EP1891108A1 - Réactifs et dosages diagnostiques permettant de détecter la protéine psp94 - Google Patents

Réactifs et dosages diagnostiques permettant de détecter la protéine psp94

Info

Publication number
EP1891108A1
EP1891108A1 EP06752805A EP06752805A EP1891108A1 EP 1891108 A1 EP1891108 A1 EP 1891108A1 EP 06752805 A EP06752805 A EP 06752805A EP 06752805 A EP06752805 A EP 06752805A EP 1891108 A1 EP1891108 A1 EP 1891108A1
Authority
EP
European Patent Office
Prior art keywords
psp94
antibody
seq
leu
pro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06752805A
Other languages
German (de)
English (en)
Other versions
EP1891108A4 (fr
Inventor
Jonathan Reeves
Jerome Edward Tanner
Chandra J. Panchal
Pierre Du Ruisseau
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ambrilia Biopharma Inc
Original Assignee
Ambrilia Biopharma Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ambrilia Biopharma Inc filed Critical Ambrilia Biopharma Inc
Publication of EP1891108A1 publication Critical patent/EP1891108A1/fr
Publication of EP1891108A4 publication Critical patent/EP1891108A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57434—Specifically defined cancers of prostate
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069—Reproductive system, e.g. ovaria, uterus, testes, prostate
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/32—Immunoglobulins specific features characterized by aspects of specificity or valency specific for a neo-epitope on a complex, e.g. antibody-antigen or ligand-receptor
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00—Chemistry: molecular biology and microbiology
    • Y10S435/975—Kit
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00—Chemistry: analytical and immunological testing
    • Y10T436/10—Composition for standardization, calibration, simulation, stabilization, preparation or preservation; processes of use in preparation for chemical testing
    • Y10T436/105831—Protein or peptide standard or control [e.g., hemoglobin, etc.]

