EP2191250A1

EP2191250A1 - Method, device and molecular biology kit for extracting amplified genetic material

Info

Publication number: EP2191250A1
Application number: EP08838264A
Authority: EP
Inventors: Yvon Cayre
Original assignee: METAGENEX
Current assignee: METAGENEX
Priority date: 2007-09-21
Filing date: 2008-09-15
Publication date: 2010-06-02
Also published as: JP2010538672A; FR2921491A1; WO2009047436A1; FR2921491B1; US20090081772A1; FR2921490A1; FR2921490B1; US20110104670A1

Abstract

The invention relates to a method for collecting cellular material from particular cells present in a liquid, that comprises: a step (210) of inserting the liquid into a compartment (105) through an upper opening (106) in the compartment, said compartment having a lower opening (107) while between said openings is provided a filter (115) in which the micropores have a diameter between that of said particular cells and that of other cells; a filtration step (215) during which the major portion of the liquid and said other cells flows through the filter; a step (230) of DNA and/or RNA lysing and amplifying; and a step (250) of recovering on said filter the amplified genetic material.

Description

Method, device and kit for molecular biology for extracting amplified genetic material

The present invention relates to a method, a device and a kit for molecular biology for extracting amplified genetic material from isolated cells on a filter and detecting mutations and levels of gene expression for sensitivity and resistance to targeted therapies. .

It applies, in particular to collect and uniformly amplify the DNA or RNA of particular cells present in a liquid, including blood.

Some particular blood cells, for example tumor cells or trophoblastic cells, are in very low concentration and must be concentrated for cytopathological analysis. However, compared to blood cells, they are larger.

It is known, for example from PCT / FR 2006/000562, to apply a formaldehyde-based fixation buffer to a blood sample to fix the desired cells, and then to pass the resulting liquid through a porous filter. This filter is then analyzed in the laboratory to look for the cells under a microscope. They can subsequently be taken from the filter for analysis, for example by genetic analysis. However, this procedure can not be reproduced on a large scale and at a reasonable cost, because of the time, materials and the precision of work involved.

This would allow the conduct of molecular biology analyzes on both tumor cells and trophoblastic cells.

The present invention aims to remedy these drawbacks and to respond to this need by making it possible to collect, in conditions compatible with routine laboratory tests, a large proportion of the cellular material, in particular, RNA and DNA, cells considered, in particular good condition. For this purpose, according to a first aspect, the present invention provides a method for collecting cellular material from particular cells present in a liquid, characterized in that it comprises:

a step of insertion of the liquid into a compartment via an upper opening of the compartment, said compartment presenting a lower opening, between the two openings being positioned a filter whose micropores have a diameter intermediate between that of said cells; particulars and that of other cells,

a filtration step during which the principal of the liquid and said other cells pass through the filter,

a step of lysis of the cells retained on the filter and

a step of recovering cellular material from the lysed cells, on the filter.

The method that is the subject of the present invention makes it possible to collect cellular material quickly and efficiently.

In general, the cellular material recovered through the practice of the present invention is the genetic material of the cells. The method which is the subject of the present invention thus makes it possible to recover, directly on the filter and with virtually no loss, the genetic material of rare cells, up to a single isolated cell. A large proportion of the genetic material of the cells in question is thus collected, in good condition, under conditions compatible with routine laboratory tests.

According to particular features, the process which is the subject of the present invention, as briefly described above, comprises, following the lysis step, a step of amplification of the DNA and / or RNA and, during the recovery step, amplified genetic material is recovered from the lysed cells.

According to particular characteristics, during the lysis and amplification step, a uniform amplification is carried out, preserving the quantitative aspect of the DNA and the RNA.

According to particular features, the method which is the subject of the present invention, as briefly described above, comprises, in in addition, a detection step, during which the amplified DNA is used as a template to detect at least one gene mutation of sensitivity or resistance to at least one targeted therapy.

