EP2191250A1 - Method, device and molecular biology kit for extracting amplified genetic material - Google Patents
Method, device and molecular biology kit for extracting amplified genetic materialInfo
- Publication number
- EP2191250A1 EP2191250A1 EP08838264A EP08838264A EP2191250A1 EP 2191250 A1 EP2191250 A1 EP 2191250A1 EP 08838264 A EP08838264 A EP 08838264A EP 08838264 A EP08838264 A EP 08838264A EP 2191250 A1 EP2191250 A1 EP 2191250A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- cells
- filter
- process according
- compartment
- during
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N1/00—Sampling; Preparing specimens for investigation
- G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
- G01N1/40—Concentrating samples
- G01N1/4077—Concentrating samples by other techniques involving separation of suspended solids
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
- B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
- B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N1/00—Sampling; Preparing specimens for investigation
- G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L2300/00—Additional constructional details
- B01L2300/06—Auxiliary integrated devices, integrated components
- B01L2300/0681—Filter
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L2300/00—Additional constructional details
- B01L2300/08—Geometry, shape and general structure
- B01L2300/0861—Configuration of multiple channels and/or chambers in a single devices
- B01L2300/087—Multiple sequential chambers
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L2400/00—Moving or stopping fluids
- B01L2400/04—Moving fluids with specific forces or mechanical means
- B01L2400/0475—Moving fluids with specific forces or mechanical means specific mechanical means and fluid pressure
- B01L2400/0478—Moving fluids with specific forces or mechanical means specific mechanical means and fluid pressure pistons
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L2400/00—Moving or stopping fluids
- B01L2400/06—Valves, specific forms thereof
- B01L2400/0677—Valves, specific forms thereof phase change valves; Meltable, freezing, dissolvable plugs; Destructible barriers
- B01L2400/0683—Valves, specific forms thereof phase change valves; Meltable, freezing, dissolvable plugs; Destructible barriers mechanically breaking a wall or membrane within a channel or chamber
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
- B01L3/02—Burettes; Pipettes
- B01L3/021—Pipettes, i.e. with only one conduit for withdrawing and redistributing liquids
- B01L3/0217—Pipettes, i.e. with only one conduit for withdrawing and redistributing liquids of the plunger pump type
- B01L3/0231—Pipettes, i.e. with only one conduit for withdrawing and redistributing liquids of the plunger pump type having several coaxial pistons
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
- B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
- B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
- B01L3/5025—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures for parallel transport of multiple samples
- B01L3/50255—Multi-well filtration
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L9/00—Supporting devices; Holding devices
- B01L9/54—Supports specially adapted for pipettes and burettes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N1/00—Sampling; Preparing specimens for investigation
- G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
- G01N1/40—Concentrating samples
- G01N1/4044—Concentrating samples by chemical techniques; Digestion; Chemical decomposition
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N1/00—Sampling; Preparing specimens for investigation
- G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
- G01N1/40—Concentrating samples
- G01N1/4077—Concentrating samples by other techniques involving separation of suspended solids
- G01N2001/4088—Concentrating samples by other techniques involving separation of suspended solids filtration
Definitions
- the present invention relates to a method, a device and a kit for molecular biology for extracting amplified genetic material from isolated cells on a filter and detecting mutations and levels of gene expression for sensitivity and resistance to targeted therapies. .
- Some particular blood cells for example tumor cells or trophoblastic cells, are in very low concentration and must be concentrated for cytopathological analysis. However, compared to blood cells, they are larger.
- the present invention aims to remedy these drawbacks and to respond to this need by making it possible to collect, in conditions compatible with routine laboratory tests, a large proportion of the cellular material, in particular, RNA and DNA, cells considered, in particular good condition.
- the present invention provides a method for collecting cellular material from particular cells present in a liquid, characterized in that it comprises:
- the method that is the subject of the present invention makes it possible to collect cellular material quickly and efficiently.
- the cellular material recovered through the practice of the present invention is the genetic material of the cells.
- the method which is the subject of the present invention thus makes it possible to recover, directly on the filter and with virtually no loss, the genetic material of rare cells, up to a single isolated cell. A large proportion of the genetic material of the cells in question is thus collected, in good condition, under conditions compatible with routine laboratory tests.
- the process which is the subject of the present invention comprises, following the lysis step, a step of amplification of the DNA and / or RNA and, during the recovery step, amplified genetic material is recovered from the lysed cells.
- a uniform amplification is carried out, preserving the quantitative aspect of the DNA and the RNA.
- the method which is the subject of the present invention, as briefly described above, comprises, in in addition, a detection step, during which the amplified DNA is used as a template to detect at least one gene mutation of sensitivity or resistance to at least one targeted therapy.
- the method which is the subject of the present invention furthermore comprises a detection step, during which the amplified DNA is used as a matrix to detect a variation in the level of d expression of genes of sensitivity or resistance to targeted therapies.
- the method which is the subject of the present invention further comprises a detection step during which RNA is converted into cDNA and said cDNA is used to detect the cDNA.
- a quantitative and real-time PCR (acronym for polymerase chain reaction) is used.
- At least one pair of sense and antisense primer pairs are used to amplify a predetermined sequence of interest.
- At least one pair of probes is implemented.
- At least two probes of a pair of probes are coupled to two different fluorochromes and are defined so that one recognizes the mutated sequence and the other recognizes the normal sequence.
- At least one pair of primers and a pair of probes are adapted to detect the G12D mutation of the K-ras gene of Erlotinib and Gefitinib resistance.
- At least one primer comprises at least 80% of the sequence
- At least one primer comprises at least 80% of the sequence
- At least one probe comprises at least 80% of the TTGGAGCTGGTGGCGT sequence.
- At least one probe comprises at least 80% of the TGGAGCTGATGGCGT sequence.
- At least one pair of primers and a pair of probes are adapted to detect the G12V mutation of the K-ras Erlotinib and Gefitinib resistance gene.
- At least one primer comprises at least 80% of the sequence
- At least one primer comprises at least 80% of the sequence
- At least one probe comprises at least 80% of the TTGGAGCTGGTGGCGT sequence.
- At least one probe comprises at least 80% of the sequence TTGGAGCTGTTGGCGT.
- At least one pair of primers and a pair of probes are adapted to detect the G13C mutation of the K-ras Erlotinib and Gefitinib resistance gene.
- At least one primer comprises at least 80% of the sequence
- At least one primer comprises at least 80% of the sequence
- At least one probe comprises at least 80% of the TTGGAGCTGGTGGCGT sequence. According to particular characteristics, at least one probe comprises at least 80% of the sequence TTGGAGCTGGTTGCGT.
- At least one pair of primers and a pair of probes are adapted to detect the L858R mutation of the EGFR gene of increased sensitivity to Erlotinib and Gefitinib.
- At least one primer comprises at least 80% of the sequence GCAGCATGTCAAGATCACAGATTT.
- At least one primer comprises at least 80% of the sequence
- At least one probe comprises at least 80% of the sequence CAGTTTGGCCAGCCCA.
- At least one probe comprises at least 80% of the sequence CAGTTTGGCCCGCCCA.
- the process as briefly described above comprises, in advance of the filtration step, a step of applying a formaldehyde-free fixing buffer to the liquid containing the particular cells.
- the particular cells sought are specifically hardened without altering the genetic material.
- the compartment has the general shape of a syringe in which the filter is positioned between the two openings.
- vacuum suction is applied below the filter. Thanks to these provisions, the filtration is more efficient and faster than in the absence of suction.
- the compartment is placed on a tube of the Eppendorf type. There is thus a direct passage from the filter to an Eppendorf-type tube.
- a piston is placed in the upper opening of the compartment, comprising a central punch movable inside the piston.
- the mobile central punch has a pointed lower end.
- the pointed lower end has a star shape.
- pressure is applied to the upper part of the punch to perforate the filter with the tip of the punch.
- the piston having a means for locking the punch longitudinally, during the recovery step, the punch is pivoted inside the piston to release it from said locking means, before applying a pressure on its upper part.
- a downward vertical pressure is applied to the piston to pass the contents of the compartment into a tube placed below the compartment.
- the cellular material of the particular cells can be extracted without deterioration through the perforation of the filter.
- the contents of the compartment are isolated by plugging the lower opening with a membrane.
- said membrane is positioned under a bar surrounding the lower opening of each compartment. This ensures the sealing and the maintenance of the lysis liquid above the filter.
- said membrane is an adhesive membrane.
- the filter is made of polycarbonate with a hydrophilic surface treatment.
- the use of such a filter improves the retention rate of the particular cells and reduces the adhesion of the cellular material to be recovered.
- the filter has a pore diameter centered on 7.5 ⁇ m.
- the diameters due to the dispersion of the diameters, virtually no pore has a diameter greater than 8 microns.
- this pore diameter which is less than the pore diameter traditionally used for the cytological analysis filters, makes it possible to remove them, which reduces the number of contiguous pores and avoids the loss of particular cells.
- the present invention relates to a device for collecting genetic material from particular cells present in a liquid, characterized in that it comprises:
- a compartment comprising an upper opening and a lower opening, between the two openings being positioned a filter whose micropores have a diameter intermediate between that of said particular cells and that of other cells,
- a filtration means passing the principal of the liquid and said other cells through the filter
- the present invention provides a molecular biology kit comprising at least two primers and / or two probes among the following sequences:
- the kit object of the present invention further comprises a device object of the present invention, as briefly described above.
- FIG. 1 schematically represents, in perspective, parts of two particular embodiments of the device that is the subject of the the present invention, implemented in a first phase of the process which is the subject of the present invention
- FIG. 2 schematically represents, in section, parts of the two particular embodiments of the device that is the subject of the present invention, implemented in a first phase of the method that is the subject of the present invention
- FIG. 3 schematically represents, in perspective, parts of a first particular embodiment of the device that is the subject of the present invention
- FIG. 4 represents, schematically, in elevation, parts of the first particular embodiment of the device that is the subject of the present invention
- FIG. 5 represents, schematically, in section, parts of the first particular embodiment of the device that is the subject of the present invention
- FIG. 6 schematically represents, in perspective, parts of a second particular embodiment of the device that is the subject of the present invention.
- FIG. 7 schematically represents, in section, parts of the second particular embodiment of the device that is the subject of the present invention.
- FIG. 8 schematically represents, in perspective, parts of the two particular embodiments of the device that is the subject of the present invention, used in a second phase of the method that is the subject of the present invention, and
- FIG. 9 represents, in the form of a logic diagram, the steps implemented in a particular embodiment of the method that is the subject of the present invention.
- the device for collecting cellular material here genetic, comprises (here four) syringe-shaped compartments 105 presenting, each , an upper opening 106 and a lower opening 107.
- a washer or ring 118 placed in the lower opening 107 retains a filter 115.
- the filters 115 are micro-perforated and glued on the washers or rings 118 and then inserted at the distal end, that is to say say, at the bottom, of the four syringe-shaped compartments 105.
- the filter 115 is made of polycarbonate with a hydrophilic surface treatment.
- the use of such a filter improves the retention rate of the particular cells and reduces the adhesion of the cellular material to be recovered.
- the filter 115 has, for example, a pore diameter centered on 7.5 ⁇ m. Due to the dispersion of the diameters, practically no pore then has a diameter greater than 8 ⁇ m.
- each compartment 105 At the small opening, or bottom opening, of each compartment 105 is placed, tightly, a tip (English "tip") 117 to avoid potential contamination of the end of the compartment 105 by splashing from the tank 112.
- These compartments 105 are assembled by a bar 116, made of plastic, to constitute a single piece.
- the assembly, consisting of the four compartments 105, the upper bar 116, the four pistons 140 and the bar-cap 120 (described below) is for single use.
- the compartments 105 are supported by a plate 110 inserted into a drawer holder 111 having a compartment connected to a tank 112 under the lower surface of the plate 110 through which an aspiration can be carried out. performed.
- An O-ring 113 seals the connection between a nozzle 117 and the plate 110.
- An O-ring 114 seals the connection between the plate 110 and the slide gate 111. The seal provided by the O-rings 113 and 114 allows aspiration of the contents of the compartments.
- the compartments 105 are removed from the portion of the device illustrated in FIGS. 1 and 2 and the tips 117 are removed from the lower openings of the compartments 105.
- a cap strip 120 is inserted at the tip of the compartments 105 in the form of syringes. It is a bar with four perforations that receive the lower end of the compartments.
