EP1859042A2

EP1859042A2 - Novel human, feline, chicken and other animal interferons and uses thereof

Info

Publication number: EP1859042A2
Application number: EP06748385A
Authority: EP
Inventors: Sidney Pestka; Christopher D. Krause
Original assignee: University of Medicine and Dentistry of New Jersey; Rutgers State University of New Jersey
Current assignee: University of Medicine and Dentistry of New Jersey; Rutgers State University of New Jersey
Priority date: 2005-03-14
Filing date: 2006-03-14
Publication date: 2007-11-28
Also published as: WO2006099451A3; WO2006099451A2

Abstract

The invention relates to novel interferon polypeptides and nucleic from humans, felines, chicken and other species and to related compositions and uses. The invention also provides novel interleukin polypeptides and nucleic acids, as well as nucleic acids and polypeptides for interferons and interleukin receptors. The invention also provides antibodies specific for the novel polypeptides, assays for identifying modulators of interferon activity, and methods of treating animals, including humans, afflicted with various disorders and conditions by administering interferon polypeptides, including IFN-P polypeptides and fragments.

Description

NOVEL HUMAN, FELINE, CHICKEN AND OTHER ANIMAL INTERFERONS

AND USES THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the filing date of U.S. Application No.

60/661686, filed March 14, 2005, entitled "NOVEL HUMAN, FELINE, CHICKEN AND OTHER ANIMAL INTERFERONS AND USES THEREOF" and of U.S. Application No. 60/664443, filed March 22, 2005, entitled "NOVEL HUMAN, FELINE, CHICKEN AND OTHER ANIMAL INTERFERONS AND USES THEREOF." The entire teachings of the referenced applications are incorporated by reference herein.

STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH OR DEVELOPMENT

The invention described herein was supported, in whole or in part, by the United States Public Health Services Grant No. RO1-AI36450, by National Institute of Allergy and Infectious Diseases Grant No. RO1-AI43369 and by National Cancer Institute Grant No. RO1-CA46465. The United States government has certain rights in the invention.

BACKGROUND OF THE INVENTION Interferons (IFNs) are a well known family of cytokines secreted by a large variety of eukaryotic cells upon exposure to various stimuli (Zoon KC: Human Interferons: Structure and Function, p. 1-12. In: Interferon 8. Academic Press, London, 1987; Walter et al., Cancer Biotherm Radiopharm 1998 June; 13(3): 143-54; Pestka, S., Biopolymers 2000; 55(4):254-87). The interferons have been classified by their chemical and biological characteristics into four groups: IFN-α (leukocytes), IFN-β (fibroblasts), IFN-γ

(lymphocytes), and IFN-ω (leukocytes). IFN-α and β are known as Type I interferons: IFN- γ is known as a Type-II or immune interferon. The IFNs exhibit anti-viral, immunoregulatory, and antiproliferative activity. The clinical potential of interferons has been recognized. Human leukocyte interferon was first discovered and prepared in the form of very crude fractions by Isaacs and Lindemann. Efforts to purify and characterize the material have led to the preparation of relatively homogeneous leukocyte interferons derived from normal or leukemic (chronic myelogenous leukemia or "CML") donor leukocytes. These interferons are a family of proteins characterized by a potent ability to confer a virus- resistant state in their target cells. In addition, interferon can inhibit cell proliferation, modulate immune responses and alter expression of proteins. These properties have prompted the clinical use of leukocyte interferon as a therapeutic agent for the treatment of viral infections and malignancies.

During the past several decades a large number of human and animal interferons have been produced, identified, purified and cloned. Several of the interferon preparations have been prepared for clinical trial in both crude form, for some of the original interferon preparations, as well as in purified form. Several individual recombinant interferon-α species have been cloned and expressed. The proteins have then been purified by various procedures and formulated for clinical use in a variety of formulations. Most of the interferons in clinical use that have been approved by various regulatory agencies throughout the world are mixtures or individual species of human α interferon (Hu-IFN-α). In some countries Hu-IFN-β and γ have also been approved for clinical trial and in some cases approved for therapeutic use. The major thesis underlying clinical use of these interferons was that they were natural molecules produced by normal individuals. Indeed, the specific thesis was that all the interferons prepared for clinical use, be they natural- or recombinant-generated products, represented interferons that were produced naturally by normal people. This is true for a large number of interferons as well as specific growth factors, lymphokines, cytokines, hormones, clotting factors and other proteins that have been produced. A need remains for the identification of additional interferons, in human and other organisms, that may be used for the treatment of diseases such as viral infection and cancer. The present invention provides such interferons and other novel genes.

SUMMARY OF THE INVENTION On aspect of the invention provides an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 80% identical to at least ten contiguous amino acids of one of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. Another aspect of the invention provides an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 90% identical to at least ten contiguous amino acids of one of the te sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. Another aspect of the invention provides an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 95% identical to at least ten contiguous amino acids of one of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71.

Another aspect of the invention provides an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 98% identical to at least ten contiguous amino acids of one of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. Another aspect of the invention provides an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 99% identical to at least ten contiguous amino acids of one of the sequences set forth in SEQ H) NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71.

Another aspect of the invention provides an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is identical to at least ten contiguous amino acids of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. In one embodiment, the polypeptide has an amino acid sequence that is identical to at least 20 contiguous amino acids of said sequences. In another embodiment, the polypeptide has an amino acid sequence that is identical to at least 50 contiguous amino acids of said sequences. In yet another embodiment, the polypeptide has an amino acid sequence that is identical to at least 100 contiguous amino acids of said sequences.

Another aspect of the invention provides an isolated polypeptide encoded by the isolated nucleic acid of any one of the nucleic acids described above. Another aspect of the invention provides a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71, or the mature form of on eof these sequneces, or a contiguous segment of at least 10, 20, 30, 40, 50, 60, 75 or 100 amino acids in length of one of these sequences. In one embodiment, the polypeptide (i) inhibits proliferation of a mammalian cell; or (ii) inhibits viral infection of a mammalian cell; or (iii) promotes activation of immune cells, or combinations thereof. In one embodiment, the mammalian cell is a HeLa cell.

Another aspect of the invention provides an isolated polypeptide comprising the amino acid sequence set forth in SEQ DD NO:69, or mature form thereof lacking a signal peptide. The invention also provides an isolated polypeptide comprising residues 24-77 of SEQ ID NO: 69. The invention also provides an isolated polypeptide comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6% and 100% identical to the amino acid sequence of residues 24-77 of SEQ ID NO:69. In one embodiment, these polypeptides have antiproliferative or anti-viral activity or immunomodulatory activity or combinations thereof.

Another aspect of the invention provides a polypeptide having at least 90%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6% and 100% amino acid sequence identity to any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71, or to a contiguous portion thereof of at least 10 amino acids in length, or to the mature foπn of one of these interferons. Li one embodiment, the portion is at least 10, 20, 30, 40, 50, 60, 75 or 100 amino acids in length. In one embodiment, the polypeptide inhibits proliferation of HeLa cells and/or inhibits viral infection of a mammalian cell, such as a HeLa cell or an MDBK cell. In one embodiment, the viral infection is an encephalomyocarditis viral infection or a vesicular stomatitis viral infection. Li one embodiment, the portion comprises at least 100, 120, 140, 160, 180, 185 or 190 contiguous amino acids of any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71. Li another embodiment, the portion includes the amino acid at position 78. Li one embodiment, the polypeptide comprising the amino acid sequence set forth in any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71, with or without the signal sequence, and with or without substitution of one or more cysteine residues with another residue, such as a serine. Li one embodiment, the portion or polypeptide enhances the activity of a type I interferon or a type II interferon. Li one embodiment, the type I interferon is selected from human interferon alphas (IFN-αs) and human interferon betas (IFN-βs). Li one embodiment, the Type II interferon is human interferon gamma (EFN-γ).

Li one embodiment, the polypeptides of the invention contain modifications. Li one embodiment, the modification increases the serum half-life of the polypeptide, by at least 1.2, 1.4, 1.6, 1.8. 2, 3, 4, 5, 10, 20, 50 or 100 foldrelative to the non-modified form. Li one embodiment, the modification comprises a polyethylene glycol (PEG) group. Li one embodiment, the polyethylene glycol is selected from linear PEG chains and branched PEG chains. Li one embodiment, the polyethylene glycol group is attached to a group selected from the lysine side chains and the N-terminal amino group of the polypeptide.

Another aspect of the invention provides an expression vector capable of replicating in a prokaryotic cell, in an eukaryotic cell, or in both, comprising any of the above nucleic acids, while another aspect of the invention provides a host cell containing the expression vector. Li one embodiment, the host cell is E. coli, B. subtilis, a yeast cell, an insect cell, myeloma cells, fibroblast 3T3 cells, COS cells, Chinese Hamster Ovary (CHO) cells, mink- lung epithelial cell, human foreskin fibroblast cell, human glioblastoma cell, or a teratocarcinoma cell or any other mammalian cell. Another aspect of the invention provides a method of producing a polypeptide, comprising (i) culturing the host cell expressing one of the polypeptides described herein in a cell culture medium to express said polypeptide; (ii) and isolating said polypeptide from said cell culture. In one embodiment of the methods of producing a polypeptide, the host cell is E. coli, B. subtilis, a yeast cell, an insect cell, a myeloma cell, a fibroblast 3T3 cell, a COS cell, a Chinese hamster ovary (CHO) cell, a mink-lung epithelial cell, a human foreskin fibroblast cell, a human glioblastoma cell, or a teratocarcinoma cell.

Another aspect of the invention provides an isolated antibody, or antigen-binding fragment thereof, that binds specifically to any one of the novel polypeptides described herein. Another aspect of the invention provides an isolated antibody that specifically binds to a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. In one embodiment, the antibody is a monoclonal antibody. In one embodiment, the antibody is a humanized antibody. In one embodiment, the antibody is a polyclonal antibody. In one embodiment, the antibody blocks binding of the polypeptide to its receptor.

Another aspect of the invention provides a composition, preferably a pharmaceutical composition, comprising at least one of the nucleic acids, polypeptides or antibodies disclosed herein, and a pharmaceutically acceptable excipient. In one embodiment, the composition comprises one of the IFN polypeptides, described herein, such as IFN-P polypeptides, fragments, or variants thereof, and a pharmaceutically-acceptable excipient.

Another aspect of the invention provides a composition comprising (i) an WN-v polypeptide, variant, or fragment thereof; (ii) a type I or type II interferon; and (iii) a pharmaceutical-acceptable carrier. Another aspect of the invention provides a composition comprising: (i) an IFN-P interferon;

(ii) an IFN-α interferon, an IFN-β interferon or an IFN-γ interferon; and (iii) a pharmaceutical-acceptable carrier.

Another aspect of the invention provides a vaccine comprising (i) an antigen; (ii) an IFN-?' polypeptide, variant, or fragment thereof; and optionally (iii) a pharmaceutically- acceptable carrier.

Another aspect of the invention provides a method of treating a mammal comprising administering a therapeutically effective amount of one of the compositions described herein. Another aspect of the invention provides a method of treating a mammal comprising administering a therapeutically effective amount of one of the isolated polypeptides described herein, such as the IFN polypeptides. In one embodiment, the IFN polypeptide is an IFN-P polypeptide or fragment or variant thereof. In one embodiment, the composition that is administered comprises an IFN-P polypeptide or biologically-active fragment thereof. In one embodiment, the method further comprises administering to the mammal an IFN-α polypeptide, an IFN-β polypeptide or an IFN-γ polypeptide. In one embodiment, the method further comprises administering to the mammal an IFN-α polypeptide, an IFN-β polypeptide or an IFN-γ polypeptide, in an amount that synergizes with the IFN-P polypeptide administered to the mammal.

In one embodiment, the therapeutic method is for the treatment of an immune system related disorder. In one embodiment, the therapeutic method is for treating a disorder selected from an autoimmune disease, multiple sclerosis, lymphoma, and allergy. In one embodiment, the therapeutic method is for treating a viral infection. In one embodiment, the therapeutic method is for treating a parasitic infection. In one embodiment, the therapeutic method is for treating cancer or a tumor. In one embodiment, the therapeutic method is for treating an autoimmune disease. In one embodiment, the therapeutic method is for treating multiple sclerosis. In one embodiment, the therapeutic method is for treating a lymphoma. IQ one embodiment, the therapeutic method is for treating an allergy. In one embodiment, the therapeutic method is for treating viral hepatitis, papilloma viral infection, herpes, or viral encephalitis. In one embodiment, the therapeutic method is for treating a viral infection caused by a virus selected from coronavirus, smallpox virus, cowpox virus, monkeypox virus, West Nile virus, vaccinia virus, respiratory syncytial virus, rhinovirus, arterivirus, filovirus, picornavirus, reovirus, retrovirus, papovavirus, herpesvirus, poxvirus, hepadnavirus, astrovirus, coxsackie virus, paramyxoviridae, orthomyxoviridae, echovirus, enterovirus, cardiovirus, togavirus, rhabdovirus, bunyavirus, arenavirus, bornavirus, adenovirus, parvovirus, and flavivirus. In one embodiment, the therapeutic method is for treating a cancer including, but is not limited to, hairy cell leukemia, chronic myeloid leukemia, lymphoma, acute myeloid leukemia, osteosarcoma, basal cell carcinoma, glioma, renal cell carcinoma, multiple myeloma, melanoma, prostate cancer, breast cancer, lung cancer, colon cancer, pancreatic cancer or Hodgkin's disease. In one embodiment, the therapeutic method is for treating a non-human mammal.

Another aspect of the invention provides a method for identifying a compound that modulates the activity of an IFN-p polypeptide, the method comprising (i) contacting a cell with the IFN-P polypeptide and with the compound; and (ii) measuring a response of the cell to the FN-P polypeptide; wherein a compound that modulates the response of the cell to the IFN-P polypeptide is a modulator of the EFN-P polypeptide. In one embodiment, the response of the cell is cell division or susceptibility to viral infection. In one embodiment, the JFN-v polypeptide (i) shares at least 90% amino acid sequence identity to any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71, or to a portion thereof; or (ii) comprises at least 100, 120, 140, 160, 180, 185 or 190 contiguous amino acids of any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71; or (iii) both.

Another aspect of the invention provides a method of detecting the level of a EFN- v polypeptide in a mammal, the method comprising (i) obtaining a sample from the mammal; (ii) contacting the sample with an antibody specific for the EFN-P polypeptide; and (iii) quantifying the amount of antibody bound to the IFN-P polypeptide.

Another aspect of the invention provides a method of detecting the level of a IFN- p nucleic acid in a mammal, the method comprising (i) obtaining a sample from the mammal; (ii) contacting the sample with a polynucleotide complementary to the IFN-P nucleic acid; and (iii) quantifying the amount of polynucleotide bound to the IFN-P nucleic acid. The invention further provides agents for the manufacture of medicaments to treat any of the disorders described herein. For example, any methods disclosed herein for treating, preventing or aiding in the prevention of a disorder, such as of viral infections or cancers, by administering an IFN-?' polypeptide to an individual may be applied to the use of the agent in the manufacture of a medicament to treat that disorder.

DETAILED DESCRIPTION OF THE INVENTION I. Overview

The present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion or a fragment of the novel polypeptides described herein. In one embodiment, the novel polypeptides are interferons, such as IFN-v interferons.

Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences described herein, and in particular to those having sequences encoding interferons, such as IFN-v interferons.

In another aspect, the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of a polypeptide having the amino acid sequence shown in one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. More generally, a fragment or portion of an isolated nucleic acid molecule refers to fragments at least about 10 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably, at least about 40 nucleotides in length. Such fragments are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-300 nucleotides in length are also useful according to the present invention.

Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide described in any of the SEQ IDs disclosed herein. In another aspect, any of the nucleic acid molecules of the present invention which encode Interferon polypeptides may include, but are not limited to, those encoding the amino acid sequence of the complete polypeptide and those that include the coding sequence for the complete polypeptide and additional sequences, such as those encoding an added secretory leader sequence, such as a pre-, or pro- or prepro-protein sequence. In some embodiments, the polypeptides lacks the signal sequence.

Also encoded by nucleic acids of the invention are the above protein sequences together with additional, non-coding sequences, including, for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example-ribosome binding and stability of mRNA; and an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.

Thus, the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc.), among others, many of which are commercially available. For instance, hexa-histidine as described by Gentz et al. provides for convenient purification of the fusion protein (Gentz et al. (1989) Proc. Natl. Acad. Sci. USA 86: 821-824). The "HA" tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al. (1984) Cell 37: 767). As discussed below, other such fusion proteins include the polypeptide, such as an IFN-v polypeptide, fused to Fc at the N- or C-terminus. In a related embodiment, the invention also provides fusion proteins comprising an interferon/interleukin protein and a heterologous protein. In certain embodiments, the fusion proteins comprise at least a portion of the interferon/interleukin or a variant thereof and a second domain selected from an immunoglobulin element, a multimerizing domain, a targeting domain, a stabilizing domain, and a purification domain. Any one domain may perform many functions. For example, an Fc domain may provide dimerization, facilitate purification and stabilize the protein in vivo. Exemplary heterologous proteins that can be used to generate interferon/interleukin fusion proteins include, but are not limited to, glutathione-S-transferase (GST), an enzymatic activity such as alkaline phosphatase (AP), or an epitope tag such as hemagglutinin (HA).

The present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of the polypeptides or peptides, including IFN-v polypeptides and fragments thereof, by recombinant techniques.

In another aspect, the invention provides an isolated polypeptide comprising an amino acid sequence selected from any of the SEQ IDs disclosed herein, with or without the signal sequence. In preferred embodiments, the invention provides an isolated polypeptide, or fragment thereof, comprising an amino acid sequence of an IFN described herein, such as one of the IFN-v polypeptides disclosed herein. The polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those described in SEQ ED NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95% similarity, to those above. Polynucleotides encoding such polypeptides are also provided. The invention also provides a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of a polypeptide, such as an IFN-v polypeptide, having an amino acid sequence of any of the SEQ ID NO: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71 , or fragments or variants thereof. Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.

In another embodiment, the invention provides an isolated antibody that binds specifically to an polypeptide having an amino acid sequence described in one of the SEQ IDs disclosed here. The invention further provides methods for isolating antibodies that bind specifically to the polypeptide having an amino acid sequence as described herein. Such antibodies are useful therapeutically. In one embodiment, the antibodies are specific for IFN-v polypeptides. In another embodiment, the antibodies provided herein specifically bind to an N-terminal fragment of the mature form of INF-v, wherein the fragment is less than 25, 50, 75 or 100 amino acids in length.

In another aspect, the invention provides compositions comprising any of the polynucleotides or polypeptides, including IFN-v polypeptides and polynucleotides, described herein, for administration to cells in vitro, to cells ex vivo, and to cells in vivo, or to a multicellular organism. In some embodiments, the compositions comprise an Interferon polynucleotide for expression of an Interferon polypeptide in a host organism for treatment of a disease or condition. Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with loss of endogenous activity of an interferon, or for treatment of a viral infection or of a tumor. The invention also provides for pharmaceutical compositions comprising Interferon polypeptides which may be employed, for instance, to treat immune system-related disorders such as viral infection, parasitic infection, bacterial infection, cancer, autoimmune disease, multiple sclerosis, lymphoma and allergy. Methods of treating individuals in need of interferon polypeptides are also provided. In certain preferred embodiments, the subject pharmaceutical composition is a veterinary composition for administration to a non-human animal, preferably a non-human primate. Exemplary conditions which can be treated with an Interferon include but are not limited to cell proliferation disorders, in particular cancer (e.g., hairy cell leukemia, Kaposi's sarcoma, chronic myelogenous leukemia, multiple myeloma, basal cell carcinoma and malignant melanoma, ovarian cancer, cutaneous T cell lymphoma), and viral infections. Without limitation, treatment with Interferon may be used to treat conditions which would benefit from inhibiting the replication of interferon- sensitive viruses. Viral infections which may be treated in accordance with the invention include hepatitis A, hepatitis B, hepatitis C₃ other non-A/non-B hepatitis, herpes virus, Epstein-Barr virus (EBV), cytomegalovirus (CMV), herpes simplex, human herpes virus type 6 (HHV-6), papilloma, poxvirus, picomavirus, adenovirus, rhinovirus, human T lymphotropic virus-type 1 and 2 (HTLV- 1-2), human rotavirus, rabies, retroviruses including human immunodeficiency virus (HIV), encephalitis and respiratory viral infections. The method of the invention can also be used to modify various immune responses. In some embodiments, the compositions comprise at least two interferons, such as an IFN-v and a second interferon. The second interferon may be a type I or a type II interferon. In one embodiment, the second interferon is an IFN-α, an IFN-β, or an IFN-γ polypeptide. In another embodiment, the second interferon is an IFN-δ or IFN-αω polypeptide.

In one embodiment, the subject interferons can be used as anti-viral agents. Other interferons have been used clinically for anti-viral therapy, for example, in the treatment of acquired immune disorders, viral hepatitis including chronic hepatitis B, hepatitis C, hepatitis D, papilloma viruses, herpes, viral encephalitis, and in the prophylaxis of rhinitis and respiratory infections .

In another embodiment, the subject Interferon can be used as anti-parasitic agents. The subject Interferons may be used, for example, for treating Cryptosporidium parvum infection.

In still another embodiment, the subject Interferons can be used as anti-bacterial agents. Interferons have been used clinically for anti-bacterial therapy. For example, the subject Interferons can be used in the treatment of multidrug-resistant pulmonary tuberculosis.

In yet another embodiment, the subject Interferons can be used as anti-cancer agents. Interferon therapy using the subject Interferons can be used in the treatment of numerous cancers e.g., hairy cell leukemia, acute myeloid leukemia, osteosarcoma, basal cell carcinoma, glioma, renal cell carcinoma, multiple myeloma, melanoma, and Hodgkin's disease.

In yet another embodiment, the subject Interferons can be used as part of an immunotherapy protocol. The Interferons of the present invention may be used clinically for immunotherapy or more particularly, for example, to prevent graft vs. host rejection, or to curtail the progression of autoimmune diseases, such as arthritis, multiple sclerosis, or diabetes. In another embodiment, the subject Interferons can be used as part of a program for treating allergies.

In still another embodiment, the subject Interferons can be used as vaccine adjuvants. The subject Interferons may be used as an adjuvant or coadjuvant to enhance or stimulate the immune response in cases of prophylactic or therapeutic vaccination.

In addition to the treatment of animals in general, the specific invention particularly contemplates the use of the subject Interferons for the treatment of primates as part of veterinary protocols. In one embodiment, the interferon is a Rhesus interferon. In addition to the treatment of animals in general, the specific invention particularly contemplates the use of the subject Interferons for the treatment of cats as part of veterinarian protocols. In one embodiment, the Interferon is a feline Interferon, such as an EFN-v. In certain embodiments, the subject Interferons are used to treat cats for viral infections. For instance, cats with Feline Immunodeficiency Virus (FIV) require support therapies in order to maintain normal health. The subject interferons can be used as part of a treatment of cats infected with FIV. Likewise, the subject Interferons can be used as part of a treatment of cats infected with Feline Leukemia Virus (FeLV). The feline leukemia virus (FeLV) is the causative agent of the most important fatal infectious disease complex of American domestic cats today. Interferons can be used for treating feline panleukopenia

Also called feline infectious enteritis, feline "distemper," and feline ataxia or incoordination, feline panleukopenia is a highly contagious viral disease of cats characterized by its sudden onset, fever, inappetence (loss of appetite), dehydration, depression, vomiting, decreased numbers of circulating white blood cells (leukopenia), and often a high mortality rate. Intrauterine (within the uterus) infection may result in abortions, stillbirths, early neonatal deaths, and cerebellar hypoplasia (underdevelopment of the cerebellum) manifested by incoordination (ataxia) in kittens beginning at two to three weeks of age. All members of the cat family (Felidae) are susceptible to infection with feline panleukopenia virus (FPV), as are raccoons, coatimundis, and ringtails, in the family Procyoniclae. Interferons can be used for treating cats infected with feline infectious peritonitis. Interferons can be used for treating cats infected with rabies. In other embodiments directed to feline care, the subject Interferons can be used in treating inflammatory airway disease (LAD).

In still another embodiment, the subject interferons can be used to treat dogs or other household pets. In still another embodiment, the subject interferons can be used to treat farm animals.

The subject invention also contemplates functional antagonists, e.g., wherein one or more amino acid residues are different from the wild-type Interferon, which inhibit one or more biological activities of the wild-type Interferon. Such antagonists can be used to treat disorders resulting from aberrant overexpression or other activation of an endogenous interferon. The functional antagonists may be formulated in a pharmaceutical preparation.

The present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a biological activity of one the polypeptides described herein. In the exemplary case where the polypeptide is an interferon, this may involve contacting a receptor which is enhanced by an Interferon polypeptide with the candidate compound in the presence of an Interferon polypeptide, assaying, for example, anti-viral activity in the presence of the candidate compound and an Interferon polypeptide, and comparing the activity to a standard level of activity, the standard being assayed when contact is made between the receptor and Interferon in the absence of the candidate compound. In this assay, an increase in activity over the standard indicates that the candidate compound is an agonist of interferon activity and a decrease in activity compared to the standard indicates that the compound is an antagonist of interferon activity.

One aspect of the invention provides screening assays for drug candidates to identify compounds that competitively bind or complex with the receptor(s) of the interferons described herein, such as EFN-v, and signal through such receptor(s). Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)peptide-immunoglobulin fusions, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments. The assays can be performed in a variety of formats, including protein- protein binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art. An additional aspect of the invention is related to a method for treating an animal in need of an increased level of interferon activity in the body comprising administering to such an animal a composition comprising a therapeutically effective amount of an isolated Interferon polypeptide of the invention or an agonist thereof. A still further aspect of the invention is related to a method for treating an animal in need of a decreased level of interferon activity in the body comprising, administering to such an animal a composition comprising a therapeutically effective amount of an Interferon antagonist. Preferred antagonists for use in the present invention are Interferon-specific antibodies.

The amount of the interferon composition administered to treat the conditions described above is based on the Interferon activity of the composition. It is an amount that is sufficient to significantly affect a positive clinical response. Although the clinical dose will cause some level of side effects in some animals, the maximal dose for animals including humans is the highest dose that does not cause unmanageable clinically-important side effects. For purposes of the present invention, such clinically important side effects are those which would require cessation of therapy due to severe flu-like symptoms, central nervous system depression, severe gastrointestinal disorders, alopecia, severe pruritus or rash substantial white and/or red blood cell and/or liver enzyme abnormalities or anemia- like conditions are also dose limiting. Naturally, the dosages of Interferon may vary somewhat depending upon the formulation, selected. In general, however, the Interferon composition is administered in amounts ranging from about 100,000 to about several million IU/m² per day, based on the animal's condition. The range set forth above is illustrative and those skilled in the art will determine the optimal dosing of Interferon selected based on clinical experience and the treatment indication. The pharmaceutical compositions may be in the form of a solution, suspension, tablet, capsule, lyophilized powder or the like, prepared according to methods well known in the art. It is also contemplated that administration of such compositions will be chiefly by the parenteral route although oral or inhalation routes may also be used depending upon the needs of the artisan.

The invention further provides methods of detecting the level of gene expression of an IFN-v gene in a animal. Such methods may involve detection of IFN- v polypeptide or mRNA levels. Polypeptide levels may be quantified from a sample derived from the animal using an antibody, while mRNA levels may be quantitated using, for example, Northern blots, TR-PCR amplification, and DNA microarrays.

II. Definitions For convenience, certain terms employed in the specification, examples, and appended claims are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article, unless context clearly indicates otherwise. By way of example, "an element" means one element or more than one element.

The term "or" is used herein to mean, and is used interchangeably with, the term "and/or", unless context clearly indicates otherwise.

The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

The term "antibody" as used herein is intended to include whole antibodies, e.g., of any isotype (IgG, IgA, IgM, IgE, etc), and includes fragments thereof which are also specifically reactive with a vertebrate, e.g., mammalian, protein. Antibodies can be fragmented using conventional techniques and the fragments screened for utility and/or interaction with a specific epitope of interest. Thus, the term includes segments of proteolytically-cleaved or recombinantly-prepared portions of an antibody molecule that are capable of selectively reacting with a certain protein. Non-limiting examples of such proteolytic and/or recombinant fragments include Fab, F(ab')2, Fab' , Fv, and single chain antibodies (scFv) containing a V[L] and/or V[H] domain joined by a peptide linker. The scFv's may be covalently or non-covalently linked to form antibodies having two or more binding sites. The term antibody also includes polyclonal, monoclonal, or other purified preparations of antibodies and recombinant antibodies.

A "chimeric polypeptide" or "fusion polypeptide" is a fusion of a first amino acid sequence with a second amino acid sequence where the first and second amino acid sequences are not naturally present in a single polypeptide chain.

The term "detection", in addition to art-recognized meanings, is intended to refer to any process of observing a marker, in a biological sample, whether or not the marker is actually detected. In other words, the act of probing a sample for a marker is a "detection" even if the marker is determined to be not present or below the level of sensitivity. Detection may be a quantitative, semi-quantitative or non-quantitative observation.

An "expression construct" is any recombinant nucleic acid that includes an expressible nucleic acid and regulatory elements sufficient to mediate expression in a suitable host cell. For example, an expression construct may contain a promoter or other RNA polymerase contact site, a transcription start site or a transcription termination sequence. An expression construct for production of a protein may contain, for example a translation start site, such as an ATG codon, a ribosome binding site, such as a Shine- Dalgarno sequence, or a translation stop codon.

The term "isolated" as used in reference to nucleic acids or polypeptides indicates a nucleic acid or polypeptide, such as an IFN-v nucleic acid or polypeptide, that is removed from its natural context. For example, an "isolated" polypeptide may be substantially free of other proteins that are normally associated with it. As another example, an "isolated" nucleic acid may be removed from its normal genomic context and recombined with other nucleic acids, such as a cloning vector.

A "knock-out" of a gene means an alteration in the sequence of the gene that results in a decrease of function of the target gene, preferably such that target gene expression is undetectable or insignificant. For example, a knock-out of an endogenous IFN-v gene means that function of the endogenous IFN-v gene has been substantially decreased. "Knock-out" transgenics can be transgenic animals having a heterozygous knock-out of the IFN-v gene or a homozygous knock-out of the IFN-v gene. "Knock-outs" also include conditional knock-outs, where alteration of the target gene can occur upon, for example, exposure of the animal to a substance that promotes target gene alteration, introduction of an enzyme that promotes recombination at the target gene site (e.g., Cre in the Cre-lox system), or other method for directing the target gene alteration postnatally.

A "knock-in" of a target gene means an alteration in a host cell genome that results in altered expression (e.g., increased (including ectopic) or decreased) of the target gene, e.g., by introduction of an additional copy of the target gene, or by operatively inserting a regulatory sequence that provides for enhanced expression of an endogenous copy of the target gene. "Knock-in" transgenics of interest for the present invention can be transgenic animals having a knock-in of the animal's endogenous IFN-v. Such transgenics can be heterozygous knock-in for the IFN-v gene, homozygous for the knock-in of the IFN-v gene. "Knock-ins" also encompass conditional knock-ins.

The term "nucleic acid" includes, in addition to any art recognized meaning, polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.

The terms "polypeptide" and "protein" are used interchangeably herein. The term "purified protein" refers to a preparation of a protein or proteins which are preferably isolated from, or otherwise substantially free of, other proteins normally associated with the protein(s) in a cell or cell lysate. The term "substantially free of other cellular proteins" (also referred to herein as "substantially free of other contaminating proteins") is defined as encompassing individual preparations of each of the component proteins comprising less than 20% (by dry weight) contaminating protein, and preferably comprises less than 5% contaminating protein. Functional forms of each of the component proteins can be prepared as purified preparations by using a cloned gene as described in the attached examples. By "purified", it is meant, when referring to component protein preparations used to generate a reconstituted protein mixture, that the indicated molecule is present in the substantial absence of other biological macromolecules, such as other proteins ^' (particularly other proteins which may substantially mask, diminish, confuse or alter the characteristics of the component proteins either as purified preparations or in their function in the subject reconstituted mixture). The term "purified" as used herein preferably means at least 80% by dry weight, more preferably in the range of 85% by weight, more preferably 95-99% by weight, and most preferably at least 99.8% by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 5000, can be present). The term "pure" as used herein preferably has the same numerical limits as "purified" immediately above.

The term "recombinant" as used in reference to a nucleic acid indicates any nucleic acid that is positioned adjacent to one or more nucleic acid sequences that it is not found adjacent to in nature. A recombinant nucleic acid may be generated in vitro, for example by using the methods of molecular biology, or in vivo, for example by insertion of a nucleic acid at a novel chromosomal location by homologous or non-homologous recombination. The term "recombinant" as used in reference to a polypeptide indicates any polypeptide that is produced by expression and translation of a recombinant nucleic acid. The term "transgene" is used herein to describe genetic material which has been or is about to be artificially inserted into the genome of an animal, particularly a mammalian cell of a living animal.

By "transgenic animal" is meant a non-human animal, usually a mammal (e.g., mouse, rat, rabbit, hamster, etc.), having a non-endogenous nucleic acid sequence present as an extrachromosomal element in a portion of its cells or stably integrated into its germ line

DNA (i.e., in the genomic sequence of most or all of its cells). Heterologous nucleic acid is introduced into the germ line of such transgenic animals by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal.

As used herein, the term "PEG moiety" is intended to include, but is not limited to, linear and branched PEG, methoxy PEG, hydrolytically or enzymatically degradable PEG, pendant PEG, dendrimer PEG, copolymers of PEG and one or more polyols, and copolymers of PEG and PLGA (poly(lactic/glycolic acid)). According to the present invention, the term polyethylene glycol or PEG is meant to comprise native PEG as well as derivatives thereof. "Tumor", as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.

The teπns "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, ovarian cancer, cervical cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, liver cancer, bladder cancer, hepatoma, colorectal cancer, endometrial carcinoma, salivary gland carcinoma, kidney cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer. "Treatment" is an intervention performed with the intention of preventing the development or altering the pathology of a disorder. Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. In tumor (e.g. cancer) treatment, a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to treatment by other therapeutic agents, e.g. radiation and/or chemotherapy. Similarly, in the treatment of virus infections, the therapeutic agent may treat the infection directly, or increase the efficacy of other antiviral treatments, e.g. by upregulating the immune system of the patient. "Chronic" administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial biological effect for an extended period of time.

A "therapeutically effective amount", in reference to the treatment of tumor, refers to an amount capable of invoking one or more of the following effects: (1) inhibition, to some extent, of tumor growth, including, slowing down and complete growth arrest; (2) reduction in the number of tumor cells; (3) reduction in tumor size; (4) inhibition (i.e., reduction, slowing down or complete stopping) of tumor cell infiltration into peripheral organs; (5) inhibition (i.e., reduction, slowing down or complete stopping) of metastasis; (6) enhancement of anti-tumor immune response, which may, but does not have to, result in the regression or rejection of the tumor; and/or (7) relief, to some extent, of one or more symptoms associated with the disorder.

A "therapeutically effective amount" in the context of antiviral activity is an amount capable of invoking one or more of the following effects: (1) at least partial killing of the virus causing the infection; (2) enhancement of anti-viral immune response; (3) relief, to some extent, of one or more symptoms associated with the disorder.

"Carriers" as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN™, polyethylene glycol (PEG), and PLURONICS™.

Administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order. The term "antagonist" is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native interferon polypeptide disclosed herein. In a similar manner, the teπn "agonist" is used in the broadest sense and includes any molecule that mimics a biological activity of a native interferon polypeptide disclosed herein. A "small molecule" is defined herein to have a molecular weight below about 1000

Daltons, preferably below 500 Daltons.

By a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably about 30-70 (e.g., 50) nucleotides of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.

"Stringent hybridization conditions" refer to overnight incubation at 42°C. in a solution comprising: 50% formamide, 5xSSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0. IxSSC at about

65°C.

A "mature protein" is a protein that is produced by cellular processing of a primary translation product of a DNA sequence. Such processing may include removal of a secretory signal peptide, sometimes in combination with a propeptide. Mature sequences can be predicted from full-length sequences using methods known in the art for predicting cleavage sites (see, for example, von Heijne Nuc. Acids Res. 14:4683, 1986; Bendtsen et al. JMo/

Biol. 2004 JuI 16;340(4):783-95; Hiller et al, Nucleic Acids Res. 2004 JuI l;32(Web Server issue):W375-9). The sequence of a mature protein can be determined experimentally by expressing a DNA sequence of interest in an eukaryotic host cell and determining the amino acid sequence of the final product. For proteins lacking secretory peptides, the primary translation product will be the mature protein.

The teπns "microarray," "GeneChip," "genome chip," and "biochip," as used herein refer to an ordered arrangement of hybridizeable array elements. The array elements are arranged so that there are preferably at least one or more different array elements on a substrate surface, such as paper, nylon or other type of membrane, filter, chip, glass slide, or any other suitable solid support. The hybridization signal from each of the array elements is individually distinguishable.

III. Nucleic Acids

The present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of a polypeptide having an amino acid sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. Thus, one aspect of the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding a polypeptide including an amino acid sequence in at least one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71; (b) a nucleotide sequence encoding a biologically active fragment of a polypeptide shown in at least one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71; and (c) a nucleotide sequence complementary to at least one of any of the nucleotide sequences in (a) or (b) above. In some embodiments, the polypeptide is one of the interferon polypeptides set forth in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71. In one preferred embodiment, the polypeptide is one of the IFN-v polypeptides whose amino acid sequence is set forth in SEQ ID NOS: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71.

One aspect of the invention provides an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to at least 10, 12, 14, 16, 20, 22, 24, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 contiguous amino acids of one of the sequences set forth in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49 or 71. In one embodiment, the polypeptide has an amino acid sequence that is at least 80-100% identical to a portion an interferon polypeptide having a sequence set forth in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, or to a portion of an IFN-v having a sequence set forth in SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 or 71. In one embodiment, the interferon polypeptide, such as the IFN-v polypeptide, is a mature protein. In another embodiment, the IFN polypeptide does not comprise a signal sequence. In certain aspects the invention provides isolated and/or recombinant nucleic acids encoding interferon polypeptides, interferon receptor polypeptides, interleukin polypeptides and interleukin receptor polypeptides, such as, for example, SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70. Nucleic acids of the invention are further understood to include nucleic acids that comprise variants of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70. Variant nucleotide sequences include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants; and will, therefore, include coding sequences that differ from the nucleotide sequence of the coding sequence designated in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70, e.g. due to the degeneracy of the genetic code. For example, nucleic acids encoding interleukin/interferon polypeptide, receptor, or fragments thereof, may be nucleic acids comprising a sequence that is at least 85%, 90%, 95%, 99% or 10% identical to a sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70 or a sequence that encodes the polypeptide of any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. In other embodiments, variants will also include sequences that will hybridize under stringent hybridization conditions to a coding sequence of a nucleic acid sequence designated in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70.

One aspect of the invention provides nucleic acid fragments comprising sequences identical to a fragment of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70. In one embodiment, such fragment is at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably, at least about 40 nucleotides in length which are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-300 nucleotides in length are also useful according to the present invention as are fragments corresponding to most, if not all, of at least one of the nucleotide sequences shown in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70. Another aspect of the invention provides isolated polypeptides encoded by these nucleic acids.

Isolated nucleic acids which differ from the sequences set forth in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70 due to degeneracy in the genetic code are also within the scope of the invention. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC are synonyms for histidine) may result in "silent" mutations which do not affect the amino acid sequence of the protein. One skilled in the art will appreciate that these variations in one or more nucleotides of the nucleic acids encoding a particular protein may exist among individuals of a given species due to natural allelic variation. Any and all such nucleotide variations and resulting amino acid polymorphisms are within the scope of this invention.

Optionally, a nucleic acid of the invention encoding an interleukin/interferon polypeptide, receptor, or fragments thereof, will genetically complement a partial or complete loss of function phenotype in the corresponding gene. For example, an IFN- v nucleic acid of the invention may be expressed in a cell in which endogenous IFN- v has been knocked out, and the introduced IFN-v nucleic acid will mitigate a phenotype resulting from the knockout.

