2 gene can be isolated in dicotyledonous plants, such as Arabidopsis, tobacco, rapeseed, sunflower, soybeans, cotton, or in monocotyledonous plants such as rice, corn or wheat. Advantageously, the SGS2 gene is isolated in dicotyledonous plants, in particular cruciferous plants such as Arabidopsis or rapeseed. Preferably, the polynucleotides of the invention comprise a SGS2 gene from Arabidopsis thaliana.

The term "SGS2 polynucleotides" designates all of the polynucleotides of the present invention, preferably the polynucleotides of the genomic sequence of SGS2. polynucleotides of the SGS2 cDNA sequence. as well as the polynucleotides encoding the SGS2 polypeptides of the present invention. The term "SGS2 polynucleotides" also denotes recombinant polynucleotides comprising the said polynucleotides.

According to the present invention, the term "polynucleotide" means a single-stranded nucleotide chain or its complement or a double-stranded nucleotide chain which may be of DNA or RNA type. Preferably, the polynucleotides of the invention are of the DNA type, in particular double stranded DNA. The term "polynucleotide" also denotes modified oligonucleotides and polynucleotides.

The polynucleotides of the present invention are isolated or purified from their natural environment. Preferably, the polynucleotides of the present invention can be prepared by conventional techniques of molecular biology as described by Sambrook et al. (Molecular Cloning: A Labratory Manual, 1989) or by chemical synthesis.

The invention includes polynucleotides of the genomic sequence of the SGS2 gene. This genomic sequence comprises 2 exons (positions 851-3564 and 3987-4862 of SEQ ID NO. 1), an intron (position 3565-3986 of SEQ ID NO.l) and regulatory sequences in 5 'and 3'. In a preferred embodiment of the invention, the polynucleotides of the genomic sequence of SGS2 comprise the polynucleotide of SEQ ID NO.l or a polynucleotide comprising at least one exon of SEQ ID NO.l. The present invention also relates to a polynucleotide comprising a regulatory sequence 5 ′ or 3 ′ of the SGS2 gene. In a first embodiment, the invention relates to a 5 'regulatory polynucleotide comprising the polynucleotide whose sequence is between position 1 and position 850 of SEQ ID NO. 1. In a second embodiment, the invention relates to a 3 ′ regulatory polynucleotide comprising the polynucleotide whose sequence is between position 4863 and position 6863 of SEQ ID NO. 1.

The invention also relates to a promoter of the SGS2 gene from Arabidopsis thaliana. Preferably, the promoter of the SGS2 gene comprises a polynucleotide whose sequence is between position 1 and position 850 of SEQ ID NO. 1. In another embodiment of the invention, the promoter of the SGS2 gene comprises a biologically active fragment of a polynucleotide whose sequence is between position 1 and position 850 of SEQ ID NO. 1.

By "biologically active fragment" is meant above a polynucleotide having a promoter activity and preferably a promoter activity in plants or a transcription regulation activity and preferably a transcription regulation activity in plants. to establish the promoter activity of a polynucleotide are well known to those skilled in the art. These techniques conventionally involve the use of an expression vector comprising, in the direction of transcription, the polynucleotide to be tested and a reporter gene (see Sambrook et al., Molecular Cloning: A Labratory Manual. 1989).

The invention also relates to a terminator sequence of the SGS2 gene of Arabidopsis thaliana. Preferably, the terminator sequence of the SGS2 gene comprises a polynucleotide whose sequence is between position 4863 and position 6863 of SEQ ID NO. 1. In another embodiment of the invention, the terminator sequence of the SGS2 gene comprises a biologically active fragment of a polynucleotide whose sequence is between position 4863 and position 6863 of SEQ ID NO. 1.

By "biologically active fragment" is meant above a polynucleotide having a transcription termination activity and preferably a transcription termination activity in plants.

The invention also relates to polynucleotides of the SGS2 cDNA. Preferably, the polynucleotides of the coding sequence of a plant SGS2 gene comprise polynucleotides of SEQ ID NO. 2.

The subject of the invention is also polynucleotides comprising a polynucleotide coding for a polypeptide chosen from the following polypeptides: a) the polypeptide of SEQ ID NO.3; b) a polypeptide homologous to a polypeptide of SEQ ID NO. 3; c) a fragment of a polypeptide as defined in a) or b).

The invention also extends to polynucleotides comprising a polynucleotide chosen from the following polynucleotides: a) the polynucleotide of SEQ ID NO. 1; b) the polynucleotide of SEQ ID NO. 2; c) a polynucleotide homologous to a polynucleotide as defined in a) or b) d) a polynucleotide capable of hybridizing selectively to a polynucleotide as defined in a) or b); e) a fragment of a polynucleotide as defined in a), b), c) or d).

By “fragment” is meant according to the invention a polynucleotide of at least 10, 20, 30, 50, 100, 200, 300, 400, 500 contiguous nucleotides of the reference sequence. Preferably, these fragments retain the function of the reference sequence. By ^"homologous" is meant according to ^the invention a polynucleotide having one or more sequence modifications relative to the reference sequence. These modifications can be deletions. additions or substitutions of one or more nucleotides of the reference sequence. Advantageously, the percentage of homology will be at least 70%, 75%, 80%, 85%, 90%, 95% and preferably at least 98% "and more preferably at least 99% ) relative to the reference sequence. The methods for measuring and identifying the homologies between the nucleic acid sequences are well known to those skilled in the art. One can use for example the PILEUP or BLAST programs (in particular Altschul et al., J. Mol.Evol., 36: 290-300, 1993; Altschul et al., J.Mol.Biol., 215: 403-10, 1990). Preferably, the default settings will be used.

The invention therefore relates to polynucleotides comprising polynucleotides having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% and preferably at least 98% and more preferably at least 99% homology with SGS2 polynucleotides. polynucleotides of SEQ ID NO.l or polynucleotides of SEQ ID NO. 2. Preferably the invention relates to a polynucleotide comprising a polynucleotide of at least 50, 100, 200, 300, 400, 500, 1000 nucleotides having at least 70%. 75%, 80%, 85%, 90%, 95%, 98% and preferably at least 98% and more preferably at least 99% homology with the polynucleotides SGS2, the polynucleotides of SEQ ID NO.l or the polynucleotides of SEQ ID NO. 2. Preferably, these homologs retain the function of the reference sequence.