- a plastic film is glued to the underside of this plug-bar 120, and constitutes a sealed membrane, preferably adhesive.
- the contents of the compartment 105 are thus kept away from the environment until the recovery of the cellular material of the particular cells.
- the bar 116 carrying the compartments 105, associated with the bar of plugs 120, is placed in abutment on a rack 133 made of plastic material. Then, in an oven, the lysis of the cells present in the compartment 105 is carried out in an oven. For this purpose, after the addition of the reagents for the lysis of the cell membranes of the desired cells and the uniform amplification of the DNA or the RNA, the rack 133, now the vertical compartments 105, is transported in an oven. At the outlet of the oven, after cooling, the Eppendorf-type tubes are positioned on the lower support 131 of the gantry 130. The bar 116 carrying the compartments 105, associated with the bar of plugs 120, is positioned on the gantry 130 and place the gantry 130 on the lower support 131.
- a piston 140 provided with a central axial punch 141 ending in a tip 142.
- this tip 142 has a star shape, for example to four branches, the point being cruciform.
- each compartment 105 is positioned an Eppendorf tube 125 held in position by a shelf of the gantry 130.
- Figures 3 and 4 illustrate the respective successive positions of the piston 140 and the punch 141 during the second phase of the process.
- the piston 140 and the punch 141 are substantially entirely outside the compartment 106 and the upper part of the punch 141 protrudes vertically above the piston 140.
- the punch is passed from a safety position in which the punch 141 can not slide longitudinally inside a piston 140 because of a mechanical stop, at a position activation device in which the punch can slide longitudinally inside the piston 140.
- a vertical force is applied downward on the top of the punch 141, the tip 142 of the punch 141 is lowered into the body of the compartment 106, to the filter 115.
- the tip 142 first pierces the filter 115 and the membrane 120 to penetrate slightly into the tube 125.
- the punch 141 is then held in position by contact on the opening bottom of the compartment 105.
- the Eppendorf type tubes 125 are then removed from the lower support 131, by withdrawing, upwardly from the gantry 130, the compartments 105 and the membrane 120, for analysis of the amplified genetic material, in particular the DNA or the RNA of the cells. of interest, collected in these tubes 125.
- the plate 110, the rack 133, the gantry 130 and the support 131 are reusable.
- a support 131 of the gantry 130 is replaced by a support 132 having eight openings instead of four.
- the four tubes of Eppendorf type 125 are replaced by a bar of eight tubes of Eppendorf type 126 of lower capacity, typically 0.25 ml. Instead of 1, 5 ml.
- These Eppendorf-type tubes are adapted to another mode of recovery of cellular material making it possible to extract the amplified genetic material directly on the filter but in a smaller volume. Such a volume can then be contained in Eppendorf type tubes directly adapted to a RT-PCR apparatus (acronym for "reverse transcription polymerase chain reaction" for reverse transcription and polymerase chain reaction) in real time. It is noted that when using eight Eppendorf-type tubes, four tubes are used to collect amplified genetic material and four tubes are used to make controls, positive or negative.
- the method which is the subject of the present invention first comprises, in a known manner, a step 200 of sampling a sample of liquid to be analyzed, for example from blood to which, optionally, a dilution or filtration.
- a formaldehyde-free fixing buffer is applied in order to fix, that is to say harden, specifically the particular cells sought, without altering their genetic material.
- this binding buffer is composed of "PBS", a phosphate buffer, saponin for lysing red blood cells of BSA, bovine serum albumin to preserve the morphology of ETDA cells calcium chelating, sodium hydroxide (NaOH ) to adjust the pH to 7.2 and RCL2, a cell fixer that does not alter their genetic material. It is noted that formaldehyde is not used because it induces breaks in the genetic material.
- step 210 the liquid resulting from step 205 is placed in a compartment 105 which ends with a filter whose micropores have an intermediate diameter between that of the desired cells and that of the other cells of the sample. liquid.
- step 205 is fixed inside compartment 105 after step 210.
- step 215 vacuum suction is applied below the filter.
- the principal of the liquid as well as the cells of diameter smaller than that of the pores of the filter 115 then pass through the filter 115.
- the desired cells of diameter smaller than that of the pores of the filter 115 are retained above the filter 115, in the compartment 105.
- the compartments are removed from the plate 110, the tips 117 are removed from the compartments 105 and this remaining content is isolated in the compartment 105 by plugging the lower opening with a cap bar covered, in its lower part with an adhesive membrane 120.
- the compartments 105 associated on the one hand with the bar of plugs 120 and the bar 116, are inserted into the rack 133, the bar 116 being held by this rack 133.
- the cells retained on the filter are lysed according to known techniques.
- the rack 133 maintaining the vertical compartments 105, is kept in an oven for a period of time. known duration.
- each compartment 105 is placed above an Eppendorf type tube 125, or 126 by positioning this tube on the lower support, 131 or 132 respectively, then the gantry 130 is positioned with the bar 116 compartments 105 and the cap strip 120 on lower portion 131, or 132, respectively.
- a piston 140 provided with a central axial punch 141 movable relative to the piston 140 and ending, inside the compartment 105, by a tip 142.
- this tip 142 has a star shape, for example with four branches, the tip then being cruciform.
- a pressure is applied on the upper part of the punch 141 to lower it along the longitudinal axis of the compartment 105, being guided by the piston 140.
- the tip 142 of the punch 141 perforates , successively, the filter 115 and the plug or the adhesive membrane 120.
- a pressure is applied on the rest of the piston 140 so that the remaining contents of the compartment 105 passes through the filter 115 and the plug or the membrane 120, and reaches the Eppendorf-type tube, by opening surrounding the tip 142 of the punch 141.
- the genetic material of the particular cells is extracted without deterioration through the perforation of the filter.
- the support, 131 or 132, and the Eppendorf type tubes, 125 or 126 are removed after removal, upwardly of the gantry 130, from the compartments 105 and the membrane 120.
- steps 265 and 270 an analysis of the genetic material, in particular the DNA or RNA of the desired cells, is carried out in these tubes 125 or 126.
- the amplified DNA is used as a template to detect the mutations of sensitivity or resistance to targeted therapies.
- cDNA derived from RNA by RT conversion and amplified is used as a template to detect the level of expression of susceptibility genes. or resistance to targeted therapies.
- a defined volume of the amplified genetic material, in particular DNA, is taken to detect mutations in sensitivity or resistance to targeted therapies using primer and antisense pairs of primers. pairs of probes and during a quantitative and real-time PCR (acronym for polymerase chain reaction).
- the principle of the search for mutations of sensitivity or resistance to targeted therapies implemented in the embodiment shown is as follows.
- the allele discrimination or "SNP genotyping assay” (SNP being the acronym for "single nucleotide polymorphism” for single nucleotide polymorphism) provides information on the presence or absence of a point mutation in a gene.
- the first step, 265, of allelic discrimination is a real-time quantitative PCR reaction carried out with two primers to amplify the sequence of interest and two probes, for example of the TaqMan (registered trademark) type. One of the probes recognizes the mutated sequence and the other recognizes the normal sequence.
- the two probes are associated with different fluorochromes, for example "VIC” for the probe hybridizing to the normal sequence and "FAM” for the probe hybridizing to the mutated sequence.
- the second step, 270 uses an allelic discrimination program measuring the initial fluorescence and the final fluorescence emitted by the FAM or / and VIC fluorochromes. This program makes it possible to distinguish between the different sequences present in each sample:
- sequences of the following primers and probes are used, for example:
- a defined volume of the genetic material including RNA converted to cDNA by RT (acronym for "reverse transcription") and amplified is taken to detect the level of gene expression of sensitivity or resistance to targeted therapies using sense and antisense primer pairs and a probe and during a quantitative and real-time polymerase chain reaction (PCR), for example with 50 cycles.
- PCR polymerase chain reaction
- the method, the device and the kit object of the present invention make it possible to collect and amplify under a condition compatible with routine laboratory tests, a large proportion of the genetic material of the present invention. cells considered, in good condition, even if the sample has only one desired cell.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Physics & Mathematics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Hematology (AREA)
- Clinical Laboratory Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method for collecting cellular material from particular cells present in a liquid, that comprises: a step (210) of inserting the liquid into a compartment (105) through an upper opening (106) in the compartment, said compartment having a lower opening (107) while between said openings is provided a filter (115) in which the micropores have a diameter between that of said particular cells and that of other cells; a filtration step (215) during which the major portion of the liquid and said other cells flows through the filter; a step (230) of DNA and/or RNA lysing and amplifying; and a step (250) of recovering on said filter the amplified genetic material.
Description
Procédé, dispositif et kit de biologie moléculaire permettant l'extraction du matériel génétique amplifié Method, device and kit for molecular biology for extracting amplified genetic material
La présente invention concerne un procédé, un dispositif et un kit de biologie moléculaire permettant l'extraction du matériel génétique amplifié de cellules isolées sur filtre et la détection de mutations et des niveaux de l'expression de gènes de sensibilité et de résistance aux thérapies ciblées.The present invention relates to a method, a device and a kit for molecular biology for extracting amplified genetic material from isolated cells on a filter and detecting mutations and levels of gene expression for sensitivity and resistance to targeted therapies. .
Elle s'applique, en particulier à recueillir et à amplifier de façon uniforme l'ADN ou l'ARN de cellules particulières présentes dans un liquide, notamment le sang.It applies, in particular to collect and uniformly amplify the DNA or RNA of particular cells present in a liquid, including blood.
Certaines cellules particulières du sang, par exemple les cellules tumorales ou les cellules trophoblastiques, sont en très faible concentration et doivent être concentrées pour une analyse cytopathologique. Cependant, par rapport aux cellules sanguines, elles sont de plus grande taille.Some particular blood cells, for example tumor cells or trophoblastic cells, are in very low concentration and must be concentrated for cytopathological analysis. However, compared to blood cells, they are larger.
Il est connu, par exemple du document PCT/FR 2006/000562, d'appliquer un tampon de fixation à base de formaldéhyde à un échantillon sanguin pour fixer les cellules recherchées, puis de faire passer le liquide résultant dans un filtre poreux. Ce filtre est ensuite analysé en laboratoire pour y rechercher les cellules sous microscope. On peut, par la suite, les prélever sur le filtre pour des analyses, par exemple par une analyse génétique. Cependant, cette procédure ne peut faire l'objet d'une reproduction à grande échelle et à un coût raisonnable, du fait du temps, des matériels et de la précision de travail qu'elle implique.It is known, for example from PCT / FR 2006/000562, to apply a formaldehyde-based fixation buffer to a blood sample to fix the desired cells, and then to pass the resulting liquid through a porous filter. This filter is then analyzed in the laboratory to look for the cells under a microscope. They can subsequently be taken from the filter for analysis, for example by genetic analysis. However, this procedure can not be reproduced on a large scale and at a reasonable cost, because of the time, materials and the precision of work involved.
Cela permettrait la conduite d'analyses de biologie moléculaire à la fois sur des cellules tumorales et sur des cellules trophoblastiques.This would allow the conduct of molecular biology analyzes on both tumor cells and trophoblastic cells.
La présente invention vise à remédier à ces inconvénients et à répondre à ce besoin en permettant de recueillir dans des conditions compatibles avec des examens de laboratoire de routine, une grande proportion du matériel cellulaire, en particulier, ARN et ADN, des cellules considérées, en bon état.
A cet effet, selon un premier aspect, la présente invention vise un procédé pour recueillir du matériel cellulaire de cellules particulières présentes dans un liquide, caractérisé en ce qu'il comporte :The present invention aims to remedy these drawbacks and to respond to this need by making it possible to collect, in conditions compatible with routine laboratory tests, a large proportion of the cellular material, in particular, RNA and DNA, cells considered, in particular good condition. For this purpose, according to a first aspect, the present invention provides a method for collecting cellular material from particular cells present in a liquid, characterized in that it comprises:
- une étape d'insertion du liquide dans un compartiment par l'intermédiaire d'une ouverture supérieure du compartiment, ledit compartiment présentant une ouverture inférieure, entre les deux ouvertures étant positionné un filtre dont les micropores ont un diamètre intermédiaire entre celui des dites cellules particulières et celui d'autres cellules,a step of insertion of the liquid into a compartment via an upper opening of the compartment, said compartment presenting a lower opening, between the two openings being positioned a filter whose micropores have a diameter intermediate between that of said cells; particulars and that of other cells,
- une étape de filtration au cours de laquelle le principal du liquide et des dites autres cellules passe à travers le filtre,a filtration step during which the principal of the liquid and said other cells pass through the filter,
- une étape de lyse des cellules retenues sur le filtre eta step of lysis of the cells retained on the filter and
- une étape de récupération de matériel cellulaire des cellules lysées, sur le filtre.a step of recovering cellular material from the lysed cells, on the filter.