In certain aspects, nucleic acids encoding interleukin/interferon polypeptides, receptors, or fragments thereof, and variants thereof may be used to increase expression of the gene in an organism or cell by direct delivery of the nucleic acid. A nucleic acid therapy construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which encodes an interleukin/interferon polypeptide, receptor, or fragments thereof. In another aspect, nucleic acid encoding an interleukin/interferon polypeptide, receptor, fragment thereof, or variants thereof, may be used to decrease gene expression. Such a nucleic acid therapy construct can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes an interleuldn/interferon polypeptide or receptor. Alternatively, the construct is an oligonucleotide which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences encoding the interleukin/interferon polypeptide or receptor. Such oligonucleotide probes are optionally modified oligonucleotide which are resistant to endogenous nucleases, e.g. exonucleases and/or endonucleases, and is therefore stable in vivo. Exemplary nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patents 5,176,996; 5,264,564; and 5,256,775). Additionally, general approaches to constructing oligomers useful in nucleic acid therapy have been reviewed, for example, by van der Krol et al., (1988) Biotechniques 6:958-976; and Stein et al., (1988) Cancer Res 48:2659-2668. Another aspect of the invention relates to the use of KNA interference (RNAi) to effect knockdown of the mterleukin/interferon polypeptide and receptor genes described herein. RNAi constructs comprise double stranded RNA that can specifically block expression of a target gene. "RNA interference" or "RNAi" is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner. Without being bound by theory, RNAi appears to involve mRNA degradation, however the biochemical mechanisms are currently an active area of research. RNAi constructs can comprise either long stretches of double stranded RNA identical or substantially identical to the target nucleic acid sequence or short stretches of double stranded RNA identical to substantially identical to only a region of the target nucleic acid sequence. Exemplary methods of making and delivering either long or short RNAi constructs can be found, for example, in WO01/68836 and WOO 1/75164.

Ribozyme molecules designed to catalytically cleave an mRNA transcript can also be used to prevent translation of mRNA (See, e.g., PCT International Publication

WO90/11364, published October 4, 1990; Sarver et al., 1990, Science 247: 1222-1225 and U.S. Patent No. 5,093,246). While ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy particular mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988, Nature, 334:585-591. The ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes") such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-578; Zaug and Cech, 1986, Science, 231:470-475; Zaug, et al., 1986, Nature, 324:429-433; published International patent application No. WO88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47:207-216). The Cech-type ribozymes have an eight base pair active site that hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech- type ribozymes that target eight base-pair active site sequences.

As in the antisense approach, the ribozymes can be composed of modified oligonucleotides (e.g., for improved stability, targeting, etc.) and can be delivered to cells in vitro or in vivo. A preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy targeted messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency. A further aspect of the invention relates to the use of DNA enzymes to inhibit expression of the interleukin/interferon polypeptide and receptor genes described herein. DNA enzymes incorporate some of the mechanistic features of both antisense and ribozyme technologies. DNA enzymes are designed so that they recognize a particular target nucleic acid sequence, much like an antisense oligonucleotide. But much like a ribozyme they are catalytic and specifically cleave the target nucleic acid.

Briefly, to design an ideal DNA enzyme that specifically recognizes and cleaves a target nucleic acid, one of skill in the art must first identify the unique target sequence. Preferably, the unique or substantially unique sequence is a G/C rich of approximately 18 to 22 nucleotides. High G/C content helps insure a stronger interaction between the DNA enzyme and the target sequence. When synthesizing the DNA enzyme, the specific antisense recognition sequence that will target the enzyme to the message is divided so that it comprises the two arms of the DNA enzyme, and the DNA enzyme loop is placed between the two specific arms.

Methods of making and administering DNA enzymes can be found, for example, in U.S. Patent No. 6,110,462. Additionally, one of sldll in the art will recognize that, like antisense oligonucleotide, DNA enzymes can be optionally modified to improve stability and improve resistance to degradation.

Accordingly, the modified oligomers of the invention are useful in therapeutic, diagnostic, and research contexts. In therapeutic applications, the oligomers are utilized in a manner appropriate for nucleic acid therapy in general.

In addition to use in therapy, the oligomers of the invention may be used as diagnostic reagents to detect the presence or absence of the interleukin/interferon gene and receptor gene DNA or RNA sequences, such as for determining the level of expression of the gene or for determining whether the gene of the invention contains a genetic lesion. In another aspect of the invention, the subject nucleic acid is provided in an expression vector comprising a nucleotide sequence encoding a subject interleukin/interferon polypeptide, receptor, or fragment thereof, operably linked to at least one regulatory sequence. Regulatory sequences are art-recognized and are selected to direct expression of the polypeptide, or fragment. Accordingly, the term regulatory sequence includes promoters, enhancers and other expression control elements. Exemplary regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, CA (1990). For instance, any of a wide variety of expression control sequences that control the expression of a DNA sequence when operatively linked to it may be used in these vectors to express DNA sequences encoding an interleukin/interferon polypeptide, receptor, or fragment thereof. Such useful expression control sequences, include, for example, the early and late promoters of SV40, tet promoter, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast α-mating factors, the polyhedron promoter of the baculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. Moreover, the vector's copy number, the ability to control that copy number and the expression of any other protein encoded by the vector, such as antibiotic markers, should also be considered.

As will be apparent, the subject gene constructs can be used to cause expression of the subject polypeptides in cells propagated in culture, e.g. to produce proteins or polypeptides, including fusion proteins or polypeptides, for purification.

The nucleic acids provided by the invention may be used as probes. Probes may also be employed in PCR techniques to generate a pool of sequences for identification of closely related interleukin or interferon sequences, such as IFN-v sequences. Nucleotide sequences encoding the interleukin and interferon polypeptides described herein can also be used to construct hybridization probes for mapping the gene which encodes the interleukin/interferon and for the genetic analysis of individuals with genetic disorders. The nucleotide sequences provided herein may be mapped to a chromosome and specific regions of a chromosome using known techniques, such as in situ hybridization, linkage analysis against known chromosomal markers, and hybridization screening with libraries.

Nucleotide sequences (or their complement) encoding interferons, including IFN-v, have various applications in the art of molecular biology, including uses as hybridization probes, in chromosome and gene mapping and in the generation of anti-sense RNA and DNA. IFN-encoding nucleic acids will also be useful for the preparation of IFN polypeptides by the recombinant techniques described herein.

The full-length native sequence gene encoding IFN-v, or portions thereof, may be used as hybridization probes for a cDNA library to isolate the full-length gene or to isolate still other genes (for instance, those encoding naturally-occurring variants of IFN-v from other species) which have a desired sequence identity to the IFN-v sequence disclosed in SEQ ID NOs: 4 or 26. Optionally, the length of the probes will be about 20 to about 50 bases. The hybridization probes may be derived from the nucleotide sequence of SEQ ID NOs: 4 or 26 or from genomic sequences including promoters, enhancer elements and introns of native sequence IFN-v. By way of example, a screening method will comprise isolating the coding region of the IFN-v gene using the known DNA sequence to synthesize a selected probe of about 40 bases. Hybridization probes may be labeled by a variety of labels, including radionucleotides such as ³²P or ³⁵S, or enzymatic labels such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems. Labeled probes having a sequence complementary to that of the IFN-v gene of the present invention can be used to screen libraries of human cDNA, genomic DNA or mRNA to determine which members of such libraries the probe hybridizes to.

Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); by the homology alignment algorithm of Needleman and Wunsch, J. MoI Biol. 48: 443 (1970); by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. 8: 2444 (1988); by computerized implementations of these algorithms, including, but not limited to: CLUSTAL in the PC/Gene program by lntelligenetics, Mountain View, Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 7 Science Dr., Madison, Wis., USA; the CLUSTAL program is well described by Higgins and Sharp, Gene, 73: 237-244, 1988; Higgins and Sharp, CABIOS :11-13, 1989; Corpet, et al., Nucleic Acids Research, 16:881-90,1988; Huang, et al., Computer Applications in the Biosciences 8:1-7,1992; and Pearson, et al., Methods in Molecular Biology 24:7-331,1994. The BLAST family of programs which can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York, 1995. New versions of the above programs or new programs altogether will undoubtedly become available in the future, and can be used with the present invention.

IV. Proteins

In certain aspects, the invention provides interleukin/interferon polypeptides, receptors, or fragments thereof, of various mammals and nonmammal organisms, and functional variants thereof. Preferred functional variants of interleukin/interferon polypeptides and receptors, are those that have immunomodulatory, antiviral and/or antiproliferative activity. In certain aspects, the present invention includes the full-length interleukin/interferon protein and variants of these proteins, which include biologically- active fragments of the proteins and fusion proteins including at least a portion of the interleuldn/interferon polypeptides. These include proteins with antiviral and/or antiproliferative activity that have amino acid substitutions or have sugars or other molecules attached to amino acid functional groups. The term "variants" also encompasses homologous genes of xenogenic origin. Typically, IFN variants will retain all, a substantial proportion, or at least partial biological activity as, for example, can be determined using the interferon bioassays provided herein.

In certain aspects, the present disclosure makes available isolated and/or purified foπns of interleukin/interferon polypeptides and receptors, which are isolated from, or otherwise substantially free of, other proteins which might normally be associated with the protein or a particular complex including the protein. In certain embodiments, an interleukin/interferon polypeptide or receptor, is any polypeptide having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identity to an amino acid sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. In certain embodiments, the invention provides an interferon polypeptide having an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to the amino acid sequence selected from SEQ K) NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, or to the mature foπns of these IFN polypeptides, hi certain embodiments, the invention provides an interferon polypeptide having an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to the amino acid sequence selected from SEQ DD NO: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71, or to the mature forms of these IFN polypeptides, m some embodiments, the invention provides polypeptides identical to either to full-length or the mature forms of the interferons of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, wherein at least 1, 2, 3, 4 or 5 cysteine residues are replaced with another residue, preferably a serine residue. Other preferred residues with which the cysteine may substituted include alanine and threonine.

The invention provides polypeptides having signal peptides and polypeptides having them. Signal peptides are normally cleaved from proteins post-translationally such that they are absent from the mature for of the protein. For example, the sequence of human IFN-v is provided in SEQ ID:3, but the mature form starts at cysteine 24. Likewise, sequence 25 sets forth the amino acid sequence of full-length feline IFN-v, while the mature foπn of the protein begins at cysteine 24. Accordingly, one aspect of the invention provides the mature forms of the IFN polypeptides set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, and variants thereof. In certain embodiments, an interleulcin/interferon polypeptide or receptor is a polypeptide comprising a portion of an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to the amino acid sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, or to the mature forms of these IFN polypeptides, wherein said portion is a functional portion, such as a portion that retains a substantial anti-viral or anti- proliferative activity. By substantial activity, it is meant that the portion of the polypeptide retains, on a molar basis, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of the antiviral or antiproliferative of the mature protein. In certain related embodiments, the present invention also includes fragments of the full-length IFN polypeptides of SEQ ID NOs:l, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71. In one embodiment, the fragments are N- or C-terminal fragments, preferably fragments having anti-viral activity or antiproliferative or immunomodulatory activity or combinations thereof. An terminal fragment of feline IFN-v, for example, retains both viral activity or anti-proliferative activity.

The invention further provides interleulcin/interferon polypeptides, obtained when a nucleic acid comprising a nucleic acid sequence at least 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71 is expressed in cell. In one embodiment, the cell is a mammalian cell. In certain embodiments, the interleulcin/interferon polypeptide or receptor is purified or partially purified. Optionally, an interleulcin/interferon polypeptide or receptor of the invention will function in place of an endogenous interleukin/interferon polypeptide or receptor, for example, by mitigating a partial or complete loss of function phenotype in a cell. In an exemplary embodiment, an interleukin/interferon polypeptide or receptor may be produced in a cell in which the endogenous interleukin/interferon polypeptide or receptor has been reduced, and the introduced interleukin/interferon polypeptide or receptor will mitigate a phenotype resulting from the reduction in endogenous expression.

In another aspect, the invention provides polypeptides that are agonists or antagonists of an interleukin/interferon polypeptide or receptor. Variants of an interleukin/interferon polypeptide or receptor may have a hyperactive or constitutive activity, or, alternatively, act to prevent the interleukin/interferon polypeptide or receptor from perfoπning one or more functions. For example, a truncated form lacking one or more domain may have a dominant negative effect.

Another aspect of the invention relates to polypeptides derived from a full-length interleulάn/interferon polypeptide or receptor. Isolated peptidyl portions of the subject proteins can be obtained by screening polypeptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such polypeptides. In addition, fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry. For example, any one of the subject proteins can be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length. The fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments which can function as either agonists or antagonists of an interleukin/interferon polypeptide or receptor.

It is also possible to modify the structure of the subject interleukin/interferon polypeptides for such purposes as enhancing therapeutic or prophylactic efficacy, or stability (e.g., ex vivo shelf life and resistance to proteolytic degradation in vivo). Such modified polypeptides, when designed to retain at least one activity of the naturally- occurring form of the protein, are considered functional equivalents of the interleukin/interferon polypeptides described in more detail herein. Such modified polypeptides can be produced, for instance, by amino acid substitution, deletion, or addition. For instance, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, cysteine with a serine, or a similar replacement of an amino acid with a structurally related amino acid (i.e. conservative mutations) will not have a major effect on the biological activity of the resulting molecule. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are can be divided into four families: (1) acidic = aspartate, glutamate; (2) basic = lysine, arginine, histidine; (3) nonpolar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. In similar fashion, the amino acid repertoire can be grouped as (1) acidic = aspartate, glutamate; (2) basic = lysine, arginine histidine, (3) aliphatic = glycine, alanine, valine, leucine, isoleucine, serine, threonine, with serine and threonine optionally be grouped separately as aliphatic-hydroxyl; (4) aromatic = phenylalanine, tyrosine, tryptophan; (5) amide = asparagine, glutamine; and (6) sulfur - containing = cysteine and methionine, (see, for example, Biochemistry, 2nd ed., Ed. by L. Stryer, W.H. Freeman and Co., 1981). Whether a change in the amino acid sequence of a polypeptide results in a functional homolog can be readily determined by assessing the ability of the variant polypeptide to produce a response in cells in a fashion similar to the wild-type protein. For instance, such variant forms of an interleukin/interferon polypeptides can be assessed, e.g., for their ability to modulate viral infection of proliferation, as described in the exampled, for their ability to bind to another polypeptide, e.g., another interleukin/interferon polypeptide or receptor.

Polypeptides in which more than one replacement has taken place can readily be tested in the same manner. This invention further contemplates a method of generating sets of combinatorial mutants of the interleukin/interferon polypeptides, as well as truncation mutants, and is especially useful for identifying potential variant sequences (e.g. homologs) that are functional in binding to an interleukin/interferon receptor. The purpose of screening such combinatorial libraries may be to generate, for example, IFN-v homologs which can act as either agonists or antagonist, or alternatively, which possess novel activities all together. Combinatorially-derived homologs can be generated which have a selective potency relative to a naturally occurring interleukin/interferon polypeptide. Such proteins, when expressed from recombinant DNA constructs, can be used in gene therapy protocols. Likewise, mutagenesis can give rise to variants which have intracellular half-lives dramatically different than the corresponding wild-type protein. For example, the altered protein can be rendered either more stable or less stable to proteolytic degradation or other cellular process which result in destruction of, or otherwise inactivation of the interleukin/interferon polypeptide or receptor of interest. Such variants, and the genes which encode them, can be utilized to alter interleukin/interferon levels by modulating the half-life of the protein. For instance, a short half-life can give rise to more transient biological effects and, when part of an inducible expression system, can allow tighter control of recombinant interleukin/interferon production within the cell. As above, such proteins, and particularly their recombinant nucleic acid constructs, can be used in gene therapy protocols. In similar fashion, interleukin/interferon homologs can be generated by the present combinatorial approach to act as antagonists, in that they are able to interfere with the ability of the corresponding wild-type protein to function. In a representative embodiment of this method, the amino acid sequences for a population of interleukin/interferon homologs are aligned, preferably to promote the highest homology possible. Such a population of variants can include, for example, homologs from one or more species, or homologs from the same species but which differ due to mutation. Amino acids which appear at each position of the aligned sequences may be selected to create a degenerate set of combinatorial sequences. In a preferred embodiment, the combinatorial library is produced by way of a degenerate library of genes encoding a library of polypeptides which each include at least a portion of potential interleukin/interferon sequences. For instance, a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential interleukin/interferon nucleotide sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g. for phage display).

There are many ways by which the library of potential homologs can be generated from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic genes then be ligated into an appropriate gene for expression. The purpose of a degenerate set of genes is to provide, in one mixture, all of the sequences encoding the desired set of potential interleukin/interferon sequences. The synthesis of degenerate oligonucleotides is well known in the art (see for example, Narang, SA (1983) Tetrahedron 39:3; Itakura et al.,

(1981) Recombinant DNA, Proc. 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp273-289; Itakura et al., (1984) Annu. Rev. Biochem. 53:323; Itakura et al., (1984) Science 198:1056; Ike et al., (1983) Nucleic Acid Res. 11:477). Such techniques have been employed in the directed evolution of other proteins (see, for example, Scott et al., (1990) Science 249:386-390; Roberts et al., (1992) PNAS USA 89:2429-2433; Devlin et al., (1990) Science 249: 404-406; Cwirla et al., (1990) PNAS USA 87: 6378-6382; as well as U.S. Patent NOs: 5,223,409, 5,198,346, and 5,096,815).

Alternatively, other forms of mutagenesis can be utilized to generate a combinatorial library. For example, interleukin/interferon variants (both agonist and antagonist forms) can be generated and isolated from a library by screening using, for example, alanine scanning mutagenesis and the like (Ruf et al., (1994) Biochemistry 33:1565-1572; Wang et al., (1994) J. Biol. Chem. 269:3095-3099; Balint et al., (1993) Gene 137:109-118; Grodberg et al., (1993) Eur. J. Biochem. 218:597-601; Nagashima et al., (1993) J. Biol. Chem. 268:2888-2892; Lowman et al., (1991) Biochemistry 30:10832- 10838; and Cunningham et al., (1989) Science 244: 1081-1085), by linker scanning mutagenesis (Gustin et al., (1993) Virology 193:653-660; Brown et al., (1992) MoI. Cell Biol. 12:2644-2652; McKnight et al., (1982) Science 232:316); by saturation mutagenesis (Meyers et al., (1986) Science 232:613); by PCR mutagenesis (Leung et al., (1989) Method Cell MoI Biol 1:11-19); or by random mutagenesis, including chemical mutagenesis, etc. (Miller et al., (1992) A Short Course in Bacterial Genetics, CSHL Press, Cold Spring

Harbor, NY; and Greener et al., (1994) Strategies in MoI Biol 7:32-34). Linker scanning mutagenesis, particularly in a combinatorial setting, is an attractive method for identifying truncated (bioactive) forms of interleukin/interferon polypeptides or receptors.

A wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations and truncations, and, for that matter, for screening cDNA libraries for gene products having a certain property. Such techniques will be generally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of interleukin/interferon variants. The most widely used techniques for screening large gene libraries typically comprises cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected. Each of the illustrative assays described below are amenable to high throughput analysis as necessary to screen large numbers of degenerate sequences created by combinatorial mutagenesis techniques.

In an illustrative embodiment of a screening assay, candidate combinatorial gene products of one of the subject proteins are displayed on the surface of a cell or virus, and the ability of particular cells or viral particles to bind an interleukin/interferon polypeptide or receptor is detected in a "panning assay". For instance, a library of interleukin/interferon variants can be cloned into the gene for a surface membrane protein of a bacterial cell (Ladner et al., WO 88/06630; Fuchs et al., (1991) Bio/Technology 9:1370-1371; and Goward et al., (1992) TIBS 18:136-140), and the resulting fusion protein detected by panning, e.g. using a fluorescently labeled molecule which binds the interleukin/interferon polypeptide, to score for potentially functional homologs. Cells can be visually inspected and separated under a fluorescence microscope, or, where the morphology of the cell permits, separated by a fluorescence-activated cell sorter.

In similar fashion, the gene library can be expressed as a fusion protein on the surface of a viral particle. For instance, in the filamentous phage system, foreign peptide sequences can be expressed on the surface of infectious phage, thereby conferring two significant benefits. First, since these phage can be applied to affinity matrices at very high concentrations, a large number of phage can be screened at one time. Second, since each infectious phage displays the combinatorial gene product on its surface, if a particular phage is recovered from an affinity matrix in low yield, the phage can be amplified by another round of infection. The group of almost identical E, coli filamentous phages Ml 3, fd, and fl are most often used in phage display libraries, as either of the phage gill or gVIII coat proteins can be used to generate fusion proteins without disrupting the ultimate packaging of the viral particle (Ladner et al., PCT publication WO 90/02909; Garrard et al., PCT publication WO 92/09690; Marks et al., (1992) J. Biol. Chem. 267:16007-16010; Griffiths et al., (1993) EMBO J. 12:725-734; Clackson et al., (1991) Nature 352:624-628; and Barbas et al., (1992) PNAS USA 89:4457-4461).

In certain embodiments, the invention also provides for reduction of the subject interleukin/interferon polypeptide or receptor to generate mimetics, e.g. peptide or non- peptide agents, which are able to mimic binding of the authentic protein to another cellular partner. Such mutagenic techniques as described above, as well as the thioredoxin system, are also particularly useful for mapping the determinants of an interleuldn/interferon polypeptides which participate in protein-protein interactions involved in, for example, binding to their respective receptors. To illustrate, the critical residues of an interleukin/interferon polypeptide which are involved in binding to its receptor can be determined and used to generate interleuldn/interferon peptidomimetics which bind to the receptor, and by inhibiting interleukin/interferon binding, act to inhibit its biological activity. By employing, for example, scanning mutagenesis to map the amino acid residues of an interleukin/interferon polypeptide which are involved in binding to the receptor, peptidomimetic compounds can be generated which mimic those residues involved in binding. For instance, non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine (e.g., see Freidinger et al., in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al., in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gamma lactam rings (Garvey et al., in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), keto- methylene pseudopeptides (Ewenson et al., (1986) J. Med. Chem. 29:295; and Ewenson et al., in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), b-turn dipeptide cores (Nagai et al., (1985) Tetrahedron Lett 26:647; and Sato et al., (1986) J Chem Soc Perlcin Trans 1:1231), and b-aminoalcohols (Gordon et al., (1985) Biochem Biophys Res Commun 126:419; and Dann et al., (1986) Biochem Biophys Res Commun 134:71).

The subject polypeptides may further comprise post-translational or non-amino acid elements, such as hydrophobic modifications (e.g. polyethylene glycols or lipids), poly- or mono-saccharide modifications, phosphates, acetylations, etc. Effects of such elements on the functionality of an interleulάn/interferon polypeptide may be tested as described herein for other polypeptide variants.

Covalent modifications of IFNs, such as IFN-v, are included within the scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of the IFN polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C-terminal residues of IFN. Derivatization with bifunctional agents is useful, for instance, for crosslinking IFN to a water-insoluble support matrix or surface for use in the method for purifying anti-IFN antibodies, and vice-versa. Commonly used crosslinking agents include e.g., l,l-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'- dithiobis(succinimidylpropionate), bifunctional maleimides such as bis-N-maleimido-1,8- octane and agents such as methyl-3-[(p-azidophenyl)dithio]propioimidate. Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains [T. E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.

Another type of covalent modification of the IFN polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence IFN, and/or adding one or more glycosylation sites that are not present in the native sequence IFN, and/or altering the nature (profile) of the sugar moieties attached to the polypeptide at various glycosylation sites. Addition of glycosylation sites to the IFN polypeptides may be accomplished by altering the amino acid sequence. The alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence IFN (for O-linked glycosylation sites). The IFN amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the IFN polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids. Another means of increasing the number of carbohydrate moieties on the IFN polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO 87/05330 published Sep. 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).

Removal of carbohydrate moieties present on the IFN polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem., 118:131 (1981).

Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al., Meth. Enzymol., 138:350 (1987).

The IFN molecules of the present invention may also be modified in a way to form a chimeric molecule comprising an IFN fused to another, heterologous polypeptide or amino acid sequence. Different elements of fusion proteins may be arranged in any manner that is consistent with the desired functionality. For example, an IFN-v may be placed C-terminal to a heterologous domain, or, alternatively, a heterologous domain may be placed C- terminal to a IFN-v. The IFN-v and the heterologous domain need not be adjacent in a fusion protein, and additional domains or amino acid sequences may be included C- or N- terminal to either domain or between the domains.

In one embodiment, such a chimeric molecule comprises a fusion of the IFN with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the amino- or carboxyl-terminus of the IFN. The presence of such epitope-tagged forms of the IFN can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the IFN to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag.

Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et al., MoI. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include the Flag-peptide [Hopp et al., BioTechnology,

6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al., Science, 255:192-194 (1992)]; an α-rubulin epitope peptide [Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393-6397 (1990)]. Techniques for making fusion genes are well known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene^' fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons;. 1992).

The invention further provides chimeric proteins generated from an IFN-v polypeptide and a second interferon polypeptide. Such chimeric interferons may contain, for example, an N-terminal portion of an INF-v polypeptide and a C-terminal polypeptide from another IFN polypeptide, such as an IFN-a, β, etc. In one embodiment, the hybrid interferon contains two or more segments of IFN-v. U.S. Patent No. 6,174,996 illustrates how hybrid interferons may be generated.

In another embodiment, the chimeric molecule may comprise a fusion of the IFN with an immunoglobulin or a particular region of an immunoglobulin. An immunoglobulin element may be any portion of an immunoglobulin. In certain embodiments, the immunoglobulin element comprises one or more domains of an IgG heavy chain. For example, an immunoglobulin element may comprise a heavy chain or a portion thereof from an IgG, IgD, IgA or IgM. Immunoglobulin heavy chain constant region domains include CHl, CH2, CH3, and CH4 of any class of immunoglobulin heavy chain including gamma, alpha, epsilon, mu, and delta classes. Immunoglobulin variable regions include VH, Vkappa, or Vgamma. An Fc portion is a commonly used immunoglobulin element. For a bivalent form of the chimeric molecule, such a fusion could be to the Fc region of an IgG molecule, to form an "immunoadhesin". The fusion is preferably to a heavy chain constant region sequence, e.g., a hinge, CH2 and CH3 regions, or the CHl, hinge, CH2 and CH3 regions of an IgG immunoglobulin. Immunoadhesins are expected to have a longer half-life and/or slower clearance than the corresponding IFN polypeptide.

In certain embodiments, the subject polypeptides, such as the DMF-v polypeptides, are fused to a multimerization domain, such as a dimerization domain. Multimerization domains may be essentially any polypeptide that forms a dimer (or higher order complex, such as a trimer, tetramer, etc.) with another polypeptide. Optionally, the multimerization polypeptide associates with other, identical multimerization polypeptides, thereby forming homomultimers. An IgG Fc element is an example of a dimerizing domain that tends to form homomultimers. Optionally, the multimerizing polypeptide associates with other different multimerizing polypeptides, thereby forming heteromultimers. The Jun leucine zipper domain forms a dimer with the Fos leucine zipper domain, and is therefore an example of a dimerizing domain that tends to form heteromultimers. Multimerizing domains may form both hetero- and homomultimers.

Another type of covalent modification of IFN comprises linking the IFN polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337. For example, PEGylated variants are expected to have a longer half-life and/or shorter clearance than the corresponding, non- PEGylated IFN-v polypeptide. The polyol moiety in the polyol-IFN conjugate according to the present invention can be any water-soluble mono- or bifunctional poly(alkylene oxide) having a linear or branched chain. Typically, the polyol is a poly(alkylene glycol) such as poly(ethylene glycol) (PEG). However, those of skill in the art will recognize that other polyols, such as, for example poly(propylene glycol) and copolymers of polyethylene glycol and polypropylene glycol, can be suitably used. Methods of pegylating interferons are described, in U.S. Patent Pub. No. 2006/0029573 (also WO06004959). Exemplary formulations for pegylated interferons are described in U.S. Patent Pub. 2006/0051320. Other interferon conjugates can be prepared by coupling an interferon to a water- soluble polymer. A non-limiting list of such polymers include other polyalkylene oxide homopolymers such as polypropylene glycols, polyoxyethylenated polyols, copolymers thereof and block copolymers thereof. As an alternative to polyalkylene oxide-based polymers, effectively non-antigenic materials such as dextran, polyvinyl pyrrolidones, polyacrylamides, polyvinyl alcohols, carbohydrate-based polymers and the like can be used. Interferons tend to oligomerize when expressed recombinantly. It is believed, that certain oligomeric forms result from two or more interferon molecules becoming irreversibly associated with one another through intermolecular covalent bonding, such as by disulfide linkages. This problems has been observed particularly with respect to leukocyte and fibroblast interferons (See, e.g. U.S. Pat. No. 4,816,566). Accordingly, the invention includes variants of the interferons in which one or more cysteine residues are deleted or substituted by residues of other amino acids which are incapable of disulfide bond formation. Preferred variants substantially retain or mimic the biological activity of the IFN from which they are derived. For example, in feline IFN-v, cys-171 may be mutated to Ser- 171 while retaining activity. Cys-24, Cys-118 and Cys-171 may also be mutated in feline IFN-v to Ser-24, Ser-118 and Ser-171 in some embodiments. In human IFN-V, cys-29 and cys-179 may be mutated to serine residues. Modification of Cys-24, Cys-29, Cys-119 and Cys-179 to serine residues in human IFN-v results in a biologically activity polypeptide with antiproliferative activity and antiviral activity. Accordingly, the invention provides variants of the polypeptides set forth in SEQ K) NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, or their mature forms, where at least 1, 2, 3, 4, 5, 6,

7, 8, 9 or 10 cysteine residues are mutated to another residue, preferably a serine residue. The invention also fragments of at least 20, 30, 40, 50, 60, 70, 80, 90, 100 or 150 residues in length of the polypeptides having sequences set forth in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, where at least 1, 2, 3, 4, 5, 6, 7,

8, 9 or 10 cysteine residues are mutated to another residue, preferably a serine residue.

Another aspect of the invention provides mutant forms of the human IFN-P gene, where the internal stop codon at position 78 is substituted with an amino acid residue selected from Ala, GIy, Cys, Met, VaI, Ser, Thr, Leu, lie, Trp, Phe, Tyr, Lys, Arg, His, GIu, GIn, Asp and Asn. In one embodiment, the stop codon is replaced by a linker peptide, having 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25 or more amino acids in length. In yet another embodiment, the stop codon is deleted without replacement by another amino acid. In yet another embodiment, the stop codon is replaced with a non-naturally occurring amino acid or an amino acid analog, such as jS-cyanoalanine, canavanine, djenkolic acid, norleucine, 3- phosphoserine, homoserine, dihydroxyphenylalanine, 5-hydroxytryptophan, 1- methylhistidine, 3-methylhistidine, allyl glycine (or its alkyne counterpart), O-methyl- serine, biotinyl-lysine, biotinyl-cysteine (or other biotin-labelled amino acids) cyclohexylalanine, homoglutamate, D-alanine (or other D-amino acids), N-methyl glycine (or other N-methyl amino acids) or epsilon-N-methyl-lysine. Removal of the "internal" stop codon results in translation of coding sequences downstream of the stop codon. Example 3 demonstrates that translation past the stop codon at position 78 (by replacing the stop codon with one encoding glutamine) results in a polypeptide that has both antiviral and antiproliferative properties. One aspect of the invention provides a polypeptide comprising the amino acid sequence of residues 24-193 of SEQ ID NO:71. In one embodiment, the polypeptide comprises the amino acid sequence of residues 24-193 of SEQ ID NO:71 where at least 1, 2, 3, 4 or 5 or more cysteine residues are replaced by another amino acid, preferably a serine residue. The invention also provides variants of the above polypeptides lacking 1, 2, 3, 4,5 6, 7, 8, 9, 10, and up to 50 amino acids from either the N-terminus, C- terminus or both. One aspect of the invention provides a composition comprising one or more IFN-III avian polypeptides, such as chicken polypeptides. In certain embodiments, the IFN-III avian polypeptide comprises at least a portion of 30 residues of an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to the amino acid sequence selected from SEQ ID NO:29, or to the mature forms of this IFN polypeptides. In one embodiment, the polypeptide has substantial antiviral activity, such as in QT35 quail cells when infected with vesicular stomatitis virus (VSV). Example 4 provides an antiviral assay in quail cells. By substantial activity, it is meant that the portion of the polypeptide retains, on a molar basis, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of the antiviral or antiproliferative of the mature protein set forth in SEQ IN NO:29. In certain related embodiments, the present invention also includes fragments of the full-length IFN polypeptides of SEQ ID NOs:29. In one embodiment, the fragments are N- or C-terminal fragments, preferably fragments having anti-viral activity. In one embodiment, the IFN-III avian polypeptides has the sequence set forth in SEQ IN NO:29, or the mature form of said sequence. In another embodiment, at least 1, 2, 3, 4 or 5 of the cysteine residues in the avian interferon have been substituted with other residues, such as with serine residues.

V. Cell Lines and Production of Polypeptides

This invention also pertains to a host cell transfected with a recombinant gene including a coding sequence for one or more of the subject interleukin/interferon polypeptides or receptors. The host cell may be any prokaryotic or eukaryotic cell. For example, a polypeptide of the present invention may be expressed in bacterial cells such as E. coli, insect cells (e.g., using a baculovirus expression system), yeast, or mammalian cells. Other suitable host cells are known to those skilled in the art. Accordingly, the present invention further pertains to methods of producing the subject interleukin/interferon polypeptides and receptors. For example, a host cell transfected with an expression vector encoding an interleukin/interferon polypeptide or receptor, can be cultured under appropriate conditions to allow expression of the polypeptide to occur. In the cases of the interleukin/interferon polypeptide, the polypeptide may be secreted and isolated from a mixture of cells and medium containing the polypeptide. Alternatively, the polypeptide may be retained cytoplasmically or in a membrane fraction and the cells harvested, lysed and the protein isolated. A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art. The polypeptide can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins, including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for particular epitopes of the polypeptide. In a preferred embodiment, the interleukin/interferon polypeptide or receptor is a fusion protein containing a domain which facilitates its purification, such as a GST fusion protein, intein fusion protein, cellulose binding domain fusion protein, polyhistidine fusion protein etc.

A nucleotide sequence encoding an interleukin/interferon polypeptide can be used to produce a recombinant form of the protein via microbial or eukaryotic cellular processes. Ligating the polynucleotide sequence into a gene construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial) cells, are standard procedures.

A recombinant nucleic acid of the invention can be produced by ligating the cloned gene, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells, or both. Expression vehicles for production of a recombinant interleukin/interferon polypeptide or receptor include plasmids and other vectors. For instance, suitable vectors for the expression of an interleukin/interferon polypeptide or receptor include plasmids of the types: pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli. The preferred mammalian expression vectors contain both prokaryotic sequences to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells. The pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfτ, pTl<2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells. Some of these vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells. Alternatively, derivatives of viruses such as the bovine papilloma virus (BPV-I), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells. Examples of other viral (including retroviral) expression systems can be found below in the description of gene therapy delivery systems. The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press, 1989) Chapters 16 and 17. In some instances, it may be desirable to express the recombinant interleukin/interferon polypeptide or receptor by use of a baculovirus expression system. Examples of such baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWl), and pBlueBac-derived vectors (such as the β-gal containing pBlueBac III).

It is well known in the art that a methionine at the N-terminal position can be enzymatically cleaved by the use of the enzyme methionine aminopeptidase (MAP). MAP has been cloned from.£. coli (Ben-Bassat et al., (1987) J. Bacteriol. 169:751-757) and Salmonella typhimurium and its in vitro activity has been demonstrated on recombinant proteins (Miller et al., (1987) PNAS USA 84:2118-1722). Therefore, removal of an N- terminal methionine, if desired, can be achieved either in vivo by expressing such recombinant polypeptides in a host which produces MAP (e.g., E. coli or CM89 or S. cerevisiae), or in vitro by use of purified MAP (e.g., procedure of Miller et al.).

Alternatively, the coding sequences for the polypeptide can be incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide.

This type of expression system can be useful under conditions where it is desirable, e.g., to produce an immunogenic fragment of an interleukin/interferon polypeptide. For example, the VP6 capsid protein of rotavirus can be used as an immunologic carrier protein for portions of polypeptide, either in the monomeric form or in the form of a viral particle. The nucleic acid sequences corresponding to the portion of the interleukin/interferon polypeptide to which antibodies are to be raised can be incorporated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising a portion of the protein as part of the virion. The Hepatitis B surface antigen can also be utilized in this role as well. Similarly, chimeric constructs coding for fusion proteins containing a portion of an interleukin/interferon polypeptide and the poliovirus capsid protein can be created to enhance immunogenicity (see, for example, EP Publication NO: 0259149; and Evans et al., (1989) Nature 339:385; Huang et al., (1988) J. Virol. 62:3855; and Schlienger et al., (1992) J. Virol. 66:2). The Multiple Antigen Peptide system for peptide-based immunization can be utilized, wherein a desired portion of an interleukin/interferon polypeptide or receptor is obtained directly from organo-chemical synthesis of the peptide onto an oligomeric branching lysine core (see, for example, Posnett et al., (1988) JBC 263:1719 and Nardelli et al., (1992) J. Immunol. 148:914). Antigenic determinants of an interleulάn/mterferon polypeptide can also be expressed and presented by bacterial cells.

In another embodiment, a fusion gene coding for a purification leader sequence, such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of the recombinant protein, can allow purification of the expressed fusion protein by affinity chromatography using a Ni⁺² metal resin. The purification leader sequence can then be subsequently removed by treatment with enterokinase to provide the purified interleukin/interferon polypeptide or receptor (e.g., see Hochuli et al., (1987) J. Chromatography 411:177; and Janknecht et al., PNAS USA 88:8972).

Forms of interleukin/interferon may be recovered from culture medium or from host cell lysates. It may be desired to purify the interleukin/interferon from recombinant cell proteins or polypeptides. The following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation, reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope-tagged forms of the interleukin/interferon. Various methods of protein purification may be employed and such methods are known in the art and described for example in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer- Verlag, New York (1982). The purification step(s) selected will depend, for example, on the nature of the production process used and the particular IFN produced.

VI. Antibodies

Another aspect of the invention pertains to an antibody reactive with an interleukin/interferon polypeptide or receptor, preferably antibodies that are specifically reactive with said proteins. For example, by using immunogens derived from an interleukin/interferon polypeptide or receptor, anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)). A mammal, such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide (e.g., an interleukin/interferon polypeptide or receptor, or an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein). Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art. An immunogenic portion of an interleuldn/interferon polypeptide or receptor can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies. In a preferred embodiment, the subject antibodies are immunospecific for antigenic determinants of an interleukin/interferon polypeptide or receptor of a mammal, e.g., antigenic determinants of a protein set forth in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71. In one embodiment, antibodies are specific for an IFN-v protein having the amino acid sequence as set forth in any of SEQ ID NOs:3, 5, 25, 57, 61, 63, 65, 67, 69 and 71.

Following immunization of an animal with an antigenic preparation of an interleukin/interferon polypeptide, anti-interleukin/interferon antisera can be obtained and, if desired, polyclonal anti- interleukin/interferon antibodies can be isolated from the serum. To produce monoclonal antibodies, antibody-producing cells (lymphocytes) can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells. Such techniques are well known in the art, and include, for example, the hybridoma technique (originally developed by Kohler and Milstein, (1975) Nature, 256: 495-497), the human B cell hybridoma technique (Kozbar et al., (1983) Immunology Today, 4: 72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole et al., (1985) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96). Hybridoma cells can be screened immunochemical^ for production of antibodies specifically reactive with a mammalian interleukin/interferon polypeptide of the present invention and monoclonal antibodies isolated from a culture comprising such hybridoma cells.

