WO2004083398A2 - Therapeutic uses of hmgn1 and hmgn2 - Google Patents

Abstract

This application discloses methods of modulating integumentary prolifération or development, such as prolifération of the dermis, epidermis, sweat glands, and sebaceous glands, by modulating the level of HMGN1 or HMGN2 activity. For example, integumentary prolifération or development increases in the absence of HMGN1 or HMGN2 activity, while integumentary prolifération or development decreases in the presence of HMGN1 or HMGN2 activity. Methods are also provided for modulating the rate of hair growth cycling. Methods are also provided for increasing repair of DNA-damage, for example regulating sensitivity to UV-induced DNA damage by modulating the level of HMGN1 or HMGN2 activity. For example, increasing HMGN1 activity decreases sensitivity to UV, and thus increases the rate of repair of UV-damaged DNA.

Description

THERAPEUTIC USES OF HMGNl AND HMGN2

CROSS REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Application No. 60/455,728 filed March 17, 2003, herein incorporated by reference in its entirety.

FIELD

This application relates to methods of modulating integumentary growth or development, such as the proliferation of skin and skin structures such as dermis, epidermis, and adnexal structures, modulating the hair growth cycle, and increasing repair of DNA damage, for example regulating sensitivity to UV-induced DNA damage.

BACKGROUND The high mobility group (HMG) chromosomal proteins are divided into three families, with each family having a characteristic functional sequence motif: HMGB (HMG-box motif), HMGN (nucleosomal binding domain), and HMGA (AT-hook motif). The HMGN proteins HMGNl and HMGN2 (formerly known as HMG 14 and HMG17, respectively) bind to nucleosomes, change the architecture of chromatin, and enhance transcription and replication from chromatin templates. Efficient and correct repair of the damage induced in DNA by extracellular and intracellular agents is a key factor in maintaining the fidelity of gene expression and preventing mutations leading to disease or death. Inefficient repair of the major DNA UV lesions, cyclobutane pyrimidine dimers (CPD) and pyrimidine (6-4) pyrimidone photoproducts (6-4PPs), can lead to pathological conditions such as xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy (Bootsma et al, Nucleotide excision repair syndromes: xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. In Vogelstein, B. and Kinzler, K.W. (eds.), Tiie Genetic Basis Of Human Cancer. McGraw-Hill, New York, pp. 211-237, 2002; de Laat et al., Genes Dev, 13:768-85, 1999; Friedberg, Nat. Rev. Cancer, 1:22-33, 2001; van Steeg and Kraemer,. Mol. Med. Today, 5:86-94, 1999).

UN-induced damage in DΝA can be corrected by nucleotide excision repair (ΝER) (Green and Almouzni, EMBO Rep. 3:28-33, 2002; Smerdon and Conconi, Prog. Nucleic Acid Res. Mol. Biol. 62:277-55, 1999; Υlxoma, EMBO J. 18:6585-98, 1999; Ura and Hayes, Eur. J. Biochem. 269:288-93, 2002). Evidence demonstrating a role of the higher order chromatin structure in DΝA repair is lacking. In chromatin, nucleotide excision repair is a complex process involving damage recognition, chromatin remodeling, damage excision, DΝA synthesis, DΝA ligation, and chromatin reassembly (Green and Almouzni, EMBO Rep. 3:28-33, 2002; Thoma, EMBO J. 18: 6585-98, 1999). The various phases of the nucleotide excision repair process involve the function of many components, some of which are organized in large multiprotein complexes.

HMGΝ1 and HMGΝ2 proteins affect the stability of the higher order chromatin structure (Bustin, Mol. Cell. Biol. 19:5237-46, 1999). Binding of HMGN to nucleosomes reduces the compaction of chromatin fibers and enhances transcription from chromatin, but not from deproteinzed DNA. HMGN proteins destabilize the higher order chromatin structure by targeting two main elements known to compact chromatin: histone HI and the amino terminal tail of histone H3 (reviewed in Bustin, Trends Biochem. Sci. 26:431-7, 2001; Bustin, Mol. Cell. Biol. 19:5237-46, 1999). Other roles of HMGNl have been previously reported. Pash et al. (J. Biol. Chem. 268:13632-8, 1993) disclosed that induction of HMGNl expression in mouse myoblasts inhibited the differentiation of myoblast cells into myotubes. Revertant colonies, which lost the ability to express HMGNl, regained the ability to differentiate into myotubes. Mohamed et al. (Dev. Biol. 229:237-49, 2001) disclosed an effect of HMGNl antisense molecules on mouse embryonic development. One-cell embryos injected with antisense HMGN molecules transiently depleted the quantity of nuclear HMGN in early embryos. Depletion of both HMGNl and HMGN2 delayed, but did not arrest developmental progression. However, there is no previous disclosure demonstrating a relationship between HMGNl or HMGN2 function and the growth of the integumentary system. The integumentary system includes the skin and its accessory structures that cover and protect the outer surface of the body. The skin includes two layers, the epidermis and underlying dermis, as well as accessory structures, such as hairs, nails, eccrine sweat glands, sebaceous glands, apocrine sweat glands, and mammary glands. The primary function of the skin is to provide a barrier against the outside world, and guard against desiccation. The skin also protects the body from harmful ultraviolet light, by producing the pigment melanin, and helps the body regulate temperature by producing sweat.

SUMMARY Previously unknown functions for HMGNl and HMGN2 have been discovered. HMGNl is a chromatin architectural protein involved in DNA repair, such as repair of UV-damaged DNA, which can regulate the development of the integument including the skin (both epidermis and dermis), adnexal structures, subcutaneous tissues, and vessels. It is believed that HMGN2, which is similar to HMGNl, has similar effects on DNA repair and the growth of skin and skin structures.

Mice lacking detectable HMGNl protein are disclosed. These Hmgnl^'1' mice have numerous changes in their skin and hair. Notably, these mice have increased numbers and growth of skin structures, such as epidermis and dermis, as well as an increase in the hair growth cycle. The loss of HMGNl function also increased the sensitivity of mice and of mouse embryonic fibroblasts (MEFs) to UV irradiation. Hmgnϊ^1' cells have a decreased removal rate of photoproducts from the chromatin as compared to the chromatin of Hmgnl^+/+ MEFs; yet, host cell reactivation assays and DNA array analysis indicate that the Nucleotide Excision Repair (NER) pathway in the HrngnT^1' MEFs remains intact. The UV hypersensitivity oϊHmgnT^1' MEFs was rescued by transfection with plasmids expressing wild type HMGNl protein, but not with plasmids expressing HMGNl mutants that do not bind to nucleosomes or do not unfold chromatin. Transcriptionally active genes, the main target of the NER pathways in mice, contain HMGNl protein and loss of HMGNl protein reduces the accessibility of transcribed genes to nucleases. By reducing the compaction of the higher order chromatin structure HMGNl facilitates access to UV damaged DNA sites and enhances the rate of DNA repair in chromatin. HMGNl or HMGN2 proteins, nucleic acid molecules, specific binding agents, mimetics thereof, and antagonists can be used to modulate, such as increase or decrease, the integumentary development or proliferation, such as proliferation of eccrine sweat glands, sebaceous glands, epidermis, and dermis, as well as to modulate the hair growth cycle, by altering HMGNl or HMGN2 activity in the tissue. For example, administration of agents that interfere with HMGNl or HMGN2 activity to a subject, for example by administration of an HMGNl or HMGN2 antibody, HMGNl or HMGN2 antisense molecule, or HMGNl or HMGN2 antagonist, increases proliferation of the epidermis and dermis, increases the number of skin stem cells, and increases the rate of hair growth in the subject. Such methods can be used, for example, to treat a subject having alopecia, or to enhance or accelerate wound healing.

In contrast, administration of agents that increase HMGNl or HMGN2 activity to a subject, for example by administration of an HMGNl or HMGN2 protein, nucleic acid molecule, or mimetic thereof, decreases proliferation of the epidermis and dermis, decreases the number of skin stem cells, decreases the number of sebaceous glands, and decreases the rate of hair growth in the subject. Such methods can be used, for example, to treat a subject having hyperkeratotic or hyperproliferative skin conditions such as psoriasis, breast cancer, skin cancer, acne, hirsutism or other undesired hair.

HMGNl or HMGN2 proteins, nucleic acid molecules, specific binding agents, and mimetics thereof can also be used to increase the rate of repair of DNA damage in a cell by increasing HMGNl or HMGN2 activity in the cell. For example, the rate of

DNA damage caused by photodamage (such as UV or x-rays), chemicals, or toxins, can be increased by increasing HMGNl or HMGN2 activity in the cell. Examples of UV lesions in DNA include, but are not limited to: cyclobutane pyrimidine dimers (CPD) and pyrimidine (6-4) pyrimidone photoproducts (6-4PPs). Such methods can be used to treat a subject having increased UV sensitivity, such as a patient having xeroderma pigmentosum, Cockayne syndrome, or trichothiodystrophy. In addition, methods can be used to treat a subject having DNA damage (or expected to have increased DNA damage) caused by other sources, for example a subject having radiation damage, undergoing chemotherapy, or previously exposed to chemotherapy, such as a subject having skin cancer.

Methods are also provided for screening for one or more agents that decrease development of skin and its adnexal structures, such as eccrine sweat glands, sebaceous glands, dermis, or epidermis, or decrease the rate of the hair growth cycle. In one example, the method includes administering the agent to an HmgnT ^", Hmgnl^{+ '},

Hmgn2^' , or Hmgn2^{+ '} transgenic mouse or other non-human mammal and determining whether the agent affected development of the integument, such as skin and hair growth. The method can further involve comparing an extent of development of the integument in the mammal in the presence of the agent, with an extent of development of these structures in the absence of the agent.

In another example, the screening method includes administering the agent to an integument ex vivo or in vivo, such as a wild-type mouse, and determining whether the agent modulated HMGNl or HMGN2 expression or activity, such as increase or decrease such expression or activity. Agents that decreased HMGNl or HMGN2 expression or activity can be further assayed for their ability to increase integumentary development, such as increasing development of eccrine sweat glands, increasing development of sebaceous glands, increasing the hair growth cycle rate. Agents that increased HMGNl or HMGN2 expression or activity can be further assayed for their ability to decrease integumentary development, such as decreasing development of eccrine sweat glands, decreasing development of sebaceous glands, decreasing the hair growth cycle rate, or increasing repair of damaged DNA. The method can further involve comparing an extent of HMGNl or HMGN2 expression or activity in the presence of the agent, with an extent of HMGNl or HMGN2 expression or activity in the absence of the agent. HMGNl or HMGN2 expression or activity can be monitored using any assay known in the art, such as Western, Northern, or Southern blotting, or microarray technologies.

Screening can also be performed for one or more agents that increase repair of damaged DNA, for example DNA damaged by UV, X-rays, or chemicals. An example of a screening method includes administering the agent(s) to a wild type, HmgnV ^', Hmgn ^', Hmgn2^{~ '}, or Hmgn2^{+ "}transgenic mouse or other non-human mammal, and determining whether the agent increases repair of the damaged DNA. The transgenic animal can be exposed to radiation (such as UV or x-rays) or a chemical, and the agent administered before, during, or after such exposure. The method can further include comparing an extent of repair of damaged DNA in the transgenic mammal in the presence of the agent, with an extent of repair of damaged DNA in the absence of the agent.

Also disclosed are compositions that include HMGNl or HMGN2 proteins or nucleic acid molecules, as well as HMGNl or HMGN2 mimetics or antagonists thereof. For example, a composition including HMGNl (such as HMGNl protein, HMGNl cDNA, or HMGNl mimetic) and one or more other anti-proliferative agents can be applied topically to treat skin cancer. In one example, a sunscreen composition including HMGNl (such as HMGNl protein, HMGNl cDNA, or HMGNl mimetic) can be applied topically to protect the skin from UV damage. In addition, a composition including an HMGNl antagonist (such as HMGNl antisense or siRNA) and one or more other hair-stimulating agents (such as minoxidil) can be applied topically to increase hair growth.

The foregoing and other objects, features, and advantages of the disclosure will become more apparent from the following detailed description of a several embodiments which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1 is a schematic drawing showing how a mouse Hmgnl gene was disrupted. The upper strand represents an Hmgnl genomic sequence and the bottom strand represents a targeting vector and insertion sites.

FIG. 2 is a digital image showing 10 week old wild-type and HmgnT^1' mice 1 week following shaving.

FIG. 3 is a graph showing the hair growth cycle in Hmgnl^+/+ and Hmgnl^''^' mice.

FIGS 4A-4C are graphs showing that the hair growth cycle in Hmgnl^'1' mice is faster than in Hmgnl^+/+ mice.

FIG. 5 is a graph showing increased UV sensitivity of Hmgnl ^''^' fibroblasts.

FIG. 6 is a graph showing a decreased rate of gene-specific CPD removal in Hmgnl^''^' fibroblasts. The 0 hour point represents the initial lesion frequency. Bar graphs represent the average of three experiments.

FIG. 7A is a schematic diagram showing the results of microarray analysis of gene expression in Hrngrιl^{+ +} and Hmgnl ^{' '} cells after UV-C irradiation.

FIG. 7B is a graph showing that a UV damaged luciferase reporter plasmid is repaired to a similar extent in Hmgnl^''^' and in Hrngnl^+/+ cells, using a host cell reactivation assay.

FIG. 0A is a graph showing UV-survival curves of cell lines expressing (Δ, Δ) or not expressing (□, ■) HMGNl in the presence (A, ■) or absence (D, Δ) of doxycycline. FIG. 8B is a graph showing rescue of the UV-C hypersensitivity of Hmgnl^''^' cells by transient transfection of fully functional HMGNl protein. The schematic drawings outline the major functional domains of HMGNl protein: NLS: nuclear localization signal; NBD: nucleosome binding domain; CHUD: chromatin unfolding domain. FIG. 9A is a schematic drawing showing the primers used to detect the genes in the ChlP assays. Black boxes indicate exons.

FIG. 9B is a bar graph showing quantification, by real time PCR analysis, of the Hmgnl and Dhfr genes in IP from Hmgnl^+/+ cells.

FIGS. 10A and 10B are graphs showing a scan of (A) an ethidium bromide stained DNA gel or (B) an autoradiogram of a Southern analysis with an Hmgn2 probe, of a micrococcal nuclease digest of nuclei isolated from the livers of Hmgnl^" and Hmgnl^+/+ mice. The increased average oligonucleosome length in the autoradiogram of the Hmgnl^''^' cells indicates slower rate of digestion of the Hmgn2 chromatin.

DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS Abbreviations and Terms The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. The singular forms "a," "an," and "the" refer to one or more than one, unless the context clearly dictates otherwise. For example, the term "comprising a nucleic acid" includes single or plural nucleic acids and is considered equivalent to the phrase "comprising at least one nucleic acid." The term "or" refers to a single element of stated alternative elements or a combination of two or more elements, unless the context clearly indicates otherwise. As used herein, "comprises" means "includes." Thus, "comprising A or B," means "including A, B, or A and B," without excluding additional elements.

Unless explained otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting.

HMGNl: high mobility group nucleosomal binding domain 1

HMGN2: high mobility group nucleosomal binding domain 2 MEF: mouse embryonic fibroblasts NER: nucleotide excision repair Adnexal structure: A part of the skin, such as eccrine sweat glands, sebaceous glands, apocrine glands, smooth muscle (arrector pili muscle), and nerve sensors. The skin includes epidermis, dermis and adnexal structures. In some examples, excludes hair follicles and hair shafts. Agent: Any substance, including, but not limited to, an antibody, chemical compound, molecule, peptidomimetic, or protein. cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (mtrons) and regulatory sequences that determine transcription. cDNA can be synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.

Chemical synthesis: An artificial means by which a protein can be generated.

Conservative substitution: A substitution of an amino acid residue for another amino acid residue having similar biochemical properties. Typically, conservative substitutions have little to no impact on the biological activity of a resulting polypeptide. In a particular example, a conservative substitution is an amino acid substitution in a peptide that does not substantially affect the biological function of the peptide. A peptide can include one or more amino acid substitutions, for example 2-10 conservative substitutions, 2-5 conservative substitutions, 4-9 conservative substitutions, such as 2, 5 or 10 conservative substitutions. For example, a conservative substitution in a HMGNl or HMGN2 peptide does not substantially affect the ability of HMGNl or HMGN2 to increase the rate of UV-damaged DNA repair (and thus decrease UV sensitivity) or decrease growth or development of the integument.

A polypeptide can be produced to contain one or more conservative substitutions by manipulating the nucleotide sequence that encodes that polypeptide using, for example, standard procedures such as site-directed mutagenesis or PCR. Alternatively, a polypeptide can be produced to contain one or more conservative substitutions by using standard peptide synthesis methods. An alanine scan can be used to identify which amino acid residues in a protein can tolerate an amino acid substitution. In one example, the biological activity of the protein is not decreased by more than 25%, for example not more than 20%, for example not more than 10%, when an alanine, or other conservative amino acid (such as those listed below), is substituted for one or more native amino acids.

Examples of amino acids which can be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include, but are not limited to: Ser for Ala; Lys for Arg; Gin or His for Asn; Glu for Asp; Ser for Cys; Asn for Gin; Asp for Glu; Pro for Gly; Asn or Gin for His; Leu or Val for He; He or Val for Leu; Arg or Gin for Lys; Leu or He for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr; Tyr for Trp; Tip or Phe for Tyr; and lie or Leu for Val. Further information about conservative substitutions can be found in, among other locations in, Ben-Bassat et al., (J. Bacterial. 169:751-7, 1987), O'Regan et al., (Gene 77:237-51, 1989), Sahin-Toth et al, (Protein Sci. 3:240-7, 1994), Hochuli et al., (Bio/Technology 6:1321-5, 1988) and in standard textbooks of genetics and molecular biology. Decrease: To reduce the quality, amount, or strength of something. In one example, a therapy decreases growth of skin or other adnexal structures if growth of such structures is reduced as compared to growth in the absence of the therapy. In a particular example, increased levels of HMGNl or HMGN2 decrease growth of the skin or other adnexal structures in a subject, for example in a subject in whom decreased growth of the integument (such as skin or hair) is desired. Such reduction can be measured, for example, by cell proliferation or hair growth as described in EXAMPLES 6-7.

In one example, a therapy decreases the rate of hair growth cycling if the rate is reduced as compared to the rate of cycling in the absence of the therapy. In a particular example, increased levels of HMGNl or HMGN2 decrease the hair growth cycling rate in a subject, for example in a subject in whom decreased cycling is desired (such as in an area where hair growth is not desired, such as on the back, upper lip, or face). Such reduction can be measured, for example as described in EXAMPLE 2. In another example, a therapy decreases UV-sensitivity of a cell, such as a cell in a subject having xeroderma pigmentosum, UV damage, or skin cancer, if the rate of DNA repair is increased as compared to the rate of DNA repair in the absence of the therapy. In a particular example, increased levels of HMGNl or HMGN2 increase the rate of DNA repair and thus decrease UV-sensitivity. The rate of DNA repair can be measured, for example, by cell viability measurements as described in EXAMPLES 1-3.

Degenerate variant: A polynucleotide sequence encoding a polypeptide that includes a sequence that is degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included as long as the amino acid sequence of the polypeptide encoded by the nucleotide sequence is unchanged.

Deletion: The removal of one or more nucleotides from a nucleic acid sequence (or one or more amino acids from a protein sequence), the regions on either side of the removed sequence being joined together. DNA (deoxyribonucleic acid): A long chain polymer which includes the genetic material of most living organisms (some viruses have genes including ribonucleic acid, RNA). The repeating units in DNA polymers are four different nucleotides, each of which includes one of the four bases, adenine, guanine, cytosine and thymine bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides, referred to as codons, in DNA molecules code for amino acid in a polypeptide. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.

Enhance: To improve the quality, amount, or strength of something. In one example, a therapy enhances the DNA repair system if the DNA repair system is more effective at repairing DNA damage, for example damage induced by UV or x- irradiation, or chemicals. In a particular example, HMGNl or HMGN2 enhances the DNA repair system in a subject who is UV sensitive, such as a subject having xeroderma pigmentosum, or in a subject having photodamage or radiation damage, for example a subject having skin cancer. Such enhancement can be measured using any bioassay known in the art, for example, a UV survival assay as described in EXAMPLE 3.

In another example, a therapy enhances the growth of skin and its adnexal structures, if such growth increases as compared to growth in the absence of the therapy. In a particular example, decreased levels of HMGNl or HMGN2 enhance growth of integument (such as skin and its adnexal structures), in a subject, for example in a subject in whom increased growth of integument is desired, such as a subject having a wound. Such enhancement can be measured, for example, by cell proliferation measurements as described in EXAMPLES 6-7.

In another example, a therapy enhances the hair growth cycle rate, if such a cycle rate increases as compared to a rate in the absence of the therapy. In a particular example, decreased levels of HMGNl or HMGN2 enhance the hair growth cycle rate in a subject, for example in a subject in whom increased hair growth cycle rate is desired, for example a subject having baldness. Such enhancement can be measured, for example as described in EXAMPLES 2.

Functional deletion or disruption: A deletion or mutation of a nucleic acid molecule or amino acid sequence that substantially decreases the biological activity of the nucleic acid or amino acid sequence. In one example, the function of a gene or gene product is reduced or eliminated by a deletion, insertion, or substitution. For example, functional deletion of HMGNl or HMGN2 reduces or can even eliminate detectable HMGNl or HMGN2 activity, such as the ability of HMGNl or HMGN2 to reduce the rate of repair of UV damaged DNA.