Le procédé objet de la présente invention permet de recueillir du matériel cellulaire rapidement et efficacement.The method that is the subject of the present invention makes it possible to collect cellular material quickly and efficiently.
En général, le matériel cellulaire récupéré grâce à la mise en œuvre de la présente invention est le matériel génétique des cellules. Le procédé objet de la présente invention permet ainsi la récupération, directement sur filtre et pratiquement sans perte, du matériel génétique de cellules rares, jusqu'à une seule cellule isolée. On recueille ainsi une grande proportion du matériel génétique des cellules considérées, en bon état, dans des conditions compatibles avec des examens de laboratoire de routine.In general, the cellular material recovered through the practice of the present invention is the genetic material of the cells. The method which is the subject of the present invention thus makes it possible to recover, directly on the filter and with virtually no loss, the genetic material of rare cells, up to a single isolated cell. A large proportion of the genetic material of the cells in question is thus collected, in good condition, under conditions compatible with routine laboratory tests.
Selon des caractéristiques particulières, le procédé objet de la présente invention, tel que succinctement exposé ci-dessus comporte, à la suite de l'étape de lyse, une étape d'amplification de l'ADN et/ou de l'ARN et, au cours de l'étape de récupération, on récupère du matériel génétique amplifié des cellules lysées.According to particular features, the process which is the subject of the present invention, as briefly described above, comprises, following the lysis step, a step of amplification of the DNA and / or RNA and, during the recovery step, amplified genetic material is recovered from the lysed cells.
Selon des caractéristiques particulières, au cours de l'étape de lyse et d'amplification, on effectue une amplification uniforme conservant l'aspect quantitatif de l'ADN et de l'ARN.According to particular characteristics, during the lysis and amplification step, a uniform amplification is carried out, preserving the quantitative aspect of the DNA and the RNA.
Selon des caractéristiques particulières, le procédé objet de la présente invention, tel que succinctement exposé ci-dessus, comporte, en
outre, une étape de détection, au cours de laquelle l'ADN amplifié est utilisé comme matrice pour détecter au moins une mutation de gêne de sensibilité ou de résistance à au moins une thérapie ciblée.According to particular features, the method which is the subject of the present invention, as briefly described above, comprises, in in addition, a detection step, during which the amplified DNA is used as a template to detect at least one gene mutation of sensitivity or resistance to at least one targeted therapy.
Selon des caractéristiques particulières, le procédé objet de la présente invention, tel que succinctement exposé ci-dessus, comporte, en outre, une étape de détection, au cours de laquelle l'ADN amplifié est utilisé comme matrice pour détecter une variation de niveau d'expression de gènes de sensibilité ou de résistance aux thérapies ciblées.According to particular features, the method which is the subject of the present invention, as briefly described above, furthermore comprises a detection step, during which the amplified DNA is used as a matrix to detect a variation in the level of d expression of genes of sensitivity or resistance to targeted therapies.
Selon des caractéristiques particulières, le procédé objet de la présente invention, tel que succinctement exposé ci-dessus, comporte, en outre, une étape de détection au cours de laquelle on convertit de l'ARN en ADNc et on utilise ledit ADNc pour détecter le niveau d'expression de gène de sensibilité ou de résistance aux thérapies ciblées.According to particular features, the method which is the subject of the present invention, as briefly described above, further comprises a detection step during which RNA is converted into cDNA and said cDNA is used to detect the cDNA. level of gene expression of sensitivity or resistance to targeted therapies.
Selon des caractéristiques particulières, au cours de l'étape de détection, on met en œuvre une PCR (acronyme de « polymerase chain reaction ») quantitative et en temps réel.According to particular characteristics, during the detection step, a quantitative and real-time PCR (acronym for polymerase chain reaction) is used.
Selon des caractéristiques particulières, au cours de l'étape de détection, on met en œuvre au moins un couple d'amorces sens et anti-sens pour amplifier une séquence d'intérêt prédéterminé.According to particular characteristics, during the detection step, at least one pair of sense and antisense primer pairs are used to amplify a predetermined sequence of interest.
Selon des caractéristiques particulières, au cours de l'étape de détection, on met en œuvre au moins un couple de sondes.According to particular characteristics, during the detection step, at least one pair of probes is implemented.
Selon des caractéristiques particulières, au moins deux sondes d'un couple de sondes sont couplées à deux fluorochromes différents et sont définis pour que l'une reconnaisse la séquence mutée et que l'autre reconnaisse la séquence normale.According to particular characteristics, at least two probes of a pair of probes are coupled to two different fluorochromes and are defined so that one recognizes the mutated sequence and the other recognizes the normal sequence.
Selon des caractéristiques particulières, au moins un couple d'amorces et un couple de sondes sont adaptés à détecter la mutation G12D du gène K-ras de résistance à l'Erlotinib et au Gefitinib.According to particular characteristics, at least one pair of primers and a pair of probes are adapted to detect the G12D mutation of the K-ras gene of Erlotinib and Gefitinib resistance.
Selon des caractéristiques particulières, au moins une amorce comporte au moins 80 % de la séquenceAccording to particular characteristics, at least one primer comprises at least 80% of the sequence
AGGCCTGCTGAAAATGACTGAATAT.
Selon des caractéristiques particulières, au moins une amorce comporte au moins 80 % de la séquenceAGGCCTGCTGAAAATGACTGAATAT. According to particular characteristics, at least one primer comprises at least 80% of the sequence
TCGTCCACAAAATGATTCTGAATTAGCT.TCGTCCACAAAATGATTCTGAATTAGCT.
Selon des caractéristiques particulières, au moins une sonde comporte au moins 80 % de la séquence TTGGAGCTGGTGGCGT.According to particular characteristics, at least one probe comprises at least 80% of the TTGGAGCTGGTGGCGT sequence.
Selon des caractéristiques particulières, au moins une sonde comporte au moins 80 % de la séquence TGGAGCTGATGGCGT.According to particular characteristics, at least one probe comprises at least 80% of the TGGAGCTGATGGCGT sequence.
Selon des caractéristiques particulières, au moins un couple d'amorces et un couple de sondes sont adaptés à détecter la mutation G12V du gène K-ras de résistance à l'Erlotinib et au Gefitinib.According to particular characteristics, at least one pair of primers and a pair of probes are adapted to detect the G12V mutation of the K-ras Erlotinib and Gefitinib resistance gene.
Selon des caractéristiques particulières, au moins une amorce comporte au moins 80 % de la séquenceAccording to particular characteristics, at least one primer comprises at least 80% of the sequence
AGGCCTGCTGAAAATGACTGAATAT.AGGCCTGCTGAAAATGACTGAATAT.
Selon des caractéristiques particulières, au moins une amorce comporte au moins 80 % de la séquenceAccording to particular characteristics, at least one primer comprises at least 80% of the sequence
TCGTCCACAAAATGATTCTGAATTAGCT.TCGTCCACAAAATGATTCTGAATTAGCT.
Selon des caractéristiques particulières, au moins une sonde comporte au moins 80 % de la séquence TTGGAGCTGGTGGCGT.According to particular characteristics, at least one probe comprises at least 80% of the TTGGAGCTGGTGGCGT sequence.
Selon des caractéristiques particulières, au moins une sonde comporte au moins 80 % de la séquence TTGGAGCTGTTGGCGT.According to particular characteristics, at least one probe comprises at least 80% of the sequence TTGGAGCTGTTGGCGT.
Selon des caractéristiques particulières, au moins un couple d'amorces et un couple de sondes sont adaptés à détecter la mutation G13C du gène K-ras de résistance à l'Erlotinib et au Gefitinib.According to particular characteristics, at least one pair of primers and a pair of probes are adapted to detect the G13C mutation of the K-ras Erlotinib and Gefitinib resistance gene.
Selon des caractéristiques particulières, au moins une amorce comporte au moins 80 % de la séquenceAccording to particular characteristics, at least one primer comprises at least 80% of the sequence
AGGCCTGCTGAAAATGACTGAATAT.AGGCCTGCTGAAAATGACTGAATAT.
Selon des caractéristiques particulières, au moins une amorce comporte au moins 80 % de la séquenceAccording to particular characteristics, at least one primer comprises at least 80% of the sequence
TCGTCCACAAAATGATTCTGAATTAGCT.TCGTCCACAAAATGATTCTGAATTAGCT.
Selon des caractéristiques particulières, au moins une sonde comporte au moins 80 % de la séquence TTGGAGCTGGTGGCGT.
Selon des caractéristiques particulières, au moins une sonde comporte au moins 80 % de la séquence TTGGAGCTGGTTGCGT.According to particular characteristics, at least one probe comprises at least 80% of the TTGGAGCTGGTGGCGT sequence. According to particular characteristics, at least one probe comprises at least 80% of the sequence TTGGAGCTGGTTGCGT.
Selon des caractéristiques particulières, au moins un couple d'amorces et un couple de sondes sont adaptés à détecter la mutation L858R du gène EGFR de sensibilité augmentée à l'Erlotinib et au Gefitinib.According to particular characteristics, at least one pair of primers and a pair of probes are adapted to detect the L858R mutation of the EGFR gene of increased sensitivity to Erlotinib and Gefitinib.
Selon des caractéristiques particulières, au moins une amorce comporte au moins 80 % de la séquence GCAGCATGTCAAGATCACAGATTT.According to particular characteristics, at least one primer comprises at least 80% of the sequence GCAGCATGTCAAGATCACAGATTT.
Selon des caractéristiques particulières, au moins une amorce comporte au moins 80 % de la séquenceAccording to particular characteristics, at least one primer comprises at least 80% of the sequence
CCTCCTTCTGCATGGTATTCTTTCT.CCTCCTTCTGCATGGTATTCTTTCT.
Selon des caractéristiques particulières, au moins une sonde comporte au moins 80 % de la séquence CAGTTTGGCCAGCCCA.According to particular characteristics, at least one probe comprises at least 80% of the sequence CAGTTTGGCCAGCCCA.
Selon des caractéristiques particulières, au moins une sonde comporte au moins 80 % de la séquence CAGTTTGGCCCGCCCA.According to particular characteristics, at least one probe comprises at least 80% of the sequence CAGTTTGGCCCGCCCA.
Selon des caractéristiques particulières, le procédé tel que succinctement exposé ci-dessus comporte, préliminairement à l'étape de filtration, une étape d'application d'un tampon de fixation sans formaldéhyde au liquide contenant les cellules particulières.According to particular features, the process as briefly described above comprises, in advance of the filtration step, a step of applying a formaldehyde-free fixing buffer to the liquid containing the particular cells.
Ainsi, on durcit spécifiquement les cellules particulières recherchées, sans altérer le matériel génétique.Thus, the particular cells sought are specifically hardened without altering the genetic material.
Selon des caractéristiques particulières, au cours de l'étape d'insertion, le compartiment présente la forme générale d'une seringue dans laquelle le filtre est positionné entre les deux ouvertures.According to particular characteristics, during the insertion step, the compartment has the general shape of a syringe in which the filter is positioned between the two openings.
Grâce à ces dispositions, on peut appliquer un piston dans l'ouverture supérieure sans modifier la position du filtre.Thanks to these provisions, it is possible to apply a piston in the upper opening without modifying the position of the filter.
Selon des caractéristiques particulières, au cours de l'étape de filtration, on applique une aspiration par dépression en dessous du filtre. Grâce à ces dispositions, la filtration est plus efficace et plus rapide qu'en l'absence d'aspiration.According to particular characteristics, during the filtration step, vacuum suction is applied below the filter. Thanks to these provisions, the filtration is more efficient and faster than in the absence of suction.
Selon des caractéristiques particulières, à la suite de l'étape de filtration et avant l'étape de récupération, on place le compartiment sur un tube
du type Eppendorf. On réalise ainsi un passage direct depuis le filtre vers un tube du type Eppendorf.According to particular characteristics, following the filtration step and before the recovery step, the compartment is placed on a tube of the Eppendorf type. There is thus a direct passage from the filter to an Eppendorf-type tube.