The term antibody as used herein is intended to include fragments thereof which are also specifically reactive with one of the subject interleukin/interferon polypeptides. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab)₂ fragments can be generated by treating antibody with pepsin. The resulting F(ab) ₂ fragment can be treated to reduce disulfide bridges to produce Fab fragments. The antibody of the present invention is further intended to include bispecific, single-chain, and chimeric and humanized molecules having affinity for an interleukin/interferon polypeptide or receptor conferred by at least one CDR region of the antibody. In preferred embodiments, the antibodies, the antibody further comprises a label attached thereto and able to be detected, (e.g., the label can be a radioisotope, fluorescent compound, enzyme or enzyme co-factor). In certain preferred embodiments, an antibody of the invention is a monoclonal antibody, and in certain embodiments the invention makes available methods for generating novel antibodies. For example, a method for generating a monoclonal antibody that binds specifically to an interleukin/interferon polypeptide may comprise administering to a mouse an amount of an immunogenic composition comprising the interleukin/interferon polypeptide effective to stimulate a detectable immune response, obtaining antibody- producing cells (e.g. cells from the spleen) from the mouse and fusing the antibody- producing cells with myeloma cells to obtain antibody-producing hybridomas, and testing the antibody-producing hybridomas to identify a hybridoma that produces a monocolonal antibody that binds specifically to the interleukin/interferon polypeptide, receptor, or fragments thereof. Once obtained, a hybridoma can be propagated in a cell culture, optionally in culture conditions where the hybridoma-derived cells produce the monoclonal antibody that binds specifically to the interleukin/interferon polypeptide, receptor, or fragments thereof. The monoclonal antibody may be purified from the cell culture.

In addition, the techniques used to screen antibodies in order to identify a desirable antibody may influence the properties of the antibody obtained. For example, an antibody to be used for certain therapeutic purposes will preferably be able to target a particular cell type. Accordingly, to obtain antibodies of this type, it may be desirable to screen for antibodies that bind to cells that express the antigen of interest (e.g. by fluorescence activated cell sorting). Likewise, if an antibody is to be used for binding an antigen in solution, it may be desirable to test solution binding. A variety of different techniques are available for testing antibody: antigen interactions to identify particularly desirable antibodies. Such techniques include ELISAs, surface plasmon resonance binding assays (e.g. the Biacore binding assay, Bia-core AB, Uppsala, Sweden), sandwich assays (e.g. the paramagnetic bead system of IGEN International, Inc., Gaithersburg, Maryland), western blots, immunoprecipitation assays and immunohistochemistry. Another application of anti-interleukin/interferon antibodies of the present invention is in the immunological screening of cDNA libraries constructed in expression vectors such as gtll, gtl8-23, ZAP, and ORF8. Messenger libraries of this type, having coding sequences inserted in the correct reading frame and orientation, can produce fusion proteins. For instance, gtl 1 will produce fusion proteins whose amino termini consist of β- galactosidase amino acid sequences and whose carboxy termini consist of a foreign polypeptide. Antigenic epitopes of an interleukin/interferon polypeptide or receptor, e.g., other orthologs of a particular protein or other paralogs from the same species, can then be detected with antibodies, as, for example, reacting nitrocellulose filters lifted from infected plates with the appropriate anti- interleukin/interferon antibodies. Positive phage detected by this assay can then be isolated from the infected plate. Thus, the presence of interleukin/interferon homologs can be detected and cloned from other animals, as can alternate isoforms (including splice variants) from humans.

The antibodies described herein may be used to assay the levels of the interleukin/interferon receptors and polypeptides described herein, and in particular for detecting the presence of an IFN-v polypeptide on a biological sample. The level of interleukin/interferon polypeptide may be measured in a variety of sample types such as, for example, in cells, stools, and/or in bodily fluid, such as in whole blood samples, blood serum, blood plasma and urine. An antibody specifically reactive with the interleukin of IFN is preferable. The adjective "specifically reactive with" as used in reference to an antibody is intended to mean, as is generally understood in the art, that the antibody is sufficiently selective between the antigen of interest (e.g. an interleukin/interferon polypeptide or receptor) and other antigens that are not of interest that the antibody is useful for, at minimum, detecting the presence of the antigen of interest in a particular type of biological sample. In certain methods employing the antibody, a higher degree of specificity in binding may be desirable. For example, an antibody for use in detecting a low abundance protein of interest in the presence of one or more very high abundance protein that are not of interest may perform better if it has a higher degree of selectivity between the antigen of interest and other cross-reactants. Monoclonal antibodies generally have a greater tendency (as compared to polyclonal antibodies) to discriminate effectively between the desired antigens and cross-reacting polypeptides. In addition, an antibody that is effective at selectively identifying an antigen of interest in one type of biological sample (e.g. a stool sample) may not be as effective for selectively identifying the same antigen in a different type of biological sample (e.g. a blood sample). Likewise, an antibody that is effective at identifying an antigen of interest in a purified protein preparation that is devoid of other biological contaminants may not be as effective at identifying an antigen of interest in a crude biological sample, such as a blood or urine sample. Accordingly, in preferred embodiments, the method employs antibodies that have demonstrated specificity for an antigen of interest in a sample type that is likely to be the sample type of choice for use of the antibody. In a particularly preferred embodiment, the method uses antibodies that bind specifically to an interleukin/interferon polypeptide in a protein preparation from blood (optionally serum or plasma) from a subject.

VII. Transgenic Animals

Another aspect of the invention features transgenic non-human animals which express a heterologous interleukin/interferon gene, preferentially an IFN-v. In another aspect the invention features transgenic non-human animals which have had one or both copies of the endogenous interleukin/interferon genes disrupted in at least one of the tissue or cell-types of the animal. In one embodiment, the transgenic non-human animals is a mammal such as a mouse, rat, rabbit, goat, sheep, dog, cat, cow, or non-human primate. In certain embodiments, such a transgenic animal may display a phenotype associated with inadequate or excessive cell proliferation or viral infection, and may therefore serve as a useful animal model to study the progression of diseases caused by such inadequate or excessive processes. In one embodiment, the IFN-v transgenic animals of the present invention may be used for in vivo assays to identify anti-cancer or anti-viral therapeutics. The term "transgene" is used herein to describe genetic material that has been or is about to be artificially inserted into the genome of a mammalian cell, particularly a mammalian cell of a living animal. The transgene is used to transform a cell, meaning that a permanent or transient genetic change, preferably a permanent genetic change, is induced in a cell following incorporation of exogenous DNA. A permanent genetic change is generally achieved by introduction of the DNA into the genome of the cell. Vectors for stable integration include plasmids, retroviruses and other animal viruses, YACs, and the like. Of interest are transgenic mammals, e.g. cows, pigs, goats, horses, etc., and particularly rodents, e.g. rats, mice, etc. Preferably, the transgenic-animals are mice.

Transgenic animals comprise an exogenous nucleic acid sequence present as an extrachromosomal element or stably integrated in all or a portion of its cells, especially in germ cells. Unless otherwise indicated, it will be assumed that a transgenic animal comprises stable changes to the germline sequence.- During the initial construction of the animal, "chimeras" or "chimeric animals" are generated, in which only a subset of cells have the altered genome. Chimeras are primarily used for breeding purposes in order to generate the desired transgenic animal. Animals having a heterozygous alteration are generated by breeding of chimeras. Male and female heterozygotes are typically bred to generate homozygous animals.

The exogenous gene is usually either from a different species than the animal host, or is otherwise altered in its coding or non-coding sequence. The introduced gene may be a wild-type gene, naturally occurring polymorphism, or a genetically manipulated sequence, for example having deletions, substitutions or insertions in the coding or non-coding regions. Where the introduced gene is a coding sequence, it is usually operably linked to a promoter, which may be constitutive or inducible, and other regulatory sequences required for expression in the host animal. By "operably linked" is meant that a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules, e.g. transcriptional activator proteins, are bound to the regulatory sequence(s).

In one aspect of the invention, an interleukin/interferon transgene can encode the wild-type form of the protein, homologs thereof, as well as antisense constructs. An interferon transgene can also encode a soluble form of the protein that has immunomodulatory, antiviral and/or antiproliferative activity. It may be desirable to express the heterologous IFN transgene conditionally such that either the timing or the level of IFN gene expression can be regulated. Such conditional expression can be provided using prokaryotic promoter sequences which require prokaryotic proteins to be simultaneous expressed in order to facilitate expression of the IFN transgene. Exemplary promoters and the corresponding trans-activating prokaryotic proteins are given in U.S. Pat. No. 4,833,080.

Moreover, transgenic animals exhibiting tissue specific expression can be generated, for example, by inserting a tissue specific regulatory element, such as an enhancer, into the transgene. For example, the endogenous IFN-v gene promoter or a portion thereof can be replaced with another promoter and/or enhancer, e.g., a CMV or a Moloney murine leukemia virus (MLV) promoter and/or enhancer.

Transgenic animals containing an inducible IFN transgene can be generated using inducible regulatory elements (e.g. metallothionein promoter), which are well-known in the art. IFN transgene expression can then be initiated in these animals by administering to the animal a compound which induces gene expression (e.g. heavy metals). Another preferred inducible system comprises a tetracycline-inducible transcriptional activator (U.S. Pat. Nos. 5,654,168 and 5,650,298).

The present invention provides for transgenic animals that carry the transgene in all their cells, as well as animals that carry the transgene in some, but not all cells, i.e., mosaic animals. The transgene can be integrated as a single transgene or in tandem, e.g., head to head tandems, or head to tail or tail to tail or as multiple copies.

The successful expression of the transgene can be detected by any of several means well known to those skilled in the art. Non-limiting examples include Northern blot, in situ hybridization of mRNA analysis, Western blot analysis, immunohistochemistry, and FACS analysis of protein expression.

In a further aspect, the invention features non-human animal cells containing a IFN-v transgene, preferentially a human IFN-v transgene. For example, the animal cell (e.g. somatic cell or germ cell (i.e. egg or sperm)) can be obtained from the transgenic animal. Transgenic somatic cells or cell lines can be used, for example, in drug screening assays. Transgenic germ cells, on the other hand, can be used in generating transgenic progeny, as described below.

Although not necessary to the operability of the invention, the transgenic animals described herein may comprise alterations to endogenous genes in addition to, or alternatively, to the genetic alterations described above. For example, the host animals may be either "knockouts" and/or "knockins" for a target gene(s) as is consistent with the goals of the invention (e.g., the host animal's endogenous IFN-v may be "knocked out"). Knockouts have a partial or complete loss of function in one or both alleles of an endogenous gene of interest. Knockins have an introduced transgene with altered genetic sequence and/or function from the endogenous gene. The two may be combined, for example, such that the naturally occurring gene is disabled, and an altered form introduced. For example, it may be desirable to knockout the host animal's endogenous IFN-v gene, while introducing an exogenous IFN-v gene (e.g., a human IFN-v gene).

In a knockout, preferably the target gene expression is undetectable or insignificant. For example, a knock-out of a IFN-v gene means that function of the IFN-v has been substantially decreased so that expression is not detectable or only present at insignificant levels. This may be achieved by a variety of mechanisms, including introduction of a disruption of the coding sequence, e.g. insertion of one or more stop codons, insertion of a DNA fragment, etc., deletion of coding sequence, substitution of stop codons for coding sequence, etc. In some cases the exogenous transgene sequences are ultimately deleted from the genome, leaving a net change to the native sequence. Different approaches may be used to achieve the "knock-out". A chromosomal deletion of all or part of the native gene may be induced, including deletions of the non-coding regions, particularly the promoter region, 3' regulatory sequences, enhancers, or deletions of gene that activate expression of APP genes. A functional knock-out may also be achieved by the introduction of an anti-sense construct that blocks expression of the native genes (for example, see Li and Cohen (1996) Cell 85:319-329). "Knock-outs" also include conditional knock-outs, for example where alteration of the target gene occurs upon exposure of the animal to a substance that promotes target gene alteration, introduction of an en2yme that promotes recombination at the target gene site (e.g. Cre in the Cre-lox system), or other method for directing the target gene alteration postnatally.

A "knockin" of a target gene means an alteration in a host cell genome that results in altered expression or function of a native target gene. Increased (including ectopic) or decreased expression may be achieved by introduction of an additional copy of the target gene, or by operatively inserting a regulatory sequence that provides for enhanced expression of an endogenous copy of the target gene. These changes may be constitutive or conditional, i.e. dependent on the presence of an activator or repressor. The use of knockin technology may be combined with production of exogenous sequences to produce the transgenic animals of the invention.

DNA constructs for random integration need not include regions of homology to mediate recombination. Where homologous recombination is desired, the DNA constructs will comprise at least a portion of the target gene with the desired genetic modification, and will include regions of homology to the target locus. Conveniently, markers for positive and negative selection are included. Methods for generating cells having targeted gene modifications through homologous recombination are known in the art. For various techniques for transfecting mammalian cells, see Keown et al. (1990) Methods in Enzymology 185:527-537.

For embryonic stem (ES) cells, an ES cell line may be employed, or embryonic cells may be obtained freshly from a host, e.g. mouse, rat, guinea pig, etc. Such cells are grown on an appropriate fibroblast-feeder layer or grown in the presence of appropriate growth factors, such as leukemia inhibiting factor (LIF). When ES cells have been transformed, they may be used to produce transgenic animals. After transformation, the cells are plated onto a feeder layer in an appropriate medium. Cells containing the construct may be detected by employing a selective medium. After sufficient time for colonies to grow, they are picked and analyzed for the occurrence of homologous recombination or integration of the construct. Those colonies that are positive may then be used for embryo manipulation and blastocyst injection. Blastocysts are obtained from 4 to 6 week old superovulated females. The ES cells are trypsinized, and the modified cells are injected into the blastocoel of the blastocyst. After injection, the blastocysts are returned to each uterine horn of pseudopregnant females. Females are then allowed to go to term and the resulting litters screened for mutant cells having the construct. By providing for a different phenotype of the blastocyst and the ES cells, chimeric progeny can be readily detected.

The chimeric animals are screened for the presence of the modified gene and males and females having the modification are mated to produce homozygous progeny. If the gene alterations cause lethality at some point in development, tissues or organs can be maintained as allogeneic or congenic grafts or transplants, or in in vitro culture.

In certain embodiments, the invention further provides methods for identifying (screening) or for determining the safety and/or efficacy of therapeutics, i.e. compounds which are useful for treating and/or preventing tumors and viral infections. In addition, the assays are useful for further improving known therapeutic compounds, e.g, by modifying their structure to increase their stability and/or activity and/or toxicity.

Vπi. Methods of Screening

The present invention also provides screening methods for identifying compounds capable of enhancing or inhibiting a biological activity of an Interferon polypeptide. In one embodiment, the method comprises (i) contacting a receptor whose activity is regulated by an interferon polypeptide with the candidate compound in the presence of a Interferon polypeptide, (ii) assaying an activity of the receptor, for example, anti-viral activity, in the presence of the candidate compound and the Interferon polypeptide, and (iii) comparing the activity to a standard level of activity, the standard being assayed when contact is made between the receptor and interferon in the absence of the candidate compound. In this assay, an increase in activity over the standard indicates that the candidate compound is an agonist of interferon activity and a decrease in activity compared to the standard indicates that the compound is an antagonist of interferon activity.

The invention provides methods of identifying modulators of IFN- v activity. In one aspect, the elucidation of the IFN-v sequence facilitates rational design of IFN-v agonists and antagonists based on the structural features of the IFN-v protein, which can be deteπnined using X-ray crystallography, neuron diffraction, nuclear magnetic resonance spectrometry, and other techniques. In addition, the present invention provides assays for identifying therapeutic agents that modulate cell proliferation and viral infection. In certain embodiments, the therapeutic agents either interfere with or promote IFN-v function, hi other embodiments, the therapeutic agents interfere with the interaction between IFN-v and an IFN-v receptor (see Example 9). In another embodiment, the therapeutic agents alter the expression level of endogenous IFN-v expression, by either increasing or decreasing IFN-v expression. In a further embodiment, the present invention provides assays for identifying therapeutic agents which either interfere with or promote the anti-viral or antiproliferative activity of an IFN-v polypeptide. In another embodiment, the assay detects agents which modulate the intrinsic biological activity of IFN-v, such as its anti-viral, immunomodulatory or antiproliferative properties, binding to other cellular components, cellular compartmentalization, and the like. Certain embodiments of the invention relate to assays for identifying agents that bind to an interleukin/interferon polypeptide. In one embodiment, an assay detects agents which inhibit interaction of one or more subject interleukin/interferon polypeptides with its receptor. A wide variety of assays may be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, interaction trap assay, immunoassays for protein binding, and the like.

Given the role of interferon polypeptides in modulating viral infection and cell proliferation, the agents that bind to interferons as well as the agents that interfere with interferons binding to their receptors may be able to modulate viral infection and/or cell proliferation. Accordingly, one aspect of the invention provides a method for assessing the ability of an agent to modulate viral infection and/or cell proliferation, comprising: 1) combining: a first polypeptide including at least a portion of an interferon polypeptide with an cell expressing an interferon receptor, and an agent, under conditions wherein the first polypeptide interacts with the interferon receptor in the absence of said agent, 2) determining if said agent interferes with the interaction, and 3) for an agent that interferes with the interaction, further assessing its ability to interfere with the interferon's antiviral or antiproliferative activity. In preferred embodiments, the interferon is an IFN-v interferon or a biologically-active fragment thereof, such as an N-terminal fragment of the mature form. Other embodiments of the invention include methods for assessing the ability of an agent to modulate viral infection and/or cell proliferation comprising 1) combining a polypeptide including at least a portion of an interferon with an agent under conditions where the polypeptide exhibits antiviral and/or antiproliferative activity in the absence of the agent, and 2) determining if the agent interferes with or promotes the interferon modulation of antiviral and/or antiproliferative activity.

A variety of assay formats will suffice and, in light of the present disclosure, those not expressly described herein will nevertheless be comprehended by one of ordinary skill in the art. Assay formats which approximate such conditions as formation of protein complexes may be generated in many different forms, and include assays based on cell-free systems, e.g. purified proteins or cell lysates, as well as cell-based assays which utilize intact cells. Simple binding assays can also be used to detect agents which bind to the interferons of the present invention. Such binding assays may also identify agents that act by disrupting the interaction between an interferon polypeptide and its receptor. Agents to be tested can be produced, for example, by bacteria, yeast or other organisms (e.g. natural products), produced chemically (e.g. small molecules, including peptidomimetics), or produced recombinantly. In a preferred embodiment, the test agent is a small organic molecule, e.g., other than a peptide or oligonucleotide, having a molecular weight of less than about 1,000 Daltons. In many drug screening programs which test libraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time.

In binding assays, the interaction is binding and the complex formed can be isolated or detected in the reaction mixture. In a particular embodiment, a receptor of a polypeptide encoded by one of the interferon/interleukin polypeptides disclosed herein, or the drug candidate, is immobilized on a solid phase, e.g. on a microtiter plate, by covalent or non- covalent attachments. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying. Alternatively, an immobilized antibody, e.g. a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g. the coated surface containing the anchored component. When the reaction is complete, the non-reacted components are removed e.g. by washing, and complexes anchored on the solid surface are detected. When the originally non-immobilized component carries a detectable label, the detection of label immobilized on the surface indicates that complexing occurred. Where the originally non-immobilized component does not carry a label, complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex. A variety of other reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding and/or reduce nonspecific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti- microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4° and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening.

In yet another embodiment, the interleukm/interferon polypeptide and a potential interacting polypeptide can be used to generate an interaction trap assay (see also, U.S. Patent NO: 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J Biol Chem 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; and Iwabuchi et al. (1993) Oncogene 8:1693-1696), for subsequently detecting agents which disrupt binding of the proteins to one and other.

One aspect of the present invention provides reconstituted protein preparations including an interleukin/interferon polypeptide and one or more interacting polypeptides.

IX. DNA Microarravs

Another aspect of the invention provides a DNA microarray comprising at least one polynucleotide comprising at least a region of 20, 25, 30, 35, 40, 45, 50, 60 or 70 nucleotides in length that is identical to a portion of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 58, 62, 64, 66, 68 and 70, or more preferably to a portion of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 58, 62, 64, 66, 68 or 70, or more preferable to a portion of SEQ ID NO: 4, 6, 26, 58, 62, 64, 66, 68 or 70. In one embodiment, the microarray comprises at least one polynucleotide comprising at least a region of 20, 25, 30, 35, 40, 45, 50, 60 or 70 nucleotides identical to a portion of SEQ ID NO:4.

DNA microarray and methods of analyzing data from microarrays are well-known in the art, including in DNA Microarrays: A Molecular Cloning Manual, Ed by Bowtel and Sambrook (Cold Spring Harbor Laboratory Press, 2002); Microarrays for an Integrative Genomics by Kohana (MIT Press, 2002); A Biologist's Guide to Analysis of DNA Microarray Data, by Knudsen (Wiley, John & Sons, Incorporated, 2002); and DNA Microarrays: A Practical Approach, Vol. 205 by Schema (Oxford University Press, 1999); and Methods of Microarray Data Analysis II, ed by Lin et al. (Kluwer Academic Publishers, 2002), hereby incorporated by reference in their entirety. In one embodiment, a microarray comprises a support or surface with an ordered array of binding (e.g., hybridization) sites or "probes" each representing one of the markers described herein. Preferably the microarrays are addressable arrays, and more preferably positionally addressable arrays. More specifically, each probe of the array is preferably located at a known, predetermined position on the solid support such that the identity (i.e., the sequence) of each probe can be determined from its position in the array (i.e., on the support or surface). In preferred embodiments, each probe is covalently attached to the solid support at a single site.

Microarrays may be prepared by selecting probes which comprise a polynucleotide sequence, and then immobilizing such probes to a solid support or surface. For example, the probes may comprise DNA sequences, RNA sequences, or copolymer sequences of DNA and RNA. The polynucleotide sequences of the probes may also comprise DNA and/or RNA analogues, or combinations thereof. For example, the polynucleotide sequences of the probes may be full or partial fragments of genomic DNA. The polynucleotide sequences of the probes may also be synthesized nucleotide sequences, such as synthetic oligonucleotide sequences. The probe sequences can be synthesized either enzymatically in vivo, enzymatically in vitro (e.g., by PCR), or non-enzymatically in vitro.

The probe or probes used in the methods and gene chips of the invention may be immobilized to a solid support which may be either porous or non-porous. For example, the probes of the invention may be polynucleotide sequences which are attached to a nitrocellulose or nylon membrane or filter covalently at either the 3' or the 5' end of the polynucleotide. Such hybridization probes are well known in the art (see, e.g., Sambrook et al., MOLECULAR CLONING-A LABORATORY MANUAL (2ND ED.), VoIs. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989). Alternatively, the solid support or surface may be a glass or plastic surface. In a particularly preferred embodiment, hybridization levels are measured to microarrays of probes consisting of a solid phase on the surface of which are immobilized a population of polynucleotides, such as a population of DNA or DNA mimics, or, alternatively, a population of RNA or RNA mimics. The solid phase may be a nonporous or, optionally, a porous material such as a gel.

DNA microarrays can be fabricated using drop deposition from pulse-jets of either nucleic acid precursor units (such as monomers) in the case of in situ fabrication, or the previously obtained nucleic acid. Such methods are described in detail in, for example, the previously cited references including U.S. Pat. Nos. 6,242,266, 6,232,072, 6,180,351, 6,171,797, 6,323,043. Instead of drop deposition methods, photolithographic array fabrication methods may be used. Inter-feature areas need not be present particularly when the arrays are made by photolithographic methods as described in those patents.

Preferably, microarrays are made from materials that are stable under binding (e.g., nucleic acid hybridization) conditions. The microarrays are preferably small, e.g., between 1 cm² and 25 cm², between 12 cm² and 13 cm², or about 3 cm². However, larger arrays are also contemplated and may be preferable, e.g., for use in screening arrays. Preferably, a given binding site or unique set of binding sites in the microarray will specifically bind (e.g., hybridize) to the product of a single gene in a cell (e.g., to a specific mRNA, or to a specific cDNA derived therefrom). However, in general, other related or similar

X. Compositions In another aspect, the invention further provides compositions comprising any of the interferon/interleukin polynucleotides or interferon/interleukin polypeptides, described herein, for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the compositions comprise an interferon polynucleotide for expression of an interferon polypeptide in a host organism for treatment of disease. Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with loss of endogenous activity of an interferon.

Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. The therapeutic compositions of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, the therapeutic compositions of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the therapeutic compositions may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included. For oral administration, the therapeutic compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., ationd oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated to give controlled release of the active agent. For buccal administration the therapeutic compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by inhalation, the compositions for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the therapeutic agents and a suitable powder base such as lactose or starch.

The therapeutic compositions may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. In addition to the formulations described previously, the therapeutic compositions may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the therapeutic compositions may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For topical administration, the compositions of the invention are formulated into ointments, salves, gels, or creams as generally known in the art. A wash solution can be used locally to treat an injury or inflammation to accelerate healing. For oral administration, the therapeutic compositions are formulated into conventional oral administration forms such as capsules, tablets, and tonics.

The therapeutic compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.

For therapies involving the administration of nucleic acids, the nucleic acids of the invention can be formulated for a variety of modes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, intranodal, and subcutaneous for injection, the nucleic acids of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the nucleic acids may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.

Toxicity and therapeutic efficacy of therapeutic compositions of the present invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining The Ld50 (The Dose Lethal To 50% Of The Population) and the Ed50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Therapeutic agents which exhibit large therapeutic induces are preferred. While therapeutic compositions that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such therapeutic agents to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any agents used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test therapeutic agent which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high perfoπnance liquid chromatography.

In one embodiment, the compositions are formulated for oral administration. U.S. Patent No. 5,846,526 describes the oral interferon compositions that may be adapted for the IFN-v polypeptides described herein. Another aspect of the invention provides an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described below is provided. The article of manufacture comprises a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The active agent in the composition is an interleukin/interferon of the present invention, preferable an IFN-v polypeptide, or an agonist or antagonist thereof. The label on, or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice. The article of manufacture may further comprise a second container comprising a pharmaceutically- acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.

In another aspect, the JFN-v is cofoπnulated with another interferon. Applicants have discovered a synergistic effect between mST-p and an INF-(X Accordingly, in one embodiment of the compositions of IFN-J' polypeptides further comprise an interferon alpha (IFN-αs), an interferon beta (TFN-jδs), or an interferon gamma (IFN-γ). In one embodiment, the composition comprises IFN-α2a. In another embodiment, the composition of an IFN-P further comprises an interferon selected from IFN-α, IFN-/3, IFN-ε, IFN-K, IFN-τ or IFN-ω. In one embodiment, the IFN-p and the second interferon act synergistically in at least one of the assays described herein , such as the anti-viral assays, and anti-proliferation assays and the immunomodulatory assays. Another aspect of the invention provides a composition comprising (i) an interferon polypeptide having an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to the amino acid sequence selected from SEQ ID NO: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71, or to the mature forms of these IFN polypeptides; (ii) a second interferon polypeptide selected from an IFN-α, IFN-/3, IFN-ε, IFN-K, IFN-τ or IFN-ω; and (iii) a pharmaceutically acceptable carrier. In one embodiment, the interferon polypeptide of part (i) is identical to either to full-length or the mature forms of the interferons of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, optionally where at least 1, 2, 3, 4 or 5 cysteine residues are replaced with another residue, preferably a serine residue. In another embodiment, the IFN polypeptides of part (i) is a polypeptide comprising a portion of an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to the amino acid sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, or to the mature forms of these IFN polypeptides, wherein said portion is a functional portion, such as a portion that retains a substantial anti-viral or anti-proliferative activity.

In preferred embodiments, the compositions comprise the full-length forms, mature forms, variants, or cysteine substituted forms, or combinations thereof, of the interferons having the amino acid sequences set forth in SEQ ID NOs: 3, 5, 25, 29, 57, 61, 63, 65, 67, 69 or 71.

XI. Therapeutic Applications

The novel interferon polypeptides of the present invention have antiviral, antiproliferative and/or immunoregulatory activities. Thus, the interferons, including variants and derivatives of the native protein, may be used for the treatment of malignant or non-malignant conditions associated with unwanted cell proliferation, or viral diseases.

More particularly, the interferons may be useful for the treatment of diseases characterized by tumorigenic or neoplastic cell growth, malignant hematological systemic diseases, viral disease, asthma, carcinomas, sarcomas, myelomas, melanomas, lymphomas, papillomas, degenerative diseases, allergic diseases psoriasis and pain. Dosages can be calculated based upon the specific activity of the interferon as compared to the specific activities of other, known interferons, which have been used to treat similar conditions.

The IFN polypeptides and their agonists may also be used as adjuncts to chemotherapy. It is well understood that chemotherapeutic treatment results in suppression of the immune system. Often, although successful in destroying the tumor cells against which they are directed, chemotherapeutic treatments result in the death of the subject due to such side effects of the chemotherapeutic agents. Administration of the IFN polypeptides or their agonists may prevent this side effect as a result of their ability to upregulate the subject's immune system. In general, patients suffering from immunosuppression due to any underlying cause, including HIV infection (or AIDS), may benefit from treatment with the IFN polypeptides or agonist thereof. The invention provides a method of treating a subject afflicted with severe acute respiratory syndrome, comprising administering to the subject an amount of an IFN-v polypeptide effective to reduce the concentration of SARS-associated coronavirus particles in the subject, thereby treating the subject. The invention provides a method of treating a subject infected with a virus selected from the group consisting of coronavirus, smallpox virus, cowpox virus, monkeypox virus, West Nile virus, vaccinia virus, respiratory syncytial virus, rhinovirus, arterivirus, fϊlovirus, picornavirus, reovirus, retrovirus, papovavirus, herpesvirus, poxvirus, hepadnavirus, astrovirus, coxsackie virus, paramyxoviridae, orthomyxoviridae, echovirus, enterovirus, cardiovirus, togavirus, rhabdovirus, bunyavirus, arenavirus, bornavirus, adenovirus, parvovirus, and flavivirus, comprising administering to the subject an amount of an interferon polypeptide, preferably an LNF-v polypeptide, that is effective to reduce the concentration of virus particles in the subject, thereby treating the subject.

This invention contemplates any of the treatment methods described herein also as methods for preventing the subject from becoming afflicted or infected, or as methods of reducing the subject's risk of a affliction or infection, or as protecting the subject against disorders/conditions related to a particular virus, or as preventing the subject from exhibiting symptoms associated with a viral infection. For instance, the above methods for treating subject infected with a virus may also be used to prevent the subject from becoming infected with the virus, or to reduce the subject risk of viral infection.

This invention provides a method of reducing a subject's risk of viral infection comprising administering to the subject one of the interferon polypeptides described herein, or biologically active fragments thereof. In one embodiment, this method comprises preventing the subject from being infected with the virus. In one embodiment, this method comprises preventing the subject from exhibiting symptoms associated with a viral infection. In one embodiment, this method comprises protecting the subject against disorders/conditions related to a particular virus. This protection may be conferred by preventing or lessening the severity of a disorder/condition resulting from the infection. In another embodiment, the protection may also be conferred by reducing the spread of infection to others by lessening the severity of a disorder/condition resulting from the infection in the patient. In another embodiment, the prevention or reduction of risk is effected by causing the subject's cells to become less susceptible to infection. The methods and embodiments described herein are not necessarily mutually exclusive. The viral infections include but are not limited to those caused by coronavirus, smallpox virus, cowpox virus, monkeypox virus, West Nile virus, vaccinia virus, respiratory syncytial virus, rhinovirus, arterivirus, filovirus, picornavirus, reovirus, retrovirus, papovavirus, herpesvirus, poxvirus, hepadnavirus, astrovirus, coxsackie virus, paramyxoviridae, orthomyxoviridae, echovirus, enterovirus, cardiovirus, togavirus, rhabdovirus, bunyavirus, arenavirus, bornavirus, adenovirus, parvovirus, and flavivirus. This invention provides a method of treating a subject afflicted with influenza

(orthomyxovirus), comprising administering to the subject an amount of one of the interferon polypeptides described herein, preferably an IFN-v polypeptide, that is effective to reduce the concentration of influenza virus particles in the subject.

This invention also provides a method of preventing a subject from becoming afflicted with a syndrome caused by a virus selected from the group consisting of coronavirus, smallpox virus, cowpox virus, monkeypox virus, West Nile virus, vaccinia virus, respiratory syncytial virus, rhinovirus, arterivirus, filovirus, picornavirus, reovirus, retrovirus, papovavirus, herpesvirus, poxvirus, hepadnavirus, astrovirus, coxsackie virus, paramyxoviridae, orthomyxoviridae, echovirus, enterovirus, cardiovirus, togavirus, rhabdovirus, bunyavirus, arenavirus, bornavirus, adenovirus, parvovirus, and flavivirus, comprising administering to the subject an amount of an interferon polypeptide described herein, such as an IFN-v polypeptide.

In one embodiment, the subject interferons can be used as anti-viral agents. Interferons have been used clinically for anti-viral therapy, for example, in the treatment of acquired immune disorders, viral hepatitis including chronic hepatitis B, hepatitis C, hepatitis D, papilloma viruses, herpes, viral encephalitis, and in the prophylaxis of rhinitis and respiratory infections.

In still another embodiment, the subject interferons can be used as anti-bacterial agents. Interferons have been used clinically for anti-bacterial therapy. For example, the subject Interferons can be used in the treatment of multidrug-resistant pulmonary tuberculosis. In yet another embodiment, the subject interferons can be used as anti-cancer agents. Interferon therapy using the subject Interferons can be used in the treatment of numerous cancers e.g., hairy cell leukemia, acute myeloid leukemia, osteosarcoma, basal cell carcinoma, glioma, renal cell carcinoma, multiple myeloma, melanoma, and Hodgkin's disease. In yet another embodiment, the subject interferons can be used as part of an immunotherapy protocol. The interferons of the present invention may be used clinically for immunotherapy or more particularly, for example, to prevent graft vs. host rejection, or to curtail the progression of autoimmune diseases, such as arthritis, multiple sclerosis, or diabetes. In another embodiment, the subject interferons can be used as part of a program for treating allergies. In still another embodiment, the subject interferons can be used as vaccine adjuvants. The subject interferons may be used as an adjuvant or coadjuvant to enhance or stimulate the immune response in cases of prophylactic or therapeutic vaccination.

In certain embodiments, interferons are used to treat cats for viral infections. In one embodiment, the interferon is an IFN-v interferon, such as the one having the amino acid sequence of SEQ ID NO: 26 or the mature form thereof, or one in which one or more cysteine residues are substituted with serine residues. For instance, cats with Feline Immunodeficiency Virus (FIV) require support therapies in order to maintain normal health. Interferons can be used as part of a treatment of cats infected with FIV. Likewise, Interferons can be used as part of a treatment of cats infected with Feline Leukemia Virus (FeLV). The feline leukemia virus (FeLV) is the causative agent of the most important fatal infectious disease complex of American domestic cats today.

Interferons can be used for treating feline panleukopenia. Also called feline infectious enteritis, feline "distemper," and feline ataxia or incoordination, feline panleukopenia is a highly contagious viral disease of cats characterized by its sudden onset, fever, inappetence (loss of appetite), dehydration, depression, vomiting, decreased numbers of circulating white blood cells (leukopenia), and often a high mortality rate. Intrauterine (within the uterus) infection may result in abortions, stillbirths, early neonatal deaths, and cerebellar hypoplasia (underdevelopment of the cerebellum) manifested by incoordination (ataxia) in kittens beginning at two to three weeks of age. All members of the cat family

(Felidae) are susceptible to infection with feline panleukopenia virus (FPV), as are raccoons, coatimundis, and ringtails, in the family Procyoniclae.

Interferons can be used for treating cats infected with feline infectious peritonitis. Interferons can be used for treating cats infected with rabies. In other embodiments directed to feline care, Interferons can be used in treating inflammatory airway disease (IAD).

In certain embodiments, the invention provides methods of treating disease by administering substantially purified IFN-v, or IFN-v agonists or antagonists, or IFN-v binding agents, or IFN-v antisera or antisera directed against IFN-v antisera to a patient. Additional methods include administration of IFN-v, IFN-v fragments, IFN-v antisera, or IFN-v receptor agonists and antagonists linked to cytotoxic agents. It is to be understood that the IFN-v can be animal or human in origin.

The present invention further includes methods of treating disease by altering (including increasing or decreasing) the production and/or activity of IFN-v. Exemplary methods for inhibiting the production of IFN-v include: decreasing IFN-v level by administrating IFN-v inhibitory nucleic acids such as RNAi constructs, antisense oligonucleotides, ribozyme, and DNA en∑ymes.

Another method of treating disease is by blocking the action of excess endogenous IFN-v. This can be done by passively immunizing a human or animal with antibodies specific for the undesired IFN-v in the system. The present invention also encompasses gene therapy whereby the gene encoding

IFN-v is regulated in a patient. Various methods of transferring or delivering DNA to cells for expression of the gene product protein, otherwise referred to as gene therapy, are disclosed in Gene Transfer into Mammalian Somatic Cells in vivo, N. Yang, Crit. Rev. Biotechn. 12(4): 335-356 (1992), which is hereby incorporated by reference. Gene therapy encompasses incorporation of DNA sequences into somatic cells or germ line cells for use in either ex vivo or in vivo therapy. Gene therapy functions to replace genes, augment normal or abnormal gene function.

Strategies for treating these medical problems with gene therapy include therapeutic strategies such as identifying the defective gene and then adding a functional gene to either replace the function of the defective gene or to augment a slightly functional gene; or prophylactic strategies, such as adding a gene for the product protein that will treat the condition or that will make the tissue or organ more susceptible to a treatment regimen.

Gene transfer methods for gene therapy fall into three broad categories-physical (e.g., electroporation, direct gene transfer and particle bombardment), chemical (lipid-based carriers, or other non-viral vectors) and biological (virus-derived vector and receptor uptake). For example, non-viral vectors may be used which include liposomes coated with DNA. Such liposome/DNA complexes may be directly injected intravenously into the patient. It is believed that the liposome/DNA complexes are concentrated in the liver where they deliver the DNA to macrophages and Kupffer cells. These cells are long lived and thus provide long term expression of the delivered DNA. Additionally, vectors or the "naked"

DNA of the gene may be directly injected into the desired organ, tissue or tumor for targeted delivery of the therapeutic DNA.

Gene therapy methodologies can also be described by delivery site. Fundamental ways to deliver genes include ex vivo gene transfer, in vivo gene transfer, and in vitro gene transfer. In ex vivo gene transfer, cells are taken from the patient and grown in cell culture. The DNA is transfected into the cells, the transfected cells are expanded in number and then reimplanted in the patient. In in vitro gene transfer, the transformed cells are cells growing in culture, such as tissue culture cells, and not particular cells from a particular patient. These "laboratory cells" are transfected, the transfected cells are selected and expanded for either implantation into a patient or for other uses.

In vivo gene transfer involves introducing the DNA into the cells of the patient when the cells are within the patient. Methods include using virally mediated gene transfer using a noninfectious virus to deliver the gene in the patient or injecting naked DNA into a site in the patient and the DNA is taken up by a percentage of cells in which the gene product protein is expressed. Additionally, the other methods described herein, such as use of a "gene gun," may be used for in vitro insertion of endothelial cell proliferation inhibitor DNA or inhibitor regulatory sequences.

Chemical methods of gene therapy may involve a lipid based compound, not necessarily a liposome, to ferry the DNA across the cell membrane. Lipofectins or cytofectins, lipid-based positive ions that bind to negatively charged DNA, make a complex that can cross the cell membrane and provide the DNA into the interior of the cell. Another chemical method uses receptor-based endocytosis, which involves binding a specific ligand to a cell surface receptor and enveloping and transporting it across the cell membrane. The ligand binds to the DNA and the whole complex is transported into the cell. The ligand gene complex is injected into the blood stream and then target cells that have the receptor will specifically bind the ligand and transport the ligand-DNA complex into the cell.

Many gene therapy methodologies employ viral vectors to insert genes into cells. For example, altered retrovirus vectors have been used in ex vivo methods to introduce genes into peripheral and tumor-infiltrating lymphocytes, hepatocytes, epidermal cells, myocytes, or other somatic cells. These altered cells are then introduced into the patient to provide the gene product from the inserted DNA.

Viral vectors have also been used to insert genes into cells using in vivo protocols. To direct tissue-specific expression of foreign genes, cis-acting regulatory elements or promoters that are known to be tissue specific can be used. Alternatively, this can be achieved using in situ delivery of DNA or viral vectors to specific anatomical sites in vivo. For example, gene transfer to blood vessels in vivo was achieved by implanting in vitro transduced endothelial cells in chosen sites on arterial walls. The virus infected surrounding cells which also expressed the gene product. A viral vector can be delivered directly to the in vivo site, by a catheter for example, thus allowing only certain areas to be infected by the virus, and providing long-term, site specific gene expression. In vivo gene transfer using retrovirus vectors has also been demonstrated in mammary tissue and hepatic tissue by injection of the altered virus into blood vessels leading to the organs.