By "sequence capable of selective hybridization" is meant according to the invention the sequences which hybridize with the reference sequence at a level above the background noise significantly. The level of the signal generated by the interaction between the sequence capable of selective hybridization and the reference sequences is generally 10 times, preferably 100 times more intense than that of the interaction of other DNA sequences generating background noise. The stringent hybridization conditions allowing selective hybridization are well known to those skilled in the art. In general, the hybridization and washing temperature is at least 5 ° C. lower than the Tm of the reference sequence at a given pH and for a given ionic strength. Typically the hybridization temperature is at least 30 ° C for a polynucleotide of 15 to 50 nucleotides and at least 60 ° C for a polynucleotide of more than 50 nucleotides. By way of example, the hybridization is carried out in the following buffer: 6X SSC, 50 mM Tris-HCl (pH 7.5). 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, 500 μg / ml denatured salmon sperm DNA. The washes are for example carried out successively at low stringency in a 2X SSC buffer, 0.1% SDS. at medium stringency in a 0.5X SSC buffer, 01% SDS and at high stringency in a 0.1X SSC buffer, 0.1% SDS. The hybridization can of course be carried out according to other usual methods well known to those skilled in the art (see in particular Sambrook et al., Molecular Cloning: A Labratory Manual. 1989). The invention therefore relates to polynucleotides comprising a polynucleotide capable of hybridizing selectively with the polynucleotide of SEQ ID NO.l or the polynucleotide of SEQ ID NO. 2. Preferably, the invention relates to a polynucleotide comprising a polynucleotide of at least 50, 100, 200, 300, 400, 500, 1000 nucleotides capable of hybridizing selectively with the polynucleotide of SEQ ID NO.l or the polynucleotide of SEQ ID NO. 2. Preferably, these polynucleotides which selectively hybridize to a reference polynucleotide retain the function of the reference sequence.

Preferably, the polynucleotides of the present invention encode an RNA dependent RNA polymerase functional in plant cells and plants. In a preferred embodiment, the polynucleotides of the present invention encode an RNA-dependent RNA polymerase involved in post-transcriptional inactivation in plants.

In another preferred embodiment, the polynucleotides of the present invention encode an RNA dependent RNA polymerase involved in virus resistance in plants. The present invention also relates to antisense polynucleotides allowing the inhibition of the expression of a plant SGS2 gene. The antisense polynucleotides specifically hybridize to the mRNA of a plant SGS2 gene thus interfering with the expression of this gene. Techniques for inhibiting the expression of a protein by an antisense polynucleotide are well known to those skilled in the art and widely described in the literature, in particular by Judelson et al. (Gene 133: 63-69,1993) as well as by Prokish et al. (Mol.Gen.Genet. 256: 104-114, 1997).

The antisense polynucleotides of the present invention hybridize to the mRNA of a plant SGS2 gene over its entire length or only to part of the mRNA of a plant SGS2 gene. The antisense polynucleotides of the present invention can be perfectly complementary to the mRNA of a plant SGS2 gene or sufficiently homologous to allow pairing and inhibition of the expression of a plant SGS2 gene.

The present invention therefore also relates to polynucleotides comprising an antisense polynucleotide of a plant SGS2 gene and preferably an antisense polynucleotide of the coding sequence of the SGS2 gene of SEQ ID NO. 2.

Preferentially. the antisense polynucleotides of the present invention are derived from a polynucleotide of SEQ ID NO. 2. According to a first embodiment, the antisense polynucleotides of the present invention comprise the polynucleotide of SEQ ID No.2. According to a second embodiment, the antisense polynucleotides of the present invention comprise a fragment of at least 100 nucleotides, preferably of at least 500 nucleotides and preferably of at least 1000 nucleotides of SEQ ID NO.2. Preferably, the antisense polynucleotides of the present invention comprise a fragment of at least 100 nucleotides whose sequence is between position 333 and position 576 of SEQ ID NO.2. Preferably, the antisense polynucleotides of the present invention comprise a fragment of at least 100 nucleotides, preferably of at least 500 nucleotides and preferably of at least 1000 nucleotides whose sequence is between position 859 and position 3591 of the SEQ ID NO.2. According to a third embodiment, the antisense polynucleotides of the present invention comprise a polynucleotide having at least 85%, 90%), 95% and preferably at least 98% and more preferably at least 99%) of homology with a polynucleotide from SEQ ID NO. 2. According to another embodiment, the antisense polynucleotides of the present invention comprise a polynucleotide having at least 85%, 90%, 95%) and preferably at least 98%) and more preferably at least 99% of homology with a fragment of at least 100 nucleotides, preferably at least 500 nucleotides and preferably at least 1000 nucleotides of SEQ ID NO.2.

Preferably, the antisense polynucleotides of the present invention specifically inhibit the expression of an SGS2 gene in plants.

According to a preferred embodiment, the antisense polynucleotide of the present invention are expressed in plant cells or plants from an expression cassette.

The present invention relates to ^the use of a polynucleotide or a fragment of a polynucleotide according to the present invention for identifying SGS2 genes in other plants and thus for the identification of genes encoding RNA polymerases RNA agents involved in post-transcriptional inactivation in plants. Cloning is carried out, for example, by screening cDNA libraries or genomic DNA libraries with a polynucleotide or a fragment of a polynucleotide of SEQ ID NO.l and SEQ ID NO.2. These libraries can also be screened by PCR using specific or degenerate oligonucleotides derived from SEQ ID NO.l or SEQ ID NO.2. The construction and screening techniques of these banks are well known to those skilled in the art (see in particular Sambrook et al., Molecular Cloning: A Labratory Manual. 1989). Plant SGS2 genes can also be identified in databases by nucleotide or protein BLAST using SEQ ID NOs. 1-3.

Preferably, it is verified that the cloned genes perform the same function as the SGS2 gene of Arabidopsis thaliana by introduction of the genes identified in sgs2 mutants and by test for restoration of post-transcriptional inactivation (see below).

SGS2 Polvpeptides

The present invention also relates to SGS2 polypeptides. The term "SGS2 polpeptides" designates all the polypeptides of the present invention as well as the polypeptides for which the polynucleotides of the present invention encode. The term "SGS2 polypeptides" also refers to fusion proteins, recombinant proteins or chimeric proteins comprising these polypeptides. In the present description, the term "polypeptide" also denotes proteins and peptides as well as modified polypeptides. The polypeptides of the invention are isolated or purified from their natural environment.

The polypeptides can be prepared by various methods. These methods include purification from natural sources such as cells naturally expressing these polypeptides, production of recombinant polypeptides by appropriate host cells and their subsequent purification, production by chemical synthesis or, finally, a combination of these different approaches. . These various production methods are well known to those skilled in the art. Thus, the SGS2 polypeptides of the present invention can be isolated from plants expressing SGS2 polypeptides. Preferably, the SGS2 polypeptides of the present invention are isolated from recombinant host organisms expressing a heterologous SGS2 polypeptide or expressing a natural SGS2 polypeptide under the control of a heterologous promoter. These organisms are preferably chosen from bacteria, yeasts, fungi, animal cells, plant cells or plants.

The subject of the present invention is a polypeptide of sequence SEQ ID NO.3 as well as a polypeptide comprising a polypeptide of sequence SEQ ID NO. 3. The invention also comprises polypeptides comprising a fragment or a homolog of a SGS2 polypeptide and more particularly of the polypeptide of SEQ ID NO. 3.

The term "fragment" of a polypeptide refers to a polypeptide comprising part but not all of the polypeptide from which it is derived. The invention relates to a polypeptide comprising a fragment of at least 10, 15, 20, 25, 30, 35, 40, 50 amino acids of a polypeptide of SEQ ID NO.3. Preferably, these fragments retain at least one biological activity of the polypeptide from which they are derived.