Functionally equivalent: A protein or nucleic acid sequence that includes one or more sequence alterations, wherein the sequence retains a specified function of a native sequence. For example, a functionally equivalent HMGNl protein retains the ability to facilitate UV-induced DNA repair and decrease growth of skin or adnexal structures, as compared to an amount of UV-induced DNA repair and integument growth in the absence of detectable HMGNl. Examples of sequence alterations include, but are not limited to, substitutions, deletions, mutations, frameshifts, and insertions. In one example, a peptide binds an antibody, and a functional equivalent is a peptide that binds the same antibody. Thus a functional equivalent includes peptides which have the same binding specificity as a polypeptide, and which may be used as a reagent in place of the polypeptide (such as in a diagnostic assay or vaccine). In one example a functional equivalent includes a polypeptide wherein the binding sequence is discontinuous, wherein the antibody binds a linear epitope. Thus, if the peptide sequence is MPKRKVSSAE (SEQ ID NO: 1, the N-terminal 10 amino acids of a human HMGNl protein) a functional equivalent includes discontinuous epitopes, which may can appear as follows (**=any number of intervening amino acids): NH2-**-M**P**K**R**K**V**S**S**A**E-COOH. This polypeptide is functionally equivalent to SEQ ID NO: 1 if the three dimensional structure of the polypeptide is such that it can bind a monoclonal antibody that binds SEQ ID NO: 1. HMGNl: Includes any HMGNl nucleic acid molecule or protein from any organism that has HMGNl activity, such as the ability to facilitate repair of UV-damaged DNA, the ability to reduce growth of the integument, such as the skin and its adnexal structures, the ability to reduce the rate of hair growth cycling, or combinations thereof. Examples of native HMGNl nucleic acid sequences include, but are not limited to: Genbank Accession Nos: M21339, NM_004965, BC000075, BC023984, and J02621 (human); M20817 (chicken); NM_008251 (mouse). Examples of HMGNl amino acid sequences include, but are not limited to: Genbank Accession Nos: AAA52677, AAA52676, CAB90453, NP_004956, AAH00075, P05114, and AAH23984 (human), AAB59965 (chicken); NP_032277 (mouse). In one example, an HMGNl sequence includes a full-length wild-type (or native) sequence, as well as HMGNl allelic variants, variants, fragments, homologs or fusion sequences that retain the ability to facilitate repair of damaged DNA, or the ability to reduce growth of the integument (such as skin, hair, and sweat glands). In certain examples, HMGNl has at least 80% sequence identity, for example at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a native HMGNl. In particular examples, an HMGNl protein includes at least 9 amino acids, such as at least 10 amino acids, at least 20 amino acids, at least 50 amino acids, or even at least 75 amino acids, for example 9-100 amino acids.

HMGNl activity: The ability of an HMGNl agent to modulate the growth or development of the integument, such as the skin and its adnexal structures, modulate the hair cycling rate, modulate the sensitivity of UV-induced DNA damage, or combinations thereof. HMGNl agents include, but are not limited to, HMGNl proteins (including variants, fusions, fragments and mimetics thereof), nucleic acid molecules (including DNA, RNA, RNAi, siRNA and antisense molecules), specific binding agents, mimetics thereof, and antagonists.

In particular examples, HMGNl activity occurs when HMGNl proteins, nucleic acid molecules, specific binding agents, or mimetics thereof decrease the growth or development of skin and adnexal structures (such as sweat glands), for example by at least 10%, for example by at least 25%, as compared to an amount of growth or development in the absence of such agents. In another example HMGNl activity occurs when HMGNl proteins, nucleic acid molecules, specific binding agents, or mimetics thereof decrease the hair cycling rate, for example by at least 10%, for example by at least 20% as compared to a rate of cycling in the absence of such agents, In another example HMGNl activity occurs when HMGNl proteins, nucleic acid molecules, specific binding agents, or mimetics thereof decrease UV-sensitivity, thereby increasing the rate of DNA repair, for example by at least 10%, for example by at least 20% as compared to an amount of DNA repair in the absence of such agents. In some examples, HMGNl activity occurs when HMGNl proteins, nucleic acid molecules, specific binding agents, or mimetics thereof facilitate repair of DNA resulting from other types of damage, such as x-rays or chemicals, for example by at least 10%, for example by at least 20% as compared to an amount of DNA repair in the absence of such agents. In particular examples, HMGNl induces repair of DNA damage by facilitating access to damaged DNA and enhancing the rate of DNA repair in chromatin. HMGN1 activity is reduced or decreased when HMGNl proteins, nucleic acid molecules, specific binding agents, or antagonists increase the growth or development of the integument, such as skin or hair, for example by at least 10%, for example by at least 25%, as compared to a control (such as an amount of growth or development of skin and adnexal structures in the absence of such agents).

Assays are described herein that can be used to determine if an agent has HMGNl activity or reduces that activity, for example as shown in EXAMPLES 1-4 and 7-8. In one example, an HMGNl protein can be assessed for its ability to decrease hair growth cycle by the intradermal injection or topical application of the protein to the skin or tails of newborn mice. Functional protein activity would be detected by a decrease in hair growth cycle in the presence of the protein. The protein can also be applied to or injected into the footpads of newborn mice, with subsequent monitoring of sweat gland development. Similar assays can be used to determine if any agent disclosed herein can increase the growth or development of the integument. Any of these assays can be modified by using in vivo expression of a nucleic acid molecule encoding an HMGNl protein, as an alternative to (or in addition to) applying/injecting purified proteins.

In another example, an HMGNl protein can be assessed for its ability to decrease UV sensitivity, by increasing the rate of repair of UV-damaged DNA. In one example, cells are exposed to UV in the presence or absence of an HMGNl protein or nucleic acid molecule expressing HMGNl, and subsequent determination of cell viability calculated, for example using the methods disclosed herein.

HMGN2: Includes any HMGN2 nucleic acid molecule or protein from any organism that has HMGN2 activity, such as the ability to facilitate repair of UV-damaged DNA, the ability to reduce growth of the integument (such as the skin and sweat glands), the ability to reduce the rate of hair growth cycling, or combinations thereof.

Examples of native HMGN2 nucleic acid sequences include, but are not limited to: Genbank Accession Nos: M12623, NM_005517, BC032140, BC014644, and AY408429 (human); X12944 (mouse) and J03229 (chicken). Examples of HMGN2 amino acid sequences include, but are not limited to: Genebank Accession Nos: AAA52678, NP_005508, AAH14644, AAH32140, and P05204 (human); CAA31404 (mouse); and AAA48816 (chicken). In one example, an HMGN2 sequence includes a full-length wild-type (or native) sequence, as well as HMGN2 allelic variants, variants, fragments, homologs or fusion sequences that retain the ability to facilitate DNA repair, the ability to reduce growth of skin and adnexal structures, or the ability to reduce the hair growth cycling rate. In certain examples, HMGN2 has at least 80% sequence identity, for example at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a native HMGN2. In particular examples, an HMGN2 protein includes at least 9 amino acids, such as at least 10 amino acids, at least 20 amino acids, at least 50 amino acids, or even at least 75 amino acids, for example 9-100 amino acids.

HMGN2 activity: The ability of an HMGN2 agent to modulate the growth or development of the integument, modulate the sensitivity of UV-induced DNA damage, or combinations thereof. HMGN2 agents include, but are not limited to, HMGN2 proteins (including variants, fusions, fragments and mimetics thereof), nucleic acid molecules (including DNA, RNA, RNAi, siRNA and antisense molecules), specific binding agents, mimetics thereof, and antagonists.

In particular examples, HMGN2 activity occurs when HMGN2 proteins, nucleic acid molecules, specific binding agents, or mimetics thereof decrease the growth or development of the integument (such as skin and its adnexal structures), for example by at least 10%, for example by at least 25% as compared to an amount of growth or development in the absence of such agents. In one example, HMGN2 activity occurs when HMGN2 proteins, nucleic acid molecules, specific binding agents, or mimetics thereof decrease the rate of hair growth cycling, for example by at least 10%, for example by at least 25% as compared to a rate of cycling in the absence of such agents. In another example, HMGN2 activity occurs when HMGN2 proteins, nucleic acid molecules, specific binding agents, or mimetics thereof decrease UV-sensitivity, thereby increasing the rate of DNA repair, for example by at least 10%, for example by at least 20% as compared to an amount of DNA repair in the absence of such agents. In some examples, HMGNl activity occurs when HMGNl proteins, nucleic acid molecules, specific binding agents, or mimetics thereof facilitate repair of DNA resulting from other types of damage, such as x-rays or chemicals, for example by at least 10%, for example by at least 20% as compared to an amount of DNA repair in the absence of such agents. In particular examples, HMGNl induces repair of DNA damage by facilitating access to damaged DNA and enhancing the rate of DNA repair in chromatin. HMGN2 activity is reduced or decreased when HMGN2 proteins, nucleic acid molecules, specific binding agents, or antagonists increase the growth or development of the integument, for example by at least 10% for example by at least 25% as compared to a control (such as an amount of growth or development of the integument in the absence of such agents).

Assays are described herein that can be used to determine if an agent has HMGN2 activity, or reduces that activity, for example as shown in EXAMPLES 1-4 and 7-8. In one example, an HMGN2 protein can be assessed for its ability to decrease the hair growth cycle by the intradermal injection or topical application of the protein to the skin or tails of newborn mice. Functional protein activity would be detected by a decrease in hair growth cycle in the presence of the protein. The protein can also be applied to or injected into the footpads of newborn mice, with subsequent monitoring of sweat gland development. Similar assays can be used to determine if any agent disclosed herein can increase the growth or development of the integument. Any of these assays can be modified by using in vivo expression a nucleic acid molecule encoding an HMGN2 protein, as an alternative to (or in addition to) applying/injecting purified proteins.

In another example, an HMGN2 protein can be assessed for its ability to decrease UV sensitivity, by increasing the rate of repair of UV-damaged DNA. Cells are exposed to UV in the presence or absence of an HMG l protein or nucleic acid molecule expressing HMGN2, and subsequent determination of cell viability calculated, for example using the methods disclosed herein.

Hybridization: To form base pairs between complementary regions of two strands of DNA, RNA, or between DNA and RNA, thereby forming a duplex molecule. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (such as the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions for attaining particular degrees of stringency are discussed in Sambrook et al., (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, NY (chapters 9 and 11). The following is an exemplary set of hybridization conditions and is not limiting: Very High Stringency (detects sequences that share 90% identity)

Hybridization: 5x SSC at 65°C for 16 hours

Wash twice: 2x SSC at room temperature (RT) for 15 minutes each

Wash twice: 0.5x SSC at 65°C for 20 minutes each

High Stringency (detects sequences that share 80% identity or greater)

Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours

Wash twice: 2x SSC at RT for 5-20 minutes each

Wash twice: Ix SSC at 55°C-70°C for 30 minutes each

Low Stringency f detects sequences that share greater than 50% identity)

Hybridization: 6x SSC at RT to 55°C for 16-20 hours

Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.

Insertion: The addition of one or more nucleotides to a nucleic acid sequence, or the addition of one or more amino acids to a protein sequence. Isolated: An "isolated" biological component (such as a nucleic acid molecule, protein, or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, such as other chromosomal and extra-chromosomal DNA and RNA, proteins and organelles. Nucleic acids and proteins that have been "isolated" include nucleic acid molecules and proteins purified by standard purification methods. The term also embraces nucleic acid molecules and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acid molecules and proteins.

Integument: Includes the skin and its adnexal structures. The skin includes two layers, the epidermis and underlying dermis, as well as adnexal structures, such as hairs, nails, eccrine sweat glands, sebaceous glands, apocrine sweat glands, and mammary glands. Integumentary proliferation or development includes adnexal structure proliferation (such as sweat gland proliferation or sebaceous gland proliferation), hair growth cycling, or combinations thereof. In some examples, integumentary proliferation or development further includes skin proliferation (such as dermal or epidermal proliferation).

Mammal: This term includes both human and non-human mammals.

Mimetic: An HMGNl or HMGN2 mimetic includes variants, fragments of fusions of HMGNl or HMGN2 peptides, as well as organic compounds and modified HMGNl or HMGN2 peptides, which retain HMGNl or HMGN2 activity, respectively. In one example, a mimetic mimics the increase in DNA repair generated by HMGNl or HMGN2.

Modulate: To increase or decrease.

Nucleic acid molecules: A deoxyribonucleotide or ribonucleotide polymer including, without limitation, cDNA, mRNA, genomic DNA, and synthetic (such as chemically synthesized) DNA. Nucleic acid molecules can be double-stranded or single-stranded. Where single-stranded, the nucleic acid molecule can be the sense strand or the antisense strand. In addition, nucleic acid molecules can be circular or linear. The disclosure includes isolated nucleic acid molecules that include specified lengths of an HMGNl or HMGN2 nucleotide sequence. For example, such molecules can include at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 consecutive nucleotides of these sequences or more, and can be obtained from any region of an HMG l or HMGN2 nucleic acid molecule. Nucleotide: Includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA). Includes analogues of natural nucleotides that hybridize to nucleic acid molecules in a manner similar to naturally occurring nucleotides. A nucleotide is one monomer in a polynucleotide. A nucleotide sequence refers to the sequence of bases in a polynucleotide.

Oligonucleotide: An oligonucleotide is a plurality of joined nucleotides joined by native phosphodiester bonds, between about 6 and about 300 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide.

Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 200 nucleotides in length, for example a sequence (such as DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 nucleotides long, or from about 6 to about 50 nucleotides, for example about 10-25 nucleotides, such as 12, 15 or 20 nucleotides.

ORF (open reading frame): A series of nucleotide triplets (codons) coding for amino acids without any termination codons. These sequences are usually translatable into a peptide.

Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

Peptide Modifications: The present disclosure includes HMGNl and HMGN2 proteins, as well as synthetic examples of the proteins described herein. In addition, analogues (non-peptide organic molecules), derivatives (chemically functionalized peptide molecules obtained starting with the disclosed peptide sequences) and variants (homologs) of these proteins that facilitate repair of damaged DNA (such as UV damaged DNA), modulate the hair growth cycling rate, or modulate growth of the integument, can be utilized in the methods described herein. The peptides disclosed herein include a sequence of amino acids, which can be either L- or D- amino acids, naturally occurring and otherwise.

Peptides can be modified by a variety of chemical techniques to produce derivatives having essentially the same activity as the unmodified peptides, and optionally having other desirable properties. For example, carboxylic acid groups of the protein, whether carboxyl-terminal or side chain, may be provided in the form of a salt of a pharmaceutically-acceptable cation or esterified to form a - β ester, or converted to an amide of formula NRιR₂ wherein R._\ and R₂ are each independently H or - β alkyl, or combined to form a heterocyclic ring, such as a 5- or 6-membered ring. Amino groups of the peptide, whether amino-terminal or side chain, may be in the form of a pharmaceutically-acceptable acid addition salt, such as the HC1, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric and other organic salts, or may be modified to Ci- β alkyl or dialkyl amino or further converted to an amide.

Hydroxyl groups of the peptide side chains may be converted to -Ciβ alkoxy or to a - β ester using well-recognized techniques. Phenyl and phenolic rings of the peptide side chains may be substituted with one or more halogen atoms, such as fluorine, chlorine, bromine or iodine, or with Ci-Ciβ alkyl, Ci-Ciβ alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids. Methylene groups of the peptide side chains can be extended to homologous C₂-C₄ alkylenes. Thiols can be protected with any one of a number of well-recognized protecting groups, such as acetamide groups. Those skilled in the art will also recognize methods for introducing cyclic structures into the peptides of this invention to select and provide conformational constraints to the structure that result in enhanced stability. For example, a carboxyl- terminal or amino-terminal cysteine residue can be added to the peptide, so that when oxidized the peptide will contain a disulfide bond, generating a cyclic peptide. Other peptide cyclizing methods include the formation of thioethers and carboxyl- and amino- terminal amides and esters.

Peptidomimetic and organomimetic embodiments are also within the scope of the present disclosure, whereby the three-dimensional arrangement of the chemical constituents of such peptido- and organomimetics mimic the three-dimensional arrangement of the peptide backbone and component amino acid side chains, resulting in such peptido- and organomimetics of the proteins of this disclosure having measurable or enhanced ability to bind an antibody. For computer modeling applications, a pharmacophore is an idealized, three-dimensional definition of the structural requirements for biological activity. Peptido- and organomimetics can be designed to fit each pharmacophore with current computer modeling software (using computer assisted drug design or CADD). See Walters, "Computer-Assisted Modeling of Drugs", in Klegerman & Groves, eds., 1993, Pharmaceutical Biotechnology, Interpharm Press: Buffalo Grove, EL, pp. 165-174 and Principles of Pharmacology Munson (ed.) 1995, Ch. 102, for descriptions of techniques used in CADD. Also included within the scope of the disclosure are mimetics prepared using such techniques.

Pharmaceutical agent or drug: A chemical compound or composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject.

Polynucleotide: A nucleic acid sequence of at least 3 nucleotides. Therefore, a polynucleotide includes molecules which are at least 15, 20, 30, 50, 100, 200, 500, 1000, or 5000 nucleotides in length, and also nucleotides as long as a full length cDNA. An HMGNl polynucleotide encodes an HMGNl peptide, while an HMGN2 polynucleotide encodes an HMGN2 peptide.

Polypeptide: Any chain of amino acids at least six amino acids in length, such as at least 8 amino acids, such as at least 9 amino acids, such as at least 20 amino acids, such as at least 50 amino acids, such as about 10-100 or 50-75 amino acids, regardless of post-translational modification (such as glycosylation or phosphorylation).

Preventing or treating a disease: "Preventing" a disease refers to inhibiting the full development of a disease, for example preventing development of baldness in a subject having alopecia or the clinical appearance of skin lesions in a subject prone to psoriasis. "Treatment" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition, such as decreasing UV sensitivity in a subject sensitive to UV irradiation, for example a subject having xeroderma pigmentosum.

Probes and primers: A probe includes an isolated nucleic acid molecule attached to a detectable label or reporter molecule. Exemplary labels include, but are not limited to, radioactive isotopes, ligands, chemiluminescent agents, fluorophores, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, for example in Sambrook et ah, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989) and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley- Intersciences (1987).

Primers are short nucleic acid molecules, such as DNA oligonucleotides about at least 15 nucleotides in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, for example by PCR or other nucleic-acid amplification methods known in the art.

Methods for preparing and using probes and primers are described, for example, in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989), Ausubel et al., 1987, and Innis et al., PCR Protocols, A Guide to Methods and Applications, 1990, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge, MA). Promoter: An array of nucleic acid control sequences that directs transcription of a nucleic acid molecule. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as a TATA element. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. Both constitutive and inducible promoters are included (Bitter et al., Meth. Enzymol. 153:516-44, 1987).

Specific, non-limiting examples of promoters include promoters derived from the genome of mammalian cells (such as a metallothionein promoter) or from mammalian viruses (such as a retrovirus long terminal repeat; an adenovirus late promoter; a vaccinia virus 7.5K promoter). Promoters produced by recombinant DNA or synthetic techniques can also be used. A nucleotide sequence encoding HMGNl or HMGN2 can be inserted into an expression vector that contains a promoter sequence which facilitates the efficient transcription of the inserted genetic sequence of the host. The expression vector typically contains an origin of replication, a promoter, as well as specific nucleic acid sequences that allow phenotypic selection of the transformed cells. Purified: The term purified does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified peptide preparation is one in which the peptide or protein is more enriched than the peptide or protein is in its environment within a cell, such that the peptide is substantially separated from cellular components (such as nucleic acid molecules, lipids, carbohydrates, and other polypeptides) that may accompany it. In another example, a purified peptide preparation is one in which the peptide is substantially-free from contaminants, such as those that might be present following chemical synthesis of the peptide.

In one example, an HMG l or HMGN2 peptide is purified when at least 60% by weight of a sample is composed of the peptide, for example when 75%, 95%, or 99% or more of a sample is composed of the peptide. Examples of methods that can be used to purify an antigen, include, but are not limited to the methods disclosed in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989, Ch. 17). Protein purity can be determined by, for example, polyacrylamide gel electrophoresis of a protein sample, followed by visualization of a single polypeptide band upon staining the polyacrylamide gel; high-pressure liquid chromatography; sequencing; or other conventional methods.

Recombinant: A recombinant nucleic acid molecule is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acid molecules, for example by genetic engineering techniques. Similarly, a recombinant protein is one encoded for by a recombinant nucleic acid molecule.

Sample: A material to be analyzed. Examples include biological samples containing genomic DNA, cDNA, RNA, or protein obtained from the cells of a subject, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, fine needle aspriates, amniocentesis samples and autopsy material. Sensitivity to UV radiation: Having an increased propensity to DNA damage in the presence of UV irradiation. Examples of diseases associated with sensitivity to UV radiation, include, but are not limited to cutaneous malignant melanoma (CMM) and xeroderma pigmentosum.

Sequence identity/similarity: The identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity/similarity when aligned using standard methods. This homology is more significant when the orthologous proteins or cDNAs are derived from species which are more closely related (such as human and mouse sequences), compared to species more distantly related (such as human and C. elegans sequences).

Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al, Nuc. Acids Res. 16:10881- 90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al, J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al, J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38 A, Room 8N805, Bethesda, MD 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.

BLASTN can be used to compare nucleic acid sequences, while BLASTP can be used to compare amino acid sequences. To compare two nucleic acid sequences, the options can be set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (such as C:\seql.txt); -j is set to a file containing the second nucleic acid sequence to be compared (such as C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (such as C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seql .txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2.

To compare two amino acid sequences, the options of B12seq can be set as follows: -i is set to a file containing the first amino acid sequence to be compared (such as C:\seql.txt); -j is set to a file containing the second amino acid sequence to be compared (such as C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (such as C:\outputtxt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seql .txt -j c:\seq2.txt - p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.

Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (such as 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1166 matches when aligned with a test sequence having 1154 nucleotides is 75.0 percent identical to the test sequence (1166÷1554* 100=75.0). The percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. The length value will always be an integer. In another example, a target sequence containing a 20- nucleotide region that aligns with 20 consecutive nucleotides from an identified sequence as follows contains a region that shares 75 percent sequence identity to that identified sequence (that is, 15÷20*100=75).

