MXPA00011932A

MXPA00011932A - Membrane-bound proteins and nucleic acids encoding the same

Info

Publication number: MXPA00011932A
Application number: MXPA/A/2000/011932A
Authority: MX
Inventors: Austin L Gurney; Audrey Goddard; William I Wood; Jian Chen; Jean Yuan; Kevin Baker; Victoria Smith; Colin K Watanabe
Original assignee: Genentech Inc
Priority date: 1998-06-02
Filing date: 2000-11-30
Publication date: 2001-11-21

Abstract

The present invention is directed to polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Description

- - SECRET AND TRANSMEMBRANE POLYPEPTIDES AND NUCLEIC ACIDS THAT CODIFY THE SAME FIELD OF THE INVENTION The present invention relates in general to the identification and isolation of the new DNA and to the recombinant production of new polypeptides.

BACKGROUND OF THE INVENTION Extracellular proteins play important roles in, among other things, the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, for example, proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and / or from the immediate environment. This information is often transmitted by secreted polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which, in turn, are received and interpreted by various cellular receptors or linked proteins. to the membrane. These secreted polypeptides or REF. DO NOT. 124936 - signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment.

The secreted proteins have several industrial applications, which include the use as pharmaceutical agents, of diagnostics, biosensors and bio-reactors. Most of the proteinaceous drugs available in the present, such as thrombolytic agents, interferons, interleukins, e r i t ropoieties, colony stimulation factors, and several other cytokines, are secretory proteins. Their receptors, which are proteins bound to the membrane, also have potential use as diagnostic or therapeutic agents. Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for new secreted proteins. Examples of selection methods and techniques are described in the literature [see, for -H-tifl-iM-a-a-t-aÉ-1 - -example, Klein et al., Proc. Nati Acad. Sci. 93: 7108-7113 (1996); U.S. Patent No. 5, 536, 637)].

Proteins bound to the membrane and receptors can play important roles in, among other things, the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, for example, proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and / or from the immediate environment. This information is often transmitted by secreted polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiating factors, neuropeptides, and hormones) which, in turn, are received and interpreted by various cellular receptors or linked proteins. to the membrane. Such membrane-bound proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules such as -M-to-Üil ^ - - selectins and integrins. For example, the transduction of signals that regulate cell growth and differentiation are regulated in part by the phosphorylation of several cellular proteins. The protein tyrosine kinases, enzymes that catalyze this process, can also act as growth factor receptors. Examples include the fibroblast growth factor receptor and the nerve growth factor receptor.

The membrane-bound proteins and the receptor molecules also have various industrial applications, including diagnostic or therapeutic agents. The receptor immunoassays, for example, can be used as therapeutic agents to block the receptor-1 igand interaction. The membrane-bound proteins can also be used to separate the potential peptide or small molecular inhibitors from the relevant receptor / ligand interaction.

Efforts have been made both by the industry and the academia to identify new native membrane-bound or receptor proteins. Many efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for new proteins receptors or linked to the membrane. 1. PR0281 A new gene designated transcript of the improved testis gene (TEGT) has recently been identified ^) 10 in humans (Walter et al., Genomics 20: 301-304 (1995)). The results have shown that the TEGT protein is regulated during development in mammalian testes and possesses a portion of the nuclear target that allows the The protein localizes to the nucleus (Walter et al., Mamm. Genome 5: 216-221 (1994)). As such, it is believed that the TF protein TEGT plays an important role in the development of the testes. Therefore, there is a substantial interest in identifying and characterizing new polypeptides having homology to the TEGT protein. The identification and characterization of the new polypeptides having homology to the TEGT protein, designated herein as polypeptides, is described herein.

PR0281. - - 2. PR0276 Efforts have been made both by the industry and by the academy to identify • new proteins bound to the membrane, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new membrane-bound proteins. It is described in the present identification and characterization of the new transmembrane polypeptides, designated herein as polypeptides PR0276. 3. PR0189 15 Efforts have been made both by industry and academia to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries for identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated herein as PR0189 polypeptides, is described herein.