Selon des caractéristiques particulières, avant l'étape de récupération, on positionne, dans l'ouverture supérieure du compartiment, un piston comportant un poinçon central mobile à l'intérieur du piston.According to particular characteristics, before the recovery step, a piston is placed in the upper opening of the compartment, comprising a central punch movable inside the piston.
Selon des caractéristiques particulières, le poinçon central mobile présente une extrémité inférieure pointue.According to particular features, the mobile central punch has a pointed lower end.
Selon des caractéristiques particulières, l'extrémité inférieure pointue présente une forme en étoile.According to particular features, the pointed lower end has a star shape.
Selon des caractéristiques particulières, au cours de l'étape de récupération, on applique une pression sur la partie haute du poinçon pour perforer le filtre avec la pointe du poinçon.According to particular features, during the recovery step, pressure is applied to the upper part of the punch to perforate the filter with the tip of the punch.
Selon des caractéristiques particulières, le piston comportant un moyen de blocage longitudinal du poinçon, au cours de l'étape de récupération, on fait pivoter le poinçon à l'intérieur du piston pour le dégager dudit moyen de blocage, avant d'appliquer une pression sur sa partie haute.According to particular features, the piston having a means for locking the punch longitudinally, during the recovery step, the punch is pivoted inside the piston to release it from said locking means, before applying a pressure on its upper part.
Selon des caractéristiques particulières, au cours de l'étape de récupération, on applique une pression verticale vers le bas sur le piston pour faire passer le contenu du compartiment dans un tube placé en dessous du compartiment.According to particular features, during the recovery step, a downward vertical pressure is applied to the piston to pass the contents of the compartment into a tube placed below the compartment.
Grâce à chacune de ces dispositions, le matériel cellulaire des cellules particulières peut être extrait sans détérioration à travers la perforation du filtre.By virtue of each of these arrangements, the cellular material of the particular cells can be extracted without deterioration through the perforation of the filter.
Selon des caractéristiques particulières, à la suite de l'étape de filtration et avant l'étape de récupération, on isole le contenu du compartiment en en bouchant l'ouverture inférieure par une membrane.According to particular characteristics, following the filtration step and before the recovery step, the contents of the compartment are isolated by plugging the lower opening with a membrane.
Selon des caractéristiques particulières, ladite membrane est positionnée sous une barrette entourant l'ouverture inférieure de chaque compartiment. On assure ainsi l'étanchéité et le maintien du liquide de lyse au dessus du filtre.According to particular features, said membrane is positioned under a bar surrounding the lower opening of each compartment. This ensures the sealing and the maintenance of the lysis liquid above the filter.
Selon des caractéristiques particulières, ladite membrane est une membrane adhésive.
Grâce à chacune de ces dispositions, le contenu du compartiment est maintenu à l'écart de l'environnement entre la filtration et la récupération du matériel cellulaire des cellules particulières.According to particular features, said membrane is an adhesive membrane. By virtue of each of these arrangements, the contents of the compartment are kept away from the environment between the filtration and the recovery of the cellular material of the particular cells.
Selon des caractéristiques particulières, au cours de l'étape de récupération, on applique une pression sur la partie haute du poinçon pour perforer la membrane isolant le contenu du compartiment.According to particular characteristics, during the recovery step, pressure is applied to the upper part of the punch to perforate the membrane isolating the contents of the compartment.
Selon des caractéristiques particulières, le filtre est réalisé en polycarbonate avec un traitement de surface hydrophile. L'utilisation d'un tel filtre améliore le taux de retenu des cellules particulières et réduit l'adhérence du matériel cellulaire à récupérer.According to particular characteristics, the filter is made of polycarbonate with a hydrophilic surface treatment. The use of such a filter improves the retention rate of the particular cells and reduces the adhesion of the cellular material to be recovered.
Selon des caractéristiques particulières, le filtre possède un diamètre de pores centré sur 7,5 μm. Ainsi, du fait de la dispersion des diamètres, pratiquement aucun pore ne possède un diamètre supérieur à 8 μm.According to particular characteristics, the filter has a pore diameter centered on 7.5 μm. Thus, due to the dispersion of the diameters, virtually no pore has a diameter greater than 8 microns.
La mise en œuvre de ce diamètre de pores, inférieur au diamètre de pores traditionnellement utilisé pour les filtres d'analyse cytologique, permet de les éloigner, ce qui réduit le nombre de pores jointifs et évite de perdre des cellules particulières.The implementation of this pore diameter, which is less than the pore diameter traditionally used for the cytological analysis filters, makes it possible to remove them, which reduces the number of contiguous pores and avoids the loss of particular cells.
Selon un deuxième aspect, la présente invention vise un dispositif pour recueillir du matériel génétique de cellules particulières présentes dans un liquide, caractérisé en ce qu'il comporte :According to a second aspect, the present invention relates to a device for collecting genetic material from particular cells present in a liquid, characterized in that it comprises:
- un compartiment comportant une ouverture supérieure et une ouverture inférieure, entre les deux ouvertures étant positionné un filtre dont les micropores ont un diamètre intermédiaire entre celui des dites cellules particulières et celui d'autres cellules,a compartment comprising an upper opening and a lower opening, between the two openings being positioned a filter whose micropores have a diameter intermediate between that of said particular cells and that of other cells,
- un moyen d'insertion du liquide dans ledit compartiment par l'intermédiaire de l'ouverture supérieure,a means for inserting the liquid into said compartment via the upper opening,
- un moyen de filtration faisant passer le principal du liquide et des dites autres cellules à travers le filtre,a filtration means passing the principal of the liquid and said other cells through the filter,
- un moyen de lyse des cellules retenues sur le filtre eta means of lysis of the cells retained on the filter and
- un moyen de récupération de matériel cellulaire des cellules lysées, sur le filtre.
Selon un troisième aspect, la présente invention vise un kit de biologie moléculaire comportant au moins deux amorces et/ou deux sondes parmi les séquences suivantes :a means for recovering cellular material from the lysed cells, on the filter. According to a third aspect, the present invention provides a molecular biology kit comprising at least two primers and / or two probes among the following sequences:
- AGGCCTGCTGAAAATGACTGAATAT,- AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TGGAGCTGATGGCGT,- TGGAGCTGATGGCGT,
- AGGCCTGCTGAAAATGACTGAATAT,- AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TTGGAGCTGTTGGCGT,- TTGGAGCTGTTGGCGT,
- AGGCCTGCTGAAAATGACTGAATAT,- AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TTGGAGCTGGTTGCGT,- TTGGAGCTGGTTGCGT,
- GCAGCATGTCAAGATCACAGATTT,- GCAGCATGTCAAGATCACAGATTT,
- CCTCCTTCTGCATGGTATTCTTTCT,- CCTCCTTCTGCATGGTATTCTTTCT,
- CAGTTTGGCCAGCCCA et- CAGTTTGGCCAGCCCA and
- CAGTTTGGCCCGCCCA.- CAGTTTGGCCCGCCCA.
Selon des caractéristiques particulières, le kit objet de la présente invention, tel que succinctement exposé ci-dessus, comporte, en outre, un dispositif objet de la présente invention, tel que succinctement exposé ci- dessus.According to particular features, the kit object of the present invention, as briefly described above, further comprises a device object of the present invention, as briefly described above.
Les avantages, buts et caractéristiques de ce dispositif et de ce kit étant similaires à ceux du procédé objet de la présente invention, tel que succinctement exposé ci-dessus, ils ne sont pas rappelés ici.Since the advantages, aims and characteristics of this device and of this kit are similar to those of the method that is the subject of the present invention, as briefly described above, they are not recalled here.
D'autres avantages, buts et caractéristiques de la présente invention ressortiront de la description qui va suivre, faite, dans un but explicatif et nullement limitatif en regard des dessins annexés, dans lesquels :Other advantages, aims and features of the present invention will emerge from the description which follows, made for an explanatory and non-limiting purpose with reference to the appended drawings, in which:
- la figure 1 représente, schématiquement, en perspective, des pièces de deux modes de réalisation particuliers du dispositif objet de la
présente invention, mises en œuvre dans une première phase du procédé objet de la présente invention,FIG. 1 schematically represents, in perspective, parts of two particular embodiments of the device that is the subject of the the present invention, implemented in a first phase of the process which is the subject of the present invention,
- la figure 2 représente, schématiquement, en coupe, des pièces des deux modes de réalisation particuliers du dispositif objet de la présente invention, mises en œuvre dans une première phase du procédé objet de la présente invention,FIG. 2 schematically represents, in section, parts of the two particular embodiments of the device that is the subject of the present invention, implemented in a first phase of the method that is the subject of the present invention,
- la figure 3 représente, schématiquement, en perspective, des pièces d'un premier mode de réalisation particulier du dispositif objet de la présente invention,FIG. 3 schematically represents, in perspective, parts of a first particular embodiment of the device that is the subject of the present invention,
- la figure 4 représente, schématiquement, en élévation, des pièces du premier mode de réalisation particulier du dispositif objet de la présente invention,FIG. 4 represents, schematically, in elevation, parts of the first particular embodiment of the device that is the subject of the present invention,
- la figure 5 représente, schématiquement, en coupe, des pièces du premier mode de réalisation particulier du dispositif objet de la présente invention,FIG. 5 represents, schematically, in section, parts of the first particular embodiment of the device that is the subject of the present invention,
- la figure 6 représente, schématiquement, en perspective, des pièces d'un deuxième mode de réalisation particulier du dispositif objet de la présente invention,FIG. 6 schematically represents, in perspective, parts of a second particular embodiment of the device that is the subject of the present invention,
- la figure 7 représente, schématiquement, en coupe, des pièces du deuxième mode de réalisation particulier du dispositif objet de la présente inventionFIG. 7 schematically represents, in section, parts of the second particular embodiment of the device that is the subject of the present invention;
- la figure 8 représente, schématiquement, en perspective, des pièces des deux modes de réalisation particuliers du dispositif objet de la présente invention, utilisés dans une deuxième phase du procédé objet de la présente invention etFIG. 8 schematically represents, in perspective, parts of the two particular embodiments of the device that is the subject of the present invention, used in a second phase of the method that is the subject of the present invention, and
- la figure 9 représente, sous forme d'un logigramme, des étapes mises en œuvre dans un mode de réalisation particulier du procédé objet de la présente invention.FIG. 9 represents, in the form of a logic diagram, the steps implemented in a particular embodiment of the method that is the subject of the present invention.
Comme on l'observe en regard des figures 1 et 2, dans les deux modes de réalisation illustrés dans les figures, le dispositif pour recueillir du matériel cellulaire, ici génétique, comporte des (ici quatre) compartiments en forme de seringue 105 présentant, chacun, une ouverture supérieure 106 et
une ouverture inférieure 107. Une rondelle ou bague 118 placée dans l'ouverture inférieure 107 retient un filtre 115. Les filtres 115 sont micro perforés et collés sur les rondelles ou bagues 118 puis insérés à l'extrémité distale, c'est-à-dire au fond, des quatre compartiments en forme de seringue 105. Par exemple, le filtre 115 est réalisé en polycarbonate avec un traitement de surface hydrophile. L'utilisation d'un tel filtre améliore le taux de retenu des cellules particulières et réduit l'adhérence du matériel cellulaire à récupérer. Le filtre 115 présente, par exemple, un diamètre de pores centré sur 7,5 μm. Du fait de la dispersion des diamètres, pratiquement aucun pore ne possède alors un diamètre supérieur à 8 μm.As can be seen with reference to FIGS. 1 and 2, in the two embodiments illustrated in the figures, the device for collecting cellular material, here genetic, comprises (here four) syringe-shaped compartments 105 presenting, each , an upper opening 106 and a lower opening 107. A washer or ring 118 placed in the lower opening 107 retains a filter 115. The filters 115 are micro-perforated and glued on the washers or rings 118 and then inserted at the distal end, that is to say say, at the bottom, of the four syringe-shaped compartments 105. For example, the filter 115 is made of polycarbonate with a hydrophilic surface treatment. The use of such a filter improves the retention rate of the particular cells and reduces the adhesion of the cellular material to be recovered. The filter 115 has, for example, a pore diameter centered on 7.5 μm. Due to the dispersion of the diameters, practically no pore then has a diameter greater than 8 μm.