1 20

Target Sequence: AGGTCGTGTACTGTCAGTCA

Identified Sequence:ACGTGGTGAACTGCCAGTGA

For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). Homologs are typically characterized by possession of at least 70% sequence identity counted over the full-length alignment with an amino acid sequence using the NCBI Basic Blast 2.0, gapped blastp with databases such as the nr or swissprot database. Queries searched with the blastn program are filtered with DUST (Hancock and Armstrong, 1994, Comput. Appl Biosci. 10:67-70). Other programs use SEG. In addition, a manual alignment can be performed. Proteins with even greater similarity to an HMGNl or HMGN2 protein sequence (which can be used in the disclosed methods) will show increasing percentage identities when assessed by this method, such as at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity. When aligning short peptides (fewer than around 30 amino acids), the alignment is be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). HMGNl or HMGN2 Proteins with even greater similarity to the reference sequence will show increasing percentage identities when assessed by this method, such as at least about 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologs will typically possess at least 75% sequence identity over short windows of 10-20 amino acids, and can possess sequence identities of at least 85%, 90%, 95% or 98% depending on their identity to the reference sequence. Methods for determining sequence identity over such short windows are described at the NCBI web site.

One indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions, as described above. Nucleic acid sequences that do not show a high degree of identity may nevertheless encode identical or similar (conserved) amino acid sequences, due to the degeneracy of the genetic code. Changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein. Such homologous nucleic acid sequences can, for example, possess at least about 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity to an HMGNl or HMGN2 sequence determined by this method. An alternative (and not necessarily cumulative) indication that two nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.

One of skill in the art will appreciate that the particular sequence identity ranges are provided for guidance only; it is possible that strongly significant homologs could be obtained that fall outside the ranges provided.

Short interfering or interrupting RNA (siRNA): Double-stranded RNAs that can induce sequence-specific post-transcriptional gene silencing, thereby decreasing or even inhibiting gene expression. In some examples, siRNA molecules are about 19-23 nucleotides in length, such as at least 21 nucleotides, for example at least 23 nucleotides.

In one example, siRNA triggers the specific degradation of homologous RNA molecules, such as mRNAs, within the region of sequence identity between both the siRNA and the target RNA. For example, WO 02/44321 discloses siRNAs capable of sequence-specific degradation of target mRNAs when base-paired with 3¹ overhanging ends. The direction of dsRNA processing determines whether a sense or an antisense target RNA can be cleaved by the produced siRNA endonuclease complex. Thus, siRNAs can be used to modulate transcription, for example, by silencing genes, such as HMGNl, HMGN2, or combinations thereof. The effects of siRNAs have been demonstrated in cells from a variety of organisms, including Drosophila, C. elegans, insects, frogs, plants, fungi, mice and humans (for example, WO 02/44321; Gitlin et al., Nature 418:430-4, 2002; Caplen et al, Proc. Natl. Acad. Sci. 98:9742-9747, 2001; and Elbashir et al, Nature 411 :494-8, 2001).

Skin cancer: The uncontrolled growth of abnormal skin cells, which can result in tumors, which are either benign (noncancerous) or malignant (cancerous). The most common skin cancers are basal cell cancer and squamous cell cancer (nonmelanoma skin cancers). Melanoma is a type of skin cancer that starts in the melanocytes. Although skin cancer can occur anywhere on the body, it is most common in places that have been exposed to more sunlight, such as the face, neck, hands, and arms. Specific binding agent: An agent that binds substantially only to a defined target. For example, a protein-specific binding agent binds substantially only the specified protein and a nucleic acid specific binding agent binds substantially only the specified nucleic acid. In one example, an HMGNl specific binding agent binds substantially only an HMGNl protein, while an HMGN2 specific binding agent binds substantially only an HMGN2 protein. The terms "anti-HMGNl antibodies" and "anti- HMGN2 antibodies" encompasses antibodies specific for an HMGNl or HMGN2 protein, respectively, as well as immunologically effective portions ("fragments") thereof. Exemplary antibodies include polyclonal or monoclonal antibodies, humanized antibodies, or chimeric antibodies, as well as any other agent capable of specifically binding to an HMGNl or HMGN2 protein.

Shorter fragments of antibodies can also serve as specific binding agents. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to a specified protein would be specific binding agents. These antibody fragments include: (1) Fab, the fragment containing a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab')2, a dimer of two Fab' fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (6) single chain antibody ("SCA"), a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine. For example, construction of Fab expression libraries permits the rapid and easy identification of monoclonal Fab fragments with the desired specificity for an HMGN1 or HMGN2 protein described herein.

HMGNl antibodies are known in the art (for example see Bustin et al., J. Biol. Chem. 265:20077-80, 1990; Westermann and Grossbach, Chromosoma 90:355-65, 1984; et al, EMBO J. 19:3714-26, 2000; Posrnikov et al. Nucleic Acids Res. 19:717-25, 1991). HMGN2 antibodies are also known in the art (for example see Dorbic et al., Nucleic Acids Res. 14:3363-76, 1986; Tahourdin et «/., Biochemistry 20:9 0-5, 1981). In addition, antibodies can also be produced using standard procedures, for example as described in Harlow and Lane (Antibodies: A Laboratory Manual. 1988). For example, polyclonal antibodies can be produced by immunizing a host animal by injection with an HMGNl or HMGN2 peptide (or variants, fragments, or fusions thereof). The production of monoclonal antibodies can be accomplished by a variety of methods, such as the hybridoma technique (Kohler and Milstein, Nature 256:495-7, 1975), the human B-cell technique (Kosbor et al, Immunology Today 4:72, 1983), or the EBV-hybridoma technique (Cole et al, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96, 1983). Additionally, chimeric antibodies can be produced (for example, see Morrison et al, J. Bacteriol 159:870, 1984; Neuberger et al, Nature 312:604-8, 1984; and Takeda et al, Nature 314:452-4, 1985), as well as single-chain antibodies (for example, see U.S. Patent Nos: 5,476,786; 5,132,405; and 4,946,778).

The determination that a particular agent binds substantially only to an HMGNl or HMGN2 protein can be made using or adapting routine procedures. For example, western blotting can be used to determine that a specific binding agent, such as a mAb, binds substantially only to the protein (Harlow and Lane, Antibodies: A Laboratory Manual 1988). Other assays include, but are not limited to, competitive and non- competitive homogenous and heterogeneous enzyme-linked immunosorbent assays (ELISA) as symmetrical or asymmetrical direct or indirect detection formats; "sandwich" immunoassays; immunodiffusion assays; in situ immunoassays (for example, using colloidal gold, enzyme or radioisotope labels); agglutination assays; complement fixing assays; immunoelectrophorectic assays; enzyme-linked immunospot assays (ELISPOT); radioallergosorbent tests (RAST); fluorescent tests, such as used in fluorescent microscopy and flow cytometry; Western, grid, dot or tissue blots; dip-stick assays; halogen assays; or antibody arrays (for example, see O'Meara and Tovey, Gin. Rev. Allergy Immunol, 18:341-95, 2000; Sambrook et al, 2001, Appendix 9; Simonnet and Guilloteau, in: Methods of Immunological Analysis, Masseyeff et al. (Eds.), VCH, New York, 1993, pp. 270-388).

A specific binding agent also can be labeled for direct detection (see Chapter 9, Harlow and Lane, Antibodies: A Laboratory Manual. 1988). Suitable labels include (but are not limited to) enzymes (such as alkaline phosphatase or horseradish peroxidase), fluorescent labels, colorimetric labels, radioisotopes, chelating agents, dyes, colloidal gold, ligands (such as biotin), and chemiluminescent agents.

Subject: Living multicellular vertebrate organisms, a category which includes both human and veterinary subjects for example, mammals, rodents, and birds.

Therapeutieally active molecule: An agent, such as an HMGNl or HMGN2 protein, nucleic acid molecule, mimetic or antagonist thereof, that can modulate the development or growth of the integument or its structures (such as the skin and adnexal structures) as measured by clinical response (for example increase or decrease in the number of eccrine sweat glands), can modulate the hair growth cycling rate as measured by clinical response (for example an increase or decrease in the rate of hair growth), or can increase the rate of repair of DNA, such as UV-damaged DNA, as measured by clinical response (for example increasing the number of viable cells). In particular examples, decreasing sensitivity to UV increases the rate of repair of UV-damaged DNA.

Therapeutieally active molecules can also be made from nucleic acid molecules. Examples of nucleic acid molecule based therapeutieally active molecules are a nucleic acid sequence that encodes HMGNl or HMGN2 (or fragments that of that encode a peptide that retains the desired biological activity), wherein the nucleic acid sequence is operably linked to a control element such as a promoter. Therapeutieally active agents can also include organic or other chemical compounds that mimic the effects of HMGNl or HMGN2 peptides. Therapeutic Amount: The preparations disclosed herein are administered in a therapeutieally effective amount, which is an amount of a pharmaceutical preparation that alone, or together with further doses, stimulates the desired response, such as an amount necessary to improve signs or symptoms a disease or injury. Treatment can involve only slowing the progression of the disease temporarily, but can also include halting or reversing the progression of the disease permanently. The therapeutieally effective amount also includes a quantity of HMGNl or HMGN2 protein, nucleic acid molecule, specific binding agent, mimetic thereof, or antagonist sufficient to achieve a desired effect in a subject being treated. A desired response can be a decrease in the development or growth of the integument (such as the skin and its adnexal structures) or a decrease in the hair growth cycling rate. One example of a therapeutic effect is regression of hirsutism, decrease hair growth where hair is not desired (such as on the back, face, legs, or underarms) or regression of hyperkeratotic or hyperproliferative skin conditions such as psoriasis, in a subject. Another example of a therapeutic effect is regression of a cancer, such as skin cancer or breast cancer. Yet another example of a therapeutic effect is a decrease in acne due to a decrease in the development or growth of sebaceous glands.

In another example, a desired response is an increase in the development or growth of the integument (such as the skin and its adnexal structures), or an increase in the hair growth cycling rate. Examples of therapeutic effects due to such a response include, but are not limited to: regression of alopecia in a subject, an increase in wound healing, and an increase the number of eccrine sweat glands.

Desired responses can also include an increase in the rate of DNA repair, for example repair of DNA damaged by UV, x-rays, and chemicals. One example of a therapeutic effect is in increase in cell survival in a subject having xeroderma pigmentosum, Cockayne syndrome, trichothiodystrophy, skin cancer, pre-cancerous lesions (actinic keratoses), or photodamage, by decreasing sensitivity to UV in the subject. An effective amount of HMGNl or HMGN2 protein, nucleic acid molecule, specific binding agent, mimetic thereof, or antagonist can be administered in a single dose, or in several doses, for example daily, during a course of treatment. However, the effective amount can be dependent on the source applied (for example, HMGNl peptide isolated from a cellular extract versus a chemically synthesized and purified HMGNl peptide, or a variant or fragment that may not retain full HMGNl activity), the subject being treated, the severity and type of the condition being treated, and the manner of administration. For example, a therapeutieally effective amount of HMGNl or HMGN2 protein can vary from about 0.01 mg/kg body weight to about 1 g/kg body weight, such as about 1 mg per subject.

The methods disclosed herein have equal application in medical and veterinary settings. Therefore, the general term "subject being treated" is understood to include all animals (such as humans, apes, dogs, cats, horses, and cows) that are in need of an increase or decrease in HMGNl or HMGN2 activity. Transduced and Transformed: A virus or vector "transduces" or "transfects" a cell when it transfers a nucleic acid molecule into the cell. A cell is "transformed" by a nucleic acid molecule transduced into the cell when the DNA becomes stably replicated by the cell, either by incorporation of the nucleic acid molecule into the cellular genome, or by episomal replication. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.

Transfected: A transfected cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the term transfection encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration. Transgene: An exogenous nucleic acid sequence supplied by a vector. In one example, a transgene encodes an HMGNl or HMGN2 polypeptide.

Variants, fragments or fusion proteins: The disclosed HMGNl and HMGN2 sequences include variants, fragments, and fusions thereof that retain desired properties, such as the ability to increase the rate of UV-damaged DNA repair (and thus decrease UV sensitivity), decrease the hair growth cycling rate, or decrease growth or development of the integument. DNA sequences which encode an HMGNl or HMGN2 protein or fusion thereof, or a fragment or variant of thereof (for example a fragment or variant having 80%, 90%, 95% or 98% sequence identity to an HMGNl or HMGN2 sequence) can be engineered to allow the protein to be expressed in eukaryotic cells or organisms, bacteria, insects, or plants. To obtain expression, the DNA sequence can be altered and operably linked to other regulatory sequences. The final product, which contains the regulatory sequences and the protein, is referred to as a vector. This vector can be introduced into eukaryotic, bacteria, insect, or plant cells. Once inside the cell the vector allows the protein to be produced.

A fusion protein including a protein, such as HMGNl or HMGN2 (or variants or fragments thereof) linked to other amino acid sequences that do not significantly decrease the desired activity of HMGNl or HMGN2, for example the characteristic of increasing the rate of UV-damaged DNA repair (and thus decrease UV sensitivity), decreasing the hair growth cycling rate, and decreasing growth or development of the integument. In one example, the other amino acid sequences are no more than about 10, 20, 30, or 50 amino acid residues in length.

One of ordinary skill in the art will appreciate that the DNA can be altered in numerous ways without affecting the biological activity of the encoded protein. For example, PCR can be used to produce variations in a DNA sequence which encodes

HMGNl or HMGN2. Such variants can be variants optimized for codon preference in a host cell used to express the protein, or other sequence changes that facilitate expression.

Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector can include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. A vector can also include one or more therapeutic genes or selectable marker genes and other genetic elements known in the art. A vector can transduce, transform or infect a cell, thereby causing the cell to express nucleic acid molecules or proteins other than those native to the cell. A vector optionally includes materials to aid in achieving entry of the nucleic acid molecule into the cell, such as a viral particle, liposome, protein coating or the like. In one example, a vector is a viral vector. Viral vectors include, but are not limited to, retroviral and adenoviral vectors.

Therapeutic uses of HMGNl and HMGN2

Disclosed herein are transgenic Hmgnl^{' '} and Hmgnl^{+ '} mice. This disclosure therefore enables other Hmgnl^{' '} and Hmgnl^+/' transgenic non-human mammals such as rats and primates. Transgenic Hmgnl^{' '} and Hmgnl^+/' mice had numerous changes in the integument, such as the skin and hair. For example, such mice had increased numbers and growth of skin structures including epidermis, and dermis, as well as an increase in the hair growth cycling rate. Hmgnl^{+ '} mice had a phenotype that was intermediate between wild-type and homozygous Hmgnl^''^' mice. Therefore, decrease or loss of HMGNl activity increases the development of the integument (including the skin and many adnexal structures) and increases the hair growth rate. Similar results can be achieved by decreasing HMGN2 activity, for example in the cell or tissue of a subject.

The loss of HMGNl function also increased the sensitivity of mice and of mouse embryonic fibroblasts (MEFs) to UV irradiation. Therefore, loss of HMGNl activity reduced the rate of repair of UV induced DNA damage. Similar results can be achieved by decreasing HMGN2 activity, alternatively or in addition to decreasing HMGNl activity. This HMGN-mediated enhancement of the rate of UV repair in chromatin is linked to the ability of HMGNl to bind to nucleosomes and unfold chromatin. This indicates that the higher order chromatin structure plays a regulatory role in the UV repair process.

Without wishing to be bound to a particular theory, it is proposed that HMGNl enhances the rate of DNA repair by reducing the compaction of the chromatin fiber and facilitating access of various components involved in the repair of the UV damage to the nucleosomes containing the damaged DNA sites, based on the observation that HMGNl deletion mutants that do not unfold chromatin fail to rescue the UV hypersensitivity of the Hmgnl^''^' fibroblasts and the reduced rate of micrococcal nuclease digestion of the Hmgn2 gene in these cells. HMGN may facilitate access to nucleosomes by targeting histone HI and the amino termini of core histones. HMGNl may affect the accessibility of the transcribed chromatin regions to the NER either by facilitating the unfolding of the chromatin fiber, or by binding and stabilizing an already unfolded conformation.

The development or proliferation of the integument (such as one or more of the skin and its adnexal structures, such as eccrine sweat glands, sebaceous glands, epidermis, dermis, and hair growth recycling), can be modulated by altering HMGNl or HMGN2 activity in a tissue or a cell, for example by increasing or decreasing HMGNl or HMGN2 activity. The development or proliferation of the integument (such as the hair cycling growth rate), can be decreased by increasing HMGNl or HMGN2 activity in a cell, such as the cell of a tissue. In one example, increased HMGNl or HMGN2 activity can be used to treat a subject having a cancer associated with the epithelium, such as breast, skin, or lung cancer (to reduce proliferation of the respective epidermal tissue). Increasing HMGNl or HMGN2 activity can also be used to treat a subject having a skin cancer or other hyperproliferative skin conditions such as actinic keratoses or psoriasis (to reduce epidermal proliferation), acne (to reduce sebaceous gland development or activity), a subject having unwanted sweat glands such as hyperhidrosis of the axillae, palms and soles, (to reduce eccrine sweat gland development or activity) or a subject having hirsutism or other unwanted hair (to decrease the rate of hair growth) or to slow hair growth to reduce the need for shaving or hair cuts.

Conversely, development or proliferation of skin and one or more adnexal structures, can be increased by decreasing HMGNl or HMGN2 activity in the tissue, such as the skin. For example, increased integumentary proliferation (such as increased adnexal proliferation, increased dermis or epidermis proliferation, or increase hair growth cycling) can be acheived in a tissue by decreasing HMGNl or HMGN2 activity in the tissue. Increasing hair growth cycling rate can be used to treat a subject having baldness or alopecia, or to increase the length of the hair. Increasing the proliferation of the epidermis or dermis can be used to assist in healing a wound.

The repair of DNA-damage in a cell can be enhanced by increasing HMGNl or HMGN2 activity in a cell. Examples of DNA-damage include, but are not limited to, UV-induced DNA lesions such as cyclobutane pyrimidine dimers (CPD) and pyrimidine (6-4) pyrimidone photoproducts (6-4PPs); radiation such as x-rays or gamma-rays, and chemical-induced DNA lesions, such as those resulting from administration of chemotherapy. For example, increasing HMGNl or HMGN2 activity can be used to treat a subject having increased sensitivity to UV radiation, such as a subject having xeroderma pigmentosum, Cockayne syndrome, trichothiodystrophy, or photodamage. Subjects having radiation-induced DNA damage or chemical-induced DNA damage can also benefit by increasing HMGNl or HMGN2 activity to increase the rate of DNA repair in their cells. For example, subjects having skin cancer (such as a basal cell or squamous cell cancer) can benefit by increasing HMGNl or HMGN2 activity in their cells. In addition, increasing HMGNl or HMGN2 activity in a cell can be used to protect the skin from UV damage, for example by applying HMGNl or HMGN2 proteins to the skin, such as in a sunscreen composition.

HMGNl or HMGN2 activity can be increased by increasing HMGNl or HMGN2 expression in a tissue or cell, for example by increasing expression by at least 10%, at least 20%, at least 50%, or even at least 75% as compared to an amount of expression in the absence of the therapeutic agent. For example, a vector encoding HMGNl or HMGN2, or variants, fragments, or fusions thereof that retain HMGNl or HMGN2 activity, can be introduced into the cell or tissue, thereby allowing increased HMGNl or HMGN2 expression in the tissue or cell. In one example, the vector is a DNA sequence. In addition, HMG l or HMGN2 activity can be increased by administering a purified HMGNl or HMGN2 protein to a cell or tissue. The protein can be recombinant protein, for example a recombinant protein that includes a molecule to target HMGNl or HMGN2 to a skin structure, such as an antibody that recognizes a hair-follicle-specific antigen. In another example, HMGNl or HMGN2 activity is increased by administering a therapeutic amount of an HMG l or HMGN2 mimetic thereof that increases HMGNl or HMGN2 expression in the tissue.

In one example, an HMGNl or HMGN2 protein, nucleic acid molecule, specific binding agent, or mimetic thereof is administered at a therapeutieally effective amount, such as an amount sufficient to decrease development of proliferation of the integument. A therapeutieally effective amount can also include an amount sufficient to increase the rate of repair of DNA damage, such as UV-induced or x-ray-induced DNA damage, for example an increase of at least 10%, at least 20%, or even at least 50% as compared to an amount of repair in the absence of the therapeutic agent.

Methods that can be used to decrease or inhibit HMGNl or HMGN2 activity, include but are not limited to, disrupting expression of an HMGNl or HMGN2 nucleic acid sequence encoding HMGNl or HMGN2 proteins, (for example by functionally deleting the coding sequence, such as by a mutation, insertion, or deletion), altering the amino acid sequence or overall shape of an HMGNl or HMGN2 protein, degrading HMGNl or HMGN2 proteins, employing an agent that specifically binds HMGNl or HMGN2 (such as a specific binding agent, for example an antibody or small molecule), employing an HMGNl or HMGN2 antagonist, or a combination thereof.

For example, expression of an HMGNl or HMGN2 protein can occur during transcription or translation of a nucleic acid encoding an HMGNl or HMGN2 protein. Methods that can be used to interrupt or alter transcription of a nucleic acid include, but are not limited to, site-directed mutagenesis including mutations caused by a transposon or an insertional vector; and providing a DNA-binding protein that binds to the coding region of the host protein, thus blocking or interfering with RNA polymerase or another protein involved in transcription. Various inactive and recombinant DNA-binding proteins, and their effects on transcription, are discussed in Lewin, Genes VII. Methods that can be used to interrupt or alter translation of an HMGNl or HMGN2 nucleic acid molecule include, but are not limited to, using an antisense RNA or an siRNA that binds to a messenger RNA transcribed by an HMGNl or HMGN2 nucleic acid sequence. Disrupting the expression of an HMGNl or HMGN2 nucleic acid sequence can increase integumentary development or proliferation, for example an increase of at least 10%, at least 20%, or even at least 50%, as compared to an amount of development or proliferation in the absence of the therapeutic agent. Even if expression of an HMGNl or HMGN2 nucleic acid is not completely blocked or disrupted, integumentary development or proliferation can still increase. In one example, HMGNl or HMGN2 activity is decreased by interrupting or altering translation of an HMGNl or HMGN2 nucleic acid. In some examples, HMGNl or HMGN2 activity is decreased by at least 10%, such as at least 20%, at least 50%, or even at least 75% as compared to an amount of expression in the absence of the therapeutic agent. Methods that can be used to interrupt or alter translation of an HMGNl or HMGN2 nucleic acid include, but are not limited to, using an antisense RNA, RNAi molecule, or an siRNA that binds to a messenger RNA transcribed by the nucleic acid encoding an HMGNl or HMGN2 peptide. Decreasing or inhibiting the expression of HMGNl or HMGN2 nucleic acid sequences can be used to increase integumentary development or proliferation (such as increase skin proliferation, adnexal structure proliferation or hair growth cycling rate) for example an increase of at least 10%, at least 20%, or even at least 50%, as compared to an amount of development or proliferation in the absence of the therapeutic agent.

