EP2061500A2

EP2061500A2 - Pharmaceutical and sunscreen compositions comprising caspase-14

Info

Publication number: EP2061500A2
Application number: EP07803078A
Authority: EP
Inventors: Wim Declercq; Geertrui Denecker; Peter Vandenabeele
Original assignee: Universiteit Gent; Vlaams Instituut voor Biotechnologie VIB
Current assignee: Universiteit Gent; Vlaams Instituut voor Biotechnologie VIB
Priority date: 2006-09-01
Filing date: 2007-08-30
Publication date: 2009-05-27
Also published as: CA2661668A1; WO2008025830A2; IL197273A0; AU2007291199A1; WO2008025830A3

Abstract

The present invention relates to the field of sunscreen compositions for preventing or treating the harmful effects of solar radiation in skin. More particularly the invention provides sunscreen compositions comprising caspase-14 as an ingredient.

Description

SUNSCREEN COMPOSITIONS

Field of the invention

Background of the invention

A wide variety of compositions are known in the art for providing cosmetic and/or pharmacological benefits to human skin. Benefits sought include, for example, prevention, treatment or amelioration of environmental or age-related damage or deterioration of the skin, improved appearance by modifying surface characteristics, improved feel by moisturizing, and prevention or treatment of specific skin disorders. It is now generally recognized that exposure to solar radiation can have adverse health consequences, sometimes not appearing until several years following the exposure. Sunburn is a burn to the skin produced by overexposure to ultraviolet (UV) radiation, commonly from the sun's rays. A similar burn can be produced by overexposure to other sources of UV such as from tanning lamps, or occupationally, such as from welding arcs. Exposure of the skin to lesser amounts of UV will often produce a suntan. Usual mild symptoms are red or reddish skin that's hot to the touch, a washed out feeling, and mild dizziness. Sunburn can be life-threatening and is a leading cause of cancer. The risk of sunburn increases with proximity to the earth's equator. It can also be increased by pharmaceutical products that sensitized some users to UV radiation. Certain antibiotics, contraceptives, and tranquillizers have this effect. People with red hair and/or freckles generally have a greater risk of sunburn than others because of their lighter skin tone. Suntans, which naturally develop in some individuals as a protective mechanism against the sun, are viewed by many in the Western world as desirable. This has led to increases in sunburn incidences and in solarium popularity as individuals attempt to tan. A 2003 study found that 36% of US adults have sunburn at least once a year. In recent years, the incidence and severity of sunburn has increased worldwide, especially in the southern hemisphere, because of damage to the ozone layer. Ozone depletion and the seasonal ozone hole have led to dangerously high levels of UV radiation. A wide variety of commercial preparations are available that block UV light, known as sunscreens. Typical sunscreen product formulations are lotions, creams, ointments, or gels containing chemical and/or physical barriers to ultraviolet transmission. These vary considerably in their abilities to protect the skin against the physical and biochemical effects of ultraviolet radiation. Earlier sunscreen formulations were designed to protect against sunburn from a limited solar exposure period, while transmitting sufficient radiation to permit skin tanning. However, the current focus is on eliminating as much ultraviolet exposure as possible, it being recognized that skin tanning, while esthetical pleasing to some is a clear indication of tissue damage from overexposure to solar radiation. It has been recently discovered that any amount of unprotected exposure can potentially cause immune system suppression and lead to future health problems, such as skin carcinomas and other dermatological disorders. Thus, there exists a need for developing alternative sunscreen compositions to protect from sunburn and to cure skin from sunburn. The present invention satisfies this need and offers a sunscreen composition comprising caspase-14 that can be used to prevent sunburn and to treat sunburn damaged skin.

Figure legends

Figure 1. Targeting of embryonic stem cells. A mouse 129/SvJ genomic DNA BAC library (Genome Systems) was PCR-screened for clones containing the mouse caspase-14 gene. The correct clone was identified using primers targeting exon 3 (forward primer: TGGTACTCATGGCACATGGT, reverse primer: CAAGCCTGGATGATGTACAC). Several caspase-14 genomic DNA fragments were subcloned and sequenced. For construction of the targeting vector, a large homology domain of 3863 bp upstream of exon 3 was generated by PCR (forward primer: CGGGGJACCTGCACTCACATACACACAATGT, reverse primer: TGCTTACTTGCAGAGGTCTCAG, the Kpnl restriction site is underlined), digested with

27

Kpnl/BamHI and cloned into a Kpnl/BamHI opened pPNT vector . A small homology domain of 2398 bp (spanning a region starting in intron 4 and extending to part of exon 7) was amplified with primers extended with Xhol (5'-end) and Notl (3'-end) restriction sites (forward primer: ACCGCTCGAGATCCAGGCTTGTAGAGGAGGT, reverse primer:

ATAAGAATGCGGCCGCTGGTAGTTGAGGCCTAGCTCAT, the Xhol and Notl restriction sites are underlined). This fragment was cloned into an Xhol/Notl opened pPNT vector already containing the large homology domain. The DNA inserts were sequence verified. The targeting vector was electroporated in ES cells and the correctly recombined ES cells were used to generate caspase-14 deficient mice. Southern-blot screening of EcoRV-digested genomic DNA was performed using a radioactively labelled 3' probe (3'P)

Figure 2 Adult caspase-14 deficient mice are more sensitive to UVB irradiation. Wild-type and

-/- caspase-14 mice were shaved and irradiated with different UVB doses. Skin samples were taken 24 h after irradiation, sectioned, and stained with antibodies against active caspase-3 to identify apoptotic cells. Bars represent the mean number of caspase-3-positive cells ± s.d. of three mice of a representative experiment.

Figure 3. Caspase-14 deficient mice are more prone to the induction of parakeratotic plaques upon topical imiquimod (Aldara™) treatment. Numbers of large parakeratotic plaques were scored microscopically by two independent persons. Numbers represented indicate numbers of large parakeratotic plaques per cm of skin slice.

Figure 4. Caspase-14 deficient mice are more prone to the development of parakeratosis upon repeated skin barrier disruption by means of acetone treatment. Numbers of large parakeratotic plaques were scored microscopically by two independent persons. Numbers represented indicate numbers of large parakeratotic plaques per cm of skin slice. 4 mice in each group.

Figure 5: Caspase-14 deficient mice are more prone to the development of parakeratosis upon repeated skin barrier disruption by means of tape stripping. Numbers of large parakeratotic plaques were scored microscopically by two independent persons. Numbers represented indicate numbers of large parakeratotic plaques per cm of skin slice. 4 mice in each group.

Figure 6: Scheme of human, reverse caspase-14

Aims and detailed description of the invention Caspase-14 belongs to a conserved family of aspartate-specific proteinases. It is a short prodomain caspase which expression is almost exclusively restricted to the suprabasal layers

1-4 of the epidermis and the hair follicles . The nucleotide sequence of human caspase-14 is depicted in SEQ ID NO: 1 , the amino acid sequence of human caspase-14 is depicted in SEQ ID NO: 2. Procaspases consist of a prodomain, a large subunit (p20) and a small subunit (p10) and activation of caspases is induced by dimerisation, (auto-)proteolytic cleavage at Asp residues and/or conformational changes. Currently, proteolytic maturation of caspase-14 in its p20 and p10 subunit was only consistently observed in cornifying epithelia such as the epidermis and the rodent forestomach (Lippens et al., 2000). The activation of caspase-14 in the epidermis remains enigmatic as caspase-14 is not processed at an aspartate residu like other caspases, but at Ne¹⁵² in human and presumably at Leu¹⁶⁷ in murine caspase-14, respectively. In order to determine the role of caspase-14, we generated caspase-14 deficient mice. We found that the skin of caspase-14 deficient mice is highly sensitive to the formation of cyclobutane pyrimidine dimers upon UVB irradiation, leading to increased levels of UVB-induced apoptosis. These results demonstrate that caspase-14 has a crucial function in protecting the skin against UV- damage. Typical sunscreen compositions include organic or inorganic compounds which reduce the ultraviolet radiation that reaches the skin by scattering or absorbing ultraviolet rays. Commercial formulations are usually in the form of a lotion to be spread over the exposed skin. These lotions usually contain more than one active agent, and are designed to protect skin against various wavelengths of light. In addition, commercial formulations frequently contain further components which provide other desirable properties, such as fragrance and/or moisturizers, such as aloe vera. Many conventional cosmetic cream and lotion compositions are described in the art, for example, in Flick, E. W., Cosmetic and Toiletry formulations, Volume 4 (2^nd Edition), (1995) William Andrew Publishing/Noyes. Ultraviolet (UV) radiation with a wavelength of approximately 290-400 nanometres (nm) has long been known to have harmful effects on human skin. There is an increasing awareness of the need to use sunscreens in order to protect exposed skin. UV-B radiation is produced between 290-320 nm and UV-A radiation between 320-400 nm. UV-C radiation, which is generally defined as radiation with a wavelength of less than approximately 290 nm, is absorbed by the atmosphere and is therefore not considered to be of general concern. UV radiation damage to human skin may result in damage to the dermal infrastructure that, in its most extreme form, may result in malignancies. UV radiation falling within the range of 290-320 nm may cause erythema and oedema associated with sunburn.