According to particular features, the method which is the subject of the present invention, as briefly described above, furthermore comprises a detection step, during which the amplified DNA is used as a matrix to detect a variation in the level of d expression of genes of sensitivity or resistance to targeted therapies.

According to particular features, the method which is the subject of the present invention, as briefly described above, further comprises a detection step during which RNA is converted into cDNA and said cDNA is used to detect the cDNA. level of gene expression of sensitivity or resistance to targeted therapies.

According to particular characteristics, during the detection step, a quantitative and real-time PCR (acronym for polymerase chain reaction) is used.

According to particular characteristics, during the detection step, at least one pair of sense and antisense primer pairs are used to amplify a predetermined sequence of interest.

According to particular characteristics, during the detection step, at least one pair of probes is implemented.

According to particular characteristics, at least two probes of a pair of probes are coupled to two different fluorochromes and are defined so that one recognizes the mutated sequence and the other recognizes the normal sequence.

According to particular characteristics, at least one pair of primers and a pair of probes are adapted to detect the G12D mutation of the K-ras gene of Erlotinib and Gefitinib resistance.

According to particular characteristics, at least one primer comprises at least 80% of the sequence

AGGCCTGCTGAAAATGACTGAATAT. According to particular characteristics, at least one primer comprises at least 80% of the sequence

TCGTCCACAAAATGATTCTGAATTAGCT.

According to particular characteristics, at least one probe comprises at least 80% of the TTGGAGCTGGTGGCGT sequence.

According to particular characteristics, at least one probe comprises at least 80% of the TGGAGCTGATGGCGT sequence.

According to particular characteristics, at least one pair of primers and a pair of probes are adapted to detect the G12V mutation of the K-ras Erlotinib and Gefitinib resistance gene.

AGGCCTGCTGAAAATGACTGAATAT.

TCGTCCACAAAATGATTCTGAATTAGCT.

According to particular characteristics, at least one probe comprises at least 80% of the sequence TTGGAGCTGTTGGCGT.

According to particular characteristics, at least one pair of primers and a pair of probes are adapted to detect the G13C mutation of the K-ras Erlotinib and Gefitinib resistance gene.

AGGCCTGCTGAAAATGACTGAATAT.

TCGTCCACAAAATGATTCTGAATTAGCT.

According to particular characteristics, at least one probe comprises at least 80% of the TTGGAGCTGGTGGCGT sequence. According to particular characteristics, at least one probe comprises at least 80% of the sequence TTGGAGCTGGTTGCGT.

According to particular characteristics, at least one pair of primers and a pair of probes are adapted to detect the L858R mutation of the EGFR gene of increased sensitivity to Erlotinib and Gefitinib.

According to particular characteristics, at least one primer comprises at least 80% of the sequence GCAGCATGTCAAGATCACAGATTT.

CCTCCTTCTGCATGGTATTCTTTCT.

According to particular characteristics, at least one probe comprises at least 80% of the sequence CAGTTTGGCCAGCCCA.

According to particular characteristics, at least one probe comprises at least 80% of the sequence CAGTTTGGCCCGCCCA.

According to particular features, the process as briefly described above comprises, in advance of the filtration step, a step of applying a formaldehyde-free fixing buffer to the liquid containing the particular cells.

Thus, the particular cells sought are specifically hardened without altering the genetic material.

According to particular characteristics, during the insertion step, the compartment has the general shape of a syringe in which the filter is positioned between the two openings.

Thanks to these provisions, it is possible to apply a piston in the upper opening without modifying the position of the filter.

According to particular characteristics, during the filtration step, vacuum suction is applied below the filter. Thanks to these provisions, the filtration is more efficient and faster than in the absence of suction.

According to particular characteristics, following the filtration step and before the recovery step, the compartment is placed on a tube of the Eppendorf type. There is thus a direct passage from the filter to an Eppendorf-type tube.

According to particular characteristics, before the recovery step, a piston is placed in the upper opening of the compartment, comprising a central punch movable inside the piston.