In one example, HMGNl or HMGN2 activity is decreased by using HMGNl or HMGN2 antisense molecules or siRNAs, respectively. For example, HMGNl or HMGN2 antisense molecules or siRNAs can be can be introduced into the cell or tissue at a therapeutic amount, thereby decreasing or inhibiting expression of HMGNl or HMGN2 nucleic acid molecules in the tissue or cell, respectively. For example, an expression vector that transcribes antisense RNA or siRNA that recognizes HMGNl or HMGN2 mRNA can be used to transform cells, such as the cells of a mammal, thereby resulting in increased integumentary development or proliferation, for example an increase of at least 10%, at least 20%, or even at least 50%, as compared to an amount of integumentary development or proliferation in the absence of the antisense RNA or siRNA. The vector, or other nucleic acid carrying the HMGNl or HMGN2 antisense of siRNA nucleic acid, can introduced into a cell, such as a cell in a subject, by any standard molecular biology method and can be included in a composition containing a pharmaceutically acceptable carrier.

In another example, HMGNl or HMGN2 activity is decreased by administering a therapeutic amount of an HMGNl or HMGN2 specific binding agent or HMGNl or HMGN2 antagonist, thereby decreasing HMGNl or HMGN2 activity in the tissue.

Examples of HMGNl and HMGN2 specific binding agents include, but are not limited to, an antibody, such as a polyclonal antibody, monoclonal antibody or fragment of a monoclonal antibody. For example, anti-HMGNl or HMGN2 protein binding agents can provide a therapeutic effect, for example by increasing integumentary development or proliferation. Effective amounts of such specific binding agents can be administered alone to a subject, or as part of a pharmaceutical composition, for the treatment of baldness, alopecia or a wound.

Screening for Agents Methods are provided for screening for agents that can decrease integumentary proliferation or development, such as skin development, adnexal structure development, or alters how quickly hair grows. In one example, the method involves administering the test agent to a non-human transgenic mammal (such as a mouse) having one or both of its HMGNl or HMGN2 genes functionally deleted or disrupted, such as an Hmgnl^+/', Hmgnl^{' '}, Hmgn2^{+ '} or Hmgn2^{' "}mouse, and subsequently determining whether the test agent affected the development of the skin, one or more adnexal structures, hair growth rate, or combinations thereof. The method can further include comparing the extent of skin and adnexal structure development in the transgenic non-human mammal in the presence of the agent, with the extent of such development in the absence of the agent. For example, if the treated Hrngnl^+/', Hmgnl^''^', Hmgn2^+A orH gn2^"/"mouse shows fewer sebaceous glands, or eccrine sweat glands, has a slower hair cycling growth rate, or has a slower rate of epidermal or dermal proliferation, compared to an untreated Hmgnl^+/', Hmgnl^''^', Hmgn2^+/' or Hmgn2^{' '} mouse, this indicates that the test agent decreases development of skin and adnexal structures and decreases the hair cycling growth rate.

In some examples, the method includes administering the test agent to an integument ex vivo or in vivo (such as a mouse, rat, rabbit, or human, having wild-type ΗMGN1 or ΗMGN2 genes), and determining whether the agent modulated HMGNl or HMGN2 expression or activity, such as increase or decrease in HMGNl or HMGN2 expression or activity. In some examples, the mammal has an integument disorder, such as a wound, psoriasis, baldness, alopecia, undesired hair, skin cancer, or in need of fewer/greater sweat glands. The method can further involve comparing an extent of HMGNl or HMGN2 expression or activity in the presence of the agent, with an extent of HMGNl or HMGN2 expression or activity in the absence of the agent.

HMGNl or HMGN2 expression or activity can be monitored using any assay known in the art, such as Western, Northern, or Southern blotting, or microarray technologies, h addition, specific methods for monitoring HMGNl or HMGN2 expression or activity are disclosed herein, such as monitoring mRNA expression levels using real time RT-PCR (Example 5), monitoring protein expression levels and the ability of HMGNl or HMGN2 to bind to chromatin/nucleosomes with immunofluorescence (Example 6), and monitoring the rate of digestion at which the HMGNl or HMGN2 gene is digested (see Example 6).

Agents that decrease HMGNl or HMGN2 expression or activity are candidate agents for increasing integumentary development, such as increasing development of eccrine sweat glands, increasing development of sebaceous glands, increasing the hair growth cycle rate, or combinations thereof. Such identified agents can be further assayed for their ability to increase integumentary development using the methods disclosed herein. In contrast, agents that increased HMGNl or HMGN2 expression or activity can be further assayed for their ability to decrease integumentary development, such as decreasing development of eccrine sweat glands, decreasing development of sebaceous glands, decreasing the hair growth cycle rate, or increasing repair of damaged DNA. Such identified agents can be further assayed for their ability to decrease integumentary development using the methods disclosed herein.

Also disclosed are methods of screening test agents that can increase repair of damaged DNA. Sources of DNA damage include photodamage, radiation damage, and chemical damage. In some examples, increasing the rate of repair of UV-damaged DNA decreases UV sensitivity of the cells. In some examples, the method includes administering a test agent to a transgenic non-human mammal functionally deleted for HMGNl or HMGN2, such as an Hmgrιl^+/', Hmgnl^''^', Hmgn2^+/' or Hmgnl^''^' mouse, and subsequently determining whether the agent affected the rate of repair of the DNA. The transgenic non-human mammal can be exposed to one or more sources of DNA damage, before, during, or following administration of the test agent. In one example, the method further includes comparing the extent of repair of DNA in the transgenic non-human mammal in a presence of the test agent, with an extent of repair of damaged DNA in the absence of the test agent. For example, if a treated Hmgn ^', Hmgnl^{' '}, Hmgnl^+/' or Hmgnl^''^" mouse shows a higher rate of UV-damaged DNA repair, or an increase in cell viability, as compared to an untreated Hmgn '^', Hmgnl^{" '}, Hmgnl* ^' or Hmgnl^''^' mouse, this indicates that the test agent(s) can increase repair of UV-damaged DNA.

Therapeutic Compositions Disclosed are compositions that include HMGNl or HMGN2 proteins or nucleic acid molecules, as well as HMGNl or HMGN2 mimetics or antagonists thereof. Such compositions can be used to treat a disorder associated with a defect in integumentary proliferation or DNA damage. For example, a composition including HMGNl (such as HMGNl protein, HMGNl cDNA, or HMG l mimetic) and one or more other anti-proliferative agents can be applied topically to treat skin cancer in a subject, such as basal cell cancer or squamous cell cancer. Exemplary anti-proliferative agents include 5-FU and mitomycin C.

In one example, a sunscreen composition including HMGNl (such as HMGNl protein, HMGNl cDNA, or HMGNl mimetic) can be applied topically to protect the skin from UV damage. In particular examples, the sunscreen composition also includes one or more of a therapeutieally effective amount of para-aminobenzoic acid (PABA), avobenzone, benzophenone- 1 , benzophenone-2, benzophenone-3 , benzophenone-4, benzophenone-6, benzophenone-8, benzophenone- 12, methoxycinnamate, ethyl dihydroxypropyl-PABA, glyceryl PABA, homosalate, methyl anthranilate, octocrylene, octyl dimethyl PABA, octyl methoxycinnamate, octyl salicylate, 2- phenylbenzimidazole-5-sulphonic acid, triethanolamine salicylate, 3-(4- methylbenzylidene)-camphor, red petrolatum, titanium oxide, oxybenzone, octyl dimethyl p-aminobenzoic acid, DEA methoxycinnamate, homosalate, menthyl anthranilate, octocrylene, phenylbenzimidazole sulfonic acid, TEA salicylate, isopropyl dibenzoyl methane, butyl methoxy-dibenzoylmethane, etocrylene, PEG-25 PABA, and octyl triazone. In particular examples, these protecting components can be present in an amount of 0-15% w/w, such as 2.0-8.0% w/w in the composition.

In addition, a composition including an HMGNl antagonist (such as HMGNl antisense or siRNA) and one or more other hair-stimulating agents (such as minoxidil) can be applied topically to increase hair growth. In a particular example, a composition including an HMGNl antagonist (such as HMGNl antisense or siRNA) and one or more other hair-stimulating agents (such as finasteride) can be administered orally to a male to increase hair growth.

Topical compositions can further include DMSO or other pharmaceutical carriers to enhance the ability of the therapeutic agents to enter the cells of the skin. EXAMPLE 1 Generation of Hmgnl ^1' Mice

This example describes methods used to generate Hmgnl^''^' mutant mice. The Hmgnl gene was inactivated (functionally deleted) by replacing part of its genomic sequence with a neomycin resistance cassette (Neo) as follows. Similar methods can be used to generate Hmgn2^''^' or Hmgnl^+/'mutant mice, as well as other Hmgnl^''^' or HmgnT '^' non-human transgenic mammals.

Hmgnl containing clones from a 129 Sv λ EMBL3 phage library were identified by screening with intron specific probes obtained by PCR of genomic mouse DNA. The 4.5 kbp Sac VNot I and 2.5 kbp Sac WSac I restriction fragments (FIG. 1) were sequentially subcloned to generate the targeting vector containing the Neo l-Sac I region of the gene in which the neomycin cassette replaces part of intron 1, exons 2, 3 and part of exon 4. The targeting vector included the TK gene with its promoter (FIG. 1, _*) 5' to Hmgnl sequence. The Neo gene linked to HSV TK promoter (FIG. 1, _*) replaced the Hmgnl sequence from the middle of intron I to the middle of exon IV. An Xba I site introduced in the targeting vector and two genomic Xba I sites flanking the Hmgnl gene were used to determine the homologous recombination, using the external probe 3' to exon V. The Xlio I-linearized targeting vector was electroporated into ESVJ- 1183 cells grown in the presence of G418 and gancyclovir. ES cells were genotyped by Southern analysis of .XbαZ-digested DNA probed with either a 400 bp fragment from intron V DNA, located 3' to the targeting vector (FIG. 1, external probe), or an internal probe spanning a 1 kb region starting from the middle of exon TV ("internal probe"), or a Neo probe. The targeted ES cell clones were injected into C57 BL/6 blastocysts and transferred into pseudopregnant NIH black Swiss females. The resulting chimera males were mated with C57BL/6 and 129 Sv females.

Genotyping of the tail clip-DNA was performed by Southern using the 3' external probe, with an internal probe (from intron IV), and with a Neo probe verified that the vector targeted the correct sequence. The 15 kb and 4.1kb fragments correspond to the wild type and mutated allele, respectively.

The progeny of male chimera mice were genotyped by PCR with primers (FIG. 1, black arrowheads and numbered 1, 2, 3) that distinguish between the wild type and the mutated allele. Primers 1 and 2 identify the mutated allele, and primers 1 and 3 identify the wild type allele. PCR analysis was compared between DNA samples from Hmgnl^{+ +}, Hmgnl^+/' and Hmgn ^"mice. It was demonstrated that Hmgnl* ^' and Hmgn ^''^' mice express the mutated allele, while Hmgnl* * and Hmgnl* ^' mice express the wild- type allele. HMGNl protein expression was determined using western blot analysis of 5% perchloric acid (PC A) extracts using affinity pure antibodies to mouse HMGNl. It was demonstrated that Hmgnl^''^' mice do not express detectable levels of HMGNl protein, and Hmgnl heterozygotes express about half of that HMGNl protein detected in wild type cells, supporting previous observations that Hmgnl gene expression is dosage dependent (Vash et al., Proc Natl Acad Sci USA 87:3836-40, 1990). Similar results were obtained when gene expression was monitored by Northern analysis using mouse Hmgnl cDNA. In addition, Western and Northern analysis demonstrated that transcription of the closely related Hmgnl gene and cellular levels of HMGN2 protein were not affected by the loss of HMGNl protein. The frequency ratio of the Hmgnl^''^' pups from mating of Hmgnl^"'* heterozygotes (>900 pups genotyped) was 0.08 rather than 0.25, as would be expected from a Mendelian distribution of the Hmgnl^' allele. It is likely that the low number of Hmgnl^''^' offspring is due to events occurring in early stages of embryonic development, since the genotype distribution in 11.5 day embryos was the same as that in born pups. Furthermore, in the matings of over 150 Hmgnl^''^' pairs, the average litter size was

7±1.7, while that obtained from Hmgnl*'* matings was 11+ 2. The 30% decrease in the litter size from the Hmgnl^{' '} matings and the low frequency of Hmgnl^{' '} pups from mating of Hmgnl heterozygotes indicate that HMGNl protein has a role in embryonic development. EXAMPLE 2 Effect of Decreased HMGNl expression on Skin and Hair Development

This example describes the phenotype of the Hmgnl^'1' and Hmgnl^'1* mice generated in Example 1. Hmgnl^'1' mice had numerous changes in the skin and hair.

Hmgnl^" ice were observed to have longer peripheral hairs than wild-type mice. In addition, a faster hair growth rate was observed in Hmgnl^'1' mice. Wild-type and Hmgnl^''^' ice 7-11 weeks old were completely shaved on an area on the back, and hair growth subsequently observed 24 hours- 1 week following shaving. As shown in FIG. 2, Hmgnl^'1' mice regrew hair more quickly than wild-type or heterozygous mice.

In other examples, hair was removed by depilation, and re-growth of hair monitored. Depilation synchronizes the hairs so that they are in phase. Following such treatment, changes related to "cycling" of the hair growth cycle were observed. The normal hair growth cycle includes a growing phase (anagen), resting phase (catagen), and falling out phase (telogen). When mice were followed over time, there was an acceleration of the cycling of hair growth (FIGS. 3 and 4A-C). In addition, it was observed that Hmgnl^{' '} mice had shortened hair length at catagen and telogen, but not anagen, indicating a faster rate of hair growth.

Using standard in situ hybridization and immunohistochemistry methods, along with HMGNl- specific antibodies and antisense molecules, expression of HMGNl in skin components during development in wild-type mice was determined. The HMGNl antisense molecule recognized the entire open reading frame of HMGNl, and the antibody was previously described (Bustin et al, J. Biol. Chem. 265:20077-80, 1990). HMGNl protein expression was observed in the basal layers, outer root sheath (ORS), hair follicles and epidermis regions of the skin, while HMGNl mRNA expression was observed in the basal layers, ORS, epidemis, and hair follicles.

To demonstrate that HMGNl proteins are co-expressed in hair stem cells along with other hair stem cell markers such as betal-integrin, cytokeratin-15, and p63 were used. It was observed that both HMGNl and p63 are expressed at the same locations (basal layer, ORS, and hair follicles) in Hmgn* mice at catagen. However, in Hmgnl^' '^' mice, p63 expression is decreased and p63 expression is altered at catagen. In addition, it was observed that p21 expression was increased in Hmgnl^''^' mice.

An increase in the growth capacity of many skin components in Hmgnl^''^' mice, including an increase in epidermis, epidermal appendages and dermis was observed.

Heterozygous Hmgnl*'^' mice had an intermediate phenotype between Hmgnl^''^' and Hmgnl*'* mice. That is, Hmgnl*'^'mice had increased number and growth of skin structures such as epidermis, and dermis, as compared to wild-type Hmgnl* * mice, but less than the amount of growth observed in Hmgnl^''^' mice. Therefore, antagonists of HMGNl, such as HMGNl antibodies or antisense molecules, can be used to stimulate growth of skin and adnexal structures, including the hair cycling growth rate. Conversely, HMGNl nucleic acid molecules and proteins, as well as HMGNl mimetics thereof, can be used to decrease growth of skin and adnexal structures, including the hair cycling growth rate..

EXAMPLE 3 Increased Sensitivity to UV-B Irradiation in the Skin of Hmgnl^''^' Mice This example describes methods used to determine the UV sensitivity of Hmgnl^' '^' mice. Mice were anaesthetized by IP injection of 2.5% avertin (300 μl/mouse) prior to each treatment. The backs of shaved 8-10 week old Hmgnl* * and Hmgnl^{" '} littermates (9 of each), were irradiated with UV-B (FS20 sunlamp) at a cumulative dose of 1.2 kJ/m for 1 week. This dose produces detectable damage in the skin of XPA^{' '} mice (de Boer et al, Cancer Res. 59:3489-94, 1999; de Vries et al, Nature 377:169-73, 1995). On the seventh day, two hours after the last treatment, the animals were euthanized and skin samples were taken from irradiated and non-irradiated areas and as additional controls, from non-irradiated animals. Skin specimens were fixed in 10% buffered formalin phosphate, embedded in paraffin and 6 μm thick sections were stained with haematoxylin and eosin. The lowest UV-B dose that induced erythema and edema after 24 hours on the shaved backs of C57 BL/6 mice was considered as the minimal erythema/edema dose (MED) for this mouse strain.

Exposure to 1.2 kJ/m² of UV-B irradiation for 1 week produced acute alterations in the skin of Hmgnl^''^' mice but not in the skin of control, wild type litterrnates. Histopathological examination of skin samples showed marked acanthosis and localized hyperkeratosis in the epidermis of irradiated, but not in the non-irradiated areas taken from the Hmgnl^''^' mice or in samples taken from irradiated skin of control, Hmgnl* * mice. Therefore, loss of HMGNl expression increased the sensitivity of the skin to the hyperproliferative effects of UV-B irradiation. As a result, increased HMGNl expression can reduce UV sensitivity in a subject.

EXAMPLE 4

Impaired DNA Repair in Hmgnl^''^' Embryonic Fibroblasts This example describes methods used to prepare and grow primary mouse embryonic fibroblasts (MEF) and MEF cell lines, and subsequently expose them to irradiation and determine rates of DNA repair. After removal of the head and viscera, E13.5 embryos were digested in 0.25% trypsin at 37 C with gentle pipetting for 30 minutes. The dissociated fibroblasts were allowed to settle and then cultured in 150 cm plates in DMEM with 10% FBS under 5% CO₂ at 37 C. Cell lines were established by transforming the primary embryonic fibroblasts with SV40 ts mutant virus by incubating the cells with a solution of purified virus (Chou, Mol. Endocrinol. 3:1511-4, 1989; Jat and Sharp, Mol. Cell. Biol. 9:1672-81, 1989).

UV survival of MEF cells was measured as follows. All treatments commenced 24 hours after plating 5 x 10⁴ cells into 35 mm dishes. The medium was aspirated and replaced with 0.5 ml PBS. Subsequently, the cell plates were chilled and UV-C irradiated (UV Systems, LS-15, 254 run) at the indicated doses. Fresh medium was added to the plates immediately after irradiation and cell survival was determined 72 hours after treatment by counting the number of trypan blue excluding cells. Survival is expressed as a percentage, using untreated cells as the 100% value. All experiments were conducted in triplicate and repeated at least twice. As shown in FIG. 5, primary MEFs prepared from 13.5 day old Hmgnl^''^' embryos were more sensitive to UV-C irradiation than MEFs prepared from Hmgnl*'* littermates. The D5₀ (UV dose resulting in 50% survival) for Hmgnl^''^' MEFs was 3 J/m² , a value 4.5 times lower than the D₅₀ of 13.5 J/m² observed in the irradiated Hmgnl*'* MEFs (FIG. 5). The survival of the heterozygote MEFs was intermediate between that of the wild type and Hmgnl^''^' MEF cells, indicating a dose dependent correlation between loss of HMGNl protein and the UV- sensitivity of the cells. Therefore, MEFs lacking HMGNl are impaired in their ability to repair damage due to UV.

Cellular survival from UV irradiation is directly linked to the cell's ability to repair its UV-damaged DNA and remove cyclobutane-pyrimidine dimers (CPDs) from chromatin (Thoma, EMBO J. 18: 6585-98, 1999). In view of the low survival rate of Hmgnl^{" "} cells after UV irradiation, a determination was made as to whether lack of HMGNl protein impairs the repair of UV damage in cellular chromatin. Since murine cells lack global DNA repair, but have an active transcription-coupled repair (Bohr et al, Cell 40:359-69, 1985; Hanawalt, Environ. Mol. Mutagen. 38:89-96, 2001), the rate of CPDs removal from two transcribed genes, Dhfr and Hmgnl, was determined as follows.

Genomic DNA was isolated at various times after UV-C irradiation (30 J/m²) and restricted with either Eco RI (to detect the 15 kb fragment of the Dhfr gene) or Bgl II (to detect the 10 kb fragment of the Hmgnl gene), and half of each sample was further digested with T4 Endonuclease V (Epicentre Technologies) which specifically induces single strand breaks at each CPD. Therefore, in T4 endonuclease V-treated DNA, the intensity of a restriction fragment is inversely correlated with the number of CPD present (Bill et al, J. Biol. Chem. 266:21821-6, 1991). Quantitative Southern analysis (Image Quant-Molecular Dynamics) of fragments detected with a 2.9 kb Eco Til/Eco RV probe from plasmid pBR327 (V. Bohr, NIH) containing the Dhfr gene, or a 560 bp Bam Hi/Hind TTL probe from plasmid pXT17 containing the Hmgn2 gene, allowed estimation of the rate of removal of the CPD from the chromatin of the cells. For each time point, the intensity of the restriction fragment obtained in DNA that was not digested with T4 endonuclease V was taken as 100%. The results obtained by Southern analysis were independently verified by semi- quantitative PCR, using primers that amplified specific regions of Dhfr or Hmgnl.