A la petite ouverture, ou ouverture inférieure, de chaque compartiment 105 est placé, de façon étanche, un embout (en anglais « tip ») 117 afin d'éviter de potentielles contaminations de l'extrémité du compartiment 105 par des éclaboussures provenant du réservoir 112. Ces compartiments 105 sont assemblés par une barrette 116, en matière plastique, pour constituer une pièce unique. L'ensemble, ainsi constitué des quatre compartiments 105, de la barrette supérieure 116, les quatre pistons 140 et la barrette-bouchon 120 (décrite plus loin) est à usage unique.At the small opening, or bottom opening, of each compartment 105 is placed, tightly, a tip (English "tip") 117 to avoid potential contamination of the end of the compartment 105 by splashing from the tank 112. These compartments 105 are assembled by a bar 116, made of plastic, to constitute a single piece. The assembly, consisting of the four compartments 105, the upper bar 116, the four pistons 140 and the bar-cap 120 (described below) is for single use.
Dans la première phase du procédé pour recueillir du matériel cellulaire, les compartiments 105 sont supportés par une platine 110 insérée dans un porte-tiroir 111 comportant un compartiment relié à un réservoir 112 sous la surface inférieure de la platine 110 par laquelle une aspiration peut être effectuée. Un joint torique 113 assure l'étanchéité de la liaison entre un embout 117 et la platine 110. Un joint torique 114 assure l'étanchéité de la liaison entre la platine 110 et le porte tiroir 111. L'étanchéité offerte par les joints toriques 113 et 114 permet l'aspiration du contenu des compartiments.In the first phase of the process for collecting cellular material, the compartments 105 are supported by a plate 110 inserted into a drawer holder 111 having a compartment connected to a tank 112 under the lower surface of the plate 110 through which an aspiration can be carried out. performed. An O-ring 113 seals the connection between a nozzle 117 and the plate 110. An O-ring 114 seals the connection between the plate 110 and the slide gate 111. The seal provided by the O-rings 113 and 114 allows aspiration of the contents of the compartments.
Lors de l'aspiration par le réservoir 112, certaines cellules particulières du liquide présent dans le compartiment 105, de plus fort diamètre, sont retenues par le filtre 115 alors que le principal du liquide et des cellules de petites dimensions sont aspirées en dehors du compartiment 105, à travers le filtre 115.
A la fin de la première phase du procédé pour recueillir du matériel cellulaire, les compartiments 105 sont retirés de la partie du dispositif illustrée en figures 1 et 2 et les embouts 117 sont retirés des ouvertures inférieures des compartiments 105. Puis, une barrette-bouchon 120 est insérée à l'embout des compartiments 105 en forme de seringues. Il s'agit d'une barrette avec quatre perforations qui reçoivent l'embout inférieur des compartiments. Un film- plastique est collé à la face inférieure de cette barrette-bouchon 120, et constitue une membrane étanche, préférentiellement adhésive.During aspiration by the reservoir 112, certain particular cells of the liquid present in the compartment 105, of larger diameter, are retained by the filter 115 while the principal of the liquid and small cells are sucked out of the compartment 105, through the filter 115. At the end of the first phase of the process for collecting cellular material, the compartments 105 are removed from the portion of the device illustrated in FIGS. 1 and 2 and the tips 117 are removed from the lower openings of the compartments 105. Then, a cap strip 120 is inserted at the tip of the compartments 105 in the form of syringes. It is a bar with four perforations that receive the lower end of the compartments. A plastic film is glued to the underside of this plug-bar 120, and constitutes a sealed membrane, preferably adhesive.
Le contenu du compartiment 105 est ainsi maintenu à l'écart de l'environnement jusqu'à la récupération du matériel cellulaire des cellules particulières.The contents of the compartment 105 are thus kept away from the environment until the recovery of the cellular material of the particular cells.
Lors de la deuxième phase du procédé, la barrette 116, portant les compartiments 105, associés à la barrette de bouchons 120, est mise en appui sur un portoir 133 en matière plastique. Puis, on réalise, en étuve, la lyse des cellules présentes dans le compartiment 105. A cet effet, après l'addition des réactifs pour la lyse des membranes cellulaires des cellules recherchées et l'amplification uniforme de l'ADN ou de l'ARN, le portoir 133, maintenant les compartiments 105 verticaux, est transporté dans une étuve. A la sortie de l'étuve, après refroidissement, on positionne les tubes de type Eppendorf sur le support inférieur 131 du portique 130. On positionne la barrette 116 portant les compartiments 105, associés à la barrette de bouchons 120 sur le portique 130 et on place le portique 130 sur le support inférieur 131.During the second phase of the method, the bar 116, carrying the compartments 105, associated with the bar of plugs 120, is placed in abutment on a rack 133 made of plastic material. Then, in an oven, the lysis of the cells present in the compartment 105 is carried out in an oven. For this purpose, after the addition of the reagents for the lysis of the cell membranes of the desired cells and the uniform amplification of the DNA or the RNA, the rack 133, now the vertical compartments 105, is transported in an oven. At the outlet of the oven, after cooling, the Eppendorf-type tubes are positioned on the lower support 131 of the gantry 130. The bar 116 carrying the compartments 105, associated with the bar of plugs 120, is positioned on the gantry 130 and place the gantry 130 on the lower support 131.
Ensuite, par l'ouverture supérieure 106 de chaque compartiment 105, est inséré un piston 140 muni d'un poinçon axial central 141 se finissant par une pointe 142. Préférentiellement, en coupe, cette pointe 142 présente une forme en étoile, par exemple à quatre branches, la pointe étant alors cruciforme.Then, through the upper opening 106 of each compartment 105, is inserted a piston 140 provided with a central axial punch 141 ending in a tip 142. Preferably, in section, this tip 142 has a star shape, for example to four branches, the point being cruciform.
En dessous de chaque compartiment 105 est positionné un tube de type Eppendorf 125 retenu en position par une étagère du portique 130.Below each compartment 105 is positioned an Eppendorf tube 125 held in position by a shelf of the gantry 130.
Les figures 3 et 4 illustrent les positions respectives successives du piston 140 et du poinçon 141 au cours de la deuxième phase du procédé. A gauche de chacune de ces figures 3 et 4, le piston 140 et le poinçon 141 sont
pratiquement intégralement en dehors du compartiment 106 et la partie supérieure du poinçon 141 dépasse verticalement au dessus du piston 140.Figures 3 and 4 illustrate the respective successive positions of the piston 140 and the punch 141 during the second phase of the process. To the left of each of these FIGS. 3 and 4, the piston 140 and the punch 141 are substantially entirely outside the compartment 106 and the upper part of the punch 141 protrudes vertically above the piston 140.
Puis, par application d'une rotation, on fait passer le poinçon d'une position de sécurité dans laquelle le poinçon 141 ne peut pas coulisser longitudinalement à l'intérieur d'un piston 140 du fait d'une butée mécanique, à une position d'activation dans laquelle le poinçon peut coulisser longitudinalement à l'intérieur du piston 140. Ensuite, on applique une force verticale vers le bas sur le sommet du poinçon 141 , on fait descendre la pointe 142 de ce poinçon 141 dans le corps du compartiment 106, vers le filtre 115. En poursuivant cette descente, la pointe 142 perce d'abord le filtre 115 puis la membrane 120 jusqu'à pénétrer légèrement dans le tube 125. Le poinçon 141 est alors maintenu en position par contact sur l'ouverture inférieure du compartiment 105. Enfin, comme représenté à droite des figures 3 et 4, en maintenant en place le poinçon 141 , on applique une force vers le bas sur le piston 140 afin qu'il repousse le contenu du compartiment 105 vers le tube 125, par l'intermédiaire du trou formé dans le filtre 115 et dans la membrane 120 par la pointe du poinçon 142.Then, by applying a rotation, the punch is passed from a safety position in which the punch 141 can not slide longitudinally inside a piston 140 because of a mechanical stop, at a position activation device in which the punch can slide longitudinally inside the piston 140. Then, a vertical force is applied downward on the top of the punch 141, the tip 142 of the punch 141 is lowered into the body of the compartment 106, to the filter 115. Continuing this descent, the tip 142 first pierces the filter 115 and the membrane 120 to penetrate slightly into the tube 125. The punch 141 is then held in position by contact on the opening bottom of the compartment 105. Finally, as shown on the right of Figures 3 and 4, holding in place the punch 141, a force is applied downwardly on the piston 140 so that it pushes the contents of the compartment 105 towards the tube 125, through the hole formed in the filter 115 and in the membrane 120 by the tip of the punch 142.
Les tubes de type Eppendorf 125 sont ensuite retirés du support inférieur 131 , par retrait, vers le haut du portique 130, des compartiments 105 et de la membrane 120, pour analyse du matériel génétique amplifié, notamment l'ADN ou l'ARN des cellules d'intérêt, recueillis dans ces tubes 125.The Eppendorf type tubes 125 are then removed from the lower support 131, by withdrawing, upwardly from the gantry 130, the compartments 105 and the membrane 120, for analysis of the amplified genetic material, in particular the DNA or the RNA of the cells. of interest, collected in these tubes 125.
On note que la platine 110, le portoir 133, le portique 130 et le support 131 sont réutilisables.Note that the plate 110, the rack 133, the gantry 130 and the support 131 are reusable.
Dans le deuxième mode de réalisation, illustré en regard des figures 1 , 2, 6 et 7, un support 131 du portique 130 est remplacé par un support 132 présentant huit ouvertures au lieu de quatre. Les quatre tubes de type Eppendorf 125 sont remplacés par une barrette de huit tubes de type Eppendorf 126 de capacité inférieure, typiquement de 0.25 ml. Au lieu de 1 ,5 ml. Ces tubes de type Eppendorf sont adaptés à un autre mode de récupération de matériel cellulaire permettant d'extraire le matériel génétique amplifié directement sur le filtre mais dans un plus petit volume. Un tel volume peut alors être contenu dans des tubes de type Eppendorf directement adaptés à un
appareil de RT-PCR (acronyme de « reverse transcription polymerase chain reaction » pour transcription reverse et réaction en chaîne à la polymerase) en temps réel. On note que, lors de l'utilisation de huit tubes de type Eppendorf, quatre tubes servent à recueillir du matériel génétique amplifié et quatre tubes servent à réaliser des témoins, positifs ou négatifs.In the second embodiment, illustrated with reference to FIGS. 1, 2, 6 and 7, a support 131 of the gantry 130 is replaced by a support 132 having eight openings instead of four. The four tubes of Eppendorf type 125 are replaced by a bar of eight tubes of Eppendorf type 126 of lower capacity, typically 0.25 ml. Instead of 1, 5 ml. These Eppendorf-type tubes are adapted to another mode of recovery of cellular material making it possible to extract the amplified genetic material directly on the filter but in a smaller volume. Such a volume can then be contained in Eppendorf type tubes directly adapted to a RT-PCR apparatus (acronym for "reverse transcription polymerase chain reaction" for reverse transcription and polymerase chain reaction) in real time. It is noted that when using eight Eppendorf-type tubes, four tubes are used to collect amplified genetic material and four tubes are used to make controls, positive or negative.
Comme on l'observe en figure 9, le procédé objet de la présente invention comporte d'abord, de manière connue, une étape 200 de prélèvement d'un échantillon de liquide à analyser, par exemple de sang auquel on applique, éventuellement, une dilution ou une filtration.As is observed in FIG. 9, the method which is the subject of the present invention first comprises, in a known manner, a step 200 of sampling a sample of liquid to be analyzed, for example from blood to which, optionally, a dilution or filtration.
Au cours d'une étape 205, on applique un tampon de fixation sans formaldéhyde afin de fixer, c'est-à-dire durcir, spécifiquement les cellules particulières recherchées, sans altérer leur matériel génétique.During a step 205, a formaldehyde-free fixing buffer is applied in order to fix, that is to say harden, specifically the particular cells sought, without altering their genetic material.
Par exemple, ce tampon de fixation est composé de « PBS », un tampon de phosphate, de saponine pour lyser les globules rouges de BSA, sérum albumine bovine pour préserver la morphologie des cellules de l'ETDA chélateur de calcium, de soude (NaOH) pour ajuster le pH à 7,2 et de RCL2, un fixateur de cellules n'altérant pas leur matériel génétique. On note que le formaldéhyde n'est pas utilisé car il induit des cassures dans le matériel génétique.For example, this binding buffer is composed of "PBS", a phosphate buffer, saponin for lysing red blood cells of BSA, bovine serum albumin to preserve the morphology of ETDA cells calcium chelating, sodium hydroxide (NaOH ) to adjust the pH to 7.2 and RCL2, a cell fixer that does not alter their genetic material. It is noted that formaldehyde is not used because it induces breaks in the genetic material.