Definitions

  • This invention relates to diagnostic assays, methods, and kits for detecting a free form of PSP94, and reagents such as antibodies able to bind to a free form of PSP94.
  • the prostate gland which is found exclusively in male mammals, produces several components of semen and blood and several regulatory peptides.
  • the prostate gland comprises stromal and epithelial cells, the latter group consisting of columnar secretory cells and basal nonsecretory cells. A proliferation of these basal cells as well as stromal cells gives rise to benign prostatic hyperplasia (BPH), which is one common prostate disease.
  • BPH benign prostatic hyperplasia
  • Another common prostate disease is prostatic adenocarcinoma (CaP), which is the most common of the fatal pathophysiological prostate cancers, and involves a malignant transformation of epithelial cells in the peripheral region of the prostate gland.
  • Prostatic adenocarcinoma and benign prostatic hyperplasia are two common prostate diseases, which have a high rate of incidence in the aging human male population.
  • Prostate cancer is the second most common cause of cancer related death in elderly men, with approximately 185,000 cases diagnosed and about 39,000 deaths reported annually in the United States.
  • PAP Prostatic Acid Phosphatase
  • PSA Prostate Specific Antigen
  • PSP94 Prostate Secretory Protein of 94 amino acids
  • PIP Prostatic lnhibin Peptide
  • HSPI Human Seminal Plasma lnhibin
  • ⁇ -MSP ⁇ - microseminoprotein
  • PSP94 is a simple non-glycosylated cysteine-rich protein, and constitutes one of three predominant proteins found in human seminal fluid along with Prostate Specific Antigen (PSA) and Prostate Acid Phosphatase (PAP).
  • PSA Prostate Specific Antigen
  • PAP Prostate Acid Phosphatase
  • PSP94 has a molecular weight of 10.7 kDa, and the complete amino acid sequence of this protein has already been determined.
  • the cDNA and gene for PSP94 have been cloned and characterized (Ulvsback, et al., Biochem. Biophys. Res. Comm., 164:1310, 1989; Green, et al., Biochem. Biophys. Res. Comm., 167:1 184, 1990).
  • PSP94 is located predominantly in prostate epithelial cells. It is also present, however, in a variety of other secretory epithelial cells (Weiber, et al., Am. J. Pathol., 137:593, 1990). PSP94 has been shown to be expressed in prostate adenocarcinoma cell line, LNCap (Yang, et al., J. Urol., 160:2240, 1998).
  • Native PSP94 has been shown to have a therapeutic effect in the treatment of hormone refractory prostate cancer (and potentially other prostate indications). For example, PSP94 expression within prostate cancer is known to decrease as tumor grade and agressivity increases. Tumor PSP94 expression is stimulated upon anti- androgen treatment, particularly in high grade tumors.
  • United States Patent No. 5,428, 01 1 (Sheth A. R. et al., issued 1995-06-27), incorporated herein by reference, describes pharmaceutical preparations comprising native PSP94 used in the in-vitro and in-vivo inhibition of prostate, gastrointestinal and breast tumor growth.
  • These pharmaceutical preparations include either native PSP94 alone or a mixture of native PSP94 and an anticancer drug such as, for example, mitomycin, idalubicin, cisplatin, 5-fluorouracil, methotrexate, adriamycin and daunomycin.
  • an anticancer drug such as, for example, mitomycin, idalubicin, cisplatin, 5-fluorouracil, methotrexate, adriamycin and daunomycin.
  • rhuPSP94 recombinant human PSP94
  • polypeptide analogues such as PCK3145
  • PSP94 is involved in the feedback control of, and acts to suppress secretion of, circulating follicle-stimulating hormone (FSH) both in-vitro and in-vivo in adult male rats.
  • FSH circulating follicle-stimulating hormone
  • PSP94 acts both at the pituitary as well as at the prostate site since both are provided with receptor sites for PSP94.
  • PSP94 has been demonstrated to suppress the biosynthesis and release of FSH from the rat pituitary as well as to possibly affect the synthesis/secretion of an FSH-like peptide by the prostate.
  • PSP94 occurs as a free (unbound) form or bound form associated with a carrier protein(s) of unknown identity.
  • PSP94 in its bound form (state) has been quantified in the blood of prostate cancer patients and these measurements have been analyzed for their utility as prognostic evaluation (Bauman, G. S., et al., The Prostate J. 2:94-101 , 2000; Xuan, J.W. US patent 6,107,103; Wu, D. et al., J. Cell. Biochem. 76:71 -83, 1999). It was suggested that measurements of the free and bound forms of PSP94 are likely to have a greater clinical relevance in several areas of prostate cancer than measurements of the free form alone.
  • the present invention relates to antibodies having specificity for PSP94 or a PSP94-binding protein and improved diagnostic and prognostic assays, hybridomas, kits and reagents thereof.
  • the carrier protein(s) to which PSP94 is bound is described, identified and characterized in the present application.
  • PSP94-binding protein(s) and related antibodies may have an impact on the biological activity of PSP94 and may therefore be used herein as a diagnostic and prognostic marker of (PSP94-related) disease.
  • the present invention relates to an (isolated) antibody able to bind to an epitope of PSP94 which may be available when PSP94 is in a free form.
  • an (isolated) antibody of the present invention may bind to a free form of PSP94 (SEQ ID NO.:1 ) without being able to bind to a PSP94/PSP94-binding protein complex.
  • the antibody may be, for example, an antibody produced by the hybhdoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240 or antigen binding fragments thereof. Also in accordance with the present invention, the antibody may be, for example, the antibody produced by the hybhdoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599 or antigen binding fragments thereof.
  • the present invention relates to a hybridoma cell line producing an antibody that may bind to an epitope of PSP94 which may be available when PSP94 is in a free form.
  • hybridoma cell line which may be used for the present invention may include the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240 or the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599.
  • This invention also relates to polypeptides (SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9) identified herein as PSP94-binding protein(s), purification process, nucleic acid and amino acid sequence and the use of these sequences in the diagnosis, and prognosis of diseases (e.g., prostate cancer or diseases characterized by abnormal or elevated levels of PSP94 and/or follicle stimulating hormone (FSH) and/or abnormal or elevated levels of a PSP94-binding protein).
  • diseases e.g., prostate cancer or diseases characterized by abnormal or elevated levels of PSP94 and/or follicle stimulating hormone (FSH) and/or abnormal or elevated levels of a PSP94-binding protein.
  • the present invention provides a (e.g., isolated) polynucleotide (e.g., encoding a PSP94-binding protein), which may comprise a member selected from the group consisting of a) a polynucleotide as set forth in SEQ ID NO.: 1 , b) a polynucleotide as set forth in SEQ ID NO.: 6, c) a polynucleotide having sequence 1 to 1392 of SEQ ID NO.:6, d) a polynucleotide having sequence 1 to 1653 of SEQ ID NO.:6, e) a polynucleotide of a size between 10 and 2005 (or 2004) bases in length identical in sequence to a contiguous portion of at least 10 bases of the polynucleotide as set forth in SEQ ID NO.: 1 , and f) a polynucleotide of a size between 10 and 1876 (or 1875) bases in length identical in
  • the polynucleotide may preferably be the polynucleotide as set forth in SEQ ID NO.:1 or the polynucleotide as set forth in SEQ ID NO.:6 or the polynucleotide having sequence 1 to 1392 of SEQ ID NO.:6 or a polynucleotide having sequence 1 to 1653 of SE ⁇ ID NO.:6.
  • the polynucleotide of the present invention may particularly be chosen based on the ability of the encoded protein to bind PSP94. It is to be understood herein that SEQ ID NO.: 1 may be considered an analogue of SEQ ID NO.: 6.
  • the present invention provides polypeptides and polypeptides analogues such as for example, a polypeptide as set forth in SEQ ID NO.: 2,
  • polypeptide of a size between 10 and 505 amino acids in length identical to a contiguous portion of the same size of SEQ ID NO.:2 a polypeptide of a size between 10 and 592 amino acids in length identical to a contiguous portion of the same size of SEQ ID NO.:3,
  • polypeptide analogue having at least 90 % of its amino acid sequence identical to the amino acid sequence set forth in SEQ ID NO: 2, in SEQ ID NO.:3, in SEQ ID NO.:7, in SEQ ID NO: 8 or in SEQ ID NO.:9,
  • polypeptide analog having at least 70 % of its amino acid sequence identical to the amino acid sequence set forth in SEQ ID NO: 2, in SEQ ID NO.:3, in SEQ ID NO.:7, in SEQ ID NO: 8 or in SEQ ID NO.:9,
  • polypeptide analog having at least 50 % of its amino acid sequence identical to the amino acid sequence set forth in SEQ ID NO: 2 in SEQ ID NO.:3, in SEQ ID NO.:7, in SEQ ID NO: 8 or in SEQ ID NO.:9,
  • polypeptide analogue having at least 90 % of its amino acid sequence identical to the amino acid sequence of
  • polypeptide of a length from between 10 and 505 contiguous amino acids of SEQ ID NO.:2,
  • polypeptide analogue having at least 70 % of its amino acid sequence identical to the amino acid sequence of -a polypeptide of a length from between 10 and 505 contiguous amino acids of SEQ ID NO.:2,
  • polypeptide of a length from between 10 and 592 contiguous amino acids of SEQ ID NO.:3 or,
  • polypeptide of a length from between 10 and 624 contiguous amino acids of SEQ ID NO. :7, a polypeptide analogue having at least 50 % of its amino acid sequence identical to the amino acid sequence of
  • polypeptide of a length from between 10 and 624 contiguous amino acids of SEQ ID NO.:7.
  • the polypeptide may preferably be the polypeptide as set forth SEQ ID NO.: 2, the polypeptide as set forth SEQ ID NO.: 3, the polypeptide as set forth SEQ ID NO.:7, the polypeptide as set forth SEQ ID NO.:8 or the polypeptide as set forth SEQ ID NO.:9.
  • the polypeptide of the present invention may particularly be chosen based on its ability to bind PSP94. It is to be understood herein that SEQ ID NO.: 2 and SEQ ID NO.: 3 may be considered analogues of SEQ ID NO.: 7. SEQ ID NO.: 8 and SEQ ID NO.:9 may also be considered analogues of SEQ ID NO.:7.
  • the present invention provides an immunizing composition including, for example, a vector comprising a polynucleotide as defined herein. It is sometimes preferable to have a polynucleotide of at least 21 bases in length of a desired sequence since a polypeptide of 7 amino acids (encoded by a 21 base pair polynucleotide sequence) is often associated with the major histocompatibility complex (MHC) during antigen presentation.
  • MHC major histocompatibility complex
  • the vector may comprise, for example, a polynucleotide selected from the group consisting of a polynucleotide as set forth in SEQ ID NO.: 1 , a polynucleotide as set forth in SEQ ID NO.: 6, a polynucleotide having sequence 1 to 1392 of SEQ ID NO.:6, a polynucleotide having sequence 1 to 1653 of SEQ ID NO.:6, a polynucleotide of a size between 21 and 2005 bases in length identical in sequence to a contiguous portion of the same size of the polynucleotide set forth in SEQ ID NO.: 1 or a polynucleotide of a size between 21 and 1876, bases in length, identical in sequence to a contiguous portion of the same size of the polynucleotide set forth in SEQ ID NO.: 6, and a diluent or buffer.
  • the vector may enable the expression of a polypeptide encoded from the polynucleotide.
  • the vector may be linear or circular and may contain minimal sequences in addition to the polynucleotide itself (e.g., sequence for integration into the genome, promoter, CpG sequences).
  • Administration of a polynucleotide of the present invention may sometimes be sufficient to initiate a desired immune response.
  • the present invention relates to an immunizing composition
  • an immunizing composition comprising a polypeptide as defined herein (e.g., SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9), a polypeptide analogue, variant, fragment or combination thereof and a diluent or a buffer.
  • Immunization with a combination of any of the immunizing composition described herein is also encompassed by the present invention.
  • the immunizing composition(s) may further comprise an adjuvant.
  • the immunizing composition may also comprise PSP94 (native and/or recombinant), PSP94 variant, PSP94 fragment, a vector comprising a polynucleotide encoding PSP94, a polynucleotide encoding a PSP94 variant, a polynucleotide encoding a PSP94 fragment and combination thereof.
  • the vector may enable the expression of a polypeptide encoded from the polynucleotide.
  • the present invention relates to a method of (for) generating an antibody (monoclonal or polyclonal) to a polypeptide (e.g., PSP94, PSP94-binding protein and/or PSP94/PSP94-binbing protein complex), the method comprising administering to a mammal an immunizing composition (comprising a polypeptide, polypeptide analogue, a polynucleotide and combination thereof etc.) as defined herein.
  • an immunizing composition comprising a polypeptide, polypeptide analogue, a polynucleotide and combination thereof etc.
  • mammals that may be immunized using the present method include, for example, a human, a mouse, a rabbit, a sheep, a horse, a cow, a rat, a pig, and other mammals having a functional immune system.
  • a "mammal having a functional immune system” is to be understood herein as a mammal able to produce antibodies (immunoglobulins) when immunized with an antigen (i.e., having a humoral immune response and/or a cellular immune response to the antigen).
  • Firther aspects of the present invention relate to a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242 and antigen binding fragments thereof, to a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4243 and antigen binding fragments thereof, to an hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4242 and to a hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4243
  • the present invention relates to a cell that has incorporated (has been transformed, transduced, transfected, etc ) with any of the polynucleotide of the present invention e g , SEQ ID NO 1 , SEQ ID NO 6, antisenses, fragments, vanants, mRNA, etc
  • the present invention relates to a (isolated) cell that has incorporated and/or that is expressing at least one of the polypeptides of the present invention, e g , SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, variants, fragments, analogues or combination thereof
  • the present invention comprises the use of a polynucleotide as defined herein (SEQ ID NO 1 , SEQ ID NO 6, fragments, antisense, analogues, mRNA), in the diagnosis or prognosis, (or treatment) of a condition linked with abnormal (e g , high, elevated) levels of PSP94, or with abnormal (e g , high, elevated) levels of a PSP94-b ⁇ nd ⁇ ng protein
  • the present invention provides the use of the polypeptide as defined herein (e g , SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, analogue, variant, fragments) in the diagnosis or prognosis, (or treatment) of a condition linked with abnormal (e g , high, elevated) levels of PSP94 or with abnormal (e g , high, elevated) levels of a PSP94-b ⁇ nd ⁇ ng protein
  • polynucleotide defined herein or the polypeptide defined herein may be used in the diagnosis, or prognosis of a condition such as, for example, prostate cancer, stomach cancer, breast cancer, endometrial cancer, ovarian cancer, other cancers of epithelial secretion and benign prostate hyperplasia (BPH) or a disease characterized with an elevated level of FSH
  • a condition such as, for example, prostate cancer, stomach cancer, breast cancer, endometrial cancer, ovarian cancer, other cancers of epithelial secretion and benign prostate hyperplasia (BPH) or a disease characterized with an elevated level of FSH
  • the present invention relates to a method for measuring, in a sample, the amount of a polypeptide as defined herein, for example, a polypeptide selected from the group consisting of SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 7,
  • the method may comprise contacting the sample with a molecule (an antibody or a polypeptide) able to recognize the polypeptide.
  • a molecule an antibody or a polypeptide
  • the method contemplated herein may be applied to polypeptides that are immobilized to a blot membrane, a plate, a matrix or not (in solution).
  • a preferred molecule may have sufficient affinity and specificity for the desired polypeptide. Affinity and specificity may be determined, for example, by comparing binding of the molecule to irrelevant polypeptides, by competition assays for the polypeptide of interest, etc.
  • the molecule used for the above described method may include, for example, the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242 and the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4243.
  • the molecule may be, for example PSP94 and analogues thereof.
  • the method for measuring the amount of a polypeptide selected from the group consisting of SEQ ID NO.: 2, SEQ ID NO.: 3, SEQ ID NO.:7, SEQ ID NO.:8 and SEQ ID NO.:9 contemplated herein may further comprise, for example, the following steps: a) bringing a sample comprising at least one of the polypeptide of the present invention into contact with an antibody immobilized to a suitable substrate (e.g., ELISA plate, matrix, SDS-PAGE, Western blot membranes), b) adding to step a) a detection reagent comprising a label or marker, and; c) detecting a signal resulting from a label or marker.
  • a suitable substrate e.g., ELISA plate, matrix, SDS-PAGE, Western blot membranes
  • Suitable detection reagents may comprise, for example, an antibody or a polypeptide having an affinity for a polypeptide(s) of the present invention, and the detection reagent may have preferably, a different binding site than the antibody. As described herein, the detection reagent may either be directly coupled (conjugated) to a label (or marker) or able to be recognized by a second molecule carrying (conjugated with) the label or marker.
  • an antibody that may be used in step a) is the monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4243.
  • the monoclonal antibody (3F4) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit no.: PTA-4242 may be used as a detection reagent in step c).
  • any antibodies able to bind to a PSP94-binding protein (SEQ ID NO.:2, SEQ ID NO.:3, etc.), such as those antibodies listed in table 10 (identified as clones), may be used in the methods described herein (e.g., (clone) 2B10, 1 B11 , 9B6, P8C2, B3D1 , 26B10, 1A6).
  • (clone) 2B10, 1 B11 , 9B6, P8C2, B3D1 , 26B10, 1A6) When two antibodies are needed to perform the present methods it may be preferable to choose antibodies binding to different epitopes.
  • an antibody that may be used in step a) is the monoclonal antibody (3F4) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit no.: PTA-4242.
  • the monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit no.: PTA-4243 may be used as a detection reagent in step c).
  • the present invention relates to a method for measuring, in a sample the amount of a polypeptide selected from the group consisting of SEQ ID NO.: 2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8 and SEQ ID NO.:9 (variants, analogues, fragments) or combination thereof, that is not bound (i.e., free (unbound)) to PSP94, the method comprising ; a) removing, from the sample, a complex formed by PSP94 and any one of the polypeptide selected from the group consisting of SEQ ID NO.: 2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8 and SEQ ID NO.:9 (variants, analogues, fragments) generating a complex-free sample, and; b) contacting the complex-free sample with an antibody able to recognize any one of the polypeptide selected from the group consisting of SEQ ID NO.: 2, SEQ ID NO.:3,
  • the antibody used in step b) may be selected from the group consisting of the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242 and the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4243.
  • the method for measuring the amount of the polypeptide of the present invention that is not bound to PSP94 contemplated above may, for example, comprise the following step; a) removing, from the sample, a complex formed by PSP94 and any one of the polypeptide selected from the group consisting of SEQ ID
  • the removal of the complex may be performed, for example, by using the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241.
  • Suitable antibodies that may be used in step b) are antibodies selected from the group consisting of the monoclonal antibody (3F4) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242 and the monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4243.
  • the present invention includes the use of an (monoclonal) antibody selected from the group consisting of a monoclonal antibody (2D3) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240, a monoclonal antibody (P1 E8) produced by the hybridoma cell line deposited to the
  • SEQ ID NO.: 3 SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9, variants, fragments, analogues, and/or combination thereof.
  • the present invention includes the use of a molecule selected from the group consisting of a polypeptide as set forth in SEQ ID NO.:2, a polypeptide as set forth in SEQ ID NO.: 3, a polypeptide as set forth in SEQ ID NO.: 7, a polypeptide as set forth in SEQ ID NO.: 8, a polypeptide as set forth in SEQ ID NO.: 9, a monoclonal antibody (2D3) produced by the hybhdoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240, a monoclonal antibody (P1 E8) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241 , a monoclonal antibody (3F4) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242, a monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4243, and
  • the present invention relates to an antibody conjugate comprising a first moiety and a second moiety, the first moiety being selected from the group consisting of a monoclonal antibody (2D3) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240, a monoclonal antibody
  • PTA-4241 a monoclonal antibody (3F4) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242 and a monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under
  • the present invention relates to an antibody conjugate which may comprise a first moiety and a second moiety
  • the first moiety may be an antibody able to bind to an epitope of PSP94 which may be available when PSP94 is in a free form
  • the second moiety may be selected, for example, from the group consisting of a pharmaceutical agent, a solid support, a reporter molecule, a group carrying a reporter molecule, a chelating agent, an acylating agent, a cross-linking agent, and a targeting group.
  • the solid support may be selected, for example, from the group consisting of carbohydrates, liposomes, lipids, colloidal gold, microparticles, microcapsules, microemulsions, and a solid matrix.
  • the reporter molecule may be selected, for example, from the group consisting of a fluorophore, a chromophore, a dye, an enzyme, a radioactive molecule and a molecule of a binding/ligand complex.
  • the pharmaceutical agent may be selected, for example, from the group consisting of a toxin, a drug and a pro-drug.
  • the first moiety may be, for example, an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240 or may be an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599.
  • examples of solid support may comprise, for example, carbohydrates, liposomes, lipids, colloidal gold, microparticles, microcapsules, microemulsions, and the matrix of an affinity column.
  • reporter molecule may be selected from the group consisting of a fluorophore (e.g., rhodamine, fluoroscein, and green fluorescent protein), a chromophore, a dye, an enzyme (e.g., alkaline phosphatase, horseradish peroxidase, beta-galactosidase, chloramphenicol acetyl transferase), a radioactive molecule and a molecule of a binding/ligand (e.g., biotin/avidin (streptavidin)) complex.
  • a fluorophore e.g., rhodamine, fluoroscein, and green fluorescent protein
  • a chromophore e.g., chromophore
  • a dye e.g., an enzyme (e.g., alkaline phosphatase, horseradish peroxidase, beta-galactosidase, chloramphenicol
  • the pharmaceutical agent may be selected from the group of a toxin (e.g., bacterial toxins), a (e.g., anti-cancer) drug and a pro-drug.
  • a toxin e.g., bacterial toxins
  • a (e.g., anti-cancer) drug e.g., a pro-drug.
  • the present invention includes a kit for use in evaluating (in a sample) the amount of PSP94 or for the diagnosis of a condition linked with abnormal (e.g., high, elevated) levels of PSP94 (or of a PSP94-binding protein) comprising a container having a molecule able to recognize (bind) PSP94.
  • a condition linked with abnormal (e.g., high, elevated) levels of PSP94 or of a PSP94-binding protein
  • the kit may be provided (sold) in separate constituents.
  • the molecule able to recognize PSP94 may (comprise, for example) be a molecule selected from the group consisting of (one or more of the following) a monoclonal antibody (2D3) produced by the hybhdoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240, a monoclonal antibody (P1 E8) produced by the hybhdoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241 , a monoclonal antibody (3F : 4) produced by the hybhdoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242, a monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4243, the antibody conjugate(s) of the present inventions and a polypeptide selected from the group consisting of SEQ ID NO.:2, SEQ ID NO.:3, S
  • the kit may further comprise a container having an antibody able to recognize (bind) a polypeptide selected from the group consisting of the polypeptide set forth in SEQ ID NO.:2, the polypeptide set forth in SEQ ID NO.:3 and the polypeptide set forth in SEQ ID NO.:7, the polypeptide set forth in SEQ ID NO.:8, the polypeptide set forth in SEQ ID NO.:8, variant, fragment, analogues and combination thereof.
  • Contemplated by the present invention are the monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4243 and a monoclonal antibody (3F4) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242.
  • kits may be provided in separate constituents.
  • the antibodies provided with the kit may be in different forms such as bound to plates or mtjmbranes or other type of solid matrix or in vials containing concentrated forms or su table working dilutions of the antibodies.
  • the present invention relates to a kit comprising an antibody (a first antibody) which is able to bind to an epitope of PSP94 which may be available when PS1P94 is in a free form.
  • the kit may be use in evaluating the amount of PSP94 or for the diagnosis of a condition linked with abnormal or elevated levels of PSP94.
  • the kit may comprise a container having a molecule able to recognize PSP94.
  • the antibody used in the kit may be conjugated, for example, with a reporter molecule.
  • the reporter molecule may be, for example, an enzyme such as a peroxidase (e.g., horseradish peroxidase).
  • the kit may further comprise a control sample containing a known (predetermined) amount of PSP94 (for example in a substantially purified form)
  • Suitable (first) antibody which may be used in the kit of the present invention includes, for example, the antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-6599
  • the kit may also comprise a second aniibody which may bind to a different epitope of PSP94 or may alternatively comprise a polyclonal antibody which binds to PSP94
  • the second antibody may be, for example, the antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4240
  • kits may further comprise a second antibody which may bind to a different epitope of PSP94 or alternatively, the kit may further comprise a polyclonal antibody which may bird to PSP94
  • one of the antibody of the kits may be bound to a solid matrix (e g , a plate, a membrane, etc ) Any unspecific binding sites of the solid matrix may also be blocked (using bovine serum albumin, milk protein, etc ) if desired
  • the present invention more particularly relates to a kit which may comprise a first and second antibody which binds to PSP94
  • a kit which may comprise a first and second antibody which binds to PSP94
  • at least one of the first or second antibody may bind to a free form of PSP94 (only)
  • the first and second antibody may bind to a different epitope of PSP94
  • the kit may comprise a control sample which may contain a known (predetermined) amount of PSP94 (for example, in a substantially purified form)
  • the first antibody may be selected, for example, from the group consisting of a polyclonal antibody, an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4240, an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241 and an antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599.
  • the second antibody may be selected, for example, from the group consisting of a polyclonal antibody, an antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240, an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241 and an antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599.
  • the first antibody may be a polyclonal antibody and the second antibody may be selected, for example, from the group consisting of an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599 and an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240.
  • the first antibody may be produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241 and the second antibody may be selected, for example, from the group consisting of an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599 and an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240.
  • the second antibody may be conjugated with a reporter molecule.
  • the reporter molecule may be, for example, an enzyme such as a peroxidase (e.g., horseradish peroxidase).