The present invention shows that when a composition comprising caspase-14 is applied to skin - that upon UV-B-irradiation - less cyclobutane pyrimidine dimers are formed which leads to a reduced level of UV-B-induced apoptosis. Thus, the present invention is directed to a composition for a sunscreen comprising caspase-14 designed for topical application to skin, in particular human skin. More particularly, the present invention is directed to the use of a sunscreen composition comprising caspase-14 to protect skin against harmful UV radiation, particularly UV-A or UV-B or UV-A and UV-B radiation. In a particular embodiment said caspase-14 is procaspase-14. In another particular embodiment said caspase-14 is reverse caspase-14. In another particular embodiment said caspase-14 is mixture of recombinantly expressed p20 and p10 catalytic subunits of caspase-14. The terms procaspase-14 and reverse caspase-14 are further explained in the examples. One can for example recombinantly express procaspase-14 in bacteria and purify the procaspase-14 form bacterial lysates such will not have enzymatic activity since processing between the p20 and p10 subunits is required. This pro-caspase-14 can be applied to human skin, speculating on the fact that the endogenous caspase-14-processing factor present in the skin will convert the procaspase-14 to its enzymatically active form. A second strategy is the generation of reverse caspase-14 in which the p10 subunit is placed amino-terminal to the p20 subunit in a colinear polypeptide chain. It is believed that the structure of reverse caspases mimic structure of proteolytically activated caspases and this strategy has been successfully applied for caspase-3, -6 en -7 (Srinivasula SM et al (1998) MoI Cell 1 , 949-957). This reverse caspase-14 does no longer require proteolytic processing and is thus as such enzymatically active. In a preferred embodiment caspase-14 (pro-caspase-14 or reverse caspase-14 or the catalytic p10 and p20 fragments of caspase-14) is a recombinant protein. The recombinant protein may be manufactured using recombinant expression systems comprising bacterial cells, yeast cells, animal cells, insect cells, plant cells or transgenic animals or plants. The recombinant protein may be purified by any conventional protein purification procedure close to homogeneity and/or be mixed with additives.

In a preferred embodiment, combinations of two or more sunscreen ingredients, in addition to caspase-14 as an active agent, are used in a formulation to achieve higher levels of ultraviolet absorption or to provide useful absorption over a wider range of ultraviolet wavelengths than can be attained with a single active component. Such a sunscreen composition preferentially includes both UV-A and UV-B filters to prevent most of the sunlight within the full range of about 280 nm to about 400 nm from damaging human skin. This sunscreen composition preferably also comprises a suitable carrier for topical application to human skin. A variety of UV absorbers is known in the art and has varying effectiveness at absorbing different parts of the UV spectrum. A preferred embodiment of the present invention would include a UV absorber component that has activity in both the UVA and UVB ranges. This may be accomplished either through the use of a UV absorber that is effective in both the UVA and the UVB ranges or through the use of two or more UV absorbers having combined activity across the UVA and UVB spectra. UV absorbers encompassed by this invention include, but are not limited to, the use of one or more of the following: benzophenone derivatives (such as benzophenone-1 , benzophenone-2 or benzophenone-3 [also known as oxybenzone], benzophenone-4, benzophenone-6, benzophenone-8, benzophenone-12, alkyl and aryl cinnamate derivatives (such as DEA methoxycinnamate, octyl methoxycinnamate), aminobenzoate derivatives (such as p-aminobenzoic acid, ethyl dihydroxypropyl p-amino benzoic acid glyceryl p-aminobenzoic acid, octyl dimethyl p-aminobenzoic acid), homosalate, anthranilate derivatives (such as menthyl anthranilate), aryl acrylate derivatives (such as etocrylene, octocrylene), salicylate derivatives (such as octyl salicylate, trolamine salicylate), benzimidazole derivatives (such as 2-phenylbenzimidazole-5 sulphonic acid), benzilidene derivatives (such as 3-(4-methylbenzylidene)-camphor), benzoyl methane derivatives (such as 4-isopropyl dibenzoyl methane, butyl methoxy dibenzoyl methane[also known as avobenzone]) and oxides (such as titanium dioxide and zinc oxide). The amount of UV absorber employed will depend on its effectiveness, alone or in combination with other UV absorbers, but in any event will be sufficient to block a measurable quantity of UV radiation, preferably that UV radiation generated naturally, such as by the sun, or generated by man-made UV radiation generating sources, such as electric lamps and beams. The sunscreen compositions comprising caspase-14 of the invention can, in some embodiments of the present invention, further be combined with known moisturizers, emollients, solvents, lubricants, emulsifiers and/or other common cosmetic formulation ingredients which may enhance the solubility of the compound, produce emulsification, provide thickening, and/or provide other skin enhancement properties known in the art. The compositions of the present invention can be produced as a lotion, as a gel, in solid stick form, as an emulsion, as an aerosol, and in other forms. In what follows a brief explanation and definition of emulsions (emulsifiers), moisturizers, emollients, humectants, dry feel modifiers, waterproofing agents, insect repellents, anti-microbial preservatives, antioxidant chelating agents, fragrances and pH modifiers is presented. Emulsions/Emulsifiers: In some preferred embodiments of the present invention, the compositions and sunscreen compositions comprising caspase-14 is in the form of an emulsion. In a preferred embodiment this emulsion comprises a hydrophobic component which imparts film forming and waterproofing characteristics to the emulsion. Examples of such hydrophobic components are copolymers derived of octadecene-1 and maleic anhydride, polyanhydride resin and a copolymer of vinyl pyrrolidone and eicosene monomers. A stable emulsion is a mixture of two immiscible liquids, i.e. liquids that are not mutually soluble, but which can form a fluid in which very small droplets of one component are stably dispersed throughout the other liquid, giving the mixture the appearance of a homogeneous fluid. Emulsions can include particulate materials and materials which are solid or solid-like at room temperature, but which will liquefy at higher temperatures used during formation of the emulsion. The presence of an emulsifier enhances the ability of one of the immiscible liquids to remain in a continuous form, while allowing the other immiscible liquid to remain in a dispersed droplet form. Thus, one function of an emulsifier, a stabilizing compound, is to assist in the production of a stable emulsion. A secondary function of emulsifiers is to provide a thickening or "bodying" to an emulsion. Typically, emulsifiers are molecules with non-polar and polar parts that are able to reside at the interface of the two immiscible liquids. The term "emulsion" shall be used herein to identify oil-in-water (o/w) or water-in-oil (w/o) type dispersion formulations intended for application to the skin, particularly lotions and creams providing cosmetic or therapeutic benefits. Techniques for forming o/w and w/o emulsions are very well known in the art. The present invention is not dependent upon any particular formulation technique, it being recognized that the choice of specific formulation components may well make necessary some specific formulation procedure. Suitable emulsifiers for one aspect of the invention are those known in the art for producing oil-in-water and/or water-in-oil type emulsions. An aqueous external phase is preferred by many people for skin contact, since it is not as likely to produce an oily or greasy sensation when it is being applied, as is an emulsion having an oil external phase. Water is employed in amounts effective to form the emulsion. It is generally preferred to use water which has been purified by processes such as deionization or reverse osmosis, to improve the batch-to-batch formulation inconsistencies which can be caused by dissolved solids in the water supply. The amount of water in the emulsion or composition can range from about 15 to 95 weight percent, preferably from about 45 to 75 percent.

Moisturizers: In preferred embodiments the compositions or sunscreen compositions of the present invention include moisturizers, such as guanidine, glycolic acid, glycolate salts such as ammonium and quaternary alkyl ammonium, lactic acid and lactate salts, aloe vera in any of its variety of forms, polyhydroxy alcohols such as sorbitol, glycerol, hexanetriol, propylene glycol, butylene glycol, hexylene glycol, polyethylene glycols, sugars and starches, sugar and starch derivatives, hyaluronic acid, lactamide monoethanolamine, acetamide monoethanolamine and mixtures thereof. Moisturizers and techniques for preparing moisturizers is well known in the art.

Additional/Optional Components: The compositions or sunscreen compositions of the present invention may contain a wide range of additional, optional components. The CTFA Cosmetic Ingredient Handbook, Seventh Edition, 1997 and the Eighth Edition, 2000 describes a wide variety of cosmetic and pharmaceutical ingredients commonly used in skin care compositions, which are suitable for use in the compositions of the present invention. Examples of these functional classes disclosed in this reference include: absorbents, abrasives, anticaking agents, antifoaming agents, antioxidants, binders, biological additives, buffering agents, bulking agents, chelating agents, chemical additives, colorants, cosmetic astringents, cosmetic biocides, denaturants, drug astringents, external analgesics, film formers, fragrance components, humectants, opacifying agents, pH adjusters, plasticizers, preservatives, propellants, reducing agents, skin bleaching agents, skin-conditioning agents (emollient, humectants, miscellaneous, and occlusive), skin protectants, solvents, foam boosters, hydrotropes, solubilizing agents, suspending agents (nonsurfactant), sunscreen agents, ultraviolet light absorbers, waterproofing agents, and viscosity increasing agents (aqueous and nonaqueous).

Emollients: An emollient is an oleaginous or oily substance that helps to smooth and soften the skin, and may also reduce its roughness, cracking or irritation. Typical suitable emollients include mineral oil having a viscosity in the range of 50 to 500 centipoise (cps), lanolin oil, coconut oil, cocoa butter, olive oil, almond oil, macadamia nut oil, aloe extracts such as aloe vera lipoquinone, synthetic jojoba oils, natural sonora jojoba oils, safflower oil, corn oil, liquid lanolin, cottonseed oil and peanut oil.

Humectants: A humectant is a moistening agent that promotes retention of water due to its hygroscopic properties. Suitable humectants include glycerin, polymeric glycols such as poyethylene glycol and polypropylene glycol, mannitol and sorbitol. One or more humectants can optionally be included in the in the sunscreen in amounts from about 1 to 10 weight percent. Dry-feel Modifier: A dry-feel modifier is an agent which when added to an emulsion, imparts a "dry feel" to the skin when the emulsion dries. Dry feel modifiers can be used in addition to the epichlorohydrin cross-linked glyceryl starch used in the formulation of the present invention. Dry feel modifiers can include talc, kaolin, chalk, zinc oxide, silicone fluids, inorganic salts such as barium sulfate, surface treated silica, precipitated silica, fumed silica such as an Aerosil available from Degussa Inc. of New York, N.Y. U.S.A. Waterproofing Agents: A waterproofing or water resistance agent is a hydrophobic material that imparts film forming and waterproofing characteristics to an emulsion. A suitable waterproofing agent is a copolymer of vinyl pyrollidone and eicosene and dodecane monomers such as Ganex V 220 and Ganex V 216 Polymers, respectively, trade names of ISP Inc. of Wayne, NJ. U.S.A. Still other suitable waterproofing agents include polyurethane polymer, such as Performa V 825 available from New Phase Technologies and polyanhydride resin No. 18 available under the trade name PA-18 from Chevron. The waterproofing agent is used in amounts effective to allow the sunscreen to remain effective on the skin after exposure to circulating water for at least 40 minutes for water resistance and at least 80 minutes for waterproofing using the procedures described by the U.S. Food and Drug Administration in "Sunscreen Drug Products for OTC Human Use," Federal Register, Vol. 43, Aug. 25, 1978, Part 2, pp. 38206 38269.