Au cours d'une étape 210, on place le liquide résultant de l'étape 205 dans un compartiment 105 qui se termine par un filtre dont les micropores ont un diamètre intermédiaire entre celui des cellules recherchées et celui des autres cellules de l'échantillon de liquide. En variante, on effectue la fixation de l'étape 205 à l'intérieur du compartiment 105, après l'étape 210.During a step 210, the liquid resulting from step 205 is placed in a compartment 105 which ends with a filter whose micropores have an intermediate diameter between that of the desired cells and that of the other cells of the sample. liquid. In a variant, step 205 is fixed inside compartment 105 after step 210.
Au cours d'une étape 215, on applique une aspiration par dépression en dessous du filtre. Le principal du liquide ainsi que les cellules de diamètre inférieur à celui des pores du filtre 115 traversent alors le filtre 115. En revanche, les cellules recherchées de diamètre inférieur à celui des pores du filtre 115 sont retenues au dessus du filtre 115, dans le compartiment 105.During a step 215, vacuum suction is applied below the filter. The principal of the liquid as well as the cells of diameter smaller than that of the pores of the filter 115 then pass through the filter 115. On the other hand, the desired cells of diameter smaller than that of the pores of the filter 115 are retained above the filter 115, in the compartment 105.
Au cours d'une étape 220, on retire les compartiments de la platine 110, on retire les embouts 117 des compartiments 105 et on isole ce contenu restant dans le compartiment 105 en bouchant l'ouverture inférieure par une
barrette-bouchon recouverte, dans sa partie inférieure d'une membrane adhésive 120.During a step 220, the compartments are removed from the plate 110, the tips 117 are removed from the compartments 105 and this remaining content is isolated in the compartment 105 by plugging the lower opening with a cap bar covered, in its lower part with an adhesive membrane 120.
Au cours d'une étape 225, les compartiments 105, associés d'une part à la barrette de bouchons 120 et à la barrette 116, sont insérés dans le portoir 133, la barrette 116 étant maintenue par ce portoir 133.During a step 225, the compartments 105, associated on the one hand with the bar of plugs 120 and the bar 116, are inserted into the rack 133, the bar 116 being held by this rack 133.
Au cours d'une étape 230, on lyse les cellules retenues sur le filtre, selon des techniques connues. A cet effet, après l'addition des réactifs pour la lyse des membranes cellulaires des cellules recherchées et l'amplification uniforme du matériel génétique conservant l'aspect quantitatif, le portoir 133, maintenant les compartiments 105 verticaux, est maintenu dans une étuve pendant une durée connue.During a step 230, the cells retained on the filter are lysed according to known techniques. For this purpose, after the addition of the reagents for lysis of the cell membranes of the desired cells and the uniform amplification of the genetic material preserving the quantitative aspect, the rack 133, maintaining the vertical compartments 105, is kept in an oven for a period of time. known duration.
Après la sortie de l'étuve, au cours d'une étape 232, on retire du portoir 133, la barrette 116, les compartiments 105 et la barrette de bouchons 120 et on les place sur le portique 130.After leaving the oven, during a step 232, is removed from the rack 133, the bar 116, the compartments 105 and the bar of plugs 120 and placed on the gantry 130.
Au cours d'une étape 235, on place chaque compartiment 105 au dessus d'un tube du type Eppendorf 125, ou 126 en positionnant ce tube sur le support inférieur, 131 ou 132 respectivement, puis on positionne le portique 130 avec la barrette 116, les compartiments 105 et la barrette de bouchons 120 sur la partie inférieure 131 , ou 132, respectivement.During a step 235, each compartment 105 is placed above an Eppendorf type tube 125, or 126 by positioning this tube on the lower support, 131 or 132 respectively, then the gantry 130 is positioned with the bar 116 compartments 105 and the cap strip 120 on lower portion 131, or 132, respectively.
Au cours d'une étape 240, par l'ouverture supérieure 106 de chaque compartiment 105, est inséré un piston 140 muni d'un poinçon axial central 141 mobile par rapport au piston 140 et se finissant, à l'intérieur du compartiment 105, par une pointe 142. Préférentiellement, en coupe transversale, cette pointe 142 présente une forme en étoile, par exemple à quatre branches, la pointe étant alors cruciforme.During a step 240, through the upper opening 106 of each compartment 105, is inserted a piston 140 provided with a central axial punch 141 movable relative to the piston 140 and ending, inside the compartment 105, by a tip 142. Preferably, in cross section, this tip 142 has a star shape, for example with four branches, the tip then being cruciform.
Au cours d'une étape 245, on tourne le poinçon pour le sortir de sa position de sécurité. Puis, on applique une pression sur la partie haute du poinçon 141 pour le faire descendre le long de l'axe longitudinal du compartiment 105, en étant guidé par le piston 140. Au cours de ce déplacement longitudinal, la pointe 142 du poinçon 141 perfore, successivement, le filtre 115 et le bouchon ou la membrane adhésive 120.
Au cours d'une étape 250, on applique une pression sur le reste du piston 140 pour que le contenu restant du compartiment 105 passe à travers le filtre 115 et le bouchon ou la membrane 120, et atteigne le tube de type Eppendorf, par l'ouverture entourant la pointe 142 du poinçon 141.During a step 245, the punch is rotated out of its safety position. Then, a pressure is applied on the upper part of the punch 141 to lower it along the longitudinal axis of the compartment 105, being guided by the piston 140. During this longitudinal movement, the tip 142 of the punch 141 perforates , successively, the filter 115 and the plug or the adhesive membrane 120. During a step 250, a pressure is applied on the rest of the piston 140 so that the remaining contents of the compartment 105 passes through the filter 115 and the plug or the membrane 120, and reaches the Eppendorf-type tube, by opening surrounding the tip 142 of the punch 141.
Ainsi, le matériel génétique des cellules particulières est extrait sans détérioration à travers la perforation du filtre.Thus, the genetic material of the particular cells is extracted without deterioration through the perforation of the filter.
Au cours d'une étape 255, le support, 131 ou 132, et les tubes de type Eppendorf, 125 ou 126, sont retirés après retrait, vers le haut du portique 130, des compartiments 105 et de la membrane 120.During a step 255, the support, 131 or 132, and the Eppendorf type tubes, 125 or 126, are removed after removal, upwardly of the gantry 130, from the compartments 105 and the membrane 120.
Au cours d'étapes 265 et 270, on effectue une analyse du matériel génétique, notamment l'ADN ou l'ARN des cellules recherchées, recueilli dans ces tubes 125 ou 126. L'ADN amplifié est utilisé comme matrice pour détecter les mutations de sensibilité ou de résistance aux thérapies ciblées. De plus, ou alternativement, l'ADNc (en anglais « cDNA », « c » signifiant « complémentaire ») provenant de l'ARN par conversion par RT et amplifié est utilisé comme matrice pour détecter le niveau d'expression de gènes de sensibilité ou de résistance aux thérapies ciblées.During steps 265 and 270, an analysis of the genetic material, in particular the DNA or RNA of the desired cells, is carried out in these tubes 125 or 126. The amplified DNA is used as a template to detect the mutations of sensitivity or resistance to targeted therapies. In addition, or alternatively, cDNA ("c" meaning "complementary") derived from RNA by RT conversion and amplified is used as a template to detect the level of expression of susceptibility genes. or resistance to targeted therapies.
Un volume défini du matériel génétique amplifié, notamment l'ADN, est prélevé pour détecter les mutations de sensibilité ou de résistance aux thérapies ciblées à l'aide de couples d'amorces (en anglais « primers ») sens et anti-sens et de couples de sondes et au cours d'une PCR (acronyme de « polymerase chain reaction ») quantitative et en temps réel.A defined volume of the amplified genetic material, in particular DNA, is taken to detect mutations in sensitivity or resistance to targeted therapies using primer and antisense pairs of primers. pairs of probes and during a quantitative and real-time PCR (acronym for polymerase chain reaction).
Le principe de la recherche de mutations de sensibilité ou de résistance aux thérapies ciblées mis en œuvre dans le mode de réalisation représenté est le suivant. La discrimination allélique ou « SNP genotyping assay » (SNP étant l'acronyme de « single nucleotide polymorphism » pour polymorphisme nucleotide simple) permet de renseigner sur la présence ou l'absence d'une mutation ponctuelle au niveau d'un gène. La première étape, 265, d'une discrimination allélique est une réaction de PCR quantitative en temps réel réalisée avec deux amorces pour amplifier la séquence d'intérêt et deux sondes, par exemple de type TaqMan (marque déposée). L'une des sondes reconnaît la séquence mutée et l'autre reconnaît la séquence normale.
Les deux sondes sont associées à des fluorochromes différents, par exemple « VIC » pour la sonde s'hybridant à la séquence normale et « FAM » pour la sonde s'hybridant à la séquence mutée. La seconde étape, 270, fait appel à un programme de discrimination allélique mesurant la fluorescence initiale et la fluorescence finale émise par les fluorochromes FAM ou/et VIC. Ce programme permet de faire la distinction entre les différentes séquences présentes dans chaque échantillon :The principle of the search for mutations of sensitivity or resistance to targeted therapies implemented in the embodiment shown is as follows. The allele discrimination or "SNP genotyping assay" (SNP being the acronym for "single nucleotide polymorphism" for single nucleotide polymorphism) provides information on the presence or absence of a point mutation in a gene. The first step, 265, of allelic discrimination is a real-time quantitative PCR reaction carried out with two primers to amplify the sequence of interest and two probes, for example of the TaqMan (registered trademark) type. One of the probes recognizes the mutated sequence and the other recognizes the normal sequence. The two probes are associated with different fluorochromes, for example "VIC" for the probe hybridizing to the normal sequence and "FAM" for the probe hybridizing to the mutated sequence. The second step, 270, uses an allelic discrimination program measuring the initial fluorescence and the final fluorescence emitted by the FAM or / and VIC fluorochromes. This program makes it possible to distinguish between the different sequences present in each sample:
- une augmentation de la fluorescence uniquement en VIC indique un profil homozygote pour la séquence normale,an increase in the fluorescence only in VIC indicates a homozygous profile for the normal sequence,
- une augmentation de la fluorescence uniquement en FAM indique un profil homozygote pour la séquence mutée,an increase in the fluorescence only in FAM indicates a homozygous profile for the mutated sequence,
- une augmentation de la fluorescence à la fois en VIC et en FAM indique un profil hétérozygote.an increase in the fluorescence in both VIC and FAM indicates a heterozygous profile.
Pour la détection de mutations, on met en œuvre, par exemple, les séquences des amorces et sondes suivantes (sens et anti-sens, 5' à 3') :For the detection of mutations, the sequences of the following primers and probes (sense and antisense, 5 'to 3') are used, for example:
Pour la mutation G12D du gène K-ras de résistance à l'Erlotinib et au Gefitinib :For the G12D mutation of the Erlotinib and Gefitinib resistance K-ras gene:
- amorce sens (ou « forward ») AGGCCTGCTGAAAATGACTGAATAT, amorce anti-sens (ou « reverse »)- sense primer (or "forward") AGGCCTGCTGAAAATGACTGAATAT, antisense (or "reverse") primer
TCGTCCACAAAATGATTCTGAATTAGCT,TCGTCCACAAAATGATTCTGAATTAGCT,
- sondes « sauvage », couleur « VIC » TTGGAGCTGGTGGCGT,- "wild" probes, "VIC" color TTGGAGCTGGTGGCGT,
- sonde « muté », couleur « FAM » TGGAGCTGATGGCGT.- "mutated" probe, color "FAM" TGGAGCTGATGGCGT.
Pour la mutation G12V (codant « 12 ») du gène K-ras de résistance à l'Erlotinib et au Gefitinib :For the G12V mutation (coding "12") of the K-ras gene for Erlotinib and Gefitinib resistance:
- amorce sens (ou « forward ») AGGCCTGCTGAAAATGACTGAATAT, amorce anti-sens (ou « reverse »)- sense primer (or "forward") AGGCCTGCTGAAAATGACTGAATAT, antisense (or "reverse") primer
TCGTCCACAAAATGATTCTGAATTAGCT,TCGTCCACAAAATGATTCTGAATTAGCT,
- sondes « sauvage », couleur « VIC » TTGGAGCTGGTGGCGT,- "wild" probes, "VIC" color TTGGAGCTGGTGGCGT,
- sonde « muté », couleur « FAM » TTGGAGCTGTTGGCGT.- "mutated" probe, color "FAM" TTGGAGCTGTTGGCGT.