According to particular features, the mobile central punch has a pointed lower end.

According to particular features, the pointed lower end has a star shape.

According to particular features, during the recovery step, pressure is applied to the upper part of the punch to perforate the filter with the tip of the punch.

According to particular features, the piston having a means for locking the punch longitudinally, during the recovery step, the punch is pivoted inside the piston to release it from said locking means, before applying a pressure on its upper part.

According to particular features, during the recovery step, a downward vertical pressure is applied to the piston to pass the contents of the compartment into a tube placed below the compartment.

By virtue of each of these arrangements, the cellular material of the particular cells can be extracted without deterioration through the perforation of the filter.

According to particular characteristics, following the filtration step and before the recovery step, the contents of the compartment are isolated by plugging the lower opening with a membrane.

According to particular features, said membrane is positioned under a bar surrounding the lower opening of each compartment. This ensures the sealing and the maintenance of the lysis liquid above the filter.

According to particular features, said membrane is an adhesive membrane. By virtue of each of these arrangements, the contents of the compartment are kept away from the environment between the filtration and the recovery of the cellular material of the particular cells.

According to particular characteristics, during the recovery step, pressure is applied to the upper part of the punch to perforate the membrane isolating the contents of the compartment.

According to particular characteristics, the filter is made of polycarbonate with a hydrophilic surface treatment. The use of such a filter improves the retention rate of the particular cells and reduces the adhesion of the cellular material to be recovered.

According to particular characteristics, the filter has a pore diameter centered on 7.5 μm. Thus, due to the dispersion of the diameters, virtually no pore has a diameter greater than 8 microns.

The implementation of this pore diameter, which is less than the pore diameter traditionally used for the cytological analysis filters, makes it possible to remove them, which reduces the number of contiguous pores and avoids the loss of particular cells.

According to a second aspect, the present invention relates to a device for collecting genetic material from particular cells present in a liquid, characterized in that it comprises:

a compartment comprising an upper opening and a lower opening, between the two openings being positioned a filter whose micropores have a diameter intermediate between that of said particular cells and that of other cells,

a means for inserting the liquid into said compartment via the upper opening,

a filtration means passing the principal of the liquid and said other cells through the filter,

a means of lysis of the cells retained on the filter and

a means for recovering cellular material from the lysed cells, on the filter. According to a third aspect, the present invention provides a molecular biology kit comprising at least two primers and / or two probes among the following sequences:

- AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TGGAGCTGATGGCGT,

- AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TTGGAGCTGTTGGCGT,

- AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TTGGAGCTGGTTGCGT,

- GCAGCATGTCAAGATCACAGATTT,

- CCTCCTTCTGCATGGTATTCTTTCT,

- CAGTTTGGCCAGCCCA and

- CAGTTTGGCCCGCCCA.

According to particular features, the kit object of the present invention, as briefly described above, further comprises a device object of the present invention, as briefly described above.

Since the advantages, aims and characteristics of this device and of this kit are similar to those of the method that is the subject of the present invention, as briefly described above, they are not recalled here.

Other advantages, aims and features of the present invention will emerge from the description which follows, made for an explanatory and non-limiting purpose with reference to the appended drawings, in which:

FIG. 1 schematically represents, in perspective, parts of two particular embodiments of the device that is the subject of the the present invention, implemented in a first phase of the process which is the subject of the present invention,

FIG. 2 schematically represents, in section, parts of the two particular embodiments of the device that is the subject of the present invention, implemented in a first phase of the method that is the subject of the present invention,

FIG. 3 schematically represents, in perspective, parts of a first particular embodiment of the device that is the subject of the present invention,

FIG. 4 represents, schematically, in elevation, parts of the first particular embodiment of the device that is the subject of the present invention,

FIG. 5 represents, schematically, in section, parts of the first particular embodiment of the device that is the subject of the present invention,

FIG. 6 schematically represents, in perspective, parts of a second particular embodiment of the device that is the subject of the present invention,

FIG. 7 schematically represents, in section, parts of the second particular embodiment of the device that is the subject of the present invention;

FIG. 8 schematically represents, in perspective, parts of the two particular embodiments of the device that is the subject of the present invention, used in a second phase of the method that is the subject of the present invention, and

FIG. 9 represents, in the form of a logic diagram, the steps implemented in a particular embodiment of the method that is the subject of the present invention.