The term "homologous" denotes a polypeptide according to the invention denotes a polypeptide which may have a deletion. an addition or substitution of at least one amino acid. The subject of the invention is a polypeptide having at least 75%. 80%, 85%. 90%), 95%, 98% and preferably 99% of amino acids identical with a polypeptide from SEQ ID NO. 3. Preferably, these homologous polypeptides retain the same biological activity. Preferably, this activity is a RNA dependent RNA polymerase activity in plant cells and plants. In a preferred embodiment, the polypeptides of the present invention have RNA dependent RNA polymerase activity essential in post-transcriptional inactivation in plants.

In another preferred embodiment, the polypeptides of the present invention encode an RNA dependent RNA polymerase essential for resistance to the virus in plants.

Expression tapes

The SGS2 gene can be expressed or over-expressed in different host organisms such as plants. The present invention relates in particular to the overexpression of the SGS2 gene in plants or plant cells to improve their resistance to viruses. The present invention also relates to the overexpression of the SGS2 gene in plants to increase the post-transcriptional inactivation of certain genes. The SGS2 gene can be expressed in a host organism under the control of the SGS2 promoter of the present invention or under the control of a heterologous promoter and preferably under the control of a functional promoter in plants. According to one embodiment of the invention, a polynucleotide encoding an SGS2 polypeptide is inserted into an expression cassette using cloning techniques well known to those skilled in the art. This expression cassette includes the elements necessary for transcription and translation of the sequences coding for the SGS2 polypeptide. Advantageously, this expression cassette comprises both elements making it possible to produce an SGS2 polypeptide by a host cell and elements necessary for the regulation of this expression. In a first embodiment, the expression cassettes according to the invention comprise, in the direction of transcription, a promoter functional in a host organism, a plant SGS2 gene or the coding sequence of a plant SGS2 gene and a terminator sequence in said host organism. In another embodiment, the expression cassettes according to the invention comprise, in the direction of transcription, a promoter functional in a host organism, a polynucleotide coding for an SGS2 polypeptide and a terminator sequence in said host organism. Preferably, the expression cassette comprises, in the direction of transcription, a functional promoter in a host organism, a polynucleotide chosen from the following polynucleotides: a) a polynucleotides encoding a polypeptide SGS2 of SEQ ID NO. 3, for a homolog or for a fragment of a polypeptide of SEQ ID NO.3; b) a polynucleotide of SEQ ID NO. 1; c) a polynucleotide of SEQ ID NO. 2; d) a polynucleotide homologous to a polynucleotide as defined in b) or c); e) a polynucleotide capable of hybridizing specifically to a polynucleotide as defined in b) or c); f) a polynucleotide comprising a fragment of a polynucleotide as defined in b), c), d) and e). and a terminator sequence in said host organism.

In another embodiment, the expression cassettes of the present invention allow the expression of an antisense polynucleotide for the inhibition of expression of the SGS2 gene in a plant. For the expression of an antisense polynucleotide in a plant, the expression cassettes according to the invention comprise, in the direction of transcription, a promoter functional in a host organism, an antisense polynucleotide of the coding sequence of a SGS2 gene. of a plant and a functional terminator sequence in said host organism. Preferably, the expression cassettes according to the invention comprise, in the direction of transcription, a promoter functional in a host organism, an antisense polynucleotide of the coding sequence of the SGS2 gene of SEQ ID NO. 2 and a functional terminator sequence in said host organism. Preferably, the antisense polynucleotides of the present invention are expressed under the control of an inducible promoter.

The SGS2 promoter can be used to express a heterologous gene in a host organism and in particular in plant cells or in plants. The invention therefore also relates to expression cassettes comprising the promoter of a plant SGS2 gene operatively associated with a sequence coding for a heterologous protein, allowing the expression of said protein in plant cells or plants. . In one embodiment, the expression cassette according to the invention comprises, in the direction of transcription, the SGS2 promoter from Arabidopsis thaliana, the coding sequence for the heterologous protein and a functional terminator sequence in plant cells and plants. Preferably, the expression cassette according to the invention comprises, in the direction of transcription, a polynucleotide whose sequence is between position 1 and position 850 of SEQ ID NO. 1 or a biologically active fragment of the polynucleotide whose sequence is between position 1 and position 850 of SEQ ID NO. 1, the sequence coding for a heterologous polypeptide and a terminator sequence functional in plant cells and plants.

The expression cassettes according to the present invention can also include any other sequence necessary for the expression of the gene of interest, such as for example regulatory elements or signal sequences allowing the addressing of the polypeptide of interest.

The construction techniques of these expression cassettes are widely described in the literature (see in particular Sambrook et al., Molecular Cloning: A Labratory Manual. 1989). The present invention also relates to a polynucleotide comprising an expression cassette according to the invention and in particular a vector comprising an expression cassette according to the invention.

Advantageously, the expression cassettes according to the present invention are inserted into a vector for their replication or for the transformation of a host organism. Certain elements of the expression cassettes according to the invention are illustrated below without implied limitation. Promoters

Any type of promoter sequence can be used in the expression cassettes according to the invention. The choice of promoter will depend in particular on the host organism chosen for the expression of the gene of interest. The present invention relates more particularly to the transformation of plants. The choice of promoter used in the expression cassette determines the temporal and spatial expression of the gene of interest. Certain promoters allow specific expression in certain tissues of the plant (roots, leaves or seeds for example) or in certain cells of the plant. Some promoters allow constitutive expression while other promoters are on the contrary inducible. As promoter regulatory sequence in plants, any promoter sequence of a gene expressing itself naturally in plants can be used, in particular a promoter expressing in particular in the leaves of plants, such as for example so-called promoters of original origin. bacterial, viral or vegetable or also so-called light-dependent promoters such as that of a gene for the small ribulose-biscarboxylase / oxygenase (RuBisCO) subunit of a plant or any suitable known promoter which can be used. Among the promoters of plant origin promoters histone be mentioned as described in EP 0507698, or the promoter ^of rice actin (US 5,641,876). Among the promoters of a plant virus gene, there may be mentioned that of the cauliflower mosaic (CAMV 19S or 35S), or the circovirus promoter (AU 689 311). It is also possible to use a promoter regulatory sequence specific for particular regions or tissues of plants, and more particularly promoters specific for seeds (Datla et al., Biotechnology Ann. Rev. 3: 269-296, 1997). It is also possible to use an inducible promoter advantageously chosen from the promoters of phenylalanine ammonia lyase (PAL), of HMG-CoA reductase (HMG). chitinases, glucanases, proteinase inhibitors (PI), genes of the PR1 family, nopaline synthase (nos) or the vspB gene (US 5 670 349), the HMG2 promoter (US 5 670 349), the promoter of apple beta-galactosidase (ABG1) or the promoter of apple amino cyclopropane carboxylate syntase (ACC synthase) (WO 98/45445).

The promoter of the SGS2 gene from Arabidopsis thaliana can also be used. Expression regulation sequences

In the expression cassettes of the present invention, any regulatory sequence can be used which makes it possible to increase the level of expression of the sequence. coder inserted in said expression cassette. According to the invention, it is possible in particular to use, in association with the promoter regulatory sequence, other regulatory sequences which are located between the promoter and the coding sequence, such as transcription activators ("enhancer"). Among the leader sequences derived from viruses, mention will be made, for example, of the activator of the tobacco mosaic virus (TMV) described in application WO 87/07644, or the activator of the tobacco etch virus (TEV). Different sequences derived from plant introns can also be used to increase the level of expression of the gene of interest, especially in monocotyledonous plants. We may cite, for example, the intron I of the corn gene AdhI (Callis et al. Genes Develop., 1: 1183-1200, 1987).