Pour la mutation G13C du gène K-ras de résistance à l'Erlotinib et au Gefitinib :For the G13C mutation of the Erlotinib and Gefitinib resistance K-ras gene:
- amorce sens (ou « forward ») AGGCCTGCTGAAAATGACTGAATAT,
amorce anti-sens (ou « reverse »)- forward primer AGGCCTGCTGAAAATGACTGAATAT, antisense (or "reverse") primer
TCGTCCACAAAATGATTCTGAATTAGCT,TCGTCCACAAAATGATTCTGAATTAGCT,
- sondes « sauvage », couleur « VIC » TTGGAGCTGGTGGCGT,- "wild" probes, "VIC" color TTGGAGCTGGTGGCGT,
- sonde « muté », couleur « FAM » TTGGAGCTGGTTGCGT.- "mutated" probe, color "FAM" TTGGAGCTGGTTGCGT.
Pour la mutation L858R du gène EGFR de sensibilité augmentée à l'Erlotinib et au Gefitinib :For the L858R mutation of the EGFR gene with increased sensitivity to Erlotinib and Gefitinib:
- amorce sens (ou « forward ») GCAGCATGTCAAGATCACAGATTT,- forward primer GCAGCATGTCAAGATCACAGATTT,
- amorce anti-sens (ou « reverse ») CCTCCTTCTGCATGGTATTCTTTCT,- antisense primer (or "reverse") CCTCCTTCTGCATGGTATTCTTTCT,
- sondes « sauvage », couleur « VIC » CAGTTTGGCCAGCCCA,- "wild" probes, "VIC" color CAGTTTGGCCAGCCCA,
- sonde « muté », couleur « FAM » CAGTTTGGCCCGCCCA.- "mutated" probe, "FAM" color CAGTTTGGCCCGCCCA.
La signification de « sens » et « anti-sens », et « 5' à 3' » est bien connue de l'homme du métier. Les sondes s'apparient entre les deux amorces et révèlent la présence ou l'absence d'une mutation du fait de leur couleur de fluorescence associée. Pour mémoire, la couleur « FAM » est dans les bleus et la couleur « VIC » est dans les verts. Une mesure de l'intensité de la fluorescence dans chacune de ces couleurs, par l'appareil de PCR, permet de discriminer les gènes normaux, les gènes homozygotes mutés et les gènes hétérozygotes mutés. Par exemple, on réalise 50 cycles d'amplification.The meaning of "sense" and "antisense" and "5 'to 3'" is well known to those skilled in the art. The probes are paired between the two primers and reveal the presence or absence of a mutation because of their associated fluorescence color. For the record, the color "FAM" is in the blues and the color "VIC" is in the greens. A measurement of the intensity of fluorescence in each of these colors, by the PCR apparatus, makes it possible to discriminate between normal genes, mutated homozygous genes and mutated heterozygous genes. For example, 50 amplification cycles are carried out.
Dans d'autres modes de réalisation, un volume défini du matériel génétique notamment l'ARN converti en ADNc par RT (acronyme de « reverse transcription ») et amplifié est prélevé pour détecter le niveau d'expression de gène de sensibilité ou de résistance aux thérapies ciblées à l'aide de couples d'amorces sens et anti-sens et d'une sonde et au cours d'une PCR (acronyme de « polymerase chain reaction ») quantitative et en temps réel, par exemple avec 50 cycles.In other embodiments, a defined volume of the genetic material including RNA converted to cDNA by RT (acronym for "reverse transcription") and amplified is taken to detect the level of gene expression of sensitivity or resistance to targeted therapies using sense and antisense primer pairs and a probe and during a quantitative and real-time polymerase chain reaction (PCR), for example with 50 cycles.
Comme on le comprend à la lecture de la description, le procédé, le dispositif et le kit objets de la présente invention permettent de recueillir et d'amplifier dans des conditions compatibles avec des examens de laboratoire de routine, une grande proportion du matériel génétique des cellules considérées, en bon état, même si l'échantillon ne comporte qu'une seule cellule recherchée.
As understood by reading the description, the method, the device and the kit object of the present invention make it possible to collect and amplify under a condition compatible with routine laboratory tests, a large proportion of the genetic material of the present invention. cells considered, in good condition, even if the sample has only one desired cell.
Claims
REVENDICATIONS
1 - Procédé pour recueillir du matériel cellulaire de cellules particulières présentes dans un liquide, caractérisé en ce qu'il comporte :1 - Process for collecting cell material from particular cells present in a liquid, characterized in that it comprises:
- une étape (210) d'insertion du liquide dans un compartiment (105) par l'intermédiaire d'une ouverture supérieure (106) du compartiment, ledit compartiment présentant une ouverture inférieure (107), entre les deux ouvertures étant positionné un filtre (115) dont les micropores ont un diamètre intermédiaire entre celui des dites cellules particulières et celui d'autres cellules,a step (210) for inserting the liquid into a compartment (105) via an upper opening (106) of the compartment, said compartment having a lower opening (107), between the two openings being positioned a filter (115) whose micropores have an intermediate diameter between that of said particular cells and that of other cells,
- une étape (215) de filtration au cours de laquelle le principal du liquide et des dites autres cellules passe à travers le filtre,a filtration step (215) in which the principal of the liquid and said other cells pass through the filter,
- une étape (230) de lyse des cellules retenues sur le filtre eta step (230) of lysis of the cells retained on the filter and
- une étape (245, 250) de récupération de matériel cellulaire des cellules lysées, sur le filtre.a step (245, 250) of recovering cell material from the lysed cells, on the filter.
2 - Procédé selon la revendication 1 , caractérisé en ce qu'il comporte, à la suite de l'étape de lyse, une étape d'amplification de l'ADN et/ou de l'ARN et, au cours de l'étape de récupération, on récupère du matériel génétique amplifié des cellules lysées.2 - Process according to claim 1, characterized in that it comprises, following the lysis step, a step of amplification of the DNA and / or RNA and, during the step recovery, amplified genetic material is recovered from the lysed cells.
3 - Procédé selon la revendication 2, caractérisé en ce que, au cours de l'étape d'amplification, on effectue une amplification uniforme conservant l'aspect quantitatif de l'ADN ou de l'ARN.3 - Process according to claim 2, characterized in that, during the amplification step, a uniform amplification is carried out maintaining the quantitative appearance of the DNA or RNA.
4 - Procédé selon l'une quelconque des revendications 1 à 3, caractérisé en ce qu'il comporte, en outre, une étape (265, 270) de détection, au cours de laquelle l'ADN amplifié est utilisé comme matrice pour détecter au moins une mutation de gêne de sensibilité ou de résistance à au moins une thérapie ciblée.4 - Process according to any one of claims 1 to 3, characterized in that it comprises, in addition, a step (265, 270) of detection, during which the amplified DNA is used as a matrix to detect at least one mutation of sensitivity or resistance to at least one targeted therapy.
5 - Procédé selon l'une quelconque des revendications 1 à 3, caractérisé en ce qu'il comporte, en outre, une étape (265, 270) de détection, au cours de laquelle l'ADN amplifié est utilisé comme matrice pour détecter une
variation de niveau d'expression de gènes de sensibilité ou de résistance aux thérapies ciblées.5 - Process according to any one of claims 1 to 3, characterized in that it comprises, in addition, a step (265, 270) of detection, during which the amplified DNA is used as a matrix to detect a variation in gene expression level of sensitivity or resistance to targeted therapies.
6 - Procédé selon l'une quelconque des revendications 1 à 3, caractérisé en ce qu'il comporte, en outre, une étape (265, 270) de détection, au cours de laquelle on convertit de l'ARN en ADNc et on utilise ledit ADNc pour détecter le niveau d'expression de gène de sensibilité ou de résistance aux thérapies ciblées.6 - Process according to any one of claims 1 to 3, characterized in that it further comprises a detection step (265, 270), during which RNA is converted into cDNA and used said cDNA to detect the level of gene expression of sensitivity or resistance to targeted therapies.
7 - Procédé selon l'une quelconque des revendications 4 à 6, caractérisé en ce que, au cours de l'étape (265, 270) de détection, on met en œuvre une PCR (acronyme de « polymerase chain reaction ») quantitative et en temps réel.7 - Process according to any one of claims 4 to 6, characterized in that, during the step (265, 270) of detection, is implemented a PCR (acronym for "polymerase chain reaction") quantitative and in real time.
8 - Procédé selon l'une quelconque des revendications 4 à 7, caractérisé en ce que, au cours de l'étape (265, 270) de détection, on met en œuvre au moins un couple d'amorces sens et anti-sens pour amplifier une séquence d'intérêt prédéterminé.8 - Process according to any one of claims 4 to 7, characterized in that, during the step (265, 270) of detection, it implements at least one pair of sense and antisense primer for amplify a predetermined sequence of interest.
9 - Procédé selon l'une quelconque des revendications 4 à 8, caractérisé en ce que, au cours de l'étape (265, 270) de détection, on met en œuvre au moins un couple de sondes.9 - Process according to any one of claims 4 to 8, characterized in that, during the step (265, 270) of detection, it implements at least one pair of probes.
10 - Procédé selon la revendication 9, caractérisé en ce qu'au moins deux sondes d'un couple de sondes sont couplées à deux fluorochromes différents et sont définis pour que l'une reconnaisse une séquence mutée et que l'autre reconnaisse une séquence normale.10 - Process according to claim 9, characterized in that at least two probes of a pair of probes are coupled to two different fluorochromes and are defined so that one recognizes a mutated sequence and the other recognizes a normal sequence. .
11 - Procédé selon l'une quelconque des revendications 7 ou 8 et une des revendications 8 ou 9, caractérisé en ce qu'au moins un couple d'amorces et un couple de sondes sont adaptés à détecter l'une des mutations suivantes :11 - Process according to any one of claims 7 or 8 and one of claims 8 or 9, characterized in that at least one pair of primers and a pair of probes are adapted to detect one of the following mutations:
- la mutation G12D du gène K-ras de résistance à l'Erlotinib et au Gefitinib,the G12D mutation of the K-ras gene for Erlotinib and Gefitinib resistance,
- la mutation G12V du gène K-ras de résistance à l'Erlotinib et au Gefitinib,the G12V mutation of the K-ras gene for Erlotinib and Gefitinib resistance,
- la mutation G13C du gène K-ras de résistance à l'Erlotinib et au Gefitinib et
- la mutation L858R du gène EGFR de sensibilité augmentée à l'Erlotinib et au Gefitinib.the G13C mutation of the Erlotinib and Gefitinib resistance K-ras gene and the L858R mutation of the EGFR gene of increased sensitivity to Erlotinib and Gefitinib.
12 - Procédé selon la revendication 11 , caractérisé en ce qu'au moins deux amorces et/ou deux sondes sont parmi les séquences suivantes :12 - Process according to claim 11, characterized in that at least two primers and / or two probes are among the following sequences:
- AGGCCTGCTGAAAATGACTGAATAT,- AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TGGAGCTGATGGCGT,- TGGAGCTGATGGCGT,
- AGGCCTGCTGAAAATGACTGAATAT,- AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TTGGAGCTGTTGGCGT,- TTGGAGCTGTTGGCGT,
- AGGCCTGCTGAAAATGACTGAATAT,- AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TTGGAGCTGGTTGCGT,- TTGGAGCTGGTTGCGT,
- GCAGCATGTCAAGATCACAGATTT,- GCAGCATGTCAAGATCACAGATTT,
- CCTCCTTCTGCATGGTATTCTTTCT,- CCTCCTTCTGCATGGTATTCTTTCT,
- CAGTTTGGCCAGCCCA et- CAGTTTGGCCAGCCCA and
- CAGTTTGGCCCGCCCA.- CAGTTTGGCCCGCCCA.
13 - Procédé selon l'une quelconque des revendications 1 à 12, caractérisé en ce que, avant l'étape (245, 250) de récupération, on positionne, dans l'ouverture supérieure (106) du compartiment (105), un piston (140) comportant un poinçon (141 ) central mobile à l'intérieur du piston.13 - Process according to any one of claims 1 to 12, characterized in that, before the step (245, 250) of recovery, is positioned in the upper opening (106) of the compartment (105), a piston (140) having a central punch (141) movable within the piston.
14 - Procédé selon la revendication 13, caractérisé en ce que le poinçon (141 ) central mobile présente une extrémité inférieure (142) pointue présentant une forme en étoile.14 - Method according to claim 13, characterized in that the movable central punch (141) has a pointed lower end (142) having a star shape.