  • the present invention provides a method for preparing a polypeptide as defined herein (a PSP94-binding protein, e.g., a polypeptide selected from the group consisting of the polypeptide set forth in SEQ ID NO.:2, the polypeptide set forth in SEQ ID NO.:3, the polypeptide set forth in SEQ ID NO.:7, the polypeptide set forth in SEQ ID NO.:8 and the polypeptide set forth in SEQ ID NO.:9) comprising: a) cultivating a host cell under conditions which provide for the expression of the polypeptide by the cell; and b) recovering the polypeptide by one or more purification step.
  • a PSP94-binding protein e.g., a polypeptide selected from the group consisting of the polypeptide set forth in SEQ ID NO.:2, the polypeptide set forth in SEQ ID NO.:3, the polypeptide set forth in SEQ ID NO.:7, the polypeptide set forth in SEQ ID NO.:8 and the polypeptid
  • the present invention provides a method for preparing the polypeptide as defined herein (a PSP94-binding protein, e.g., a polypeptide selected from the group consisting of the polypeptide set forth in SEQ ID NO.:2, the polypeptide set forth in SEQ ID NO.:3, the polypeptide set forth in SEQ ID NO.:7 the polypeptide set forth in SEQ ID NO.:8, the polypeptide set forth in SEQ ID NO.:9 and combination thereof) comprising: a) collecting one or more biological sample containing the polypeptide; and b) recovering the polypeptide by one or more purification step.
  • a PSP94-binding protein e.g., a polypeptide selected from the group consisting of the polypeptide set forth in SEQ ID NO.:2, the polypeptide set forth in SEQ ID NO.:3, the polypeptide set forth in SEQ ID NO.:7 the polypeptide set forth in SEQ ID NO.:8, the polypeptide set forth in SEQ ID NO.:
  • the purification step either alone or in combination may be selected from the group consisting of ammonium sulfate precipitation, size exclusion chromatography, affinity chromatography, ion-exchange chromatography or the like.
  • the purification step may comprise; a) adding ammonium sulfate to the biological sample, b) performing ion-exchange chromatography, c) performing affinity-chromatography using a PSP94-conjugated affinity matrix, d) performing size-exclusion chromatography, and e) recovering a fraction containing a substantially pure PSP94-binding protein.
  • the present invention also includes a process for the purification of a PSP94-binding protein from a sample comprising:
  • the precipitation of a PSP94-binding protein in step a) may be effected by adding ammonium sulfate to a final concentration of up to 47%.
  • the ion-exchange chromatography of step d) may be performed by using an anion-exchange chromatography matrix.
  • the present invention in a further aspect thereof comprises a purification process for a PSP94-binding protein (e.g., a polypeptide selected from the group consisting of the polypeptide defined in SEQ ID NO.:2, the polypeptide defined in SEQ ID NO.:3, the polypeptide defined in SEQ ID NO.:7, the polypeptide defined in SEQ ID NO.:8, the polypeptide defined in SEQ ID NO.:9 and combination thereof) (summarized in Figure 8).
  • the purification of a PSP94-binding protein from serum may comprise, for example, the following steps:
  • aqueous media e.g., water, phosphate buffered saline, 10 mM MES, 10 mM MOPS, 10 mM Bicine : these solution (when applicable) may be at a pH comprised, for example, between 4.7 and 9.0, preferably between 5.7 and 8.0 and more preferably between 5.7 and 6.7
  • a preferred aqueous media is 10 mM MES buffer at a pH of 6.5
  • a salt solution selected from the group consisting of sodium chloride, magnesium chloride, potassium chloride to recover (elute, detach) proteins containing a PSP94-binding protein from the ion-exchange chromatography column, preferably sodium chloride with a molarity ranging from, for example, 100 mM to 100O mM,
  • the present invention relates to the product obtained from the purification process defined above.
  • samples e.g., biological sample
  • samples may comprise, for example, blood, plasma, serum, urine, seminal fluid, cell culture media, cell lyzate, etc.
  • the sample is preferably a human (e.g., male) sample.
  • the present invention relates to an antibody, and antigen binding fragments thereof, able to recognize a PSP94 epitope (i.e., exposed epitope) that is available even when PSP94 is bound to another polypeptide (another molecule).
  • a polypeptide may be for example, a polypeptide selected from the group consisting of SEQ ID NO.: 2, SEQ ID NO.: 3, SEQ ID NO.: 7, SEQ ID NO.:8, SEQ ID NO.:9, variant, fragment, analogue and combination thereof.
  • the hybridoma cell line producing such antibody is also contemplated by the present invention.
  • Such antibody is the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit NO.: PTA-4241 (P1 E8) or a polyclonal antibody able to recognize free and bound forms of PSP94.
  • the identification of an exposed epitope may be performed by testing a panel of antibody for their specificity to free and bound forms of PSP94. Antibodies which react (recognize) with both forms may represent candidate antibodies. In parallel, partial trypsin digestion may be performed on the PSP94/PSP94-binding protein complex. PSP94 epitopes (e.g., linear epitopes) available in the complexed forms may then be identified by amino acid sequence analysis. Antibodies able to bind to this or these (available) epitope(s) may be generated. Exposed epitopes are to be understood herein, as epitopes of a molecule (e.g., PSP94, SEQ ID NO.:2, SEQ ID NO.:3.
  • SEQ ID NO.: 7, SEQ ID NO.:8, SEQ ID NO.:9 and their complex that are accessible to an antibody, preferably when the molecule(s) or complex is in its native (natural) state (e.g., non-denatured, natural or 3D form).
  • the present invention provides a method for removing PSP94 from a sample, the method comprising a) contacting the sample with a molecule able to bind to PSP94 (the molecule may be directly or indirectly bound to a matrix or solid support) and ; b) recuperating a sample free of PSP94.
  • PSP94 may proved useful to remove PSP94 from a sample (biological sample) for example, removing excess PSP94 from serum of individuals (i.e., serum depletion of PSP94) having elevated levels of PSP94 and to reinfuse a depleted serum into the individual
  • PSP94 is based on the affinity between PSP94 and any one of the sequence set forth in SEQ ID NO.: 2, SEQ ID NO.: 3, SEQ ID NO.: 7, SEQ ID NO.: 8, SEQ ID NO.: 9,
  • PSP94 antibodies and combination thereof.
  • the molecule referred above may molecule may be selected from the group consisting of SEQ ID NO.: 2, SEQ ID NO.:3, SEQ ID NO.: 7, SEQ ID NO.:8, SEQ ID NO.: 9, a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240 and a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241.
  • the present invention provides a method for removing a complex formed by PSP94 and any one of the polypeptide defined in SEQ ID NO: 2, SE-Q ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9 and combination thereof (e g., PSP94/SEQ ID NO:2 and/or PSP94/SEQ ID NO.:3 and/or PSP94/SEQ ID NO:7, etc.) from a sample, the method comprising; a) contacting the sample with an antibody able to recognize an available (exposed) epitope of the complex (e.g., the antibody may be directly or indirectly bound to a matrix or solid support) and ; b) recuperating a sample free of the complex.
  • an antibody able to recognize an available (exposed) epitope of the complex
  • the antibody may be directly or indirectly bound to a matrix or solid support
  • recuperating a sample free of the complex e.g., the antibody may be directly or indirectly bound to a matrix
  • the antibody used in step b) may comprise, for example, a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4241 , a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No P FA-4242 and a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4243
  • a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4243 Preferably used is the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4243
  • hybridoma cell lines producing the antibodies described herein include the hybridoma cell line deposited to the AfCC under Patent Deposit (e g , Accession) No PTA-4240, the hybridoma cell line deposited to the ATCC under Patent Deposit (e g , Accession) No PTA-4241 and the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-6599
  • the present invention provides a method for measuring, in a sample, the total amount of PSP94, the method may comprise contacting the sample with an antibody able to recognize PSP94 even when PSP94 is bound to another polypeptide
  • the antibody that may be used in measuring the total amount of P3P94 in a sample may be, for example, the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4241 or it may be a polyclonal antibody able to recognize free and bound forms of PSP94
  • the method for measuring total (free (unbound) and bound) amount of PSP94 in a sample contemplated above may comprise the following steps; a) immobilizing (coating, adsorbing) a PSP94-antibody to a suitable substrate (ELISA plate, matrix, SDS-PAGE, Western blot membranes).
  • the antibody may be able to recognize PSP94 even when bound to a
  • PSP94-binding protein such as SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9; b) adding a sample comprising PSP94, c) adding a PSP94 detection reagent comprising a label or marker, and; d) detecting a signal resulting from a label or marker.
  • detection reagents examples include an antibody and a polypeptide having an affinity for PSP94.
  • the detection reagent may preferably have a different binding site than the PSP94- antibody and a PSP94-binding protein.
  • the detection reagent may either be directly coupled to a label (or marker) (e.g., antibody conjugate of the present invention) or able to be recognized by a second molecule carrying (conjugated with) the label or marker.
  • PSP94-antibody that may be used in step a) is the antibody (P1 E8) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit no.: PTA-4241.
  • the detection reagent may be, for example, the antibody (2D3) (e.g., antibody-conjugate) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit no.: PTA-4240 or any other suitable PSP94 antibody.
  • a polyclonal antibody (one or more polyclonal antibodies) able to recognize free and bound forms of PSP94 may be suitable for any of steps a) or c) in combination with any of the monoclonal antibody described herein.
  • total PSP94 may be captured with a polyclonal antibody (an antibody able to recognize free and bound forms of PSP94) and detection may be performed (directly or indirectly) with another antibody such as P1 E8 (and vice versa).
  • total PSP94 may be captured with an antibody able to recognize PSP94 in its free and bound forms (e.g., bound to a PSP94-binding protein as described herein), such as, for example, a polyclonal antibody or the P1 E8 antibody (produced by the hybridoma cell line PTA-4241 ), and detection of the captured proteins (complex) may be performed with a combination of two or more antibodies i.e., one able to detect the free PSP94 (e.g., 2D3 produced by hybridoma cell line PTA-4240) and one or more antibodies able to detect PSP94-binding protein (e.g., 17G9 produced by the hybridoma cell line PTA-4243; and/or 3F4 produced by the hybridoma cell line PTA- 4242).
  • an antibody able to recognize PSP94 in its free and bound forms e.g., bound to a PSP94-binding protein as described herein
  • detection of the captured proteins (complex) may be performed
  • the present invention provides an improved method for measuring the amount of free PSP94 in a sample, the method comprising contacting the sample with an antibody able to recognize PSP94 (e.g., in its free form).
  • the present invention relates to a method for measuring the amount of free PSP94 in a sample, the method may comprise contacting the sample with an antibody able to recognize PSP94 (a free form of PSP94).
  • the present invention relates to a method for detecting or measuring a free form of PSP94 in a sample, the method may comprise for example,
  • an antibody of the present invention e.g., an antibody able to bind to an epitope of PSP94 which is available when PSP94 is in a free form
  • an antibody of the present invention e.g., an antibody able to bind to an epitope of PSP94 which is available when PSP94 is in a free form
  • suitable antibody used with the method of the present invention includes the antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240 antigen binding fragments thereof ot the antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.:PTA-6599 and antigen binding fragments thereof.
  • the signal obtained for the sample may be compared with a signal obtained for a control sample containing a predetermined amount of PSP94.
  • the present invention also relates to a method for detecting or measuring a free form of PSP94 in a sample, the method may comprise:
  • the first and second antibody may bind to a different PSP94 epitope.
  • the first antibody may be selected, for example, from the group consisting of a polyclonal antibody, an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240 and an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599.
  • the first antibody may be a polyclonal antibody and the second antibody may be an antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240.
  • the first antibody may be a polyclonal antibody and the second antibody may be an antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-6599.
  • the sample may be selected, for example, from the group consisting of blood, plasma, serum, urine, seminal fluid, cell culture media and cell lyzate.
  • the present invention relates to a method for detecting or measuring a free form of PSP94 in a sample, the method may comprise :
  • the first and second antibody may bind to a different PSP94 epitope.
  • the first antibody may be an antibody pioduced by a hyb ⁇ doma cell line deposited to the ATCC under Patent Deposit No PTA-4240 and the second antibody may be selected from the group consisting of a polyclonal antibody, an antibody produced by a hyb ⁇ doma cell line deposited to the ATCC under Patent Deposit No PTA-4241 and an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-6599
  • the first antibody may be an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No PFA-6599 and the second antibody may be selected from the group consisting of a polyclonal antibody, an antibody produced by a hybridoma cell line deposited to the AfCC under Patent Deposit No PTA-4241 and an antibody produced by a hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4240
  • the present invention relates to a method for detecting or measuring a free form of PSP94 in a sample
  • the method may comprise contacting the sample with an antibody conjugate able to bind to an epitope of PSP94 which may be available when PSP94 is in a free form
  • the antibody conjugate may comprise a first moiety and a second moiety
  • the first moiety may be an antibody able to bind to an epitope of PSP94 which may be available when PSP94 is in a free form and the second moiety may be selected from the group consisting of a reporter molecule and a group carrying a reporter molecule
  • the present invention relates to a method for measuring free PSP94 in a sample, the method may comprise contacting the sample with a first antibody and second antibody Each of the first antibody and second antibody may be able to bind to a different epitope of PSP94 In accordance with the present invention at least one of the first antibody and second antibody may bind to PSP94 in its free form only
  • suitable antibodies may include for example, the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4240 and the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No PTA-4241
  • suitable antibodies are encompassed by the present invention, such as the 12C3 antibody (Table 10) Any of the antibodies binding to PSP94 described herein may be used to detect PSP94 in other types of assays such as immunohistochemistry, Western blot, etc.
  • a tissue section (e.g., from a prostate) which comprises PSP94 expressing cells may be contacted with one of the anti-PSP94 antibody of the present invention and the presence of PSP94 is assessed by detecting a signal from a label carried by the anti-PSP94 antibody.
  • the presence of PSP94 may also be assessed by detecting a signal, for example, from a label carried by a second antibody able to bind to the anti- PSP94 antibody.
  • An example of a suitable second antibody is an anti-mouse IgG (e.g., anti-mouse IgG 1 K ) for the monoclonal antibodies (e.g., 1A6, 2D3, 12C3, P1 E8, etc.) or for the anti-PSP94 polyconal antibody, an anti-rabbit antibody (e.g., anti rabbit Ig3).
  • an anti-mouse IgG e.g., anti-mouse IgG 1 K
  • the monoclonal antibodies e.g., 1A6, 2D3, 12C3, P1 E8, etc.
  • an anti-rabbit antibody e.g., anti rabbit Ig3
  • An example of an immunodetection assay (a sandwich ELISA assay measuring free PSP94) may be performed with an antibody able to recognize PSP94 coated onto the wells of an ELISA plate which is contacted with a sample containing PSP94.
  • a second antibody able to bind to an epitope of PSP94 available when PSP94 is in a free form may be added and detection may be performed.
  • the second antibody may carry a reporter molecule.
  • two antibodies are used; (a first antibody and a second antibody) each one may be able to bind a different epitope of PSP94. It is to be understood that the first and second antibody may be interchanged without affecting the results.
  • One of the first or second antibody may be an antibody able to bind to PSP94 in its free form only (e.g., not in a form bound to a PSP94 binding protein described herein).
  • the first antibody may be an antibody able to bind to all forms of PSP94 (bound and free, for example, a polyclonal antibody) and the second antibody may be an antibody able to bind to the free form of PSP94 only (i.e., an antibody able to bind to an epitope of PSP94 which is available when PSP94 is in a free form only, i.e., the antibody may bind to an epitope of PSP94 which is masked when PSP94 is bound (e.g., to a PSP94 binding protein described herein)). Therefore although all forms of PSP94 are captured by the first antibody, only the free form of PSP94 may be detected by the second antibody in this type of assay.
  • the first antibody may be an antibody which may bind to the free form of PSP94 only (1A6), as described herein, and the second antibody may be an antibody which may bind to all (every) form of PSP94 (bound and unbound). As the first antibody captures only the free form of PSP94 and the bound form is not retained, the second antibody may detect the free form of PSP94 only.
  • the first antibody may be an antibody which binds to the free form of PSP94 only (1A6), as described herein, and the second antibody may also be an antibody which binds to the free form of PSP94 (only).
  • the first and second antibody may bind to different epitopes of PSP94.
  • the second antibody may carry an enzyme, i.e. horseradish peroxidase which, when the enzyme's substrate is added, produces a colorimetric reaction.
  • an enzyme i.e. horseradish peroxidase which, when the enzyme's substrate is added, produces a colorimetric reaction.
  • this third antibody may carry itself a reporter molecule (or else). This third antibody may be able to recognize the second antibody (it may recognize the isotype and species of the second antibody).
  • the present invention provides an improved method for measuring the amount of free (unbound PSP94) PSP94 (and/or PSP94 fragments and analogues thereof) in a sample, the method comprising, contacting a sample free of the PSP94/PSP94-binding protein complex with an antibody able to recognize PSP94, PSP94 fragments and analogues thereof.
  • the improved method may for measuring the amount of free PSP94 in a sample may comprise; a) removing a complex formed by PSP94 and any one of the polypeptide selected from the group consisting of SEQ ID NO.: 2, SEQ ID NO.:3, SEQ ID NO.:7 SEQ ID NO.:8, SEQ ID NO.:9 and combination thereof, generating a complex-free sample, and; b) contacting the complex-free sample with an antibody able to recognize PSP94.
  • the improved method for measuring the amount of free (unbound PSP94) PSP94 in a sample contemplated herein may also comprise, for example, the following steps; a) removing a complex formed by PSP94 and any one of the polypeptide selected from the group consisting of SEQ ID NO.: 2, SEQ ID NO.:3, SEQ
  • detection reagents examples include reagents selected from the group consisting of an antibody, a polypeptide or other molecule having an affinity for PSP94.
  • the detection reagent may have a different binding site than the PSP94-antibody, and the detection reagent may either be directly coupled to a label (or marker) or able to be recognized by a second molecule carrying (conjugated with) the label or marker.
  • PSP94-antibody used in step b) is the monoclonal antibody (2D3) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit no.: PTA-4240.
  • the monoclonal antibody (P1 E8) (e.g., conjugated) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit no.: PTA-4241 may be used as a detection reagent (directly or indirectly as described herein).
  • PSP94-antibody that may be used in step b) is the monoclonal antibody (P1 E8) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit no.: PTA-4241.
  • the monoclonal antibody (2D3) e.g., conjugated
  • PTA-4240 may be used as a detection reagent(directly or indirectly as described herein).
  • the present invention relates to a method for measuring the amount of total PSP94 (bound and unbound (free)) in a sample
  • the method may comprise using a first and a second antibody able to bind to PSP94 even when PSP94 is bound to another polypeptide (e.g., SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NQ. :8, SEQ ID NO.:9). It may be preferable that the first and second antibodies bind to a different PSP94 epitope.
  • the present invention relates also to a method for measuring tolal PSP94 in a sample, the method comprising using a first and a second antibody, wherein the first antibody is able to bind to PSP94 even when PSP94 is bound to a polypeptide and wherein the second antibody is able to bind to PSP94 and to displace any one of the polypeptide selected from the group consisting of SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9 from a complex formed by PSP94 and the polypeptide.
  • the first antibody may be, for example, the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241 , or any other suitable antibody.
  • the second antibody may be, for example, the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240.
  • the present invention provides a method for measuring the level (amount, concentration) of PSP94 in a sample the method comprising contacting the sample with an antibody that is able to recognize PSP94 in its free and bound forms (e.g., bound to SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9 etc.) forms.
  • an antibody that is able to recognize PSP94 in its free and bound forms (e.g., bound to SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9 etc.) forms.
  • the monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit NO.: PTA-4241 may be used.
  • methods e.g., measuring total PSP94, free PSP94, free or total PSP94-binding protein and calculating ratios
  • clinical samples serum, blood, plasma, etc.
  • they may be useful for screening subjects for a condition linked to abnormal or elevated levels of PSP94 (e.g., prostate cancer (e.g., prediction of relapse free interval in post-radiotherapy prostate cancer)) and for assessing, for example, prognosis in a subject diagnosed with prostate cancer.
  • a condition linked to abnormal or elevated levels of PSP94 e.g., prostate cancer (e.g., prediction of relapse free interval in post-radiotherapy prostate cancer)
  • prognosis in a subject diagnosed with prostate cancer.
  • methods of the present invention may also include a step of collecting a sample; for example, a blood sample from an individual with a condition linked with elevated levels of PSP94 or other condition and performing the above- mentioned methods and assays.
  • Methods of the present invention may further comprise detecting a signal from a label that is provided (carried) by the molecule (antibody, polypeptide; e.g., from the label attached to the molecule) or by a second molecule (antibody or binding/ligand system) carrying the label.
  • Methods of the present invention may also include comparing (detecting) the signal (results) obtained for the sample with signal (results) obtained for a control sample containing a known amount of the polypeptide of interest.
  • the present invention relates to the use of a PSP94 antibody for the treatment of a condition associated with elevated levels of PSP94. It is to be understood that a method of treating a patient with such condition, comprising administering a PSP94 antibody is also encompassed herein.
  • the present invention relates to the use of a PSP94 antibody in the manufacture of a medicament for the treatment of a condition associated with elsvated levels of PSP94.
  • the PSP94 antibodies may be for example, a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240 or a monoclonal antibody produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241.
  • a sample is to be understood herein as an aliquot of blood, serum, plasma, biological fluid, or it may be, for example, proteins (containing other constituents or not) bound to the well of an ELISA plate, a membrane, a gel, a matrix, etc.
  • the present invention relates to the use of a molecule selected from the group consisting of the polypeptide as set forth in SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.: 7, SEQ ID NO.:8, SEQ ID NO.:9, a monoclonal antibody (2D3) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4240, a monoclonal antibody (P1 E8) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4241 , a monoclonal antibody (3F4) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4242 and a monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit No.: PTA-4243, for evaluating the amount oi PSP94 (free and/or bound and/or total), PSP94 variants and analogues thereof in
  • conditions that are contemplated for methods and uses described herein may comprise, for example, prostate cancer, stomach cancer, breast cancer, endometrial cancer, ovarian cancer, other cancers of epithelial secretory cells and benign prostate hyperplasia (BPH).
  • BPH benign prostate hyperplasia
  • PSP94-binding protein specific antibodies li ⁇ .ted in table 10 are interchangeable and are encompassed by the present invention (including their hydridoma cell lines).
  • the monoclonal antibody (3F4) pioduced by the hybridoma cell line deposited to the ATCC under Patent Deposit NO.: PTA-4242 may be interchanged with the monoclonal antibodies 2B10, 9B6, 1 B1 1 , etc.
  • the monoclonal antibody (17G9) produced by the hybridoma cell line deposited to the ATCC under Patent Deposit NO.: PTA-4243 may be interchanged with the monoclonal antibody P8C2, 1 B11 , 26B10, 9B6, etc.
  • PTA-4243 may be interchanged with the monoclonal antibody P8C2, 1 B11 , 26B10, 9B6, etc.
  • P8C2 1 B11 , 26B10, 9B6, etc.
  • a variety of other conditions are possible. However, when two antibodies are needed to perform the present methods it is preferable to choose antibodies that bind to different epitopes.
  • antibody fragments such as an antigen-binding fragment (e.g., antigen binding site) of any of the (monoclonal) antibodies disclosed herein are encompassed by the present invention.
  • Polynucleotide generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA, or modified RNA or DNA.
  • Polynucleotides include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide refers to triple- stranded regions comprising RNA or DNA or both RNA and DNA.
  • the term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RMA characteristic of viruses and cells.
  • Polynucleotide includes but is not limited to linear and end-closed molecules.
  • Polynucleotide also embraces relatively short polynucleotides, often referred to as oligonucleotides.
  • the polynucleotide may be, for example, a polyribonucleotide, a polydeoxyribonucleotide, a modified polyribonucleotide, a modified polydeoxyribonucleotide, a complementary polynucleotide (e.g., antisense) or a combination thereof.
  • Polypeptide refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds (i.e., peptide isosteres). "Polypeptide” refers to both short chains, commonly referred as peptides, oligopeptides or oligomers, and to longer chains generally referred to as proteins. As described above, polypeptides may contain amino acids other than the 20 gene- encoded amino acids.
  • Variant is a polynucleotide or polypeptide that differs from reference polynucleotide or polypeptide respectively, but retains essential properties.
  • a typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusion and truncations in the polypeptide encoded by the reference sequence, as discussed herein.
  • a typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequence of the reference polypeptide and the variant are closely similar overall and, in many regions, identical.
  • a variant and reference polypeptide may differ in amino acid by one or more substitutions, additions, deletions, or any combination therefore.
  • a substituted or inserted amino acid residue may or may not be one encoded by the genetic code.
  • a variant polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis. "Variants” as used herein encompass (active) mutants, analogues, homologues, chimeras, fragments and portions thereof. However, “variants” as used herein may retain parts of the biological activity of the original polypeptide.
  • pharmaceutical composition means therapeutically effective amounts of the agent together with suitable diluents, preservatives, solubilizers, emulsifiers, adjuvant and/or carriers.
  • a “therapeutically effective amount” as used herein refers to that amount which provides a therapeutic effect for a given condition and administration regimen.
  • compositions are liquids or lyophilized or otherwise dried formulations and include diluents of various buffer content (e.g., Tris-HCI., acetate, phosphate), pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), solubilizing agents (e.g., glycerol, polyethylene glycerol), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), bulking substances or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to the protein, complexation with metal ions, or incorporation of the material into or onto particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid,