- - PRO190 Of particular interest are proteins that have seven transmembrane domains (7TM), or more generally, all transmembrane space generating proteins, multiple. Among the multiple transmembrane space generating proteins are ion channels and transporters. Examples of transporters are the UDP-galactose transporter described in Ishida, et al. • 10 al., J. Biochem., 120 (6): 1074-1078 (1996), and the CMP-sialic acid transporter described in Eckhardt, et al., PNAS, 93 (15): 7572-7576 (1996 ). Described herein is the identification and characterization of the new polypeptides of transmembrane, designated herein as PRO190 polypeptides. • 5. PR0341 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new membrane-bound proteins. Disclosed herein is the identification and characterization of the novel transmembrane polypeptides, designated herein as PR0341 polypeptides. 6. PRO180 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. • 10 Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new proteins bound to the membrane. It is described in the present Identification and characterization of the new transmembrane polypeptides, designated in the • present as PRO180 polypeptides. 7 PR0194 20 Efforts have been made both by the industry and by the academia to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of recombinant DNA libraries from mammal to identify the coding sequences for the new proteins bound to the membrane. The identification and characterization of the new transmembrane polypeptides, designated in the • present as PR0194 polypeptides. 8. PRO203 Enzymatic proteins play important roles in the chemical reactions involved in the digestion of food, the biosynthesis of macromolecules, the controlled release and the use of chemical energy, and other processes necessary to sustain life. ATPases are a family of enzymes that play a variety of important roles, which include energizing the transport of ions and molecules, through cell membranes. The transport mechanisms • that they use ATPases often involve the exclusion of xeno- and endobiotic toxins from the environment cellular environment, thus protecting the cells from the toxicity of these compounds. Lu et al. Report a mechanism of detoxification in which glutathione S-ransferase (GST) catalyzes the glutathioneation of plant toxins, and a Mg-specific ATPase 2+ is involved in the transport - - of the glutathione S conjugates of the cytosol. Proc. Nati Acad. Sci. USA 94 (15): 8243-8248 (1997). This study and others indicate the importance of the identification of ATPases, such as GST 5 ATPase, and of new proteins that have a sequence identity with ATPases.

More generally, and also of interest are the new proteins bound to the membrane, which include those that may be involved in the transport of ions and molecules through the membranes. The proteins bound to the membrane and the receptors can play important roles in the formation, differentiation and maintenance of the multicellular organisms. The fate of many individual cells, for example, proliferation, 4fc migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and / or the environment immediate environment. This information is often transmitted by secreted polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones).

Which, in turn, are received and interpreted by - - various cellular receptors or proteins bound to the membrane. Such membrane-bound proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. For example, the transduction of signals that regulate growth and cell differentiation are regulated in part by the • Phosphorylation of several cellular proteins. The protein tyrosine kinases, enzymes that catalyze this process, can also act as growth factor receptors. Examples include receptor of the fibroblast growth factor and the nerve growth factor receptor.

• In light of the important physiological roles played by ATPases and proteins In addition to membrane binding, efforts have been made both by industry and academia to identify novel, membrane-bound, native proteins, and proteins that have sequence identity to ATPases. It is described in Present the identification and characterization of the new polypeptides having sequence identity to the GST ATPase, designated herein as PRO203 polypeptides. 9 PRO290 Of particular interest are novel proteins and nucleic acids that have a sequence identity with known proteins and nucleic acids. Proteins of interest that are well known in the art include NTII-1, a nerve protein that facilitates regeneration, FAN, and beige. Beige, or bg, is a murine analogue related to Chedia k-Higashi syndrome (CHS), a rare recessive, autosomal condition in which neutrophils, monocytes and lymphocytes contain giant, cytoplasmic granules. See Perou et al., J. Biol. Chem. 272 (47): 29790 (1997) and Barbosa et al., Nature 382: 262 (1996).

Disclosed herein is the identification and characterization of novel polypeptides having sequence identity NTII-1, FAN and beige, designated herein as PRO290 polypeptides. - - 10. PR0874 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native.

• Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new proteins bound to the membrane. It is described in the present identification and characterization of the new • transmembrane polypeptides, designated herein as PR0194 polypeptides. 11 PRO710 15 In Sa c ch a romyce s ce re vi siae, the chromatin structure of the DNA replication origins changes as the cells become more competent for DNA replication, suggesting that the specific association of the Gl phase of the replication factors with the source DNA regulates entry to the S phase (Aparicio et al., Cell 91: 59-69 (1997)). In fact, it has been shown that the initiation of DNA replication in Saccharomyces cerevisiae requires the product of the protein of the CDC45 gene that encodes a protein that - - is found at relatively constant levels throughout the cell cycle (Owens et al Proc Nati Acad. Sci USA 94: 12521-12526 (1997 CDC45 protein is part of a pre-replication complex that can move with DNA replication in yeast.) Given the obvious importance of CDC45 protein in DNA replication, there is interest significant in the identification and characterization of new polypeptides that have homology to the CDC45 protein. It is described in • present the identification and characterization of the new polypeptides having homology to the CDC45 protein, designated herein as PRO710 polypeptides. 15 12. PR01151 Complementary proteins comprise a • large group of whey proteins some of which act in an enzymatic cascade, producing effector molecules involved in inflammation. Competent proteins are of particular importance in the regulation of movement and in the function of the cells involved in inflammation. One of the proteins, Clq, has shown that it is involved in the recognition of microbial surfaces and antibody-antigen complexes in the classical complement pathway (Shapiro et al., Curr. Biol. 8 (6): 335-338 (1998)).

• Given the physiological importance of inflammation and related mechanisms in the biological and physiological activities of the complementary Clq protein, efforts have now been made to identify new proteins natives who share the similarity of sequence with • complementary proteins. The identification and characterization of the new polypeptides having complementary Clq protein homology, designated in the present as PR01151 polypeptides. 13 PR01282 All proteins that contain leucine-rich repeats are thought to be involved in protein-protein interactions. Leucine-rich repeats are short-sequence portions present in a number of proteins with diverse cellular functions and locations. The crystal structure of the inhibitory protein of the ribonuclease has revealed that the leucine-rich repeats correspond to the beta-alpha structural units. These units are arranged so that they form a parallel beta sheet with a surface exposed to the solvent, so that the protein acquires a non-globular, unusual conformation. These two characteristics have been indicated as responsible for the protein-binding functions of proteins that contain leucine-rich repeats. See, Kobe and Deisenhofer, Trends Biochem. Sci. 19 (10): 15-42 (Oct. 1994); Kobe and Deisenhofer, Curr. Opin. Struct. Biol., 5 (3): 409-416 (1995).

A study has been reported on leucine-rich proteoglycans that serve as organizers, counselors and computers of collagen fibril tissue during ontogeny and are implicated in pathological processes such as wound healing, tissue repair, and formation of the tumor stroma. Iozzo, R. V., Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies involving leucine-rich proteins in wound healing and tissue repair are De La Salle, C, et al., Vouv. Rev. Fr. Hematol.