As can be seen with reference to FIGS. 1 and 2, in the two embodiments illustrated in the figures, the device for collecting cellular material, here genetic, comprises (here four) syringe-shaped compartments 105 presenting, each , an upper opening 106 and a lower opening 107. A washer or ring 118 placed in the lower opening 107 retains a filter 115. The filters 115 are micro-perforated and glued on the washers or rings 118 and then inserted at the distal end, that is to say say, at the bottom, of the four syringe-shaped compartments 105. For example, the filter 115 is made of polycarbonate with a hydrophilic surface treatment. The use of such a filter improves the retention rate of the particular cells and reduces the adhesion of the cellular material to be recovered. The filter 115 has, for example, a pore diameter centered on 7.5 μm. Due to the dispersion of the diameters, practically no pore then has a diameter greater than 8 μm.

At the small opening, or bottom opening, of each compartment 105 is placed, tightly, a tip (English "tip") 117 to avoid potential contamination of the end of the compartment 105 by splashing from the tank 112. These compartments 105 are assembled by a bar 116, made of plastic, to constitute a single piece. The assembly, consisting of the four compartments 105, the upper bar 116, the four pistons 140 and the bar-cap 120 (described below) is for single use.

In the first phase of the process for collecting cellular material, the compartments 105 are supported by a plate 110 inserted into a drawer holder 111 having a compartment connected to a tank 112 under the lower surface of the plate 110 through which an aspiration can be carried out. performed. An O-ring 113 seals the connection between a nozzle 117 and the plate 110. An O-ring 114 seals the connection between the plate 110 and the slide gate 111. The seal provided by the O-rings 113 and 114 allows aspiration of the contents of the compartments.

During aspiration by the reservoir 112, certain particular cells of the liquid present in the compartment 105, of larger diameter, are retained by the filter 115 while the principal of the liquid and small cells are sucked out of the compartment 105, through the filter 115. At the end of the first phase of the process for collecting cellular material, the compartments 105 are removed from the portion of the device illustrated in FIGS. 1 and 2 and the tips 117 are removed from the lower openings of the compartments 105. Then, a cap strip 120 is inserted at the tip of the compartments 105 in the form of syringes. It is a bar with four perforations that receive the lower end of the compartments. A plastic film is glued to the underside of this plug-bar 120, and constitutes a sealed membrane, preferably adhesive.

The contents of the compartment 105 are thus kept away from the environment until the recovery of the cellular material of the particular cells.

During the second phase of the method, the bar 116, carrying the compartments 105, associated with the bar of plugs 120, is placed in abutment on a rack 133 made of plastic material. Then, in an oven, the lysis of the cells present in the compartment 105 is carried out in an oven. For this purpose, after the addition of the reagents for the lysis of the cell membranes of the desired cells and the uniform amplification of the DNA or the RNA, the rack 133, now the vertical compartments 105, is transported in an oven. At the outlet of the oven, after cooling, the Eppendorf-type tubes are positioned on the lower support 131 of the gantry 130. The bar 116 carrying the compartments 105, associated with the bar of plugs 120, is positioned on the gantry 130 and place the gantry 130 on the lower support 131.

Then, through the upper opening 106 of each compartment 105, is inserted a piston 140 provided with a central axial punch 141 ending in a tip 142. Preferably, in section, this tip 142 has a star shape, for example to four branches, the point being cruciform.

Below each compartment 105 is positioned an Eppendorf tube 125 held in position by a shelf of the gantry 130.