As shown in FIG. 6, Southern blotting and PCR analysis of the Dhfr and Hmgnl genes demonstrated that the rate of CPDs removal from the chromatinised DNA in Hmgnl^''^' MEFs was significantly impaired. In the Hmgnl^''^" cells, over 60% of the UV lesions in the Hmgnl and 80% of the lesions in the Dhfr genes were still present 24 hours after irradiation, while only about 20% remained in the Hmgnl*'*. The inefficient removal of CPDs in Hmgnl^"'^' MEFs is believed to increase sensitivity to UV irradiation, such as UV- A, UV-B, and UV-C irradiation.

EXAMPLE 5

The Nucleotide Excision Repair Machinery Remains Functional in Hmgnl^"'^' MEFs

Removal of the UV induced damage from the chromatin by the nucleotide excision repair (NER) complex involves several steps (Balajee and Bohr, Gene 250: 15- 30, 2000; Hoeijmakers, Trends Genet, 9:211-7, 1993). The first step involves efficient access of the NER complex to the damaged DNA, the second involves removal of the damage and the third involves restoration of the nucleosome structure at the repaired site. The results disclosed in this example demonstrate that loss of HMGNl activity does not alter the expression of NER machinery components.

To demonstrate that expression levels of NER components are not affected by HMGNl, cDNA microarrays were used to compare four sets of expression profiles of Hmgnl^"'^' and Hmgnl*'* cells before and six hours after UV-C irradiation at 3 J/m². The arrays included 15 out of the 27 genes listed as NER components in the data base (Wood et al, Science 291 : 1284-9, 2001). RNA was purified using Trizol (Life

Technologies) followed by RNeasy (Qiagen) as recommended by the manufacturers. Fluorescently-labeled cDNA was prepared using anchored oligo (dT) primer and the Cyscribe first strand cDNA labeling kit (AP Biotech). Cy3 and Cy5-labeled samples were combined and hybridized to a glass microarray slide at 65°C overnight. Mouse expression arrays from the Advanced Technology Center, NCI/ N H, contained 10,368 cDNA spots from the Incyte mouse GEM2 clone set. Arrays were scanned and quantified using the GenePix 4000A microarray scanner. Two separate reverse-fluor hybridizations were performed, and genes selected that showed greater than 1.3 fold change in both hybridizations. Individual mRNAs were quantified by real time RT- PCR using SYBR green and an ABI PRISM ® 7900HT sequence detection system, as described by the manufacturer (Applied Biosystems). Expression levels were normalized to GAPDH, and differences calculated using the ΔΔCt method (Applied Biosystems). Four sets of expression profiles were compared (FIG. 7A). In set a, the expression profile of wild type (Hmgnl* *) was compared in cells before, and six hours after, UV-C irradiation. In set b, the expression profile of Hmgnl^''^' cells before and 6 hours after UV-C irradiation was compared. In set c, the expression profile of wild type Hmgnl*'* cells to that of Hmgnl^''^' cells before irradiation was compared. In set d, the expression profile of Hmgnl*'* cells was compared to that of Hmgnl^''^' cells 6 hours after UV irradiation.

The number of genes whose expression changed (either increased or decreased) by more than 1.3 fold in each array is indicated for the sets shown in FIG. 7A, and ranged from 52 to 176; however none of these genes are known NER components as listed in Wood et al. {Science 291:1284-9, 2001). However, the expression level of a few genes potentially associated with apoptosis and DNA damage, including Gadd45a (Hollander and Fornace, Oncogene 21:6228-33, 2002), were induced in Hmgnl^''^' cells to a greater extent than in Hmgnl* * cells (Table 1). Since none of the genes shown in Table 1 are considered part of the NER machinery, the elevated levels of these transcripts reflect, rather than cause, the decreased ability of the Hmgnl^''^' cells to repair UV damage. Table 1: Genes involved in the response to DNA damage with an altered expression in

Hmgnl^"'^" cells compared to Hmgnl*'* cells, 6 hours after UV irradiation.

Expressior i Gene Function

Levels

KO/WT

2.1 Gadd45a (Growth arrest and Induced by stresses. Stimulates DNA repair

DNA-damage-inducible 45 alpha) and inhibits entry into S phase.

1.6 Rad21 (RAD21 homolog, S. Involved in repair of ionizing radiation- pombe) induced DNA damage in yeast; part of cohesin; cleavage of RAD21 by caspase activates apoptosis.

1.4 Apexl (Apurinic/apyrimidinic Endonuclease involved in DNA repair endonuclease 1)

1.3 Hells (Helicase, lymphoid Helicase; possible role in DNA repair. specific)

1.4 Smarca (SWI7SNF related)5 Part of chromatin remodeling complex; possible role in DNA repair.

1.7 Caspl2 (Caspase 12) Protease; induces apoptosis

1.5 Casp3 (Caspase 3, apoptosis Protease; induces apoptosis related cysteine protease)

1.4 Tia (1 Cytotoxic granule- Apoptosis; induces DNA fragmentation associated RNA binding protein 1 )

To verify that Hmgnl^''^' cells contain functional NER machinery a host cell reactivation assay was used as previously described (Protic-Sabljic and Kraemer, Proc. Natl. Acad. Sci. USA 82:6622-6, 1985). The ability of Hmgnl^"'^' and Hmgnl*'* MEFs to repair the UV-induced damage in luciferase expressing plasmids, which were irradiated with increasing doses of UV prior to transfection, was determined as follows. Briefly, the pGL3 promoter vector (Promega) containing the luciferase gene under the CMV promoter, was treated with UV-C at different doses and transfected into 1.5 x 10⁵MEFs in 35 mm plates using Lipofectamine 2000 reagent (GibcoBRL). After 48 hours, luciferase activity was measured with a luminometer (TD-20/20, Turner Designs) using a luciferase assay system (Promega) as recommended by the manufacturer. Total protein in the cell lysates was measured by Bio-Rad Protein Assay. The relative luciferase activities were expressed as percentage of expression from non-irradiated control plasmids, which were taken as 100% (Emmert et al, Dermatol. 118:972-82, 2002).

As shown in FIG. 7B, the luciferase activity recovered from the Hmgnl^''^" and Hmgnl* * MEFs extracts was similar, which indicates that the UV-irradiated plasmids were repaired at the same rate in the two cell types. Therefore, the UV hypersensitivity observed in cells lacking HMG l protein is not a result of specific changes in the expression of genes coding for the major NER machinery components. All known components necessary to repair the UV induced damage in cellular DNA are present and functioning in Hmgnl^''^' MEFs.

EXAMPLE 6

Loss of HMGNl Impedes Access to UV Damaged Sites in Cellular Chromatin

The chromatin structure and transcriptional regulation of transiently transfected plasmids is different from that of the endogenous cellular chromatin (Archer et al, Science 255:1573-6, 1992). The observation that loss of HMGNl protein impairs the repair of cellular genes (FIG. 6) but not transfected plasmids (FIG. 7B), indicates that the UV sensitivity of the Hmgnl^''^' cells is linked to the ability of HMGNl to reduce the compaction of the higher order chromatin structure.

Revertant Hmgnl^''^' MEFs were generated that express wild type HMGNl under the control of the inducible tetracycline response element (TRE) promoter. SV-40- immortalised Hmgnl ^{" '} embryonic fibroblasts were co-transfected with linearised pTet- On, pTet-tTS (Clontech) and pZeoSV2 (Invitrogen). Cells were plated in 2% methocel (Fluka) containing 50 μg/ml zeocin (Invitrogen) to isolate colonies of stable integrants. Colonies were expanded and screened for the ability to induce doxycycline-dependent expression from a transiently transfected TRE (tetracycline response element) reporter plasmid. The best clone was transfected with pTK-Hyg, and either pBI-G-HMGNl, to generate line #622, or pBI-G-HMGNlS20/24E (Primakovska-Bosak, 2001) to generate line #85, which are derived from pBI-G (Clontech). pBI-G-HMGNl contains the open reading frame of human HMGNl inserted in the Sal 1/Not I sites. Cells were plated in methocel containing 50 μg/ml zeocin and 100 μg/ml hygromycin (Clontech). Colonies were expanded and screened for doxycycline-induced HMGN expression.

Induction of the TRE promoter by addition of doxycycline gradually increased the cellular levels of HMGNl until they were comparable to those in HeLa cells. Induction of HMGNl expression increased the UV-C survival of the cells (FIG. 8A). In the absence of doxycycline, the D₅₀ of the HMGNl revertant cells remained 3 J/m², while in cells grown in the presence of the inducer the D₅₀ was 12 J/m², a level comparable to wild type MEFs (compare FIG. 8A to FIG. 5). The UV sensitivity of control cells transfected with Tet inducible plasmids that do not express HMGNl was not affected by addition of doxycycline and the survival level remained low regardless whether they were grown in the presence or absence of the inducer (FIG. 8A). Thus, the hypersensitivity of the Hmgnl^''^" MEFs to UV irradiation is linked to the absence of HMGNl protein.

To demonstrate the molecular mechanism whereby HMGNl affects the cellular UV response, wild type and Hmgnl^{' '} MEFs were transfected with plasmids expressing either intact HMGNl protein, the HMGNl S20,24E double point mutant that cannot bind to chromatin (Prymakowska-Bosak et al, Mol. Cell. Biol. 21:5169-78, 2001), with HMGN1-CHUD, a C-terminal deletion mutant which binds to nucleosomes but does not unfold chromatin (Ding et al, Mol. Cell. Biol, 17:5843-55, 1997), or with an empty plasmid vector as a control. The transfected cells were irradiated with UV-C 24 hours after transfection and the sensitivity to irradiation (survival rate) evaluated 72 hours later.

Point and deletion mutants of HMGNl cDNA subcloned into pCI-neo (Promega) mammalian expression vectors, were transfected into 5 x 10⁵ MEFs, in 35 mm plates, using Lipofectamine 2000 reagent (GibcoBRL). Twenty-four hours later, the cells were UV irradiated at the indicated dosages and the cell survival rate was determined 72 hours after irradiation, as described above. Survival was expressed as a percentage using transfected nontreated cells as the 100% value. Methods were conducted in triplicate and repeated at least twice. Transfection efficiency for each plasmid was over 60% as determined by cotransfection with green fluorescent protein (GFP) HMGN-fusion proteins. Expression levels of the protein from the various transfected plasmids were similar to each other, as determined by immunofluorescence (Prymakowska-Bosak etal.,Mol. Cell. Biol 22:6809-19, 2002; Prymakowska-Bosak et al, Mol Cell. Biol. 21:5169-78, 2001). As shown in FIG. 8B, the UV hypersensitivity of the Hmgnl^''^' MEFs could be rescued by transfection with plasmids coding for intact HMGNl protein, in agreement with the result with the inducible revertant cells expressing HMGNl (FIG. 8A). In contrast, transfection either with plasmids coding for the nucleosomal binding domain (NBD) mutant that cannot bind to nucleosomes, or with the C-terminal deletion mutants that cannot unfold chromatin, did not rescue the UV sensitivity of the Hmgnl^''^' MEFs (FIG. 8B). This observation that expression of intact, but not of mutant HMGNl, rescues the ability of the cell to survive UV induced DNA damage indicates that through a direct interaction with nucleosomes, HMGNl facilitates alterations in chromatin structure that ultimately enhance the rate of repair of the damaged DNA. The observation that HMGNl rescues the UV hypersensitivity of Hmgnl^''^'

MEFs, taken together with the decreased rate of CPD removal in these cells (FIG. 6), indicates that HMGNl protein is at, or near the sites of active UV repair. To demonstrate that HMGNl protein is associated with Dhfr and Hmgnl, the two genes whose rate of UV repair was impaired in Hmgnl^{' '} MEFs (FIG. 6), isolated chromatin regions containing HMGNl from Hmgnl*'* MEFs were isolated by chromatin immunoprecipitation assays (ChEP) with affinity pure antibodies to mouse HMGNl as described previously (Orlando et al, Methods 11:205-14, 1997) and modified by Upstate Biotechnology. Chromatin isolated from Hmgnl^''^' MEFs served as negative controls. Briefly, formaldehyde (Sigma) was added to a final concentration of 1% directly to the medium of primary Hmgnl*'* and Hmgnl^''^' MEFs grown to 95% confluence in Dulbecco's modified Eagle's medium (DMEM) with 10% (v/v) fetal bovine serum at 37°C. Cells were sonicated to produce -200-800 bp DNA fragments. HMGN1- containing fragments were purified with affinity pure rabbit anti-mouse HMGNl peptide 6 antibodies (Bustin et al, J. Biol. Chem. 265:20077-80, 1990). For semiquantitative PCR, 30-40 cycle-PCR reaction (95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds) were performed with 1-5 ng DNA of input samples or with 0.2-1% (v/v) of the IP sample. Real-time PCR reactions were performed using an ABI PRISM 7900HT Sequence Detection System and SYBR Green PCR master mix (Applied Biosystems, CA) with appropriate primers (FIG. 9A). ChIP values normalized to input.

The amount of chromatin DNA recovered from Hmgnl^{' '} MEFs was negligible, and was in the order as that usually obtained with non-immune IgG. The immunoprecipitated DNA contained both Dhfr and Hmgnl genes. To obtain a more accurate indication of the relative amount of HMGNl in transcribed genes imunoprecipitated DNA was analyzed by quantitative RT-PCR. Since in murine cells most UV repair is coupled to transcription, the amount of transcribed Dhfr and Hmgnl was normalized to β-globin, a gene not actively transcribed in MEFs. The value for β- globin was set to one, and the bar graphs represent the average of three experiments. By quantitative RT-PCR analysis the Dhfr gene was enriched 11-fold, and the Hmgnl gene up to 6-fold over the globin gene (FIG. 9B). Thus, HMGNl is preferentially associated with actively transcribed genes.

To demonstrate that the association of HMGNl with the Dhfr and Hmgnl genes affects their chromatin structure and enhances the NER process by increasing the accessibility of the DNA in these genes, nuclei isolated from the livers of either Hmgnl^' '^' or Hmgnl* * mice were digested with micrococcal nuclease as follows. Nuclei were isolated from mouse livers by ultracentrifugation through layered 1.7 M and 2.3 M sucrose solutions (Hewish and Burgoyne, Biochem. Biophys. Res. Cornmun. 52:504-10, 1973) and digested with micrococcal nuclease (Sigma- Aldrich N5386) for five minutes at 25°C and the extent of digestion analyzed as previously described (Einck et al, Biochemistry 25:7062-8, 1986).

The ethidium bromide stained nucleosomal ladder (Nl to N6), which is indicative of the overall rate of digestion of the chromatin, was compared to the ladder resulting from Southern analysis with a probe specific for the Hmgnl gene which is indicative of the rate of digestion of this specific gene. The rate of chromatin digestion (the conversion of the chromatin fiber into progressively smaller oligonucleosomal units) is an indication of the accessibility of the linker DNA to the enzyme. 5 After 5 minutes of digestion with 2 units of enzyme the average ethidium bromide stained nucleosome length in the digest of nuclei isolated from either Hmgnl^''^' ox Hmgnl*'* mice was 2.88 and 2.91, respectively (Table 2). After a five minute digestion with 11 units, the average lengths were 1.42 and 1.46 nucleosomes. Thus, the ratio of the average nucleosomal lengths (length in the -/- cells to length in +/+ cells,

10 expressed as Hmgnl^''^' I Hmgnl*'*) is close to 1 , an indication that the overall accessibility of the chromatin to micrococcal nuclease is the same in the two cell types. In contrast, in the autoradiogram which measures the accessibility of the Hmgnl gene, the ratio is about 1.3, an indication that in the Hmgnl^{' '} nuclei, the Hmgnl gene is digested slower than in the wild type, Hmgnl* * nuclei (FIGS. 10A and 10B). The

15 average Hmgnl^''^' I Hmgnl*'* ratio obtained was 1.02 for the ethidium bromide lanes and 1.48 for the lanes measuring the Hmgnl organization (Table 2). Thus, loss of HMGNl decreases the rate at which the chromatin region containing the Hmgnl gene is digested into smaller chromatin fragments, an indication that loss of this protein decreases the accessibility of the Hmgr l gene to micrococcal nuclease, and by analogy to the NER

20 system. The reduced accessibility of the UV damage to the NER system may account for the reduced removal of the CPD from the Hmgnl^''^' genome and for the lower rate of cell survival.

Table 2. Average nucleosome length (L_a) following Micrococcal nuclease digestion.

25

* Average from 3 different experiments

L_a- average nucleosome length was calculated as: La= ∑_NI-NO (P_N)- Nl to N6 is the oligonucleosome size (mono, di) and P_N is the fraction of a particular oligonucleosome size out of the total scan (the region covering mono- to hexa- nucleosomes was scanned) Statistical significance of the two groups was determined by t-test, p<0.01.

EXAMPLE 7 Therapeutic Applications of Decreasing HMGNl and HMGN2 Activity

This example discloses several therapeutic applications of decreasing HMGNl or HMGN2 activity. For example, HMGNl or HMGN2 antagonists can be used to interfere with HMGNl or HMGN2 activity and thereby increase integumentary proliferation or development (such as the skin, adnexal structures, and hair growth cycling rate), for example in the treatment of baldness or alopecia, or to increase epithelial cell proliferation or sweat gland development, for example in the treatment of a wound or burn. The therapies provided can be used alone or in combination with other therapies, depending on the condition of the subject to be treated.

In one example, a non-functional form of an HMGNl or HMGN2 protein, such as a truncated HMGNl or HMGN2 protein (such as an HMGNl or HMGN2 protein including no more than 50 amino acids, such as no more than 10 amino acids, for example 10-50 amino acids or 10-20 amino acids), serves as an HMGNl or HMGN2 antagonist, respectively. An HMGNl or HMGN2 antisense, RNAI, or siRNA molecule can also function as an HMGNl or HMGN2 antagonist, respectively. Such peptides and nucleic acid molecules can decrease or abrogate HMGNl or HMGN2 function in vivo when expressed or applied therapeutieally. In another example, antagonists of HMGNl or HMGN2 protein activity are generated by producing antibodies that bind to HMGNl or HMGN2, respectively, thereby decreasing HMGNl or HMGN2 biological activity, respectively. Such antibodies are antagonists of HMGNl or HMGN2, and can be used to increase the growth or development of the integument (such as skin and adnexal structures), for example an increase of at least 5%, such as at least 10%, at least 20%, or even at least 50%, as compared to an amount of growth or development in the absence of the therapeutic agent. Interfering with HMGNl or HMGN2 activity stimulates the growth of the integument such as dermis and epidermis (functional deletion of HMGNl increases hair and skin development, see EXAMPLE 2) to advance healing of the skin in cases of wounds, trauma or burns (Dev. Biol. 1988, 130:610-20). In pigs, sweat glands can re- epithelialize damaged skin, thus their stimulation has therapeutic uses (J. Invest. Dermatol 110:13-9, 1998).

HMGNl or HMGN2 activity can be decreased to increase hair growth in a subject. In a specific example, HMGNl or HMGN2 activity is decreased by administering HMGNl or HMGN2 antisense molecules, siRNA molecules, RNAi molecues, or antibodies, or other agents that decrease HMGNl or HMGN2 activity. The agent that decreases HMGNl or HMGN2 activity is applied or administered to the subject in whom increase hair growth is desired, for example a protein or antibody can be applied to the scalp at concentrations ranging from 1 ng/ml to 1 g/ml. An increase in the rate of hair growth cycling when the agent that decreases HMGNl or HMGN2 activity is applied compared to the administration of no agent, indicates the ability of the agent to interfere with HMGNl or HMGN2 activity and increase hair growth cycling. Particular examples of an increase in the rate of hair growth cycling or hair density are an increase of at least 5%, at least 10%, at least 25% or more, as compared to a number in the absence of the therapeutic agent. hi yet other examples, HMGNl or HMGN2 activity is decreased to increase eccrine sweat gland development in individuals for whom the normal sweating mechanism is compromised, for example by disease, trauma, burns or surgery. In a specific example, HMGNl or HMGN2 activity is decreased by administering HMGNl or HMGN2 antisense molecules, RNAi molecules, siRNA molecules, or antibodies, or other agents that decrease HMGNl or HMGN2 activity. Agents that decrease HMGNl or HMGN2 activity are applied or administered to the subject in whom increased eccrine sweat gland development is desired, for example a protein or antibody can be applied to desired areas of the skin at concentrations ranging from 1 ng/ml to 1 g/ml. An increase in the number of eccrine sweat glands when the agents are applied as compared to the administration of no agents indicates the ability of the agent to stimulate eccrine sweat gland development. Particular examples of an increase in the in the number of eccrine sweat glands are increases of at least 5%, 10%, 25% or more as compared to a number in the absence of the therapeutic agent. HMGNl or HMGN2 activity can be decreased to stimulate epidermal growth, for example to increase healing in cases of trauma or burns. In a specific example, HMGNl or HMGN2 activity is decreased by administering HMGNl or HMGN2 antisense molecules, siRNA molecules, RNAi molecules, or antibodies, or other agents that decrease HMGNl or HMGN2 activity. Agents that decrease HMGNl or HMGN2 activity are applied or administered to the subject in whom increased epidermal growth is desired, for example a protein or antibody can be applied to desired areas of the skin (such as at a wound or burn site) at concentrations ranging from 1 ng/ml to 1 g/ml. An increase in the rate of wound healing when the agents are applied as compared to the administration of no agents indicates the ability of the agent to stimulate epidermal growth and development. Particular examples of an increase in the rate of healing are an increase of at least 5%, 10%, 25% or more, as compared to a rate in the absence of the therapeutic agent.

In one example, HMGNl or HMGN2 activity is decreased to increase sebaceous gland development, for example in individuals for whom the normal sebaceous mechanism is compromised by disease, trauma, burns or surgery. In a specific example, HMGNl or HMGN2 activity is decreased by administering HMGNl or HMGN2 antisense molecules or antibodies, or other agents that decrease HMGNl or HMGN2 activity. Agents that decrease HMGNl or HMGN2 activity are applied or administered to the subject in whom increased sebaceous gland development is desired, for example a protein or antibody can be applied to desired areas of the skin at concentrations ranging from 1 ng/ml to 1 g/ml. An increase in the number of sebaceous glands when the agents are applied as compared to the administration of no agents indicates the ability of the agent to stimulate sebaceous gland development. Particular examples of an increase in the in the number of sebaceous gland are increases of at least 5%, 10%, 25% or more, as compared to a number in the absence of the therapeutic agent.