Mechanical methods of DNA delivery include fusogenic lipid vesicles such as liposomes or other vesicles for membrane fusion, lipid particles of DNA incorporating cationic lipid such as lipofectin, polylysine-mediated transfer of DNA, direct injection of DNA, such as microinjection of DNA into germ or somatic cells, pneumatically delivered DNA-coated particles, such as the gold particles used in a "gene gun," and inorganic chemical approaches such as calcium phosphate transfection. Another method, ligand- mediated gene therapy, involves complexing the DNA with specific ligands to form ligand- DNA conjugates, to direct the DNA to a specific cell or tissue.

It has been found that injecting plasmid DNA into muscle cells yields high percentage of the cells which are transfected and have sustained expression of marker genes. The DNA of the plasmid may or may not integrate into the genome of the cells. Non- integration of the transfected DNA would allow the transfection and expression of gene product proteins in terminally differentiated, non-proliferative tissues for a prolonged period of time without fear of mutational insertions, deletions, or alterations in the cellular or mitochondrial genome. Long-term, but not necessarily permanent, transfer of therapeutic genes into specific cells may provide treatments for genetic diseases or for prophylactic use. The DNA could be reinjected periodically to maintain the gene product level without mutations occurring in the genomes of the recipient cells. Non-integration of exogenous DNAs may allow for the presence of several different exogenous DNA constructs within one cell with all of the constructs expressing various gene products.

Particle-mediated gene transfer methods were first used in transforming plant tissue. With a particle bombardment device, or "gene gun," a motive force is generated to accelerate DNA-coated high density particles (such as gold or tungsten) to a high velocity that allows penetration of the target organs, tissues or cells. Particle bombardment can be used in in vitro systems, or with ex vivo or in vivo techniques to introduce DNA into cells, tissues or organs.

Electroporation for gene transfer uses an electrical current to make cells or tissues susceptible to electroporation-mediated gene transfer. A brief electric impulse with a given field strength is used to increase the permeability of a membrane in such a way that DNA molecules can penetrate into the cells. This technique can be used in in vitro systems, or with ex vivo or in vivo techniques to introduce DNA into cells, tissues or organs.

Carrier mediated gene transfer in vivo can be used to transfect foreign DNA into cells. The carrier-DNA complex can be conveniently introduced into body fluids or the bloodstream and then site specifically directed to the target organ or tissue in the body. Both liposomes and polycations, such as polylysine, lipofectins or cytofectins, can be used.

Liposomes can be developed which are cell specific or organ specific and thus the foreign

DNA carried by the liposome will be taken up by target cells. Injection of immunoliposomes that are targeted to a specific receptor on certain cells can be used as a convenient method of inserting the DNA into the cells bearing the receptor. Another carrier system that has been used is the asialoglycoportein/polylysine conjugate system for carrying

DNA to hepatocytes for in vivo gene transfer.

The transfected DNA may also be complexed with other kinds of carriers so that the DNA is carried to the recipient cell and then resides in the cytoplasm or in the nucleoplasm.

DNA can be coupled to carrier nuclear proteins in specifically engineered vesicle complexes and carried directly into the nucleus.

The interferons of the invention can also be given prophylactically to individuals known to be at high risk for developing new or re-current cancers. Accordingly, an aspect of the invention encompasses methods for prophylactic prevention of cancer in a subject, comprising administrating to the subject an effective amount of an IFN- v polypeptide and/or a derivative thereof.

According to the present invention, IFN-v may be used in combination with other compositions and procedures for the treatment of diseases. For example, a tumor may be treated conventionally with surgery, radiation or chemotherapy combined with IFN-v and then IFN-v may be subsequently administered to the patient to extend the dormancy of micrometastases and to stabilize any residual primary tumor.

In one embodiment of the therapeutic methods described herein, the IFN-v is administered in combination with another interferon. Applicants have discovered a synergistic effect between IFN-v and an INF-α. Accordingly, in one embodiment of the methods described herein for the treatment of mammal or other animal by administering an

IFN-v polypeptide, the method further comprises the coadministration of an interferon alpha (IFN-αs), an interferon beta (H⁷N-(Ss), or an interferon gamma (IFN-γ). In another embodiment, the method further comprises the coadministration of an interferon alpha IFN- α, IFN-jS, IFN-ε, DFN-K, IFN-τ or IFN-ω. In one embodiment, the WN-v and the second interferon act synergistically in any of the assays described herein , such as the anti-viral assays, and anti-proliferation assays and the immunomodulatory assays.

In one embodiment of the therapeutic methods described herein, the animal or individual to be treated is administered a composition comprising (i) an interferon polypeptide having an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6% or 100% identical to the amino acid sequence selected from SEQ ID NO: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71, or to the mature forms of these IFN polypeptides; (ii) a second interferon polypeptide selected from an IFN-α, IFN-/3, IFN-ε, IFN-K, IFN-τ or IFN-ω; and (iii) a pharmaceutically acceptable carrier. In one embodiment, the interferon polypeptide of part (i) above is identical to either to full-length or the mature forms of the interferons of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, optionally where at least 1, 2, 3, 4 or 5 cysteine residues are replaced with another residue, preferably a serine residue. In another embodiment, the IFN polypeptides of part (i) above is a polypeptide comprising a portion of an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to the amino acid sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 57, 61, 63, 65, 67, 69 and 71, or to the mature forms of these IFN polypeptides, wherein said portion is a functional portion, such as a portion that retains a substantial anti-viral, anti-proliferative activity or immunomodulatory activity.

The invention also provides methods of treating an avian viral infection. In one embodiment, the avian viral infection is an influenza infection. In another embodiment, the avian infections is caused by a virus selected from avian pneumovirus, avian encephalitis virus, avian influenza, avian leukosis, fowl pox, infectious bronchitis virus, infectious bursal disease virus, Newcastle disease virus and reovirus. In one embodiment, the avian species is a turkey or a chicken. The invention also envisions treating game birds. In one embodiment, the bird to be treated is selected from African greys, Amazon parrots, parakeets, caiques, canaries, cockatiels, cockatoos, conures, doves, eclectus, falcons, crows, vultures, ostrich, eagles, finches, such as Gouldian and zebra finches; peafowl, peacocks, poultry, quail and other game birds, waterfowl, hawk-headed parrots, love birds such as Fischer's, Masked, Peachfaced, and Abyssinians; macaws; parrotlets; pigeons including homing pigeons and fancy frilled pigeons; pionus parrots; African parrots such as senegals, greater vasa, red-bellied parrots, and Meyer's parrots; monk parakeets, soft bills, such as mynahs, toucans, touracos, tanagers, and other related species. In one embodiment, the method of treating an avian viral infection comprises administering to the avian species a composition comprising an IFN-III avian polypeptide or biologically-active fragment thereof. In certain embodiments, the IFN-III avian polypeptide comprises an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3, 99.6 % or 100% identical to the amino acid sequence selected from (i) SEQ ID NO:29; (ii) or to the mature form of SEQ ID NO:29; or (iii) to a fragment of SEQ ID NO:29 having at least 50 residues in length. In one embodiment, the polypeptide has substantial antiviral activity, such as in QT35 quail cells. Example 4 provides an antiviral assay in quail cells. By substantial activity, it is meant that the portion of the polypeptide retains, on a molar basis, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of the antiviral or antiproliferative of the mature protein set forth in SEQ IN NO:29. In certain related embodiments, the present invention also includes fragments of the full-length IFN polypeptides of SEQ ID NOs: 29. In one embodiment, the fragments are N- or C-terminal fragments, preferably fragments having anti-viral activity. In one embodiment, the IFN-III avian polypeptides has the sequence set forth in SEQ IN NO:29, or the mature form of said sequences. In another embodiment, at least 1, 2, 3, 4 or 5 of the cysteine residues have been substituted with other residues, such as with serine residues.

The invention also provides methods of detecting the level of EMF-P gene products in a sample from an animal, preferably a mammal. In one embodiment of the methods described herein for detecting the level of a IFN-V gene product, determining a level of a IFN-P gene product in a sample obtained from a mammal comprises determining the level of IFN-P mRNA in the sample. The level of IFN-P mRNA in the sample can be assessed by combining oligonucleotide probes derived from the nucleotide sequence of IFN-P with a nucleic acid sample from the individual, under conditions suitable for hybridization. Hybridization conditions can be selected such that the probes will hybridize only with the specified gene sequence. In one specific embodiment, conditions can be selected such that the probes will hybridize only with an altered nucleotide sequences, such as but not limited to, splice isoforms, and not with unaltered nucleotide sequences; that is, the probes can be designed to recognize only particular alterations in the nucleic acid sequence of IFN-P, • including addition of one or more nucleotides, deletion of one or more nucleotides or change in one or more nucleotides (including substitution of a nucleotide for one which is normally present in the sequence).

Methods of quantitating mRNA in a sample are well-known in the art. In a particular embodiment, oligonucleotide probes specific to IFN-P can be displayed on an oligonucleotide array or used on a DNA chip, as described in WO 95/11995. The term "microarray" refers to an array of distinct polynucleotides or oligonucleotides synthesized on a substrate, such as paper, nylon or other type of membrane, filter, chip, glass slide, or any other suitable solid support. Microarrays also includes protein microarrays, such as protein microarrays spotted with antibodies. Other techniques for detecting IFN-P mRNA levels in a sample include reverse transcription of mRNA, followed by PCR amplification with primers specific for a IFN-P mRNA. In one embodiment of the methods described herein, determining a level of a IFN-p gene product in a sample obtained from an individual comprises determining the level of IFN-P polypeptide in the sample. In one embodiment of the methods described herein, determining a level of a IFN-p gene product comprises determining the level of a putative secreted portion of human IFN-F in the sample, such as but not limited to, a secreted IFN-P polypeptide spanning from amino acid residue 24-193 of SEQ ID NO:3.

The level of a IFN-P polypeptide can be determined by contacting the biological sample with an antibody which specifically binds to IFN-/' and determining the amount of bound antibody, e.g., by detecting or measuring the formation of the complex between the antibody and a IFN-p polypeptide. Antibodies may be used which bind to a secreted form of IFN-P, or to altered forms of the IFN-P protein, including addition proteolytic products.

The term antibody as used herein is intended to include whole antibodies, e.g., of any isotype (IgG, IgA, IgM, IgE, etc) and fragments which are also specifically reactive with IFN-P or a complex comprising IFN-P. Antibodies can be fragmented using conventional techniques and the fragments screened in the same manner as described above for whole antibodies. For example, F(ab')₂ fragments can be generated by treating antibody with pepsin. The resulting F(ab')₂ fragment can be treated to reduce disulfide bridges to produce Fab' fragments. The antibodies used in the present invention is further intended to include bispecific and chimeric molecules, as well as single chain (scFv) antibodies. The IFN-P antibodies may include trimeric antibodies and humanized antibodies, which can be prepared as described, e.g., in U.S. Patent No: 5,585,089. Single chain antibodies may also be used to detect levels of IFN-p polypeptides. All of these modified forms of antibodies as well as fragments of antibodies are intended to be included in the term "antibody". Antibodies which bind to IFN-P may also be obtained commercially. For example, a purified IgG Antibody specific for residues 51-108 of human IFN-P may be purchased from Phoenix Pharmaceuticals, Inc., 530 Harbor Boulevard, Belmont, CA 94002, U.S.A.. Alternatively, a rabbit polyclonal antibody to human IFN-P may also be purchased from Bio Vision, Inc, 980 Linda Vista Avenue, Mountain View, CA 94043.

The antibodies can be labeled (e.g., radioactive, fluorescently, biotinylated or HRP- conjugated) to facilitate detection of the complex. Appropriate assay systems for detecting IFN-P polypeptide levels include, but are not limited to, Enzyme-Linked Immunosorbent Assay (ELISA), competition ELISA assays, Radioimmuno-Assays (RIA), immunofluorescence, western, and immunohistochemical assays which involve assaying a IFN-p gene product in a sample using antibodies having specificity for IFN-p. Numerous methods and devices are well known to the skilled artisan for the detection and analysis of IFN-J' of the instant invention. With regard to polypeptides or proteins in test samples, immunoassay devices and methods are often used. See, e.g., U.S. Pat. Nos. 6,143,576; 6,113,855; 6,019,944; 5,985,579; 5,947,124; 5,939,272; 5,922,615; 5,885,527; 5,851,776; 5,824,799; 5,679,526; 5,525,524; and 5,480,792, each of which is hereby incorporated by reference in its entirety. These devices and methods can utilize labeled molecules in various sandwich, competitive, or non-competitive assay formats, to generate a signal that is related to the presence or amount of an analyte of interest. Additionally, certain methods and devices, such as but not limited to, biosensors and optical immunoassays, may be employed to determine the presence or amount of analytes without the need for a labeled molecule. See, e.g., U.S. Pat. Nos. 5,631,171 and 5,955,377, each of which is hereby incorporated by reference in its entirety, including all tables, figures and claims.

An amplified immunoassay, such as but not limited to, immuno-PCR can also be used. In this technique, the antibody is covalently linked to a molecule of arbitrary DNA comprising PCR primers, whereby the DNA with the antibody attached to it is amplified by the polymerase chain reaction. See E. R. Hendrickson et al., Nucleic Acids Research 1995; 23, S22-529 (1995) or T. Sano et al., in "Molecular Biology and Biotechnology" ed. Robert A. Meyers, VCH Publishers, Inc. (1995), pages 458-460.

Levels of IFN-J' polypeptides may also be determined using protein microarrays. Methods of producing protein microarrays that may be adapted for detecting levels of IFN-F protein in a clinical sample are described in the art (see for example of Xiao et al. (2005)

MoI Cell Endocrinol; 230(l-2):95-10; Protein Microarrays (2004) Mark Schena (Ed) Jones & Bartlett Publishers, Inc.). U.S. Patent Pub. 2003/0153013 describes methods of detecting proteins, e.g. antigens or antibodies, by immobilizing antibodies in a protein microarray on a membrane and contacting the microarray with detection proteins which can bind to the proteins to form protein complexes. Similarly, U.S. Patent Pub. 2004/0038428 describes methods of constructing protein microarrays.

Alternatively, the level of IFN-J' polypeptide may be detected using mass spectrometric analysis. Mass spectrometric analysis has been used for the detection of proteins in serum samples (see for example Wright et «/.(1999) Prostate Cancer Prostatic Dis 2:264-76, and Petricoin et al. (2002) Lancet.; 359 (9306): 572-7). U.S. Patent No. 2003/0013120 describes a system and method for differential protein expression and a diagnostic biomarker discovery system that may be adapted for measuring levels of IFN- v polypeptides in a fluid sample. Mass spectroscopy methods include Surface Enhanced Laser Desorption Ionization (SELDI) mass spectrometry (MS), SELDI time-of-flight mass spectrometry (TOF-MS), Maldi Qq TOF, MS/MS, TOF-TOF, ESI-Q-TOF and ION-TRAP. In one embodiment of the methods described herein, determining the level of a IFN- v gene product in a biological sample comprises determining the level of a IFN-p polypeptide having a post-translational modification, such as a phosphorylated, glycosylated or proteolytic processed EFN-// polypeptide. Phosphorylation can include phosphorylation of a tyrosine, serine, threonine or histidine. Antibodies that can be used to detect these modifications can include phosphotyrosine-specific antibody, phosphoserine-specific antibody, phosphoserine-specific antibody, and phospho-threonine-proline antibody, for example. Proteolytic processing may be detected by using antibodies specific for a cleaved product or by amino acid sequencing of the EFN-P protein.

EXEMPLIFICATION

The invention now being generally described, it will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention, as one skilled in the art would recognize from the teachings hereinabove and the following examples, that other variant polypeptides, anti-viral assays, anti-proliferation assays, cell lines, purification assays, data analysis methods, and the like, all without limitation, can be employed, without departing from the scope of the invention as claimed.

The practice of aspects of the present invention may employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N.

Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent No: 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, VoIs. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1986).

Various publications, patents, and patent publications are cited throughout this application the contents of which are incorporated herein by reference in their entirety.

Example 1: New Interferons and Class 2 Cytokines and Their Receptors

An analysis of the evolution of the Interferons and Class 2 cytokines and their receptors led us to a number of new human and animal sequences. In addition, as described in detail in the attached paper, we discovered cytokine receptors in invertebrates for the first time. This led to a new understanding of innate and adaptive immunity. A brief summary of all the sequences (protein and DNA sequences) are given with each sequence.

Example 2; Identification of EFN-v, a new class of interferons

We discovered three new classes of interferons, IFN-v, IFN-αω and IFN III. IFN-v is present in human cells as a pseudogene, but since the pseudogene has been stable for about 10 million years or more in primates, it is likely it has some functions that the other interferons lack. Human IFN-v (Sequence 3, protein sequence) is a previously unrecognized (undiscovered) novel type I IFN present in humans. It represents a new class of interferons of the type I IFN family that is present in several mammalian genomes. This novel type I IFN is intact in the cat genome, but in the human genome it is a pseudogene because it contains a stop codon (END) at position 78. This new interferon may have novel activities useful therapeutically. It may have other activities in the form of the pseudogene.

Example 3: Anti- Viral and Anti-proliferative Activity of human IFN-v The plasmid pEF3 (Krause et ah, 2002) is an expression vector which allows a gene of interest to be transcribed in mammalian cells. The gene of interest is driven by a fragment of the human EF- lα promoter, and transcription terminated and the resulting mKNA message stabilized by the bovine growth hormone polyadenylation sequence. The plasmid is capable of being stably retained in either the mammalian or bacterial cells by two selection markers: a neomycin resistance gene to protect the host mammalian cell and an ampicillin resistance gene to protect the host bacterial cells. The plasmid pET15b (Novagen) is an expression vector which allows a cDNA of interest to be transcribed in Escherichia coli cells. The gene of interest is driven by the bacteriophage T7 promoter and the lac operator, and transcription terminated with the bacteriophage T7 terminator sequence. Retention of the plasmid in the Escherichia coli host is facilitated by the ampicillin resistance gene. This plasmid also encodes the Lad protein, which binds to the lac operon to enhance expression of the target gene.

Antiviral assays were performed as previously described (Rubinstein, S., Familletti, P.C., and Pestka, S. (1981) "Convenient Assay for Interferons," J. Virol. 37, 755-758; Familletti, P.C., Rubinstein, S., and Pestka, S. (1981) "A Convenient and Rapid Cytopathic Effect Inhibition Assay for Interferon," in Methods in Enzymology, Vol. 78 (S. Pestka, ed.), Academic Press, New York, 387-394; Interferons" Vol. 78, Methods in Enzymology, Edited by Sidney Pestka, Academic Press, New York, 1981, 632 pp.; "Interferons" Vol. 79, Methods in Enzymology, Edited by Sidney Pestka, Academic Press, New York, 1981, 677 pp.; "Interferons" Vol. 119, Methods in Enzymology, Edited by Sidney Pestka, Academic Press, New York, 1986, 845 pp.; Familletti, Phillip C, Pestka, Sidney and Rubinstein, Sara, Improved Interferon Assay, U.S. Patent 4,241,174, December 23, 1980; Friesen, Heinz- Jurgen and Pestka, Sidney, Preparation of Homogeneous Human Fibroblast Interferon, U.S. Patent 4,289,689, September 15, 1981; Pestka, Sidney and Rubinstein, Menachem, Protein Purification Process and Product, U.S. Patent 4,289,690, September 15, 1981; Pestka,

Sidney and Rubinstein, Menachem, Protein Purification Process and Product, U.S. Patent 4,503,035, March 5, 1985; Goeddel, David V. and Pestka, Sidney, Microbial Production of Mature Human Leukocyte Interferon K and L, U.S. Patent 4,801,685, January 31, 1989; Friesen, Heinz- Jϋrgen and Pestka, Sidney, Preparation of Homogeneous Human Fibroblast Interferon, U.S. Patent 5,015,730, May 14, 1991; Pestka, Sidney, Human Leukocyte

Interferon Hu-IFN-alpha.OOl, U.S. Patent 5,789,551, August 4, 1998; Pestka, Sidney, DNA Encoding Human Interferon-αOOl, U.S. Patent 5,869,293, February 9, 1999; Pestka, Sidney, Method of identifying proteins modified by disease states related thereto, U.S. Patent 6,001,589, Dec. 14, 1999; Pestka, Sidney, Mutant human interferons, U.S. Patent 6,299,870, October 9, 2001; Pestka, Sidney, Modified interferons, U.S. Patent 6,300,474, October 9, 2001; Goeddel, David V., and Pestka, Sidney, Microbial production of mature human leukocyte interferons, U.S. Patent 6,482,613, November 19, 2002; Goeddel, David V. and Pestka, Sidney, Microbial production of mature human leukocyte interferons, U.S. Patent 6,610,830, August 26, 2003). Antiproliferative assays were performed as previously reported described

("Interferons" Vol. 78, Methods in Enzymology, Edited by Sidney Pestka, Academic Press, New York, 1981, 632 pp.; "Interferons" Vol. 79, Methods in Enzymology, Edited by Sidney Pestka, Academic Press, New York, 1981, 677 pp.; "Interferons" Vol. 119, Methods in Enzymology, Edited by Sidney Pestka, Academic Press, New York, 1986, 845 pp.; Evinger, M., Maeda, S., and Pestka, S. (1981) "Recombinant Human Leukocyte Interferon Produced in Bacteria Has Antiproliferative Activity," J. Biol. Chem. 256, 2113-2114; Yumi Takemotol,2, Hirohisa Yanol, Seiya Momosakil, Sachiko Ogasawaral, Naoyo Nishidal,2, Sakiko Kojirol,2, Toshiharu Kamura2 and Masamichi Kojiro (2004) Clinical Cancer Research 10, 7418-7426; Evinger, M., Rubinstein, M., and Pestka, S. (1981) "Antiproliferative and Antiviral Activities of Human Leukocyte Interferons," Arch.

Biochem. Biophys. 210, 319-329; Rehberg, E., Kelder, B., Hoal, E.G., and Pestka, S. (1982) "Specific Molecular Activities of Recombinant and Hybrid Leukocyte Interferons," J. Biol. Chem. 257, 11497 '-11502).

Because it was an apparent pseudogene, we removed the stop codon so that we could express the protein (Sequence 5, modified human IFN-v, protein sequence). The human IFN-v nucleotide sequence was modified to yield an IFN-v protein sequence that expressed the entire protein. The stop codon was replaced with GIn. This modified protein converted the stop codon to GIn at amino acid 78/nucleotide 232, yielding an active type I IFN. Nucleotide 232 T was mutated to C to convert the TAA stop codon to CAA encoding GIn. It has novel therapeutic activities. Sequence 6 represents the DNA sequence of the modified human IFN-v. Nucleotide 232 T of the native IFN-v was mutated to C to convert the TAA stop codon to CAA encoding GIn.

The feline IFN-v (Sequence 25, feline IFN-v, protein sequence) is a previously unrecognized (undiscovered) novel type I IFN present in cats. It represents a new class of interferons of the type I IFN family that is present in several mammalian genomes. This novel type I IFN is intact in the cat genome, but in the human genome it is a pseudogene because it contains a stop codon (END) at position 78. This type I IFN represents a new class of IFN-v interferons that encodes pseudogenes in primates, pigs, and mice, but encodes an intact IFN in monotremes (egg-laying mammals) and in the cat genome. This new interferon may have novel activities useful therapeutically. It may have other activities in the form of the pseudogene.

We prepared a vector expressing full length human IFN-v (modified to remove the stop codon) in E. coli and in mammalian cells. The E. coli product was expressed and purified, then assayed for antiviral activity and antiproliferative activity. The full length IFN-v exhibited antiviral and antiproliferative activity in HeLa cells; however, on bovine MDBK cells little antiproliferative activity was observed, although antiviral activity was strong. Thus, IFN-v will have therapeutic use in humans and animals. The feline IFN-v could be used in cats for various therapeutic indications.

Human IFN-v is most likely a pseudogene because there is a stop codon in the middle of the open reading frame that is easily identified and is well conserved in its putative amino acid sequence relative to other type I IFNs. Consequently, we would predict that this sequence, if translated, would yield a truncated and inactive protein. Because the putative open reading frame is so well conserved relative to other type I IFNs, we hypothesized that this pseudogene could encode an active IFN if the stop codon were mutated to encode an amino acid. Human IFN-v pseudogene was cloned by amplification of Sequence 4 from human genomic DNA by the Polymerase Chain Reaction (PCR). The source of the genomic DNA was from HeLa cells, a human cervical carcinoma cell line. Primer sequences 51 and 52 were used to amplify the human IFN-v pseudogene cDNA to obtain PCR product 1 that was inserted into the bacterial expression vector pET15b. The resulting plasmid, pET15b-human IFN-v, was produced. Next, the premature stop codon in plasmid pET15b-human IFN-v was mutated by PCR with plasmid pET15b-human IFN-v as a template, and mutagenic overlapping primer sequences 53 and 54. The resulting plasmid was called pET15b-human IFN-v-Gln78, and the presence of the proper mutation and integrity of the remaining sequence was confirmed. Plasmid pET15b-human IFN-v-Gln78 was introduced into E. coli BL21(DE3)CP that was used to synthesize the mature modified human IFN-v (Sequence 4, missing the signal peptide, amino acids Thr-2 -Asp-23). The mature IFN-v-Gln78 exhibited antiviral activity on HeLa and MDBK cells with encephalomyocarditis virus (EMCV) and vesicular stomatitis virus (VSV), respectively. Also, the mature IFN-v-Gln78 exhibited potent antiproliferative activity on HeLa cells, but exhibited only slight antiproliferative activity on MDBK cells.

Example 4: Antiviral Activity of Chicken interferon sequence IFN HI, a new class of interferons.

Chicken IFN III (Sequence 29, protein sequence) is a previously unrecognized (undiscovered) novel chicken type I IFN. This chicken IFN is more homologous to mammalian type I EFNs than the previously known chicken interferons. This IFN may have applications in avian immunology and treatment of viral and other diseases in chickens and other avian species. Chicken IFN III was expressed in animal cells and in E. coli. Antiviral activity was seen in QT35 quail cells. This interferon could be an effective interferon for prevention and treatment of diseases such as viral diseases in avian species.

Chicken IFN III was cloned by amplification of Sequence 30 from genomic DNA of the domestic chicken by the Polymerase Chain Reaction (PCR). The source of the genomic DNA was from embryonic chicken tissue. Primer sequences 55 and 56 were used to amplify the chicken IFN III cDNA to obtain PCR product 2 that was inserted into the mammalian expression vector pEF3 to create plasmid pEF3-chicken-IFN-III. Plasmid pEF3-chicken-IFN-III was transfected into COS-I cells to synthesize chicken IFN III (Sequence 31). The mature chicken IFN III exhibited antiviral activity on QT35 quail cells with vesicular stomatitis virus (VSV) as the challenge virus.

Example 5: IFN-αω, a new class of interferons

A wide variety of animal species encode genes for this new class of interferons, IFN-αω. Porcine IFN-αω (Sequence 17, protein sequence) is a previously unrecognized (undiscovered) interferon. This sequence represents a new class of interferons of the type I IFN family that is present in several mammalian genomes, but not the human genome. This new class of porcine interferons may have novel activities that may be useful therapeutically. Bovine IFN-αω 1 and IFN-αω2 (Sequences 19 and 21, protein sequences) are previously unrecognized (undiscovered) interferons. These sequences represents a new class of interferons of the type I IFN family that is present in several mammalian genomes, but not the human genome. This new class of interferons may have novel activities that may be useful therapeutically. Feline IFN-αω (Sequence 23, protein sequence) is a previously unrecognized (undiscovered) feline IFN-αω. This sequence represents a new class of interferons of the type I IFN family that is present in several mammalian genomes, but not the human genome. This new class may have novel activities that may be useful therapeutically.

Example 6. Cvtofluorographic Analysis of Cells for Expression of Class I MHC and Other Surface Antigens such as Tumor Associated Antigens

Cells are seeded in 24-well plates at a density of about 25,000 cells/well (1 μL/well) and are treated with the indicated concentrations and types of interferon for about 72 hr by which time the cells are nearly confluent. Cells are trypsinized, transferred to 1.5 mL tubes, and washed with complete F12 medium. HLA-B7 antigens on 16-9 cells are detected by incubating the cells with 15 μL of culture supernatant from the hybridoma line producing mouse monoclonal anti-HLA antibody W6/32 (Jung et al, 1988; Hibino et al, 1992; Soh et al, 1994a; Soh et al, 1994b) for 30 min at 4⁰C. Cells are washed with complete medium and resuspended in 15 μL of fluorescein isothiocyanate-conjugated (FITC-conjugated) goat anti-mouse IgG (Cappel, R&D Systems, and other sources) diluted to 80 μg/mL and incubated for 30 min at 4⁰C, after which they are washed with complete medium and resuspended in 200 μL of cold complete medium for the immediate analysis of live cells. If cells had to be fixed for future analysis, they are washed twice with PBS, resuspended in 15 μL of 3% (w/v) paraformaldehyde in PBS, and incubated from 1 to 16 hr at 4⁰C. The fixed cells are washed with PBS and finally resuspended in 200 μL PBS. Samples are analyzed on a Coulter Epics Profile Cytofluorograph and other fluorescence activated cell sorters. For each analysis, 10,000 events are accumulated and analyzed on CytoLogic software and other software. Analysis of expression of Class II MHC surface antigens is assessed similarly (Sarkar et al, 1995). Moreover, expression of tumor associated antigens (TAA) on cells in response to IFN-v is expected to be measured as described for human IFN-α (Schlom et al, 1984; Greiner et al, 1984, 1986, 1987). References: Jung et al. Somatic Cell and Molecular Genetics 14, 583-592; Hibinoet al. J. Biol. Chem. 267, 3741-3749; Sarkaret al. Intl. J. Oncology 7, 17-24; Sohet al. Cell 76, 793-802; Sohet al. J. Biol. Chem. 269, 18102-18110.; Schlom et al. Cancer 54, 2777-2794; Greiner et al. Cancer Res. 44, 3208- 3214; Greiner et al. Cancer Res. 46, 4984-4990; Greiner et al. Science 235, 895-898.

Example 7. Antiviral Assay

Human interferon activity is measured by a cytopathic-effect inhibition assay on human WISH cells, human A549 cells, or bovine MDBK cells with vesicular stomatitis virus (VSV), encephalomyocardidis virus (EMCV), influenza virus (Familletti et al, 1981; Rubinstein et al, 1981; Sόh et al, 1994b). Parental and transfected CHO-Kl, CHO- 16-9 and other modified CHO cells are also assayed for resistance to EMCV or VSV infection by a cytopathic-effect inhibition assay (Familletti et al, 1981). Interferon activity is expressed in units/mL calibrated against the NIH reference standard for human IFN-αA (Gxa-01 -901 - 535). References: Li, B-L., Langer, J.A., Schwartz, B., and Pestka, S. (1989) "Creation of Phosphorylation Sites in Proteins: Construction of a Phosphorylatable Human Interferon Alpha," Proc. Natl Acad. ScL U.S.A. 86, 558-562; Familletti, P.C., Rubinstein, S., and Pestka, S. (1981) "A Convenient and Rapid Cytopathic Effect Inhibition Assay for Interferon," in Methods in Enzymology, Vol. 78 (S. Pestka, ed.), Academic Press, New York, 387-394. Rehberg, E., Kelder, B., Hoal, E.G., and Pestka, S. (1982) "Specific Molecular Activities of Recombinant and Hybrid Leukocyte Interferons," J. Biol. Chem. 257, 11497-11502; Rubinstein, S., Familletti, P.C., and Pestka, S. (1981) "Convenient Assay for Interferons," J. Virol. 37, 755-758. Staehelin, T., Hobbs, D.S., Kung, H.-F., and Pestka, S. (1981a) "Purification of Recombinant Human Leukocyte Interferon (IFLrA) with

Monoclonal Antibodies," in Methods in Enzymology, Vol. 78 (S. Pestka, ed.), Academic Press, New York, 505-512. Staehelin, T., Hobbs, D.S., Kung, H.-F., Lai, C-Y., and Pestka, S. (1981b) "Purification and Characterization of Recombinant Human Leukocyte Interferon (IFLrA) with Monoclonal Antibodies," J. Biol. Chem. 256, 9750-9754. Wang, P., Izotova, L., Mariano, T.M., Donnelly, RJ., and Pestka, S. (1994) "Construction and Activity of Phosphorylatable Human Interferon-αB2 and Interferon-αA/D," J. Interferon Res. 14, 41- 46.

Example 8. Production of Monoclonal and Polyclonal Antibodies: Polyclonal antibodies are prepared using purified IFN- v injected into rabbits. It is expected that polyclonal antibodies will also be developed in sheep, goats and other animal species. Monoclonal antibodies are expected to be produced as described (Staehelin et at, 1981) in mice and in other species as well. References: References: Staehelin, T., Durrer, B., Schmidt, J., Takacs, B., Stocker, J., Miggiano, V., Stahli, C, Rubinstein, M., Levy, W.P., Hershberg, R., and Pestka, S. (1981) "Production of Hybridomas Secreting

Monoclonal Antibodies to the Human Leukocyte Interferons," Proc. Natl. Acad. Sd U.S.A. 78, 1848-1852.

Example 9. Binding of IFN-p Interferon to Receptors Hu-IFN-αA and is prepared as previously reported (Staehelin et at, 1981a;

Staehelin et at, 1981b; Rehberg e^ α/., 1982; Moschera e? α/., 1982). Hu-IFN-αA-Pl and Hu-IFN-αB2-P are prepared as described (Li et at, 1989; Wang et at, 1994). Purified IFN- v is assessed for viral activity. Genetically-engineered phosphorylatable Hu-IFN-αA (Hu- IFN-αA-Pl) and Hu-IFN-αB2 (Hu-IFN-αB2-P) are phosphorylated with the catalytic subunit of bovine heart cAMP-dependent protein kinase and [γ-³²P]ATP as described (Li et at, 1989; Wang et at, 1994). The specific activity of the labeled interferon is 3-5 x 10⁶ cpm/pmole at the time used. For binding studies, cells are treated with trypsin and collected from tissue culture flasks. Binding of interferons to cells is performed in a volume of 0.1 ml containing 0.5-1 x 10⁶ cells as described (Soh et at, 1994b). The [³²P] -interferon bound to cells is separated from the unbound [³²P] -interferon by sedimentation through a cushion of 10% sucrose in PBS (Langer and Pestka, 1986; Flores et at, 1991). Nonspecific binding of [³²P]Hu-IFN-CcA-Pl and [³²P]Hu-IFN-αB2-P is determined by the addition of a 200-fold excess of unlabeled recombinant Hu-IFN-αA. The nonspecific binding is subtracted from the total radioactivity in each case to yield the cpm bound specifically. For competition studies, cells are collected from tissue culture flasks and resuspended at 2 x 10⁶ cells/ml for Daudi cells, and 8 x 10⁶ cells/ml for CHO-Kl/αRy9-4 and 16-9/αRy9-2 cells. The Chinese hamster cells, CHO-Kl/αRy9-4 and 16-9/αRy9-2 cells, are modified so they contained the two human type I interferon receptor chains, Hu- IFN-αRl and Hu-IFN-αR2. To 100 μl of cells is added 10 μl of non-radioactive Hu-IFN- as to produce final concentrations in the range of 2 x 10^"12 M to 4 x 10^'8 M, and 1 μl [³²P]Hu-IFN-αA-Pl (final concentration, 1 x 10^"10 M; 0.8 x 10⁵ cpm). After incubation at room temperature for 1 hr with intermittent shaking, bound [³²P]Hu-IFN-αA-Pl is measured as described above. The IFN-v competes with [³²P]Hu-EFN-OcA-Pl for binding to cells. References: Flores, L, Mariano, T.M., and Pestka, S. (1991) "Human Interferon Omega(ω) Binds to the α/β Receptor," J. Biol. Chem. 266, 19875-19877; Langer, J.A., and Pestka, S. (1985) "Changes in Binding of Alpha Interferon IFN-αA to HL60 Cells During Myeloid Differentiation," J. Interferon Res. 5, 637-649.

Example 10. Cross-linking of [³²PlHu- IFN- p to Cell-Surface Receptors

HeLa and Daudi cells are harvested, pelleted and resuspended in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum at a density of 1 x 10⁷ cells/ml. Cells are incubated with 5 x 10⁶ cpm/ml of [³²P]Hu-EFN-OcA-Pl or [³²P]Hu- IFN-αB2-P at room temperature for 1 hour in a volume of 0.2 ml with or without a 200-fold excess of unlabeled IFN-αA. The cells are washed and resuspended in 0.1 ml of cold PBS (pH adjusted to 8.0 with 1 M potassium borate) and the chemical cross-linker disuccinimidyl suberate (Pierce) in dimethyl sulfoxide is added to a final concentration of 500 :M (Rashidbaigi et ah, 1985; Langer et ah, 1986). After incubation on ice for 30 min, 50 mM TrisΗCl (pH 8.0) is added to quench the reaction for 5 min. The cells are washed with ice-cold PBS and pelleted. [³²P]Interferon:receptor complexes are extracted with 0.1 ml of 1% (v/v) Triton X-100 in PBS containing protease inhibitors (Ronnett et ah, 1984). The detergent extracts are then analyzed on 7.5% polyacrylamide gels in the presence of SDS (Laemmli, 1970). Gels are dried under vacuum and autoradiographed. By modification of these procedures, EFN-v is cross-linked to HeLa and Daudi cells and it is expected that proteins associated with EFN-v will be identified. References: Rashidbaigi, A., Kung, H.-F., and Pestka, S. (1985) "Characterization of Receptors for Immune Interferon in U937 Cells with ³²P-Labeled Human Recombinant Immune Interferon," J. Biol. Chem. 260, 8514-8519. Langer, J.A., Rashidbaigi, A., Pestka, S. (1986) Preparation of ³²P-labeled murine immune interferon and its binding to the mouse immune interferon receptor. J. Biol. Chem. 21: 9801 -9804; Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227: 680-685; Ronnett, G.V., Knutson, V.P., Kohanski, R.A., Simpson, T.L., and Lane, M.D. (1984) Role of glycosylation in the processing of newly transfected insulin proreceptor in 3T3-LI adipocytes. J. Biol. Chem. 259: 4566-4575 Example 11. Immunomodulation by IFN-F in NK-92 Activation Assay

NK-92 growth medium: Alpha modified MEM (Sigma M4526) supplemented with 10-20 units/ml TL-2 (PBL Biomedical Laboratories 11810-1), 0.292 g/L L-glutamine (Sigma G7513) and 10% FBS (Sigma F2442). For maintenance, 3 ml cells are added to 15 ml growth medium.

NK-92 assay medium: Alpha modified MEM supplemented with L-glutamine and 10% FBS, without IL-2. Because TL-2 causes the NK-92 cells to secrete interferon gamma, an overnight incubation in medium is done in the absence of IL-2 prior to performing experimental work to reduce the background secretion level of interferon gamma.

Cells are disaggregated by aspirating several times, spun down, and the supernatant aspirated. Cells are then resuspended in 15 ml NK-92 assay medium and placed into T-75 flask at 37⁰C (5.0% CO₂) overnight. Cells are disaggregated by aspirating several times, if necessary, and brought to a concentration of 5.0 x 10⁵ cells/ml. Interferon standards and test samples are diluted in assay buffer to the desired concentration, and 150 μl of sample is loaded into each well of a 96-well microtiter plate. The Standard Curve is usually run from 300 ng/ml to 0.005 ng/ml using sequential 3 fold dilutions. (Human interferon alpha-2a, Hu-DFN-α2a, typically exhibits an EC50 in the range of 0.7 to 4 ng/ml.). A 150 μl aliquot of NK-92 cells is then added to each well, followed by incubation for 24 hr (37⁰C, 5.0% CO₂). The test cells are incubated with recombinant nature Hu-IFN-?' or the N-terminal fragment of IFN-v stretching from residue 24-77 of SEQ ID NO:3. Supematants are collected and either immediately frozen at -7O⁰C or examined with a Human Interferon Gamma (Hu-IFN- γ ELISA to measure interferon gamma in the samples. A 100 μl aliquot of cell supernatant or a dilution thereof is loaded straight into the first well of a row in a 96 well microtiter plate. The ELISA assay is performed as per the manufacturer's instructions (PBL #11500- 1) to quantitate Human Interferon Gamma in the medium. It is expected that both the mature TFN-v polypeptide, and the fragment, will modulate IFN-γ release into the medium.