Figures 3 and 4 illustrate the respective successive positions of the piston 140 and the punch 141 during the second phase of the process. To the left of each of these FIGS. 3 and 4, the piston 140 and the punch 141 are substantially entirely outside the compartment 106 and the upper part of the punch 141 protrudes vertically above the piston 140.

Then, by applying a rotation, the punch is passed from a safety position in which the punch 141 can not slide longitudinally inside a piston 140 because of a mechanical stop, at a position activation device in which the punch can slide longitudinally inside the piston 140. Then, a vertical force is applied downward on the top of the punch 141, the tip 142 of the punch 141 is lowered into the body of the compartment 106, to the filter 115. Continuing this descent, the tip 142 first pierces the filter 115 and the membrane 120 to penetrate slightly into the tube 125. The punch 141 is then held in position by contact on the opening bottom of the compartment 105. Finally, as shown on the right of Figures 3 and 4, holding in place the punch 141, a force is applied downwardly on the piston 140 so that it pushes the contents of the compartment 105 towards the tube 125, through the hole formed in the filter 115 and in the membrane 120 by the tip of the punch 142.

The Eppendorf type tubes 125 are then removed from the lower support 131, by withdrawing, upwardly from the gantry 130, the compartments 105 and the membrane 120, for analysis of the amplified genetic material, in particular the DNA or the RNA of the cells. of interest, collected in these tubes 125.

Note that the plate 110, the rack 133, the gantry 130 and the support 131 are reusable.

In the second embodiment, illustrated with reference to FIGS. 1, 2, 6 and 7, a support 131 of the gantry 130 is replaced by a support 132 having eight openings instead of four. The four tubes of Eppendorf type 125 are replaced by a bar of eight tubes of Eppendorf type 126 of lower capacity, typically 0.25 ml. Instead of 1, 5 ml. These Eppendorf-type tubes are adapted to another mode of recovery of cellular material making it possible to extract the amplified genetic material directly on the filter but in a smaller volume. Such a volume can then be contained in Eppendorf type tubes directly adapted to a RT-PCR apparatus (acronym for "reverse transcription polymerase chain reaction" for reverse transcription and polymerase chain reaction) in real time. It is noted that when using eight Eppendorf-type tubes, four tubes are used to collect amplified genetic material and four tubes are used to make controls, positive or negative.

As is observed in FIG. 9, the method which is the subject of the present invention first comprises, in a known manner, a step 200 of sampling a sample of liquid to be analyzed, for example from blood to which, optionally, a dilution or filtration.

During a step 205, a formaldehyde-free fixing buffer is applied in order to fix, that is to say harden, specifically the particular cells sought, without altering their genetic material.

For example, this binding buffer is composed of "PBS", a phosphate buffer, saponin for lysing red blood cells of BSA, bovine serum albumin to preserve the morphology of ETDA cells calcium chelating, sodium hydroxide (NaOH ) to adjust the pH to 7.2 and RCL2, a cell fixer that does not alter their genetic material. It is noted that formaldehyde is not used because it induces breaks in the genetic material.

During a step 210, the liquid resulting from step 205 is placed in a compartment 105 which ends with a filter whose micropores have an intermediate diameter between that of the desired cells and that of the other cells of the sample. liquid. In a variant, step 205 is fixed inside compartment 105 after step 210.

During a step 215, vacuum suction is applied below the filter. The principal of the liquid as well as the cells of diameter smaller than that of the pores of the filter 115 then pass through the filter 115. On the other hand, the desired cells of diameter smaller than that of the pores of the filter 115 are retained above the filter 115, in the compartment 105.

During a step 220, the compartments are removed from the plate 110, the tips 117 are removed from the compartments 105 and this remaining content is isolated in the compartment 105 by plugging the lower opening with a cap bar covered, in its lower part with an adhesive membrane 120.

During a step 225, the compartments 105, associated on the one hand with the bar of plugs 120 and the bar 116, are inserted into the rack 133, the bar 116 being held by this rack 133.