EXAMPLE 8 Therapeutic Applications of Increasing HMGNl and HMGN2 Activity This example describes several therapeutic applications of increasing HMGNl or HMGN2 activity. For example, HMGNl or HMGN2 (as well as mimetics thereof) can be used to increase HMGNl or HMGN2 activity, thereby reducing integumentary growth or proliferation, such as proliferation of the skin, proliferation of adnexal structures or the hair growth cycling rate. Such therapy can be used to reduce hair growth in areas where hair is not desired (such as on the back, legs, face or underarms), for example in the treatment of hirsutism; to selectively eliminate sweat glands where sweat glands are not desired, for example in the treatment of hyperhidrosis of the axillae, palms, and soles; to reduce the number or activity of sebaceous glands to reduce acne; to treat a skin hyperproliferation disorder, for example in the treatment of psoriasis; to inhibit epithelial cell proliferation, for example in the treatment of breast cancer or skin cancer; or to decrease UV sensitivity, for example in a subject having xeroderma pigmentosum, photodamage, or radiation damage, such as skin cancer. h one example, HMGNl or HMGN2 activity is increased by administration an protein, for example a full-length HMGNl protein (such as Genbank Accession No.: AAA52677 (human), AAB59965 (chicken); or NP B2277 (mouse)), or an HMGN2 protein (for example Genbank Accession No.: AAA52678 (human); CAA31404 (mouse); and AAA48816 (chicken)), as well as alternative HMGNl and HMGN2 sequences (such as polymorphisms, fragments, mutants, fusions, or other variants) that retain the distinctive functional characteristic of HMGNl or HMGN2. In one example, an HMGNl or HMGN2 protein includes at least 10 amino acids, such as at least 20 amino acids, at least 50 amino acids, or at least 75 amino acids.

As an alternative to applying a protein, an HMGNl or HMGN2 nucleic acid sequence can be expressed in vivo, for example using the techniques of Hoffman (J. Drug Target; 5:67-74, 1998) Li and Hoffman (Nat. Med. 1:705, 1995) or Majumder et al (Mammalian Genome, 9:863-8, 1998). In another example, mimetics of HMGNl or HMGN2 protein activity are generated by producing antibodies that bind to HMGNl or HMGN2 and increase HMG l or HMGN2 biological activity. Such antibodies are mimetics of HMGNl or HMGN2 which can be used to decrease integumentary development or proliferation, or to decrease UV sensitivity (increase DNA repair). For example, increasing HMG l or HMGN2 activity reduces hair growth cycling rate, which in some examples reduces hair growth. In a specific example, HMGNl or HMGN2 activity is increased by administering an HMGNl or HMGN2 protein (or nucleic acid molecule encoding the protein) to a subject in whom decreased hair growth cycling rate is desired, for example topically applying the protein to the skin of a subject having hirsutism, or to an area of the skin where decrease hair growth is desired, at concentrations ranging from 1 ng/ml to 1 g/ml. A decrease in hair growth cycling rate when the agent that increases HMGNl or HMGN2 activity is applied compared to the administration of no agent, indicates the ability of the agent to increase HMGNl or HMGN2 activity and decrease hair growth cycling rate. Particular examples of a decrease in the hair growth cycling rate are a decrease of at least 5%, at least 10%, at least 25% or more, as compared to a rate in the absence of the therapeutic agent.

Hair reducing activity of HMGNl or HMGN2 variants, fusions, or fragments can be demonstrated as follows. The protein, for example a purified protein, is applied at concentrations ranging from 1 ng/ml to 1 g/ml, to the tails, bellies, and the area behind the ears of newborn mice (such as a wild-type, Hmgnl*'^', Hmgnl^'1', Hmgnl*'^', or Hmgnl^"'^" mouse) over a period of 6 weeks, and hair growth cycling monitored. Various methods available for the appropriate delivery of the protein to hair follicles in human skin can be performed (see Hoffman, J. Drug Target; 5:67-74, 1998; Lieb et al, J.

Pharm. Sci. 86:1022, 1997; Laurer et al, Pharm. Res. 12:179-86, 1995; and Illel, Crit. Rev. Ther. Drug Carrier Syst. 14:207-19, 1997). In another example, protein is applied to skin of mouse embryos and the rate of hair growth cycling monitored using the methods described in Example 2. Another example is topical (for example daily) application to an area of the human scalp, back, or face. A decrease in hair growth cycling rate when the protein is applied compared to the administration of no protein, indicates the ability of the protein to decrease hair growth cycling rate. Particular examples of a decrease in the hair growth cycling rate are decreases of at least 5%, at least 10%, at least 25% or more as compared to a number in the absence of the therapeutic agent.

In particular examples, increasing HMGNl or HMGN2 activity reduces epidermal growth. In a specific example, HMGNl or HMGN2 activity is increased by administering an HMGNl or HMGN2 protein (or nucleic acid molecule encoding the protein) to a subject in whom decreased epidermal growth is desired, for example topically applying the protein to the skin of a subject having psoriasis or skin cancer at concentrations ranging from 1 ng/ml to 1 g/ml, or systemically administering the protein to a subject having breast cancer or skin cancer. A decrease in epidermal growth when the agent that increases HMGNl or HMGN2 activity is administered compared to the administration of no agent, indicates the ability of the agent to increase HMGNl or HMGN2 activity and decrease epidermal growth. Particular examples of a decrease in epidermal growth is a decrease in epidermal growth of at least 5%, at least 10%, at least 25% or more, as compared to a number in the absence of the therapeutic agent. Epidermal- and dermal-growth reducing activity of HMGNl or HMGN2 variants, fusions, or fragments, as well as other agents that increase the activity of

HMGNl or HMGN2, can be demonstrated as follows. The skin of a mouse (such as a wild-type or Hmgnl*^', Hmgnl^{' "}, Hmgnl*'^', or Hmgnl^{' "} mouse) is wounded, and an agent is applied topically, injected, or administered systemically at concentrations ranging from 1 ng/ml to 1 g/ml, into the wound site over a period of time with subsequent monitoring of wound healing. A decrease in the rate of wound healing, as measured by cell proliferation measurements, when the agent is applied as compared to the administration of no agent indicates the ability of the agent to decrease wound healing. Particular examples of a decrease in the rate of healing are decreases of at least 5%, at least 10%, at least 25% or more, as compared to a rate in the absence of the therapeutic agent.

In a particular example, increasing HMGNl or HMGN2 activity reduces eccrine sweat gland development. In a specific example, HMGNl or HMGN2 activity is increased by administering an HMGNl or HMGN2 protein (or nucleic acid molecule encoding the protein) to a subject in whom decreased eccrine sweat gland development is desired, for example topically applying the protein to the skin of a subject having hyperhidrosis of the axillae, palms, and soles, at concentrations ranging from 1 ng/ml to 1 g/ml. A decrease in the number of eccrine sweat glands, as measured by eccrine sweat gland density measurements, in the presence of the agent that increases HMGNl or HMGN2 activity, compared to the administration of no agent, indicates the ability of the agent to increase HMGNl or HMGN2 activity and decrease eccrine sweat gland development. Particular examples of a decrease in the number of eccrine sweat glands include a decrease of at least 5%, at least 10%, at least 25% or more, as compared to a number in the absence of the therapeutic agent. Reduction of eccrine sweat gland development by HMGNl or HMGN2 variants, fusions, or fragments, as well as other agents that increase the activity of HMGNl or HMGN2, can be demonstrated as follows. Agents that increase HMGNl or HMGN2 activity are administered to an area where decreased sweat glands are desired with subsequent monitoring of sweat gland development. The ability of an agent to decrease sweat gland development can be tested in one example by injecting the agent into the footpads of newborn mice (such as a wild-type, Hmgnl*'^', Hmgnl^'1', Hmgnl*'^', or Hmgnl^'1' mouse) over a period of 6 weeks. A decrease in the number of eccrine sweat glands when the agent is administered as compared to the administration of no agent, indicates the ability of the agent to reduce eccrine sweat gland development. Particular examples of a decrease in the number of eccrine sweat glands are in decreases of at least 5%, at least 10%, at least 25% or more, as compared to a number in the absence of the therapeutic agent.

HMGNl or HMGN2 activity can be increased to reduce sebaceous gland development. In a specific example, HMGNl or HMGN2 activity is increased by administering an HMGNl or HMGN2 protein (or nucleic acid molecule encoding the protein) to a subject in whom decreased sebaceous gland development is desired, for example topically applying the protein to the skin of a subject acne, at concentrations ranging from 1 ng/ml to 1 g/ml. A decrease in the number of sebaceous glands, as measured by sebaceous gland density measurements, in the presence of the agent that increases HMGNl or HMGN2 activity, compared to the administration of no agent, indicates the ability of the agent to increase HMGNl or HMGN2 activity and decrease sebaceous gland development. Particular examples of a decrease in the number of sebaceous glands is a decrease of at least 5%, at least 10%, at least 25% or more, as compared to a number in the absence of the therapeutic agent.

Reduction of sebaceous gland development by HMGNl or HMGN2 variants, fusions, or fragments, as well as other agents that increase the activity of HMGNl or HMGN2, can be demonstrated as follows. Agents that increase HMGNl or HMGN2 activity are administered to an area where a decreased number of sebaceous glands are desired, with subsequent monitoring of sebaceous gland development. The ability of an agent to decrease sebaceous development can be tested in one example by administering the agent into a mouse (such as a wild-type, Hmgnl*'^', Hmgnl^'1', Hmgnl*'^', ox Hmgnl^"1' mouse). A decrease in the number of sebaceous glands when the agent is administered as compared to the administration of no agent, indicates the ability of the agent to reduce sebaceous gland development. Particular examples of a decrease in the number of sebaceous glands are in decreases of at least 5%, at least 10%, at least 25% or more, as compared to a number in the absence of the therapeutic agent.

Increasing HMGNl activity can be used to increase DNA repair. In a specific example, HMGNl or HMGN2 activity is increased by administering an HMGNl or HMGN2 protein (or nucleic acid molecule encoding the protein) to a subject in whom decreased sensitivity to UV, or in whom increased DNA repair, is desired. In one example, the method can be used to decrease sensitivity to UV irradiation in a cell, thereby increasing DNA repair. DNA damage can be caused by photodamage, radiation induced damage, or chemical damage. These methods can be used to treat a subject who is UV sensitive, for example a subject having xeroderma pigmentosum, as well as subjects having photodamage or radiation induced damage, for example subjects having skin cancer or pre-cancerous lesions (actinic keratoses).

The ability of an agent to increase HMGNl activity, and thus increase DNA repair and decrease UV sensitivity, can be demonstrated as described in EXAMPLES 3 and 4. For example, an HMGNl or HMGN2 protein, such as a purified protein can be administered to the subject (or cells of a subject) (for example topically or injected) at 1 ng/ml to 1 g/ml, in one dose, or over a period of time. An increase in the rate of repair of damaged DNA when the protein is applied as compared to the administration of no protein indicates the ability of the protein to increase repair of DNA damage and decrease sensitivity to UV irradiation. Particular examples of an increase in the rate of repair of damaged DNA are an increase of at least 5%, at least 10%, at least 25% or more, as compared to a rate in the absence of the therapeutic agent.

EXAMPLE 9

Disruption of Gene Expression

This example describes methods that can be used to disrupt expression of HMGNl or HMGN2, and thereby decrease HMGNl or HMGN2 activity. Such methods are useful when it is desired to increase integumental proliferation or development, such as that of the skin and adnexal structures. In a particular example, disrupted expression of HMGNl or HMGN2 is used to promote the hair growth cycling rate in subjects suffering from baldness, such as a subject having alopecia. In another example, the density or number of sweat glands can be increased, for example in individuals for whom the normal sweating mechanism is compromised by disease, trauma, burns or surgery. The method can also be used to increase epithelial cell proliferation, which is of particular use to advance healing of the skin in cases of wounds, trauma or burns.

Methods useful for disrupting gene function or expression are include use of antisense oligonucleotides, siRNA molecules, RNAi molecules, ribozymes, and triple helix molecules. Techniques for the production and use of such molecules are well known to those of skill in the art.

Antisense Nucleic Acid Molecules One approach to disrupting HMGNl or HMGN2 function or expression is to use antisense oligonucleotides. To design antisense oligonucleotides, an HMGNl or HMGN2 mRNA sequence is examined. Regions of the sequence containing multiple repeats, such as TTTTTTTT, are not as desirable because they will lack specificity. Several different regions can be chosen. Of those, oligos are selected by the following characteristics: those having the best conformation in solution; those optimized for hybridization characteristics; and those having less potential to form secondary structures. Antisense molecules having a propensity to generate secondary structures are less desirable.

Plasmids including HMGNl or HMGN2 antisense sequences can be generated. For example, cDNA fragments or variants coding for HMGNl or HMGN2 are PCR amplified. The nucleotides are amplified using Pf DNA polymerase (Stratagene) and cloned in antisense orientation a vector, such as pcDNA vectors (InVitrogen, Carlsbad, CA). The nucleotide sequence and orientation of the insert can be confirmed by sequencing using a Sequenase kit (Amersham Pharmacia Biotech). Generally, the term "antisense" refers to a nucleic acid molecule capable of hybridizing to a portion of an HMGNl or HMGN2 RNA (such as mRNA) by virtue of some sequence complementarity. The antisense nucleic acid molecules disclosed herein can be oligonucleotides that are double-stranded or single-stranded, RNA or DNA or a modification or derivative thereof, which can be directly administered to a cell, or which can be produced intracellularly by transcription of exogenous, introduced sequences. HMGNl antisense nucleic acid molecules are polynucleotides, and can be oligonucleotides (ranging from about 6 to about 100 oligonucleotides). An HMGNl or HMGN2 antisense polynucleotide recognizes any species of HMGNl or HMGN2. In specific aspects, the oligonucleotide is at least 10, at least 15, or at least 100 nucleotides, or a polynucleotide of at least 200 nucleotides. However, antisense nucleic acid molecules can be much longer. The nucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, and can include other appending groups such as peptides, or agents facilitating transport across the cell membrane (Letsinger et al, Proc. Natl Acad. Sci. USA 1989, 86:6553-6; Lemaifre et al, Proc. Natl. Acad. Sci. USA 1987, 84:648-52; WO 88/09810) or blood-brain barrier (WO 89/10134), hybridization triggered cleavage agents (Krol et al, BioTechniques 1988, 6:958-76) or intercalating agents (Zon, Pharm. Res. 5:539-49, 1988).

An HMGNl or HMGN2 antisense polynucleotide (including oligonucleotides), such as a single-stranded DNA, can be modified at any position on its structure with substituents generally known in the art. For example, a modified base moiety can be 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymβthylammomethyluracil, dihydrouracil, beta-D- galactosylqueosine, inosine, N~6-sopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, methoxyarninomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2- thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-S- oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6- diaminopurine.

In another example, the HMG l or HMGN2 antisense polynucleotide includes at least one modified sugar moiety such as arabinose, 2-fluoroarabinose, xylose, and hexose, or a modified component of the phosphate backbone, such as phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, or a formacetal or analog thereof. In yet another example, the HMGNl or HMGN2 antisense polynucleotide is an α-anomeric oligonucleotide. An -anomeric oligonucleotide forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gautier et al, Nucl. Acids Res. 15:6625-41, 1987). The oligonucleotide can be conjugated to another molecule (such as a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent). Oligonucleotides can include a targeting moiety that enhances uptake of the molecule by cells. The targeting moiety can be a specific binding molecule, such as an antibody or fragment thereof that recognizes a molecule present on the surface of the cell, such as a hair follicle cell.

Antisense molecules can be synthesized by standard methods, for example by use of an automated DNA synthesizer. As examples, phosphorothioate oligos can be synthesized by the method of Stein et al. (Nucl. Acids Res. 1998, 16:3209), methylphosphonate oligos can be prepared by use of controlled pore glass polymer supports (Sarin et al, Proc. Natl Acad. Sci. USA 85:7448-51, 1988). In a specific example, an antisense oligonucleotide that recognizes HMGNl or HMGN2 includes catalytic RNA, or a ribozyme (see WO 90/11364, Sarver et al, Science 247:1222-5, 1990). In another example, the oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al, Nucl. Acids Res. 15:6131-48, 1987), or a chimeric RNA-DNA analogue (Inoue et al, FEBSLett. 215:327-30, 1987).

The antisense polynucleic acids disclosed herein include a sequence complementary to at least a portion of an RNA transcript of an HMGNl or HMGN2 gene. However, absolute complementarity, although advantageous, is not required. A sequence can be complementary to at least a portion of an RNA; in the case of double- stranded antisense nucleic acids, a single strand of the duplex DNA can thus be tested, or triplex formation can be assayed. The ability to hybridize depends on the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.

The relative ability of polynucleotides (such as oligonucleotides) to bind to complementary strands is compared by determining the T_ra of a hybridization complex of the poly/oligonucleotide and its complementary strand. The higher the T_m the greater the strength of the binding of the hybridized strands. As close to optimal fidelity of base pairing as possible achieves optimal hybridization of an oligonucleotide to its target RNA.

The amount of HMGNl or HMGN2 antisense nucleic acid molecule which is effective in the treatment of a particular disease or condition (the therapeutieally effective amount) depends on the nature of the disease or condition, and can be determined by standard clinical techniques. For example, it can be useful to use compositions to achieve sustained release of an HMGNl or HMGN2 antisense nucleic acid molecule. In another example, it may be desirable to utilize liposomes targeted via antibodies to specific identifiable cells of the skin, such as a hair follicle, epithelial cell, or sweat gland antigens (Leonetti et al. Proc. Natl. Acad. Sci. USA 1990, 87:2448-51; Renneisen et al. J. Biol Chem. 1990, 265:16337-42).

Ribozymes Catalytic nucleic acid compounds, such as ribozymes or anti-sense conjugates, can also be used to inhibit HMGNl or HMGN2 gene expression. Ribozymes can be synthesized and administered to the subject, or can be encoded on an expression vector, from which the ribozyme is synthesized in the targeted cell (as in WO 9523225, and Beigelman et al Nucl. Acids Res. 1995, 23:4434-42). Examples of oligonucleotides with catalytic activity are described in WO 9506764. Conjugates of antisense with a metal complex, such as terpyridylCu (H), capable of mediating mRNA hydrolysis, are described in Bashkin et al. (Appl. Biochem Biotechnol 54:43-56, 1995).

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage. Methods of using ribozymes to decrease or inhibit RNA expression are known in the art. An overview of ribozymes and methods of their use is provided in Kashani-Sabet (J. Imvestig. Dermatol Symp. Proc, 7:76-78, 2002). Ribozyme molecules include one or more sequences complementary to an

HMGNl or HMGN2 mRNA and include the well-known catalytic sequence responsible for mRNA cleavage (see U.S. Pat. No. 5,093,246, herein incorporated by reference). A ribozyme gene directed against HMGNl or HMGN2 can be delivered to a subject endogenously (where the ribozyme coding gene is transcribed intracellularly) or exogenously (where the ribozymes are introduced into a cell, for example by transfection). Methods describing endogenous and exogenous delivery are provided in Marschall et al. (Cell Mol. Neurobiol 14:523-38, 1994).

Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites that include the following sequence: GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features, such as secondary structure, that may render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.

For example, a plasmid that contains a riboyzme gene directed against HMGNl or HMGN2, placed behind a promoter, can be transfected into the cells of a subject, for example a subject suffering from baldness or having a compromised normal sweating mechanism. Expression of this plasmid in a cell will decrease or inhibit HMGNl or

HMGN2 RNA expression in the cell. Other examples of using ribozymes to decrease or inhibit RNA expression can be found in WO 01/83754 (herein incorporated by reference). Triple helix molecules

Nucleic acid molecules used in triplex helix formation should be single stranded and composed of deoxynucleotides. The base composition of these oligonucleotides is ideally designed to promote triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of either purines or pyrimidines to be present on one strand of a duplex. Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC+ triplets across the three associated strands of the resulting triple helix. The pyrimidine-rich molecules provide base complementarity to a purine- rich region of a single strand of the duplex in a parallel orientation to that strand, hi addition, nucleic acid molecules may be chosen that are purine-rich, for example, contain a stretch of guanidine residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in GGC triplets across the three strands in the triplex. Alternatively, the potential sequences that can be targeted for triple helix formation may be increased by creating a so called "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5'-3', 3 -5' manner, such that they base pair with one strand of a duplex first and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex.

EXAMPLE 10 Methods of Treatment using Agents that Disrupt HMGNl or HMGN2 Gene

Expression When HMGNl or HMGN2 activity is decreased, for example by downregulating their levels of expression (for example by using an antisense molecule, siRNA, or RNAi molecule), the development of the integument (such as skin, hair growth and one or more adnexal structures) can be increased. HMGNl or HMGN2 antisense molecules, siRNA molecules, ribozymes, triple helix molecules, or RNAi molecules (EXAMPLE 9) can therefore be used to disrupt cellular expression of an HMGNl or HMGN2 protein. '

A subject suffering from a disease or condition in which increased proliferation or development of the integument (for example the skin, hair growth cycling rate, sweat glands or sebaceous glands) is desired can be treated with a therapeutieally effective amount of HMGNl or HMGN2 antisense molecule, siRNA molecule, ribozyme, triple helix molecule, or RNAi molecule. After the therapeutic agent has produced an effect (HMGNl or HMGN2 levels are downregulated), for example after 24-48 hours, the subject can be monitored for increased proliferation or development of the integument, such as increased hair growth cycling rate as described in EXAMPLES 7-8.

The treatments disclosed herein can also be used prophylactically, for example to inhibit or prevent progression to of a disorder such as alopecia in which increased hair growth cycling rate is desired. Such administration is indicated where the treatment is shown to have utility for treatment or prevention of the disorder. The prophylactic use is indicated in conditions known or suspected of progressing to disorders (such as baldness) associated with a decreased amount of skin or adnexal structure development. The disclosed treatments can also be used to treat subjects for whom the normal sweating mechanism is compromised by disease, trauma, burns or surgery, and to advance healing of the skin in cases of trauma or burns.