  • Controlled or sustained release compositions include formulation in lipophilic depots (e.g., fatty acids, waxes, oils).
  • particulate compositions coated with polymers e.g., poloxamers or poloxamines.
  • Other embodiments of the compositions of the invention incorporate particulate forms protective coatings, protease inhibitors or pe ⁇ meation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral routes.
  • the pharmaceutical composition is administered parenterally, paracancerally, transmucosally, transdermal ⁇ , iniramuscularly, intravenously, intradermal ⁇ , subcutaneously, intraperitonealy, intraventricular ⁇ , intracranially and intratumorally.
  • an “immunizing composition” or “immunogenic composition” as used herein refers to a composition able to promote an immune response in the h ⁇ st receiving such composition.
  • An “immunizing composition” includes a compound, such as for example, a polypeptide (or a DNA or RNA able to encode a polypeptide) for which an antibody is sought. The polypeptide is usually diluted in a buffer, diluent or a pharmaceutically acceptable carrier.
  • An “immunizing composition” may comprise an adjuvant such as or example complete Freund's adjuvant, incomplete Freund's adjuvant and aluminum hydroxide.
  • pharmaceutically acceptable carrier or “pharmaceutical carrier” are known in the art and include, but are not limited to, 0.01-0.1 M and preferably 0.05 M phosphate buffer or 0.8% saline. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's orfixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, collating agents, inert gases and the like.
  • PSP94-binding protein relates to a protein (such as SEQ ID NO.:2, SEQ ID No.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9) that is able to bind (i.e., associate) to PSP94, usually in a reversible fashion.
  • the term “free PSP94” relates to a PSP94 protein that is not associated with another polypeptide (e.g., with a PSP94-binding protein).
  • the term “free PSP94” means that PSP94 is in an unbound form (state).
  • the term “antibody” refers to either monoclonal antibody, polyclonal antibody, humanized antibody, single-chain antibody, antibody fragments including Fc, F(ab)2, F(ab)2' and Fab and the like. It is to be understood that a "polyclonal antibody” is a term used to refer to antibodies generated by immunizing an animal against an antigen and which are often directed to multiple epitopes of the antigen.
  • the term "antigen binding fragment” relates to an antibody fragment (antigen binding domain) able to recognize (bind) the antigen of interest.
  • An “antigen binding fragment” may be isolated from the gene(s) (e.g., gene encoding a variable region) encoding the antibody using molecular biology methods. The isolated gene(s) may engineered to create, for example, a single chain antibody.
  • the "antigen binding fragment” of an antibody is known to be responsible for the specific binding of the antibody to the antigen.
  • PSP94 or “PSP” relates to the native and recombinant PSP94.
  • the identified and isolated gene may be inserted into an appropriate cloning or expression vector (i.e., expression system).
  • an appropriate cloning or expression vector i.e., expression system.
  • vectors include, but are not limited to, plasmids or modified viruses (e.g., bacteriophages, adenoviruses, adeno-associated viruses, retroviruses), but the vector system must be compatible with the host cell used.
  • cloning vectors include, but are not limited to, Escherichia coli (E.
  • plasmids such as pBR322 derivatives or pUC plasmid derivatives (e.g., pGEX vectors, pmal-c, pFLAG, etc). Examples of expression vectors are discussed bellow.
  • the insertion into a cloning or expression vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector, which has complementary cohesive termini. However, if the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules may be enzymatically modified.
  • any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences.
  • Recombinant molecules can be introduced into host cells via transformation, transfection, lipofection, infection, electroporation, etc.
  • the cloned gene may be contained on a shuttle vector plasmid, which provides for expansion in a cloning cell, e.g., E. coli, and facilitate purification for subsequent insertion into an appropriate expression cell line, if such is desired.
  • a shuttle vector which is a vector that can replicate in more than one type of organism, can be prepared for replication in both E. coli and Saccharomyces cerevisiae by linking sequences from an E. coli plasmid with sequences from the yeast 2.mu. plasmid.
  • the polynucleotide e.g., gene, cDNA, RNA
  • the polynucleotide of the present invention when inserted into the appropriate vector, it may be used, for example, as a way to express the protein in a foreign host cell for its isolation (such as bacteria, yeast, insect, animal or plant cells) or in a (isolated) cell from an individual for purpose of gene therapy treatment or cell-mediated vaccination (using, for example, dendritic cells).
  • cells may be isolated from a mammal and treated (e.g., exposed, transfected, lipofected, infected, bombarded (using high velocity microprojectiles)) ex-vivo with the polynucleotide (cDNA, gene, RNA, antisense)of the present invention before being re-infused in the same individual or in a compatible individual.
  • the polynucleotide cDNA, gene, RNA, antisense
  • In vivo delivery of a polynucleotide may be performed by other methods than the one described above.
  • liposomal formulations when injected may also be suitable for mediating in vivo delivery of a polynucleotide.
  • polypeptides of the present invention may be produced in a prokaryotic host (e.g., E. coli or Bacillus subtilis (B. subtilis)) or in a eukaryotic host (yeast e.g., Saccharomyces or Pichia Pastoris; mammalian cells, e.g., monkey COS cells, mouse 3T3 cells (Todaro GJ and Green H., J. Cell Biol. 17: 299-313, 1963), Chinese Hamster Ovary cells (CHO) (e.g., Puck TT et al. , J. Exp. Med. 108: 945-956, 1958), BHK, human kidney 293 cells (e.g., ATCC: CRL-1573), or human HeLa cells (e.g., ATCC:CCL-2); or insect cells).
  • a prokaryotic host e.g., E. coli or Bacillus subtilis (B. subtilis)
  • a eukaryotic host e.g
  • DNA sequence encoding polypeptides of the present invention may be cloned into a suitable expression vector such as the pPIC9 vector (Invitrogen).
  • a suitable expression vector such as the pPIC9 vector (Invitrogen).
  • recombination event may occur for example in the A0X1 locus.
  • Such recombination event may place the DNA sequence of polypeptides of the present invention under the dependency of the AOX1 gene promoter.
  • Successful insertion of a gene i.e.
  • DNA sequence) encoding polypeptides of the present invention may result in an expression of such polypeptides that is regulated and/or induced by methanol added in the growth media of the host cell (for reference see Buckholz, R G and Gleeson, M A G , Biotechnology, 9 1067-1072,1991 , Cregg, J M , et al , Biotechnology, 1 1 905-910, 1993, Sreekrishna, K , et al , J Basic Microbiol , 28 265-278, 1988, Wegner, G H , FEMS Microbiology Reviews, 87 279-284, 1990)
  • nucleic acid sequence may be ligated to an adenovirus transcription/translation control complex (e g , the late promoter and tripartite leader sequence)
  • adenovirus transcription/translation control complex e g , the late promoter and tripartite leader sequence
  • This chimeric gene may be inserted into the adenovirus genome, for example, by in vitro or in vivo recombination Insertion into a nonessential region of the viral genome (e g , region E1 or E3) may result in a recombinant vii us that is viable and capable of expressing polypeptides of the present invention in iniected hosts
  • Proteins and polypeptides of the present invention may also be produced by plant cells
  • Expression vectors such as cauliflower mosaic virus and tobacco mosaic virus and plasmid expression vectors (e g , Ti plasmid) may be used for the expression of polypeptides in plant cells
  • Such cells are available from a wide range of sources (e g , the American Type Culture Collection, Rockland, Md )
  • the methods of transformation or transfection and the choice of expression vehicle are of course to be chosen accordingly to the host cell selected
  • AcNPV Autographa califomica nuclear polyhidrosis virus
  • a host cell may be chosen for its ability to modulate the expression of the inserted sequences
  • Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristics and specific mechanisms for posttranslational processing and modification of proteins and gene products.
  • cell lines or host systems may be chosen to ensure desired modification and processing of the foreign protein expressed.
  • eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
  • mammalian host cells comprise for example, but are not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, and 3T3.
  • polypeptides of the present invention may be produced by a stably- transfected mammalian cell line.
  • a number of vectors suitable for stable transfection of mammalian cells are available to the public; methods for constructing such cell lines are also publicly available.
  • cDNA encoding the rHuPSP94 protein may be cloned into an expression vector that includes the dihydrofolate reductase (DHFR) gene. Integration of the plasmid and, therefore, DNA sequence of polypeptides of the present invention, into the host cell chromosome may be selected for by including methotrexate in the cell culture media. This selection may be accomplished in most cell types.
  • DHFR dihydrofolate reductase
  • Specific initiation signals may also be required for the efficient translation of DNA sequences inserted in a suitable expression vehicle as described above. These signals may include the ATG initiation codon and adjacent sequences. For example, in the event where gene or cDNA encoding polypeptides of the present invention, would not have their own initiation codon and adjacent sequences, additional translational control signals may be needed. For example, exogenous translational control signals, including, perhaps, the ATG initiation codon, may be needed. It is known in the art that the initiation codon must be in phase with the reading frame of the polypeptide sequence to ensure proper translation of the desired polypeptide. Exogenous translational control signals and initiation codons may be of a variety of origins, including both natural and synthetic.
  • transcription, translation signals may be specifically engineered to provide a desired expression pattern and level (e.g., signals that may require a specific inducer, signals that will allow expression in a defined cell type or in a specific time frame). However, these signals may be provided by the expression vector, which often contains a promoter enabling the expression of the polypeptide in a desired host cell
  • Polypeptides of the present invention comprises for example, those containing amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are known in the art Modifications may occur anywhere in a polypeptide including the polypeptide backbone, the amino acid side-chains and the amino or carboxy-termini It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide Also, a given polypeptide may contain many types of modifications Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching Cyclic, branched and branched cyclic polypeptides may result from posttranslational natural processes or may be made by synthetic methods MDdifications comprise for example, without limitation, acetylation, acy
  • polypeptide modification may comprises for example, amino acid insertion ( ⁇ e , addition), deletion and substitution ( ⁇ e , replacement), either conservative or non-conservative (e g , D-amino acids, desamino acids) in the polypeptide sequence where such changes do not substantially alter the overall biological activity of the polypeptide
  • Polypeptides of the present invention comprise fcr example, biologically active mutants, variants, fragments, chimeras, and analogs, fragments encompass amino acid sequences having truncations of one or more amino acids, wherein the truncation may originate from the amino terminus (N-terminus), carboxy terminus (C-terminus), or from the interior of the protein.
  • Polypeptide analogs of the invention involve an insertion or a substitution of one or more amino acids.
  • Variants, mutants, fragments, chimeras and analogs may have the biological property oi polypeptides of the present invention.
  • polypeptides are made synthetically, substitutions by amino acids, which are not naturally encoded by DNA may also be made.
  • alternative residues include the omega amino acids of the formula NH2(CH2)nCOOH wherein n is 2-6. These are neutral nonpolar amino acids, as are sarcosine, t-butyl alanine, t-butyl glycine, N-methyl isoleucine, and norleucine.
  • Phenylglycine may substitute for Trp, Tyr or Phe; citrulline and methionine sulfoxide are neutral nonpolar, cysteic acid is acidic, and ornithine is basic.
  • Proline may be substituted with hydroxyproline and retain the conformation conferring properties.
  • mutants or variants may be generated by substitutional mutagenesis and retain the biological activity of the polypeptides of the present invention. These variants have at least one amino acid residue in the protein molecule removed and a different residue inserted in its place.
  • one site of interest for substitutional mutagenesis may include but are not restricted to sites identified as the active site(s), or immunological site(s). Other sites of interest may be those, for example, in which particular residues obtained from various species are identical. These positions may be important for biological activity. Examples of substitutions identified as "conservative substitutions" are shown in table 1. If such substitutions result in a change not desired, then other type of substitutions, denominated "exemplary substitutions" in table 1 , or as further described herein in reference to amino acid classes, are introduced and the products screened.
  • Example of substitutions may be those, which are conservative (i.e., wherein a residue is replaced by another of the same general type).
  • naturally-occurring amino acids may be sub-classified as acidic, basic, neutral and polar, or neutral and non-polar.
  • three of the encoded amino acids are aromatic. It may be of use that encoded polypeptides differing from the determined polypeptide of the present invention contain substituted codons for amino acids, which are from the same group as that of the amino acid be replaced.
  • the basic amino acids Lysine (Lys), Arginine (Arg) and Histidine (His) may be interchangeable; the acidic amino acids Aspartic acid (Asp) and Glutamic acid (GIu) may be interchangeable; the neutral polar amino acids Serine (Ser), Threonine (Thr), Cysteine (Cys), Glutamine (GIn), and Asparagine (Asn) may be interchangeable; the non-polar aliphatic amino acids Glycine (GIy), Alanine (Ala), Valine (VaI), lsoleucine (lie), and Leucine (Leu) are interchangeable but because of size GIy and Ala are more closely related and VaI, lie and Leu are more closely related to each other, and the aromatic amino acids Phenylalanine (Phe), Tryptophan (Trp) and Tyrosine (Tyr) may be interchangeable.
  • Table 1 Exemplary amino acid substitution
  • modification of a polypeptide may result in an increase in the polypeptide's biological activity, may modulate its toxicity, may result in changes in bioavailability or in stability, or may modulate its immunological activity or immunological identity.
  • Substantial modifications in function or immunological identity are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
  • Naturally occurring residues are divided into groups based on common side chain properties:
  • Trp Tryptophan
  • Tyrosine Tyrosine
  • Phe Phenylalanine
  • Non-conservative substitutions will entail exchanging a member of one of these classes for another.
  • Mutant polypeptides will possess one or more mutations, which are deletions (e.g., truncations), insertions (e.g., additions), or substitutions of amino acid residues.
  • Mutants can be either naturally occurring (that is to say, purified or isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis on the encoding DNA or made by other synthetic methods such as chemical synthesis). It is thus apparent that the polypeptides of the invention can be either naturally occurring or recombinant (that is to say prepared from the recombinant DNA techniques).
  • a protein at least 50% identical to those polypeptides of the present invention is included in the invention, as are proteins at least 70% or 80% and more preferably at least 90% identical to the protein of the present invention. This will generally be over a region of at least 5, preferably at least 20, contiguous amino acids.
  • Amino acid sequence variants may be prepared by introducing appropriate nucleotide changes into DNA, or by in vitro synthesis of the desired polypeptide. Such variant include, for example, deletions, insertions, or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the desired characteristics.
  • the amino acid changes also may alter posttranslational processes such as changing the number or position of the glycosylation sites, altering the membrane anchoring characteristics, altering the intra-cellular location by inserting, deleting or otherwise affecting the transmembrane sequence of the native protein, or modifying its susceptibility to proteolytic cleavage.
  • Protein purification Some aspects of the present invention concern the purification, and in particular embodiments, the substantial purification, of a polypeptide.
  • the term "purified polypeptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the polypeptide is purified to any degree relative to its naturally- obtainable state, (i.e., in this case, relative to its purity within a prostate, cell extract).
  • a purified polypeptide therefore also refers to a polypeptide, free from the environment in w-iich it may naturally occur.
  • purified will refer to a polypeptide composition, which has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity. Where the term “substantially purified” is used, this will refer to a composition in which the polypeptide forms the major component or portion of the composition, such as constituting about 50% or more of the polypeptides in the composition.
  • Size exclusion chromatography or gel filtration separates molecules based on their size.
  • the gel (i.e., matrix, resin) media may consist of beads containing pores of a specific distribution. Separation may occur when molecules of different size are included or excluded from the pores within the matrix. Small molecules may diffuse into the pores and their flow through the column is retarded, while large molecules do not enter the pores and are eluted in the column's void volume. Consequently, rrolecules separate based on their size as they pass through the column and are eluted in order of decreasing molecular weight.
  • Proteins can be separated on the basis of their net charge by ion-exchange chromatography. For example, if a protein has a net positive charge at pH 7, it will usually bind (adsorb) to beads (i.e., matrix) containing a negatively charged group. For example, a positively charged protein can be separated on a negatively charged carboxymethyl-cellulose or carboxymethyl-agarose matrix. Following elution, proteins that have a low density of net positive charge will tend to emerge first from the column followed by those having a higher charge density. Negatively charged proteins can be separated by chromatography on positively charged diethylaminoethyl-cellulose (DEAE-cellulose) or DEAE-agarose matrix. A charged protein bound to an ion- exchange matrix may be eluted (released, detached) by increasing the concentration of sodium chloride or another salt solution as an eluting buffer. Ions will compete with the charged groups on the protein for binding to the matrix.
  • a positively charged protein can be separated on a negatively charged carboxymethyl
  • Salt solutions may be added to the matrix in a sequential manner (i.e., by adding a solution of a specific molarity (e.g., 100 mM sodium chloride) followed by the addition of one or more solutions of different molarity (e.g., 200 mM, followed by a solution of 300 mM, followed by a solution of 400 mM, followed by a solution of 500 mM, followed by a solution of 1000 mM)) until the specific polypeptide of the invention (i.e., PSP94- binding protein (SEQ ID NO.:2, SEQ ID NO.:3, SEQ ID NO.:7, SEQ ID NO.:8, SEQ ID NO.:9) is eluted.
  • a specific molarity e.g., 100 mM sodium chloride
  • solutions of different molarity e.g. 200 mM, followed by a solution of 300 mM, followed by a solution of 400 mM, followed by a solution of 500 mM
  • salts solution may be added as a continuous gradient.
  • a salt solution of high molarity e.g., 1000 mM
  • a second solution of lower molarity e.g., 100 mM
  • the salt solution entering the column will have a molarity slowly increasing from 100 mM to up to 1000 mM.
  • Affinity chromatography may be used when the specificity (affinity) of a polypeptide for a compound is known or suspected.
  • a polypeptide for a compound is known or suspected.
  • a column e.g., a cyanogen bromide activated sepharose matrix
  • a mixture solution
  • a desired polypeptide e.g., a PSP94-binding protein
  • the desired polypeptide may be eluted from the matrix by adding a high concentration of the compound (e.g., PSP94) in a soluble form.
  • Antibodies are an example of a compound, which is often used to purify proteins to which it binds.
  • chromatography matrix i.e., resin
  • ion-exchange matrix e.g., ion-exchange matrix, size-exclusion matrix, affinity matrix
  • affinity matrix e.g., ion-exchange matrix, size-exclusion matrix, affinity matrix
  • a polyclonal antibody preparation may be obtained by immunizing an animal with an immunogenic (immunizing) composition and collecting antisera from that immunized animal.
  • an immunogenic (immunizing) composition may be used for the production of antisera.
  • animal used for production of anti-antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat.
  • an immunogen to a carrier (e.g., keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA)) or by incorporating an adjuvant to the immunizing composition, as described herein.
  • a carrier e.g., keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA)
  • BSA bovine serum albumin
  • the production of antibodies may be monitored by sampling blood of the immunized animal at various time points following immunization. Sometimes, additional boosts may be required to provide a sufficient titer of the antibody(ies).
  • the desired antibody may be purified by known methods, such as affinity chromatography using, for example, another antibody or a peptide bound to a solid matrix.
  • Monoclonal antibodies may be readily prepared through use of known techniques, such as those exemplified in U.S. Pat. No. 4,196,265, the entire content of which is incorporated herein by reference.
  • Mice e.g., BALB/c mouse
  • rats are the animals that are usually used for the immunization.
  • B lymphocytes B cells
  • a panel of animals will have to be immunized and the animal having the highest antibody titer will be chosen.
  • the antibody-producing B lymphocytes from the immunized animal are then fused (e.g., using polyethylene glycol) with cells of an immortal myeloma cell.
  • any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984).
  • the immunized animal is a mouse
  • rats one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in connection with human cell fusions.
  • Fused hybrids are grown in a selective medium that enables the differentiation between fused cells and the parental cells (i.e., myeloma and B cells).
  • the selective medium usually contains an agent (e.g., aminopterin, methotrexate, azasehne) that blocks the de novo synthesis of nucleotides.
  • an agent e.g., aminopterin, methotrexate, azasehne
  • HAT medium hypoxanthine and thymidine as a source of nucleotides
  • azaserine the media is supplemented with hypoxanthine. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium.
  • the myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphohbosyl transferase (HPRT), and they cannot survive.
  • the B cells may operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells.
  • Selection of hybridomas is performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants for the desired reactivity. The selected hybridomas may then be serially diluted and cloned into individual antibody-producing cell lines, which clones may then be propagated indefinitely to provide mAbs.
  • Fragments of monoclonal antibody(ies) are encompassed by the present invention. These may be obtained by methods, which include digestion with enzymes such as pepsin or papain and/or cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present invention may be synthesized using an automated peptide synthesizer or may be produced from cloned gene segments engineered to produce such fragment (e.g., single-chain antibody) in a suitable cell (cell line).
  • Antibody conjugates are also encompassed by the present invention. These may be generated by coupling the antibody with a erporter molecule, a fluorophore, a chromophore or dye (e.g., rhodamine, fluoroscein, and green fluorescent protein) or any other agent or label that gives rise to a detectable signal, either by acting alone or following a biochemical reaction (e.g., enzymes such as horseradish peroxidase, alkaline phosphatase and beta-galactosidase).
  • a molecule such as diethylenethaminepentaacetic acid (DTPA) may also be linked to the antibody.
  • DTPA diethylenethaminepentaacetic acid
  • DTPA rray act as a chelating agent that is able to bind to heavy metal ions including radioisotopes (e.g. Isotope 111 of Indium ( 111 In)).
  • radioisotopes e.g. Isotope 111 of Indium ( 111 In)
  • conjugates may be used as detection tools in immunoassays or in imaging.
  • conjugates having a therapeutic agent such as a toxin may be prepared from the monoclonal antibodies of the present invention, these may be used to target cancer cells and to promote their destruction.
  • monoclonal or polyclonal antibodies specific for proteins that are linked to prostate cancer will have utilities in several types of applications. These may include the production of diagnostic kits for use in detecting, diagnosing or evaluating the prognosis of individual with prostate cancer.
  • the biological sample analyzed may be any sample that is suspected of containing an antigen of interest, either a tissue, cell lysate, urine, blood, serum, plasma, etc.
  • the antigen detection (detecting) reagent protein, peptide or antibody
  • the composition is generally a matter of simply adding the composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with the antigen. Washing of the sample (i.e., tissue section, ELISA plate, dot blot or Western blot) is generally required to remove any non-specifically bound antibody species.
  • the antigen-antibody complex is then detected using specific reagents.
  • the antigen detecting reagent is an antibody (a specific antibody)
  • this antibody may be (directly) labeled with a marker (fluorophore, chromophore, dye, enzyme, radioisotope, etc.) for enabling the detection of the complex.
  • a marker fluorophore, chromophore, dye, enzyme, radioisotope, etc.
  • a secondary binding ligand such as a secondary antibody or a biotin/avidin (streptavidin) (binding/ligand complex) arrangement, as is known in the art.
  • secondary antibodies may be labeled with a marker as described above or with an arrangement of biotin/avidin (i.e. avidin peroxidase) or biotin/streptavidin (i.e.
  • the secondary antibody will be an antibody directed to the specific antibody (primary antibody) of a defined isotype and species such as, for example, an anti-mouse IgG.
  • the antigen detecting reagent may also be a polypeptide having affinity for an antibody or another polypeptide, which forms a complex (i.e., polypeptide-polypeptide complex or antibody-polypeptide complex).
  • the polypeptide itself may be labeled using the markers described above, allowing direct detection.
  • the complex may be detected indirectly by adding a secondary (labeled) antibody or polypeptide.
  • Immunodetection methods such as enzyme-linked immunosorbent assays (ELISA), Western blots, etc. have utility in the diagnosis of conditions such as prostate cancer.
  • ELISA enzyme-linked immunosorbent assays
  • Western blots etc. have utility in the diagnosis of conditions such as prostate cancer.
  • the methods, assays, kits, antibodies and reagent described herein may find utility for eomple, in the diagnosis/prognosis of prostate cancer
  • Immunoassays that may be performed using reagents of the present invention includes, for example, enzyme linked immunosorbent assays (ELISAs) and rad ⁇ o ⁇ mmunoassays(RIA), which are known in the art lmmunohistochemical detection using tissue sections is also particularly useful
  • ELISAs enzyme linked immunosorbent assays
  • RIA rad ⁇ o ⁇ mmunoassays
  • detection is not limited to such techniques, and Western blotting, dot blotting, F ⁇ S analyses, and the like also may be used
  • ELISA assays include the following, antibodies binding to a polypeptide (e g , antibodies to PSP94) are immobilized onto a selected surface ( ⁇ e , suitable substrate) exhibiting protein affinity, such as a well in a polystyrene microtiter plate (E.LISA plate) Then, a sample suspected of containing the polypeptide is added to the wells of the plate After binding and washing to remove non-specifically bound immunocomplexes, the bound antigen may be detected Detection may be achieved by the addition of a second antibody specific for the target polypeptide, which is linked to a detectable label This type of ELISA is a simple "sandwich ELISA " Detection also may be achieved by the addition of a second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label (marker)
  • a polypeptide e g , antibodies to PSP94
  • ⁇ e suitable substrate