Example 12. Growth Inhibition Assay MDA-MB-231 breast cancer cell line (ATCC #HTB-26) is used for growth inhibition and Caspase 3/7 activation assays. Cells are maintained in DMEM supplemented with 10% FBS.MDA-MB-231 breast cancer cells (2 x 10⁴ cells/ml, 100 μl) are seeded in 96- well flat bottom microtiter plates, and incubated for 4 to 5 hr. Then 100 μl of serial dilutions of interferons is added to rows of a microtiter plate, including recombinant nature Hu-IFN-F , the N-terminal fragment of IFN-F stretching from residue 24-77 of SEQ ID NO:3, and cys-to-ser variants. The concentration of the interferon serial dilutions typically ranges from 50 ng/ml to 0.2 ng/ml. After 5 additional days at 37⁰C, medium is removed and cell viability is measured by MTS reduction assay (CellTiter 96 Aqueous Non-radioactive Cell Proliferation Assay, Promega, #G5430). Growth inhibition is calculated as percent of control (untreated) cells. It is expected that both the mature TFN-v polypeptide, the fragment and the variants will inhibit the growth of the cancer line in a dose-dependent manner.

Example 13. Caspase 3/7 Activation Assay

MDA-MB-231 breast cancer cell line (ATCC #HTB-26) is used for Caspase 3/7 activation assays. Cells are maintained in DMEM supplemented with 10% FBS. A 100 μl aliquot of cells (10⁵ cells/ml) are seeded in black wall 96-well microtiter plates, grown overnight, then treated with interferon (typically from 20 ng/ml to 0.04 ng/ml) for 24 hr at 37⁰C. Recombinant nature Hu-IFN-?' or the N-terminal fragment of IFN-P stretching from residue 24-77 of SEQ ID NO:3 are used in the assays. Caspase 3/7 activity is determined by cleavage of the proluminescent DEVD substrate (Caspase-Glo 3/7 Assay, Promega, #G8092).

Example 14. Synergy ot^*IFN-v with other Type I Interferons, other Interferons and Cytokines: Growth inhibition and Caspase 3/7 assays are carried out as described above with

IFN-v serial dilutions extending from 50 ng/ml to 0.2 ng/ml and Hu-IFN-α2 remaining constant (e.g., 10 ng/ml). Similarly, additional assays are executed with Hu-IFN-α2 serial dilutions (ranging from about 50 ng/ml to 0.2 ng/ml) and IFN-v remaining constant. IFN-v and IFN- α2a are highly synergistic in inhibition of cell growth. Growth inhibition of MDA-231 breast cancer cells is evaluated at various concentrations of IFN-α2a and of IFN-v for 72 hours, and the number of viable cells remaining is measured by the microculture tetrazolium assay (MTA). The EC50s of IFN-v and IFN-α2a were 3.5 ng/ml and 5.0 ng/ml, respectively. However, the presence of both IFN-v and IFN-α2a increased the growth inhibition immensely so that the combined IFN-v and IFN-α2a exhibited an EC50 of 0.01 ng/ml. Thus, the synergy with the combination was 30 - 100 fold higher than the sum of the individual interferons. We expect that IFN-v fragments also have a similar synergistic effect.

Example 15. TALL-104 Killing Enhancement Assav: The TALL-104 cell (ATCC CRL-11386) is a lymphoblastic! leukemia cell with characteristics of a non-MHC restricted Cytotoxic T-cell. As such, this assay serves as a model of interferon enhancement of Immune Effector cell activity. TALL-104 cells are grown in Iscove's modified Dulbecco's medium (Sigma 13390) supplemented with (Sigma G7513) and 20% FBS (Sigma F2442) supplemented with 100 units/ml recombinant human IL-2 (PBL 11810-1) at 37⁰C with 9% CO₂. Cells are deprived of IL-2 for 1-5 days prior to assay by growth in the above media without IL-2. The A549 target cells (see A549 antiviral assay for growth conditions) are plated at 1-2 x 10⁵ cells/ml in 0.5 ml in a 24-well tissue culture plate. After 4 hr, TALL-104 cells that have been deprived of IL-2 for 1-5 days are added at 5-10 x 10⁵ cells/ml in 0.5 ml. Then, various interferon dilutions (from 20 ng/ml to 0.0002 ng/ml) in a volume of 100 :1 are added to the wells and the cell mixture incubated overnight in a tissues culture incubator at 37⁰C and 9% CO₂, including IFN dilutions of recombinant nature Hu-IFN-J' or the N-terminal fragment of IFN- v stretching from residue 24-77 of SEQ ID NO:3. After 20 hr, media are removed and the wells washed twice with Dulbecco's PBS. MTS (Promega G5421) in DMEM with 10% FBS are added to each well. After 4 hours the color in the wells is determined by measuring absorption at 490 nm (A490) and compared to medium alone with no cells as a background control. The tetrazolium compound MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2- (4-sulfophenyl)-2H-tetrazolium, inner salt; MTS] and the electron coupling reagent (phenazine ethosulfate; PES) are used to determine inhibition of proliferation of cells in culture (Promega Technical Manual TB245, revised 4/05) by measuring absorbance at 490 nm (A490). The level of the product (formazan) measured in culture medium by absorbance at 490 nm is directly proportional to the number of live cells in culture. The 100% killing is defined by the background control of medium with MTS while 0% killing is defined as the level of A549 cells cultured without the TALL-104 cells. In this assay about 30-50% of the target cells are killed with no added interferon; the number of target cells killed increases by 50% with as little as 12 pg/ml added interferon, the number of target cells is expected to increase in the presence of either the recombinant nature Hu-IFN-J' or the N-terminal fragment of IFN-J' stretching from residue 24-77 of SEQ ID NO:3.

Example 16. Roles of Interferons on Viral Pathogens and Toll-like receptors

Various pathogens or their components can activate innate immune signaling in humans. Toll-like receptors (TLR) are transmembrane proteins expressed by many cell types in humans. There are greater than 10 distinct TLR's that are activated upon interaction with unique pathogen associated molecular patterns (PAMP). Activation of TLRs by PAMP interaction induces a signal transduction cascade that results in the production of several inflammatory cytokines, including interferons. Previous studies have shown that interferon production can be dependent not only upon the specific TLR/PAMP interaction, but also can be cell-type specific. The biological importance of TLRs has been well established using knock-out mouse strains. Mice defective in TLR signaling often display increased disease states or death in response to pathogen challenge. Conversely, overexpression of inflammatory cytokines in response to TLR activation can lead to severe illness including septic shock. Both type I (IFN-α and IFN-β) as well as type II IFN-γ have been shown to be expressed and secreted in response to TLR ligands; and expect IFN-v and fragments thereof to be induced in response to pathogens. This includes natural and artificial agonists of TLR ligands. Therefore, we anticipate that IFN-v is expressed in certain cell lineages following TLR/PAMP interactions.

To analyze the level of IFN-v expression in different cell lines treated with natural and synthetic TLR agonists, RNA is purified from treated cells and amplified with reverse transcriptase and random hexamers or gene specific primers. DNA probes are prepared with sequences complimentary to regions of the coding sequences of IFN-v. These include single probes for Northern blot and Ribonuclease Protections assays of the isolated RNA, and primer sets for PCR mediated amplification of distinct regions of the coding sequence. The PCR methods are also executed using specific fluorescent dyes (e.g., SYBR green) to allow for quantitative analysis of gene expression. These experiments identify the variety of pathogens that invoke IFN-v expression. In addition, gene knock-down experiments with the use of antisense RNA, RNAi, shRNA, and other antisense methods directed to IFN-v delineate the role of IFN-v in limiting pathogen infection.

Example 17. Activation of Immune Cells (T-cells, Monocytes, Macrophages, Natural Killer cells. Dendritic Cells) by Interferons:

Interferons stimulate the immune system and activate cells of the immune system to kill tumor cells and other cells (Herberman et al, 1981, 1982; Ortaldo et al, 1983a, 1983b, 1984; Li et al, 1990). It is expected that recombinant nature Hu-IFN-P or the N-terminal fragment of JFN-v comprising from residue 24-77 of SEQ ID NO: 3 will both enhance the killing of tumor cell in such assays. References: Herberman, R.B., Ortaldo, J.R., Rubinstein, M., and Pestka, S. (1981) "Augmentation of Natural and Antibody-Dependent Cell-Mediated Cytotoxicity by Pure Human Leukocyte Interferon," /. Clin. Immunol. 1, 149-153; Herberman, R.B., Ortaldo, J.R., Mantovani, A., Hobbs, D.S., Kung, H.-F., and Pestka, S. (1982) "Effect of Human Recombinant Interferon on Cytotoxic Activity of Natural Killer (NK) Cells and Monocytes," Cell Immunol. 67, 160-167; Ortaldo, J.R., Mason, A., Rehberg, E., Moschera, J., Kelder, B., Pestka, S., and Herberman, R.B. (1983a) "Effects of Recombinant and Hybrid Recombinant Human Leukocyte Interferons on Cytotoxic Activity of Natural Killer Cells," J. Biol. Chan. 258, 15011-15015; Ortaldo, J.R., Mantovani, A., Hobbs, D., Rubinstein, M., Pestka, S., and Herberman, R.B. (1983b)

"Effects of Several Species of Human Leukocyte Interferon on Cytotoxic Activity of NK Cells and Monocytes," Int. J. Cancer 31, 285-289; Ortaldo, J.R., Herberman, R.B., Harvey, C, Osheroff, P., Pan, Y.-C.E., Kelder, B., and Pestka, S. (1984) "A Species of Human Interferon That Lacks the Ability to Boost Human Natural Killer Activity," Proc. Natl. Acad. Sd. U.S.A. 81, 4926-4929; Li, B-L., Zhao, X.-X., Liu, X.-Y., Kim, H.S., Raska, Jr., K., Ortaldo, J., Schwartz, B., and Pestka, S. (1990) " Alpha-Inter fer on Structure and Natural Killer Cell Stimulatory Activity," Cancer Research 50, 5328-5332.

Type I interferons are known to induce major histocompatibility complex type I (MHCI) receptor expression on cells of the immune system. This facilitates antigen presentation of pathogens and recruits other cells of the immune system. Peripheral blood lymphocyte cells isolated from healthy volunteers are treated with increasing doses of DFN- v. The effects of treatment are analyzed over a time course period of 24hrs. Controls include mock-treated samples (negative control) as well as IFNα treated cells (positive control). A fraction of the treated cells is collected, RNA isolated, and the level of MHC expression determined by RT-PCR and MHCI specific primer pairs. Separately, the remaining cells are combined with fluorescein- and phycoerythrin (PE)-labeled antibodies directed against MHCI. These are analyzed by flow cytometry to determine the total level of cell surface expression of MHCI. Additionally, cells are mixed with additional antibodies that are immunoreactive to specific cell types such as activated/inactivated CD 8 T cells, antigen presenting cells and dendritic cells. These antibodies, conjugated to distinct fluorescent dyes other than PE, allow for combined MHC expression patterns and cell type using multiple channels on the flow cytometer. These experiments are then followed up with homogeneous cell populations to determine if the effects observed in the peripheral blood lymphocyte assays are due to autocrine or paracrine activation.

Peripheral Blood Lymphocyte Proliferation Assays:

Experiments are performed as described for Alternative Assays for MHC Class I Upregulation except at an increased length of time (several days) and analyzed as described above to determine the effects on cell proliferation. Specific Cell Type Activation Assays:

Type I and Type II T-helper cells (T_H1 and T_H2) are known to play distinct roles in the control of infections. T_H1 have been shown to facilitate cell-mediated immunity by directly activating cytotoxic T cells (CTL), monocytes and macrophages which results in the control of intracellular pathogens including viruses, bacteria or protozoans. In contrast T_H2 responses are invoked by extracellular pathogens like helminths that directly activate humoral immunity components including B-cells, neutrophils and Mast cells. Type I IFNs are known to promote a T_H1 response by directly activating NK cells killing activity as well as IFNγ production which promotes T_H1 differentiation. Dendritic cells mature in response to specific cytokine signals and pathogens. It is possible that IFN-v can effect the activity and proliferation patterns of cells of the immune system. Some assays to be performed are:

Helper T Cell Differentiation:

CD4+ are isolated through magnetic beads coated with specific anti-CD4 monoclonal antibody and employ through fluorescence activated cell sorting (FACS).

Dendritic Cell Maturation:

GM-CSF and IL-4 are added to the cells and cultured for 7 days with or without addition of IFN-v. We analyze the phenotype of immature/mature dendritic cells such as MHC class I, HLA-DR₅ CD14, CD40, CD45, CD80, CD83 and CD86. Alternately, DC are used in DC-ELISPOT assay. ELISA assays are performed to determine cytokine expression patterns of treated cells.

B-cell Proliferation and Activation: Flow cytometry is performed to measure B-cell receptor and CD21, a marker of mature B- cells. Antibody production can be measured by ELISA.

Example 18. Induction of Transcription and Translation of Genes by Interferons:

Many genes are induced by interferons (Der et ai, 1998). Both Type I and Type II interferons induce specific genes. It is expected that IFN-p and fragments of IFN-P will induce specific sets of genes.

Reference: Der, S.D., Zhou, A., Williams, B.R., Silverman, R.H. (1998) "Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays," Proc. Natl. Acad. ScL USA 95, 15623-15628. Example 19. Synergy of IFN-P with other Type I Interferons, other Interferons and Cytokines:

IFN-P and IFN-α2a are highly synergistic in inhibition of cell growth. Growth inhibition of MDA-231 breast cancer cells was evaluated at various concentrations of IFN- α2a and of IFN-P for 72 hours and the number of viable cells remaining were measured by the microculture tetrazolium assay (MTA). The EC50 of I IFN-P and IFN-α2a were 3.5 ng/ml and 5.0 ng/ml, respectively. However, the presence of both IFN-P and IFN-α2a increased the growth inhibition immensely so that the combined IFN-P and IFN-α2a exhibited and EC50 of 0.01. Thus, the synergy with the combination was 30 - 100 fold higher than the sum of the individual interferons. We expect that IFN-P fragments, as well as variants were one or more cysteine residues are replaced with a serine residue, will retain this synergistic activity.

Example 20. Transfection of IFN-P into cells Transfections of plasmids expressing interferons into cells or introduction of interferon genes via viral constructs have exhibited some efficacy in treating and preventing tumors in mice (Sarkar et al, 1995; Colombo and Forni, 1994; Ferrantini et al, 1993). Such results suggest that these gene therapy approaches could have a positive effect treating diseases. Stem cells could be used to deliver the interferon to tumors and other tissues. We expect that IFN-v and fragments of IFN-v are able to be used in these gene therapy approaches to treat cancers and other diseases. References: Sarkar, S., Flores, L, De Rosa, C, Ozzello, L., Ron, Y., and Pestka, S. (1995) "Injection of Irradiated B 16 Melanoma Genetically Modified to Secrete IFN-α Causes Regression of an Established Tumor," Intl. J. Oncology 7, 17-24. Colombo MP and Fomi G (1994) "Cytokine gene transfer in tumor inhibition and tumor therapy: where are we now?" Immunol. Today 15, 48-51. Ferrantini M. Proietti E. Santodonato L. Gabriele L. Peretti M. Plavec I. Meyer F. Kaido T. Gresser I and Balardelli F (1993) "i -Interferon gene transfer into metastatic friend leukemia cells abrogated tumorigenicity in immunocompetent mice: antitumor therapy by means of interferon-producing cells," Cancer Res. 53, 1107-1112.

Example 21: Antiviral Activity of IFN-v and IFN-v Peptide on HeLa Cells

Antiviral assays were performed with MDBK cells (4.5 x 10⁴/well) in 96-well microtiter plates as described (Familletti et al, 1981; Rubinstein et al, 1981). Interferons were added to wells of 96-well microtiter plates, then 4.5 xlO⁴ MDBK cells were added to each well. Four hours later, vesicular stomatitis virus (VSV; 2 x 10⁴ plaque forming units/ml) were added to wells and plates were incubated for an additional 18 - 24 hrs at 37⁰C in a tissue culture incubator at 5% CO₂. After 24 hrs, the media was removed from the wells, then the plates were stained with crystal violet. Cell control wells contained MDBK cells only with no interferon or virus; virus control wells contained MDBK cells and VSV, but no interferon. The 50% inhibition of cells was measured by visual evaluation of the stained cells.

The full length mature Hu-IFN-v WT (Sequence 5, amino acids 24 - 193), the full length mature Hu-IFN-v mutant 2 (Sequence 67, amino acids 24 - 193) and the Hu-IFN-v Peptide (Sequence 69, amino acids 24 - 77) was used in these experiments. Hu-EFN-αA was used a positive control. All the interferons exhibited antiviral activity. The Hu-IFN-v peptide (Sequence 69) showed antiviral activity as well. Table 1: Antiviral Activity of IFN-v and IFN-v Peptide on HeLa Cells:

Example 22: Antiproliferative Activity of IFN-v on HeLa Cells

Samples of IFN-v and IFN-αA (IFN-<x2a) were diluted to 200 ng/ml in DMEM containing 10% FBS. A buffer control was included that was diluted in the same manner as the IFN-v sample, but did not have any interferon. All samples were prepared in triplicate. The experiments were carried out in 96-well microtiter tissue culture plates. To prevent evaporation in the wells over the course of the 4 days of the experiment, the perimeter wells were filled with 250 μl of sterile distilled water. The first well of each row contained 200 μl of the 200 ng/ml IFN-v. The 2^nd - 9^th wells contained 100 μl media. Serial two-fold dilutions were done across the row of wells by carrying over 100 μl of solution from well one to the adjacent well two, and continuing across the plate. The 10^th well of each row did not receive any IFN, but served as a cell control, only containing medium and cells.

HeLa cells were prepared from one T75 tissue culture flask. The old medium was aspirated and the adherent cell layer washed with 13 ml of phosphate buffered saline (PBS). The PBS was removed and 2 ml of trypsin-EDTA was added and the flask was kept in the laminar flow hood for 3 minutes, then medium was added (8 ml) and the cells were triturated to break up any cell aggregates. After the cells were counted, a cell suspension was prepared containing 20,000 cells/ml; then 100 μl of the cell suspension (2,000 cells) were added to each well of the microtiter plate containing the interferons, the buffer or the cell controls (see above paragraph). The microtiter plate was then incubated for 4 days at 37⁰C at 5% CO₂.

Upon 4 days of incubation, the viable cells were measured by the MTS assay (Promega CellTiter 96 Aqueous assay). After the old medium was removed from each well, 120 μl of a solution containing 99 μl of fresh medium and 20 μl MTS, and 1 μl of PMS was added to each well. The plate was incubated at 37⁰C for 2 hr, after which the optical density (OD) of each well was measured with a Molecular Devices UV Max absorbance microplate reader at a wavelength of 490 nm. The interferon concentrations in the wells (1 - 9) are shown in the Table in ng/ml. The percentage of growth inhibition is shown for IFN-v and IFN-αA as a function of the ng/ml of interferon. All assays were done in triplicate and the average shown under growth inhibition. The full length mature Hu-IFN-v (Sequence 5, amino acids 24 - 193) was used in these experiments. Hu-IFN-αA was used a positive control. The interferons used were purified preparations. IFN-v was substantially more effective than IFN-αA in inhibiting growth of HeLa cells. Table 2: Inhibition of Growth of HeLa Cells by IFN-v and IFN-αA:

Example 23: Expression and Purification of IFN- v in Escherichia coli

Expression and production of E. coli. The plasmid pET15b containing the DNA sequence encoding Hu-IFN-v was transformed into the Escherichia coli strain BL21DE3 codon plus. A single colony from the freshly transformed E. coli was picked from an agar plate, then transferred to a 15 ml plastic tube containing 5 ml LB (Luria Bertani Broth) medium with ampicillin (final concentration 100 μg/ml) and chloroamphenicol (final concentration 34 μg/ml) at 37⁰C overnight with continuous shaking. On the next day, 0.75 ml of the overnight culture was transferred into a glass flask containing 50 ml LB medium with ampicillin and chloroamphenicol and grown at 37⁰C overnight with continuous shaking. The next day 10 ml of the culture was transferred to each of several four liter glass flasks with 1 liter of medium (a 1 :100 dilution of the overnight culture). The optical density at 600 nm (OD600) was monitored eveiy hour until the OD600 reached a level between 0.4 and 0.6. The expression of IFN-v was induced by adding 1 M IPTG to the culture to a final concentration 0.5 mM. The bacterial mass was harvested from the flasks 6 - 8 hours after IPTG induction. About 4 - 5 grams of bacterial pellet were obtained from 1 liter of culture. Purification of IFN-v from bacterial mass. Approximately 16 grams of bacterial pellet was resuspended in 50 ml Buffer A (50 mM Tris-HCl, pH 8.0, 40 mM NaCl, 5 mM EDTA, 1 mM PMSF, 0.2 mg/ml lysozyme, and 50 μl protease inhibitor cocktail - Sigma Catalog # 2714) and sonicated at 9OW for 40 sec on ice 3 times. After sonication, 50 ml of Buffer B (50 mM Tris-HCl, pH 8.0, 0.8 M NaCl, 100 mM EDTA and 2% NP-40 v/v) were added and the suspension was incubated at 3O⁰C overnight with shaking. The suspension was centrifuged at 12,000 x g, 4⁰C for 20 min and the pellet was resuspended in 150 ml Buffer C (50 mM Tris-HCl, pH 8.0, 400 mM NaCl, 50 mM EDTA, 1% NP-40). The suspension was sonicated under the same conditions as above and incubated at 3O⁰C for 3 hours with shaking. After centrifugation, the pellet was resuspended in 150 ml Buffer D (50 mM Tris-HCl, pH 8.0, 0.4 M NaCl, 50 mM EDTA, 0.5% NP-40 and 5 M urea) and sonicated as described above. After incubation at 3O⁰C for 2 hours with shaking, the sonicate was centrifuged, the pellet was resuspended in 50 ml distilled water, sonicated again and centrifuged. After this step, the pellet may be used in the next step or could be frozen at -70⁰C for later use. Solubilization of inclusion bodies was performed by resuspending the washed inclusion bodies in 25 ml distilled water. This suspension was sonicated, DTT was added to a final concentration of 50 mM, and the suspension was incubated at 3O⁰C for 30 min. The pH of this solution was quicldy adjusted to pH 12 with 5 M NaOH while stirring and pH monitored directly during this procedure with a pH meter. An equal volume of 5% Zwittergent 3-14 (Calbiochem, Catalog # 693017) was added to the suspension 1 minute after the suspension reached pH 12 to give a final concentration of Zwittergent of 2.5%. Solubilization was allowed to continue for an additional 2 minutes, followed by rapid adjustment to pH 8.0 with 2 M Tris-HCl, pH 8.0. The solution was then dialyzed against Buffer E (100 mM Tris-HCl, pH 8.0, 150 mM NaCl, 3 mM DTT and 0.05% Zwittergent 3-14) at room temperature for 2 hr and then at 4⁰C for 48 hr during which the dialysis buffer was changed twice.

Chromatography. All the chromatography steps were performed with the AKT A™ FPLC system (Amersham Pharmacia Biotech). The protein solution after dialysis was concentrated with a Centriprep centrifugal filter unit (Ultracel YM- 10 membrane, Millipore Catalog# 4304) for full length IFN-v or a Ultracel YM-3 membrane (Millipore Catalog# 4320) for the IFN-v peptide by centrifugation at 3,000 x g, 4⁰C. Size-exclusion chromatography was performed on the following columns: a HiLoad 26/60 Superdex 75 preparation grade column (Amersham Pharmacia Biotech Catalog# 17-1070-01), a Superose 12 HR 10/30 column (Amersham Pharmacia Biotech Catalog #17-0538-01) and HR 10/30 Superdex Peptide column (Amersham Pharmacia Biotech Catalog #17-1453-01). The columns were pre-equilibrated with 2 - 3 volumes of Buffer E. The first size-exclusion chromatography was performed on a HiLoad 26/60 Superdex 75 preparation grade column with a flow rate 1.7 ml/min. The eluted fractions of 8 ml each were collected with the Frac- 900 fraction collector (Amersham Pharmacia Biotech). Fractions with proteins were analyzed with a 12% NuPAGE gel (Invitrogen, Catalog #0342BOX). The protein fractions corresponding to IFN-v were collected, concentrated with a Centriprep centrifugal filter unit as described above and rechromatographed on a second Superose 12 HR 10/30 column for full length IFN-v or HR 10/30 Superdex Peptide column (Amersham Pharmacia Biotech Catalog #17-1453-01) for the IFN-v peptide equilibrated with Buffer E. The flow rate for both these columns was 0.5 ml/min. The eluates were collected into fractions of 1 ml. Samples in the fractions were analyzed by a 12% NuPAGE gel. The fractions corresponding to IFN-v were used for activity assays. Example 24; Antiproliferative Effects of Hu-IFN-P Alone and in Combination with Hu-IFN-αA

MD A-MB -231 is an ER-negative, highly invasive cell line originating from hard to treat breast cancers, and is widely used as an in vitro model for screening substances with antitumor activities.

MDA-MB-231 cells are maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum, trypsinized, counted and seeded at 2 x 10⁴ cell/ml (100 μl/well) in 96 well micro titer plates. After 4 to 5 hr incubation at 37⁰C (cells are well attached), 100 μl of serial dilutions of interferon is added to each well and incubated for 5 additional days at 37⁰C. Medium is then removed, 100 μl of fresh medium containing MTS reagent (6: 1 ratio) is added, and the plates incubated for 3 to 4 hr at 37⁰C. Color in the wells is assessed by measuring absorption at 490 nm (A490) and compared to the medium alone with no cells as a background control. Table 3 presents growth inhibition activities (expressed as percent of untreated cells) of Hu-IFN-?' and of Hu-IFN-αA at different concentrations, each alone or in combination. The data show that the combination of Hu-IFN- v and of Hu-IFN-oA provides an enormous reduction in cell growth. Table 3: Antiproliferative Effects of Hu-IFN-^ and Synergy with Hu-IFN-αA:

¹ Hu-IFN-αA is constant at 10 ng/ml while Hu-IFN-p is varied over the indicated concentration range.

²EC50 is effective dose of IFN (ng/ml) yielding 50% inhibition of control cell growth.

Example 25: Caspase 3/7 Activation by Hu-IFN-ϊ' Alone and in Combination with Hu-

IFN-αA

Growth inhibition activity of WN-V on MDA-MB-231 cells can be due to either growth arrest or cell death. Activation of Caspase 3 irreversibly leads to apoptosis (programmed cell death).

MDA-MB-231 cells were seeded at 10⁵ cells/ml in 100 μl/well, grown overnight, then treated with interferon (typically from 20 ng/ml to 0.04 ng/ml) for 24 hr at 37⁰C. Caspase 3/7 activity is determined by cleavage of a peptide-aminoluciferin substrate (DEVD) liberating free aminoluciferin which is used as a substrate by luciferase to generate light. The "glow-type" luminescent signal is measured in a Victor-3 (Perkin-Elmer) luminometer. The luminescence generated by interferon-treated cells is calculated by subtracting the luminescence from the blanks and untreated controls (background). Data are presented as fold increase of Caspase 3/7 activity over the untreated control cells. The activation of Caspase 3/7 by Hu-IFN-ϊ' and Hu-IFN-αA, alone or in combination is shown in Table 4. The data show that the combination of Hu-IFN-ϊ' and of Hu-IFN-oA provides an increase in Caspase 3/7 activity. Table 4: Caspase 3/7 Activation by Hu-IFN-ϊ' and Synergy with Hu-IFN-αA

³ Hu-IFN-αA is constant at 10 ng/ml while Hu-IFN-P is varied over the indicated concentration range.

Example 26: Caspase 3/7 Activation by Hu-IFN-P Fragment, Full Length Hu-IFN-y, and Hu-IFN-αA

Sequence 3 of the Hu-IFN-P contains stop codon at position 78 in the coding sequence thus truncating the mature protein to a fragment. We tested the purified fragment and the full length Hu-IFN-P for activation of Caspase 3/7 enzymes. Surprisingly the activities of both the fragment and the full length IFN- v showed similar activation of

Caspase 3/7 (expressed as fold increase over the untreated control cells) on MDA-MB-231 cells (Table 5).

Table 5: Caspase 3/7 Activation by Hu-IFN-P and Hu-IFN-P fragment:

Example 27: Antiproliferative Effects with Fe-IFN-P and Synergy with Other Interferons

Mature Fe-IFN-P (Sequence 25) was tested for inhibition of growth of AK-D feline cell line by the same experimental conditions and protocol used for MDA-MB-231 cells. Briefly, 2 x 10³ cells/well were treated with indicated IFN concentrations alone or in combination (Table 6) for 5 days. Cell viability is determined by MTS reduction assay. Table 6 presents the data as growth inhibition (percent of untreated control cells). The data show that IFN-v together with IFN-αA or IFN-αD synergize to enhance growth inhibition of AK-D feline cells.

Table 6: Antiproliferative Effects of HU-IFN-P and Synergy with Other Interferons:

Example 28. IFN-v expression patterns in response to TLR agonists:

Various pathogens or their components can activate innate immune signaling in humans. Toll-like receptors (TLR) are transmembrane proteins expressed by many cell types in humans. There are greater than 10 distinct TLR's which are activated upon interaction with unique pathogen associated molecular patterns (PAMP). Activation of TLRs by PAMP interaction induces a signal transduction cascade that results in the production of several inflammatory cytokines, including interferons. Previous studies have shown that interferon production can be dependent not only upon the specific TLR/PAMP interaction, but also can be cell-type specific. The biological importance of TLRs has been well established using knock-out mouse strains. Mice defective in TLR signaling often display increased disease states or death in response to pathogen challenge. Conversely, overexpression of inflammatory cytokines in response to TLR activation can lead to severe illness including septic shock. The expression pattern of IFN-v has not been evaluated in response to pathogens. Both type I (IFN-α and IFN-β) as well as type II IFN-g have been shown to be expressed and secreted in response to TLR ligands. This includes natural and artificial agonists. Therefore, it is plausible that IFN-v may be expressed in certain cell lineages following TLR/PAMP interactions. We will be performing assays to analyze the level of IFN-v expression in different cell lines treated with natural and synthetic TLR agonists. The RNA will be purified from treated cells and amplified using reverse transcriptase and random hexamers or gene specific primers. DNA probes will be produced with sequences complimentary to regions of the coding sequences of IFN-v. These will include single probes for Northern blot and Ribonuclease Protections assays of the isolated RNA, and primer sets for PCR mediated amplification of distinct regions of the coding sequence. The PCR methods will also be used with specific fluorescent dyes (e.g. SYBR green) to allow for quantitative analysis of gene expression. These experiments will provide insight into which pathogens invoke IFN-v expression. Following these experiments, gene knock-down experiments can be performed including antisense and RNAi directed against IFN-v to determine the role of the protein in limiting pathogen infection.

Example 29. IFN-v Role in Adaptive Immunity

Cytokines including interferons are known to exert direct effects upon cells they interact with that posses the cognate receptors and signal transduction machinery. IFNs including IFN-v have been shown to exert a direct effect that can produce an antiviral state and/or limit proliferation within an exposed cell. Interferons can also interact with cells especially those of lymphocytic origins to induce these cells to produce protein factors that can produce autocrine and paracrine signaling secondary to the primary IFN stimulation. The analysis of these events can be conducted with isolated cell populations or within mixture of cells. Since IFN-v is present in the human genome as a truncated pseudogene, it may possess properties unique as compared to other interferons including down-regulation of classic type I activities. The full-length protein produced by elimination of the stop codon could also produce activities that are excitatory or inhibitory as compared to other type I IFNs. Thus the studies we conduct include IFN-αA which serves as a type I standard. In addition, IFNs are often produced simultaneously in activated cells. Therefore, following single addition studies, combination studies are performed with IFN-v and other interferons and cytokines to determine if IFN-v can alter their known properties. These experiments are performed in vitro. Future studies with highly purified samples will be performed in vivo to validate the relevance of in vitro results.

Table of Sequences:

Sequence 1, rhesus monkey IFN-α30, protein sequence

This sequence is a previously unrecognized (undiscovered) novel primate IFN-α. This sequence is similar to a family of novel primate IFN-α 's not found in the human or chimpanzee genomes. It could possess novel therapeutic activities.

1 Met Ala Leu Ser Phe Ser Leu Leu Met Ala VaI VaI VaI Leu Ser

16 Tyr Lys Ser lie Cys Ser Leu GIy Cys Asp Leu Pro GIn lie His 31 Ser Leu GIy Asn Arg Arg Ala Leu lie Leu Leu Ala Gin Met GIy

46 Arg lie Ser Pro Phe Ser Cys Leu Lys Asp Arg His Asp Phe GIy

61 Phe Pro GIn GIu GIu Phe Asp GIy Asn GIn Phe GIn Lys Ala GIn

76 Ala Met Ser VaI Leu His GIu Met He GIn GIn Thr Phe Asn Leu 91 Phe Ser Thr Lys Asp Ser Ser Ala Ala Trp GIu Gin Asn Leu Leu

106 GIu Lys Phe Ser Ala GIu Leu Tyr GIn GIn Leu Asn Asp Leu Lys

121 Ala Cys VaI lie Ala GIu Pro GIy Met GIu Asp Thr Pro Leu Met

136 Asn GIu Asp Ser lie Leu Ala VaI Lys Lys Tyr Phe GIn Arg He

151 Thr Leu Tyr Leu Thr GIu Lys Lys Tyr Ser Pro Cys Ala Trp GIu 166 VaI VaI Arg Thr GIu He Met Arg Ser Leu Ser Phe Ser Thr Asn 181 Leu GIn Lys Arg Leu Arg Arg Lys Asp

Sequence 2, rhesus monkey IFN-α30, cDNAnucleotide sequence 1 ATGGCCCTGT CCTTTTCTTT ACTGATGGCT GTGGTGGTGC TCAGCTACAA

5i ATCCATCTGC TCTCTGGGCT GTGΆTCTGCC TCAGATCCAC AGCCTGGGTA ioi ATAGGAGGGC CTTGATACTC CTGGCACAAΆ TGGGAAGGAT CTCTCCGTTC

151 TCCTGTCTGA AGGACAGACA TGACTTTGGA TTCCCCCAGG AGGAGTTTGA

201 TGGCAACCAG TTCCAGAAGG CTCAAGCCAT GTCTGTCCTC CATGAGATGA 251 TCCAGCAGAC CTTCAATCTC TTCAGCACAA AGGACTCATC TGCTGCTTGG

301 GAACAGAACC TCCTAGAAAA ATTTTCCGCT GAGCTTTACC AGCAACTGAA

351 TGACCTGAAA GCCTGTGTGA TAGCAGAGCC TGGGATGGAA GACACTCCCT

401 TGATGAATGA GGACTCCATC CTGGCTGTGA AGAAATACTT CCAAAGAATC 451 ACTCTCTATC TGACGGAGAA GAAATACAGC CCATGTGCCT GGGAGGTTGT 501 CAGAACAGAA ATCATGAGAT CTCTCTCTTT TTCAACAAAC TTGCAAAAAA 551 GATTAAGGAG GAAGGATTGA

Sequence 3, human IFN-v pseudogene, protein sequence

This sequence is a previously unrecognized (undiscovered) novel type I IFN present in humans. It represents a new class of interferons of the type I IFN family that is present in several mammalian genomes. This novel type I IFN is intact in the cat genome, but in the human genome it is a pseudogene because it contains a stop codon (END) at position 78.

This new interferon may have novel activities useful therapeutically. It may have other activities in the form of the pseudogene. 1 Met Thr Ser GIn Cys Leu Leu Asp Trp Ala Leu VaI Leu Leu

Leu 16 Thr Thr Thr Ala Phe Ser Leu Asp Cys His Phe GIn Arg Cys Lys

31 GIy Asn Trp GIu lie Leu GIu His Leu Lys Asn Leu GIy GIu Lys 46 Phe Pro Leu GIn Cys Leu Lys Asp Arg Ser Asn Phe Arg Phe Phe

61 GIn VaI Ser Lys Ser Asn Leu Phe Ser Lys GIu Asn Ala Leu He

76 Ala Lys END GIu Met Leu GIn GIn He Phe Asn Thr Phe Ser Leu

91 Asn VaI Ser GIn Ser Phe Trp Asn GIu Ser Ser Leu GIu Arg Phe

106 Leu Ser Arg Leu Tyr GIn GIn He GIu Lys Thr GIu VaI Cys Leu 121 GIu GIn GIu Thr Arg Lys GIu GIy Arg Ser Leu Leu GIn Arg GIy

136 Asn Thr He Phe Arg Leu Lys Asn Tyr Phe GIn GIy He His Asn

151 Tyr Leu His His GIn Asn Tyr Ser Asn Cys Ala Trp GIu VaI He

166 His VaI GIu He Arg Arg GIy Leu Leu Phe He GIu GIn Cys

Thr

181 Arg Arg Leu GIn Tyr GIn GIu Thr GIy Tyr Leu His Lys

Sequence 4, human IFN-v pseudogene, cDNA nucleotide sequence

1 ATGACTAGTC AATGCTTGCT GGATTGGGCC TTGGTGCTAC TTCTCACCAC

51 TACTGCATTC TCTCTGGACT GTCACTTTCA AAGGTGCAAG GGCAACTGGG

101 AGATTTTAGA ACATTTAAAA AACCTAGGAG AAAAATTTCC TCTGCAATGT

151 CTAAAGGACA GGAGCAACTT CAGATTCTTC CAGGTTTCTA AAAGTAACCT 201 GTTTTCAAAG GAAAATGCCC TCATTGCCAA ATAAGAAATG TTACAGCAGA

251 TATTCAACAC TTTCAGCCTT AATGTCTCCC AATCTTTTTG GAATGAAAGC

301 AGCTTGGAGA GATTCCTAAG TAGACTTTAT CAGCAAATAG AGAAGACAGA

351 GGTGTGTTTG GAGCAGGAAA CCAGGAAAGA GGGCCGTTCA CTCTTGCAAA

401 GGGGGAATAC CATATTTAGA CTAAAAAATT ATTTCCAAGG GATTCACAAC 451 TACTTACACC ACCAAAATTA TAGCAACTGT GCCTGGGAGG TCATCCATGT

501 TGAAATCCGA AGGGGTCTAC TATTTATTGA ACAGTGCACA AGAAGACTCC 551 AATACCAAGA AACAGGTTAT TTACATAAAT AA

Sequence 5, modified human IFN-v, protein sequence.

The human IFN-v nucleotide sequence was modified to yield an IFN-v protein sequence that expressed the entire protein. The stop codon was replaced with GIn. This modified protein converted the stop codon to GIn at amino acid 78/nucleotide 232, yielding an active type I IFN. Nucleotide 232 T was mutated to C to convert the TAA stop codon to CAA encoding GIn. It has novel therapeutic activities.

1 Met Thr Ser GIn Cys Leu Leu Asp Trp Ala Leu VaI Leu Leu Leu

16 Thr Thr Thr Ala Phe Ser Leu Asp Cys His Phe GIn Arg Cys Lys

61 Gin VaI Ser Lys Ser Asn Leu Phe Ser Lys GIu Asn Ala Leu He

76 Ala Lys GIn GIu Met Leu GIn GIn He Phe Asn Thr Phe Ser Leu

91 Asn VaI Ser GIn Ser Phe Trp Asn GIu Ser Ser Leu GIu Arg Phe

136 Asn Thr He Phe Arg Leu Lys Asn Tyr Phe GIn GIy He His Asn

151 Tyr Leu His His Gin Asn Tyr Ser Asn Cys Ala Trp GIu VaI He

166 His VaI GIu He Arg Arg GIy Leu Leu Phe He GIu GIn Cys

Thr

181 Arg Arg Leu GIn Tyr GIn GIu Thr GIy Tyr Leu His Lys

Sequence 6, modified human IFN-v, cDNA nucleotide sequence. Nucleotide 232 T of the native IFN-v was mutated to C to convert the TAA stop codon to CAA encoding GIn.