Insect Repellants: Insect repelling components are often used in sunscreening emulsions, since the emulsions are normally used primarily by persons engaged in outdoor activities. The most widely used active agent for personal care products is N,N-Diethyl-m-toluamide, frequently called "DEET" and available in the form of a concentrate containing at least about 95 percent DEET. Other synthetic chemical repellents include dimethyl phthalate, ethyl hexanediol, indalone, di-n-propylisocinchoronate, bicycloheptene, dicarboximide and tetrahydrofuraldehyde. Certain plant-derived materials also have insect repellent activity, including citronella oil and other sources of citronella (including lemon grass oil), limonene, rosemary oil and eucalyptus oil. Choice of an insect repellent for incorporation into the sunscreen emulsion will frequently be influenced by the odor of the repellent. Antimicrobial Preservative: An antimicrobial preservative is a substance or preparation which destroys, or prevents or inhibits the proliferation of, microorganisms in the sunscreen composition, and which may also offer protection from oxidation. Preservatives are frequently used to make self-sterilizing, aqueous based products such as emulsions. This is done to prevent the development of microorganisms that may be in the product from growing during manufacturing and distribution of the product and during use by consumers, who may further inadvertently contaminate the products during normal use. Typical preservatives include the lower alkyl esters of parahydroxybenzoates (parabens), especially methylparaben, propylparaben, isobutylparaben and mixtures thereof, benzyl alcohol, phenyl ethyl alcohol and benzoic acid. Antioxidant: An antioxidant is a natural or synthetic substance added to the sunscreen to protect from or delay its deterioration due to the action of oxygen in the air (oxidation). Antioxidants prevent oxidative deterioration which may lead to the generation of rancidity and nonenyzymatic browning reaction products. Typical suitable antioxidants include propyl, octyl and dodecyl esters of gallic acid, butylated hydroxyanisole (BHA, usually purchased as a mixture of ortho and meta isomers), butylated hydroxytoluene (BHT), nordihydroguaiaretic acid, Vitamin A, Vitamin E and Vitamin C.

Chelating Agents: Chelating agents are substances used to chelate or bind metallic ions, such as with a heterocylic ring structure so that the ion is held by chemical bonds from each of the participating rings. Suitable chelating agents include ethylene diaminetetraacetic acid (EDTA), EDTA disodium, calcium disodium edetate, EDTA trisodium, EDTA tetrasodium and EDTA dipotassium.

Fragrances: Fragrances are aromatic substances which can impart an aesthetically pleasing aroma to the sunscreen composition. Typical fragrances include aromatic materials extracted from botanical sources (i.e., rose petals, gardenia blossoms, jasmine flowers, etc.) which can be used alone or in any combination to create essential oils. Alternatively, alcoholic extracts may be prepared for compounding fragrances. However, due to the relatively high costs of obtaining fragrances from natural substances, the modem trend is to use synthetically prepared fragrances, particularly in high-volume products. pH Modifier: A pH modifier is a compound that will adjust the pH of a formulation to a lower, e.g., more acidic pH value, or to a higher, e.g., more basic pH value. The selection of a suitable pH modifier is well within the ordinary skill of one in the art.

In yet another embodiment a composition comprising caspase-14 can be used for the manufacture of a medicament to treat sunburn. In yet another embodiment said composition is a sunscreen composition.

Topical application of a sunscreen comprising caspase-14 to treat sunburn: In a preferred embodiment, the method comprises the topical administration of the compositions and formulation of the invention. "Topical application", "applied topically", "topical administration" and "administered topically", are used interchangeably to mean the process of applying or spreading one or more compositions or sunscreen compositions according to the instant invention onto the surface of the skin of a subject in need thereof. Topical formulations may be comprised of oil-in-water and/or water-in-oil type emulsions but are not limited in this respect. Topical formulations contemplated by the present invention may include delayed release compositions capable of producing a slow release of the sunscreen active agent. The topical formulations of caspase-14 (i.e. the procaspase-14 protein or the reverse caspase-14 protein or the p10 and p20 catalytic subunits of caspase-14) include those pharmaceutical forms in which the composition is applied externally by direct contact with the skin surface to be treated. A conventional pharmaceutical form for topical application includes a soak, an ointment, a cream, a lotion, a paste, a gel, a stick, a spray, an aerosol, a bath oil, a solution and the like. Topical therapy is delivered by various vehicles, the choice of vehicle can be important and generally is related to whether it is applied to prevent sunburn or whether it is applied to treat sunburn (i.e. when it is applied as an aftersun composition). As an example, a sunburn can be treated with aqueous drying preparations, whereas in order to prevent sunburn hydrating preparations can be used. Soaks are the easiest method of drying acute moist eruptions. Lotions (powder in water suspension) and solutions (medications dissolved in a solvent) are ideal for hairy and intertriginous areas. Ointments or water-in-oil emulsions, are the most effective hydrating agents, appropriate for dry scaly eruptions, but are greasy and depending upon the site of the lesion sometimes undesirable. As appropriate, they can be applied in combination with a bandage, particularly when it is desirable to increase penetration of the caspase-14 composition into a sunburn lesion. Creams or oil-in-water emulsions and gels are absorbable and are the most cosmetically acceptable to the patient. (Guzzo et al, in Goodman & Gilman's Pharmacological Basis of Therapeutics, 9^th Ed., p. 1593-15950 (1996)). Cream formulations generally include components such as petroleum, lanolin, polyethylene glycols, mineral oil, glycerin, isopropyl palmitate, glyceryl stearate, cetearyl alcohol, tocopheryl acetate, isopropyl myristate, lanolin alcohol, simethicone, carbomen, methylchlorisothiazolinone, methylisothiazolinone, cyclomethicone and hydroxypropyl methylcellulose, as well as mixtures thereof. Other formulations for topical application include shampoos, soaps, shake lotions, and the like, particularly those formulated to leave a residue on the underlying skin, such as the scalp (Arndt et al, in Dermatology In General Medicine 2:2838 (1993)). In general, the concentration of the caspase-14 protein (procaspase-14, the reverse caspase-14 or a mixture of p20 and p10 caspase-14 subunits) in the topical formulation is in an amount of about 0.05 to 50% by weight of the composition, preferably about 0.1 to 5%, more preferably about 0.5-2%. The concentration used can be in the upper portion of the range initially, as treatment continues, the concentration can be lowered or the application of the formulation may be less frequent. Topical applications are often applied twice daily. However, once-daily application of a larger dose or more frequent applications of a smaller dose may be effective. The stratum corneum may act as a reservoir and allow gradual penetration of a drug into the viable skin layers over a prolonged period of time. In a topical application, a sufficient amount of caspase-14 must penetrate a patient's skin in order to obtain a desired pharmacological effect. It is generally understood that the absorption of drug into the skin is a function of the nature of the drug, the behaviour of the vehicle, and the skin. Three major variables account for differences in the rate of absorption or flux of different topical drugs or the same drug in different vehicles; the concentration of drug in the vehicle, the partition coefficient of drug between the stratum corneum and the vehicle and the diffusion coefficient of drug in the stratum corneum. To be effective for treatment, a drug must cross the stratum corneum which is responsible for the barrier function of the skin. In general, a topical formulation which exerts a high in vitro skin penetration is effective in vivo. A skin penetration enhancer which is dermatologically acceptable and compatible with caspase-14 can be incorporated into the formulation to increase the penetration of caspase-14 from the skin surface into epidemal keratinocytes. Skin penetration enhancers are well known in the art. For example, dimethyl sulfoxide (U.S. Pat. No. 3,711 ,602); oleic acid, 1 ,2-butanediol surfactant (Cooper, J. Pharm. ScL, 73:1 153-1 156 (1984)); a combination of ethanol and oleic acid or oleyl alcohol (EP 267,617), 2-ethyl-1 ,3-hexanediol (WO 87/03490); decyl methyl sulphoxide and Azone.RTM. (Hadgraft, Eur. J. Drug. Metab. Pharmacokinet, 21 :165-173 (1996)); alcohols, sulphoxides, fatty acids, esters, Azone.RTM., pyrrolidones, urea and polyoles (Kalbitz et al, Pharmazie, 51 :619-637 (1996)); terpenes such as 1 ,8-cineole, menthone, limonene and nerolidol (Yamane, J. Pharmacy & Pharmocology, 47:978-989 (1995)); Azone.RTM. and Transcutol (Harrison et al, Pharmaceutical Res. 13:542-546 (1996)); and oleic acid, polyethylene glycol and propylene glycol (Singh et al, Pharmazie, 51 :741-744 (1996)) are known to improve skin penetration of an active ingredient. Levels of penetration of an caspase- 14 composition can be determined by techniques known to those of skill in the art. For example, radiolabeling of caspase-14, followed by measurement of the amount of radiolabeled caspase-14 absorbed by the skin enables one of skill in the art to determine levels of the composition absorbed using any of several methods of determining skin penetration of the test compound. For some applications, it is preferable to administer a long acting form of caspase- 14 composition using formulations known in the arts, such as polymers. Caspase-14 can be incorporated into a dermal patch (Thacharodi et al, in Biomaterials 16:145-148 (1995) or a bandage according to methods known in the arts, to increase the efficiency of delivery of the drug to the sunburned areas to be treated.

In yet another particular embodiment the invention provides a pharmaceutical composition comprising caspase-14. Said caspase-14 can be pro-caspase-14, reverse caspase-14 or a mixture of the catalytic p20 and p10 subunits of caspase-14. In yet another particular embodiment a pharmaceutical composition comprising caspase-14 is used for the treatment of disorders involving parakeratosis. The term 'parakeratosis' refers to the retention (or a persistence) of the nuclei in the stratum corneum of the epidermis of the skin. Examples of diseases (or disorders) in which parakeratosis is involved are psoriasis, basal cell carcinoma and basal cell carcinoma.