  • ELISA assay Another example of ELISA assay is the following, the samples suspected of containing the polypeptide of interest are immobilized onto the surface of a suitable substrate and then contacted with the antibodies of the invention After binding and washing to remove non-specifically bound immunocomplexes, the bound antigen is detected
  • the immunocomplexes may be detected directly or indirectly as described herein
  • an ELISA assay is the following, again, polypeptides are immobilized to a substrate, however, in that case the assay involves a competition step
  • a known amount of the polypeptide of interest is adsorbed to the plate
  • the amount of polypeptide in an unknown sample is then determined by mixing the sample with a specific antibody before or during incubation with wells containing the immobilized polypeptide
  • a detection reagent is added (e g , antibody) to quantify the antibody that is able to bind to the immobilized polypeptide.
  • the presence of the polypeptide in the sample acts to reduce the amount of antibody available for binding to the polypeptide contained in the well (immobilized polypeptide) and thus reduces the signal.
  • a control sample may be included during the assay.
  • known (predetermined) quantities of a polypeptide usually in a substantially pure form
  • the signal obtained for the unknown sample is then compared with the signal obtained for the control.
  • the intensity (level) of the signal is usually proportional to the amount of polypeptide (antibody bound to the polypeptide) in a sample.
  • the amount of control polypeptide and antibodies required to generate a quantitative assay needs to be evaluated first.
  • Ir coating a plate with either an antigen (polypeptide) or antibody one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed tc remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein and solutions of milk powder.
  • BSA bovine serum albumin
  • the coating allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface.
  • Conditions that may allow immunocomplex (antigen/antibody) formation include diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background.
  • BSA bovine gamma globulin
  • PBS phosphate buffered saline
  • Suitable conditions involves that the incubation is at a temperature and for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 h, at temperatures preferably on the order of 20 0 C to 27°C, or may be overnight at about 4°C or so.
  • the detection of the immunocomplex is performed with a reagent that is linked to an enzyme. Detection usually requires the addition of the enzyme's substrate. Enzymes such as, for example, a phosphatase (e.g., alkaline phosphatase), a peroxidase, etc. when given an appropriate substrate will generate a reaction that may be quantified by measuring the intensity (degree) of color (radioactivity, fluorescence, etc.) produced. The reaction is usually linear over a wide range of concentrations and may be quantified using a visible spectra spectrophotometer.
  • a phosphatase e.g., alkaline phosphatase
  • peroxidase e.g., etc.
  • the reaction is usually linear over a wide range of concentrations and may be quantified using a visible spectra spectrophotometer.
  • Kits The present invention also relates to immunodetection kits and reagents for use with the immunodetection methods described above.
  • the polypeptide of the present invention may be employed to detect antibodies and the corresponding antibodies may be employed to detect the polypeptide, either or both of such components may be provided in the kit.
  • the immunodetection kits may thus comprise, in suitable container means, a polypeptide (PSP94, or PSP94-binding protein), or a first antibody that binds to a polypeptide and/or an immunodetection reagent.
  • the kit may comprise also a suitable matrix to which the antibody or polypeptide of choice may already be bound. Suitable matrix include an ELISA plate.
  • kits may already be coated with the antibody or polypeptide of choice.
  • the coated ELISA plate may also have been blocked using reagents described herein to prevent unspecific binding.
  • Detection reagents may also be provided and may include, for example, a secondary antibody or a ligand, which may carry the label or marker and/or an enzyme substrate.
  • Kits may further comprise an antibody or polypeptide (usually of known titer or ccncentration) that may be used for control.
  • Reagents may be provided, for example, lyophilized or in liquid form (of a defined concentration) and are provided in suitable containers (ensuring stability of reagents, safety etc.).
  • any specified range or group is to be understood as a shorthand way of referring to each and every member of a range or group individually as well as each and every possible sub-ranges or sub-groups encompassed therein; and similarly with respect to any sub- ranges or sub-groups therein.
  • any specified range or group is to be understood as a shorthand way of referring to each and every member of a range or group individually as well as each and every possible sub-ranges or sub-groups encompassed therein; and similarly with respect to any sub- ranges or sub-groups therein.
  • a time of 1 minute or more is to be understood as specifically incorporating herein each and every individual time, as well as sub-range, above 1 minute, such as for example 1 minute, 3 to 15 minutes, 1 minute to 20 hours, 1 to 3 hours, 16 hours, 3 hours to 20 hours etc.;
  • non-PSP94-binding protein or DNA encoding such polypeptide are excluded of the polypeptide or polynucleotide of the present invention.
  • Figure 1 is a graph showing size exclusion chromatography results of proteins from hLman male serum bound to PSP94 radiolabeled with isotope 125 of iodine ( 125 I) (specific binding). Binding of 125 I-PSP94 to human male serum protein is determined by the radioactivity, expressed in counts per minute (cpm), in each fraction. Nonspecific binding was determined by including free PSP94 in the incubation mixture together with human male serum and 125 I-PSP94. The location of fractions containing free- and complexed-PSP94 (PSP94 associated with a carrier) are indicated in the graph;
  • Figure 2 is a graph depicting results of 125 I-PSP94 binding in fractions of proteins, from human male serum, partially purified by ammonium sulfate precipitation.
  • Whole human male serum was precipitated with various concentrations of ammonium sulfate (0 to 32%, 32 to 47%, 47 to 62% and 62 to 77% of ammonium sulfate (% are calculated in w/v)), and the presence of PSP94-binding activity within the fractions was assessed by measuring the ability of radiolabeled PSP94 to associate with proteins contain in each fraction (high molecular weight components) of serum.
  • Results are expressed as the amount of radioactivity bound to human male serum proteins in each fraction relative to the total amount of radioactivity used in the binding assay (in terms of percentage);
  • Figure 3 is a graph showing anion-exchange chromatography results using a MacroPrep High Q anion exchange column, loaded with proteins purified by ammonium sulfate. Proteins are eluted with sodium chloride. The peak located between point A and B represents the protein fraction containing PSP94-binding protein. Proteins are detected and quantified by the absorbance measured at 280 nm;
  • Figure 4 is a picture of a reducing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel loaded with samples obtained following PSP94- affinity chromatography. The gel was run in an electric field and stained with Gelcode®
  • Lane 1 represents the molecular weight marker.
  • Lane 2 represents proteins bound to the PSP94-conjugated affinity matrix.
  • Lane 3 represents proteins that bound to the PSP94-conjugated affinity matrix when excess free PSP94 was included within the incubation mixture;
  • Figure 5 is a picture of a non-reducing SDS-PAGE gel loaded with samples obtained following the elution of the PSP94-binding protein from the PSP94-conjugated affinity matrix using different eluting (dissociation) conditions. After incubation, in the different eluting buffers, the affinity matrix was removed from the eluting buffer by centrifugation. The matrix was washed in PBS, and boiled in non-reducing SDS-PAGE sample buffer. The SDS-PAGE was run in an electric field and was stained with Gelcode® Blue Code Reagent (Pierce). Arrows represent the position of the high molecular weight binding protein (HMW) and the low molecular weight binding protein (LMW). Lane A represents the molecular weight marker.
  • HMW high molecular weight binding protein
  • LMW low molecular weight binding protein
  • Lane B represents untreated sample.
  • Lane C represents sample incubated for 1 hour in PBS at 34 0 C.
  • Lane D represents sample incubated for 1 hour in water at 34 0 C.
  • Lane E represents sample incubated with 300 ⁇ g of PSP94 in 1 ml of PBS at 34 0 C.
  • Lane F represents the competition control.
  • Lane G represents sample incubated in 2 M urea.
  • Lane H represents sample incubated in 8 M urea.
  • Lane I represents sample incubated in 100 mM sodium acetate at pH 2.7.
  • Lane J represents sample incubated in 100 mM 3-(Cyclohexylamino)-1- prDpanesulfonic acid (CAPS) at pH 11.0;
  • Figure 6 is a graph showing affinity chromatography (using PSP94-conjugated affinity matrix) results of samples purified by ammonium sulfate precipitation followed by anion-exchange chromatography.
  • PSP94-binding protein was eluted from the column by adding excess PSP94.
  • the peak located between point A and B represents the PSP94-binding protein fraction. Proteins are detected and quantified by the absorbance at 280 nm;
  • Figure 7 is a picture of a SDS-PAGE performed in non-reducing conditions.
  • Lane A is the molecular weight marker.
  • Lane B represents the PSP94-affinity matrix after incubation with PSP94-binding protein purified by ammonium sulfate precipitation and anion-exchange chromatography, and prior to elution with competing PSP94.
  • Lane C represents the competition control.
  • Lane D represents the affinity matrix after elution with excess PSP94.
  • Lane E represents the final eluted and concentrated (substantially) pure PSP94-binding protein;
  • Figure 8 is a schematic of a proposed purification process for the PSP94-binding protein
  • Figure 9a is a picture of a Northern blot performed on samples of human tissue poly-A RNA.
  • Lane 1 represents brain RNA
  • lane 2 represents heart RNA
  • lane 3 represents skeletal muscle RNA
  • lane 4 represents colon RNA
  • lane 5 represents thymus RNA
  • lane 6 represents spleen RNA
  • lane 7 represents kidney RNA
  • lane 8 represents liver RNA
  • lane 9 represents small intestine RNA
  • lane 10 represents placenta RNA
  • lane 11 represents lung RNA
  • lane 12 represents peripheral blood lymphocytes (PBL) RNA;
  • PBL peripheral blood lymphocytes
  • Figure 9b is a picture of a Northern blot performed on samples of human tissue poly-A RMA.
  • Lane 1 represents spleen RNA
  • lane 2 represents thymus RNA
  • lane 3 represents prostate RNA
  • lane 4 represents testis RNA
  • lane 5 represents ovary RNA
  • lane 6 represents small intestine RNA
  • lane 7 represents colon RNA
  • lane 8 represents peripheral Blood Lymphocytes (PBL) RNA;
  • Figure 10 is a picture of a Western blot showing recognition (binding) of PSP94-binding protein with a specific monoclonal antibody (1 B11) .
  • Lane 1 is molecular weight markers (from top to bottom, 212, 132, 86, 44 kDa).
  • Lane 2 is 0.2 ⁇ g of (substantially) purified PSP94-binding protein and lane 3 is 25 ⁇ l of partially pure PSP94-binding protein;
  • Figure 11 is a picture of an ELISA plate where the specificity of monoclonal antibodies for bound and free forms of PSP94 is evaluated. Colored wells represent a positive result;
  • Figure 12A is a schematic of a method used to measure the amount of free PSP94
  • Figure 12B is a result of an ELISA assay using the method illustrated in figure 12a;
  • Figure 12C is a schematic of a sandwich ELISA assay used to measure the amount of free PSP94;
  • F gure 12D is a graph illustrating the results of a sandwich ELISA assay for measuring free PSP94;
  • Figure 13 is a schematic of a proposed method used to measure the amount (PSP94 sandwich ELISA) of total PSP94 in a sample;
  • Figure 14a is a schematic of a method used to measure the amount of total PSP94- binding protein (using a PSP94-binding protein sandwich ELISA) in a sample.
  • Figure 14a is a schematic of a method used to measure the amount of total PSP94- binding protein (using a PSP94-binding protein sandwich ELISA) in a sample.
  • 14b is a result of an ELISA assay used to measure the PSP94-binding protein in a sample using the method illustrated in figure 14a;
  • Figure 15A represents concentration of total PSP94 levels from serum of individuals in low ( ⁇ 4ng/ml) and high (> 4ng/ml) PSA categories;
  • Figure 15B represents concentration of free PSP94 levels from serum of individuals in low ( ⁇ 4ng/ml) and high (> 4ng/ml) PSA categories;
  • Figure 15C represents concentration of total PSP94 Binding protein levels from serum of individuals in low ( ⁇ 4ng/ml) and high (> 4ng/ml) PSA categories;
  • Figure 15D represents concentration of corrected free PSP94 levels from serum of individuals in low ( ⁇ 4ng/ml) and high (> 4ng/ml) PSA categories. Free PSP94 values were corrected since 1-5% of PSP94 binding protein (and complexed PSP94) remained after absorption protocol. The correction subtracts the bound PSP94 x proportion of PSP94 binding protein not absorbed from the uncorrected free PSP94 value and;
  • Figure 16 represents total PSP94 binding protein concentration compared to total PSP94.
  • PSP94 was used as bait in the isolation, identification and purification of a PSP94- binding protein.
  • labeled-PSP94 was used to detect the presence of the PSP94-binding protein(s) in serum fractions that were submitted to various purification steps.
  • PSP94 was used for affinity chromatography purification of the PSP94-binding protein. Examples described below illustrate the purification, identification and utility of the PSP94-binding protein.
  • PSP94 was also used for producing antibodies and for isolating, identifying and purifying anti-PSP94 antibodies.
  • PSP94 was either prepared as described in Baijal Gupta et al. (Prot. Exp. and Purification 8:483-488, 1996) or alternatively, PSP94 was isolated and (substantially) purified as follow.
  • the mixture was reconstituted by adding 1 volume of endotoxin-free water (with reference to the original volume of seminal plasma) and 2 volumes of ice cold Buffer A (5OmM PBS pH 7.5, 2.5mM EDTA pH 8.0, 1.5m M PMSF), to which PMSF was freshly added, and was mixed to homogenise.
  • ice cold Buffer A 5OmM PBS pH 7.5, 2.5mM EDTA pH 8.0, 1.5m M PMSF
  • the pH of the reconstituted seminal plasma was adjusted to 6.0 using 0.1 M acetic acid and the volume of the resulting solution (pH 6.0) was measured.
  • Solid ammonium sulfate was added to from concentration of 0-30% (176g/L) by slowly and constant stirring. The solution was stirred in cold for 1.5 hour.
  • the equilibration of cation exchange column was started with 1 OmM sodium phosphate Buffer pH 6.3 according to the manufacturer's instructions for use the next day.
  • the solution was transferred into appropriate centrifuge tubes and was centrifuged 60 min at 12,000 x g in a refrigerated centrifuge.
  • the supernatant was saved and transfered into a fresh cold container. A sample was kept for SDS-Page analysis. The pellet was kept for record.
  • the supernatant volume was measured with a graduated cylinder. Ammonium sulfate was slowly added to the supernatant to obtain a final concentration of 30-70% (273 g/L). The mixture was stirred for 1.5 hour.
  • the solution was transferred into centrifuge tubes and was centrifuged 60 min at 12 ,000 x g in a refrigerated centrifuge.
  • the pellet was saved and the supernatant was set aside.
  • the pellets were scooped from each tube into a cold glass Dounce Tissue grinder.
  • the pellet was dissolved in as small a volume of Buffer B (2.5mM EDTA pH 8.0, 1OmM sodium phosphate pH 6.3) as possible (around 1 ml/2ml of starting material).
  • a 1 ,000 MWCO dialysis tubing (Biolynk (Spectrum): 132103) for dialysis was prepared and the resuspended pellet was added to the tubing which was then sealed with clips. One volume of empty space was left to allow volume increase during dialysis. Dialysis was carried out against Buffer B overnight, using a container of around 15 liters of buffer. The next day, pH was verified to be similar or the same as buffer B.
  • the 20OmIs Macro-prep High S Support column (BioRad: 156-0030, BioRad column: 737-5031 ) was used for a subsequent purification step.
  • This column has a capacity of approximately 1600mg of proteins. So, if needed, the sample may be divided for multiple runs making sure not to go over the capacity of the column.
  • the dialysed, ammonium sulfate precipitated sample was loaded on the column. 10- 13mls fractions were collected and placed at 4°C.
  • a sample of the pooled fractions was kept for SDS-Page analysis.
  • the samples may be frozen or may be further purified by anion exchange. Equilibration of the anion exchange column with 3OmM of Tris-HCI pH 8.8 was started according to the manufacturer's instructions.
  • the material collected from the cation column was pooled and brought to pH 8.8 using 2 M Tris-HCI, pH 8.8.
  • the final Tris concentration was below 5OmM.
  • the protein concentration was kept at or higher than 0.8mg/ml.
  • the column was equilibrated with 3OmM Tris-HCI Buffer pH 8.8 (according to the manufacturer's instructions).
  • the sample was loaded on the column and 10-13mls fractions were collected and placed at 4°C.
  • the optical density was measured and protein concentration was calculated as irdicated above.
  • PSP94 protein
  • concentration was more than 1 mg/ml, there was no need to concentrate the material.
  • 1 ,000MWCO centrifuge concentrators were used to bring it to at least 1mg/ml and the filter was rinsed with cell culture grade PBS to remove PSP (PSP94) completely.
  • the material was sterilized by filtration using a 0.22um syringe filter (ex. Millex: SLGP033RS). Aliquots were made in cryogenic tubes provided with a rubber sealing to prevent evaporation and were frozen at -80 0 C. Some aliquots were kept for characterization.
  • lodination of PSP94 was performed as followed. Twenty micrograms of native human PSP94 prepared as described in Baijal Gupta et al. (Prot. Exp. and Purification 8:483- 488, 1996) in 15 microliters of 100 mM sodium bicarbonate (pH 8.0) was labeled using one millicuhe of mono-iodinated Bolton-Hunter reagent at 0 0 C following the manufacturer's instructions (NEN Radiochemicals). The reaction was terminated after 2 hours by the addition of 100 microliters of 100 mM glycine.
  • the free iodine was separated from the iodine incorporated into the PSP94 by a PD10 disposable gel filtration column according to manufacturer's instructions (BIORAD). Typically, the proportion of iodine that became incorporated into the PSP94 protein was about 60%, giving a specific activity of about 30 microcuries per microgram of PSP94.
  • PSP94-binding serum components i.e., PSP94-binding protein
  • This assay was done in a total volume of 500 microliters.
  • the test samples contained PSP94-binding protein (neat serum, or fractions from purification trials) 50 ng of radiolabeled PSP94, with or without excess free competitor (10 micrograms free PSP94 (unlabeled)) in phosphate buffered saline-gelatin (PBS-gelatin: 10 mM sodium pnosphate, 140 mM NaCI, 0.1 % gelatin (Fisher Scientific, Type A), pH 7.5, including 8 mM sodium azide as an antibacterial agent).
  • PBS-gelatin 10 mM sodium pnosphate
  • 140 mM NaCI 0.1 % gelatin
  • pH 7.5 including 8 mM sodium azide as an antibacterial agent
  • the radioactivity (expressed in counts per minute (cpm)) in the collected fractions was measured using an LKB rack gamma counter, and the total radioactivity in the high molecular weight peak (generally contained within fractions 4-14) and low molecular weight peak (the remainder of the 0.5 ml fractions and the single 30 ml fraction) were calculated.
  • a typical elution profile is illustrated in figure 1.
  • Figure 1 shows size exclusion chromatography results of proteins from human male serum bound to PSP94 radiolabeled with isotope 125 of iodine ( 125 I) (i.e., 125 I-PSP94) (specific biding). Binding of 125 I-PSP94 to human male serum protein is determined by the radioactivity, expressed in counts per minute (cpm), in each fraction. Non-specific binding was determined by including 10 ⁇ g of free PSP94 in the incubation mixture together with 250 ⁇ l of human male serum and 50 ng of 125 I-PSP94. The location of fractions containing free- (i.e., unbound) and complexed (i.e., bound)-PSP94 are indicated in the graph.
  • 125 I iodine
  • a first purification step was performed by ammonium sulfate precipitation.
  • ammonium sulfate precipitation To establish the appropriate concentration of ammonium sulfate necessary to precipitate a PSP94-binding protein, small scale ammonium sulfate precipitation trials were performed. The presence of a PSP94-binding protein in the precipitate was determined after dissolution and dialysis against PSP94 by radioligand binding analysis as discussed in example 1. These trials determined that the 32-47% ammonium sulfate fraction contained the vast majority of a PSP94 binding material as illustrated in figure 2.
  • Ammonium sulfate precipitation was routinely performed on a larger scale. Briefly, 1 liter of male frozen serum (Bioreclamation Inc, New York) was thawed and added to 1 liter of cold 10 mM Sodium Phosphate, 140 mM NaCI, pH 7.5 (phosphate buffered saline; PBS), and to this 370 g of ammonium sulfate (BDH ACS reagent grade) was added slowly under constant stirring to bring the ammonium sulfate concentration up to 32%. After dissolution of the salt, the mixture (i.e., male serum containing ammonium sulfate) was stirred for 20 minutes before centrifugation at 5,000 x g for 15 minutes.
  • PBS phosphate buffered saline
  • the pellet was discarded, and the supernatant fraction of proteins containing a PSP94- binding protein was collected. Further ammonium sulfate (188 g) was added slowly under constant stirring to the supernatant fraction, bringing the total ammonium sulfate concentration to 47%. After 20 minutes, this mixture was also spun at 5,000 x g, the supernatant was discarded, and the pellet was dissolved in a total of 500 ml of 10 mM MES ((2-[N-Morpholino]ethanesulfonic acid) hydrate), 100 mM NaCI, pH 6.5.
  • 10 mM MES ((2-[N-Morpholino]ethanesulfonic acid) hydrate
  • This pellet was dialyzed using 6-8,000 molecular weight cut off dialysis tubing (Spectra/Por, Fisher Scientific Canada) with 16 liters of 10 mM MES, 100 mM NaCI, pH 6.5 for 16 hours at 4 0 C followed by another dialysis step using a further 16 liters of the same buffer for an additional 7 hours.
  • the protein concentration within the product was measured using 280 nm ultraviolet (UV) absorbance and the preparation was stored at -20 0 C in 4 g of protein aliquots (generally about 150 ml).
  • a typical ammonium sulfate precipitation assay is shown in figure 2.
  • Ion exchange chromatography separates molecules based on their net charge. Negatively or positively charged functional groups are covalently bound to a solid support matrix yielding a cation or anion exchanger. When a charged molecule is applied to an exchanger of opposite charge it is adsorbed, while neutral ions or ions of the same charge are eluted in the void volume of the column. The binding of the charged molecules is reversible, and adsorbed molecules are commonly eluted with a salt or pH gradient.
  • the anion-exchange chromatography assays indicated good adsorption of a PSP94- binding protein to the matrix between pH 5.7 and 9.0, consistent with an isoelectric point of 5. It was clear that a preferred purification strategy would have to use the anion-matrix, because good adsorption could be attained at neutral (non-denaturing) pH values. So the anion-exchange matrix, and the 1 OmM MES buffer at pH 6.5 was selected for further work using salt concentration elution rather than pH elution. Optimization of conditions of PSP94-binding protein elution from the anion-exchange matrix was performed using various sodium chloride concentration.
  • a column (1 x 15 cm) containing Macro Prep High Q was equilibrated with buffer containing 10 mM MES, 100 mM NaCI, pH 6.5 and run at 0.5 ml per minute. Seven milliliters of the 32-47% ammonium sulfate cut (i.e., starting material of table 4) equilibrated into the same buffer, was applied to the column, and various buffers were applied to elute a PSP94-binding protein. The eluant was monitored with a UV recorder. The fractions were collected, and buffer was exchanged into PBS using CentriPrep concentrators with a molecular weight cut off of 10 kDa (Amicon).
  • An anion exchange column (5 cm diameter x 12 cm length, Macro-Prep Hi Q, Biorad) was prepared and equilibrated in accordance with the manufacturer's guidelines in 10 rriM MES, 100 mM NaCI, pH 6.5 and run at room temperature with a flow rate of about 3 ml per minute.
  • An aliquot of ammonium sulfate precipitated serum (from example 2; 4 g total protein in about 150 ml of solution) was applied to the column which, was then washed with about 250 ml of 10 mM MES, 100 mM NaCI, pH 6.5 ( Figure 3).
  • FIG. 3 is a graph showing anion-exchange chromatography results using a MacroPrep High Q anion exchange column, loaded with proteins purified by ammonium sulfate (about 4 grams). Proteins are eluted with stepwise increases in sodium chloride concentration. The peak located between point A and B represents the protein fraction containing a PSP94-binding protein. Proteins are detected by the absorbance measured at 280 nm.
  • the column could be regenerated with 10 mM MES, 1 M NaCI, pH 6.5 (300 ml) followed by an equilibration with 500 ml of 10 mM MES, 100 mM NaCI, pH 6.5.
  • Sodium azide was added to this buffer at 0.05% (w/v) for storage of the column for greater than 24 hours.
  • the 300 mM fraction (about 90 ml) was collected (between markers A and B, Figure 3) and this was shown previously to contain the majority of a PSP94-binding activity.
  • This preparation identified "partially pure PSP94-binding protein" (PPBP) was concentrated to about 20 ml in centrifugal concentrators according to the manufacturer's instruction (Centriprep 10, Amicon) diluted with PBS to 60 ml, concentrated to 20 ml, further diluted with PBS to 60 ml, concentrated to 20 ml, and finally diluted with PBS to give a sclution with an A280 of 2.0 (generally a final volume of about 150 ml). This solution was stored at -20 0 C.
  • the conjugation reaction was continued until 70-80% of the PSP94 had bound to the matrix (after about 60 minutes in the preparation illustrated in table 5). At this time, 1 ml of 200 mM glycine was added to block any further reactive groups and the slurry was incubated overnight at 4 0 C with gentle agitation. The matrix was washed according to the manufacturer's recommendations and diluted in PBS to give a slurry w th a concentration with respect to PSP94 of 1 microgram per microliter. Sodium a2:ide (NaN 3 ) was added to 0.05% as an anti-microbial agent.
  • a PSP94 affinity matrix was prepared by conjugating PSP94 to cyanogen bromide activated sepharose.
  • the matrix typically had 4 micrograms of PSP94 per microliter of packed matrix, and a working slurry with 1 microgram of PSP94 per microliter was prepared by dilution with PBS containing 0.05% NaN 3 .
  • the PSP94 affinity matrix (at a concentration of 5 micrograms per milliliter with respect to PSP94) was added to the partially pure PSP94-binding protein.
  • Tween 20 at a concentration of 0.1 % (v/v) and NaN 3 at 0.05% (w/v) were also included in the mixture, which was then incubated at 34 0 C for 18 hours or a rocking table.
  • free- PSP94 was also added at a concentration of 50 micrograms per milliliter. The addition of free PSP94 in this control experiment would compete with the PSP94 conjugated to the matrix for the binding of a PSP94-binding protein. This will reverse the binding of a PSP94-binding protein to the affinity column thus enabling the identification of proteins specifically binding to PSP94.
  • the affinity matrix was separated from the supernatant by rapid filtration, and the matrix was extensively washed in PBS at 4 0 C.
  • the matrix was collected and boiled in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) reducing sample buffer (final concentration in sample: 5mM Tris pH 6.8, 2% (w/v) SDS, 10% glycerol (v/v), 8mM dithiothreitol, 0.001% Bromophenol blue) to dissociate the bound proteins and these were resolved by 7.5% SDS-PAGE. Result of this experiment is il ustrated in figure 4
  • Figure 4 shows results of a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loaded with samples obtained following PSP94-affinity chromatography. The gel was run in an electric field and stained with Coomassie Brilliant Blue. Lane 1 represents the molecular weight marker (Kaleidoscope prestained standards, Bio-Rad). Lane 2 represents proteins bound to the PSP94-conjugated affinity matrix. Lane 3 represents proteins bound to PSP94-conjugated affinity matrix and incubated with excess of PSP94. Note that at least two proteins, A and C, remain present in the two lanes, (lane 2 and 3). Two bands, B and D, are present in the lane 3 but not in the control experiment (lane 2). These bands (B and D) are likely to be specific PSP94- binding proteins.
  • SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
  • the matrices were washed in PBS, and boiled in non-reducing SDS-PAGE sample buffer (final concentration in sample: 5rnM Tris pH 6.8, 2% (w/v) SDS, 10% glycerol (v/v), 0.001% Bromophenol blue) and proteins were resolved on 7.5% SDS-PAGE. If proteins remains associated with the matrix after elution, the conditions are not suitable for an appropriate dissociation. Thus if a PSP94-binding protein is absent from the SDS-PAGE illustrated in figure 5, elution (dissociation) conditions are suitable. Non-reducing conditions were found to provide superior separation conditions, because the major contaminating band was left at the top of the gel, rather than between the two PSP94-binding protein bands. Conditions tested and results of this experiment are illustrated in figure 5 and summarized in table 6.