During a step 230, the cells retained on the filter are lysed according to known techniques. For this purpose, after the addition of the reagents for lysis of the cell membranes of the desired cells and the uniform amplification of the genetic material preserving the quantitative aspect, the rack 133, maintaining the vertical compartments 105, is kept in an oven for a period of time. known duration.

After leaving the oven, during a step 232, is removed from the rack 133, the bar 116, the compartments 105 and the bar of plugs 120 and placed on the gantry 130.

During a step 235, each compartment 105 is placed above an Eppendorf type tube 125, or 126 by positioning this tube on the lower support, 131 or 132 respectively, then the gantry 130 is positioned with the bar 116 compartments 105 and the cap strip 120 on lower portion 131, or 132, respectively.

During a step 240, through the upper opening 106 of each compartment 105, is inserted a piston 140 provided with a central axial punch 141 movable relative to the piston 140 and ending, inside the compartment 105, by a tip 142. Preferably, in cross section, this tip 142 has a star shape, for example with four branches, the tip then being cruciform.

During a step 245, the punch is rotated out of its safety position. Then, a pressure is applied on the upper part of the punch 141 to lower it along the longitudinal axis of the compartment 105, being guided by the piston 140. During this longitudinal movement, the tip 142 of the punch 141 perforates , successively, the filter 115 and the plug or the adhesive membrane 120. During a step 250, a pressure is applied on the rest of the piston 140 so that the remaining contents of the compartment 105 passes through the filter 115 and the plug or the membrane 120, and reaches the Eppendorf-type tube, by opening surrounding the tip 142 of the punch 141.

Thus, the genetic material of the particular cells is extracted without deterioration through the perforation of the filter.

During a step 255, the support, 131 or 132, and the Eppendorf type tubes, 125 or 126, are removed after removal, upwardly of the gantry 130, from the compartments 105 and the membrane 120.

During steps 265 and 270, an analysis of the genetic material, in particular the DNA or RNA of the desired cells, is carried out in these tubes 125 or 126. The amplified DNA is used as a template to detect the mutations of sensitivity or resistance to targeted therapies. In addition, or alternatively, cDNA ("c" meaning "complementary") derived from RNA by RT conversion and amplified is used as a template to detect the level of expression of susceptibility genes. or resistance to targeted therapies.

A defined volume of the amplified genetic material, in particular DNA, is taken to detect mutations in sensitivity or resistance to targeted therapies using primer and antisense pairs of primers. pairs of probes and during a quantitative and real-time PCR (acronym for polymerase chain reaction).

The principle of the search for mutations of sensitivity or resistance to targeted therapies implemented in the embodiment shown is as follows. The allele discrimination or "SNP genotyping assay" (SNP being the acronym for "single nucleotide polymorphism" for single nucleotide polymorphism) provides information on the presence or absence of a point mutation in a gene. The first step, 265, of allelic discrimination is a real-time quantitative PCR reaction carried out with two primers to amplify the sequence of interest and two probes, for example of the TaqMan (registered trademark) type. One of the probes recognizes the mutated sequence and the other recognizes the normal sequence. The two probes are associated with different fluorochromes, for example "VIC" for the probe hybridizing to the normal sequence and "FAM" for the probe hybridizing to the mutated sequence. The second step, 270, uses an allelic discrimination program measuring the initial fluorescence and the final fluorescence emitted by the FAM or / and VIC fluorochromes. This program makes it possible to distinguish between the different sequences present in each sample:

an increase in the fluorescence only in VIC indicates a homozygous profile for the normal sequence,

an increase in the fluorescence only in FAM indicates a homozygous profile for the mutated sequence,

an increase in the fluorescence in both VIC and FAM indicates a heterozygous profile.

For the detection of mutations, the sequences of the following primers and probes (sense and antisense, 5 'to 3') are used, for example:

For the G12D mutation of the Erlotinib and Gefitinib resistance K-ras gene:

- sense primer (or "forward") AGGCCTGCTGAAAATGACTGAATAT, antisense (or "reverse") primer

TCGTCCACAAAATGATTCTGAATTAGCT,

- "wild" probes, "VIC" color TTGGAGCTGGTGGCGT,

- "mutated" probe, color "FAM" TGGAGCTGATGGCGT.