The term 'medicament to treat' relates to a composition comprising caspase-14 and a pharmaceutically acceptable carrier or excipient (both terms can be used interchangeably) to prevent diseases involving parakeratosis. Suitable carriers or excipients known to the skilled man are saline, Ringer's solution, dextrose solution, Hank's solution, fixed oils, ethyl oleate, 5% dextrose in saline, substances that enhance isotonicity and chemical stability, buffers and preservatives. Other suitable carriers include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids and amino acid copolymers. The 'medicament' may be administered by any suitable method within the knowledge of the skilled man. In a particular embodiment caspase-14 is delivered via transdermal delivery into the skin using transdermal delivery technology described herein before and transdermal delivery technology known to the person skilled in the art. However, the dosage and mode of administration will depend on the individual. Generally, the medicament is administered so that the caspase-14 of the present invention is given at a dose between 1 μg/kg and 100 mg/kg, preferably between 10 μg/kg and 10 mg/kg, more preferably between 0.1 and 5 mg/kg.

In yet another embodiment the invention provides a transgenic, non-human animal characterised by having an endogenous nucleic acid sequence encoding a non-functional caspase-14 expression.

In yet another embodiment the invention provides a transgenic, non-human animal characterised by having an endogenous nucleic acid sequence encoding a non-functional caspase-14 expression wherein said non-functional caspase-14 expression is in a specific tissue or in a specific organ. More specifically, the present invention provides a transgenic non-human animal whose genome comprises a disruption in the caspase-14 gene, wherein the transgenic animal exhibits a decreased level of functional caspase-14 protein relative to wild-type. The non- human animal may be any suitable animal (e.g., cat, cattle, dog, horse, goat, rodent, and sheep), but is preferably a rodent. More preferably, the non-human animal is a rat or a mouse. Unless otherwise indicated, the term "caspase-14 gene" refers herein to a nucleic acid sequence encoding caspase-14 protein, and any allelic variants thereof. Due to the degeneracy of the genetic code, the caspase-14 gene of the present invention includes a multitude of nucleic acid substitutions which will also encode a caspase-14 protein. An "endogenous" caspase-14 gene is one that originates or arises naturally, from within an organism. Additionally, as used herein, "caspase-14 protein" includes a "caspase-14 protein analogue". A "caspase-14 analogue" is a functional variant of the "caspase-14 protein", having a caspase-14-protein biological activity, that has 60% or greater (preferably, 70% or greater) amino-acid-sequence homology with a caspase-14 protein, as well as a fragment of the caspase-14 protein having a caspase-14 protein biological activity. As further used herein, the term "transgene" refers to a nucleic acid (e.g., DNA or a gene) that has been introduced into the genome of an animal by experimental manipulation, wherein the introduced gene is not endogenous to the animal, or is a modified or mutated form of a gene that is endogenous to the animal. The modified or mutated form of an endogenous gene may be produced through human intervention (e.g., by introduction of a point mutation, introduction of a frameshift mutation, deletion of a portion or fragment of the endogenous gene, insertion of a selectable marker gene, insertion of a termination codon, insertion of recombination sites, etc.). A transgenic non-human animal may be produced by several methods involving human intervention, including, without limitation, introduction of a transgene into an embryonic stem cell, newly fertilized egg, or early embryo of a non-human animal; integration of a transgene into a chromosome of the somatic and/or germ cells of a non-human animal; and any of the methods described herein.

The transgenic animal of the present invention has a genome in which the caspase-14 gene has been selectively inactivated, resulting in a disruption in its endogenous caspase-14 gene in at least one tissue or organ. As used herein, a "disruption" refers to a mutation (i.e., a permanent, transmissible change in genetic material) in the caspase-14 gene that prevents normal expression of functional caspase-14 protein (e.g., it results in expression of a mutant caspase-14 protein; it prevents expression of a normal amount of caspase-14 protein; or it prevents expression of caspase-14 protein). Examples of a disruption include, without limitation, a point mutation, introduction of a frameshift mutation, deletion of a portion or fragment of the endogenous gene, insertion of a selectable marker gene, and insertion of a termination codon. As used herein, the term "mutant" is used herein to refer to a gene (or its gene product), which exhibits at least one modification in its sequence (or its functional properties) as compared with the wild-type gene (or its gene product). In contrast, the term "wild-type" refers to the characteristic genotype (or phenotype) for a particular gene (or its gene product), as found most frequently in its natural source (e.g., in a natural population). A wild-type animal, for example, expresses functional caspase-14.

Selective inactivation of a gene in a transgenic non-human animal may be achieved by a variety of methods, and may result in either a heterozygous disruption (wherein one caspase- 14 gene allele is disrupted, such that the resulting transgenic animal is heterozygous for the mutation) or a homozygous disruption (wherein both caspase-14 gene alleles are disrupted, such that the resulting transgenic animal is homozygous for the mutation). In one embodiment of the present invention, the endogenous caspase-14 gene of the transgenic animal is disrupted through homologous recombination with a nucleic acid sequence that encodes a region common to the caspase-14 gene product. By way of example, the disruption through homologous recombination may generate a knockout mutation in the caspase-14 gene, particularly a knockout mutation wherein at least one deletion has been introduced into at least one exon of the caspase-14 gene. In a preferred embodiment of the present invention, the knockout mutation is generated in a coding exon of the caspase-14 gene. Additionally a disruption in the caspase-14 gene may result from insertion of a heterologous selectable marker gene into the endogenous caspase-14 gene. As used herein, the term "selectable marker gene" refers to a gene encoding an enzyme that confers upon the cell or organism in which it is expressed a resistance to a drug or antibiotic, such that expression or activity of the marker can be selected for (e.g., a positive marker, such as the neo gene) or against (e.g., a negative marker, such as the dt gene). As further used herein, the term "heterologous selectable marker gene" refers to a selectable marker gene that, through experimental manipulation, has been inserted into the genome of an animal in which it would not normally be found. As used herein, the term "caspase-14 targeting vector" refers to an oligonucleotide sequence that comprises a portion, or all, of the caspase-14 gene, and is sufficient to permit homologous recombination of the targeting vector into at least one allele of the endogenous caspase-14 gene within the recipient cell. In one embodiment of the present invention, the targeting vector further comprises a positive or negative heterologous selectable marker gene (e.g., the positive selection gene, neo). Preferably, the targeting vector may be a replacement vector (i.e., the selectable marker gene replaces an endogenous target gene). Such a disruption is referred to herein as a "null" or "knockout" mutation. In a particular embodiment the caspase- 14 targeting vector comprises recombination sites (e.g. loxP sites or FRT sites) which do not interrupt the coding region of the caspase-14 gene. The caspase-14 targeting vector of the present invention may be introduced into the recipient cell by any in vivo or ex vivo means suitable for gene transfer, including, without limitation, electroporation, DEAE Dextran transfection, calcium phosphate transfection, lipofection, monocationic liposome fusion, polycationic liposome fusion, protoplast fusion, creation of an in vivo electrical field, DNA- coated microprojectile bombardment, injection with recombinant replication-defective viruses, homologous recombination, viral vectors, and naked DNA transfer, or any combination thereof. Recombinant viral vectors suitable for gene transfer include, but are not limited to, vectors derived from the genomes of viruses such as retrovirus, HSV, adenovirus, adeno-associated virus, Semiliki Forest virus, cytomegalovirus, and vaccinia virus. In accordance with the methods of the present invention, the treated recipient cell then may be introduced into a blastocyst of a non-human animal of the same species (e.g., by injection or microinjection into the blastocoel cavity), to produce a treated blastocyst. Thereafter, the treated blastocyst may be introduced (e.g., by transplantation) into a pseudopregnant non-human animal of the same species, for expression and subsequent germline transmission to progeny. For example, the treated blastocyst may be allowed to develop to term, thereby permitting the pseudopregnant animal to deliver progeny comprising the homologously recombined vector, wherein the progeny may exhibit decreased expression of caspase-14 relative to corresponding wild-type animals of the same species. It then may be possible to identify a transgenic non-human animal whose genome comprises a disruption in its endogenous caspase-14 gene. The identified transgenic animal then may be interbred with other founder transgenic animals, to produce heterozygous or homozygous non-human animals exhibiting decreased expression of functional caspase-14 protein relative to corresponding wild-type animals of the same species. A type of recipient cell for transgene introduction is the embryonal stem cell (ES). ES cells may be obtained from pre-implantation embryos cultured in vitro. Transgenes can be efficiently introduced into the ES cells by standard techniques such as DNA transfection or by retrovirus- mediated transduction. The resultant transformed ES cells can thereafter be combined with blastocysts from a non-human animal. The introduced ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal. As used herein, a "targeted gene" or "knock-out" is a DNA sequence introduced into the germline or a non-human animal by way of human intervention, including but not limited to, the methods described herein. The targeted genes of the invention include DNA sequences which are designed to specifically alter cognate endogenous alleles. In order to produce the gene constructs used in the invention, recombinant DNA and cloning methods, which are well known to those skilled in the art, may be utilized (see Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, NY). In this regard, appropriate caspase-14 coding sequences may be generated from genomic clones using restriction enzyme sites that are conveniently located at the relevant positions within the caspase-14 sequence. Alternatively, or in conjunction with the method above, site directed mutagenesis techniques involving, for example, either the use of vectors such as M13 or phagemids, which are capable of producing single stranded circular DNA molecules, in conjunction with synthetic oligonucleotides and specific strains of Escherichia coli (E. coli) (Kunkel, T. A. et al., 1987, Meth. Enzymol. 154:367- 382) or the use of synthetic oligonucleotides and PCR (polymerase chain reaction) (Ho et al., 1989, Gene 77:51-59; Kamman, M. et al., 1989, Nucl. Acids Res. 17:5404) may be utilized to generate the necessary caspase-14 nucleotide coding sequences. Appropriate caspase-14- sequences may then be isolated, cloned, and used directly to produce transgenic animals. The sequences may also be used to engineer the chimeric gene constructs that utilize regulatory sequences other than the caspase-14 promoter, again using the techniques described here. These chimeric gene constructs can then also be used in the production of transgenic animals. In a particular embodiment a non-human, transgenic animal comprising a targeting vector which further comprises recombination sites (e.g. Lox sites, FRT sites) can be crossed with a non-human, transgenic animal comprising a recombinase (e.g. Cre recombinase, FLP recombinase) under control of a particular promoter. It has been shown that these site-specific recombination systems, although of microbial origin for the majority, function in higher eukaryotes, such as plants, insects and mice. Among the site-specific recombination systems commonly used, there may be mentioned the Cre/Lox and FLP/FRT systems. The strategy normally used consists in inserting the loxP (or FRT) sites into the chromosomes of ES cells by homologous recombination, or by conventional transgenesis, and then in delivering Cre (or FLP) for the latter to catalyze the recombination reaction. The recombination between the two loxP (or FRT) sites may be obtained in ES cells or in fertilized eggs by transient expression of Cre or using a Cre transgenic mouse. Such a strategy of somatic mutagenesis allows a spatial control of the recombination, because the expression of the recombinase is controlled by a promoter specific for a given tissue or for a given cell. A second strategy consists in controlling the expression of recombinases over time so as to allow temporal control of somatic recombination. To do this, the expression of the recombinases is controlled by inducible promoters such as the interferon-inducible promoter, for example.