Terminating sequences

A wide variety of terminator sequences can be used in the expression cassettes according to the invention. These sequences allow the termination of transcription and polyadenylation of the mRNA. Any terminator sequence functional in the selected host organism can be used. For expression in plants, it is possible in particular to use the terminator nos of Agrobacterium tumefaciens, or alternatively terminator sequences of plant origin, such as for example the histone terminator (see EP 0 633 317), the terminator CaMV 35 S and the tml terminator. These terminator sequences are usable in monocotyledonous and dicotyledonous plants. The terminator sequence of the SGS2 gene from Arabidopsis thaliana is another example of a terminator sequence which can be used in the expression cassettes according to the invention. Heterologous genes

Any gene of interest can be expressed in a host organism under the control of an SGS2 promoter. Preferably, the SGS2 promoter is used for the expression of a heterologous gene in plant cells or in a plant. The genes of interest which can be expressed in plants under the control of an SGS2 promoter are more widely illustrated below.

vectors

The present invention also relates to transformation or expression vectors comprising at least one SGS2 polynucleotide and / or an expression cassette according to the present invention. The vectors of the present invention are used in particular for transforming a host organism and for expressing an SGS2 polypeptide or an SGS2 polynucleotide in said host organism. The host organism is for example a bacterium, a yeast, a fungus, a plant cell or a plant. This vector can in particular consist of a plasmid. a cosmid, a bacteriophage or a virus into which is inserted an SGS2 polynucleotide or an expression cassette according to the invention. In general, any vector capable of maintaining itself, of self-replicating or of spreading in a host cell to induce expression of a polynucleotide or a polypeptide can be used.

The techniques for constructing these vectors and the techniques for inserting an appropriate sequence into these vectors are widely described in the literature (see in particular Sambrook et al, Molecular Cloning: A Labratory Manual, 1989).

Advantageously, the vectors according to the invention comprise at least one origin of replication. Preferably, the vectors of the invention also comprise at least one selection marker and preferably a selection marker usable in plant cells or in plants. Among the selection markers, there may be mentioned antibiotic resistance genes such as the npt11 gene for resistance to kanamycin (Bevan et al. Nature 304: 184-187, 1983) and the hph gene for resistance to hygromycin (Gritz et al., Gene 25: 179-188, 1983). We will also mention the herbicide tolerance genes such as the bar gene (White et al., NAR 18: 1062. 1990) for bialaphos tolerance, the EPSPS gene (US 5,188,642) for glyophosate tolerance or the HPPD gene. (WO 96/38567) for tolerance to isoxazoles. It is also possible to use genes encoding readily identifiable reporter enzymes such as ^the GUS enzyme or genes encoding pigments and enzymes regulating the production of pigments in the transformed cells. Such selection marker genes are described in particular in patent applications EP 242 236, EP 242 246, GB 2 197 653, WO 91/02071, WO 95/06128, WO 96/38567 or WO 97/04103.

Advantageously, these vectors are used for the transformation of a host organism. Those skilled in the art will choose the appropriate transformation vectors in particular as a function of the host organism to be transformed and as a function of the transformation technique used. For the transformation of plant cells or plants, it will in particular be a virus which can be used for the transformation of developed plants and which additionally contains its own elements of replication and expression. Preferably, the vector for transforming plant cells or plants according to the invention is a plasmid. Many vectors have been developed for the transformation of plants with

Agrobacterium tumefaciens. Other vectors are used for transformation techniques not based on the use of Agrobacterium. These vectors are well known to those skilled in the art and widely described in the literature.

Transformation

The subject of the invention is also a method of transforming host organisms, in particular plant cells with a SGS2 polynucleotide, an expression cassette or a transformation or expression vector according to the invention.

According to the present invention, the transformation of the host organism can be obtained by any suitable known means, the transformation techniques and in particular of transformation of plants are fully described in the specialized literature. For the processes of transformation of plant cells and regeneration of plants, mention will be made in particular of the following patents and patent applications: US 4,459,355, US 4,536,475, US 5,464,763. US 5,177,010, US 5,187,073. EP 267,159, EP 604,662, EP 672,752, US 4,945,050, US 5,036,006. US 5,100,792. US 5,371,014, US 5,478,744, US 5,179,022, US 5,565,346. US 5,484,956. US 5,508,468. US 5,538,877, US 5,554,798, US 5,489,520, US 5,510,318. US 5,204,253. US 5,405,765, EP 442,174. EP 486,233, EP 486,234, EP 539,563. EP 674,725, WO 91/02071 and WO 95/06128.

Certain techniques use Agrobacterium in particular for the transformation of dicotyledons. A series of methods consists in using as a means of transfer into the plant a chimeric gene inserted into a Ti plasmid of Agrobacterium tumefaciens or Ri of Agrobacterium rhizogenes. Other methods include bombarding cells, protoplasts or tissues with particles to which the DNA sequences are attached. Other methods can also be used such as micro-injection or electroporation, or even direct precipitation using PEG.

Those skilled in the art will choose the appropriate method depending on the nature of the host organism, in particular the plant cell or the plant.

Host organisms The present invention also relates to a host organism transformed with a polynucleotide SGS2, an expression cassette and / or a vector according to the invention.

In one embodiment, the invention relates to a host organism in which the SGS2 gene is overexpressed. In another embodiment, the present invention relates to a host organism in which the expression of the SGS2 gene is inhibited or the expression of the SGS2 gene is inactivated.

By host organism is meant in particular according to the invention any mono or multicellular organism, lower or higher, in particular chosen from bacteria, yeasts, fungi or plant cells and plants. Advantageously, the bacteria are chosen from Escherichia coli, the yeasts are chosen from Pichia pastoris and Saccharomyces cerevisae, the fungi are chosen from Aspergillus niger. Preferably, the host organism is a plant cell or a plant. By "plant cell" is meant according to the invention any cell originating from a plant and which can constitute undifferentiated tissues such as calluses, differentiated tissues such as embryos, parts of plants, plants or seeds. The term "plant" of ^the invention, any differentiated multicellular organism capable of photosynthesis, in particular monocotyledons or dicotyledons, more particularly crop plants intended or not for animal or human food, such as corn, wheat. barley, sorghum, rapeseed, soybeans, rice. sugar cane, beet, tobacco, cotton, etc. According to a particular embodiment of the invention, the host organism comprises at least one other heterologous gene coding for a peptide, a polypeptide or a protein of interest. The polynucleotide comprising a polynucleotide according to the invention SGS2 and or other heterologous genes may have been introduced into ^the host organism simultaneously by means of the same vector comprising the same, or using several vectors or sequentially with several vectors, or by crossing several host organisms, each comprising a heterologous gene.