  • Figure 5 shows a SDS-PAGE loaded with samples obtained following the elution of a PSP94-binding protein from the PSP94-conjugated affinity matrix using different eluting (dissociation) conditions. After incubation, in the different eluting buffers, the affinity matrix was removed from the eluting buffer by centrifugation. The matrix was washed in PBS, and boiled in non-reducing SDS-PAGE sample buffer. The SDS-PAGE was run in an electric field and was stained with Gelcode® Blue Code Reagent (Pierce). Arrows represent the position of the high molecular weight binding protein (HMW) and the low molecular weight binding protein (LMW).
  • HMW high molecular weight binding protein
  • LMW low molecular weight binding protein
  • Lane A represents the molecular weight marker (Kaleidoscope prestained standards, Bio-Rad).
  • Lane B represents untreated sample.
  • Lane C represents sample incubated for 1 hour in PBS at 34 0 C.
  • Lane D represents sample incubated for 1 hour in water at 34 0 C.
  • Lane E represents sample incubated with 300 ⁇ g of PSP94 in 1 ml of PBS at 34 0 C.
  • Lane F represents the competition control, where the matrix was incubated with the PPBP in the same way as the sample from lane B, but included in this incubation was a saturating excess of free PSP94.
  • Lane G represents sample incubated in 2 M urea.
  • Lane H represents sample incubated in 8 M urea.
  • Lane I represents sample incubated in 100 mM sodium acetate at pH 2.7.
  • Lane J represents sample incubated in 100 mM 3-(Cyclohexylamino)-1- propanesulfonic acid (CAPS
  • the matrix was resuspended in 1 milliliter of 10 mM sodium phosphate, 500 mM NaCI pH 7.5 containing 2 mg of free PSP94 and incubated with gentle agitation for 5 hours at 34 0 C.
  • the matrix was then separated from the solution by centrifugation (1000 x g for 30 seconds) and the supernatant (containing the eluted PSP94-binding protein and free PSP94) was resolved by molecular sieve chromatography at room temperature using a 1 x 20 cm sephadex G 100 column equilibrated with 10 mM sodium phosphate, 500 mM NaCI, pH 7.5 and run at a flow rate of approximately 0.7 ml per minute.
  • FIG. 6 shows affinity chromatography (using PSP94-conjugated affinity matrix (Sephadex G-100)) results of samples purified by ammonium sulfate precipitation and anion-exchange chromatography.
  • Figure 7 is a picture of a SDS-PAGE (7.5%) performed in non-reducing conditions.
  • Lane A is the molecular weight marker (Kaleidoscope prestained standards, Bio-Rad).
  • Lane B represents a PSP94-affinity matrix after incubation with a PSP94-binding protein purified by ammonium sulfate precipitation and anion-exchange chromatography, and prior to elution with competing (i.e., excess) PSP94 (i.e., free- PSP94).
  • Lane C represents the competition control.
  • Lane D represents the affinity matrix after elution with excess PSP94.
  • Lane E represents the final eluted and concentrated (substantially) pure PSP94-binding protein. Results obtained indicate that affinity chromatography increase the purity of a PSP94-binding protein(s) in a significant manner.
  • a SDS-PAGE gel was prepared as described in example 5. However the proteins were transferred to sequencing grade PVDF membranes (ProBlott membranes, Applied Biosystem) using a Mini Trans-Blot transfer cell (Bio-Rad) according to the manufacturer's recommendations for sequencing preparation. This membrane was stained with Coomassie Brilliant blue, and analyzed by amino-terminal (i.e., N-terminal) amino acid sequencing. The amino-terminal amino acid sequencing was carried out for bands B, C and D illustrated in figure 4.
  • Tie cDNA was subsequently amplified by polymerase chain reaction (PCR) using Platinum Taq DNA Polymerase High Fidelity (Life Technologies) using a 5'-primer (5'- ATGCACGGCTCCTGCAGTTTCCTGATGCTT-3') and a 3'-primer (5'- GCCCACGCGTCGACTAGTAC(T) 17 -3')(Life Technologies 3'Race adapter primer, Life Technologies).
  • the 5'-primer DNA sequence was based on PSP94-binding protein amino acid sequence and partial cDNA sequence published in Gene Bank database (National Institute of Health, U.S.A.) G. B. Accession No.
  • AA311654 (EST182514 Jurkat T-cells Vl Homo sapiens cDNA 5' mRNA sequence).
  • Amplified DNA was resolved by agarose gel electrophoresis, excised from the gel and concentrated using Qiagen Il DNA extraction kit (Qiagen, Mississauga, ON, Canada). Purified DNA was ligated into pCR2.1 plasmid (Invitrogen, Carlsbad, CA) and used to transform E.coli, strain TOP10 (Invitrogen). Ampicillin-resistant colonies were screened for cDNA- positive inserts by restriction enzyme analysis and DNA sequence analysis.
  • a PSP94-binding protein messenger RNA was isolated and the size and relative expression level in human tissues was determined by Northern blot.
  • Commercial Northern blots containing 1 or 2 micrograms of human tissue poly-A RNA per lane (Multiple Tissue Northern (MTNTM) Blot, Clontech, Palo Alto, CA) were hybridized as per the manufacture's recommendations with a [ 32 P]-labeled PSP94- binding Protein cDNA probe which spanned PSP94-binding Protein cDNA sequences 346 to 745.
  • the intensity of the band was quantified with an alpha imager 2000, model 22595.
  • the relative intensity of the band was determined and given an arbitrary score ranging from + to +++. This scoring was based on the lowest detectable 2.0 kb signal band seen.
  • RNA from brain, heart, skeletal muscle, colon, thymus, spleen, kidney, liver, small intestine, placenta, lung, prostate, testis, ovary, and peripheral blood lymphocytes (PBL) was analyzed for the expression of a PSP94- binding protein RNA expression.
  • Anti-PSP94 antibodies such as, antibodies which bind to an epitope of PSP94 that is exposed when PSP94 is in a bound form (e.g., bound to a PSP94-binding protein), antibodies which bind to an epitope of PSP94 that is available only when PSP94 is in a free form (free of PSP binding protein) or antibodies which bind both the free and bound forms of PSP94.
  • mice Four Balb/c mice (identified a, b, c and d) were immunized subcutaneously with 15 micrograms each of a (substantially) pure PSP94-binding protein (i.e., this preparation also contains PSP94) preparation in TiterMaxTM adjuvant. Twenty-one days later, all mice were given a second boost and after a further 8 days, the mouse serum was tested for reactivity for both PSP94 and PSP94-binding protein in the ELISA screening assay described above.
  • a (substantially) pure PSP94-binding protein i.e., this preparation also contains PSP94
  • mice a and b were boosted intra-peritoneally with a further 15 ⁇ g of a PSP94-binding protein with no adjuvant.
  • the remaining two mice (c and d) were boosted subcutaneously with a further 15 ⁇ g of a PSP94-binding protein together with 15 ⁇ g of native PSP94 in Titer MaxTM adjuvant in order to increase the likelihood of obtaining antibodies to exposed epitopes of PSP94.
  • mice a and b After a further 4 days, the spleens of mice a and b were harvested, the B lymphocytes collected, and fused with NSO myeloma cells in order to generate hybridomas (Galfre G. and Milstein C, Meth. Enzymol. 73:3-46, 1981 ).
  • a hundred thousand splenocytes, in Iscove's MDM selection medium (supplemented with 20% FBS, HAT, 10 ng per ml interleukine-6, and antibiotics), were plated into each well of 96 well plates. Since antibodies are secreted from the cells, cell culture media (i.e., supernatant) may be harvested for characterization of the antibodies produced.
  • Desired (positive) hybridoma clones were plated into 6 well plates. The supematants were re-tested for the presence of the specific antibody, and those of the clones remaining positive were passed through successive cycles of cloning by limiting dilution. Cloning in such a manner to ensure that the hybridoma cell line produced is stable and pure. Typically, two cycles of cloning were necessary to achieve this goal. Multiple vials of frozen stocks were prepared, with one vial from each batch tested for viability and antibody production. Results of clone characterization are illustrated in ta3le 10.
  • mice are immunized with a PSP94 preparation (substantially pure PSP94) in TiterMaxTM adjuvant.
  • Boosting and hybridoma procedures are performed as described above. Therefore, antibodies which bind to an epitope of PSP94 that is exposed when PSP94 is. in a bound form are produced using the immunization schemes described above.
  • the binding specificity of the antibody is determined in an ELISA assay or in a Western blot assay by contacting the desired antibody which is conjugated with a reporter molecule with a complex formed by PSP94 and a PSP94-binding protein. When the antibody binds to the complex, a positive reaction arises upon detection of the signal generated by the reporter molecule.
  • Antibodies which bind to an epitope of PSP94 that is available only when PSP94 is in a free form (free of a PSP binding protein) are also produced using the immunization schemes described above.
  • the binding specificity of the antibody is determined in an ELISA assay or in a Western blot by contacting the desired antibody which is conjugated with a reporter molecule with a substantially purified PSP94 and in a parallel experiment by contacting the antibody with a complex formed by PSP94 and a PSP94-binding protein.
  • An antibody e.g., conjugated with a reporter molecule which binds to an epitope of PSP94 that is available only when PSP94 is in a free form will produce a positive reaction when contacted with a substantially purified PSP94 and a negative reaction (i.e., no signal (color) is detected) when contacted with the complex.
  • Antibodies which bind both the free and bound forms of PSP94 are also produced using the immunization schemes described above. However an antibody which binds both the free and bound forms of PSP94 will produce a positive reaction when contacted with a substantially purified PSP94 and will also produce a positive reaction when contacted with the complex formed by PSP94 and a PSP94-binding protein.
  • H/bridomas producing a desired antibody are isolated, expanded and stored as described above.
  • Mouse IgGI monoclonal antibodies were purified using a high salt protein A procedure as detailed in Antibodies: A Laboratory Manual eds Harlow and Lane, Cold Spring Harbor Laboratory (for reference see above).
  • Monoclonal antibody lsotyping lsotyping was performed using a Mouse Monoclonal Antibody lsotyping Kit (Roche Diagnostics Corporation Indianapolis USA). This kit provides information relating to the class (IgG, IgA or IgM) the type of light chain (kappa or lambda) and IgG subtype (IgGI , lgG2a, lgG2b or lgG3). The antibodies tested were mainly of the IgGI kappa subtype. However, one antibody was shown to be of the IgM kappa subtype (B26B10).
  • the polyclonal antibody to PSP94 of the present invention was produced by immunizing New Zealand white rabbits. Each rabbit was immunized with 50 micrograms of purified human PSP94 (>95% purity) in Freunds complete adjuvant. 3 weeks later the rabbits were boosted with a further 50 micrograms of PSP94. After a further 4 weeks, the rabbits were bled every week for a period of 12 weeks (25 ml bleed each week). The serum was separated from the whole blood and affinity purified antibodies were purified from the IgG fraction as described below.
  • First step Purification of IgG fraction using protein A 1.5 g of Protein A immobilized on Sepharose CL-4B obtained from Sigma (Cat no. P- 3391 ) was swelled and washed in 20 volumes of PBS (0.14 m NaCI, 10 mM sodium Phosphate, pH 7.4). Once the sepharose was swelled, two additional aliquots of PBS were used to wash the matrix twice. The total volume of swelled matrix was about 5 ml which correspond to a capacity of binding of at least 50 mg of rabbit IgG.
  • Step 2 Affinity purification of anti-PSP94 IgG on PSP94 affinity column.
  • a first step in purification of an anti-PSP94-specific IgG antibody was to produce an affinity purification matrix. It was found that a good efficiency may be achieved using a column with about 1 mg of PSP94 per milliliter of matrix. This protocol produces about a 5 ml column with 5 mg of conjugated PSP94.
  • the OD of the cold PSP94 solution was first measured and the solution was added to 5ml of the cold matrix, and mixed. After 1 minute, 1 ml of slurry was removed and spined for 10 seconds in a microfuge. The supernatant was removed and the OD 280 was measured. The removed slurry and antibody solution was replaced to the conjugation mixture. The reaction was continued until the OD measurement indicated that between about 70 and 80 % of the PSP94 has been removed from the solution. The reaction was stopped by adding 10 ml of 0.1 m Glycine in 100 mM sodium bicarbonate. The mixture was incubated for 30 minutes at about 4 0 C. Exemplary results of conjugation of PSP94 to the sepharose matrix are illustrated in Table B.
  • Step 2 B Affinity purification of PSP94 specific IgG.
  • the protein A purified IgG was at a concentration of about 5-10 mg per ml in 0.1 M g ycine, 100 mM Tris at neutral pH. This solution was diluted in PBS to a concentration of 1 mg per ml, (OD 280 of 1.4). This buffer composition was adequate for the affinity purification.
  • ELISA-based hybridoma screening assay In order to evaluate the titer and the specificity of the antibodies produced from mice or from the hybridoma generated from mouse B cells, an ELISA screening assay was developed.
  • microtitre plates (Nunc, MaxiSorp) were coated with 100 ⁇ l aliquots of either native PSP94 (isolated from human seminal plasma; 5 ⁇ g/ml in 0.1 M sodium carbonate pH 9.6) or with a PSP94-binding protein (0.1 ⁇ g/ml in 0.1 M NaHCO 3 ) or phosphate buffered saline (PBS; 140 mM NaCI 10 mM sodium phosphate pH 7.5) overnight at 4 0 C.
  • native PSP94 isolated from human seminal plasma; 5 ⁇ g/ml in 0.1 M sodium carbonate pH 9.6
  • PBS phosphate buffered saline
  • BSA bovine serum abumin
  • PBS-Tween polyoxyethyylene-sorbitan monolaurate
  • the plates were incubated for 1 hour at 34 0 C prior to application of a 1 : 1000 dilution in PBS 0.5% BSA of peroxidase conjugated polyclonal rabbit immunoglobulins recognizing mouse immunoglobulins, (rabbit anti-mouse IgG peroxidase). After a further 1 hour incubation at 34 0 C the plates were extensively washed in PBS Tween, prior to development of the peroxidase signal in 3, 3', 5,5'- Tetramethylbenzidine (TMB). After 30 minutes the optical density at 630 nm was read in a micro plate reader.
  • TMB 3, 3', 5,5'- Tetramethylbenzidine
  • the diluent (buffer) of the purified antibody was exchanged for 0.1 M NaHCO 3 buffer ph 8.0 and the protein concentration was adjusted to 1 mg/ml.
  • a 2 mg/ml solution of biotinamidocaproate N-hydroxysuccinimide ester was prepared in DMSO and an appropriate volume of this solution was added to the antibody to give either a 5, 10 or 20 fold excess of biotinylating agent.
  • the solution was incubated on ice for 2 hours with occasional agitation before an equal volume of 0.2 M glycine in 0.1 M NaHCO 3 was added to give a final concentration of 0.1 M glycine.
  • the antibody was separated from the free biotinylating agent by gel filtration using a PD10 gel filtration column (Biorad). Biotinylated antibodies were stored at 4 0 C in with 0.05% sodium azide added as preservative. The optimal extent of biotinylation and optimal usage concentration of the biotinylated antibodies was determined on antigen-coated plates.
  • ELISA plates were coated either with a PSP94-binding protein or PSP94 and blocked as described above. Appropriate concentrations of the biotinylated antibodies p r epared as described above were incubated with the coated plates in the presence or absence of a 50-fold excess of a panel of unlabelled antibodies. Competition with the unlabelled antibodies indicates epitopes that are shared between the two antibodies. Detection is performed using streptavidin peroxidase.
  • Kits using antibodies conjugated with a reporter molecule were developed.
  • Antibodies listed in table 10 were conjugated with a reporter molecule using the following procedures.
  • Horse radish peroxidase (3 mg) (HRP) was diluted into 0.6ml of deionized water. 0.2ml of sodium periodate 0.01 M in PBS pH 7.5 was added to the diluted HRP and the mixture was incubated for 25 minutes at room temperature. Dialysis was carried out against sodium acetate solution (1 mM pH 4.0) at 4 0 C. Buffer changes (3 times) were effected at each two hours.
  • the mixture was transferred in a conical tube and 1.2 ml of ammonium sulfate saturated solution (30Og of (NH 4 ) 2 SO 4 in 400 ml of deionized water) was added and was left for 1 hour at 4 0 C with agitation.
  • the precipitated solution was centrifuged at 300 RPM for 20 minutes.
  • the pellet was resuspended in the ammonium sulfate saturated solution. Centrifugation was again performed as described above.
  • the pellet was then resuspended in 2 ml of PBS (0.01 M pH 7.1 ).
  • Dyalisis was performed against 0.01 M PBS pH 7.4.
  • the buffer was changed every 2 hours with fresh 0.01 M PBS pH 7.4 (4 buffer changes).
  • HRP conjugated antibody was diluted in a stabilizing solution (50% fetal bovine serum in Tris-HCI (31.52g/L in deionized water), pH 6.8) and was used at a concentration of between 1.5 to 10mg/ml in the assays, methods and kits of the present invention.
  • a stabilizing solution 50% fetal bovine serum in Tris-HCI (31.52g/L in deionized water), pH 6.8
  • a PSP94 master solution standard was prepared and lyophylized in bovine serum albumin/mannitol stabilization buffer (5 micrograms of PSP94 in 4 mg/ml mannitol, 2% BSA (fraction v) in 10 mM sodium phosphate, 20 mM EDTA, 40 micrograms per ml Thimerosal pH 7.5 in 0.5 ml).
  • Multiple vials of the master solution were stored at -20 0 C and this material was used to calibrate the standard curves used in each batch of ELISA kits Several dilution of the standard for use within the kits was prepared as indicated below
  • PSP94 antibodies for free or total PSP94
  • an assay was developed to determine if the monoclonal antibodies recognize PSP94 in its free form and/or when it is bound to a PSP94-b ⁇ nd ⁇ ng protein
  • PSP94/PSP94-b ⁇ nd ⁇ ng protein complex In order to promote the formation of a PSP94/PSP94-b ⁇ nd ⁇ ng protein complex, the two (substantially or partially) purified proteins were pre-incubated together Briefly, a partially pure PSP94-b ⁇ nd ⁇ ng protein preparation (see example 4), at a concentration of 1 mg/ml (total protein concentration) in PBS containing 0 5% BSA was pre-incubated for 1 hour at 34 0 C with or without 5 ⁇ g/ml of native PSP94
  • Results illustrated in figure 11 indicate that none of the antibodies tested react with captured PSP94-b ⁇ nd ⁇ ng protein when the binding sites are not saturated with PSP94 When the binding sites are saturated with PSP94, P1 E8 shows strong reactivity towards the complex However, 2D3 and 12C3 do not Thus, PIE8 recognize bound and free PSP94 and the other two antibodies (2D3 and 12C3) only recognize the free form of the protein Antibodies 2D3 and 12C3 probably recognize a PSP94 epitope that is masked when it is bound to a PSP94-b ⁇ nd ⁇ ng protein Each of these antibodies detects native and recombinant PSP94 when coated onto ELISA plates All three antibodies function as capture or detector antibodies in sandwich ELISA formats to produce a linear standard curve over a useful range of concentrations of PSP94. However, 12C3 appears to be of lower affinity than 2D3 or P1 E8 toward PSP94.
  • PSP94 antibodies described above (2D3 (PTA-4240), P1 E8 (PTA-4241 ), 12C3, polyclonal and 1A6 (PTA-6599)), may be used in a competitive ELISA assays e.g., coating plates with PSP94 (or sample), and using the PSP94 within the sample to inhibit the binding of the antibody to the PSP94 coated plates.
  • These antibodies may also be used in standard ELISA assays where an antibody is coated to the plate and a sample containing PSP94 is added. Specific detection of the complex is subsequently performed with a second antibody able to bind to PSP94 (the first and second antibodies binding to a different epitope of PSP94).
  • the improved assay involves pre-absorption (removal) of the PSP94/PSP94- binding protein complex with a PSP94-b ⁇ nd ⁇ ng protein antibody described herein before performing the assay
  • the PSP94-b ⁇ nd ⁇ ng protein antibodies selectively remove
  • P3P94-b ⁇ nd ⁇ ng protein and the PSP94/PSP94-b ⁇ nd ⁇ ng protein complex ( ⁇ e , bound P3P94) This is done without upsetting the kinetics of the equilibrium reaction between a PSP94-b ⁇ nd ⁇ ng protein and PSP94
  • Pre-absorption can be done with, for example the 17G9 linked to a sepharose matrix, giving then a sample that is free of the complex
  • Another standard immunodetection assay (a sandwich ELISA assay measuring free PSP94) was performed Briefly, wells of an ELISA plate were coated with 150 rricrolitres of an ant ⁇ -PSP94 polyclonal antibody (which has been generated as described herein) at 3 ⁇ g/mL in KPO 4 0 1 M, Glutaraldehyde 0 001 % at a pH of 6 5 Tie antibody is allowed to bind to the plates for 24 hours at room temperature and rinsed with 300 microlitres of deionized water After washing, the wells were coated with 200 microlitres of 10 mM sodium phosphate, 140 mM NaCI, pH 7 5 with 0 5% BSA (fraction v) and 2 % sucrose and incubated for 24 hours before aspiration of the solution The plates were allowed to dry at room temperature overnight The plates may be used right away or may be dried and stored for subsequent experiments
  • PSP94 standards dilutions were prepared by diluting a master solution of PSP94 to obtain concentrations of 0, 1 , 5, 10, 20, 40ng/mL in a final volume of 0 5mL of 10 mM sodium phosphate, 20 mM EDTA, 40 micrograms per ml Thimerosal, 0 25% BSA
  • Twenty-five micro liters of serum samples containing PSP94 or PSP94 standards (the samples and standards were brought to room temperature, i.e., about 22 0 C +/- 2 0 C) and added to independent wells.
  • the plates were incubated for sixty minutes on a plate shaker (110 +/- 10 rpm) at room temperature (i.e., about 22 0 C +/- 2 0 C).
  • the well content was decanted by inverting the plates and excess liquid was absorbed by putting the inverted plate onto absorbing paper.
  • the wells were then washed three times with 300 ⁇ L of washing solution. At the last wash, the plates were completely decanted by tapping them against absorbing paper until there was no trace of liquid remaining.
  • a hundred microliters of the enzyme's substrate solution was added to each well and the reaction was allowed to proceed for 15 minutes on a plate shaker (110 +/- 10 rpm) at room temperature (i.e., about 22 0 C +/- 2 0 C).
  • stopping solution 0.5M sulfuric acid
  • the enzyme's substrate substrate- chromogen solution
  • the enzyme catalyzes a reaction which produces a blue color.
  • the stopping solution is added, the color turns yellow.
  • the intensity of the color is directly proportional to the concentration of PSP94 in the sample or standard. The intensity of the color was measured by reading the absorbance at 415 or 405 nm in a microplate reader (spectrophotometer) immediately after the assay was completed.
  • the quantity of free PSP94 in the sample was determined by making a plot of the optical density (on the ordinate) measured for the standards as a function of the concentration of standards (on the abscissa) and the corresponding concentration which gives the optical density measured for the sample was evaluated.
  • Table 11 represents results obtained by measuring the concentration of PSP94 in 2 unknown human serum samples using the sandwich ELISA assay for measuring free PSP94 described above. These results are also illustrated as a graph in Fig. 12c.
  • Precision The precision of an analytical method describes the closeness of mean test results obtained by the method to the true value (concentration) of the analyte. Precision is determined by replicate analysis of samples containing a known amount of the analyte.
  • the standard curve and five times each of the three control levels are measured.
  • the mean the standard deviation and the coefficient of variation (in percent) are calculated.
  • the within assay % coefficient of variation is preferably below 15%.
  • the linearity is the ability of a diluted patient sample to show proportional values when read through the working standard curve. Two serum samples were diluted and run.
  • P1 E8 antibody Since the P1 E8 antibody is able to recognize PSP94 both in its free and bound form, an assay to measure total PSP94 has been developed. For example, P1 E8 is immobilized to the plate and a sample containing free PSP94 and PSP94 complexed w ith a PSP94-binding protein is added. The PSP94 and the complex remains bound to the antibody and an antibody having a different affinity (a different binding site on PSP94) than P1 E8 may be added.
  • An example of such an antibody is 2D3 or any other suitable PSP94-antibody. Detection is performed by using a label that may be conjugated to 2D3 or by a secondary molecules (antibody or protein) recognizing directly or indirectly (e.g., biotin/avidin or streptavidin system) the 2D3 antibody.
  • the assay was performed as illustrated in figure 13.
  • total P3P94 is captured with the P1 E8 antibody, and a high concentration (excess) of biotinylated 2D3 is used to encourage the dissociation (displacement) of a PSP94- binding protein.
  • the actual concentration of 2D3 for coating the plate is low as the plastic has a capacity of no more than 50 ng.
  • this assay may also measure free (unbound) PSP94, if the complex (PSP94/PSP94-binding protein) is adsorbed out from the serum prior to measurement.
  • FIG 14a illustrates a sandwich ELISA assay, as illustrated in figure 14a, has been developed using these two antibodies.
  • Figure 14b illustrates a standard curve from the assays used to measure a PSP94-binding protein within serum samples. Note that these two antibodies may be interchanged. For example, the capture antibody can be switched to be used as detection reagent (when labeled).
  • PSP94-binding protein ELISA assay described above (illustrated in Figure 14a). The PSP94-binding protein serum concentration was successfully measured. Values of PSP94-binding protein in these male donors ranged from about 1 ⁇ g/ml to about 10 ⁇ g/ml, with two cases having in excess of 20 ⁇ g/ml. Two cases from female donors have been assessed; one has about 3 ⁇ g/ml, the other about 7.8 ⁇ g/ml.
  • Figure 15 A is a graph illustrating results obtained following measurement of total PSP94 in serum of individuals for which PSA values are known to be lower or higher than the cut-off value of 4ng/ml and using an assay as illustrated in figure 13 and described in example 14. Results are expressed as the log of total PSP94 concentration (in ng/ml) measured for each individual. Each point represents results obtained for a specific individual. With respect to this figure, total PSP94 concentration of 1 to 2250 ng/ml were measured in serum of individuals.
  • this figure is a graph illustrating results obtained following measurement of free PSP94 in serum of individuals for which PSA values are known to be lower or higher than the cut-off value of 4ng/ml.
  • Results were obtained using an assay which is based on the removal (depletion) of PSP94-binding protein and P3P94/PSP94-binding protein complex from serum using an anti-PSP94-binding protein antibody as described herein prior to measurement of free PSP94 with the 2D3 and P1 E8 monoclonal antibodies in a sandwich ELISA assay.
  • Results are expressed as the log of free PSP94 concentration (in ng/ml) measured for each individual. Each point represent results obtained for a specific individual.
  • this figure is a graph illustrating results obtained following measurement of total PSP94-binding protein in serum of individuals for which PSA values are known to be lower or higher than the cut-off value of 4ng/ml. Results were obtained using an assay which is illustrated in figure 14a and described in example 15. Results are expressed as the log of total PSP94-binding protein concentration (in ng/ml) measured for each individual. Each point represent results obtained for a specific individual. With respect to this figure, PSP94-binding protein concentration ranging from 0.7 to 125 micrograms/ml were measured in serum of individuals.
  • this figure is a graph illustrating results obtained following correction of the free PSP94 concentration obtained in serum of individuals for which
  • PSA values are known to be lower or higher than the cut-off value of 4ng/ml.
  • Results were corrected by taking into account that 1 to 5 % of residual PSP94/PSP94-binding protein complex remains in the serum even after depletion which may affect the results obtain, i.e., PSP94 may be dissociated from the complex after the 2D3 antibody is added, falsely increasing the "free PSP94" value.
  • Results are again expressed as the log of corrected free PSP94 concentration (in ng/ml) measured for each individual.
  • Figure 16 is a graph illustrating the total PSP94-bind ⁇ ng protein concentration (ng/ml) versus the total PSP94 concentration (ng/ml) measured in serum of individuals, where each point represent results obtained for a specific individual. With respect to this figure, a significant positive relationship between these two parameters may be observed
  • MOLECULE TYPE PROTEIN
  • HYPOTHETICAL
  • Xaa may be any amino acid (e.g., Ala, Cys, Asp, GIu, Phe, GIy, His, lie, Lys, Leu, Met, Asn, Pro, Gin, Arg, Ser, Thr, VaI, Trp, Tyr) .
  • GIu Pro lie GIy Ser Pro GIu Asp Ala GIn Asp Leu Pro Tyr Leu VaI 245 250 255
  • MOLECULE TYPE Protein
  • HYPOTHETICAL HYPOTHETICAL:
  • ANTI-SENSE FRAGMENT TYPE:
  • Xaa may be any amino acid (e.g.,
  • Pro Ser lie Leu Ala Ala His Ser Leu Pro Ser Leu Asp GIu GIu Pro 290 295 300
  • Pro GIy GIy GIy Arg lie Xaa GIy Ser Ser Leu Pro Thr Trp Pro GIy 545 550 555 560
  • LyEi 625 (.2) INFORMATION FOR SEQ ID NO . : 8: (i) SEQUENCE CHARACTERISTICS
  • Xaa may be any amino acid (e.g.,
  • Pro Ser lie Leu Ala Ala His Ser Leu Pro Ser Leu Asp GIu GIu Pro 290 295 300
  • VaI Thr Phe Pro Lys Ser Thr His VaI Pro lie Pro Lys Ser Ala Asp 305 310 315 320 Lys VaI Thr Asp Lys Thr Lys VaI Pro Ser Arg Ser Pro GIu Asn Ser 325 330 335