1 ATGACTAGTC AATGCTTGCT GGATTGGGCC TTGGTGCTAC TTCTCACCAC

51 TACTGCATTC TCTCTGGACT GTCACTTTCA AAGGTGCAAG GGCAACTGGG 101 AGATTTTAGA ACATTTAAAA AACCTAGGAG AAAAATTTCC TCTGCAATGT

151 CTAAAGGACA GGAGCAACTT CAGATTCTTC CAGGTTTCTA AAAGTAACCT

201 GTTTTCAAAG GAAAATGCCC TCATTGCCAA ACAAGAAATG TTACAGCAGA

251 TATTCAACAC TTTCAGCCTT AATGTCTCCC AATCTTTTTG GAATGAAAGC

301 AGCTTGGAGA GATTCCTAAG TAGACTTTAT CAGCAAATAG AGAAGACAGA 351 GGTGTGTTTG GAGCAGGAAA CCAGGAAAGA GGGCCGTTCA CTCTTGCAAA

401 GGGGGAATAC CATATTTAGA CTAAAAΆATT ATTTCCAAGG GATTCACAAC

451 TACTTACACC ACCAAAATTA TAGCAACTGT GCCTGGGAGG TCATCCATGT 501 TGAAATCCGA AGGGGTCTAC TATTTATTGA ACAGTGCACA AGAAGACTCC 551 AATACCAAGA AACAGGTTAT TTACATAAAT AA

Sequence 7, porcine IFN-53, protein sequence

This sequence is a previously unrecognized (undiscovered) variant of the porcine IFN-δ present in the domestic pig genome.

1 Met Ala GIn VaI Tyr Leu Leu VaI Ala GIy VaI Met Leu Cys Ser

16 Thr Pro Ala Cys Ser Leu GIy GIn Asn Leu Ser GIy lie Pro Ser

31 GIn GIu Asn Arg GIu lie Ser Thr Tyr Leu Trp Trp Met Lys Arg 46 lie Pro Ser GIn Leu Cys Leu Lys GIu Arg Thr Asp Phe Lys Phe

61 Pro Trp Lys Arg Asp Asn Asn Thr Pro lie GIn Met Thr GIn GIy

76 Thr Cys Tyr His His Leu lie Leu GIn GIn lie Ser Asn Leu Phe

91 Asn Thr GIu GIu Ser Arg Ala Ala Trp Asn Asn Thr Leu Leu Asp

106 GIn Leu Leu Ser Arg Leu His His Ser Leu GIu GIn Leu Trp Lys 121 Gin Met Asp Lys Asp Asn Leu Ala Cys Pro Tyr Trp GIu Thr VaI 136 VaI Arg Lys Tyr Phe GIn GIy lie His Arg Tyr Leu Lys GIy Lys

151 GIu Tyr Ser Leu Cys Ala Trp GIu VaI VaI Arg VaI Lys lie GIy 166 GIu Cys Leu Ser Leu Met

Sequence 8, porcine IFN-δ3, cDNA nucleotide sequence

1 ATGGCCCAGG TCTACTTGCT GGTGGCAGGA GTGATGCTCT GCTCCACTCC

51 TGCTTGCTCT CTTGGGCAGA ACTTGTCTGG GATCCCTAGC CAAGAAAATA 101 GGGAAATCTC CACATATTTG TGGTGGATGA AAAGGATCCC CTCTCAGTTG

151 TGTCTAAAGG AAAGAACTGA TTTCAAATTT CCCTGGAAAC GAGACAATAA

201 CACCCCAATC CAGATGACTC AAGGCACCTG TTACCACCAT CTGATACTCC

251 AGCAGATCAG CAACCTCTTC AACACAGAGG AGAGCCGAGC TGCGTGGAAC

301 AACACCCTCC TTGATCAACT GCTCTCTAGG CTTCATCACA GCCTGGAACA 351 ACTGTGGAAG CAAATGGACA AAGACAATCT GGCTTGTCCC TACTGGGAAA

401 CTGTTGTCCG GAAATATTTC CAAGGCATCC ATCGCTATCT GAAAGGAAAG 451 GAATATAGCC TCTGTGCCTG GGAGGTTGTC AGGGTCAAAA TTGGAGAGTG

501 TCTCTCCCTC ATGTAA

Sequence 9, porcine IFN-δ4, protein sequence

1 Met Ala GIn He Tyr Leu Leu VaI Ala GIy VaI Met Leu Cys Ser 16 Thr Pro Ala Cys Ser Leu GIy GIn Asn Leu Ser GIy He Pro Ser

31 GIn GIu Asn Arg GIu He Ser Thr Tyr Leu Trp Trp Met Lys Arg

46 He Pro Ser GIn Leu Cys Leu Lys GIu Arg Thr Asp Phe Lys Phe

61 Pro Trp Lys Arg Asp Asn Asn Thr Pro He GIn Met Thr GIn GIy

76 Thr Cys Tyr His His Leu He Leu GIn GIn He Ser Asn Leu Phe 91 Asn Thr GIu GIu Ser Arg Ala Ala Trp Asn Asn Thr Leu Leu Asp 106 GIn Leu Leu Ser Arg Leu Asp His Ser Leu GIu Gin Leu Trp

Lys

121 GIn Met Asp Lys Asp Asn Leu Ala Cys Pro Tyr Trp GIu Thr

VaI 136 VaI Arg Lys Tyr Phe GIn GIy lie His Arg Tyr Leu Lys GIy

Lys

151 GIu Tyr Ser Leu Cys Ala Trp GIu VaI VaI Arg VaI Lys He

GIy

166 GIu Cys Leu Ser Leu Met

Sequence 10, porcine IFN-54, cDNA nucleotide sequence

1 ATGGCCCAAA TCTACTTGCT GGTGGCAGGA GTGATGCTCT GCTCCACTCC

51 TGCTTGCTCT CTTGGCCAGA ACTTGTCTGG GATCCCTAGC CAAGAAAATA

101 GGGAAATCTC CACATATTTG TGGTGGATGA AAAGGATCCC CTCTCAGTTG 151 TGTCTAAAGG AAAGAACTGA TTTCAAATTT CCCTGGAAAC GAGACAATAA

201 CACCCCAATC CAGATGACTC AAGGCACCTG TTACCACCAT CTGATACTCC

251 AGCAGATCAG CAACCTCTTC AΆCACAGAGG AGAGCCGAGC TGCGTGGAAC

301 AACACCCTCC TTGATCAACT GCTCTCTAGG CTTGATCACA GCCTGGAACA

351 ACTGTGGAAG CAAATGGACA AAGACAATCT GGCTTGTCCC TACTGGGAAA 401 CTGTTGTCCG GAAATATTTC CAAGGCATCC ATCGCTATCT GAAAGGAAAG

451 GAATATAGCC TCTGTGCCTG GGAGGTTGTC AGGGTCAAAA TTGGAGAGTG

501 TCTCTCCCTC ATGTAA

Sequence 11, porcine IFN-δ5, protein sequence This sequence is a previously unrecognized (undiscovered) variant of the porcine IFN-δ present in the domestic pig genome.

1 Met Ala His He His Leu Leu Leu Ala GIy VaI He Leu Ser Ser

16 He Ala Ala GIy Thr Leu GIy GIn Phe Ser GIy He His Arg Leu

31 GIu Asn Arg GIu He Phe Met Leu Leu Arg GIn Met Lys Arg He

46 Ser Ser GIn Ala Cys Leu Lys Asp Arg Thr Asp Phe GIn Phe Pro 61 Trp Lys GIy GIy Lys Thr Thr Arg Thr GIn Thr Ser GIn GIy Thr 76 Cys Phe His Pro Leu Met Leu GIn Gin lie lie Asn Leu Phe

Asn

91 Thr GIu Asn Ser Arg Ala Ala Trp Asn Asn Ala Leu Leu Asp

GIn 106 Leu Leu Ser Arg Leu Asp His GIy Leu Asp Arg Leu GIu GIn

Met

121 GIu GIy Asp Asn Leu Ala Cys Ala Tyr Leu GIy Ser VaI VaI

Arg

136 Lys Tyr Phe GIn Arg lie His Arg Tyr Leu Lys Lys Lys GIu Tyr

151 Ser Ser Cys Ala Trp GIu VaI VaI Arg VaI GIu Thr GIu VaI

Cys

166 Leu Ser Leu Met GIn GIn Ser Ser Thr Lys Ser GIn GIu Arg

Lys 181 Lys Ala His Leu

Sequence 12, porcine IFN-δ5, cDNA nucleotide sequence

1 ATGGCCCACA TCCATTTGCT CCTGGCAGGG GTGATACTCT CCTCCATTGC

51 TGCTGGCACT CTTGGCCAAT TCTCTGGGAT CCATAGGTTA GAGAACAGGG 101 AAATCTTCAT GCTTTTAAGA CAGATGAAAA GGATCTCCTC TCAGGCATGC

151 CTAAAGGACA GAACTGACTT CCAATTTCCT TGGAAAGGAG GCAAAACCAC

201 CAGAACACAG ACATCTCAAG GCACCTGTTT CCACCCTCTG ATGCTCCAGC

251 AGATCATCAA CCTCTTCAAC ACAGAGAΆCA GCCGGGCTGC TTGGAACAAC

301 GCCCTCCTCG ATCAACTACT CTCTCGCCTT GATCACGGCC TGGACCGACT 351 AGAGCAGATG GAAGGTGACA ATCTGGCTTG TGCCTATTTG GGAAGTGTTG

401 TCCGGAAATA TTTCCAAAGA ATCCATCGCT ATCTCAAAΆA GAAGGAATAT

451 AGTTCCTGTG CCTGGGAGGT TGTCAGAGTA GAAACTGAAG TGTGCCTTTC

501 CCTTATGCAA CAATCGTCAA CGAAGAGTCA AGAGAGAAAA AAGGCACACT

551 TGTGA

Sequence 13, porcine IFN-δ6, protein sequence

1 Met Ala His lie His Leu Leu Leu Ala Arg VaI lie Leu Ser Ser

16 Thr Ala Ala GIy Thr Leu GIy GIn Phe Ser GIy He His Arg Leu

31 Lys Asn Arg GIu lie Phe Met Leu Leu Arg GIn Met Lys Arg He

46 Ser Ser GIn Ala Cys Leu Lys Asp Arg Thr Asp Phe GIn Phe Pro

61 Trp Lys GIy GIy Lys Thr Thr Arg Thr GIn Thr Ser GIn GIy Thr

76 Cys Tyr His Pro Leu Met Leu GIn Gin He He Asn Leu Phe Asn 91 Thr GIu Thr Ser Arg Ala Ala Trp Asn Asp Thr Leu Leu Asp GIn

106 Leu Leu Ser Arg Leu Asp His GIy Leu GIu Arg Leu GIu GIn Met

121 GIu Asp Asn Asn Leu Ala Cys Ala Tyr Leu GIy Ser VaI VaI Trp

136 Lys Tyr Phe GIn Arg He His Arg Tyr Leu Lys Lys GIu GIu Cys

151 Ser Ser Cys Ala Trp GIu VaI VaI Arg VaI GIu Thr GIu VaI Cys 166 Leu Ser Leu Met GIn GIn Ser Ser Thr Lys Ser GIn GIu Arg Lys

181 Lys Ala His Leu

Sequence 14, porcine IFN-δ6, cDNA nucleotide sequence 1 ATGGCCCACA TCCATTTGCT CCTGGCAAGA GTGATACTCT CCTCCACTGC

5i TGCTGGCACT CTTGGCCAAT TCTCTGGGAT CCATAGGCTA AΆGAATAGAG ioi AAATCTTCAT GCTTTTAAGA CAGATGAAAA GGATCTCCTC TCAGGCATGC

151 CTAAAGGACA GAACTGACTT CCAATTTCCT TGGAAAGGAG GCAAAACCAC

201 CAGAACACAG ACATCTCAAG GCACCTGTTA CCACCCTCTG ATGCTCCAGC 251 AAATCATCAA CCTCTTCAAC ACAGAGACCA GCCGTGCTGC TTGGAACGAC

301 ACCCTCCTCG ATCAACTGCT CTCTCGCCTT GATCACGGCC TGGAACGACT

351 AGAGCAGATG GAAGATAACA ATCTGGCTTG TGCCTATTTG GGAAGTGTTG

401 TCTGGAAATA TTTCCAΆAGA ATCCATCGCT ATCTCAAAAA GGAGGAATGT

451 AGTTCCTGTG CCTGGGAGGT TGTAAGAGTA GAAACTGAAG TGTGCCTTTC 501 ccTTATGCAA CAATCGTCAA CGAAGAGTCA AGAGAGAAAA AAGGCACACT

551 TGTGA Sequence 15, porcine IFN-δ8, protein sequence

This sequence is a previously unrecognized (undiscovered) variant of the porcine IFN-δ present in the domestic pig genome. 1 Met Ala His lie Tyr Lys Leu Leu Ala GIy VaI lie Leu Cys Ser

16 lie His Ala Cys Ser Leu Gly GIn Asn Leu Ser GIy He GIu Asn

31 Arg Lys Thr Phe Met lie Leu Arg GIn Met Lys Arg He His Ser

46 His Leu Cys Leu Lys Asp Arg Thr Asp Phe GIn Phe Pro Trp Lys

61 Arg GIy Asn Thr Thr GIn Asn Lys Met Thr GIn GIy Ser Cys Tyr 76 His Pro Leu Met Leu GIn Gin He He Asn Leu Phe Asn Thr GIu

91 Asn Ser Arg Ala Ala Trp Asn Asn Ala Leu Leu Asp GIn Leu Leu

106 Ser Arg Leu Asp His GIy Leu GIu Gin Leu GIu GIn Met GIu Asp

121 Asp Asn Leu Ala Cys Ala Tyr Leu GIy Ser VaI VaI Arg Lys Tyr

136 Phe Gin Arg He His His Tyr Leu Lys Lys Lys GIu Tyr Ser Ser 151 Cys Ala Trp GIu VaI VaI Arg VaI GIu He VaI VaI Cys Leu Ser

166 Leu He

Sequence 16, porcine IFN-58, cDNAnucleotide sequence 1 ATGGCCCACA TCTATAAGCT TCTGGCAGGA GTGATACTCT GCTCCATCCA

5i TGCTTGCTCT CTTGGCCAGA ACTTGTCTGG CATAGAGAAC AGGAAΆACCT

101 TCATGATTTT GAGACAGATG AAAAGGATTC ACTCTCATTT ATGCCTAAAG

151 GACAGAACTG ACTTCCAATT TCCTTGGAAA AGAGGGAATA CCACCCAAAA

201 CAAGATGACT CAAGGCTCCT GTTACCACCC TCTGATGCTC CAGCAGATCA 251 TCAACCTCTT CAACACAGAG AACAGCCGTG CTGCTTGGAA CAACGCCCTC

301 CTCGATCAAC TACTCTCTCG CCTTGATCAC GGCCTGGAAC AACTAGAGCA 351 AATGGAAGAT GACAATCTGG CTTGTGCCTA TTTGGGAAGT GTTGTCCGGA

401 AATATTTCCA AAGAATCCAT CACTATCTCA AAAAGAAGGA ATATAGTTCC 451 TGTGCCTGGG AGGTTGTCAG AGTAGAAATT GTAGTGTGTC TTTCCCTTAT 501 ATAA

Sequence 17, porcine IFN-αω, protein sequence

This sequence is a previously unrecognized (undiscovered) porcine IFN-αω. This sequence represents a new class of interferons of the type I IFN family that is present in several mammalian genomes, but not the human genome. This new class of interferons may have novel activities that is expected to be useful therapeutically.

1 Met Ala Leu Pro VaI Ser VaI Leu Leu Ala Leu VaI Met Leu Cys

16 Ser Arg lie Ala Cys Ser Leu GIy Cys GIu Leu Pro GIn Ser His 31 Asp Asn Pro GIu lie Phe Thr Leu Leu Arg GIn Met GIy Arg Leu

46 Ser lie Leu Ser Cys Leu Lys Asp Arg Thr Asp Phe Arg Phe Pro

61 Arg Thr Leu VaI Asp GIy Asn Gin VaI GIu Lys Thr Gin Ala VaI

76 Ala VaI Ala His GIu Met Leu GIn Gin lie Phe Arg Leu Phe Ser

91 Thr Arg GIy Ser Pro Ser Ser Trp Asp GIu Thr Leu Leu lie Lys 106 Phe Leu Ser GIy Leu Tyr Gin GIn Leu Asp Asp Leu GIu Lys Cys

121 Leu Arg GIu GIy Lys Lys VaI GIu Gin Ser Pro Pro GIy GIy GIu

136 Asn Ser He Leu Ala VaI Lys Thr Tyr Phe GIn GIy He Ser Leu

151 Tyr Leu Lys GIu Lys GIu Tyr Ser His Cys Ala Trp GIu VaI VaI

166 Arg VaI GIu Thr Arg Lys Cys Leu Leu Phe He Asn Asn Leu VaI 181 GIy Lys Leu Lys Lys Sequence 18, porcine IFN-αω, cDNA nucleotide sequence

1 ATGGCCCTCC CAGTCTCTGT GCTGCTGGCC CTGGTGATGC TGTGCTCCAG

51 AATCGCTTGC TCTCTGGGCT GTGAGCTACC TCAGAGCCAT GACAATCCAG

101 AAATCTTTAC ACTTTTGAGA CAAATGGGAA GACTCTCCAT TCTGTCCTGT 151 CTGAAGGACA GGACTGACTT CAGATTTCCT CGGACACTTG TGGATGGAAA

201 CCAGGTTGAG AAAACACAAG CCGTGGCTGT TGCGCACGAG ATGCTCCAGC 251 AGATCTTCCG CCTCTTCAGC ACAAGGGGCT CTCCTTCATC TTGGGATGAA

301 ACTCTCCTGA TCAAATTCCT TTCTGGACTT TATCAACAGC TGGATGACCT 351 GGAGAAGTGT TTGAGGGAGG GAAAGAAAGT GGAGCAGTCA CCCCCAGGAG 401 GTGAGAACTC CATACTGGCT GTGAAGACGT ACTTCCAAGG AATCAGTCTG

451 TATCTGAAAG AGAAAGAATA CAGCCACTGT GCCTGGGAGG TTGTCAGGGT

501 GGAAACCAGA AAGTGCTTGC TCTTCATTAA CAACCTCGTA GGAAAACTCA

551 AGAAATGA

Sequence 19, bovine IFN-αω 1 , protein sequence

This sequence is a previously unrecognized (undiscovered) bovine IFN-αω 1. This sequence represents a new class of interferons of the type I IFN family that is present in several mammalian genomes, but not the human genome. This new class of interferons may have novel activities that is expected to be useful therapeutically. 1 Met Thr Leu Pro VaI Ser VaI Leu Leu Ala Leu VaI Met Leu Cys

16 Cys Ser Pro Thr Cys Ser Leu GIy Cys GIu Leu Pro Ala Ser His

31 His Ser Asn Leu GIu Ser Phe Thr Arg Trp Ser GIn Met GIu Arg

46 Leu Pro VaI VaI Ser Cys Leu Arg Asp Arg Thr Asp Phe Arg Phe

61 Pro GIn Thr Leu VaI His GIy Thr Arg Leu GIu Lys Thr GIu Ala 76 He Ala VaI VaI His GIu Leu Leu GIn GIn Thr Phe GIn Leu Phe

91 Ser Thr Thr GIy Ser Ser Ala GIy Arg Asp GIu Ser Leu Leu Asp

106 Arg Phe Leu VaI GIy Leu Asp Gin GIn Leu GIu Asp Leu Asp Thr

121 Cys Leu Arg GIu GIy Arg Thr Pro GIu GIn Ser Pro Leu GIy Ser

136 GIu Asn Ser Arg Leu Ala VaI Lys Ser Tyr Phe GIn Arg Met Ser

151 VaI Tyr Leu Lys GIu Lys GIu Tyr Ser Arg Cys Ala Trp GIu VaI

166 VaI Ser VaI GIu lie Arg Arg Cys Leu VaI Phe Ala Ser Lys

Leu

181 lie GIy Lys Leu Arg Lys

Sequence 20, bovine IFN-αω 1 , cDNA nucleotide sequence

1 ATGACCCTCC CTGTCTCTGT GCTGCTGGCC CTGGTGATGC TCTGCTGCAG

5i ccccACGTGC TCCCTGGGCT GTGAGCTGCC TGCGAGCCAC CACAGCAATC

101 TGGAAAGCTT CACACGTTGG AGTCAGATGG AGAGACTGCC CGTTGTGTCC

151 TGTCTGAGGG ACAGGACTGA CTTCAGATTT CCTCAGACCC TGGTGCATGG 201 GACCAGGCTT GAGAAGACAG AAGCCATAGC TGTTGTACAC GAGTTGCTCC

251 AGCAGACCTT CCAGCTCTTC AGCACCACGG GCTCTTCTGC AGGTCGGGAC

301 GAGAGCCTCC TGGACAGATT CCTCGTGGGA CTTGATCAGC AGCTGGAGGA

351 CTTGGACACG TGTCTGAGAG AGGGAAGGAC ACCGGAACAG TCACCTCTAG

401 GGAGTGAGAA CTCCAGATTG GCTGTGAAGA GTTACTTCCA GCGAATGAGT 451 GTGTATCTCA AAGAGAAAGA ATACAGCCGC TGTGCCTGGG AGGTTGTCAG

501 CGTGGAAATC AGAAGGTGTT TGGTCTTTGC CAGCAAGCTC ATCGGAAAAC

551 TCAGGAAATA A

Sequence 21, bovine IFN-αω2, protein sequence This sequence is a previously unrecognized (undiscovered) bovine IFN-αω2. This sequence represents a new class of interferons of the type I IFN family that is present in several mammalian genomes, but not the human genome. This new class of interferons may have novel activities that is expected to be useful therapeutically.

1 Met Ala Leu Pro VaI Thr VaI Leu Leu Ala Leu VaI Met Leu Cys

16 Cys Ser Pro Thr Cys Ser Leu GIy Cys GIu Leu Pro Ser Ser His

31 GIy Asn Leu GIu Ser Phe Thr Arg Trp Ser GIn Met GIu Arg VaI 46 Pro lie VaI Ser Cys Leu Arg Asp Arg Thr Asp Phe Arg Phe Pro

61 GIn Thr Leu VaI His GIy Thr Arg Leu GIu Lys Thr GIu Ala Thr

16 Ala VaI VaI His GIu Leu Leu GIn GIn Thr Phe GIn Leu Phe Ser

91 Thr Thr GIy Ser Ser Ala GIy Arg Asp Lys Ser Leu Leu Asp Arg

106 Phe Leu VaI GIy Leu Asp GIn GIn Leu GIu Asp Leu Asp Thr Cys 121 Leu Arg GIu GIy Arg Thr Leu GIu GIn Ser Pro Leu GIy Ser GIu

136 Asn Ser Arg Leu Ala VaI Lys Ser Tyr Phe GIn Arg lie Ser VaI

151 Tyr Leu Lys GIu Lys GIu Tyr Ser His Cys Ala Trp GIu VaI VaI

166 Ser VaI GIu lie Arg Arg Cys Leu VaI Phe Ala Asn GIu Leu

He

181 GIy Lys Leu Arg Lys

Sequence 22, bovine IFN-αω2, cDNA nucleotide sequence

1 ATGGCCCTCC CCGTCACTGT GCTGCTGGCC CTGGTGATGC TCTGCTGCAG

51 CCCCACGTGC TCCCTGGGCT GTGAGCTGCC TTCGAGCCAC GGCAATCTGG

101 AAAGTTTCAC ACGTTGGAGT CAGATGGAGA GAGTGCCCAT TGTGTCCTGT

151 CTGAGGGACA GGACTGACTT CAGATTTCCT CAGACCCTGG TGCATGGGAC 201 CAGGCTTGAG AAGACAGAAG CCACAGCTGT TGTGCACGAG TTGCTCCAGC

251 AGACCTTCCA GCTCTTCAGC ACCACGGGCT CTTCTGCAGG TCGGGACAAG

301 AGCCTCCTGG ACAGATTCCT CGTGGGACTT GATCAGCAGT TGGAGGACCT

351 GGACACGTGT CTGAGGGAGG GAAGGACACT GGAACAGTCA CCTCTAGGGA

401 GTGAGAACTC CAGATTGGCT GTGAAGAGTT ACTTCCAGCG AATCAGTGTG 451 TATCTCAAAG AGAAAGAATA CAGCCACTGT GCCTGGGAGG TTGTCAGCGT

501 GGAAATCAGA AGGTGCTTGG TCTTTGCCAA TGAGCTCATT GGAAAACTCA

551 GGAAATAA

Sequence 23, feline IFN-αω, protein sequence This sequence is a previously unrecognized (undiscovered) feline IFN-αω. This sequence represents a new class of interferons of the type I IFN family that is present in several mammalian genomes, but not the human genome. This new class of interferons may have novel activities that is expected to be useful therapeutically.

1 Met Ala Leu Ser lie Ser VaI Leu Leu Ala Leu VaI Met Leu Cys 16 Ser Ser Pro Ala Tyr Ser Leu Asp Cys Asp Leu Arg Pro Ser Asn

31 Pro GIu Thr Phe Thr Leu Leu Ser GIn Met GIu Arg VaI Ser He

46 Leu Ser Cys Leu Lys Asp Arg Thr Asp Phe Asn Phe Pro GIn He

61 Leu VaI Ala GIy Asn GIn Leu GIu Lys Thr GIn VaI Thr Ala VaI

76 VaI His GIu Met Leu Gin GIn He Phe Asn Leu Phe Ser Lys Ser 91 Asp Ser Phe VaI Ala Trp Asp GIu Met Leu Leu Asp Arg Phe Leu

106 VaI GIy Leu Tyr GIn GIn Leu Asp Asp Leu GIu Thr Cys Leu Arg

121 GIu GIu Met Asn Met GIu GIn Leu Pro Leu GIy Asn GIu Asn Ser

136 Arg Leu Ala VaI Lys Arg Tyr Phe GIn GIy He Ser Leu Tyr Leu

151 Lys GIu Lys GIu Tyr Ser His Cys Ala Trp GIu VaI VaI Arg VaI 166 GIu He Arg Arg Cys Leu Leu VaI He Asn Lys Leu Thr GIy Thr

181 Phe Arg Lys

Sequence 24, feline IFN-αω, cDNA nucleotide sequence 1 ATGGCTCTCT CAATCTCTGT GCTGTTGGCT CTGGTGATGC TGTGCTCCAG

51 CCCCGCCTAC TCTCTGGACT GTGACCTGCG TCCGAGCAAT CCAGAAACCT

101 TCACACTTTT GAGTCAAATG GAGAGAGTCT CCATTCTGTC CTGTCTGAAG

151 GACAGGACTG ACTTCAACTT TCCTCAGATA CTTGTGGCTG GGAACCAGCT

201 TGAGAAGACA CAAGTGACAG CTGTCGTGCA TGAGATGCTC CAGCAGATCT 251 TCAACCTCTT CAGCAAAAGC GACTCCTTTG TGGCTTGGGA TGAGATGCTT

301 CTGGACAGAT TCCTTGTTGG ACTTTACCAA CAGCTGGATG ACCTGGAGAC 351 GTGTTTGAGG GAGGAAATGA ACATGGAACA GCTACCCCTG GGAAATGAGA 401 ACTCCAGACT GGCTGTGAAG AGATACTTCC AAGGAATCAG TCTCTATCTT

451 AAAGAGAAAG AATACAGCCA CTGTGCCTGG GAGGTTGTCA GGGTAGAAΆT

501 CAGAAGATGC TTGCTCGTCA TTAACAAGCT CACAGGGACA TTCAGGAAAT 551 AAAAAGGACG CTGAGTCTGA AAACAGTTCA CCTGGCCAAC TAAATGGCTA

601 TTTTCTAGGA CTCAGAGTGC AATCTTCATC TCTAATTTCA TGCCATATGA

651 AAA

Sequence 25, feline IFN-v, protein sequence This sequence is a previously unrecognized (undiscovered) novel type I IFN present in cats. It represents a new class of interferons of the type I IFN family that is present in several mammalian genomes. This novel type I IFN is intact in the cat genome, but in the human genome it is a pseudogene because it contains a stop codon (END) at position 78. This type I IFN represents a new class of interferons that encodes pseudogenes in primates, pigs and mice. This new interferon exhibits antiproliferative activity, may have other novel activities and is expected to be useful therapeutically.

1 Met Thr Ser Arg Ser Leu Pro Ser Trp Ala Leu Met Leu Leu Leu

16 Ser Ser Thr Ala Cys Ser Leu Asp Cys His Phe GIn Arg Arg GIy

31 lie Trp GIu lie VaI GIn His Leu GIu Asn Leu GIy GIy Lys Phe

46 Pro Leu Arg Cys Leu Lys Asp Arg Ser Asn Phe Arg Phe Leu GIn 61 VaI Ala Lys He Asp GIn Leu Pro GIu GIu Thr Ala Phe Leu Ala

76 He GIy GIu Met Leu Thr GIn VaI Phe Asn Thr Phe Asn Leu Asn

91 VaI Ser GIn Ser Leu Trp Asn GIu Ser Arg Leu GIu Arg Leu Leu

106 Ser GIy Leu Tyr GIn GIn Thr GIu Lys Thr GIy VaI Cys Leu Asp

121 GIn Asp Ser GIy GIn GIu Asp His Ser Ser Ser GIn Arg GIu GIy 136 Thr Arg Leu Ala He Lys Asn Tyr Phe GIn GIy He Arg Asp Tyr 151 Leu GIn GIy GIn Lys Tyr Ser His Cys Ala Trp GIu VaI lie Arg

166 VaI GIu lie Arg Arg Cys Phe Leu Phe lie GIu GIn Leu Thr Arg 181 Arg His Arg Asp Gin GIu lie GIy His Leu His Asn

Sequence 26, feline IFN-v, cDNA nucleotide sequence

1 ATGACCAGCC GGAGCTTGCC GAGCTGGGCT TTGATGCTAC TTCTTTCCAG

51 TACTGCCTGC TCTCTGGACT GTCACTTTCA ACGGAGGGGC ATCTGGGAGA 101 TTGTACAACA TTTAGAGAAC CTTGGAGGAA AATTTCCCCT GAGATGTCTG

151 AAGGACAGAA GCAACTTCAG ATTCCTCCAG GTTGCAAAAA TCGACCAGCT

201 TCCGGAGGAA ACTGCTTTCC TGGCCATTGG AGAAATGCTG ACACAGGTCT 251 TCAACACTTT CAACCTGAAT GTCTCCCAAT CGTTGTGGAA TGAAAGCCGT

301 TTAGAGAGAC TCCTAAGTGG ACTGTATCAG CAAACGGAGA AGACAGGGGT 351 ATGCCTGGAT CAGGACTCTG GGCAGGAGGA TCATTCATCC TCGCAAAGGG

401 AGGGTACCAG ACTTGCAATA AAGAATTATT TCCAAGGCAT CCGTGACTAT

451 TTGCAAGGCC AAAAGTATAG CCACTGTGCC TGGGAGGTCA TCCGTGTGGA

501 AATCCGAAGG TGTTTTCTCT TCATTGAACA GCTGACAAGA AGACATCGGG

551 ACCAAGAAAT AGGTCACTTA CATAACTAA

Sequence 27, platypus IFN-βl, protein sequence

This sequence is a previously unrecognized (undiscovered) novel type I IFN present in the platypus. This type I IFN is the homolog of the previously cloned echidna IFN-βl . Platypus IFN-βl and its echidna homolog are similar to human and feline IFN-v. This new interferon may have novel activities useful therapeutically.

1 Met Thr Asn Arg Ser Ser Leu Pro Phe VaI Leu Trp Leu Leu Leu

16 Pro Thr Thr lie Met Ala GIn GIy Tyr Pro Lys Leu Tyr Ser His 31 GIn Trp Leu Ser Asn Trp GIn Ser Leu His Leu Leu Asp GIu Met

46 GIy GIy Gin Phe Pro Leu His Cys Leu Lys GIu Lys Thr Asn Phe

61 Lys Leu Pro Ala GIu Met Met His Pro His GIn Phe GIn GIn GIu 76 Asn Ala Thr GIu Ala lie His Asp Leu Leu GIn His lie Phe Asn

91 lie Phe GIy Arg Asn His Ser GIn Thr GIy Trp Asp GIu Ala Thr 106 VaI GIu Lys Phe Leu His GIy VaI His Lys GIu Met Met Arg Leu

121 GIu Leu Phe Leu GIu GIu GIu Met GIy Trp GIu Asn Ser Thr Leu

136 Arg GIy Asp VaI Ser Leu His lie Lys Ser Tyr Phe Lys GIy Met

151 Met Asp Tyr Leu Lys GIy Arg Asp Tyr Ser Ser Cys Ala Trp GIu

166 VaI Thr Arg Met GIu Ala Lys Arg Cys Phe Leu VaI Met Tyr Arg 181 Leu Thr Arg Lys Leu Lys Lys

Sequence 28, platypus IFN-βl, cDNA nucleotide sequence

1 ATGACCAACA GGAGTTCGTT ACCATTTGTT CTGTGGCTGC TCCTCCCTAC

51 GACCATCATG GCTCAAGGCT ACCCCAAGCT GTATTCCCAC CAATGGCTGA

101 GCAACTGGCA GAGCCTGCAC CTTCTGGATG AAATGGGTGG ACAGTTTCCT 151 CTGCACTGcc TCAΆGGAGAA GACGAACTTC AAGCTGCCCG CAGAGATGAT

201 GCATCCACAC CAGTTCCAGC AGGAAAATGC CACTGAGGCC ATTCATGACC 251 TGCTCCAGCA CATCTTCAAC ATCTTCGGCA GAAATCACTC CCAAACTGGC

301 TGGGATGAAG CCACTGTTGA GAAATTCCTC CATGGAGTCC ATAAGGAGAT 351 GATGCGGCTG GAGCTGTTTC TGGAAGAGGA AATGGGGTGG GAAAACAGCA 401 CCTTGAGAGG GGACGTCAGC CTGCACATTA AGAGCTACTT CAAGGGGATG 451 ATGGATTATC TGAAGGGCAG AGACTACAGC AGCTGCGCCT GGGAGGTGAC

501 ccGAATGGAA GCCAAGAGAT GCTTTCTAGT CATGTACAGA CTCACAAGAA

551 AGCTCAAGAA ATAA

Sequence 29, chicken IFN III, protein sequence

This sequence is a previously unrecognized (undiscovered) novel chicken type I IFN. This chicken IFN is more homologous to mammalian type I IFNs than the previously known chicken interferons. This IFN may have applications in avian immunology and treatment of viral and other diseases in chickens and other avian species. 1 Met Tyr Ala Phe GIy Phe He GIn He GIy Phe He Leu Leu Cys 16 Thr lie Thr lie Ser Ser Leu Thr Cys Asn His Leu Pro Leu GIn

31 GIn Arg Arg VaI lie GIu Ser Ser Leu GIn Leu Leu Asp Lys Met 46 GIy Arg Arg Phe Pro GIn GIn Cys Leu Arg GIu Lys Met Ser Phe

61 Arg Phe Pro GIu Gin VaI Leu Lys Pro Arg GIn Lys GIu Thr VaI

76 Lys VaI Ala lie GIu GIu He Leu GIn His He Phe Tyr He Phe

91 Ser Lys Asn Leu Thr Leu Ala Ala Trp Asp GIy Ala Ala Leu GIu

106 Gin Phe GIn Asn GIy Leu Tyr GIn GIn He GIu Lys Leu GIu Ala 121 Cys He He Lys Lys GIn Thr GIn Tyr Phe Trp Ser Lys GIu VaI

136 Asn Arg Leu Lys Leu Lys Lys Tyr Phe GIn Lys He Asp Ser Phe

151 Leu Lys GIu Lys GIn His Asn Leu Cys Ser Trp GIu He Ser Arg

166 Ala GIu Met Arg Arg Cys Leu Gin Leu He Asp Lys VaI He

Arg

181 Lys Leu Tyr Lys

Sequence 30, chicken IFN III, cDNA nucleotide sequence

1 ATGTATGCTT TTGGCTTTAT ACAAATTGGC TTCATTCTGC TATGCACCAT

51 CACCATCTCA AGTCTTACCT GTAATCACCT TCCTTTACAG CAAAGAAGAG

101 TGATTGAGAG CAGCCTGCAA CTTTTGGACA AAATGGGCAG AAGGTTTCCT

151 CAACAGTGTC TAAGAGAGAA AATGTCCTTC AGATTTCCTG AGCAGGTTCT 201 AAAACCCAGA CAGAAAGAAA CTGTTAAAGT AGCCATTGAA GAGATCTTGC

251 AACACATCTT CTATATCTTT AGCAAAAATC TGACTCTAGC TGCGTGGGAT

301 GGGGCAGCTC TGGAACAATT CCAGAACGGA CTCTATCAGC AAATTGAGAA

351 ATTGGAGGCG TGCATAATCA AGAAGCAGAC TCAATATTTT TGGAGTAAAG

401 AAGTCAACAG GCTGAAACTG AAAAAGTATT TCCAAAAGAT AGACTCTTTT 451 CTTAAAGAGA AGCAACACAA CCTGTGTTCC TGGGAGATCA GCCGTGCAGA

501 AATGAGGAGA TGTCTTCAAT TGATTGATAA AGTCATAAGG AAGCTTTACA 551 AGTAA

Sequence 31, Xenopus tropicalis interleuldn-20 (IL-20), protein sequence

This sequence is a previously unrecognized (undiscovered) interleukin-20 (IL-20). The discovery of this cytokine demonstrates that mammalian IL- 19 and IL-20 diverged only recently in evolution, as this cytokine is equally homologous to both. This IFN may have therapeutic applications in amphibian species.

1 Met Lys Thr Phe Phe Met Arg Cys lie Ser Phe Leu Ala VaI Leu

16 VaI Ala Thr VaI Leu Pro Trp Pro VaI GIn GIu Cys VaI Phe Ser

31 Pro Asn Thr GIu GIu lie Arg Lys Tyr Phe Ser GIu lie Arg Thr 46 Leu VaI GIn Ser GIn Asp Arg His Thr Ser His GIn Leu Leu Asn

61 GIy Leu Tyr Leu Met GIu lie Pro Ser Ser Asp Arg Cys Cys Phe

76 Leu Ser His Met Leu His Phe Tyr Met Lys Lys VaI Phe Asn His

91 Tyr Asp Thr Lys Asp Met Asn lie Tyr Arg Asn VaI Leu His He

106 Ala Asn Ser Phe Leu Ser Phe Asn Tyr GIu Leu Arg Ser Ser Ala 121 His Lys Asn Ser Cys Thr Cys GIu Asp GIn Thr Ser Lys He Leu

136 GIu Thr He Met Asn Asn Phe Asn GIu Leu Ser His His Asp Ala

151 VaI He Lys Ala He GIy GIu Leu Asp He Phe Leu Asp Trp He

166 Asn Cys Leu Leu

Sequence 32, Xenopus tropicalis IL-20, cDNA nucleotide sequence

1 ATGAAGACAT TTTTTATGAG ATGTATATCC TTTTTAGCTG TGCTTGTAGC 51 CACTGTATTG CCATGGCCTG TTCAGGAATG TGTCTTTTCT CCCAACACTG

101 AAGAGATAAG AAAATATTTC TCAGAGATAC GTACTTTAGT TCAATCACAA 151 GATAGACACA CAAGTCACCA GTTACTTAAT GGATTGTACC TGATGGAAAT

201 TCCCTCATCA GACAGATGCT GCTTTTTGAG TCACATGCTC CATTTTTACA

251 TGAAGAAGGT TTTTAATCAC TACGATACAA AGGATATGAA TATATACAGG

301 AATGTCCTTC ACATTGCTAA TTCCTTCCTT TCCTTCAATT ATGAGCTGAG 351 ATCTAGTGCC CATAAAAACT CTTGTACCTG TGAAGATCAG ACATCTAAGA

401 TACTGGAAAC AATAATGAAC AATTTCAATG AGTTGTCTCA TCATGATGCA

451 GTTATAAAAG CAATTGGAGA GCTAGATATC TTCCTGGACT GGATAAACTG

501 CCTCCTGTAA

Sequence 33, Xenopus tropicalis DL-24, protein sequence

This sequence is a previously unrecognized (undiscovered) interleukin-24 (EL-24; mda-7). This protein represents the first isolated non-mammalian homolog of the tumor suppressor gene mda-7/IL-24_; for potential use in anticancer therapies.