By heterologous gene. means according to ^the invention any gene introduced artificially into the host organism, especially artificially integrated into its genome, the methods for the introduction or integration may be those described above, the content of the cited references are incorporated herein by reference.

The heterologous gene. other than the SGS2 polynucleotides according to the invention, may be a gene comprising a coding sequence and the regulatory elements 5 ^" and 3 'of said coding sequence not modified with respect to the natural gene, artificially reintroduced into the genome of a host organism which may be of the same species as that from which the gene was isolated, or of a different species. The heterologous gene may also be a chimeric gene or an expression cassette comprising an original coding sequence, vegetable, bacterial, fungal, viral or animal, under the control of functional regulatory elements in the host organism, different from those naturally linked functionally to the coding sequence.

The present invention also relates to plants containing transformed cells as defined above, in particular plants regenerated from the transformed cells and their progeny. The regeneration is obtained by any suitable process which depends on the nature of the species, as for example described in the references above.

The present invention also relates to genetically modified plants in the genome of which an SGS2 polynucleotide or an expression cassette according to the invention are stably integrated and transmissible by sexual reproduction. The present invention also relates to plants obtained by crossing the regenerated plants above with other plants. It also relates to the seeds of transformed plants.

Sçs2 mutants The invention therefore also relates to sgs2 mutants in which the SGS2 gene is inactivated. Inactivation of this gene leads to the inhibition of post-transcriptional inactivation phenomena in these mutants.

Inactivation of the SGS2 gene in plants can be achieved using different mutagenesis techniques. site-directed mutagenesis, "machine gene" or by homologous recombination techniques (Kempin, SA et al., Targeted disruption in Arabidopsis, Nature 389: 802-803, 1997). These techniques are well known to those skilled in the art. Among the mutagenesis techniques, mention will be made of chemical mutagenesis techniques. Mention will also be made of the mutagenesis techniques using transposable elements allowing the inactivation of genes by insertion. When the mutagenesis techniques used do not make it possible to specifically inactivate the SGS2 gene. the mutants obtained are screened to identify the mutants affected in the SGS2 gene. This screening can be a phenotypic screening or a screening based on the amplification and sequencing of the SGS2 gene in the mutants according to techniques described in the literature. Among the techniques of site-directed mutagenesis, mention will be made of chimeraplasty (US 6,010,907). In a particular embodiment of the invention mutants are obtained according to the method described by Elmayan et al. (Plant Cell, 10: 1747-1757, 1998) by treating seeds with 0.4% EMS (ethyl methanesulfonate) solution. The mutants are then analyzed to identify the mutants affected in the SGS2 gene. This screening can for example be carried out by PCR. The present invention also relates to the use of sgs2 mutants for the identification of SGS2 genes in other plant species such as for example tobacco, rapeseed, sunflower, soy, cotton, rice, corn, sorghum, barley or wheat. The functional counterparts of SGS2 in other species are identified by complementing the sgs2 mutants according to the invention. A polynucleotide that restores the wild type of post-transcriptional inactivation is cloned. The sequence of this polynucleotide is then determined in order to identify the constituent elements of the cloned gene.

Inhibition / Inactivation of SGS2 and expression of heterologous genes in plants The development of genetic transfer techniques has made it possible to express genes in plants, in particular with a view to improving their agronomic properties or for the production of proteins of interest . However, post-transcriptional inactivation phenomena constitute an important obstacle to the stability of the expression of transgenes in plants. These phenomena of suppression of the expression of the transgene are particularly frequent in the context of strongly expressed transgenes. The present invention relates to a new plant gene SGS2. The inhibition or inactivation of this SGS2 gene in plants causes an inhibition of the post-transcriptional inactivation phenomenon and therefore makes it possible to obtain plants in which the expression of heterologous genes is more stable as well as plants in which the level of expression of heterologous genes is higher. Inactivation / inhibition of the SGS2 gene in plants

In a first embodiment, the invention relates to a method for expressing a heterologous gene in a plant, characterized in that it comprises the transformation of the plant with the heterologous gene and the inhibition of the expression of the SGS2 gene in said plant. . Preferably, the inhibition of the expression of the SC7S2 gene comprises the transformation of the plant with a polynucleotide comprising a polynucleotide chosen from the following polynucleotides: a) an antisense polynucleotide of the coding sequence of a plant SGS2 gene; b) an antisense polynucleotide of the coding sequence of the SGS2 gene of SEQ ID NO.2; c) an expression cassette comprising, in the direction of transcription, a promoter functional in a host organism, a polynucleotide as defined in a) or b) and a terminator sequence functional in said host organism.

In another embodiment the invention relates to a method for expressing a heterologous gene in a plant characterized in that it comprises the transformation of the plant with the heterologous gene and the inactivation of the expression of the SGS2 gene in said plant .

In the context of the present invention, it is understood that the step of inactivation or inhibition of the plant gene SC7S2 and the step of transformation of the plant with a heterologous gene can be carried out simultaneously on the same plant or sequentially or by crossing several plants. The methods according to the invention can therefore also include stages of plant regeneration, asexual multiplication or crossing of plants. Heterologous genes Different heterologous genes of interest can be expressed in plants in which the expression of the SGS2 gene is inhibited or inactivated. Preferably, the heterologous gene codes for peptides, proteins or enzymes. It may be proteins rapporteurs, selection markers or peptides or proteins of ^interest giving the host organism new properties, especially new agronomic properties to the transformed plants.

Among the genes conferring new agronomic properties on transformed plants, there may be mentioned the genes conferring tolerance to certain herbicides, those conferring resistance to certain insects, those conferring tolerance to certain diseases, etc. Such genes are described in particular in patent applications WO 91/02071 and WO 95/06128.

Among the genes conferring tolerance to certain herbicides, mention may be made of the Bar gene conferring tolerance to bialaphos, the gene coding for an appropriate EPSPS conferring resistance to herbicides having EPSPS as target such as glyphosate and its salts (US 4,535,060, US 4,769,061, US 5,094,945, US 4,940,835, US 5,188,642, US 4,971,908, US 5,145,783, US 5,310,667, US 5,312,910, US 5,627,061, US 5,633,435, FR 2,736,926), the gene encoding glyphosate oxidoreductase17 (5,4) or a gene coding for a HPPD conferring tolerance to herbicides targeting HPPD such as isoxazoles, in particular isoxafutole (FR 95 06800, FR 95 13570), diketonitriles (EP 496 630, EP 496 631) or triketones, especially sulcotrione (EP 625 505, EP 625 508, US 5,506,195). Such genes encoding an HPPD conferring a tolerance to herbicides that target the ^HPPD are described in patent application WO 96/38567.

Among the proteins of interest conferring new insect resistance properties, there will be mentioned more particularly the Bt proteins widely described in the literature and well known to those skilled in the art. Mention will also be made of proteins extracted from bacteria such as Photorabdus (WO 97/17432 & WO 98/08932).