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Zoology (AREA)
  • Reproductive Health (AREA)
  • Biotechnology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Dans le sérum, la protéine PSP94 apparaît sous forme libre ou associée à une protéine porteuse. La protéine PSP94 sous sa forme liée a été quantifiée dans du sang prélevé sur des patients atteints d'un cancer de la prostate et il s'est avéré que ces mesures présentent un intérêt pour l'évaluation pronostique du cancer. L'invention concerne donc des dosages diagnostiques, des méthodes et des trousses destinés à la détection de la forme libre de la protéine PSP94, ainsi que des réactifs, tels que des anticorps, capables de se fixer à une forme libre de la protéine PSP94.
EP06752805A 2005-06-17 2006-06-14 Réactifs et dosages diagnostiques permettant de détecter la protéine psp94 Withdrawn EP1891108A4 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US11/154,673 US7534580B2 (en) 2002-05-01 2005-06-17 PSP94 diagnostic reagents and assays
PCT/CA2006/000982 WO2006133560A1 (fr) 2005-06-17 2006-06-14 Reactifs et dosages diagnostiques permettant de detecter la proteine psp94

Publications (2)

Publication Number Publication Date
EP1891108A1 true EP1891108A1 (fr) 2008-02-27
EP1891108A4 EP1891108A4 (fr) 2010-01-13