EXAMPLE 11 Sequence Variants This example provides methods that can be used to generate and use HMGNl and HMGN2 protein variants, and nucleic acid molecules that encode these proteins, as well as variant HMGNl and HMGN2 antisense molecules. It is understood by those skilled in the art that use of variant HMGNl and HMGN2 sequences (such as polymorphisms, fragments, or fusions) can be used to practice the methods of the present disclosure, as long as the distinctive functional characteristics of HMGNl and HMGN2 are retained. For example, HMGNl or HMGN2 variants can be used to practice the methods disclosed herein if such variants retain the characteristic of decreasing integumentary proliferation, for example a decrease in proliferation of at least 10%, for example at least 20%, or at least 30%. These activities can readily be determined using the assays disclosed herein (for example, see EXAMPLES 7-8). In some examples, HMGNl or HMGN2 variants can be used to practice the methods disclosed herein if such variants retain the characteristic of decreasing hair growth cycling rate, for example a decrease in growth of at least 10%, for example at least 20%, or at least 30%. These activities can readily be determined using the assays disclosed herein (for example, see EXAMPLES 7-8). In yet other examples, HMGNl or HMGN2 variants can be used to practice the methods disclosed herein if they retain their ability to decrease UV sensitivity and thus increase repair of damaged DNA, for example an increase in the rate of repair of UV-damaged DNA of at least 10%, for example at least 20%, or at least 30%. This activity can readily be determined using the assays disclosed herein (for example the cell viability assays described in EXAMPLES 2-4).

Distinctive functional characteristics of HMGNl and HMGN2 include, but are not limited to, the ability to modulate integumentary proliferation or development, such as skin proliferation, adnexal proliferation, and hair growth cycling, for example stimulating or inhibiting such activity. These activities can readily be determined using the assays disclosed herein, for example those described in EXAMPLES 7-8. In some examples, another distinctive characteristic is the ability of HMGNl or HMGN2 to decrease UV sensitivity and thus increase repair of UV-damaged DNA, using the cell viability assay described in EXAMPLES 2-4.

This disclosure facilitates the use of DNA molecules, and thereby proteins, derived from a native (wild-type) HMGNl or HMGN2 protein but that vary in their precise nucleotide or amino acid sequence from the native sequence. Such variants can be obtained through standard molecular biology laboratory techniques and the sequence information disclosed herein. DNA molecules and nucleotide sequences derived from a native DNA molecule can also be defined as DNA sequences that hybridize under stringent conditions to the DNA sequences disclosed, or fragments thereof. Hybridization conditions resulting in particular degrees of stringency vary depending upon the nature of the hybridization method and the composition and length of the hybridizing DNA used. The degeneracy of the genetic code further widens the scope of the present disclosure as it enables variations in the nucleotide sequence of an HMGNl and HMGN2 DNA molecule while maintaining the amino acid sequence of the encoded HMGNl or HMGN2 protein. For example, the amino acid Ala is encoded by the nucleotide codon triplet GCT, GCG, GCC and GCA. Thus, the nucleotide sequence can be changed without affecting the amino acid composition of the encoded protein or the characteristics of the protein. Based upon the degeneracy of the genetic code, variant DNA molecules can be derived from a cDNA molecule using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences. DNA sequences that do not hybridize under stringent conditions to the cDNA sequences disclosed by virtue of sequence variation based on the degeneracy of the genetic code are also comprehended by this disclosure.

HMGNl and HMGN2 variants, fragments, and fusions, retain the characteristic of decreasing UV-sensitivity and increasing repair of damaged DNA, as determined using the assays disclosed herein (EXAMPLES 2-4). In another or additional example, HMGNl and HMGN2 variants, fragments, and fusions, retain the characteristic of decreasing integumentary proliferation or development as determined using the assays disclosed herein (for example see EXAMPLES 7-8). Variants and fragments of an HMGNl or HMGN2 protein retain at least 70%, 80%, 85%, 90%, 95%, 98%, or greater sequence identity to an HMG l or HMGN2 protein sequence, respectively and maintain the functional activity of the protein as understood by those in skilled in the art. In particular examples, HMGNl or HMGN2 fragments or fusions have at least 10 amino acids, for example at least 20, 30, 50, 75, 90, 100, 120, 150, or 200 amino acids. Amino acid substitutions are typically of single residues; for example 1, 2, 3, 4, 5, 10 or more substitutions; insertions usually will be from about 1 to 10 amino acid residues; and deletions can range about from 1 to 30 residues. Substitutions, deletions, insertions or any combination thereof can be combined to arrive at a final construct. Ideally, mutations in the DNA encoding the protein should not place the sequence out of reading frame and will not create complementary regions that could produce secondary mRNA structure. The simplest modifications involve the substitution of one or more amino acid residues (for example 2, 5 or 10 residues) for amino acid residues having conservative substitutions.

Such variants can be readily selected for additional testing by performing an assay (such as those described in EXAMPLES 2-4 and 7-8) to determine if an HMGNl or HMGN2 variant retains the characteristic of decreasing UV-sensitivity, increasing repair of damaged DNA, or decreasing growth of integument.

EXAMPLE 12 Generation and Expression of Fusion Proteins HMGNl and HMGN2 fusion proteins or peptides that include an HMGNl or

HMGN2 sequence (such as full-length HMGNl or HMGN2, or fragments or variants of HMGNl or HMGN2), respectively can be generated using standard methods known to those skilled in the art (for example see U.S. Patent No. 6,057,133 to Bauer et al. and U.S. Patent No. 6,072,041 to Davis et al, both incorporated by reference). In one example, linker regions are used to space the two portions of the protein from each other and to provide flexibility between the two peptides, such as a polypeptide of between 1 and 500 amino acids, such as a polypeptide of 1-10 amino acids. Other moieties can also be included, such as a binding region (such as avidin or an epitope, such as a polyhistadine tag) which can be useful for purification and processing of the fusion protein. In addition, detectable markers can be attached to the fusion protein. EXAMPLE 13 Recombinant Expression

With publicly available HMGNl nucleic acid sequences (for example Genbank Accession Nos M21339, NM_004965; BC000075; BC023984; J02621; M20817; NM_008251), HMGNl amino acid sequences (for example see Genbank Accession Nos. AAA52677; AAA52676; CAB90453; NP_004956; AAH00075; P05114, AAH23984; AAB59965; NP_032277), HMGN2 cDNA sequences (Genbank Accession Nos: M12623; NM_005517; BC032140; BC014644; AY408429; X12944; and J03229), and HMGN2 amino acid sequences (Genebank Accession Nos: AAA52678; NP_005508; AAH14644; AAH32140; P05204; CAA31404; AAA48816), native and variant HMGNl and HMGN2 sequences can be generated. Expression and purification by standard laboratory techniques of any variant, such as a polymorphism, mutant, fragment or fusion of a native HMGNl and HMGN2 sequences is enabled. One skilled in the art will understand that HMGNl and HMGN2, as well as variants thereof, can be produced recombinantly in any cell or organism of interest, and purified prior to use, for example prior to administration to a subject.

Methods for producing recombinant proteins are well known in the art. Therefore, the scope of this disclosure includes recombinant expression of any HMGNl or HMGN2 protein or variant or fragment thereof. For example, see U.S. Patent No: 5,342,764 to Johnson et al; U.S. Patent No: 5,846,819 to Pausch et al; U.S. Patent No: 5,876,969 to Fleer et al. and Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989, Ch. 17, herein incorporated by reference).

Briefly, partial, full-length, or variant HMGNl or HMGN2 cDNA sequences, that encode for a HMGNl or HMGN2 protein or peptide, respectively, can be ligated into an expression vector, such as a bacterial expression vector. Proteins or peptides can be produced by placing a promoter upstream of the cDNA sequence. Examples of promoters include, but are not limited to lac, trp, tac, trc, major operator and promoter regions of phage lambda, the control region of fd coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter of the yeast alpha-mating factors and combinations thereof. Vectors suitable for the production of HMGNl or HMGN2 proteins include pKC30 (Shimatake and Rosenberg, 1981, Nature 292:128), pKK177-3 (Amann and Brosius, 1985, Gene 40:183) andpET-3 (Studiar and Moffatt, 1986, J. Mol. Biol. 189: 113). A DNA sequence can be transferred to other cloning vehicles, such as other plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al, 1987, Science 236:806-12). These vectors can be introduced into a variety of hosts including somatic cells, and simple or complex organisms, such as bacteria, fungi (Timberlake and Marshall, 1989, Science 244:1313-7), invertebrates, plants (Gasser and Fraley, 1989, Science 244:1293), and mammals (Pursel et al, 1989, Science 244: 1281-8), that are rendered transgenic by the introduction of the heterologous HMGNl or HMGN2 cDNA.

For expression in mammalian cells, an HMGNl or HMGN2 cDNA sequence can be ligated to heterologous promoters, such as the simian virus SV40, promoter in the pSV2 vector (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072-6), and introduced into cells, such as monkey COS-1 cells (Gluzman, 1981, Cell 23: 175-82), to achieve transient or long-term expression. The stable integration of the chimeric gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, 1982, J. Mol. Appl Genet. 1:327-41) and mycophoenolic acid (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072-6).

The transfer of DNA into eukaryotic, such as human or other mammalian cells is a conventional technique. The vectors are introduced into the recipient cells as pure

DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vander Eb, 1973, Virology 52:466) strontium phosphate (Brash et al, 1987, Mol. Cell Biol. 7:2013), electroporation (Neumann et al, 1982, EMBO J. 1:841), lipofection (Feigner et al., 1987, Proc. Natl. Acad. Sci USA 84:7413), DEAE dextran (McCuthan et al, 1968, J. Natl. Cancer Inst. 41:351), microinjection (Mueller et al, 1978, Cell 15:579), protoplast fusion (Schafher, 1980, Proc. Natl. Acad. Sci. USA 77:2163-7), or pellet guns (Klein et al, 1987, Nature 327:70). Alternatively, the cDNA can be introduced by infection with virus vectors, for example retroviruses (Bernstein et al, 1985, Gen. Engrg. 7:235) such as adenoviruses (Ahmad et al, 1986, J. Virol. 57:267) or Herpes (Spaeie et al, 1982, Cell 30:295).

EXAMPLE 14 Methods for in vivo or ex vivo Expression The present disclosure provides methods of expressing HMGNl or HMGN2, or functional equivalents thereof, in a cell or tissue in vivo. Such methods are useful if HMGNl or HMGN2 activity is desired, such as for decreasing growth of integument, or for decreasing UV sensitivity and increasing DNA repair.

In one example, transfection of the cell or tissue occurs in vitro. In this example, the cell or tissue is removed from a subject and then transfected with an expression vector containing the desired cDNA. The transfected cells produce functional protein and can be reintroduced into the subject. In another example, a nucleic acid molecule is administered to the subject directly, and transfection occurs in vivo.

The scientific and medical procedures required for human cell transfection are now routine. The public availability of HMGNl and HMGN2 cDNAs allows the development of human (and other mammals) in vivo gene expression based upon these procedures. Immunotherapy of melanoma patients using genetically engineered tumor- infiltrating lymphocytes (TILs) has been reported by Rosenberg et al. (N. Engl J. Med. 323:570-8, 1990), wherein a refrovirus vector was used to introduce a gene for neomycin resistance into TILs. A similar approach can be used to introduce HMGNl or HMGN2 cDNA into subjects. h some examples, a method of treating subjects in which greater HMG l or HMGN2 expression is desired is disclosed. These methods can be accomplished by introducing a gene coding for HMGNl or HMGN2 into a subject. A general strategy for transferring genes into donor cells is disclosed in U.S. Patent No. 5,529,774, incorporated by reference. Generally, a gene encoding a protein having therapeutieally desired effects is cloned into a viral expression vector, and that vector is then introduced into the target organism. The virus infects the cells, and produces the protein sequence in vivo, where it has its desired therapeutic effect (Zabner et al. Cell 75:207-16, 1993). It may only be necessary to introduce the genetic or protein elements into certain cells or tissues, such as the surface of the skin. However, in some instances, it may be more therapeutieally effective and simple to treat all of a subject's cells, or more broadly disseminate the vector, for example by intravascular administration. In particular examples, a nucleic acid sequence encoding HMGNl or HMGN2 is under the control of a suitable promoter. Suitable promoters that can be employed include, but are not limited to, the gene's native promoter, retroviral LTR promoter, or adenoviral promoters, such as the adenoviral major late promoter; the CMV promoter; the RSV promoter; inducible promoters, such as the MMTV promoter; the metallothionein promoter; heat shock promoters; the albumin promoter; the histone promoter; the α-actin promoter; TK promoters; B 19 parvovirus promoters; and the ApoAI promoter. However the scope of the disclosure is not limited to specific promoters.

The recombinant nucleic acid molecule can be administered to the subject by any method that allows the recombinant nucleic acid molecule to reach the appropriate cells. These methods include injection, infusion, deposition, implantation, or topical administration. Injections can be intradermal or subcutaneous. The recombinant nucleic acid molecule can be delivered as part of a viral vector, such as avipox viruses, recombinant vaccinia virus, replication-deficient adenovirus strains or poliovirus, or as a non-infectious form such as naked DNA or liposome encapsulated DNA, as further described in EXAMPLE 15. EXAMPLE 15 Viral Vectors for in vivo Gene Expression

Viral vectors can be used to express a desired HMGNl or HMGN2 sequence in vivo. Methods for using such vectors for in vivo gene expression are well known (for example see U.S. Patent No. 6,306,652 to Fallaux et al, U.S. Patent No. 6,204,060 to Mehtali et al, U.S. Patent No. 6,287,557 to Boursnell et al, and U.S. Patent No. 6,217,860 to Woo et al, all herein incorporated by reference). Specific examples of such vectors include, but are not limited to: adenoviral vectors; adeno-associated viruses (AAV); retroviral vectors such as MMLV, spleen necrosis virus, RSV, Harvey Sarcoma Virus, avian leukosis virus, HIV, myeloproliferative sarcoma virus, and mammary tumor virus, as well as and vectors derived from these viruses. Other viral transfection systems may also be utilized, including Vaccinia virus (Moss et al, 1987, Annu. Rev. Immunol 5:305-24), Bovine Papilloma virus (Rasmussen et al, 1987, Methods Enzymol. 139:642-54), and herpes viruses, such as Epstein-Barr virus (Margolskee et al, 1988, Mol. Cell. Biol. 8:2837-47). In another example, RNA-DNA hybrid oligonucleotides, as described by Cole-Strauss et al. (Science 273:1386-9, 1996) are used.

Viral particles are administered in an amount effective to produce a therapeutic effect in a subject. The exact dosage of viral particles to be administered is dependent upon a variety of factors, including the age, weight, and sex of the subject to be treated, and the nature and extent of the disease or disorder to be treated. The viral particles can be administered as part of a preparation having a titer of viral particles of at least 1 x 10¹⁰pfu/ml, and in general not exceeding 2 x 10¹¹ pfu/ml. Viral particles can be administered in combination with a pharmaceutically acceptable carrier in a volume up to 10 ml. The pharmaceutically acceptable carrier may be, for example, a liquid carrier such as a saline solution, protamine sulfate (Elkins-Sinn, Inc., Cherry Hill, NJ), or Polybrene (Sigma). Conventional pharmaceutically acceptable carriers are disclosed in Remington 's Pharmaceutical Sciences, by Martin, Mack Publishing Co., Easton, PA, 15th Edition, 1975. EXAMPLE 16 Pharmaceutical Compositions and Modes of Administration

Disclosed are compositions that include HMGNl or HMGN2 proteins or nucleic acid molecules, as well as HMGNl or HMGN2 mimetics or antagonists. Such compositions can be used to treat a disorder associated with a defect in integumentary proliferation or DNA damage.

Various delivery systems for administering the therapies disclosed herein are known, and include encapsulation in liposomes, microparticles, microcapsules, expression by recombinant cells, receptor-mediated endocytosis (Wu and Wu, J. Biol. Chem. 1987, 262:4429-32), and construction of therapeutic nucleic acid molecules as part of a retroviral or other vector. Methods of introduction include, but are not limited to, topical, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, and oral routes. The compounds may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (for example oral mucosa, rectal, vaginal and intestinal mucosa, etc.) and can be administered together with other biologically active agents. Administration can be systemic or local. Topical compositions can further include DMSO or other pharmaceutical carriers to enhance the ability of the therapeutic agents to enter the cells of the skin.

In one example, pharmaceutical compositions disclosed herein are delivered locally to the area in need of treatment, for example by topical application, such as in conjunction with a wound dressing after surgery. In one example, administration can be by direct administration at a site where integumentary proliferation is desired, such as hair growth, dermal growth, epidermal growth, or sweat gland growth is desired.

In one example liposomes are used as a delivery vehicle. Liposomes fuse with the target site and deliver the contents of the lumen intracellularly. The liposomes are maintained in contact with the target cells for a sufficient time for fusion to occur, using various means to maintain contact, such as isolation and binding agents. Liposomes can be prepared with purified proteins or peptides that mediate fusion of membranes, such as Sendai virus or influenza virus. The lipids may be any useful combination of known liposome forming lipids, including cationic lipids, such as phosphatidylcholine. Other potential lipids include neutral lipids, such as cholesterol, phosphatidyl serine, phosphatidyl glycerol, and the like. For preparing the liposomes, the procedure described by Kato et al. (J. Biol. Chem. 1991, 266:3361) can be used.

The pharmaceutically acceptable carriers useful herein are conventional. Remington 's Pharmaceutical Sciences, by Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the DNA, RNA, proteins, and specific-binding agents herein disclosed. In general, the nature of the carrier will depend on the mode of administration being employed. For instance, parenteral formulations usually include injectable fluids that include phamiaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, sesame oil, glycerol, ethanol, combinations thereof, or the like, as a vehicle. The carrier and composition can be sterile, and the formulation suits the mode of administration. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, sodium saccharine, cellulose, magnesium carbonate, or magnesium stearate. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.

Embodiments of the disclosure including medicaments can be prepared with conventional pharmaceutically acceptable carriers, adjuvants and counterions as would be known to those of skill in the art. The present disclosure also provides pharmaceutical compositions which include a therapeutieally effective amount of an HMGNl or HMGN2 protein, nucleic acid molecule (such as an RNA, DNA, antisense, siRNA, RNAi, or triple helix molecule) or specific-binding agent, alone or with a pharmaceutically acceptable carrier. The amount of HMGNl or HMGN2 protein, nucleic acid molecule, or specific-binding agent effective in the treatment of a particular disorder or condition can depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays can be employed to identify optimal dosage ranges (see EXAMPLES 7-8). The precise dose to be employed in the formulation can also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each subject's circumstances. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems. Furthemiore, the phannaceutical compositions or methods of treatment can be administered in combination with other therapeutic treatments, such as other agents that modulate the growth of integument or agents that reduce UV sensitivity (increase DNA repair), such as an anti-proliferative agent or a hair growth stimulating agent.

In one example, a therapeutic composition includes a therapeutieally effective amount of HMGNl or HMGN2 (such as HMGNl protein, HMGNl cDNA, or HMGNl mimetic) and a therapeutieally effective amount of one or more other anti-proliferative agents. Exemplary anti-proliferative agents include 5-FU and mitomycin C. Such compositions can be applied topically to treat skin cancer in a subject, such as basal cell cancer or squamous cell cancer. Sunscreen compositions that include a therapeutieally effective amount of

HMGNl or HMGN2 (such as HMGNl protein, HMGNl cDNA, or HMGNl mimetic) are also disclosed. In particular examples, the sunscreen composition further includes a therapeutieally effective amount of one or more of para-aminobenzoic acid (PABA), avobenzone, benzophenone- 1, benzophenone-2, benzophenone-3, benzophenone-4, benzophenone-6, benzophenone-8, benzophenone- 12, methoxycinnamate, ethyl dihydroxypropyl-PABA, glyceryl PABA, homosalate, methyl anthranilate, octocrylene, octyl dimethyl PABA, octyl methoxycinnamate, octyl salicylate, 2- phenylbenzimidazole-5-sulphonic acid, triethanolamine salicylate, 3-(4- methylbenzylidene)-camphor, red petrolatum, titanium oxide, oxybenzone, octyl dimethyl p-aminobenzoic acid, DEA methoxycinnamate, homosalate, menthyl anthranilate, octocrylene, phenylbenzimidazole sulfonic acid, TEA salicylate, isopropyl dibenzoyl methane, butyl methoxy-dibenzoylmethane, etocrylene, PEG-25 PABA, and octyl triazone. In particular examples, these protecting components are present in an amount of 0-15% w/w, such as 2.0-8.0% w/w in the composition. Such sunscreen compositions can be applied topically to the skin of a subject to protect the skin from UV damage.

Compositions are disclosed that include a therapeutieally effective amount of an HMGNl or HMGN2 antagonist (such as HMGNl antisense or siRNA) and one or more other hair-stimulating agents, such as minoxidil. Such compositions can be applied topically to increase hair growth, h another example, a composition including a therapeutieally effective amount an HMGNl or HMGN2 antagonist (such as HMGNl antisense or siRNA) is applied topically or systemically, in combination with systemic administration to a male of one or more other hair-stimulating agents (such as finasteride) to increase hair growth. Such agents can be administered at the same time, or one after the other.

The disclosure also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the disclosed pharmaceutical compositions. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. Instructions for use of the composition can also be included. The disclosure provides compositions of HMGNl or HMGN2 peptides, for example a composition that includes at least 50%, for example at least 90%, of a peptide or variant, fragment, or fusion thereof. Such compositions are useful as therapeutic agents when constituted as pharmaceutical compositions with the appropriate carriers or diluents.