Among the proteins or peptides of interest which confer novel properties of resistance to diseases is particularly include chitinases, glucanases, ^the oxalate oxidase. all these proteins and their coding sequences being widely described in the literature, or also antibacterial and / or antifungal peptides, in particular peptides of less than 100 amino acids rich in cysteines such as thionines or plant defensins, and more particularly peptides lytic of all origins comprising one or more disulphide bridges between the cysteines and regions comprising basic amino acids, including the following lytic peptides: ^the androctonin (WO 97/30082 and PCT / FR98 / 01814, filed 18 August 1998) or drosomicin (PCT / FR98 / 01462, filed July 8, 1998).

According to a particular embodiment of the invention, the protein or peptide of interest is chosen from fungal eliciting peptides, in particular elicitins (Kamoun & al., 1993; Panabières & al., 1995). Mention may also be made of the genes modifying the constitution of the modified plants, in particular the content and quality of certain essential fatty acids (EP 666 918) or also the content and quality of the proteins, in particular in the leaves and / or seeds of the said plants. plants. Mention will in particular be made of the genes coding for proteins enriched in sulfur amino acids (Korit et al., Eur. J. Biochem. 195: 329-334, 1991; WO 98/20133; WO 97/41239; WO 95/31554; WO 94/20828; WO 92/14822). These proteins enriched in sulfur amino acids will also have the function of trapping and storing excess cysteine and / or methionine, making it possible to avoid the possible problems of toxicity linked to an overproduction of these sulfur amino acids by trapping them. Mention may also be made of genes coding for peptides rich in sulfur amino acids and more particularly in cysteines, the said peptides also having antibacterial and / or antifungal activity. Mention will more particularly be made of plant defensins, as well as lytic peptides of any origin, and more particularly the following lytic peptides: androctonine (WO 97/30082 and PCT / FR98 / 01814, deposited on August 18, 1998) or drosomicine (PCT / FR98 / 01462, filed July 8, 1998).

All the methods or operations described below in the examples are given by way of examples and correspond to a choice made from among the different methods available to achieve the same result. This choice does not affect the quality of the result and therefore, any suitable method can be used by humans. art to achieve the same result. Most of the methods for engineering DNA fragments are described in "Current Protocols in Molecular Biology" Volumes 1 and 2, Ausubel FM et al or in Sambrook et al 1989.

Examples

Example 1

Isolation and identification of the SGS2 gene from Arabidopsis

Obtaining the sgs2 mutants is described in detail in Elmayan et al. (Plant Cell 10: 1747-1757, 1998). The starting line was the Ll line. Ll is a transgenic line obtained by transformation of plants of the Columbia ecotype by construction 23b (Elmayan and Vaucheret. Plant J. 9: 787-797, 1996). The L1 line has only one transgenic locus. The glucuronidase activity in the L1 line is 4000 nmol of 4-methylumbelliferone per minute and per microgram of total proteins in the first days of development. This activity then decreases very quickly to become less than 5 nmol of 4-methylumbelliferone per minute and per microgram of total proteins 11 days after germination. The inactivation of the expression of the 35S-w / a 4 transgene is post-transcriptional, as demonstrated by the "run-on" experiments showing a strong transcription of the 35S-uidA transgene in the L1 plants showing very low GUS activity (Elmayan et al., Plant Cell 10: 1747-1757, 1998). To obtain mutants of the L1 line, 3000 seeds of the L1 line were soaked for 16 hours in a 0.4% solution of EMS (ethyl methanesulfonate). The seeds were then sown and the plants obtained were cultivated in a greenhouse until seeds for self-fertilization were obtained. These were again sown in the greenhouse and in the plants obtained, the GUS activity was measured 1 month after germination. Plants showing high activity at this stage were both crossed with plants of the Columbia ecotype (to verify that the transgenic locus remains sensitive to post-transcriptional inactivation), backcrossed with the L1 line (to evaluate the 'state of recessivity vs dominance of the mutations obtained) and crossed between them (to classify the different mutants obtained as a complementation group, each group defining a gene). 23 independent sgs2 mutants were thus isolated. These 23 mutations are recessive. GUS activity in these 23 mutant lines. 1 month after germination, is between 2500 and 3500 nmol of 4-methylumbelliferone per minute and per microgram of total proteins. To confirm that the sgs2 mutations affect the expression of the 35S-GUS transgene at the transcriptional level, the GUS activity, the mRNA accumulation and the transcription rate were measured by fluorimetric tests, by blot analysis. of mRNA and through run-on experiments. The GUS activity is multiplied by a factor of 300 in the sgs2 mutants compared to the L1 line while the accumulation of mRNA is multiplied by a factor of 250. The transcription rate is only multiplied by a factor of 1.8 compared to line L 1. To verify that the sgs2 mutations protected from post-transcriptional inactivation of a gene other than the uidA gene, one of the sgs2 mutants (named sgs2-1) was crossed with the 2a3 line (Elmayan et al., Plant Cell 10: 1747-1757, 1998). The 2a3 line is a transgenic line of Arabidopsis thaliana resulting from the transformation of a plant of the Columbia ecotype by construct 2a (Elmayan et al. Plant Cell 10: 1747-1757, 1998) containing the transcribed part of the gene NIA2 from Arabidopsis encoding nitrate reductase under the control of the 35S promoter and the hygromycin hpt resistance gene. All the plants of the 2a3 line homozygous for the 2a construction have a post-transcriptional inactivation of the Nia2 genes (transgenic and endogenous) leading to chlorosis of the plant and then to its death. When the transgenic locus 2a3 is in the heterozygous state, only part of the plants undergo post-transcriptional inactivation. The stage at which this inactivation takes place varies from one plant to another. In some plants inactivation is late enough to allow the production of pollen and seeds. The hybrid plants resulting from the cross between the mutant sgs2-1 and the line 2a3 were cultivated in the greenhouse and the seeds for self-fertilization were harvested. These were sown in the greenhouse and the plants obtained without chlorosis were kept to harvest their seeds for self-fertilization. We then sowed the different lots of seeds on an agar medium containing 20 mg / l of hygromycin. Among these, some only gave plants resistant to hygromycin and showing no sign of chlorosis throughout their development. Among these lines resistant to post-transcriptional inactivation of the nitrate reductase genes, some were also homozygous for construction 23b. We have also shown that the plants of all these lines exhibit a high GUS activity throughout their development. These results therefore show that the sgs2 mutation not only protects against post-transcriptional inactivation of the 35S-uidA transgene but also of the endogenous NIA2 transgenes and genes. Some of these lines resistant to post-transcriptional inactivation of the nitrate reductase and homozygous genes for the locus 2a3 no longer had the construction 23b. These plants were named sgs2-l 2a3.