The coupling of the tetracycline-inducible expression system with the site-specific recombinase system described in WO 94 04672 has made it possible to develop a system for somatic modification of the genome which is controlled spatiotemporally. Such a system is based on the activation or repression, by tetracycline, of the promoter controlling the expression of the recombinase gene. It has been possible to envisage a new strategy following the development of chimeric recombinases selectively activated by the natural ligand for the estrogen receptor. Indeed, the observation that the activity of numerous proteins, including at least two enzymes (the tyrosine kinases c-abl and src) is controlled by estrogens, when the latter is linked to the ligand-binding domain (LBD) of the estrogen receptor alpha (ER. alpha.) has made it possible to develop strategies for spatiotemporally controlled site-specific recombination. The feasibility of the site-specific somatic recombination activated by an antiestrogenic ligand has thus been demonstrated for "reporter" DNA sequences, in mice, and in particular in various transgenic mouse lines which express the fusion protein Cre-ER^T activated by Tamoxifen. The feasibility of the site-specific recombination activated by a ligand for a gene present in its natural chromatin environment has been demonstrated in mice.

Initial screening of the transgenic animals may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques which include but are not limited to Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of for example skin may be evaluated immunocytochemically using antibodies specific for caspase-14.

In another embodiment the transgenic, non-human animal of the present invention can be used for the testing of compounds for parakeratosis disorders, and more specifically for the testing of compounds for psoriatic skin diseases (e.g. psoriasis). Drug screening assays in general suitable for use with transgenic animals are known. Thus, the transgenic animals may be used as a model system for human parakeratosis disorders and/or to generate cell lines (e.g. keratinocytes) that can be used as cell culture models for these disorders. The transgenic animal model systems for parakeratosis disorders may be used as a test substrate to identify drugs, pharmaceuticals, therapies and interventions which may be effective in treating such disorders. The response of the animals to the treatment may be monitored by assessing the reversal of one or more symptoms associated with parakeratosis disorders. Dosages of test agents may be determined by deriving dose-response curves.

It is apparent that many modifications and variations of this invention as set forth here may be made without departing from the spirit and scope thereof. The specific embodiments described below are given by way of example only and the invention is limited only by the terms of the appended claims.

Examples

1. Generation of caspase-14 deficient mice

The formation of corneocytes is a specialized form of cell death that does not involve the

2,7 classical apoptotic caspases . To analyze the role of caspase-14 during terminal keratinocyte differentiation, we generated caspase-14 deficient mice by homologous recombination. We used a targeting vector to replace exons 3 and 4, containing the active catalytic site (QACRG

+/- box), with a neomycin-resistance cassette (Figure 1 ). Heterozygous caspase-14 mice were

+/+ -/- intercrossed to obtain homozygous caspase-14 and caspase-14 mice. Homozygosity for the mutant caspase-14 gene was confirmed by means of Southern blotting, and the complete lack of caspase-14 protein by western blotting. In wild-type mice about 50% of caspase-14 is activated during epidermal differentiation, as shown by the presence of the typical p20 en p10 subunits, which indicate proteolytic activation of caspase-14. Using a positional scanning substrate library exploring preferences in S2, S3 and S4 subsites, it was determined that

8 caspase-14 preferentially cleaves the WEHD tetrapeptide motif , a preference also expressed

9 by caspase-1 . In accordance, epidermal extracts from caspase-14 deficient mice, in contrast to wild-type mice, did not reveal WEHD-amc cleavage activity. This indicates that in homeostatic conditions all detectable proteolytic activity on WEHD in the epidermis is due to caspase-14. The expression levels of apoptotic executioner caspases, such as caspase-3 and -7, was not affected. In contrast to caspase-14, caspases 3 and 7 remained unprocessed during terminal keratinocyte differentiation, also indicated by the absence of DEVDase activity in the epidermis, confirming that the apoptotic proteolytic cascade is not activated during

10 homeostatic programmed cell death in the epidermis . Extensive immunohistochemical analysis of different tissues confirmed that caspase-14 is expressed only in cornifying epithelia, such as the epidermis and Hassall's bodies. In addition, we found that caspase-14 was also expressed in the forestomach, which is cornified in rodents. Caspase-14 expression was

--//-- aabbllaatteedd iinn aallll tthheessee ttiissssuueess iinn ccaassppaassee1144 mice. However, we observed no gross histological abnormalities in caspase-14 deficient mice.

2. Characterisation of caspase-14 deficient mice

-/-

Caspase-14 mice were born in the expected Mendelian ratio, they were fertile, and their long- term survival was indistinguishable from that of wild-type mice (up to 20 months). The skin of

-/- newborn caspase-14 mice was shinier and more lichenied than that of wild-type mice.

Lichenification is characterized by more pronounced skin lines. This phenotype became more prominent from day 2-3 and lasted throughout adulthood. Both wild-type and caspase-14

-/- deficient mice showed normal hair growth from day 7, and caspase-14 mice did not suffer from abnormal hair loss during hair cycling. Histological analysis by light microscopic examination of haematoxilin-eosin stainings of paraffin sections of newborn and adult caspase- 14 deficient epidermis revealed no abnormalities in the formation of the stratum basale, stratum spinosum, stratum granulosum or hair follicles compared to the wild-type. The stratum

1,3,4 corneum, where caspase-14 is proteolytically activated , also showed no histological abnormalities. To determine whether ablation of caspase-14 caused any defects in expression of different early and late differentiation markers, we performed immunohistochemical analysis on epidermal, thymus and forestomach sections. The distribution and expression level of differentiation markers, both early (K5, K14) and late (K1 , K10, loricrin, involucrin and filaggrin), was not different in the two genotypes. This could be expected because caspase-14 gets activated only during cornification, and differences between wild-type and caspase-14 deficient epidermis are expected mainly in the cornified layers. Indeed, scanning microscopic analysis

-/- indicated the presence of significantly larger scales in caspase-14 mice compared to

+/+ caspase-14 animals, indicating that caspase-14 is at least partially involved in the desquamation process. This agrees with the observation that some caspase-14 protein was

11 found associated with corneodesmosomes . The ultrastructure of hair shafts, examined at higher magnifications, was similar in wild-type and caspase-14 deficient mice. In addition,

-/- when we compared wild-type and caspase-14 epidermis using transmission electron microscopy, it became obvious that a significantly higher fraction (-75%) of alveolar or swollen keratohyalin F-granules was present in the transition layer of caspase-14 deficient epidermis than in wild-type epidermis (-8%). These swollen F-granules are characterized by a mottled appearance the biochemical nature of which is not known. Such structures were reported

12 earlier, e.g. in transglutaminase-1 deficient mice . F-granules are stores of profilaggrin, a major epidermal histidine-rich protein. Profilaggrin (-500 kDa) consists of tandem repeats of filaggrin and is processed into mature filaggrin units that assist the formation of macrofibril

13 keratin bundles during keratinocyte terminal differentiation . Later, these monomers are degraded to free amino acids to contribute to the so-called natural moisturising factors to

14 -/- maintain epidermal hydration . Based on the occurrence of altered F-granules in caspase-14 epidermis, we compared the profilaggrin processing pattern in wild-type and caspase-14 deficient mice. We observed in western blots that the 31-kDa filaggrin monomer band was

+/+ -/- equally well formed in both caspase14 and caspase-14 epidermis, but in contrast to wild- type tissue, an accumulation of filaggrin fragments ranging from 15 to 25 kDa was detected in caspase-14 deficient epidermis. These fragments are derived from filaggrin monomer regions since the antibody used in this study was raised against a peptide present in the functional filaggrin unit. In addition, we identified 6 times more peptide spectra derived from the filaggrin

-/- unit in caspase-14 epidermal extracts compared to wild-type extracts in the 1525 kDa range of an SDS gel using mass spectrometry analysis. This finding confirmed the nature of the accumulating filaggrin fragments observed in the western blot experiment. A similar aberration in filaggrin processing was observed in the epithelium of the forestomach, indicating that absence of caspase-14 causes this phenotype even in other tissue than epidermis. As filaggrin is an important component of the cornified envelopes (CE), an insoluble and complex protein structure that replaces the plasma membrane in corneocytes, and caspase-14 was found co-

11 localized with the F-granules , we isolated CE from newborn mice to examine their shape and morphology. The CEs prepared from caspase-14 deficient skin did not differ in shape or size from wild-type when examined by phase contrast microscopy. Genetic studies recently

15 established that filaggrin plays an important role in epidermal barrier formation . In addition, caspase-14 is proteolytically activated during embryonic development from day E16.5-17.5 on, which coincides with stratum corneum formation, profilaggrin processing, and the formation of

16,17 a functional barrier . To evaluate whether epidermal barrier formation was affected during embryonic development in caspase-14 deficient mice, we performed an in situ toluidin blue penetration assay. This assay evaluates differences in the outside-in epidermal barrier. The formation of the skin barrier was essentially the same in wild-type and caspase-14 knock-out embryos, i.e. on day E16.5 the barrier starts to form at the dorsal part and spreads around the embryo to the ventral part. It was clear that formation of the barrier on the dorsal side was not

17 uniform for all embryos on day E16.5. This has also been observed by others . On day E17.5

-/- the embryonic skin barrier was completely formed in wild-type as well as in caspase-14 embryos. Because after birth the cornified layer acts as a physical inside-out water barrier, we measured epidermal hydration and transepidermal water loss (TEWL) to see whether the water barrier was affected in caspase-14 deficient mice. The stratum corneum hydration level was consistently about 20% lower in newborn and adult caspase-14 deficient mice. Consequently, TEWL was -20% higher in caspase-14 deficient mice. These findings demonstrate that the specialized type of cell death process leading to formation of corneocytes

-/- that seal the body has been affected in caspase-14 mice, resulting in a less efficient skin barrier. Lower hydration levels could be explained by incomplete degradation of filaggrin

-/- fragments in caspase-14 mice, because profilaggrin degradation generates the free amino acids that act as natural moisturising factors involved in the hydration of the stratum

18 corneum .