For the G12V mutation (coding "12") of the K-ras gene for Erlotinib and Gefitinib resistance:

TCGTCCACAAAATGATTCTGAATTAGCT,

- "wild" probes, "VIC" color TTGGAGCTGGTGGCGT,

- "mutated" probe, color "FAM" TTGGAGCTGTTGGCGT.

For the G13C mutation of the Erlotinib and Gefitinib resistance K-ras gene:

- forward primer AGGCCTGCTGAAAATGACTGAATAT, antisense (or "reverse") primer

TCGTCCACAAAATGATTCTGAATTAGCT,

- "wild" probes, "VIC" color TTGGAGCTGGTGGCGT,

- "mutated" probe, color "FAM" TTGGAGCTGGTTGCGT.

For the L858R mutation of the EGFR gene with increased sensitivity to Erlotinib and Gefitinib:

- forward primer GCAGCATGTCAAGATCACAGATTT,

- antisense primer (or "reverse") CCTCCTTCTGCATGGTATTCTTTCT,

- "wild" probes, "VIC" color CAGTTTGGCCAGCCCA,

- "mutated" probe, "FAM" color CAGTTTGGCCCGCCCA.

The meaning of "sense" and "antisense" and "5 'to 3'" is well known to those skilled in the art. The probes are paired between the two primers and reveal the presence or absence of a mutation because of their associated fluorescence color. For the record, the color "FAM" is in the blues and the color "VIC" is in the greens. A measurement of the intensity of fluorescence in each of these colors, by the PCR apparatus, makes it possible to discriminate between normal genes, mutated homozygous genes and mutated heterozygous genes. For example, 50 amplification cycles are carried out.

In other embodiments, a defined volume of the genetic material including RNA converted to cDNA by RT (acronym for "reverse transcription") and amplified is taken to detect the level of gene expression of sensitivity or resistance to targeted therapies using sense and antisense primer pairs and a probe and during a quantitative and real-time polymerase chain reaction (PCR), for example with 50 cycles.

As understood by reading the description, the method, the device and the kit object of the present invention make it possible to collect and amplify under a condition compatible with routine laboratory tests, a large proportion of the genetic material of the present invention. cells considered, in good condition, even if the sample has only one desired cell.

Claims

1 - Process for collecting cell material from particular cells present in a liquid, characterized in that it comprises:

a step (210) for inserting the liquid into a compartment (105) via an upper opening (106) of the compartment, said compartment having a lower opening (107), between the two openings being positioned a filter (115) whose micropores have an intermediate diameter between that of said particular cells and that of other cells,

a filtration step (215) in which the principal of the liquid and said other cells pass through the filter,

a step (230) of lysis of the cells retained on the filter and

a step (245, 250) of recovering cell material from the lysed cells, on the filter.

2 - Process according to claim 1, characterized in that it comprises, following the lysis step, a step of amplification of the DNA and / or RNA and, during the step recovery, amplified genetic material is recovered from the lysed cells.

3 - Process according to claim 2, characterized in that, during the amplification step, a uniform amplification is carried out maintaining the quantitative appearance of the DNA or RNA.

4 - Process according to any one of claims 1 to 3, characterized in that it comprises, in addition, a step (265, 270) of detection, during which the amplified DNA is used as a matrix to detect at least one mutation of sensitivity or resistance to at least one targeted therapy.

5 - Process according to any one of claims 1 to 3, characterized in that it comprises, in addition, a step (265, 270) of detection, during which the amplified DNA is used as a matrix to detect a variation in gene expression level of sensitivity or resistance to targeted therapies.