In order to determine the biological role of the gene corresponding to the sgs2 mutations, sgs2-1 mutants were inoculated with the cucumber mosaic virus (CMV) strain Il 7F. On wild plants, infection with this viral strain leads to plants whose development is slower and altered: smaller rosette leaves, long but very flexible flower stalk, reduced but not zero fertility. In the mutants sgs2-l, infection with this viral strain leads to an increased alteration of development: the plants have a particularly bushy habit, the leaves of the rosette are small and twisted, the flower stalk reaches a size at the end of development of the order of 5 cm, the plants are completely sterile. These experiments therefore show that the gene corresponding to the sgs2 mutations makes it possible to limit the negative effects on development caused by the infection of the CMV virus. Four mutants sgs2-1, sgs2-2, sgs2-3, sgs2-4 were crossed with plants of the Landsberg ecotype. On these hybrid plants (FI) resulting from these crosses, the seeds of self-fertilization were harvested. These seeds were sown in vitro on an agar medium containing 50 mg / 1 of kanamycin in order to select the plants (F2) having the transgene 23b. These kanamycin resistant plants were transplanted and grown in the greenhouse. GUS activity in these plants has been measured at different stages of their development. Only plants with high GUS activity throughout development (and therefore homozygous for the sgs2 mutation) were preserved and the seeds for self-fertilization were harvested. For each of the 4 mutations, more than 100 F2 lines homozygous for the mutation were thus obtained. The self-fertilization seeds of each of these lines were sown in a greenhouse and for each line a pool of plants was harvested in order to extract the DNA. These DNAs were used to locate sgs2 mutations on the Arabidopsis genome. These analyzes showed that the sgs2 mutations were located between, on the one hand, a CAPS marker from the T7 end of the BAC clone F2K15 and, on the other hand, an RFLP marker from the sp6 end of the BAC T9C5 clone. The region of the genome of ^Arabidopsis thaliana bounded by these two markers contains the entire insert of clone BAC T9C5. The complete sequence of BAC T9C5 being known, we have produced subclones of this BAC in the binary vector pBin +. The resulting plasmids were introduced into E. coli and then into the Agrobacterium tumefaciens C58pMP90 strain. The resulting bacterial strains were used to transform plants of the sgs2-1-2a3 lines. In particular a fragment of 10.7 kb released by the enzymatic digestion of T9C5 by enzymes KpnI and XhoI allowed to ^induce in 92 of the 96 plants of the line 2a3 SGS2-l transformed with this fragment a characteristic chlorosis ^inactivation post-transcription of Nia2 genes (transgenic and endogenous). On 2 of these plants we were able to show by northern type hybridization using as probe NIA2 gene of Arabidopsis thaliana. that this chlorosis resulted from the non-accumulation of transcripts of the nitrate reductase genes (transgenic and endogenous) and therefore was due to the post-transcriptional inactivation of the nitrate reductase genes. Subsequently, a 6.9 kb subclone of this 10.7 kb fragment, obtained by digestion of the 10.7 kb fragment with the enzymes Xbal and Seal and cloning at the Xbal and Smal sites of the vector pBin +, also made it possible to induce 1 ^" post-transcriptional inactivation of the Nia2 genes. This Xbal-Scal fragment corresponds to the SGS2 gene which is discussed in this patent. By computer analysis the ORS of SGS2 could be predicted. The cDNA sequence containing the ORF of the SGS2 gene and therefore the position of the promoter, terminator and intronic sequences of SGS2 were verified.For this we first carried out a reverse-transcription reaction starting from total RNA of Arabidopsis thaliana. we performed 2 successive PCR reactions on this cDNA pool: first using the pair of primers p29Fl (CAGCCTTATCATGTGGGGG) and P29R1 (CAGATACATGGCAGAGTGGCC) then the pair of primers p29F8 (GTTTAGGCCGTGCTGTCAACC) and P29R4 (GGGTCTGTGCTTTCTTCTGAGG). The fragment from this last PCR was sequenced. The primers p29Fl and P29Rlsare located at the 2 ends of the ORF of SGS2. The primers p29F8 and P29R4 are located on either side of the intron of SGS2.

Using the BLAST software, a search for sequences homologous to SGS2 in the databases was carried out. At the nucleotide level, the only sequences having significant homology (greater than 70%) over a length of at least 50 nucleotides) are sequences originating from the Arabidopsis genome:

- A sequence from section 27 of chromosome 2 (accession number: gbAC007289) shares 82% homology with the region between nucleotides 1 and 332 of cDNA SGS2;

- A sequence from section 27 of chromosome 2 (accession number: gbAC007289) shares 85% homology with the region between nucleotides 577 and 858 of cDNA SGS2;

- A sequence from section 55 of chromosome 2 (accession number: gbAC006250) shares 82% homology with the region between nucleotides 1 and 249 of cDNA SGS2;

- A sequence from chromosome 5 (accession number: dbjAB024037) shares 87%> of homology with the region between nucleotides 1 and 114 of cDNA SGS2;

- A sequence from chromosome 4 (accession number: gbAF058825) shares 87% homology with the region between nucleotides 1 and 114 of cDNA SGS2.

At the protein level, reduced homologies have been found with a number of proteins belonging to different kingdoms. Indeed, among the sequences homologous to SGS2 we find:

- animal genome sequences: three sequences in Caenorhabditis elegans (embZ78419, embZ48334, embZ81571) and 1 in Dictyostelium discoideum

(gbAFl 17611).

- fungal genome sequences: a sequence in Neurospora crassa: QDEl (embAJ133528),), 1 in Phanerochaete chrysosporium (embZ31373) and 1 in Schizosaccharomyces pombe (embZ98533). - plant genome sequences: a sequence in Lycopersicon esculentum

(embY10403), 1 from Nicotiana tabacum (embAJO 11576), 1 from Pétunia x hybrida (embAJOl 1979), 1 from Triticum aestivum (embAJO 11978), and five of which three are clustered from Arabidopsis thaliana (giAF080120, embAJOl 1977, cluster gbACC00516) . The protein with the highest homology to SGS2 is an RNA-dependent-RNA-polymerase from tomato (Lycopersicon esculentum). Part of the amino acid sequence of this protein (embY10403) has a 36% homology with the sequence between amino acids 131 and 1170 of SGS2. All the other proteins homologous to SGS2 exhibit weaker homology (homology over a smaller area and / or of lower percentage). The protein QDE1 from Neurospora crassa (AJ133528) involved in a phenomenon analogous to PTGS (called "quelling") does not thus exhibits 24% homology with the sequence between amino acids 529 and 878 of SGS2.

It should be noted that among all the sequences homologous to SGS2, there are 5 from the Arabidopsis genome, at least one of which has been demonstrated experimentally as being transcribed (number embAJOl 1977). For each of these 5 sequences homologous to SGS2. it is statistically certain ^that there is at least one among the 23 mutant SGS2 isolated for which the considered homologous sequence is not mutated. This shows that although having a homology with SGS2. these 5 sequences do not fulfill the same function as SGS2.

Example 2 Analysis of the sgs2 mutants The sequence of the SGS2 gene was determined in 11 sgs2 mutants. A PCR reaction was carried out on the genomic DNA of these 5 mutants in order to amplify the entire ORF of the SGS2 gene. The amplified fragments were then sequenced.

Eleven distinct point mutations have thus been identified in the various sgs2 mutants. These mutations correspond to 7 amino acid changes, three stop codons and a deletion of a nucleotide resulting in a change in the open reading frame. The different mutations observed in the sgs2 mutants are represented in FIG. 1. The amino acid marked in bold indicates the position of the mutation in the SGS2 polypeptide. * indicates the presence of a stop codon, 'indicates the deletion of a nucleotide associated with a change of open reading frame and () indicates a new amino acid substituted for the amino acid marked in bold.