15 - Procédé selon l'une quelconque des revendications 1 à 14, caractérisé en ce que, à la suite de l'étape (215) de filtration et avant l'étape (245, 250) de récupération, on isole le contenu du compartiment (105) en en bouchant l'ouverture inférieure (107) par une membrane, ladite membrane étant
positionnée sous une barrette (120) entourant l'ouverture inférieure (107) de chaque compartiment (105).15 - Process according to any one of claims 1 to 14, characterized in that, following the step (215) of filtration and before the step (245, 250) of recovery, the contents of the compartment are isolated (105) by plugging the lower opening (107) with a membrane, said membrane being positioned under a bar (120) surrounding the lower opening (107) of each compartment (105).
16 - Procédé selon l'une quelconque des revendications 1 à 15, caractérisé en ce que le filtre (115) est réalisé en polycarbonate traité avec un traitement de surface hydrophile.16 - Process according to any one of claims 1 to 15, characterized in that the filter (115) is made of polycarbonate treated with a hydrophilic surface treatment.
17 - Procédé selon l'une quelconque des revendications 1 à 16, caractérisé en ce que le filtre (115) possède un diamètre de pores centré sur 7,5 μm.17 - Process according to any one of claims 1 to 16, characterized in that the filter (115) has a pore diameter centered on 7.5 microns.
18 - Dispositif pour recueillir du matériel génétique de cellules particulières présentes dans un liquide, caractérisé en ce qu'il comporte :18 - Device for collecting genetic material from particular cells present in a liquid, characterized in that it comprises:
- un compartiment (105) comportant une ouverture supérieure (106) et une ouverture inférieure (107), entre les deux ouvertures étant positionné un filtre (115) dont les micropores ont un diamètre intermédiaire entre celui des dites cellules particulières et celui d'autres cellules,a compartment (105) having an upper opening (106) and a lower opening (107), between the two openings being positioned a filter (115) whose micropores have an intermediate diameter between that of said particular cells and that of other cells; cell
- un moyen d'insertion du liquide dans ledit compartiment par l'intermédiaire de l'ouverture supérieure,a means for inserting the liquid into said compartment via the upper opening,
- un moyen (111 , 112) de filtration faisant passer le principal du liquide et des dites autres cellules à travers le filtre,filtration means (111, 112) passing the principal of the liquid and said other cells through the filter,
- un moyen de lyse des cellules retenues sur le filtre eta means of lysis of the cells retained on the filter and
- un moyen de récupération de matériel cellulaire des cellules lysées, sur le filtre.a means for recovering cellular material from the lysed cells, on the filter.
19 - Kit de biologie moléculaire pour mise en œuvre dans un dispositif selon la revendication 18, caractérisé en ce qu'il comporte au moins deux amorces et/ou deux sondes parmi les séquences suivantes :19 - Kit of molecular biology for implementation in a device according to claim 18, characterized in that it comprises at least two primers and / or two probes from the following sequences:
- AGGCCTGCTGAAAATGACTGAATAT,- AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TGGAGCTGATGGCGT,- TGGAGCTGATGGCGT,
- AGGCCTGCTGAAAATGACTGAATAT,- AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TTGGAGCTGTTGGCGT,
- AGGCCTGCTGAAAATGACTGAATAT,- TTGGAGCTGTTGGCGT, - AGGCCTGCTGAAAATGACTGAATAT,
- TCGTCCACAAAATGATTCTGAATTAGCT,- TCGTCCACAAAATGATTCTGAATTAGCT,
- TTGGAGCTGGTGGCGT,- TTGGAGCTGGTGGCGT,
- TTGGAGCTGGTTGCGT,- TTGGAGCTGGTTGCGT,
- GCAGCATGTCAAGATCACAGATTT,- GCAGCATGTCAAGATCACAGATTT,
- CCTCCTTCTGCATGGTATTCTTTCT,- CCTCCTTCTGCATGGTATTCTTTCT,
- CAGTTTGGCCAGCCCA et- CAGTTTGGCCAGCCCA and
- CAGTTTGGCCCGCCCA.- CAGTTTGGCCCGCCCA.
20 - kit selon la revendication 19, caractérisé en ce qu'il comporte,n dispositif selon la revendication 18.
20 - kit according to claim 19, characterized in that it comprises, n device according to claim 18.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0757779A FR2921490B1 (en) | 2007-09-21 | 2007-09-21 | METHOD AND DEVICE FOR COLLECTING CELLULAR EQUIPMENT FROM FILTER-INSULATED CELLS |
FR0855849A FR2921491B1 (en) | 2007-09-21 | 2008-09-01 | METHOD, DEVICE AND KIT FOR MOLECULAR BIOLOGY FOR EXTRACTING AMPLIFIED GENETIC MATERIAL. |
PCT/FR2008/051650 WO2009047436A1 (en) | 2007-09-21 | 2008-09-15 | Method, device and molecular biology kit for extracting amplified genetic material |
Publications (1)
Publication Number | Publication Date |
---|---|
EP2191250A1 true EP2191250A1 (en) | 2010-06-02 |
Family
ID=39217983
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP08838264A Withdrawn EP2191250A1 (en) | 2007-09-21 | 2008-09-15 | Method, device and molecular biology kit for extracting amplified genetic material |
Country Status (5)
Country | Link |
---|---|
US (2) | US20090081772A1 (en) |
EP (1) | EP2191250A1 (en) |
JP (1) | JP2010538672A (en) |
FR (2) | FR2921490B1 (en) |
WO (1) | WO2009047436A1 (en) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011043737A1 (en) * | 2009-10-05 | 2011-04-14 | Nanyang Technological University | Viability analysis of protozoa using polymerase chain reaction (pcr) |
SG181161A1 (en) * | 2009-12-02 | 2012-07-30 | Univ Nanyang Tech | A method and apparatus for recovering cells and their analysis |
KR101125212B1 (en) * | 2010-10-01 | 2012-03-21 | (주)아벨리노 | System for diagnosis of avellino corneal dystrophy |
EP2753926A1 (en) | 2011-09-07 | 2014-07-16 | Dana-Farber Cancer Institute, Inc. | Methods of increasing the number of target cells recovered from a fluid sample |
CN109517895B (en) * | 2012-05-24 | 2022-05-10 | 瑞儿塞尔斯公司 | Multiple analytical methods for extracting or isolating rare cells from biological samples by filtration |
KR101471920B1 (en) * | 2012-11-28 | 2014-12-12 | 대한민국 | A Convenient Portable Cell Destructible DNA extractor |
US9482215B2 (en) * | 2013-07-19 | 2016-11-01 | Norman Werbner Information Services, Inc. | Liquid extraction system with reduced exposure to air |
AU2015360856A1 (en) | 2014-12-08 | 2017-06-01 | Dana-Farber Cancer Institute, Inc. | Apparatus and method for isolating target cells from a fluid sample |
US10384841B2 (en) | 2017-06-29 | 2019-08-20 | Norman Werbner Information Services, Inc. | Liquid extraction, storage, and dispensing system and method of use |
Family Cites Families (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5146794A (en) * | 1988-03-17 | 1992-09-15 | Millipore Corporation | Filter punch and filter collection system |
US5042502A (en) * | 1989-09-18 | 1991-08-27 | La Mina Ltd. | Urine testing module with cytology cup |
US5137031A (en) * | 1989-09-18 | 1992-08-11 | La Mina Ltd. | Urine testing apparatus with urinary sediment device |
US5785869A (en) * | 1992-02-10 | 1998-07-28 | Baxter International Inc. | Method for creating a leukocyte rich sample from a mixed population of blood cells |
JP3311091B2 (en) * | 1993-06-27 | 2002-08-05 | テルモ株式会社 | Filter for separating white blood cells and filter for separating white blood cells and platelets |
US5976824A (en) * | 1993-11-24 | 1999-11-02 | Abbott Laboratories | Method and apparatus for collecting a cell sample from a liquid specimen |
US6958392B2 (en) * | 1998-10-09 | 2005-10-25 | Whatman, Inc. | Methods for the isolation of nucleic acids and for quantitative DNA extraction and detection for leukocyte evaluation in blood products |
US7374723B2 (en) * | 2002-07-31 | 2008-05-20 | Dräger Safety AG & Co. KGaA | System for collecting and releasing saliva |
JP4632262B2 (en) * | 2003-02-05 | 2011-02-16 | アイキューム,インク. | Sample processing |
EP1676906A4 (en) * | 2003-10-21 | 2011-03-09 | Fujifilm Corp | Nucleic acid separation purification cartridge and process for producing the same |
CA2559943A1 (en) * | 2004-03-15 | 2005-10-06 | Purdue Research Foundation | Cell concentration and pathogen recovery |
FR2883488B1 (en) * | 2005-03-24 | 2010-12-10 | Inst Nat Sante Rech Med | METHOD AND DEVICE FOR SEPARATING BY VERTICAL FILTRATION BIOLOGICAL PARTICLES CONTAINED IN A LIQUID |
-
2007
- 2007-09-21 FR FR0757779A patent/FR2921490B1/en active Active
-
2008
- 2008-01-18 US US12/016,222 patent/US20090081772A1/en not_active Abandoned
- 2008-09-01 FR FR0855849A patent/FR2921491B1/en active Active
- 2008-09-15 EP EP08838264A patent/EP2191250A1/en not_active Withdrawn
- 2008-09-15 WO PCT/FR2008/051650 patent/WO2009047436A1/en active Application Filing
- 2008-09-15 JP JP2010525397A patent/JP2010538672A/en active Pending
- 2008-09-15 US US12/679,027 patent/US20110104670A1/en not_active Abandoned
Non-Patent Citations (1)
Title |
---|
See references of WO2009047436A1 * |
Also Published As
Publication number | Publication date |
---|---|
US20090081772A1 (en) | 2009-03-26 |
WO2009047436A1 (en) | 2009-04-16 |
FR2921491B1 (en) | 2019-08-09 |
FR2921491A1 (en) | 2009-03-27 |
FR2921490B1 (en) | 2010-09-10 |
US20110104670A1 (en) | 2011-05-05 |
JP2010538672A (en) | 2010-12-16 |
FR2921490A1 (en) | 2009-03-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2009047436A1 (en) | Method, device and molecular biology kit for extracting amplified genetic material | |
EP2238236B1 (en) | Device and method for isolating and cultivating live cells on a filter or extracting the genetic material thereof | |
CA2601451C (en) | Method and device for the separation of biological particles contained in a liquid by means of vertical filtration | |
US20210372988A1 (en) | Whole blood separation sampling apparatus | |
EP2635669B1 (en) | Device and method for isolating and cultivating living cells on a filter or extracting the genetic material thereof from same | |
JP2012513773A5 (en) | ||
AU2011254887C1 (en) | Reaction vessel for PCR device and method of performing PCR | |
JP2008005840A (en) | Method and unit for preparing liquid sample for analyzing microorganism | |
ITTO20070307A1 (en) | METHOD AND DEVICE FOR NON-INVASIVE PRENATAL DIAGNOSIS | |
EP2997166A1 (en) | Analyte enrichment methods and compositions | |
US9790462B2 (en) | Device and method for treating a filtration medium | |
JP2014060996A (en) | Device and process for isolating and cultivating live cells on filter or extracting their genetic material | |
JP2017200446A (en) | Nucleic acid chromatography inspection equipment, nucleic acid chromatography inspection kit, and method for using nucleic acid chromatography inspection equipment | |
US20220371006A1 (en) | Pathogen filtration apparatus, system, and method | |
EP3654011B1 (en) | Method for preparing a sample to be analysed obtained from a food matrix | |
JP4573563B2 (en) | Nucleic acid extraction equipment | |
KR102102479B1 (en) | DyeEx tube assembly and DNA purification method using the same | |
JP2012143212A (en) | Solution recovery auxiliary tool and solution recovery method | |
EP3259572A1 (en) | Device for collecting biological material from a biological trace | |
CN105154580A (en) | Kit for quickly detecting rare deletional thalassemia based on hydrolysis probe method | |
WO2013024817A1 (en) | Two-dimensional cell spreading device and cell spreading method using same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20100318 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR |
|
AX | Request for extension of the european patent |
Extension state: AL BA MK RS |
|
17Q | First examination report despatched |
Effective date: 20101020 |
|
DAX | Request for extension of the european patent (deleted) | ||
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20110503 |