1 Met GIy Ala Leu Ser Ala Phe Cys Ser He VaI Phe He Cys VaI

16 Leu Met Met Lys He Lys Arg He GIu Ser Ser GIy Asn His Cys

31 Pro VaI Ser Ser Asp He GIn GIu Phe Lys Arg Tyr His Asp Ala 46 VaI Lys GIu VaI Leu His Lys Lys Asp VaI He Thr Asp VaI Ser

61 Leu Leu Lys Ala Arg GIy Leu Asn Gin He His Pro Ser GIu GIn

16 Cys Cys Phe Leu Leu GIn Leu GIy Arg Phe Tyr Leu Asn Asn VaI

91 Phe Pro Lys Leu GIu Phe Ser Ser Met Lys GIu GIn Lys Cys Leu

106 Asn His Leu Ala Asn Ser VaI Leu GIy Leu Lys He GIu Leu Lys 121 His Cys His Ser Thr Met Arg Cys Ala Cys GIy His GIn Ser His

136 Lys He Met GIu GIu Leu GIn GIu Thr Phe Tyr GIn Met GIu Thr

151 GIu Ala Ala He VaI Lys Ala Phe GIy Asp Leu Asn He Leu He

166 Arg Trp Met GIu He Asn Tyr Pro GIy Sequence 34, Xenopus tropicalis IL-24, cDNA nucleotide sequence

1 ATGGGAGCAC TTTCTGCATT TTGTTCTATT GTTTTTATTT GTGTCCTGAT

51 GATGAAGATA AAAAGAATTG AATCTAGTGG AAACCACTGC CCTGTGTCTT 101 CAGATATTCA AGAGTTTAAA AGATACCATG ATGCTGTAAA AGAAGTCTTG

151 CACAAAAAGG ATGTGATTAC AGATGTCAGC CTCCTGAAAG CCAGAGTGCT

201 GAATCAGATA CATCCCTCCG AGCAATGCTG CTTCCTTCTC CAGCTAGGAC

251 GTTTTTACTT GAACAATGTT TTCCCCAAAC TGGAATTTTC TTCCATGAAG ^•

301 GAGCAGAAAT GTCTTAATCA TTTGGCAAΆC TCTGTCCTTG GTTTAAAGAT 351 TGAGCTCAAG CACTGTCATT CTACTATGAG GTGTGCATGT GGTCATCAGT

401 CACACAAGAT TATGGAAGAG TTTAGAGAAA CCTTTTACCA GATGGAGACA

451 GAGGCAGCTA TTGTTAAAGC TTTTGGAGAC TTGAATATAC TGATCCGCTG

501 GATGGAAATA AATTATCCAG GGTGA

Sequence 35, Xenopus tropicalis IL-28.1, protein sequence

This sequence is a previously unrecognized (undiscovered) interleukin-28 (IL-28) in frogs. The presence of this IL-28-like protein in the frog genome demonstrates its presence early in the evolution of class 2 cytokines and interferons.

1 Met GIu He Pro He Arg Leu Ala Ala Met Met VaI Leu Leu VaI

16 Thr VaI Thr Ala His Pro His Arg Arg His Cys His Met Ser Arg

31 Tyr Arg Ser VaI Ser Pro Ser Asp He Arg Ala VaI Arg Arg Leu 46 His Asn GIu His GIu Lys He Ser Phe He Asp GIy He Lys Cys

61 GIn Lys Lys Met Phe Arg GIn Lys Pro Ser VaI Cys Asp Leu Lys

76 Ala Ser Asp Arg He He Leu Thr Leu GIu Arg VaI Thr Met Ala

91 VaI Asp VaI Leu Thr Asn He Thr GIu Ser Pro Leu Ser GIu Phe

106 VaI Ser GIn Pro Leu GIu Phe Phe Arg Ser Leu GIu Asp Asp Leu 121 Lys His Cys Arg Lys Ser Pro Leu Tyr Ser Asp Pro Pro Ser GIn 136 GIn Leu Met Pro Trp Leu Asn His Leu Lys His Phe Arg GIu Arg

151 VaI Ser Ser GIn Cys VaI GIn Asp Ala Met Leu Leu Ser Leu Thr 166 GIn Leu Leu lie GIu Asp VaI Met Cys Trp Ala Asn Lys GIu

Sequence 36, Xenopus tropicalis IL-28.1, cDNA nucleotide sequence

1 ATGGAAATTC CTATCAGACT GGCCGCCATG ATGGTCCTGC TGGTGACAGT

51 GACAGCGCAT CCACACAGAA GGCACTGCCA CATGTCCAGA TACAGATCTG 101 TGTCCCCCAG TGATATAAGG GCAGTCAGAC GCCTGCACAA TGAACATGAG

151 AAAATCTCTT TCATTGATGG GATAAAATGT CAGAAGAAAA TGTTTCGCCA

201 GAAGCCGTCT GTATGTGACC TAAAGGCAAG TGACAGAATT ATTCTGACTC

251 TGGAGAGAGT GACCATGGCT GTAGATGTGC TGACAAACAT AACTGAGTCT

301 CCACTGAGTG AATTCGTATC CCAGCCGCTT GAGTTTTTCC GTAGCCTGGA 351 AGATGATCTG AAGCACTGTA GGAAGTCTCC ATTGTACAGT GACCCTCCCT

401 CCCAACAGCT GATGCCGTGG CTGAACCATC TCAAGCATTT TAGGGAAAGG

451 GTTTCCTCTC AGTGTGTGCA GGATGCCATG TTACTCAGCC TAΆCCCAGCT

501 CCTAATTGAA GATGTAATGT GTTGGGCTAA TAAGGAATAA

Sequence 37, Xenopus tropicalis IL-28.3, protein sequence

This sequence is a previously unrecognized (undiscovered) interleukin-28.3 (IL- 28.3) in frogs. The presence of this IL-28-like protein in the frog genome demonstrates its presence early in the evolution of class 2 cytokines and interferons.

1 Met GIu lie Pro lie Arg Leu Ala Ala Met Met Ala Leu Leu VaI

16 Thr VaI Thr Ala His Pro His Arg Arg His Cys His Met Ser Arg

31 Tyr Arg Ser VaI Ser Pro Ser Asp lie Arg Ala VaI Arg Arg Leu 46 His Asn GIu His GIu Lys Ser Pro Phe Ser Asp GIy lie Lys Cys

61 Tyr Arg Lys Met Leu Arg GIn Lys Pro Ser VaI Cys Asp Leu GIn

76 Ala Ser Asp Arg Leu He Leu Thr Leu GIu Arg VaI Thr Leu Ala

91 VaI Asp VaI Leu Thr Asn Met Thr GIu Ser Pro Leu Ala Lys Leu

106 Leu Ser Leu Pro Leu Thr Met Leu Leu Ser Leu GIu Asp Asp Leu

121 Lys lie Cys Arg Lys Ser Pro Leu Tyr Ser Asp Pro Pro Ser GIu

136 GIn Leu Met Pro Trp Leu His His Leu Lys His Phe Arg GIu Lys

151 VaI Ser Ser GIu Cys VaI GIn Asp Ala VaI Leu Leu Ser Leu Thr 166 GIn Leu Leu lie GIu Asp lie Met Cys Trp Ala Asn Asn GIu

Sequence 38, Xenopus tropicalis IL-28.3, cDNA nucleotide sequence

1 ATGGAAATTC CTATCAGACT GGCTGCCATG ATGGCCCTGC TGGTGACAGT

151 AAAAGcccTT TCAGTGATGG GATCAAATGT TACAGGAAGA TGCTTCGTCA

201 AAAGCCGTCT GTGTGTGACC TGCAGGCAAG TGACAGACTG ATTCTGACTC

251 TGGAGAGAGT GACCTTGGCT GTAGATGTAT TGACAAACAT GACTGAGTCT

301 CCACTGGCCA AACTCTTATC CCTGCCACTT ACAATGCTCC TTAGCCTCGA 351 GGATGATCTG AAGATCTGTA GGAAGTCTCC ATTGTACAGT GACCCTCCCT

401 CCGAACAGCT GATGCCGTGG CTACACCATC TCAAACATTT TAGAGAAAAG

451 GTTTCCTCTG AATGTGTCCA GGATGCCGTG TTACTCAGCC TAACCCAGCT

501 CCTAATCGAA GACATAATGT GTTGGGCTAA TAATGAATAA

Sequence 39, Xenopus tropicalis IFN-γR2-l, protein sequence

This sequence is a previously unrecognized (undiscovered) interferon gamma receptor 2 chain (IFN-γR2-l) in frogs. The presence of IFN-γR2-l in the frog genome demonstrates its presence early in the evolution of class 2 cytokine and interferon receptors. In addition, this sequence and sequence 41 are unusual in that two homologs of a single receptor are present in the same frog genome, not seen in other vertebrates.

1 Met GIy Thr Ser Tyr Ser Pro Ala Ala Leu Leu Leu Leu Leu He

16 Leu Leu Leu Leu Arg Ser Asp Ala He Ser VaI Leu Pro Ala Pro 31 Arg Asn VaI Arg He Asp Ser Tyr Asn Leu GIn His Lys Leu Leu 46 Trp Asp Pro lie GIu Ser GIu Asn VaI Thr Tyr Thr VaI Gin

Tyr 61 Met GIy Asn Tyr lie GIy GIu Asp GIu Tyr Asn Asp lie Cys

GIu 76 Asn Leu Thr GIu Thr VaI Cys Asn Phe Thr Asp GIu lie Asn

Phe 91 GIu Leu Lys VaI lie Leu Arg VaI Arg Ala GIu Leu GIy Pro

Leu

106 His Ser Ser Trp Ser GIu Thr Ser GIu Phe GIn Ala Met Asn His

121 Thr Lys lie Ser Pro VaI Lys Ser Leu Thr VaI Ser Ser Arg

GIu

136 Ala GIu His Asn Ser Leu Tyr VaI Ser Phe GIu Ser Pro Leu

GIn 151 Pro GIu He lie Pro GIn Lys GIy Lys Met Lys Tyr Leu Leu

GIn

166 Tyr Trp Lys Lys GIy Ser Ala Ala Lys Thr Asn Leu Ser Thr

Asn

181 GIy Thr Phe Arg Lys Met Thr Asp Leu GIu Ala Ser Ala GIu Tyr

196 Cys VaI Ser VaI Thr Ala Leu Leu Met GIy Pro His Tyr Ser

Leu

211 Thr GIy GIu Thr Ser His He VaI Cys Ala GIn Thr Pro Ala

Thr 226 Pro GIy Leu Thr Ala Asp Lys VaI He Phe Leu Ser VaI GIy

Leu

241 Leu Leu GIy Cys Cys He Phe Leu GIy Phe Ser Tyr Thr Phe

Phe

256 Arg GIn Arg Arg Leu He Lys Met Trp Leu Tyr Pro Pro Tyr Ser

271 He Pro Pro Asp He GIu GIn Tyr Leu GIn Asp Pro Pro Leu

Asn

286 GIy Tyr Pro Asn GIu Ser Lys Asp Met Asp Leu Ala GIu VaI

GIn 301 Tyr Asp His He Ser He VaI GIu Ser GIu Ser Sequence 40, Xenopus tropicalis IFN-γR2-l, cDNA nucleotide sequence

1 ATGGGCACAA GCTATTCCCC TGCAGCGCTG CTCCTCCTCC TCATCTTACT

51 CCTGCTGCGC TCAGATGCCA TCTCCGTGTT ACCGGCACCC AGAAATGTAC

101 GCATTGACTC ATACAACCTG CAGCACAAAT TGCTTTGGGA TCCCATCGAA 151 TCGGAAAATG TAACTTACAC AGTGCAATAT ATGGGGAACT ATATAGGTGA

201 GGATGAATAT AATGACATTT GTGAGAACCT TACTGAGACC GTTTGTAATT 251 TTACGGACGA GATCAACTTT GAGTTGAAGG TTATTTTGAG AGTACGAGCA

301 GAACTGGGAC CACTGCATTC CAGCTGGAGT GAAACATCTG AATTCCAAGC 351 AATGAATCAC ACCAAAATAA GTCCTGTGAA ATCTCTAACC GTGTCCTCCA 401 GGGAGGCAGA ACACAACAGT CTCTATGTCA GTTTTGAGTC TCCTCTACAA

451 ccAGAGATCA TCCCACAAAA GGGCAAΆATG AAGTATTTGT TACAATACTG

501 GAAAAAAGGT TCTGCTGCAA AGACTAATCT ATCGACAAAC GGGACATTTC

551 GTAAAATGAC CGACCTGGAG GCCTCAGCTG AGTACTGTGT GTCGGTCACT

601 GCTCTCCTGA TGGGCCCTCA TTACAGTCTG ACTGGGGAGA CAAGCCACAT 651 AGTGTGTGCC CAAACGCCAG CAACTCCAGG TTTAACTGCA GACAAAGTTA

701 TTTTTCTTTC GGTGGGACTC CTTCTTGGCT GTTGTATATT CCTGGGATTC

751 AGCTATACTT TCTTCAGGCA GCGCAGACTG ATCAAAATGT GGCTGTACCC

801 CCCATACAGT ATACCCCCCG ACATAGAGCA GTACTTGCAA GATCCCCCCT

851 TGAATGGATA CCCGAACGAA AGCAAAGATA TGGATTTGGC AGAAGTGCAG 901 TACGATCACA TTTCCATTGT GGAAAGTGAA TCATGA

Sequence 41, Xenopus tropicalis IFN-γR2-2, protein sequence

This sequence is a previously unrecognized (undiscovered) interferon gamma receptor 2 chain (IFN-γR2-2) in frogs. The presence of IFN-γR2-2 in the frog genome demonstrates its presence early in the evolution of class 2 cytokine and interferon receptors. In addition, this sequence and sequence 39 are unusual in that two homologs of a single receptor are present in the same frog genome, not seen in other vertebrates.

1 Met Ala Thr Ala Cys Phe Arg Gin Ala Leu Leu Leu lie His Leu 46 Leu Pro Leu Leu Ser Ala Ala Asp Ala Thr Ser VaI Leu Pro Ala

91 Pro Thr Asn VaI Ser lie His Ser Phe Asn Leu GIn GIn lie Leu

136 His Trp Asp Pro VaI Lys GIu GIu Asp VaI Thr Tyr Arg VaI GIu 181 Tyr Lys Ala Phe Tyr GIu GIy Asp Asp Asp Tyr Ser VaI Leu

Cys

226 Lys Asia Thr Thr GIu Met Gin Cys Asn Phe Thr Asp Leu VaI

Pro 271 Phe Tyr Trp Arg He VaI VaI Arg VaI Arg Ala GIu VaI GIy

Lys

316 Leu GIn Tyr Ser Arg Trp Ser Lys Thr Pro Thr Phe Gin Ala

Thr

361 Arg Asp Thr Thr Leu GIy Pro VaI Lys Ser Leu Lys Leu Ser Pro

406 Ser GIu Ala VaI Tyr Asp Ala He Ser VaI Thr Phe GIu Pro

Pro

451 He Ser Arg GIu He Tyr Leu Pro Tyr Asp Ser GIu He Asn

Phe 496 Thr VaI Arg Tyr Trp GIu Arg Ser Ser GIy Thr GIu Lys GIu

Leu

541 Ser Ser Thr Asp Thr His VaI Leu Leu GIu Asp Leu Asp Pro

Met

586 Ala VaI Tyr Cys VaI GIu VaI Ser Ala Ser VaI Leu GIy Leu VaI

631 GIy GIn Pro Ser GIu Pro VaI Cys GIu Lys Pro Ser Ala Ala

Pro

676 Ala He Thr Ala Thr GIy Tyr He Trp Leu VaI VaI GIy Leu

VaI 721 Cys Ala Cys Cys Ala Phe Ser VaI Cys Ala Leu Ala VaI Tyr

Lys

766 His Arg GIu Met He Lys Lys Leu Leu Pro Pro Pro Phe GIu

He

811 Pro Tyr His Phe His GIu Thr Leu Lys GIu He Ser Phe Gin Arg

856 Leu GIu Asn Asp His Cys GIu VaI GIn Ser He GIu GIu Lys

Tyr

901 Asp Thr He Ser He VaI GIu Pro GIu Ser Cys His Asp Arg

Lys 946 Asp Ser Cys Thr GIu GIu Leu Asp He Lys GIn Thr Pro GIu

Asp 991 Lys Ala Ser Tyr Arg Thr VaI Thr

Sequence 42, Xenopus tropicalis IFN-γR2-2, cDNA nucleotide sequence

1 ATGGCCACAG CCTGTTTCCG TCAAGCGCTG CTCCTGATCC ACCTCCTGCC 51 TCTGCTTTCC GCAGCAGATG CCACCTCTGT GTTACCTGCA CCCACAAATG

101 TAAGCATTCA CTCATTCAAC CTGCAGCAAA TACTGCACTG GGATCCCGTG

151 AAAGAGGAAG ATGTAACCTA CAGGGTGGAA TACAAAGCGT TTTATGAAGG

201 AGATGATGAC TACAGTGTCC TTTGTAAGAA CACTACAGAG ATGCAATGTA 251 ACTTTACTGA TCTTGTTCCA TTTTATTGGA GGATAGTAGT AAGGGTCAGA 301 GCTGAAGTTG GAAΆGCTACA ATATTCTAGA TGGAGTAAAA CACCCACTTT

351 TCAAGCAACA AGAGACACTA CTTTAGGGCC TGTGAAATCT CTTAAACTGT

401 CCCCAAGCGA AGCAGTGTAT GATGCCATTT CTGTCACTTT TGAGCCCCCT 451 ATATCAAGAG AAATATATCT TCCATATGAT TCAGAAATTA ATTTTACTGT

501 GCGTTACTGG GAAAGGAGCT CTGGTACAGA GAAAGAACTG TCGAGCACAG 551 ATACACACGT GTTACTGGAG GACCTGGATC CCATGGCTGT ATACTGTGTG

601 GAAGTTTCTG CCTCGGTGCT GGGTCTTGTT GGACAGCCAΆ GTGAACCTGT

651 ATGTGAGAAA CCATCAGCAG CTCCAGCTAT CACTGCAACG GGATACATTT 701 GGCTTGTTGT CGGACTTGTA TGTGCTTGTT GCGCTTTCTC CGTCTGTGCC 751 TTGGCTGTAT ACAAACACCG CGAAATGATT AAGAAGCTGC TACCTCCTCC 801 TTTTGAAATA CCATACCACT TCCATGAGAC CTTGAAGGAG ATCTCTTTCC 851 AGCGGTTAGA AAATGACCAC TGTGAAGTGC AATCGATAGA AGAGAAGTAT 901 GATACTATTT CCATCGTGGA ACCTGAATCC TGCCATGATA GAAAGGACTC 951 CTGTACTGAG GAGCTGGACA TTAAGCAGAC ACCAGAGGAC AAGGCTTCCT 1001 ACCGAACTGT CACCTAA

Sequence 43, Tetraodon nigroviridis IL-20R2, protein sequence

This sequence is a previously unrecognized (undiscovered) interleukin-20 receptor 2 chain (IL-20R2) in fish. This DL-20R2 sequence is the first identified IL-20R2 receptor sequence in fish. Its characterization could assist in the development of aquaculture and aquatic immunology.

1 Met Asp Thr Ser GIn Leu Leu Leu Leu Leu Pro Met Met Thr Thr

16 Met Met Lys Thr Ser Ser GIn Asp GIy VaI Ser Ala Pro GIy GIy 31 Pro Arg Met Asp Ser Leu Asn Met Arg His VaI Leu Arg Trp Arg 46 Pro Leu GIn Asp Asn Cys Ser Thr Ala Leu VaI Tyr Ser VaI

GIn

61 Phe GIn GIy GIu Phe GIu Leu Ser VaI Leu Asn Asp Ser Trp

VaI 76 Asp Ala Ala GIy Cys Gin Arg Thr Pro GIy Thr Ser Cys Asp

Leu

91 Thr Phe Asp Leu GIy Ser Asp Ser Asp Tyr Arg Leu Arg lie

Arg

106 Ala His Cys GIy Ala Gin Thr Ser Ala Trp Ser Arg Ser Ser Ser 121 Pro Phe Asn Arg Arg Asp Thr VaI Leu Thr Ala Pro Leu Met Lys 136 VaI Ala Ser GIu GIy Gly Ala Leu Arg VaI Ser Leu Ser GIu Pro 151 Pro Arg Leu Thr Thr Leu Leu VaI GIu VaI Trp Arg Arg Gly GIu 166 GIu GIn Ala Thr Ala Leu Thr Leu Leu Pro GIu Gin Thr Leu Leu 181 Leu VaI Pro Thr Leu GIn VaI GIy Gly GIu Tyr Cys Ala Arg Ala 196 Tyr Thr Leu Leu Gly Gly Arg Arg Ser Asn Gly Ser His Thr GIn 211 Cys VaI Thr lie Thr Leu Ala Gly Leu Gly Leu Arg GIu lie VaI 226 Ala Thr VaI VaI Ala Thr VaI VaI VaI Met VaI Thr Leu Leu Ala 241 Ala Leu Trp Cys Met Cys Arg Cys His Leu GIu Asp Tyr Arg Arg 256 Tyr Phe Arg Ser GIu Pro Leu Pro Leu Ser Leu Arg Ser VaI Trp 271 Asp VaI Arg Phe Arg Ser Gly Ser GIu GIu Ala GIu Pro Leu GIu 286 Ala Phe Ser VaI VaI Met VaI Met Leu Ser Thr Asp Arg Leu Leu 301 Lys Asp Gly Gly Ala Ala Ala Ser Leu Sequence 44, Tetraodon nigroviridis IL-20R2, cDNA nucleotide sequence

1 ATGGACACCA GCCAGCTGCT GCTGCTGCTG CCGATGATGA CGACGATGAT

51 GAAGACGAGT TCCCAGGACG GTGTGTCGGC GCCCGGCGGC CCCCGCATGG

101 ACTCCCTCAA CATGAGGCAC GTGCTGCGGT GGCGCCCCCT GCAGGACAAC 151 TGCAGCACCG CCCTCGTCTA CAGCGTCCAG TTTCAGGGGG AGTTCGAGCT

201 GAGCGTCCTG AACGACAGCT GGGTGGACGC CGCCGGTTGC CAGCGGACGC

251 CCGGGACCTC CTGCGACCTG ACCTTTGACC TGGGCTCCGA CTCCGACTAC

301 CGCCTCCGCA TCAGAGCCCA CTGCGGCGCC CAGACGTCGG CCTGGAGCAG

351 AAGCAGCTCG CCGTTCAACC GCAGAGACAC CGTCCTCACA GCGCCGCTGA 401 TGAAGGTGGC GTCAGAGGGC GGCGCCCTTC GGGTGTCCCT GAGCGAGCCT

451 CCCAGGTTGA CCACTTTGCT GGTGGAGGTC TGGAGGCGGG GCGAGGAGCA

501 GGCGACGGCG CTCACGCTGC TTCCGGAGCA GACGCTGCTG CTCGTCCCCA

551 CCCTGCAGGT GGGGGGCGAG TACTGCGCCC GGGCCTACAC CCTGCTGGGA

601 GGTCGCCGCA GCAACGGCAG CCACACGCAG TGTGTCACCA TCACGCTCGC 651 AGGTTTGGGT TTACGGGAAA TTGTCGCCAC CGTTGTAGCG ACGGTTGTCG

701 TCATGGTGAC GCTGTTGGCC GCGTTGTGGT GCATGTGCCG GTGCCACCTG

751 GAGGACTACC GGAGGTATTT CCGGAGCGAG CCGCTGCCGC TGTCGCTGCG

801 ATCCGTCTGG GATGTGAGGT TCAGGAGCGG CTCGGAGGAG GCGGAGCCTC

851 TGGAGGCCTT CAGCGTGGTG ATGGTGATGC TGAGCACCGA CCGTCTGCTC 901 AAGGACGGAG GCGCCGCCGC CTCCCTCTAG

Sequence 45, Xenopus tropicalis IFN-αRl, protein sequence

This sequence is a previously unrecognized (undiscovered) interferon alpha receptor 1 chain (IFN-αRl) in frogs. This sequence is noteworthy in that it helps to elucidate the unusual evolution of the IFN-αRl chain.

1 Met Ala Ala GIu Pro GIy Leu Leu Leu GIy Ala VaI Leu Cys He

16 Leu Pro Leu Leu Pro Phe GIy Thr GIy Ala Leu Leu Thr GIy Leu 31 Thr Tyr Pro GIu Pro Pro Phe Asn VaI Thr VaI Asp Met Leu Pro

46 Asp Arg Tyr Ser VaI Met Trp Asp Trp Asn Ser VaI Asn Trp GIy

61 Asp Thr Lys Asn VaI Thr Phe Ser VaI Leu Leu Arg Lys Leu Lys

76 Lys Lys Thr GIn Trp Asn Ser VaI Pro GIy Cys Leu His He Pro 91 His Arg Asn Cys Ser lie Asp Pro Ala Leu VaI Asp lie Asp

Lys

106 Arg Tyr GIn VaI Arg VaI Arg Ala GIu He Ala GIn He Asn Phe

121 Ser Phe Ser Asp Thr He Thr Phe Thr Pro Lys Ala Pro GIy

GIu

136 He Ala Leu Pro He Ala VaI His VaI GIu Ser He Asp GIy

GIy 151 VaI Lys He Lys He Thr Leu Pro Asn Thr Arg GIu Tyr Trp

Asp

166 Asn Ala Leu Phe Asp Tyr He Leu Leu Leu Arg Thr Asn Ser

Ser

181 He GIu GIu Arg Arg Ser Leu Tyr Pro Asn Phe Tyr Leu Tyr Asp

196 Leu Asn Pro GIy GIu Asn Tyr Cys Phe Lys VaI Lys VaI Ser

Ser

211 Tyr Leu Thr Lys Thr Asn Asp Thr Phe Ser Pro GIu Lys Cys

Phe 226 Lys VaI GIu Ala VaI GIy Leu Asp GIy Arg Pro Tyr Pro GIu

Asn

241 VaI Thr Met GIu Ala Leu Asn Thr Asn Tyr Met Leu Lys Trp

Asp

256 Trp Asp Tyr Ser GIn His Pro Asn VaI Thr Phe Ser VaI GIu Asn

271 Asn Ser GIu He Trp Pro GIy Lys Trp Asn GIn VaI GIn GIy

Cys

286 GIu Asn He Ser Arg Arg Asn Cys Asp VaI Ser GIy He Tyr

He 301 Tyr GIy Lys Tyr Asn Phe Arg VaI Ala Ala Ser Leu Asp Asn

Asn

316 Asn Arg Thr Leu Ser Arg Ala Leu Arg Phe Asn Pro GIu Lys

Asp

331 Thr VaI He GIy Pro Pro Ser Asn VaI Ser Thr GIu Leu Tyr GIy

346 Thr Lys Leu His VaI Asn VaI Leu Lys VaI GIu Ala Phe His Asn

361 Asp Asp Leu Lys Asn Tyr Cys Asp Trp GIu Tyr Asn Leu lie

Tyr

376 Trp Lys Asp Ser Ala Ser Asp Arg GIu GIu Lys Thr Leu Asn GIu

391 Lys VaI GIy Arg Phe Thr He GIu VaI GIu Ala Ser Thr Thr

Tyr

406 Cys Leu Thr VaI Arg VaI VaI Cys GIn Thr His Asn Arg Ser

GIy 421 Leu Phe Ser GIu Thr GIn Cys He Thr Thr GIy Ala Asp Ala

Leu

436 Pro VaI Trp Ser Ala GIy He VaI He GIy VaI Leu Leu Ser

VaI

451 VaI Leu Thr Ala VaI Leu VaI Tyr Leu Cys Ala Cys Pro Leu Lys

466 Arg Tyr VaI Lys His He Leu Tyr Pro Thr GIy Lys Leu Pro

Ser

481 Ser He GIu Ser GIy Met Phe Asp Ser Arg VaI Lys He Pro

Phe 496 VaI Leu GIn GIu GIu GIu Pro Thr Asp Leu Cys Tyr He He

Arg

511 Asn Ser GIu His Asp GIu Asp Ser VaI GIn Asn Arg Lys Tyr

Ser

526 Leu Lys GIu Ser Asn Thr Asp Ser GIy Asn Tyr Ser Asn GIu Asp

541 GIu Thr Thr GIy Asp Asn GIy Leu Ser He GIn Arg Met

Sequence 46, Xenopus tropicalis IFN-αRl, partial cDNA nucleotide sequence

1 ATGGCCGCGG AGCCGGGCCT GTTGCTAGGG GCAGTATTAT GTATCCTGCC 51 GCTCTTGCCG TTCGGGACCG GGGCGCTACT AACAGGTCTA ACTTACCCGG

101 AGCCGCCTTT CAACGTAACA GTCGATATGC TCCCCGACAG ATATTCTGTA

151 ATGTGGGACT GGAATAGTGT CAATTGGGGG GACACTAAGA ATGTGACATT

201 TTCTGTGTTG CTCCGCAAAC TAAAAAAGAA AACCCAGTGG AACAGTGTCC

251 CCGGATGCCT TCACATTCCT CATCGCAACT GTAGCATTGA CCCAGCGCTT 301 GTAGATATTG ATAAGCGTTA CCAAGTGCGA GTCCGAGCTG AAATAGCACA

351 AATAAATTTT TCGTTTTCAG ATACGATTAC ATTTACTCCA AAGGCACCAG 401 GAGAAATCGC TCTTCCCATC GCTGTTCATG TGGAAAGCAT TGATGGGGGT

451 GTCAAAATAA AAATTACCCT CCCTAACACA CGAGAATATT GGGACAATGC

501 TTTGTTCGAC TATATATTGT TGCTCAGGAC AAACAGCTCT ATAGAGGAGA

551 GAAGGTCGTT GTATCCGAAT TTTTATCTTT ATGACCTCAA TCCTGGCGAA 601 AACTACTGTT TCAAAGTAAA AGTGTCTAGC TACTTAACAA AGACGAATGA

651 CACATTTAGT CCCGAGAAGT GTTTCAAAGT GGAGGCAGTA GGACTGGATG

701 GCCGGCCGTA TCCAGAGAAC GTAACGATGG AAGCTCTGAA CACAAACTAC 751 ATGTTAAAAT GGGACTGGGA TTATTCACAG CATCCAAATG TGACATTCTC

801 CGTAGAAAAT AATTCAGAAA TATGGCCAGG CAAATGGAAT CAAGTGCAAG 851 GATGTGAAAA TATTAGCAGG CACAACTGTG ATGTTTCCGG AATATACATT

901 TATGGAAAGT ATCATTTCCG TGTAGCCGCA TCGCTTGATA ACAACAACAG

951 AACGCTCTCC AGGGCCCTGC GGTTTAATCC AGAAAAGGAT ACCGTGATTG

1001 GGCCCCCTTC AAACGTGAGC ACAGAGTTAT ATGGCACAAA GCTGCACGTC

1051 AATGTGTTGA AAGTGGAAGC TTTTCACAAT GATGATTTAA AGAATTACTG 1101 TGACTGGGAA TACAATCTGA TATACTGGAA GGACAGCGCG TCTGACAGAG

1151 AGGAGAAAAC ACTAAATGAG AAAGTGGGAA GATTTACAAT AGAΆGTAGAA

1201 GCCTCAACCA CATACTGCCT GACAGTCAGA GTTGTCTGTC AAACCCATAA 1251 CAGAAGCGGG CTTTTTAGTG AGACGCAGTG CATCACCACA GGCGCCGATG

1301 CTCTGCCAGT TTGGAGTGCG GGGATTGTTA TCGGTGTCCT CTTAAGTGTA 1351 GTTCTTACAG CAGTGCTGGT TTATCTCTGT GCTTGTCCTT TGAAACGATA

1401 CGTCAAGCAC ATATTGTACC CCACCGGGAΆ ACTTCCATCA AGCATCGAAA

1451 GCGGTATGTT TGATTCACGT GTGAAAATTC CATTTGTATT ACAAGAAGAA 1501 GAGCCAACAG ACCTGTGCTA TATAATTAGG AACAGTGAGC ATGATGAAGA 1551 CAGTGTGCAG AATCGTAAAT ATTCATTGAA AGAAAGCAAC ACAGACTCTG 1601 GTAATTACTC AAATGAAGAT GAAACCACTG GGGACAATGG CCTCTCCATA

1651 CAGAGAATGT AG

Sequence 47, Ciona intestinalis CRFBRl, protein sequence

This sequence is a previously unrecognized (undiscovered) class 2 cytokine receptor chain related to the ligand binding chains. This sequence encodes a ligand-binding receptor chain that encodes the first-ever discovered invertebrate interferon receptor.

1 Met Phe VaI VaI VaI Tyr VaI Ser He Leu VaI Ala Ser Lys His

16 He His His Thr Lys Asn GIy GIu Lys Thr His Leu Arg Thr Lys

31 Asn Ser He Thr GIy His Arg Asn VaI Arg VaI Asp Ser VaI Met 46 Leu Arg His Thr VaI VaI Trp Asp Arg Phe Pro GIy GIu Asn

Asn

61 Phe Ser VaI Leu Tyr Arg Ser Lys GIy Thr Leu Lys Trp Met GIn

76 lie Pro GIn Ser Arg Met lie Asp Ser Thr His Cys Asp Ala

Ser 91 His GIu Phe Arg Asn Ala Leu Leu Thr Tyr Tyr lie Thr VaI

VaI 106 Ser Asp lie Asn Thr GIn VaI Thr GIu Lys lie Gin Phe Arg

Pro

121 GIu Leu Asp Thr Thr Leu Leu Pro Pro GIn Phe Ser Ala Phe

Arg

136 His Lys GIu VaI lie Phe lie Arg Pro VaI Ala Pro VaI Asn Leu

151 GIy Thr GIy Gin Met Leu He GIu GIu Met Arg Thr Leu Lys

Tyr

166 GIn VaI His Tyr Tyr Thr Pro Arg Lys Pro He Leu Ser GIu

Asn 181 He Ser VaI Leu He His Asp Thr GIn He Ala Ser Pro Ser

Leu

196 Asp Pro Ser Arg GIn Phe Cys Phe Arg He Arg Leu Phe GIu

Pro

211 Asp Tyr Ala Ala VaI His Ala Lys Ser GIy Phe Ser VaI Trp Ser

226 Asn Thr Thr Cys Phe Lys GIy GIn His GIu Pro Lys Ser VaI

Lys

241 He His Asp Arg Thr Ala Leu Thr GIy VaI GIy VaI Ser Leu

GIy 256 Cys VaI Leu Phe He Phe Leu Leu Phe Tyr GIy Thr Tyr Arg

GIy

271 Tyr Lys VaI Tyr Lys Ser Leu His Lys VaI GIy GIu VaI Pro

Lys

286 Ser Leu VaI Ser Asp VaI Lys GIn He Tyr Ser Thr VaI Trp

Sequence 48, Ciona intestinalis CRFBRl, cDNA nucleotide sequence 1 ATGTTCGTAG TTGTTTATGT GAGTATTTTA GTGGCGAGCA AACATATTCA

51 TCATACGAAA AACGGAGAGA AAACACATTT GCGAACGAAA AACTCAATTA

101 CAGGTCACAG GAACGTCCGC GTGGATTCGG TTATGCTGCG GCATACAGTC

151 GTCTGGGATC GATTTCCAGG GGAGAACAAC TTCTCCGTAT TGTACAGGAG 201 CAAGGGCACA TTGAAATGGA TGCAAATCCC CCAAAGTCGG ATGATTGACA

251 GCACCCACTG TGACGCAAGC CACGAGTTCC GTAACGCGCT ACTCACCTAC

301 TACATAACTG TAGTCAGCGA TATCAACACT CAAGTGACCG AGAAAATCCA

351 ATTCAGACCA GAACTCGACA CAACGTTGCT GCCGCCTCAA TTCAGCGCTT

401 TTCGTCACAA AGAAGTAATT TTCATTCGAC CGGTCGCTCC TGTTAACTTA 451 GGAACAGGGC AAATGCTAAT AGAAGAAATG AGGACGCTAA AATACCAGGT

501 TCATTACTAC ACACCAAGAA AACCTATTTT GTCAGAAAAT ATCAGCGTTC

551 TTATTCACGA CACACAAATA GCTTCACCGT CTTTAGACCC TTCCCGGCAA

601 TTCTGTTTCC GAΆTCCGACT CTTCGAACCG GATTATGCTG CAGTACATGC

651 GAAGTCCGGC TTCAGTGTTT GGAGTAATAC GACTTGCTTC AAGGGCCAAC 701 ACGAACCCAA ATCAGTAAAA ATCCATGACA GGACAGCGTT GACTGGGGTG

751 GGGGTTTCAC TCGGTTGCGT CCTGTTTATT TTCCTTCTAT TCTATGGCAC

801 ATACCGCGGG TACAAGGTGT ACAAGAGTTT GCACAAAGTA GGAGAAGTTC

851 CAAAAAGCTT GGTAAGCGAT GTTAAΆCAAA TATATAGTAC TGTGTGGTAA

Sequence 49, Ciona intestinalis CRFBR2, protein sequence

This sequence is a previously unrecognized (undiscovered) class 2 cytokine receptor chain related to the accessory chains. This sequence encodes an accessory receptor chain that encodes the first-ever discovered invertebrate interferon receptor.