In an example in which an HMGNl or HMGN2 nucleic acid molecule (such as a coding sequence, antisense molecule, RNAi molecule, or siRNA molecule) is employed to allow expression of the nucleic acid in a cell, the nucleic acid can be delivered intracellularly (for example by expression from a nucleic acid vector or by receptor- mediated mechanisms) or by an appropriate nucleic acid expression vector which is administered so that it becomes intracellular, for example by use of a retroviral vector (see U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle bombardment (such as a gene gun; Biolistic, Dupont), or coating with lipids or cell- surface receptors or transfecting agents, or by administering it in linkage to a homeobox-like peptide which is known to enter the nucleus (for example Joliot et al, Proc. Natl. Acad. Sci. USA 1991, 88:1864-8). Alternatively, the nucleic acid molecule can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination.

The vector pcDNA is an example of a method of introducing the foreign cDNA into a cell under the control of a strong viral promoter (CMV) to drive the expression. However, other vectors can be used (see EXAMPLES 14 and 15). Other retroviral vectors (such as pRETRO-ON, Clontech), also use this promoter but have the advantages of entering cells without any transfection aid, integrating into the genome of target cells only when the target cell is dividing and they are regulated. It is also possible to turn on the expression of an HMGNl or HMGN2 nucleic acid molecule by administering tetracycline when these plasmids are used. Hence these plasmids can be allowed to transfect the cells, then administer a course of tetracycline with a course of chemotherapy to achieve better cytotoxicity. The present disclosure includes all forms of nucleic acid molecule delivery, including synthetic oligos, naked DNA, plasmid and viral, integrated into the genome or not.

In an example where the therapeutic molecule is a specific-binding agent, such as an antibody that recognizes an HMGNl or HMGN2 protein, administration can be achieved by direct topical administration or injection, or by use of microparticle bombardment, or coating with lipids or cell-surface receptors or transfecting agents. Similar methods can be used to administer an HMGNl or HMGN2 protein or variants thereof.

EXAMPLE 17 Method of Treating Skin Cancer This example describes methods that can be used to treat skin cancer in a subject, such as basal cell cancer, squamous cell cancer, and melanoma. In particular examples, the subject is first screened to determine if the subject has skin cancer, and would therefore benefit from the therapies disclosed herein.

Subjects having skin cancer can be administered a therapeutieally effective amount of an agent that increases HMGNl or HMGN2 activity, for example by administration of an HMGNl or HMGN2 protein, nucleic acid molecule, or mimetic thereof. Such agents can be administered topically to the skin in the area in need of treatment (such as in a DMSO vehicle), or can be administered by any other appropriate route, such as systemically. In addition, one or more additional anti-proliferative agents (in a therapeutieally effective amount), in combination with an agent that increases HMGNl or HMGN2 activity, can be administered to the subject having skin cancer. Such anti-proliferative agents can be administered at the same time as the agent that increases HMGNl or HMGN2 activity, or at some other time, such as before or after administration of the agent that increases HMGNl or HMGN2 activity. The disclosed therapeutic compositions can be administered once or repeatedly (such as daily, weekly, or monthly) as needed. EXAMPLE 18 Screening Assays This example describes methods that can be used to identify agents that modulate (such as increase or decrease) integumentary development or proliferation, such as proliferation of adnexal structures, hair growth cycling, or increase repair of damaged DNA. Generally, the method includes applying the test agent to an integument ex vivo or in vivo, and then determining whether the agent had an effect on integumentary development or proliferation (such as proliferation of sweat glands, hair growth, or DNA repair), or determining whether the agent had an effect on HMGNl or HMGN2 expression or activity. In particular examples, the amount of integumentary proliferation/development or HMGNl or HMGN2 expression/activity in the presence of the test agent is compared to an amount of integumentary proliferation/development or HMGNl or HMGN2 expression/activity in the absence of the test agent. Integumentary proliferation can include one or more of the following: adnexal proliferation (including eccrine sweat gland or sebaceous gland proliferation), the rate of hair growth (such as the rate of hair growth cycling), and damaged DNA repair.

In some examples, the method includes applying the test agent to an integument ex vivo, such as an explanted integument growing in tissue culture, hi some examples, the test agent is applied to integument cells in vitro (such as epithelial cells

(keratinocytes) growing in culture), and the treated cells subsequently transplanted onto the skin of a mammal (such as a mouse), and the effect on integument development or HMGNl or HMGN2 expression or activity monitored.

In other examples, the method includes applying (or administering) the test agent to an integument in vivo, such as the skin of a mammal (for example a human, wild- type mouse, or Hmgnl^'/^' mouse). In some examples, the integument of one mammal is transplanted onto the skin of a second mammal, and the test agent applied or administered to the second mammal. For example, a skin sample from a human having a skin disorder (such as psoriasis) can be transplanted onto the skin of a mouse (such as an SCED mouse), the mouse is then treated with the test agent, and the effect on HMGNl or HMGN2 expression or activity determined, for example using the methods described in Examples 5 and 6.

In particular examples, agents that decrease HMGNl or HMGN2 expression or activity are selected for their potential to work as stimulators of integumentary proliferation or development, such as an ability to increase sweat gland development or increase hair growth cycling. Such agents can be further assayed for their ability to increase integumentary proliferation or development, for example using the assays provided in the Examples above. In one example, the course of the skin disorder, for example the healing, is determined, for example by measuring PASI-score in the case of psoriasis. In another example, the rate of hair growth cycling is determined using the assays provided in Example 2.

In other examples, agents that increase HMGNl or HMGN2 expression or activity are selected for their potential to work as inhibitors of integumentary proliferation or development (although 100% inhibition is not required, for example decreases of at least 20% could be considered inhibitory), such as an ability to decrease sweat gland development, decrease hair growth cycling, or increase DNA repair. Such agents can be further assayed for their ability to decrease integumentary proliferation or development, for example using the assays provided in the Examples above. In one example, the number of sweat glands or sebaceous glands is determined. In another example, the rate of hair growth cycling is determined using the assays provided in Example 2. In another example, the rate of DNA repair is determined using the assays provided in Examples 5 and 6.

Particular examples take advantage of the Hmgnl^'/^' mice described in Example 1. One skilled in the art will recognize that animals of any species, including, but not limited to, rats, rabbits, guinea pigs, pigs, micro-pigs, goats, and non-human primates, such as baboons, monkeys, and chimpanzees, can be used to generate other Hmgnl^'/^' animal models. Such animal models can also be used to screen agents for an ability to ameliorate symptoms associated with undesired integumental development (such as undesired hair growth or adnexal growth) or damaged DNA. hi addition, such animal models can be used to determine the LD50 and the ED50 in animal subjects, and such data can be used to determine the in vivo efficacy of potential agents.

In one example, the method includes screening agents for an ability to decrease HMGNl or HMGN2 activity (or confirming that an agent has such activity), such as an ability to increase integumentary proliferation. In some examples, test agents are applied or injected into the skin of a mammal, such as the tails, bellies, and the area behind the ears of newborn mice (such as an Hmgnl* ^', Hmgnl^{" '}, Hmgn2* ^', or Hmgnl^{' '} mouse) over a period of time (such as 6 weeks), with subsequent monitoring of integumentary proliferation (such as skin growth, adnexal growth (such as sweat gland or sebaceous gland development), or hair growth cycling). An increase in integumentary proliferation (such as an increase in the number of eccrine sweat glands, an increase in the number of sebaceous glands, or an increase in hair growth cycling rate) when the agents are applied as compared to the administration of no agents indicates the ability of the agent to stimulate integumentary proliferation or development. Particular examples of an increase in the in the number of eccrine sweat glands or sebaceous glands are increases of at least 5%, at least 10%, at least 25% or more, as compared to a number in the absence of the therapeutic agent. Particular examples of an increase in the rate of hair growth cycling is an increase of at least 5%, at least 10%, at least 25% or more, as compared to a rate in the absence of the therapeutic agent.

Another method that can be used to screen agents for an ability to decrease HMGNl or HMGN2 activity (or confirming that an agent has such activity), such as an ability to increase integumentary proliferation, is to wound the skin of a mammal, administer the test agent, and then monitor wound healing, hi one example, the skin of a mouse (such as an Hmgnl*'^', Hmgnl^''^", Hmgnl*'^", or Hmgnl^"'^' mouse) is wounded and the agent is applied (such as topically or systemically). For example, a purified protein or antibody can be administered at concentrations ranging from 1 ng/ml to 1 g/ml, into the wound site over a period of time, for example 6 weeks, using the method of Frank et al. (J. Clini. Invest. 106:501-9, 2000, herein incorporated by reference in its entirety), with subsequent monitoring of wound healing. Two basic types of wounds can be created using the method of Wojcik et al. (Mol. Cell. Biol. 20:5248-55, 2000, herein incorporated by reference in its entirety). One is a "full thickness wound" that involves removal of a punch of epidermis and dermis. The other is "depilation" which involves stripping off the epidermal layers (using adhesive tape) and leaving the dermis behind. In another example, the skin of the mammal is cut. Methods for evaluating rate of wound healing include measuring the rates of re-epithelialisation, wound closure, local DNA synthesis and cell proliferation (for example using the method of Frank et al, J. Clini. Invest. 106:501-9, 2000). An increase in the rate of wound healing when the agent is applied as compared to the administration of no agent indicates the ability of the agent to increase wound healing. Particular examples of an increase in the rate of healing are an increase of at least 5%, at least 10%, at least 25% or more as compared to a rate in the absence of the test agent. In addition, the methods described above can be used to screen for one or more agents that increase HMGNl or HMGN2 activity, and thus decrease integumentary development or proliferation, or increase the rate of DNA repair. The agent is contacted with a mammal (such as administered to a subject), and the development of integument or UV-sensitivity (rate of DNA repair) is monitored following therapy as described above. In particular examples, the mammal is subjected to conditions or agents that increase damage to DNA, such as radiation, light, or chemotherapy, prior to or after administration of the test agent.

The amount of agent administered can be determined by skilled practitioners. In some examples, several different doses of the potential therapeutic agent can be administered to different test subjects, to identify optimal dose ranges. In some examples, the test agent is administered in combination with another therapeutic agent (such as an anti-proliferative agent or a hair growth stimulating agent), such as before, during, or after administering the test agent. Subsequent to the treatment, animals are observed for a change in integumentary growth or development, or for an increase repair of damaged DNA, and symptoms associated therewith.

An increase in the growth or development of integument, or symptoms associated therewith, in the presence of the test agent provides evidence that the test agent is a therapeutic agent that can be used to increase integumentary growth or development (such as development of the skin, hair, and adnexal structures) in a subject.

A decrease in the growth or development of integument, or symptoms associated therewith, in the presence of the test agent provides evidence that the test agent is a therapeutic agent that can be used to decrease or even inhibit integumentary growth or development (such as development of the skin, hair, and adnexal structures)in a subject. An increase in the repair of damaged DNA, or symptoms associated therewith, in the presence of the test agent provides evidence that the test agent is a therapeutic agent that can be used to increase in the repair of damaged DNA in a subject.

Having illustrated and described several uses of HMGNl and HMGN2 nucleic acid molecules, proteins, and antibodies, it should be apparent to one skilled in the art that the disclosure can be modified in arrangement and detail without departing from such principles. In view of the many possible embodiments to which the principles of our disclosure may be applied, it should be recognized that the illustrated embodiments are only particular examples of the disclosure and should not be taken as a limitation on the scope of the disclosure. Rather, the scope of the disclosure is in accord with the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

We claim:

1. A method of modulating integumentary proliferation comprising altering HMGNl or HMGN2 activity in skin or a cell of the skin, wherein modulating integumentary proliferation comprises modulating skin proliferation, modulating adnexal structure proliferation, modulating hair growth cycling rate, increasing repair of DNA-damage, or combinations thereof.

2. The method of claim 1, wherein modulating integumentary proliferation comprises, modulating adnexal structure proliferation, modulating hair growth cycling rate, increasing repair of DNA-damage, or combinations thereof.

3. The method of claim 1, wherein the method is a method of modulating epidermal proliferation.

4. The method of claim 1, wherein the method is a method of modulating dermal proliferation.

5. The method of claim 2, wherein the method is a method of modulating adnexal structure proliferation.

6. The method of claim 5, wherein the adnexal structure is an eccrine sweat gland, a sebaceous gland, or combinations thereof.

7. The method of claim 2, wherein the method is a method of modulating hair growth cycling rate.

8. The method of claim 1, wherein the method is a method of decreasing integumentary proliferation, and altering HMGNl activity comprises increasing HMGNl activity in the skin by a therapeutieally effective amount.

9. The method of claim 2, wherein the method is a method of increasing repair of DNA-damage in a cell, and the method comprises increasing HMGNl activity in the cell by a therapeutieally effective amount.

10. The method of claim 9, wherein the DNA-damage results from exposure of cell to ultraviolet light, chemotherapy, radiation, or combinations thereof.

11. The method of claim 9, wherein the cell is a cell of a subject having xeroderma pigmentosum, Cockayne syndrome, trichothiodystrophy, photodamage, radiation damage, skin cancer, or combinations thereof.

12. The method of claim 9, wherein the cell is a cell of a subject having skin cancer.

13. The method of claim 8 or 9, wherein increasing HMGNl activity comprises increasing HMGNl expression in the skin or a cell in the skin.

14. The method of claim 13, wherein increasing HMGNl expression in the skin or cell comprises introducing into one or more cells of the skin, or into the cell, a therapeutic amount of a vector encoding HMGN 1.

15. The method of claim 14, wherein the vector comprises a DNA sequence.

16. The method of claim 8, wherein increasing HMGNl activity comprises administering a therapeutic amount of an HMGNl protein to the skin sufficient to decrease integumentary proliferation.

17. The method of claim 9, wherein increasing HMGNl activity comprises administering a therapeutic amount of an HMGNl protein to the cell sufficient to increase repair of DNA damage in the cell.

18. The method of claim 8, wherein the method is a method of decreasing epidermal proliferation in a subject having cancer, wherein the epidermal proliferation is breast epithelial proliferation, lung epithelial proliferation, or skin epithelial proliferation.

19. The method of claim 8, wherein the method is a method of decreasing skin proliferation in a subject having psoriasis.

20. The method of claim 8, wherein the method is a method of decreasing skin proliferation in a subject having skin cancer.

21. The method of claim 8, wherein the method is a method of decreasing hair growth cycling in a subject having hirsuitism or other unwanted hair.

22. The method of claim 8, wherein the method is a method of decreasing hair growth on the back, leg, arm, or face of a subject.

23. The method of claim 8, wherein adnexal structure is a sebaceous gland, and the method is a method of decreasing acne in a subject.

24. The method of claim 1, wherein the method is a method of increasing integumentary proliferation, and altering HMGNl activity comprises decreasing HMGNl activity in the skin or cell.

25. The method of claim 24, wherein decreasing HMGNl activity comprises administering a therapeutic amount of an HMGNl antisense molecule, an HMGNl siRNA molecule, an HMGNl RNAi molecule, an HMGNl specific binding agent, an HMGNl antagonist, or combinations thereof, which decreases HMGNl expression in the skin or cell.

26. The method of claim 25, wherein decreasing HMGNl activity comprises administering a therapeutic amount of an HMGNl specific binding agent to the skin, wherein the therapeutic amount is sufficient to increase one or more of skin proliferation, adnexal structure proliferation, or hair growth cycling.

27. The method of claim 26, wherein the HMGNl specific binding agent is a polyclonal antibody, monoclonal antibody, fragment of a monoclonal antibody, or combinations thereof.

28. The method of claim 25, wherein decreasing HMGNl activity comprises administering a therapeutic amount of an HMGNl antisense molecule, an HMGNl siRNA molecule, an HMGNl RNAi molecule, or combinations thereof, which decreases HMGNl expression in the skin, wherein the therapeutic amount is sufficient to increase one or more of skin proliferation, adnexal structure proliferation, or hair growth cycling.

29. The method of claim 24, wherein decreasing HMGNl activity comprises administering a therapeutic amount of an HMGNl antagonist which decreases HMGNl activity or HMGNl sensitivity in the tissue wherein the therapeutic amount is sufficient to increase skin proliferation, increase adnexal structure proliferation, or combinations thereof.

30. The method of claim 24, wherein the method is a method of increasing hair growth cycling in a subject having baldness.

31. The method of claim 24, wherein the method is a method of increasing epidermal or dermal proliferation in the tissue of a subject having a wound.

32. A transgenic mouse whose somatic and germ line cells comprise a disrupted

Hmgnl ox Hmgnl gene, wherein disruption of the Hmgnl ox Hmgnl gene is sufficient to increase integumental proliferation, the disrupted gene being introduced into the mouse or an ancestor of the mouse at an embryonic stage.

33. The transgenic mouse of claim 32, wherein disruption of the Hmgnl or Hmgnl gene is sufficient to increase hair growth cycling rate.

34. The transgenic mouse of claim 32, wherein integumental proliferation comprises dermal proliferation, epidermal proliferation, sebaceous gland proliferation, sweat gland proliferation, hair growth cycling, or combinations thereof.

35. The transgenic mouse of claim 32, wherein disruption of the Hmgnl or Hmgnl gene is sufficient to increase UV sensitivity of the mouse.

36. The transgenic mouse of claim 32, wherein the mouse is homozygous for the disrupted Hmgnl or Hmgnl gene.

37. The transgenic mouse of claim 28, wherein the mouse is heterozygous for the disrupted Hmgnl or Hmgnl gene.

38. A method of screening for an agent that modulates integumentary proliferation or development, wherein modulating integumentary proliferation comprises modulating skin proliferation, modulating adnexal structure proliferation, modulating hair growth cycling rate, or combinations thereof, comprising: administering the agent to a cell in an integument; and determining whether the agent has an effect on integumentary proliferation or development, wherein in a increase in the integumentary proliferation or development in the presence of the agent indicates that the agent can be used to increase integumentary proliferation or development and a decrease in the integumentary proliferation or development in the presence of the agent indicates that the agent can be used to decrease integumentary proliferation or development.

39. The method of claim 38, further comprising comparing an amount of integumentary proliferation or development in the presence of the agent to an amount of integumentary proliferation or development in the absence of the agent, wherein in a increase in the integumentary proliferation or development in the presence of the agent compared to an amount of integumentary proliferation or development in the absence of the agent indicates that the agent can be used to increase proliferation or development of integument, and wherein a decrease in the integumentary proliferation or development in the presence of the agent compared to an amount of integumentary proliferation or development in the absence of the agent indicates that the agent can be used to decrease integumentary proliferation or development.

40. The method of claim 38, wherein the method is a method of screening for an agent that increases integumental proliferation or development, wherein increasing integumentary proliferation comprises increasing skin proliferation, increasing adnexal structure proliferation, increasing hair growth cycling rate, or combinations thereof.

41. The method of claim 38, wherein the method is a method of screening for an agent that decreases integumental proliferation or development, wherein decreasing integumentary proliferation or development comprises decreasing skin proliferation or development, decreasing adnexal structure proliferation or development, decreasing hair growth cycling rate, or combinations thereof.

42. The method of claim 41, wherein administering the agent to a cell in an integument comprises administering the agent to the transgenic mouse of claim 32.

43. A method of screening for an agent that decreases integumental proliferation or development comprising: administering the agent to the transgenic mouse of claim 32; and determining whether the agent has an effect on integumentary proliferation or development, wherein in a decrease in the integumentary proliferation or development in the presence of the agent indicates that the agent can be used to decrease integumentary proliferation or development.

44. The method of claim 43, further comprising comparing an extent of integumental proliferation or development in the transgenic mouse in a presence of the agent, with an extent of integumental proliferation or development in an absence of the agent.

45. A method of screening for an agent that increases repair of damaged DNA, comprising: administering the agent to a cell; and determining whether the agent has an effect on repair of damaged DNA, wherein in a increase in the repair of damaged DNA in the presence of the agent indicates that the agent can be used to repair damaged DNA.

46. The method of claim 45, further comprising comparing an extent of repair of damaged DNA in a presence of the agent with an extent of repair of damaged DNA in an absence of the agent, wherein in an increase in the repair of damaged DNA in the presence of the agent compared to an amount of DNA repair in the absence of the agent indicates that the agent can be used to repair damaged DNA.

47. The method of claim 45, wherein administering the agent to a cell comprises administering the agent to the transgenic mouse of claim 32;

48. The method of claim 45, further comprising exposing the transgenic mouse to an agent that damages DNA.

49. The method of claim 47, wherein the agent that damages DNA comprises ultraviolet light.

50. A method of screening for an agent that increases repair of damaged DNA, comprising: administering the transgenic mouse of claim 32; exposing the transgenic mouse to an agent that damages DNA; and determining whether the agent has an effect on repair of damaged DNA, wherein in a increase in the repair of damaged DNA in the presence of the agent indicates that the agent can be used to repair damaged DNA.

51. The method of claim 50 further comprising comparing an extent of repair of damaged DNA in the transgenic mouse in a presence of the agent with an extent of repair of damaged DNA in an absence of the agent, wherein in an increase in the repair of damaged DNA in the presence of the agent compared to an amount of DNA repair in the absence of the agent indicates that the agent can be used to repair damaged DNA.

52. The method of claim 50, wherein the agent that damages DNA ultraviolet radiation, light, or chemotherapy.

53. A composition comprising: a therapeutic amount of HMGNl or an HMGNl mimetic; and a therapeutic amount of another anti-proliferative agent.

54. The composition of claim 53, wherein the HMGNl mimetic comprises an HMGNl protein or an HMGNl nucleic acid molecule.

55. The composition of claim 53, wherein the another anti-proliferative agent comprises 5-FU or mitomycin C.

56. A method of treating skin cancer, comprising administering the composition of claim 53 to a subject having skin cancer.

57. The method of claim 56, wherein the subject is first screened to determine if the subject has skin cancer.

58. A composition comprising: a therapeutic amount of an HMG l antagonist; and a therapeutic amount of a hair growth stimulating agent.

59. The composition of claim 58, wherein the HMGNl antagonist comprises an HMGNl antisense molecule or siRNA.

60. The composition of claim 58, wherein the hair growth stimulating agent comprises minoxidil or finasteride.

61. A method of increasing hair growth in a subject, comprising administering the composition of claim 58 to a subject in need of increased hair growth.

62. The method of claim 61, wherein the subject is balding or has alopecia.