Example 3

Construction of expression cassettes for overexpression and inhibition of SGS2

Construction of an expression cassette allowing the overexpression of the SGS2 protein To overexpress the SGS2 protein, a PCR type reaction is carried out on complementary DNA of Arabidopsis thaliana using as primers the following oligonucleotides: p29F2 ': CAGGAGAAATGGGGTCTCAGAGG p29R2 ': ACCTTTTAGAGACGCTGAGC

The nucleotide sequence thus obtained is then treated with ^the enzyme

"Klenow" to generate "blunt" ends at the ends of the amplified sequence. The sequence is then cloned between the 35S promoter and the cauliflower mosaic virus terminator. For example, this sequence could be cloned at the SmaI site of the vector pRTIOO (Topfer et al. Nucleic Acid Research, 15 (14), 5890. 1987). For the overexpression of SGS2, the clones will be chosen such that the sequence corresponding to p29F2 is located near the 35S promoter. Construction of an expression cassette allowing the inhibition of SGS2 To inhibit the expression of SGS2. a construction is carried out such that the SGS2 gene is placed in an antisense position between the 35S promoter and the terminator of the cauliflower mosaic virus. This construction can be carried out for example by choosing, in the cloning described above, the clones such that the sequence corresponding to p29R2 is located near the 35S promoter. This AsSGS2 construction allows the expression of an anti-sense mRNA of the SGS2 mRNA. However, given the presence in the genome of Arabidopsis nucleotide sequence having a higher sequence homology to 80% with the 5 ^'portion of the gene SGS2, AsSGS2 this construction could lead to inhibition of ^other genes (this level homology is achieved with the cDNA regions of SGS2 ranging from nucleotides 1 to 332 and 577 to 858). To specifically inhibit the SGS2 gene, we therefore preferentially seek to construct a gene expressing the mRNA of SGS2 deleted from its 5 'region, in antisense orientation (called Assgs2Δ5'). For example, an AsSGS2 clone is digested with the BamHI enzymes, which releases the first 749 nucleotides of SGS2, and a ligation reaction is then carried out on the digestion product.

Example 4 Transformation of Plants The expression cassettes constructed as described above are then introduced into a binary vector to allow their introduction via Agrobacterium tumefaciens into plants. The binary vector used is the plasmid pBIN + (Van Engelen et al., Transgenic Research 4, 288-290, 1995). This is done by digesting the constructions obtained above with the enzyme SphI (which releases the expression cassettes) and by ligating the product of this digestion with the plasmid pBIN + digested with the enzyme SphI. For the constructions containing all of the SGS2 cDNA (in sense or antisense orientation), a partial SphI digestion must be carried out because there is a SphI site 5 ′ of the SGS2 gene whereas the SphI digestion is complete for the AsSGS22 construction.

Claims

claims

1) Isolated or purified polynucleotide, characterized in that it comprises a polynucleotide chosen from the following polynucleotides: a) the polynucleotide of SEQ ID NO. 1: and b) a polynucleotide capable of ^hybridizing selectively to a polynucleotide of SEQ ID No.l; and c) a polynucleotide homologous at least 90% to the polynucleotide of SEQ ID NO.1.

2) Isolated or purified polynucleotide, characterized in that it comprises a polynucleotide chosen from the following polynucleotides: a) the polynucleotide of SEQ ID NO. 2: b) a polynucleotide capable of ^hybridizing selectively to a polynucleotide of SEQ ID NO.2; c) a polynucleotide homologous at least 90% to the polynucleotide of SEQ ID NO.2.

3) Polynucleotide according to claim 1 or 2, characterized in that it codes for an RNA dependent RNA polymerase.

4) Polynucleotide according to one of claims 1-3. characterized in that it codes for an RNA dependent RNA polymerase involved in post-transcriptional inactivation in plants.

5) Polynucleotide according to one of claims 1-3. characterized in that it codes for an RNA dependent RNA polymerase involved in resistance to the virus in plants.

6) Isolated or purified polynucleotide, characterized in that it comprises a polynucleotide coding for the polypeptide of SEQ ID NO. 3.

7) Isolated or purified polynucleotide, characterized in that it comprises an antisense polynucleotide of the coding sequence of the SGS2 gene of SEQ ID NO. 2.

8) Isolated or purified polynucleotide, characterized in that it comprises the promoter of the SGS2 gene whose sequence is between position 1 and position 850 of SEQ ID NO. 1 or a biologically active fragment of the SGS2 promoter whose sequence is between position 1 and position 850 of SEQ ID NO. 1. 9) Expression cassette characterized in that it comprises, in the direction of transcription: a) a functional promoter in a host organism; b) a polynucleotide according to one of claims 1-6; c) a terminator sequence in said host organism.

10) Expression cassette characterized in that it comprises, in the direction of transcription: a) a functional promoter in a host organism; b) a polynucleotide according to claim 7; c) a terminator sequence in said host organism.

11) Expression cassette characterized in that it comprises, in the direction of transcription: a) a polynucleotide according to claim 8; b) a polynucleotide encoding a heterologous polypeptide; c) a terminator sequence in plant cells or plants.

12) Expression or transformation vector comprising a polynucleotide and / or an expression cassette according to one of claims 1-11.

13) Process for transforming host organisms, in particular plant cells or plants, by integrating into said host organism at least one polynucleotide, an expression cassette and / or a vector according to one of the claims 1 to 12.

14) Method for expressing a heterologous gene in a plant characterized in that it comprises the following steps: a) transforming said plant with said heterologous gene; b) the expression of a polynucleotide according to one of claims 1 or 2 is inhibited in said plant.

15) Method according to claim 15 characterized in that step b) comprises the transformation of said plant with a polynucleotide according to one of claims 7. 10 or 12.

16) Method for expressing a heterologous gene in a plant characterized in that it comprises the following steps: a) transforming said plant with said heterologous gene; b) the expression of a polynucleotide according to one of claims 1 or 2 is inactivated in said plant. 17) Transformed host organism comprising a polynucleotide. and an expression cassette or a vector according ^to one of claims 1 to 12.

18) Host organism characterized in that the expression of a polynucleotide according to one of claims 1 or 2 is inactivated or inhibited in said host organism.

19) A host organism according ^to one of claims 17 or 18. characterized in that the host organism is selected from bacteria, yeasts, fungi or plant cells and plants.

20) Host organism according to claim 19 characterized in that the host organism is chosen from maize, wheat, barley, sorghum, rapeseed, soybeans, rice. sugar cane, beet, tobacco, cotton.

21) Host organism according to one of claims 17-20, characterized in that it comprises at least one heterologous gene coding for a peptide or a protein of interest.

22) Isolated or purified polypeptide characterized in that it comprises a polypeptide chosen from the following polypeptides: a) the polypeptide of SEQ ID NO. 3, and b) a polypeptide homologous at least 90%) to the polypeptide of SEQ ID NO. 3.

23) A polypeptide according to claim 22 characterized in that it has an RNA dependent RNA polymerase activity.

24) Use of a fragment ^of nucleic acid according to one of claims 1 to 9 for the identification of genes encoding RNA dependent RNA polymerases involved in post-transcriptional inactivation in plants.