3. Caspase-14 protects against UV-damage

One of the most important functions of the skin is to provide protection against environmental stress, of which protection against UVB is of major importance. UVB induces direct DNA damage by causing formation of cyclobutane pyrimidine dimers (CPDs). This DNA damage is

19 a crucial trigger for UVB-induced apoptosis . To examine the role of caspase-14 in this protective function of the skin barrier, the back skin of newborn wild-type and knock-out mice

2 2 was irradiated with 250 mJ/cm or 750 mJ/cm of UVB and compared with non-irradiated mice. Irradiated and control mouse skins were examined 24 h after exposure to UVB for the presence of sunburn cells. Intriguingly, haematoxylin-eosin stained sections of caspase-14

2 deficient skin displayed significantly more epidermal damage at the 250 mJ/cm dose than wild-type skin, and even a massive ballooning of cells in the stratum spinosum and

2 granulosum at the 750 mJ/cm UVB dose. Accordingly, caspase-14 deficient skin had a large number of sunburn cells with pyknotic nuclei. In order to see if these swollen cells with pyknotic nuclei displayed other typical features of apoptosis, we determined the number of active caspase-3 positive and TUNEL-positive cells. Active caspase-3 positive cells were identified using an antibody recognizing the active cleaved form of caspase-3. As shown in figures 4b and c, UVB-irradiated epidermis from caspase-14 deficient mice contains at least 2 to 3 times more active caspase-3 positive cells than wild-type epidermis. Immunofluorescence analysis clearly showed that these sunburn cells were also TUNEL-positive, demonstrating internucleosomal DNA fragmentation, a hallmark of apoptosis. Quantification of the epidermal TUNEL-positive cells indicated that, similar to the active-caspase-3 positive cells, more

-/- +/+

TUNEL-positive cells were present in caspase-14 than in caspase-14 epidermis. These experiments were done in neonatal mice (5.5 days after birth) and confirmed in adult mice (Fig.

2), indicating the persistence of the observed phenotype. These results demonstrate that caspase-14 is involved in the biochemical processes that are required to protect the skin against UVB induced apoptosis. There are two possibilities why the epidermis of caspase-14 deficient mice is more sensitive to apoptosis induced by UVB. First, keratinocytes of caspase- 14 deficient mice may be more sensitive to UVB-induced apoptosis. Second, in view of the

-/- observed alterations in the terminal differentiation program of keratinocytes in caspase-14 epidermis, the UVB scavenging capacity of the stratum corneum may be diminished. To distinguish between the two possibilities, we compared the UVB sensitivity of freshly prepared

-/- keratinocytes derived from caspase-14 and wild-type mice, and found that they showed a similar apoptotic response to UVB irradiation. This shows that the intrinsic ability of keratinocytes to resist UVB damage has not been altered by caspase-14 deficiency. In these experiments we used UVB doses lower than those used in vivo, because maximal apoptosis of

2 isolated keratinocytes occurred at 200 mJ/cm . To explore the second possibility, we reasoned

-/- that if the UVB filtering capacity of the stratum corneum is reduced in caspase-14 mice, more cyclobutane pyrimidine dimers (CPDs) would be expected immediately after UVB irradiation.

Therefore, we stained skin sections with an antibody specifically recognizing CPDs. We

+/+ observed almost no CPD staining 15 min after irradiation when caspase-14 mice were

2 2 irradiated with 250 mJ/cm , and only a minor CPD staining when 750 mJ/cm was used. This

-/- UVB-induced DNA damage was completely repaired after 24 h. In contrast, when caspase-14 mice were irradiated with similar doses, a very strong CPD staining was observed throughout the epidermis immediately after irradiation (15 min), and lasted at least 24 h after irradiation.

These CPD-positive cells eventually undergo apoptosis, corresponding with the increased

-/- number of apoptotic cells detected in caspase-14 epidermis after UVB irradiation. We

-/- confirmed this increased DNA damage in caspase-14 epidermis by south-western dot-blot experiments using the same anti-CPD antibody. Because the increase in CPD staining was observed immediately after UVB irradiation (15 min), these results indicate that the UVB-

-/- filtering capacity of caspase-14 epidermis has decreased dramatically. To test this

+/+ -/ hypothesis, caspase-14 and caspase-14 mice were tape-stripped to remove the stratum

+/+ corneum and subsequently irradiated with UVB. Tape-stripped epidermis of caspase-14 mice

-/- became at least as sensitive to UVB irradiation as non-tape-stripped caspase-14 mice. In contrast, removal of the stratum corneum in caspase-14 deficient mice did only mildly affect the CPD levels after UVB irradiation. These findings confirm that the difference in UVB sensitivity is not due to intrinsic alterations in the keratinocytes and reveals that the UVB

-/- scavenging capacity of the stratum corneum is strongly affected in caspase-14 mice. 4. Use of a composition comprising caspase-14 to prevent and/or to treat sunburn

Human reversed caspase-14 (= enzymatically active) is encapsulated in liposomes and applied to the epidermis. This is done directly on the skin and on tape-stripped skin to enhance liposome penetration. PULSin™ (Polyplus Transfection, San Marcos, USA) is a potent reagent for protein delivery to the cytoplasm of eukaryotic cells, including keratinocytes. Also carbopol containing gels or other liposome formulations have been shown to be able to deliver proteins to the epidermis (Felipe P et al (1999) MoI Med 5, 517-525 & Wolf P et al (2000) J Invest Dermatol 114, 149-156). As a proof of concept, caspase-14 deficient mice are treated and the caspase-14 protein occurrence in the epidermis is determined by means of immunohistochemistry, western blotting and measuring its enzymatic activity. Then UVB irradiation is applied to these mice and the UVB-induced damage is analysed. DNA damage is analysed immediately after irradiation by immunohistochemistry using a CPD (cyclobutane pyrimidine dimer) -specific antibody. In addition, the occurrence of apoptotic sunburn cells is analysed using histological analysis, TUNEL-assay and immunohistochemistry with an anti- active caspase-3 antibody. In a next step wild type mice are treated with the composition comprising caspase-14 and the effect of the protection to sunburn is evaluated. Also sunburned wild type mice are treated with compositions comprising caspase-14 (and with mock compositions without caspase-14) to evaluate the aftersun effect on the skin.

5. Caspase-14 -/- mice are more prone towards the induction of parakeratosis upon application of barrier disrupting treatments or topical application of imiquimod.

It is well known that topical imiquimod treatment of mice or men results in psoriasiform changes such as infiltration of plasmacytoid dendritic cell precursors in the dermis, keratinocyte hyperproliferation and parakeratosis (Gilliet et al., 2004; Palamara et al., 2004; Wu et al., 2004). In addition, repeated skin barrier disruption can also lead to psoriasiform skin disease (Denda et al., 1998; Denda et al., 1996). We challenged caspase-14 wild-type and caspase-14 deficient mice with these different models. The imiquimod model: The compound imiquimod (1-(2-methylpropyl)-1 H-imidazo[4,5]quinoline-4-amine) is a proprietary molecule of 3M Pharmaceuticals (St. Paul, MN), and the structure of this molecule has been described previously (Tomai et al., 1995). Caspase-14 deficient mice were shaved at their backs two to three days before the start of the treatment. Female mice (4 mice in each group) were used between 8-12 weeks of age. 5 % imiquimod cream formulation (Aldara™) was applied once daily on the shaved back of the mice for 6 to 8 consecutive days. Each mouse received a total dose of 3,125 mg imiquimod per day. As a negative control the shaved back was either left untreated or treated with a control cream. At the end of the treatment mice were killed by cervical dislocation and skin tissue was harvested for further processing. Paraffin embedded skin was sliced and scored for epidermal thickness (cfr hyperproliferation) and parakeratosis. There was no difference in the epidermal thickness between Aldara-treated caspase-14+/+ and caspase-14-/- mice. However there was a marked increase in the number of large parakeratotic plaques in caspase-14-/- mice as compared to wild-type mice (see fig. 3).

The Denda models (Denda et al., 1996):

1 ) acetone treatment induced hyperplasia in caspase-14 deficient mice.

Caspase-14 deficient mice were shaved at their backs two to three days before the start of the treatment. Female mice were used between 8-12 weeks of age. The shaved back of the mice were treated 4 times with fresh acetone-soaked cotton tissues. This procedure induced mild disruption of the epidermal barrier (TEWL levels of approximately 15 g/cm² per h) and was applied twice daily (morning and evening) for 7-8 days. Control mice were either left untreated or treated with 0,9 % NaCI solution soaked cotton tissues. At the end of the treatment mice were killed by cervical dislocation and tissue was harvested for further processing in a similar way as described for the imiquimod model. The number of large parakeratotic plaques was determined.

2) tape strip induced hyperplasia in caspase-14 deficient mice.

Caspase-14 deficient mice were shaved at their backs two to three days before the start of the treatment. Female mice were used between 8-12 weeks of age. The shaved back of the mice were tape stripped twice with Scotch tape (3M, St. Paul, MN). This procedure induced mild disruption of the barrier (TEWL levels of approximately 15 g/cm² per h) and was applied twice daily (morning and evening) for 7-8 days. Control mice were left untreated. At the end of the treatment mice were killed by cervical dislocation and tissue was harvested for further processing in a similar way as described for the imiquimod model.