1 Met Thr Thr Trp GIn Leu Phe Leu Leu Leu Leu lie VaI Phe Ser

16 Thr Ala Thr Ala Thr VaI Pro Thr Pro Arg Asn Leu Arg VaI Ser

31 Ala Tyr Asn Leu Asp His GIu Leu GIn Trp Asp Ala Pro Leu Ser 46 Asn Thr Ser Lys Asn Arg Thr lie GIy VaI Thr Tyr Ser VaI Arg

61 GIn Ala VaI Phe Asp GIu GIu Thr Leu Lys Thr Arg Trp GIn Tyr

76 lie Pro His Cys VaI His VaI Asn VaI Thr His Cys Tyr lie Thr

91 Asn He Thr Tyr Ser Pro Phe GIu Thr Tyr GIu Phe Asn VaI lie 106 Ala GIu He GIy Asn Arg Thr Ser Ser Leu Asp GIn Thr He Thr 121 Phe Leu Pro Phe Phe Asp GIy Leu Leu Tyr Ala Pro Asp Phe He 136 VaI Asp VaI His Asp Asn Thr Ala He Leu Tyr He Pro Arg Pro 151 Pro His He His Ser Thr GIy GIu VaI Leu Thr Asn Phe Leu Tyr 166 Asp Asp VaI Leu Thr Tyr Asn VaI GIn Tyr Trp Thr Thr GIy Ser 181 Pro Thr Pro Pro Asn Ala Thr Asp He VaI Lys Leu Thr Arg Pro 196 Ala Thr VaI Thr Asn He Thr VaI Arg VaI VaI GIy His GIu Pro 211 Ala Cys Phe Arg Leu Lys Leu Ser GIy Leu Leu Phe GIy Ser Ala 226 GIy Trp Ser Lys VaI Arg Cys Thr Thr Ser Thr Pro Arg Leu Leu 241 Ala Thr Ala Asp Lys Ala Lys His VaI His Thr Thr Ser Ser Tyr 256 Leu Thr Lys Ala VaI He GIy He VaI GIy GIy VaI VaI Phe Leu 271 Ala Leu Ala He VaI Cys VaI Lys Leu Ser Arg Ala Phe Leu Thr 286 Phe He Lys Ala Lys Lys His Arg Asp Leu Pro Pro Ser Leu VaI 301 He VaI Met Lys GIn Ser GIu Asn Asp Tyr GIu VaI Asp Ser Tyr 316 He Asp Thr GIu He VaI Thr Ser Leu GIy He Thr Pro Leu Met 331 Thr Gin Ala Lys Ser Cys Thr Ser Ser Lys Ser Asn He Ser VaI 346 Ser Phe VaI GIu VaI VaI Ser Thr Ala GIy Leu GIu Thr Arg Ser 361 Gin VaI Met GIn Thr Cys Asn Asn Lys Asp Asn GIu Tyr VaI Leu

376 Tyr He Ala Asp VaI GIu Arg Arg Ser Asn GIu Thr Asp Asp Ser

391 GIy GIy Asp Ser Thr He GIu Thr Arg Ser Leu Pro Asp Thr Asp

406 Ala Cys Cys Asp Ala Pro Pro VaI Asp He Leu Pro GIn Asn

Ser

421 Ser Asp His Ser Leu Tyr Phe Ala

Sequence 50, Ciona intestinalis CRFBR2, cDNA nucleotide sequence

1 ATGACAACTT GGCAATTATT CCTACTATTA CTTATAGTTT TCAGCACCGC

51 AACAGCAACA GTGCCAACAC CGCGAAATTT GCGCGTGTCT GCTTACAACT

101 TGGACCACGA GTTGCAATGG GATGCACCTT TAAGCAATAC CTCTAAAAAT

151 CGAACTATTG GTGTAACATA TTCGGTTCGG CAGGCAGTAT TTGATGAAGA 201 GACTTTAAAA ACACGCTGGC AATACATCCC TCATTGCGTG CATGTGAATG

251 TGACACATTG TTATATAACA AACATCACAT ATTCACCGTT TGAAACATAC

301 GAATTCAACG TGATTGCTGA AATCGGCAAC CGAACCAGCT CCTTGGACCA

351 AACGATTACG TTTTTGCCGT TTTTTGATGG CCTACTATAC GCCCCTGACT

401 TTATCGTTGA TGTACACGAC AACACAGCAΆ TACTTTATAT CCCAAGACCG 451 CCACATATTC ATTCAACAGG CGAGGTTTTA ACCAACTTTT TATACGATGA

501 CGTTCTCACC TATAATGTAC AGTATTGGAC AACGGGTTCA CCAACCCCGC

551 CAAATGCGAC TGATATTGTG AAACTCACAA GACCTGCAAC AGTTACAAAT

601 ATCACGGTTC GTGTTGTTGG TCATGAACCG GCTTGCTTCC GTTTAAAACT

651 GTCCGGGCTC CTGTTCGGTT CTGCTGGCTG GTCAAAAGTC CGTTGCACTA 701 CAAGTACCCC ACGGTTGCTG GCAACTGCAG ATAAAGCCAA ACATGTACAT

751 ACAACGTCAA GTTACTTAAC TAAAGCAGTA ATAGGCATAG TAGGTGGAGT

801 TGTATTTCTA GCTCTTGCAA TCGTATGCGT GAAGCTGTCA CGGGCATTCT

851 TAACGTTCAT TAAGGCGAAA AAACACAGGG ACTTACCGCC TTCTCTGGTA

901 ATTGTGATGA AACAAAGCGA AAATGATTAC GAGGTCGATT CTTATATCGA 951 CACCGAAATT GTGACGTCAC TTGGTATTAC CCCTCTGATG ACGCAAGCTA

1001 AAAGTTGTAC GTCATCAAAG AGCAACATTT CCGTCTCTTT TGTTGAGGTT

1051 GTGTCCACGG CAGGACTTGA AACCCGTTCC CAGGTTATGC AAACATGTAA

1101 TAACAAAGAC AATGAATATG TTTTGTATAT TGCCGATGTT GAGCGAAGAT

1151 CGAACGAAAC AGACGATTCT GGCGGGGATT CAACGATCGA AACTCGGTCG 1201 CTGCCAGATA CAGACGCGTG CTGCGACGCA CCCCCGGTTG ACATTCTTCC

1251 TCAGAATTCG AGTGATCACA GTTTATATTT TGCATAA Sequence 51, forward primer nucleotide sequence used to amplify the cDNA corresponding to the mature human IFN-v peptide CTCTCTGGACCATATGTGTCACTTTCAAAGGTGC

Sequence 52, reverse primer nucleotide sequence used to amplify the cDNA corresponding to the mature human IFN-v peptide ACTCCAAATTAGGGATCCTTATTTATGTAAATAACC

Sequence 53, forward primer nucleotide sequence used to modify the human IFN-v nucleotide sequence to yield an IFN-v protein sequence that expressed the entire protein by changing the stop codon TAA to CAA encoding GIn.

AATGCCCTCATTGCCAAACAAGAAATGTTACAGCAGATATTCAAC

Sequence 54, reverse primer nucleotide sequence used to modify the human IFN-v nucleotide sequence to yield an IFN-v protein sequence that expressed the entire protein by changing the stop codon TAA to CAA encoding GIn. GTTGAATATCTGCTGTAACATTTCTTGTTTGGCAATGAGGGCATT

Sequence 55, forward primer nucleotide sequence used to amplify the cDNA corresponding to the full-length chicken IFN III propeptide, which after cleavage of a signal peptide yielded the mature peptide

CTTTACCGGTACCATGTATGCTTTTGGCTTT

Sequence 56, reverse primer nucleotide sequence used to amplify the cDNA corresponding to the mature chicken IFN III peptide

CTTTGGTACCGGATCCTTACTTGTAAAGCTTCCT

Sequence 57, feline IFN-v, protein sequence This sequence represents the feline IFN-i' sequence of the mature peptide encoded from the DNA isolated from AK-D (ATCC #CCL-150) feline cell line (see Sequence 58). Sequence 57 resembles positions 24 - 192 of Sequence 25, but contains two amino acid changes (Leu-74 of Sequence 25 was changed to Pro-51 of this sequence and Asp- 120 of Sequence 25 was changed to Glu-97 of this sequence) found in the AK-D (ATCC #CCL- 150) feline cell line. This new interferon exhibits antiproliferative activity, may have other novel activities and is expected to be useful therapeutically.

1 Cys His Phe GIn Arg Arg GIy lie Trp GIu lie VaI GIn His Leu

16 GIu Asn Leu GIy GIy Lys Phe Pro Leu Arg Cys Leu Lys Asp Arg

31 Ser Asn Phe Arg Phe Leu GIn VaI Ala Lys lie Asp GIn Leu Pro

46 GIu GIu Thr Ala Phe Pro Ala He GIy GIu Met Leu Thr GIn VaI

61 Phe Asn Thr Phe Asn Leu Asn VaI Ser GIn Ser Leu Trp Asn GIu 76 Ser Arg Leu GIu Arg Leu Leu Ser GIy Leu Tyr Gin GIn Thr GIu

91 Lys Thr GIy VaI Cys Leu GIu GIn Asp Ser GIy Gin GIu Asp His

106 Ser Ser Ser GIn Arg GIu GIy Thr Arg Leu Ala He Lys Asn Tyr

121 Phe GIn GIy He Arg Asp Tyr Leu GIn GIy Gin Lys Tyr Ser His

136 Cys Ala Trp GIu VaI He Arg VaI GIu He Arg Arg Cys Phe Leu 151 Phe He GIu GIn Leu Thr Arg Arg His Arg Asp Gin GIu He GIy 166 His Leu His Asn

Sequence 58, feline IFN-v, cDNA nucleotide sequence This sequence was obtained by the polymerase chain reaction (PCR) with the use of genomic DNA from AK-D (ATCC #CCL-150) feline cell line and the following primers: 5 '-TGTCACTTTCAACGGAGGGGC-S ' (Sequence 59, equivalent to nucleotides 70 - 90 of Sequence 26) and 5 '-TTAGTTATGTAAGTGACCTATTTC-S ' (Sequence 60, equivalent to the reverse complement of nucleotides 556 - 579 of Sequence 26) as forward and reverse primers, respectively. Sequence 58 encodes the mature protein Sequence 57. Sequence 58 resembles nucleotides 70 - 579 of Sequence 26 except for two nucleotide differences (T-221 and T-360 of Sequence 26 are now C-152 and G-291 , respectively, of Sequence 58).

i TGTCACTTTC AΆCGGAGGGG CATCTGGGAG ATTGTACAAC ATTTAGAGAA

51 CCTTGGAGGA AAATTTCCCC TGAGATGTCT GAAGGACAGA AGCAACTTCA 101 GATTCCTCCA GGTTGCAAAA ATCGACCAGC TTCCGGAGGA AACTGCTTTC

151 CCGGCCATTG GAGAAATGCT GACACAGGTC TTCAACACTT TCAACCTGAA

201 TGTCTCCCAA TCGTTGTGGA ATGAAAGCCG TTTAGAGAGA CTCCTAAGTG 251 GACTGTATCA GCAAACGGAG AAGACAGGGG TATGCCTGGA GCAGGACTCT

301 GGGCAGGAGG ATCATTCATC CTCGCAAAGG GAGGGTACCA GACTTGCAAT 351 AAAGAATTAT TTCCAAGGCA TCCGTGACTA TTTGCAAGGC CAAAAGTATA

401 GCCACTGTGC CTGGGAGGTC ATCCGTGTGG AAATCCGAAG GTGTTTTCTC 451 TTCATTGAAC AGCTGACAAG AAGACATCGG GACCAAGAAA TAGGTCACTT 501 ACATAACTAA

Sequence 59, forward primer nucleotide sequence used to amplify the cDNA corresponding to the mature feline IFN-v peptide

TGTCACTTTCAACGGAGGGGC

Sequence 60, reverse primer nucleotide sequence used to amplify the cDNA corresponding to the mature feline IFN-v peptide TTAGTTATGTAAGTGACCTATTTC

Sequence 61, feline IFN-v mutant 1, protein sequence

This is a derivative of Sequence 25 in which Cys-171 was mutated to Ser-171. This mutant removes one cysteine from the protein. This new interferon is expected to have novel activities and is expected to be useful therapeutically.

1 Met Thr Ser Arg Ser Leu Pro Ser Trp Ala Leu Met Leu Leu Leu

16 Ser Ser Thr Ala Cys Ser Leu Asp Cys His Phe GIn Arg Arg GIy

31 He Trp GIu He VaI GIn His Leu GIu Asn Leu GIy GIy Lys Phe

46 Pro Leu Arg Cys Leu Lys Asp Arg Ser Asn Phe Arg Phe Leu GIn 61 VaI Ala Lys He Asp GIn Leu Pro GIu GIu Thr Ala Phe Leu Ala 76 lie GIy GIu Met Leu Thr GIn VaI Phe Asn Thr Phe Asn Leu

Asn

91 VaI Ser GIn Ser Leu Trp Asn GIu Ser Arg Leu GIu Arg Leu Leu

106 Ser GIy Leu Tyr GIn GIn Thr GIu Lys Thr GIy VaI Cys Leu

Asp

121 Gin Asp Ser GIy GIn GIu Asp His Ser Ser Ser GIn Arg GIu

GIy 136 Thr Arg Leu Ala lie Lys Asn Tyr Phe Gin GIy lie Arg Asp

Tyr

151 Leu GIn GIy GIn Lys Tyr Ser His Cys Ala Trp GIu VaI lie

Arg

166 VaI GIu lie Arg Arg Ser Phe Leu Phe lie GIu GIn Leu Thr Arg

181 Arg His Arg Asp GIn GIu lie GIy His Leu His Asn

Sequence 62, feline IFN-v mutant 1, cDNA nucleotide sequence

This is a derivative of Sequence 26 in which nucleotides 510 and 512 were mutated from G-510 to A-510 and G-512 to C-512. These codon changes mutated Cys-171 to Ser- 171 in the expressed protein (see Sequence 61). Two nucleotide substitutions were made so that recombinant DNA molecules possessing the mutation could be screened by the generation of a novel restriction endonuclease site created by the double mutation.

1 ATGACCAGCC GGAGCTTGCC GAGCTGGGCT TTGATGCTAC TTCTTTCCAG 51 TACTGCCTGC TCTCTGGACT GTCACTTTCA ACGGAGGGGC ATCTGGGAGA 101 TTGTACAACA TTTAGAGAAC CTTGGAGGAA AATTTCCCCT GAGATGTCTG 151 AAGGACAGAA GCAACTTCAG ATTCCTCCAG GTTGCAAAAA TCGACCAGCT

201 TCCGGAGGAA ACTGCTTTCC TGGCCATTGG AGAAATGCTG ACACAGGTCT 251 TCAACACTTT CAACCTGAAT GTCTCCCAAT CGTTGTGGAA TGAAAGCCGT 301 TTAGAGAGAC TCCTAAGTGG ACTGTATCAG CAAACGGAGA AGACAGGGGT

351 ATGCCTGGAT CAGGACTCTG GGCAGGAGGA TCATTCATCC TCGCAAAGGG 401 AGGGTACCAG ACTTGCAATA AAGAATTATT TCCAAGGCAT CCGTGACTAT 451 TTGCAAGGCC AAAAGTATAG CCACTGTGCC TGGGAGGTCA TCCGTGTGGA 501 AATCCGAAGA TCTTTTCTCT TCATTGAACA GCTGACAAGA AGACATCGGG 551 ACCAAGAAAT AGGTCACTTA CATAACTAA Sequence 63, feline JFN-v mutant 2, protein sequence

This is a derivative of sequence 25 in which Cys-24, Cys-118 and Cys-171 were mutated to Ser-24, Ser-118 and Ser-171. This mutant removes three cysteines from the protein Sequence 25. This new interferon is expected to have novel activities and is expected to be useful therapeutically.

1 Met Thr Ser Arg Ser Leu Pro Ser Trp Ala Leu Met Leu Leu Leu

16 Ser Ser Thr Ala Cys Ser Leu Asp Ser His Phe GIn Arg Arg GIy 31 lie Trp GIu lie VaI Gin His Leu GIu Asn Leu GIy GIy Lys Phe

46 Pro Leu Arg Cys Leu Lys Asp Arg Ser Asn Phe Arg Phe Leu GIn

61 VaI Ala Lys lie Asp GIn Leu Pro GIu GIu Thr Ala Phe Leu Ala

76 He GIy GIu Met Leu Thr GIn VaI Phe Asn Thr Phe Asn Leu Asn

91 VaI Ser GIn Ser Leu Trp Asn GIu Ser Arg Leu GIu Arg Leu Leu 106 Ser GIy Leu Tyr GIn GIn Thr GIu Lys Thr GIy VaI Ser Leu Asp

121 GIn Asp Ser GIy GIn GIu Asp His Ser Ser Ser GIn Arg GIu GIy

136 Thr Arg Leu Ala He Lys Asn Tyr Phe GIn GIy He Arg Asp Tyr

151 Leu GIn GIy GIn Lys Tyr Ser His Cys Ala Trp GIu VaI He Arg

166 VaI GIu He Arg Arg Ser Phe Leu Phe He GIu GIn Leu Thr Arg 181 Arg His Arg Asp GIn GIu He GIy His Leu His Asn

Sequence 64, feline IFN-v mutant 2, cDNA nucleotide sequence

This sequence is derived from Sequence 26. Nucleotide G-71 was mutated to C, nucleotide G-353 was mutated to C, nucleotide C-354 was mutated to T, and nucleotide G- 512 was mutated to C. These codon changes mutated Cys-24, Cys-118 and Cys-171 to Ser- 24, Ser-118 and Ser-171 in the expressed protein (see Sequence 59). In order to facilitate the identification of mutated nucleotide sequences, nucleotide A-351 was mutated to C; this did not alter the amino acid encoded by the new codon, but introduced a restriction endonuclease site.

1 ATGACCAGCC GGAGCTTGCC GAGCTGGGCT TTGATGCTAC TTCTTTCCAG 51 TACTGCCTGC TCTCTGGACT CTCACTTTCA ACGGAGGGGC ATCTGGGAGA

101 TTGTACAACA TTTAGAGAAC CTTGGAGGAA AATTTCCCCT GAGATGTCTG

151 AAGGACAGAA GCAACTTCAG ATTCCTCCAG GTTGCAAAAA TCGACCAGCT

201 TCCGGAGGAA ACTGCTTTCC TGGCCATTGG AGAΆATGCTG ACACAGGTCT

251 TCAACACTTT CAACCTGAAT GTCTCCCAAT CGTTGTGGAA TGAAAGCCGT 301 TTAGAGAGAC TCCTAAGTGG ACTGTATCAG CAΆACGGAGA AGACAGGGGT

351 CTCTCTGGAT CAGGACTCTG GGCAGGAGGA TCATTCATCC TCGCAAAGGG

401 AGGGTACCAG ACTTGCAATA AΆGAATTATT TCCAAGGCAT CCGTGACTAT

451 TTGCAAGGCC AAAAGTATAG CCACTGTGCC TGGGAGGTCA TCCGTGTGGA

501 AATCCGAAGG TCTTTTCTCT TCATTGAACA GCTGACAΆGA AGACATCGGG 551 ACCAAGAAAT AGGTCACTTA CATAACTAA

Sequence 65, modified human IFN-v mutant 1, protein sequence.

This sequence was derived from Sequence 5. Amino acids Cys-29 and Cys-179 were mutated to serine residues (Ser-29 and Ser-179) to remove a pair of cysteine residues. This new interferon may have novel activities and is expected to be useful therapeutically.

1 Met Thr Ser Gin Cys Leu Leu Asp Trp Ala Leu VaI Leu Leu Leu

16 Thr Thr Thr Ala Phe Ser Leu Asp Cys His Phe GIn Arg Ser Lys 31 GIy Asn Trp GIu lie Leu GIu His Leu Lys Asn Leu GIy GIu Lys

46 Phe Pro Leu GIn Cys Leu Lys Asp Arg Ser Asn Phe Arg Phe Phe

61 GIn VaI Ser Lys Ser Asn Leu Phe Ser Lys GIu Asn Ala Leu He

16 Ala Lys GIn GIu Met Leu GIn GIn He Phe Asn Thr Phe Ser Leu

91 Asn VaI Ser GIn Ser Phe Trp Asn GIu Ser Ser Leu GIu Arg Phe 106 Leu Ser Arg Leu Tyr Gin GIn He GIu Lys Thr GIu VaI Cys Leu 121 GIu GIn GIu Thr Arg Lys GIu GIy Arg Ser Leu Leu GIn Arg

GIy

136 Asn Thr lie Phe Arg Leu Lys Asn Tyr Phe GIn GIy lie His

Asn 151 Tyr Leu His His GIn Asn Tyr Ser Asn Cys Ala Trp GIu VaI

He

166 His VaI GIu He Arg Arg GIy Leu Leu Phe He GIu GIn Ser

Thr

181 Arg Arg Leu GIn Tyr GIn GIu Thr GIy Tyr Leu His Lys

Sequence 66, modified human IFN-V mutant 1, cDNA nucleotide sequence.

This sequence was derived from Sequence 6. Nucleotide G-86 was mutated to C-

86, nucleotide C-87 was mutated to T-87, and nucleotide G-536 was mutated to C-536. The altered codons from these three mutations changed Cys-29 and Cys- 179 to Ser-29 and Ser- 179 in the expressed protein (see Sequence 65). Finally, nucleotide G-84 was mutated to A-

84; this did not alter the amino acid encoded by the new codon, but introduced a restriction endonuclease site.

1 ATGACTAGTC AATGCTTGCT GGATTGGGCC TTGGTGCTAC TTCTCACCAC

51 TACTGCATTC TCTCTGGACT GTCACTTTCA AAGATCTAAG GGCAACTGGG 101 AGATTTTAGA ACATTTAAAA AACCTAGGAG AAAAATTTCC TCTGCAATGT

151 CTAAAGGACA GGAGCAACTT CAGATTCTTC CAGGTTTCTA AAAGTAACCT

201 GTTTTCAAAG GAAAΆTGCCC TCATTGCCAA ACAAGAAATG TTACAGCAGA

251 TATTCAACAC TTTCAGCCTT AATGTCTCCC AATCTTTTTG GAATGAAAGC

401 GGGGGAATAC CATATTTAGA CTAAAAAATT ATTTCCAAGG GATTCACAAC

451 TACTTACACC ACCAAAATTA TAGCAACTGT GCCTGGGAGG TCATCCATGT

501 TGAAATCCGA AGGGGTCTAC TATTTATTGA ACAGTCCACA AGAAGACTCC

551 AATACCAAGA AACAGGTTAT TTACATAAAT AA

Sequence 67, modified human IFN-v mutant 2, protein sequence.

This sequence was derived from Sequence 5. Amino acids Cys-24, Cys-29, Cys- 119 and Cys-179 were mutated to serine residues to remove four cysteine residues. This new interferon exhibited antiproliferative activity and antiviral activity, may have novel additional activities and is expected to be useful therapeutically. 1 Met Thr Ser GIn Cys Leu Leu Asp Trp Ala Leu VaI Leu Leu Leu

16 Thr Thr Thr Ala Phe Ser Leu Asp Ser His Phe GIn Arg Ser Lys 31 GIy Asn Trp GIu lie Leu GIu His Leu Lys Asn Leu GIy GIu Lys

46 Phe Pro Leu GIn Cys Leu Lys Asp Arg Ser Asn Phe Arg Phe Phe

61 Gin VaI Ser Lys Ser Asn Leu Phe Ser Lys GIu Asn Ala Leu He

76 Ala Lys GIn GIu Met Leu GIn GIn He Phe Asn Thr Phe Ser Leu

91 Asn VaI Ser Gin Ser Phe Trp Asn GIu Ser Ser Leu GIu Arg Phe 106 Leu Ser Arg Leu Tyr Gin Gin He GIu Lys Thr GIu VaI Ser Leu

121 GIu Gin GIu Thr Arg Lys GIu GIy Arg Ser Leu Leu GIn Arg GIy

136 Asn Thr He Phe Arg Leu Lys Asn Tyr Phe GIn GIy He His Asn

151 Tyr Leu His His GIn Asn Tyr Ser Asn Cys Ala Trp GIu VaI He

166 His VaI GIu He Arg Arg GIy Leu Leu Phe He GIu GIn Ser Thr 181 Arg Arg Leu GIn Tyr Gin GIu Thr GIy Tyr Leu His Lys

Sequence 68, modified human IFN-v mutant 2, cDNA nucleotide sequence.

This sequence was derived from Sequence 6. Nucleotide G-71 was mutated to C- 71, nucleotide G-86 was mutated to C-86, nucleotide C-87 was mutated to T-87, nucleotide G-356 was mutated to C-356, and nucleotide G-536 was mutated to C-536. The altered codons from these mutations changed Cys-24, Cys-29, Cys-119 and Cys- 179 to Ser-24, Ser-29, Ser-119 and Ser-179 in the expressed protein (see Sequence 67). These mutations changed the respective mutated codons so that serine instead of cysteine was encoded into the polypeptide. Nucleotides TTG (358-360) were mutated to CTC (358-360); this did not alter the amino acid encoded by the new codon, but introduced a restriction endonuclease site. 1 ATGACTAGTC AATGCTTGCT GGATTGGGCC TTGGTGCTAC TTCTCACCAC

51 TACTGCATTC TCTCTGGACT CTCACTTTCA AAGGTCTAAG GGCAACTGGG

101 AGATTTTAGA ACATTTAAAA AACCTAGGAG AAAAATTTCC TCTGCAATGT

151 CTAAAGGACA GGAGCAACTT CAGATTCTTC CAGGTTTCTA AAAGTAACCT 201 GTTTTCAAAG GAAAATGCCC TCATTGCCAA ACAAGAAATG TTACAGCAGA

251 TATTCAACAC TTTCAGCCTT AATGTCTCCC AATCTTTTTG GAATGAAAGC

30,1 AGCTTGGAGA GATTCCTAAG TAGACTTTAT CAGCAAATAG AGAAGACAGA

351 GGTGTCTCTC GAGCAGGAAA CCAGGAAAGA GGGCCGTTCA CTCTTGCAAA

501 TGAAATCCGA AGGGGTCTAC TATTTATTGA ACAGTCCACA AGAAGACTCC

551 AATACCAAGA AACAGGTTAT TTACATAAAT AA

Sequence 69, human IFN-v peptide, protein sequence. This sequence was derived from Sequence 3. This sequence includes the signal peptide while the mature peptide that was purified lacks the signal peptide. This new interferon peptide fragment (Cys-24 - Lys-77) exhibited antiproliferative activity and antiviral activity, may have novel additional activities and is expected to be useful therapeutically. 1 Met Thr Ser GIn Cys Leu Leu Asp Trp Ala Leu VaI Leu Leu Leu

16 Thr Thr Thr Ala Phe Ser Leu Asp Cys His Phe GIn Arg Cys Lys

31 GIy Asn Trp GIu lie Leu GIu His Leu Lys Asn Leu GIy GIu Lys

46 Phe Pro Leu GIn Cys Leu Lys Asp Arg Ser Asn Phe Arg Phe Phe

61 GIn VaI Ser Lys Ser Asn Leu Phe Ser Lys GIu Asn Ala Leu He 76 Ala Lys

Sequence 70, human IFN-v peptide, cDNA nucleotide sequence.

This sequence was derived from Sequence 4 and comprises nucleotide 1 to 234 of Sequence 4 encoding the IFN-v peptide. 1 ATGACTAGTC AATGCTTGCT GGATTGGGCC TTGGTGCTAC TTCTCACCAC 51 TACTGCATTC TCTCTGGACT GTCACTTTCA AAGGTGCAAG GGCAACTGGG ioi AGATTTTAGA ACATTTAAAA AACCTAGGAG AAAΆATTTCC TCTGCAATGT

151 CTAAAGGACA GGAGCAACTT CAGATTCTTC CAGGTTTCTA AAAGTAACCT 201 GTTTTCAAAG GAAAATGCCC TCATTGCCAA ATAA

Sequence 71, human IFN-v pseudogene mutated to remove the internal stop codon

This sequence is a mutant form of a previously unrecognized (undiscovered) novel type I IFN present in humans. It is equivalent to SEQ ED NO:3, except that the codon at position 78 has been replaced by one of the 19 naturally-occurring amino acids. (Xaa is selected from Ala, GIy, Cys, Met, VaI, Ser, Thr, Leu, He, Tip, Phe, Tyr, Lys, Arg, His, GIu,

GIn, Asp and Asn)

1 Met Thr Ser GIn Cys Leu Leu Asp Trp Ala Leu VaI Leu Leu

Leu

16 Thr Thr Thr Ala Phe Ser Leu Asp Cys His Phe GIn Arg Cys Lys

31 GIy Asn Trp GIu lie Leu GIu His Leu Lys Asn Leu GIy GIu

Lys

46 Phe Pro Leu GIn Cys Leu Lys Asp Arg Ser Asn Phe Arg Phe

Phe 61 GIn VaI Ser Lys Ser Asn Leu Phe Ser Lys GIu Asn Ala Leu

He

76 Ala Lys Xaa GIu Met Leu GIn GIn He Phe Asn Thr Phe Ser

Leu

91 Asn VaI Ser GIn Ser Phe Trp Asn GIu Ser Ser Leu GIu Arg Phe

106 Leu Ser Arg Leu Tyr GIn GIn He GIu Lys Thr GIu VaI Cys

Leu

121 GIu GIn GIu Thr Arg Lys GIu GIy Arg Ser Leu Leu GIn Arg

GIy 136 Asn Thr He Phe Arg Leu Lys Asn Tyr Phe GIn GIy He His

Asn

151 Tyr Leu His His GIn Asn Tyr Ser Asn Cys Ala Trp GIu VaI

He

166 His VaI GIu He Arg Arg GIy Leu Leu Phe He GIu GIn Cys Thr

181 Arg Arg Leu GIn Tyr Gin GIu Thr GIy Tyr Leu His Lys

Claims

We Claim:

1. An isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 80% identical to at least ten contiguous amino acids of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 or 71.

2. An isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 90% identical to at least ten contiguous amino acids of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 or 71.

3. An isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 95% identical to at least ten contiguous amino acids of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 or 71.

4. An isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 98% identical to at least ten contiguous amino acids of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 or 71.

5. An isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is at least 99% identical to at least ten contiguous amino acids of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 or 71.

6. An isolated nucleic acid encoding a polypeptide, wherein the polypeptide has an amino acid sequence that is identical to at least ten contiguous amino acids of the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 or 71.

7. The isolated nucleic acid of any one of claims 1-6, wherein the polypeptide has an amino acid sequence that is identical to at least 20 contiguous amino acids of said sequences.

8. The isolated nucleic acid of any one of claims 1-6, wherein the polypeptide has an amino acid sequence that is identical to at least 50 contiguous amino acids of said sequences.

9. The isolated nucleic acid of any one of claims 1 -6, wherein the polypeptide has an amino acid sequence that is identical to at least 100 contiguous amino acids of said sequences.

10. An isolated polypeptide encoded by the isolated nucleic acid of any one of claims 1 - 9.

11. An isolated polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 57, 61, 63, 65, 67, 69 and 71, or a contiguous segment of at least 10 amino acids of one of said sequences, wherein the fragment is at least 10 amino acids in length.

12. The polypeptide or claim 11, wherein the segment is at least 20 amino acids in length.

13. The polypeptide or claim 11, wherein the segment is at least 50 amino acids in length.

14. The polypeptide of any one of claims 10-13, wherein the polypeptide (i) inhibits proliferation of a mammalian cell; or

(ii) inhibits viral infection of a mammalian cell; or (iii) both.

15. The polypeptide of claim 14, wherein the mammalian cell is a HeLa cell.

16. An isolated polypeptide comprising the amino acid sequence set forth in SEQ ID NO:69.

17. An isolated polypeptide comprising residues 24-77 of SEQ ID NO:69.

18. An isolated polypeptide comprising an amino acid sequence that is at least 90% identical to the amino acid sequence of residues 24-77 of SEQ ID NO.69.

19. The isolated polypeptide of claim 18, wherein the polynucleotide sequence is at least 95% identical to the amino acid sequence of residues 24-77 of SEQ ID NO:69.

20. The isolated polypeptide of claim 18, wherein the polynucleotide sequence is at least 97% identical to the amino acid sequence of residues 24-77 of SEQ ID NO:69.

21. The isolated polypeptide of claim 18 , wherein the polynucleotide sequence is at least 99% identical to the amino acid sequence of residues 24-77 of SEQ ID NO:69.

22. The isolated polypeptide of any one of claims 18-21, wherein the polypeptide has antiproliferative or anti-viral activity or both.

23. A polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71, or to a contiguous portion thereof of at least 10 amino acids in length.

24. The polypeptide of claim 23, wherein the polypeptide has least 95% amino acid sequence identity.

25. The polypeptide of claim 23, wherein the polypeptide has least 96% amino acid sequence.

26. The polypeptide of claim 23, wherein the polypeptide has least 97% amino acid sequence.

27. The polypeptide of claim 23, wherein the polypeptide has least 98% amino acid sequence.

28. The polypeptide of claim 23, wherein the polypeptide has least 99% amino acid sequence.

29. The polypeptide of claim 23, wherein the portion is at least 20 amino acids in length.

30. The polypeptide of claim 23, wherein the portion is at least 50 amino acids in length.

31. The polypeptide of claim 23, wherein the portion is at least 100 amino acids in length.

32. The polypeptide of claim 23, wherein the polypeptide inhibits proliferation of HeLa cells.

33. The polypeptide of claim 23 or 32, wherein the polypeptide inhibits viral infection of a mammalian cell.

34. The polypeptide of claim 33, wherein the viral infection is an encephalomyocarditis viral infection or a vesicular stomatitis viral infection or one caused by one of coronavirus, smallpox virus, cowpox virus, monkeypox virus, West Nile virus, vaccinia virus, respiratory syncytial virus, rhinovirus, arterivirus, filovirus, picornavirus, reovirus, retrovirus, papovavirus, herpesvirus, poxvirus, hepadnavirus, astrovirus, coxsackie virus, paramyxoviridae, orthomyxoviridae, echovirus, enterovirus, cardiovirus, togavirus, rhabdovirus, bunyavirus, arenavirus, bornavirus, adenovirus, parvovirus, influenza virus or flavivirus.

35. The polypeptide of claim 33, wherein the mammalian cell is a HeLa cell or an MDBK cell.

36. The polypeptide of any one of claims 23-35, wherein the portion comprises at least 100, 120, 140, 160, 180, 185 or 190 contiguous amino acids of any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71.

37. The polypeptide of claim 36, wherein the portion includes the amino acid at position 78.

38. A polypeptide comprising the amino acid sequence set forth in any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71.

39. The polypeptide of anyone of claims 23-38, wherein the polypeptide comprises a modification that increases serum half-life.

40. The polypeptide of claim 39, wherein the modification comprises a polyethylene glycol (PEG) group.

41. The polypeptide of claim 40, wherein the polyethylene glycol is selected from linear PEG chains and branched PEG chains.

42. The polypeptide of claim 39, wherein the polyethylene glycol group is attached to a group selected from the lysine side chains and the N-terminaϊ amino group of the polypeptide.

43. An expression vector capable of replicating in a prokaryotic cell, an eukaryotic cell, or both, comprising the nucleic acid of any of claims 1-9.

44. A host cell including the expression vector of claim 43.

45. The host cell of claim 44, wherein the host cell is E. coli, B. subtilis, a yeast cell, an insect cell or a mammalian cell.

46. A method of producing a polypeptide, comprising

(i) culturing the host cell of claim 45 in a cell culture medium to express said polypeptide;

(ii) and isolating said polypeptide from said cell culture.

47. The method of claim 46, wherein the host cell is E. coli, B. subtilis, a yeast cell, an insect cell, a myeloma cell, a fibroblast 3T3 cell, a COS cell, a Chinese hamster ovary (CHO) cell, a mink-lung epithelial cell, a human foreskin fibroblast cell, a human glioblastoma cell, and a teratocarcinoma cell

48. An isolated antibody, or antigen-binding fragment thereof, that binds specifically to any one of the polypeptides of claims 10-42. 49. An isolated antibody that specifically binds to a polypeptide comprising the amino acid sequence set forth in SEQ E) NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47,

49, 57, 61, 63, 65, 67, 69 and 71.

50. The antibody of claim 48 or 49, wherein the antibody is a monoclonal antibody.

51. The antibody of claim 48 or 49, where in the antibody is a humanized antibody.

52. The antibody of claim 48 or 49, wherein the antibody is a polyclonal antibody.

53. The antibody of claim 48 or 49, wherein the antibody blocks binding of the polypeptide to its receptor.

54. A composition comprising at least one of the nucleic acids, polypeptides or antibodies of any one of claims 1-42 and 48-53, and a pharmaceutically acceptable excipient.

55. A composition comprising the polypeptide of any one of claims 10-42, and a pharmaceutically acceptable excipient.

56. A composition comprising the H⁷N-V polypeptide of any one of claims 23-42.

57. A method of treating a mammal comprising administering a therapeutically effective amount of the composition of claim 55 or 56.

58. A method of treating a mammal comprising administering a therapeutically effective amount of the isolated polypeptide of any of claims 10-42.

59. The method of claim 57 or 58, further comprising administering to the mammal an IFN-α polypeptide, an IFN-β polypeptide or an IFN-γ polypeptide.

60. The method of any one of claims 57-59, wherein the composition comprises an IFN-v polypeptide or biologically-active fragment thereof.

61. The method of claim 60, further comprising administering to the mammal an EFN-α polypeptide, an IFN-β polypeptide or an IFN-γ polypeptide, in an amount that synergizes with the IFN-v polypeptide administered to the mammal.

62. The method of any one of claims 57-59, wherein the method comprises a treatment for an immune system related disorder.

63. The method of any one of claims 57-59, wherein the method comprises a treatment for disorder selected from an autoimmune disease, multiple sclerosis, lymphoma, and allergy.

64. The method of claim 63, wherein the autoimmune diseases is multiple sclerosis, type-I diabetes, Hashinoto's thyroiditis, Crohn's disease, rheumatoid arthritis, systemic lupus erythematosus, gastritis, autoimmune hepatitis, hemolytic anemia, autoimmune hemophilia, autoimmune lymphoproliferative syndrome (ALPS), autoimmune uveoretinitis, glomerulonephritis, Guillain-Barre syndrome, psoriasis or myasthenia gravis.

65. The method of any one of claims 57-59, wherein the method comprises a treatment for a viral infection.

66. The method of any one of claims 57-59, wherein the method comprises a treatment for a parasitic infection.

67. The method of any one of claims 57-59, wherein the method comprises a treatment for cancer.

68. The method of any one of claims 57-59, wherein the method comprises a treatment for an autoimmune disease.

69. The method of any one of claims 57-59, wherein the method comprises a treatment for multiple sclerosis.

70. The method of any one of claims 57-59, wherein the method comprises a treatment for a lymphoma.

71. The method of any one of claims 57-59, wherein the method comprises a treatment for an allergy.

72. The method of claim 65, wherein the viral infection is viral hepatitis, papilloma viral infection, herpes, or viral encephalitis.

73. The method of claim 65, wherein the viral infection is caused by a virus selected from coronavirus, smallpox virus, cowpox virus, monkeypox virus, West Nile virus, vaccinia virus, respiratory syncytial virus, rhinovirus, arterivirus, filovirus, picornavirus, reovirus, retrovirus, papovavirus, herpesvirus, poxvirus, hepadnavirus, astrovirus, coxsackie virus, paramyxoviridae, orthomyxoviridae, echovirus, enterovirus, cardiovirus, togavirus, rhabdovirus, bunyavirus, arenavirus, bornavirus, adenovirus, parvovirus, and flavivirus.

74. The method of claim 67, wherein the cancer includes hairy cell leukemia, chronic myeloid leukemia, lymphoma, acute myeloid leukemia, osteosarcoma, basal cell carcinoma, glioma, renal cell carcinoma, multiple myeloma, melanoma, prostate cancer, breast cancer, lung cancer, colon cancer, pancreatic cancer or Hodgkin's disease.

75. The method of claims 57-74, wherein the mammal is a non-human mammal.

76. The polypeptide of anyone of claims 23-42, wherein the polypeptide enhances the activity of a type I interferon or a type II interferon.

77. The polypeptide of claim 76, wherein the type I interferon is selected from human interferon alphas (IFN-αs) and human interferon betas (IFN-βs).

78. The polypeptide of claim 76, wherein the Type II interferon is human interferon gamma (IFN-γ).

79. A composition comprising

(i) the polypeptide of anyone of claims 23-42; (ii) a type I or type II interferon; and (iii) a pharmaceutical-acceptable carrier

80. A composition comprising:

(i) an IFN-V interferon;

(ii) an IFN-α interferon, an IFN-β interferon or an IFN-γ interferon; and (iii) a pharmaceutical-acceptable carrier

81. A vaccine comprising (i) an antigen; and (ii) the IFN-v polypeptide of any one of claims 23-42.

82. A method for identifying a compound that modulates the activity of an IFN-v polypeptide, the method comprising

(i) contacting a cell with the IFN-v polypeptide and with the compound; and (ii) measuring a response of the cell to the IFN-v polypeptide; wherein a compound that modulates the response of the cell to the IFN-v polypeptide is a modulator of the IFN-v polypeptide.

83. The method of claim 82, wherein the response of the cell is cell division or susceptibility to viral infection.

84. The method of claim 82, wherein the IFN-v polypeptide

(i) shares at least 90% amino acid sequence identity to any one of SEQ E) NOs: 3,

5, 25, 57, 61, 63, 65, 67, 69 and 71, or to a portion thereof; or (ii) comprises at least 100, 120, 140, 160, 180, 185 or 190 contiguous amino acids of any one of SEQ ID NOs: 3, 5, 25, 57, 61, 63, 65, 67, 69 and 71; or (iii) both.

85. A method of detecting the level of a IFN-v polypeptide in a mammal, the method comprising

(i) obtaining a sample from the mammal; (ii) contacting the sample with an antibody specific for the IFN-v polypeptide; and

(iii) quantifying the amount of antibody bound to the IFN-v polypeptide.

86. A method of detecting the level of a IFN-v nucleic acid in a mammal, the method comprising (i) obtaining a sample from the mammal;

(ii) contacting the sample with a polynucleotide complementary to the IFN-v nucleic acid; and

(iii) quantifying the amount of polynucleotide bound to the EFN-v nucleic acid.

87. The method of claim 85 or 86, wherein the sample is selected from whole blood, serum and plasma.

88. The host cell of claim 45, wherein the mammalian cell is a myeloma cell, fibroblast 3T3 cell, COS cell, Chinese hamster ovary (CHO) cell, mink-lung epithelial cells, human foreskin fibroblast cell, human glioblastoma cells, or a teratocarcinoma cell.