Family

ID=37531926

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06752805A Withdrawn EP1891108A4 (fr) 2005-06-17 2006-06-14 Réactifs et dosages diagnostiques permettant de détecter la protéine psp94

Country Status (6)

Country Link
US (1) US7534580B2 (fr)
EP (1) EP1891108A4 (fr)
JP (1) JP2008543791A (fr)
AU (1) AU2006257671A1 (fr)
CA (1) CA2611048A1 (fr)
WO (1) WO2006133560A1 (fr)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008110006A1 (fr) 2007-03-12 2008-09-18 Miraculins Inc. Biomarqueurs du cancer de la prostate et utilisations de ceux-ci
US9193763B2 (en) 2007-08-17 2015-11-24 Purdue Research Foundation PSMA binding ligand-linker conjugates and methods for using
GB0811567D0 (en) 2008-06-24 2008-07-30 Cytosystems Ltd Assay
WO2010081240A1 (fr) * 2009-01-19 2010-07-22 Miraculins Inc. Dosages de diagnostic du cancer de la prostate utilisant psp94 et des biomarqueurs de type psa
US9951324B2 (en) 2010-02-25 2018-04-24 Purdue Research Foundation PSMA binding ligand-linker conjugates and methods for using
NZ602515A (en) * 2010-04-16 2015-06-26 Transbio Ltd Proteins that bind pi16 and uses thereof
CN102409091A (zh) * 2011-10-17 2012-04-11 刘颜 前列腺分泌蛋白94/57作为卵巢癌、乳腺癌早期临床诊断生物标记物的方法
WO2013166480A1 (fr) * 2012-05-04 2013-11-07 Wayne State University Détecteurs de biomarqueurs du sérum pour la prédiction de la récurrence du cancer ovarien
US9636413B2 (en) 2012-11-15 2017-05-02 Endocyte, Inc. Conjugates for treating diseases caused by PSMA expressing cells
MX2016005013A (es) 2013-10-18 2017-02-28 Deutsches Krebsforsch Inhibidores marcados de antigeno prostatico especifico de membrana (psma), su uso como agentes formadores de imagenes y agentes farmaceuticos para el tratamiento de cancer de prostata.
US10188759B2 (en) 2015-01-07 2019-01-29 Endocyte, Inc. Conjugates for imaging

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003093474A1 (fr) * 2002-05-01 2003-11-13 Procyon Biopharma Inc. Proteine de liaison psp94 et analyses diagnostiques de psp94

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL154598B (nl) * 1970-11-10 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van laagmoleculire verbindingen en van eiwitten die deze verbindingen specifiek kunnen binden, alsmede testverpakking.
US3817837A (en) * 1971-05-14 1974-06-18 Syva Corp Enzyme amplification assay
US3939350A (en) * 1974-04-29 1976-02-17 Board Of Trustees Of The Leland Stanford Junior University Fluorescent immunoassay employing total reflection for activation
US3996345A (en) * 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4196265A (en) * 1977-06-15 1980-04-01 The Wistar Institute Method of producing antibodies
US4277437A (en) * 1978-04-05 1981-07-07 Syva Company Kit for carrying out chemically induced fluorescence immunoassay
US4275149A (en) * 1978-11-24 1981-06-23 Syva Company Macromolecular environment control in specific receptor assays
US4366241A (en) * 1980-08-07 1982-12-28 Syva Company Concentrating zone method in heterogeneous immunoassays
JPS5938657A (ja) * 1982-08-27 1984-03-02 Saburo Hara 前立腺疾患診断用組成物
US4863851A (en) * 1986-10-20 1989-09-05 The Upjohn Company Monoclonal antibody to prostate secretory protein
SE9002480D0 (sv) * 1990-07-23 1990-07-23 Hans Lilja Assay of free and complexed prostate-specific antigen
US5428011A (en) * 1992-06-16 1995-06-27 Procyon Biopharma, Inc. Pharmaceutical preparations for inhibiting tumours associated with prostate adenocarcinoma
US6107103A (en) * 1996-10-15 2000-08-22 Procyon Bropharma Inc. Assay for PSP94 protein
US6156515A (en) * 1999-02-09 2000-12-05 Urocor, Inc. Prostate-specific gene for diagnosis, prognosis and management of prostate cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003093474A1 (fr) * 2002-05-01 2003-11-13 Procyon Biopharma Inc. Proteine de liaison psp94 et analyses diagnostiques de psp94

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
REEVES JONATHAN R ET AL: "Prognostic value of prostate secretory protein of 94 amino acids and its binding protein after radical prostatectomy." CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH 15 OCT 2006, vol. 12, no. 20 Pt 1, 15 October 2006 (2006-10-15), pages 6018-6022, XP002558157 ISSN: 1078-0432 *
See also references of WO2006133560A1 *

Also Published As

Publication number Publication date
CA2611048A1 (fr) 2006-12-21
US7534580B2 (en) 2009-05-19
JP2008543791A (ja) 2008-12-04
AU2006257671A1 (en) 2006-12-21
WO2006133560A1 (fr) 2006-12-21
EP1891108A4 (fr) 2010-01-13
US20060029984A1 (en) 2006-02-09

Similar Documents

Publication Publication Date Title
US7534580B2 (en) PSP94 diagnostic reagents and assays
EP2913673B1 (fr) Diagnostic du carcinome de l'ovaire
WO2003085399A1 (fr) Methode de determination d'une leucemie, d'une preleucemie ou d'une maladie sanguine maligne aleucemique, et methode diagnostique
JP4813661B2 (ja) 癌を診断するための方法および組成物
WO2001036977A2 (fr) Procedes et compositions d'identification de marqueurs de maladie
Reeves et al. Identification, purification and characterization of a novel human blood protein with binding affinity for prostate secretory protein of 94 amino acids
KR20110090985A (ko) 인간 ｃｘｃｌ１ 단백질의 면역학적 측정 방법
AU2011359350A2 (en) Compositions and methods of use for determination of HE4a
US20040009164A1 (en) PSP94 diagnostic reagents and assays
CN113912714A (zh) 特异性结合α-突触核蛋白的抗体及其应用
CA2045552C (fr) Haptoglobine liee au cancer
JPH0675514B2 (ja) ヒト非小細胞肺癌に関するモノクローナル抗体
EP1589033A1 (fr) Anticorps et utilisation de ce dernier
EP0667916B1 (fr) Proteine de liaison au crf
WO2004094612A2 (fr) Anticorps monoclonaux specifiques de cancer
WO1999043710A1 (fr) Antigenes d'enveloppe specifiques a la prostate et procedes de preparation et d'utilisation desdits antigenes
WO2000050457A1 (fr) Antigenes d'enveloppe prostatique specifique, ses procedes de production et d'utilisation
US6552164B1 (en) Reagents and methods useful for detecting diseases of the breast
CA2380662A1 (fr) Reactifs et methodes diagnostiques a base de psp94
CN113004406A (zh) 抗cd47抗体及其应用
EP2957571B1 (fr) Anticorps anti-pvhl monoclonaux et leurs utilisations
Zuccon et al. Immunohistochemistry of HFE in the duodenum of C282Y homozygotes with antisera for recombinant HFE protein
US8680242B2 (en) Plasminogen receptor, polypeptides and antibodies thereof
EP0582450A2 (fr) Anticorps contre récepteur de l'oxytocine et leur production
JP4829961B2 (ja) プロスタシン部分ペプチド及び抗プロスタシン抗体

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20071211

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

DAX Request for extension of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20091210

17Q First examination report despatched

Effective date: 20100406

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100817