Both Denda models resulted in a higher number of large parakeratotic plaques in caspase-14- /- mice as compared to caspase-14+/+ mice (see fig 4 and 5).

Taken together, our data show that caspase-14 deficient mice are more prone to the development of parakeratosis and we conclude that these mice are a dermatological model for skin diseases in which parakeratosis is involved.

METHODS

-/- 1. Generation of caspase-14 mice 129/SvEv embryonic stem cells were electroporated with 25 μg targeting vector linearised with

21

BstEII , and cultured in TX-WES cell culture medium (Thromb-X N.V., Leuven, Belgium). Cells were kept on neomycin resistant, mitomycin C inactivated feeder cells at 39°C, and subjected to positive/negative selection with 150 μg/ml G418 (Invitrogen Corp.) and 2 μM gancyclovir (Sigma-Aldrich, St. Louis, MO, USA), respectively. Correctly targeted ES cells were identified by Southern-blot screening of EcoRV-digested genomic DNA using a radioactively labelled 3' probe, injected into host Swiss Webster blastocysts, and reimplanted in pseudopregnant Swiss Webster females (Taconic, Germantown, NY, USA). Resulting chimeric animals were mated to Swiss Webster mice to generate heterozygous germline offspring, which were intercrossed to obtain caspase-14-/- mice. This work was approved by the local ethics committee.

2. Western blotting We isolated epidermis of 5.5 day old neonates and stomach of 10 day old mice. Skin was incubated in PBS with 10 mM EDTA at 56° C for 10 min, after which the epidermis was mechanically separated from the dermis. The stomach was washed in PBS. Isolated epidermis or stomach was lysed in NP-40 buffer (10 mM Tris-HCI - pH7, 200 mM NaCI, 5 mM EDTA, 10% glycerol, 1% NP-40, 100 nM PMSF, 0.15 nM aprotinin, 2.1 nM leupeptin) and subjected to 10 freeze-thaw cycles in liquid nitrogen. The samples were centrifuged and 20 μg protein was loaded on gel and transferred to a nitrocellulose membrane. The membranes were incubated with primary antibodies and appropriate HRP labelled secondary antibodies (Amersham).

TM

Detection was done with the Western Lightning chemiluminescence reagent plus kit (PerkinElmer).

3. Caspase activity assay

Epidermal extracts from wild-type and knock-out mice were prepared in grinding buffer without NP40 and tested for caspase activity by incubating 50 μg of extract in caspase-14 assay buffer (10 mM Pipes pH 7.5, 10 % sucrose, 100 mM NaCI, 1.3 M sodium citrate, 0.1 mM EDTA, 10 mM DTT) and 50 μM WEHD-amc or DEVD-amc (Peptide Institute, Inc., Japan). Fluorescence was monitored for 50 min with a Cytofluor Multiwell Reader series 4000 at 37 ⁰C (Perseptive Biosystems, Cambridge, MA).

4. Antibodies

2 Primary antibodies used were directed against: mouse caspase-3 and -14 , mouse Keratin 1 (K1 ), K5, K10, filaggrin, loricrin and involucrin (all Covance), active caspase-3 (Bio-Connect) and cyclobutane pyrimidine dimers (CPD) (Kamiya Biomedical Company).

5. Histological and immunohistochemical analysis Tissues were fixed for 2 h in 4% paraformaldehyde and embedded in paraffin. Sections of 5 μm were stained with haematoxylin-eosin or processed for immunohistochemical analysis. Primary antibodies were detected with the appropriate Dako EnVision System, HRP (DAB) kit. 6. Electron microscopy

For scanning electron microscopy the back skins of 4.5-day old neonates were fixed in Karnovsky buffer for 2 days at 4°C and rinsed twice in Na-cacodylate buffer. The fixed tissues were dehydrated in graded ethanol solutions (25%, 35%, 50%, 75%, 85%, 95%, 100%). The dehydrated skins were rinsed 3x with liquid CO2, critical point dried, mounted on stubs with glue (Pattex, Henkel, Germany) and coated with gold. They were examined with a Jeol JSM- 840 scanning electron microscope. For transmission electron microscopy, skin biopsies were

22 taken from the back and treated as described . Postfixation was done in 1% OsO4 Na- cacodylate buffer containing K3Fe(CN)6 at 4°C for 12 h. Ultrathin sections were stained with uranyl acetate and lead citrate and examined with a Jeol 1200 EXII electron microscope at 80 kV.

7. UVB irradiation

The UVB irradiation source was equipped with TL20W/12RS Philips UV lamps (peak emission at 310 nm). A plastic lid was used to block UVC emission. The UVB dose was monitored with an IL1700 radiometer equipped with a SED005/TLS312/W detector (International Light). The backs of wild-type and caspase-14 deficient mice were irradiated at a dose rate of 0.7

2 mJ/cm /sec.

8. TUNEL assay

TUNEL assay was performed on 5 μm paraffin sections from skin with the in situ cell death detection kit, TMR red (Roche), according to the manufacturers instructions. The stained sections were mounted with Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA).

9. Southwestern dot blot analysis

Epidermis was isolated as described for western blotting. Genomic DNA was isolated from epidermis and 0.5 μg was used for southwestern dot blot analysis using the anti-CPD antibody,

23 as described .

10. Isolation of primary newborn keratinocytes

Primary keratinocytes were isolated essentially as described24. Whole skin of 3.5 day old mice was floated on 2.5 U/ml Dispase Il (Roche) in defined keratinocyte-SFM (K-SFM, Gibco) overnight at 4^°C. The epidermis was separated form the dermis, 5x trypsin/EDTA solution was added and incubated for 10' at 37^°C. Cells were grown in complete K-SFM (K-SFM supplemented with keratinocyte growth supplement (Gibco, 10784-015), lnsuline - Hydrocortisone - hEGF (Clonetics), 1 ng/ml Cholera toxin (Sigma,), Gentamycine (50 μg/ml), 100 μg/ml Penicilin/Streptomycin and 10% LPS-free FCS) in a humified incubator at 34^°C with 7,5 % CO2. Next day cells were refreshed with complete K-SFM without FCS.

1 1. Cloning, expression and purification of human procaspase-14 Human procaspase-14 was cloned into the IPTG-inducible pLHX32 vector (N. Mertens, Department for Molecular Biomedical Research, Technologiepark 927, 9052 Gent-Zwijnaarde), which is suited for the expression of N-terminal His-tagged proteins in E.coli. The complete human procaspase-14 sequence was PCR amplified and cloned in frame with the N-terminal His-tag to generate the pLHX32hC14 expression vector. pLHX32hC14 was transformed to E. coli MC1061A plCA2 and protein expression was induced by growing the cells overnight in the presence of 1 mM IPTG. Then, bacteria were lysed by means of French press. French press lysates were cleared by centrifugation and the sample was loaded on a DEAE-anion exchange column in the presence of 20 mM Tris-HCI (pH 7.5), 10 % glycerol, 1 mM glutathion and 300 mM NaCI to remove the DNA. 5 mM imidazol was added to the run-through fraction of the previous column and this material was applied to a Ni-NTA column. To reduce aspecific sticking of proteins to the Ni-NTA column, the column was washed with 20 mM Tris-HCI (pH 7.5), 10 % glycerol, 1 mM glutathion, 250 mM NaCI en 15 mM imidazol. Subsequently, caspase-14 was eluted from the Ni-NTA column with 20 mM Tris-HCI (pH 7.5), 10 % glycerol, 1 mM glutathion, 50 mM NaCI and 100 mM imidazol. Caspase-14 containing fractions were pooled, 0.1 % CHAPS was added and the preparation was incubated for 3 hours at 4⁰C. This material was loaded on a Source Q column in 20 mM Tris-HCI (pH 8.0), 10 % glycerol, 1 mM glutathion, 50 mM NaCI and 0.1 % CHAPS. Proteins were eluted with a saltgradient from 50 mM to 500 mM NaCI. Using Coomassie staining the procaspase-14 fractions were identified.

12. Cloning, expression and purification of human reverse caspase-14

By means of PCR-based cloning the human caspase-14 p10 subunit sequences starting at E147 were fused amino-terminally to a Met startcodon. Between the end of the p10 subunit sequences (Q242) and that start of the p20 subunit at M1 a DEVDG linker was inserted (see figure 6). These sequences were cloned in fusion with the N-terminal His-tag into the pLHX32 vector. Reverse caspase-14 was expressed and purified according to the protocols described above for procaspase-14. The enzymatic activity of human, reverse caspase-14 was tested in a fluorogenic enzymatic activity test. Using peptide libraries it was determined previously that caspase-14 has a preference for the WEHD peptide (Mikolajczyk J et al (2004) Biochemistry 43, 10560-10569). However, to be able to measure caspase-14 activity in aqueous solutions it was required to add kosmotropic salts such as 1.3 M sodiumcitrate (Mikolajczyk J et al (2004)

Biochemistry 43, 10560-10569). These conditions probably mimic the semi-dry conditions that are present in the epidermal stratum corneum, where caspase-14 is expressed and activated. To analyze whether reverse caspase-14 has a similar substrate preference as normally processed procaspase-14 as occurring in skin, we generated enzymatically active caspase-14 by processing procaspase-14 with a epidermal lysate that contains caspase-14-activating protease activity. We determined previously that this caspase-14-activating protease cleaved recombinant procaspase-14 in a way similar as observed in endogenous skin (Chien AJ et al (2002) Biochem Biophys Res Commun 296, 91 1-917). Both processed and reverse caspase- 14 were tested on different peptide substrates such as WEHD, DEVD, IETD, YVAD, LEHD. Our data indicate that human, reverse caspase-14 has a similar substrate preference than proteolytically processed caspase-14. Both caspase-14 preparations showed a preference for WEHD-amc. In addition, we also observed that human, reverse caspase-14, as proteolytically processed caspase-14, can be efficiently inhibited by the pan-caspase inhibitor zVADfmk.