6 - Process according to any one of claims 1 to 3, characterized in that it further comprises a detection step (265, 270), during which RNA is converted into cDNA and used said cDNA to detect the level of gene expression of sensitivity or resistance to targeted therapies.

7 - Process according to any one of claims 4 to 6, characterized in that, during the step (265, 270) of detection, is implemented a PCR (acronym for "polymerase chain reaction") quantitative and in real time.

8 - Process according to any one of claims 4 to 7, characterized in that, during the step (265, 270) of detection, it implements at least one pair of sense and antisense primer for amplify a predetermined sequence of interest.

9 - Process according to any one of claims 4 to 8, characterized in that, during the step (265, 270) of detection, it implements at least one pair of probes.

10 - Process according to claim 9, characterized in that at least two probes of a pair of probes are coupled to two different fluorochromes and are defined so that one recognizes a mutated sequence and the other recognizes a normal sequence. .

11 - Process according to any one of claims 7 or 8 and one of claims 8 or 9, characterized in that at least one pair of primers and a pair of probes are adapted to detect one of the following mutations:

the G12D mutation of the K-ras gene for Erlotinib and Gefitinib resistance,

the G12V mutation of the K-ras gene for Erlotinib and Gefitinib resistance,

the G13C mutation of the Erlotinib and Gefitinib resistance K-ras gene and the L858R mutation of the EGFR gene of increased sensitivity to Erlotinib and Gefitinib.

12 - Process according to claim 11, characterized in that at least two primers and / or two probes are among the following sequences:

- AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TGGAGCTGATGGCGT,

- AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TTGGAGCTGTTGGCGT,

- AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TTGGAGCTGGTTGCGT,

- GCAGCATGTCAAGATCACAGATTT,

- CCTCCTTCTGCATGGTATTCTTTCT,

- CAGTTTGGCCAGCCCA and

- CAGTTTGGCCCGCCCA.

13 - Process according to any one of claims 1 to 12, characterized in that, before the step (245, 250) of recovery, is positioned in the upper opening (106) of the compartment (105), a piston (140) having a central punch (141) movable within the piston.

14 - Method according to claim 13, characterized in that the movable central punch (141) has a pointed lower end (142) having a star shape.

15 - Process according to any one of claims 1 to 14, characterized in that, following the step (215) of filtration and before the step (245, 250) of recovery, the contents of the compartment are isolated (105) by plugging the lower opening (107) with a membrane, said membrane being positioned under a bar (120) surrounding the lower opening (107) of each compartment (105).

16 - Process according to any one of claims 1 to 15, characterized in that the filter (115) is made of polycarbonate treated with a hydrophilic surface treatment.

17 - Process according to any one of claims 1 to 16, characterized in that the filter (115) has a pore diameter centered on 7.5 microns.

18 - Device for collecting genetic material from particular cells present in a liquid, characterized in that it comprises:

a compartment (105) having an upper opening (106) and a lower opening (107), between the two openings being positioned a filter (115) whose micropores have an intermediate diameter between that of said particular cells and that of other cells; cell

a means for inserting the liquid into said compartment via the upper opening,

filtration means (111, 112) passing the principal of the liquid and said other cells through the filter,

a means of lysis of the cells retained on the filter and

a means for recovering cellular material from the lysed cells, on the filter.

19 - Kit of molecular biology for implementation in a device according to claim 18, characterized in that it comprises at least two primers and / or two probes from the following sequences:

- AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TGGAGCTGATGGCGT,

- AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TTGGAGCTGTTGGCGT, - AGGCCTGCTGAAAATGACTGAATAT,

- TCGTCCACAAAATGATTCTGAATTAGCT,

- TTGGAGCTGGTGGCGT,

- TTGGAGCTGGTTGCGT,

- GCAGCATGTCAAGATCACAGATTT,

- CCTCCTTCTGCATGGTATTCTTTCT,

- CAGTTTGGCCAGCCCA and

- CAGTTTGGCCCGCCCA.

20 - kit according to claim 19, characterized in that it comprises, n device according to claim 18.