13. Cloning, expression, purification and denaturation/refolding of the caspase-14 p20 and p10 subunits.

By means of PCR-based cloning the human caspase-14 p20 (Met1-lle152) and p10 (Lys153- end) subunit sequences were fused amino-terminally to a Met startcodon or carboxy-terminally to a translational stop codon where appropriate. These sequences were cloned in the IPTG- inducible pLT32 bacterial expression vector (N. Mertens, VIB-Department for Molecular Biomedical Research, Technologiepark 927, 9052 Gent-Zwijnaarde). The pLT32hC14p20wt or the pLT32hC14p10 vectors were transformed to E. coli MC1061A plCA2 and protein expression was induced by growing the cells overnight at 28 ⁰C in the presence of 1 mM IPTG. Then, bacteria were lysed by means of French press in 50 mM Tris HCL pH 8.0, 100 mM NaCI, 5 mM EDTA and 1 mM PMSF. French press lysates containing inclusion bodies with human caspase-14 p20 or p10 subunits were pelleted by centrifugation. Inclusion bodies were washed several times with washbuffer 1 (50 mM Tris HCL pH 8.0, 100 mM NaCI, 5 mM EDTA, 1 mM PMSF and 0.1 % Triton-X100) and finally once washed with washbuffer 2 (50 mM Tris HCL pH 8.0, 100 mM NaCI). Next, the inclusion bodies where denaturated in 5OmM Tris pH8.0; 10OmM NaCI; 6M guanidine HCI; 1OmM beta-mercapto-ethanol. Equimolar amounts of the p20 and p10 human caspase-14 subunits were mixed in refolding buffer (10OmM Hepes pH7.5; 20% sucrose; 1 OmM DTT). This material has enzymatic activity in the presence of kosmotropic salts (KZ) and has retained the native caspase-14 peptide-substrate preference for WEHD-amc. The substrate specificity of the different forms of recombinant caspase-14 (refolded human p20/p10 caspase-14, reversed human caspase-14 or cleaved caspase-14 (= recombinant procaspase-14 that was cleaved at Ile152 by treatment with a partially purified epidermal extract) were similar (preference for WEHD-amc and no specificity for DEVD-amc). References

1. Eckhart, L. et al. Terminal differentiation of human keratinocytes and stratum corneum formation is associated with caspase-14 activation. J Invest Dermatol 115, 1148-51 (2000).

2. Lippens, S. et al. Epidermal differentiation does not involve the pro-apoptotic executioner caspases, but is associated with caspase-14 induction and processing. Cell Death Differ 7,

1218-24 (2000).

3. Lippens, S. et al. Vitamin D3 induces caspase-14 expression in psoriatic lesions and enhances caspase-14 processing in organotypic skin cultures. Am J Pathol 165, 833-41 (2004). 4. Fischer, H. et al. Stratum corneum-derived caspase-14 is catalytically active. FEBS Lett 577, 446-50 (2004).

5. Candi, E., Schmidt, R. & Melino, G. The cornified envelope: a model of cell death in the skin. Nat Rev MoI Cell Biol 6, 328-40 (2005).

6. Lippens, S., Denecker, G., Ovaere, P., Vandenabeele, P. & Declercq, W. Death penalty for keratinocytes: apoptosis versus cornification. Cell Death Differ 12 Suppl 2, 1497-508

(2005).

7. Rendl, M. et al. Caspase-14 expression by epidermal keratinocytes is regulated by retinoids in a differentiation-associated manner. J Invest Dermatol 119, 11505 (2002).

8. Mikolajczyk, J., Scott, F. L., Krajewski, S., Sutherlin, D. P. & Salvesen, G. S. Activation and substrate specificity of caspase-14. Biochemistry 43, 10560-9 (2004).

9. Rano, T. A. et al. A combinatorial approach for determining protease specificities: application to interleukin-1 beta converting enzyme (ICE). Chem Biol 4, 149-55 (1997).

10. Lippens, S. et al. Caspase-14 is expressed in the epidermis, the choroid plexus, the retinal pigment epithelium and thymic Hassall's bodies. Cell Death Differ 10, 257-9 (2003). H . AIibardi, L., Dockal, M., Reinisch, C, Tschachler, E. & Eckhart, L. Ultrastructural localization of caspase-14 in human epidermis. J Histochem Cytochem 52, 156174 (2004). 12. Matsuki, M. et al. Defective stratum corneum and early neonatal death in mice lacking the gene for transglutaminase 1 (keratinocyte transglutaminase). Proc Natl Acad Sci U S A 95,

1044-9 (1998). 13. Dale, B. A., Holbrook, K. A. & Steinert, P. M. Assembly of stratum corneum basic protein and keratin filaments in macrofibrils. Nature 276, 729-31 (1978).

14. Rawlings, A. V., Scott, I. R., Harding, C. R. & Bowser, P. A. Stratum corneum moisturization at the molecular level. J Invest Dermatol 103, 731-41 (1994).

15. Palmer, C. N. et al. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis. Nat Genet 38, 441-6 (2006).

16. Fischer, H. et al. Caspase-14 but not caspase-3 is processed during the development of fetal mouse epidermis. Differentiation 73, 406-13 (2005). 17. Hardman, M. J., Sisi, P., Banbury, D. N. & Byrne, C. Patterned acquisition of skin barrier function during development. Development 125, 1541-52 (1998).

18. Scott, I. R. & Harding, C. R. Filaggrin breakdown to water binding compounds during development of the rat stratum corneum is controlled by the water activity of the environment. Dev Biol 1 15, 84-92 (1986).

19. Kulms, D. & Schwarz, T. Molecular mechanisms of UV-induced apoptosis. Photodermatol Photoimmunol Photomed 16, 195-201 (2000).

20. Rawlings, A. V. & Matts, P. J. Stratum corneum moisturization at the molecular level: an update in relation to the dry skin cycle. J Invest Dermatol 124, 1099-110 (2005). 21. Schoonjans, L. et al. Improved generation of germline-competent embryonic stem cell lines from inbred mouse strains. Stem Cells 21 , 90-7 (2003).

22. Krysko, D. V. et al. Macrophages use different internalization mechanisms to clear apoptotic and necrotic cells. Cell Death Differ (2006).

23. Schwarz, A. et al. lnterleukin-12 suppresses ultraviolet radiation-induced apoptosis by inducing DNA repair. Nat Cell Biol 4, 26-31 (2002).

24. Caldelari, R., Suter, M. M., Baumann, D., De Bruin, A. & Muller, E. Long-term culture of murine epidermal keratinocytes. J Invest Dermatol 1 14, 1064-5 (2000).

25. Koch, P. J. et al. Lessons from loricrin-deficient mice: compensatory mechanisms maintaining skin barrier function in the absence of a major cornified envelope protein. J Cell Biol 151 , 389-400 (2000).

26. Denecker, G. et al. Death receptor-induced apoptotic and necrotic cell death: differential role of caspases and mitochondria. Cell Death Differ 8, 829-40 (2001 ).

27. Carmeliet, P. et al. Impaired myocardial angiogenesis and ischemic cardiomyopathy in mice lacking the vascular endothelial growth factor isoforms VEGF164 and VEGF188. Nat Med 5, 495-502 (1999).

28. Denda, M., Sato, J., Tsuchiya, T., Elias, P.M. and Feingold, K.R. (1998) Low humidity stimulates epidermal DNA synthesis and amplifies the hyperproliferative response to barrier disruption: implication for seasonal exacerbations of inflammatory dermatoses. J Invest Dermatol, 111 , 873-878. 29. Denda, M., Wood, L. C, Emami, S., Calhoun, C, Brown, B. E., Elias, P.M. and Feingold, K.R. (1996) The epidermal hyperplasia associated with repeated barrier disruption by acetone treatment or tape stripping cannot be attributed to increased water loss. Arch Dermatol Res, 288, 230-238.

30. Gilliet, M., Conrad, C, Geiges, M., Cozzio, A., Thurlimann, W., Burg, G., Nestle, F. O. and Dummer, R. (2004) Psoriasis triggered by toll-like receptor 7 agonist imiquimod in the presence of dermal plasmacytoid dendritic cell precursors. Arch Dermatol, 140, 1490-1495.

31. Palamara, F., Meindl, S., Holcmann, M., Luhrs, P., Stingl, G. and Sibilia, M. (2004) Identification and characterization of pDC-like cells in normal mouse skin and melanomas treated with imiquimod. J Immunol, 173, 3051-3061. 32. Tomai, M.A., Gibson, SJ. , Imbertson, L. M., Miller, R. L., Myhre, P. E., Reiter, MJ. , Wagner,

T. L., Tamulinas, C. B., Beaurline, J. M., Gerster, J. F. and et al. (1995) lmmunomodulating and antiviral activities of the imidazoquinoline S-28463. Antiviral Res, 28, 253-264. 33. Wu, J. K., Siller, G. and Strutton, G. (2004) Psoriasis induced by topical imiquimod.

Australas J Dermatol, 45, 47-50.

Claims

1. A pharmaceutical composition comprising caspase-14

2. A pharmaceutical composition according to claim 1 wherein caspase-14 is pro- caspase-14.

3. A pharmaceutical composition according to claim 1 wherein caspase-14 is reverse caspase-14.

4. A pharmaceutical composition according to claim 1 wherein caspase-14 is a mixture of catalytic p10 and p20 subunits.

5. A sunscreen composition comprising caspase-14.

6. A sunscreen composition according to claim 5 wherein caspase-14 is pro-caspase-14.

7. A sunscreen composition according to claim 5 wherein caspase-14 is reverse caspase- 14.

8. A sunscreen composition according to claim 5 wherein caspase-14 is a mixture of catalytic p10 and p20 subunits.

9. Use of a pharmaceutical composition according to claims 1-4 for the manufacture of a medicament to treat skin disorders in which parakeratosis is a component.

10. Use of a sunscreen composition according to claims 5-8 for the prevention or reduction of the harmful effects of solar radiation on skin.

1 1. A transgenic, non-human animal characterized by having an endogenous nucleic acid sequence encoding a non-functional caspase-14.

12. Use of a transgenic animal according to claim 1 1 for testing compounds that specifically modulate skin disorders in which parakeratosis is a component.