(Germany), 37 (): 215-222 (1995), which report mutations in the leucine-rich portions of a complex associated with the bleeding condition of the Bernard-Soulier syndrome, Chlemetson, K. J., • 5 Thromb. Haemost. (Germany), 74 (1): 111-116 (July 1995), reports that platelets have rich repeats in leucine and Ruoslahti, EI, et al., O9110727-A by La Jolla Cancer Research Foundation reports that the binding of the decorina that transforms to the ß factor of growth has implication in the • treatment for cancer, healing of wounds and in the formation of scars. The function of this group of proteins is insulin-like growth factor (IGF), it is related in that it is useful in wound healing and is associated with therapies related to additional tissue growth, such as connective tissue, skin and bones; in the promotion of body growth in humans and animals; and in the stimulation of other processes related to growth. The labile acid subunits (ALS) of IGF are also of interest in that they increase the half-life and increase in IGF and are part of the IGF complex. Other The protein that has been reported to have leucine-rich repeats is the SLIT protein that has been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage 5 such as in the condition of Parkinson's and for the diagnosis of cancer, see, Art avani st sa konas, S. and Rothberg, JM, WO9210518-A1 by Yale University. Of particular interest is LIG-1, a membrane glycoprotein that is expressed specifically in the glial cells in the brain • mouse and has rich repeats in leucine and immunoglobulin-like domains. Suzuki, et al., J. Biol. Chem. (U.S.), 271 (37): 22522 (1996). Other studies that report on the functions biological proteins that have leucine-rich repeats include: Tayar, N., et al., Mol. Cell Endocrinol. , (Ireland), 125 (1 -2): 65-70 (Dec. • 1996) (implication of the gonadot receptor ropina); Miura, Y., et al., Nippon Rinsho (Japan), 54 (7): 1784-1789 (July 1996) (implication of apoptosis); Harris, P.C., et al., J. Am. Soc. Nephrol. , 6 (4): 1125-1133 (Oct. 1995) (implication of kidney disease).

Proteins with leucine-rich repeats are discussed further in Kajava, J. Mol. Biol. , 277 (3): 519-527 (1998), Nagasawa, et al., Genomics, (3): 273-279 (1997), Bengtsson, J. Biol. Chem., 270 (43): 25639-25644 ( 1995), Gaillard, et al., • Cell, 65 (7): 1127-1141 (1991) and Ohkura and Yanagida, Cell, 64 (1): 149-157 (1991), all are incorporated herein by reference.

Thus, due to all the reasons listed above, the new members of the • superfamily of repetitions rich in leucine. On a more general level, all new proteins are of interest. The identification and characterization of the new polypeptides that are have repeats rich in leucine, designated herein as polypeptides PR01282. 14 PR0358 Cloning of the Toil gene from Dros oph i l, a The maternal effect gene that plays a central role in the establishment of the embryonic vent 1 -vector pattern has been reported by Hashimoto et al., Cell 52, 269-279 (1998). The Toil gene from Dros oph i l encodes an integral membrane protein with a domain ext raci toplásmi co of 803 amino acids and a cytoplasmic domain of 269 amino acids. The toplasmic ext raci domain has a segment of potential membrane separation, and contains multiple copies of a segment rich in leucine, a structural portion • found in many transmembrane proteins. The Toil protein controls the formation of the dorsal-vent pattern in Drosophila embryos and activates the Dorsal transcription factor after binding to its Spátzle ligand. (Morisato and Anderson, Cell 76: 677-688 (1994)). In the Dros oph i l a • Adult, the Toll / Dorsal signaling pathway participates in the antimicrobial immune response. (Lenaitre et al., Cell 86: 973-983 (1996)).

A human homolog of the Toil protein of Dros oph i l a has been described by Medzhitov et al., Nature 388: 394-397 (1997). This human Toil such as • Dros ophyl toil is a transmembrane type I protein with an extracellular domain consisting of 21 portions rich in leucine, repeated in tandem form (leucine-rich region - LRR), separated by a region not containing LRR and a cytoplasmic domain homologous to the cytoplasmic domain of the int leucine-1 receptor (IL -1) .

An active constitutively mutant of the human Toil protein transfected into human cell lines was shown to be capable of inducing the activation of NF-? B and the expression of genes controlled by NF-? B for cytokines. • 5 inflammatory IL-1, IL-6 and IL-8, as well as the expression of the B7-1 molecule, which is required for the activation of native T cells. It has been suggested that the Toil protein works in vertebrates as a non-receptor clonal immune system that can induce • signals for the activation of both innate and adaptive immune responses in vertebrates. The human Toil gene reported by Medzhitov et al., Upra was more strongly expressed in the spleen and in peripheral blood leukocytes (PBL), and the authors suggest that its expression in other tissues may be due to the presence of macrophages and dendritic cells, where it could act as an early warning system for infection. The The public GenBank database contains the following Toil: Tolll sequences (DNAX # HSU88540-1, which is identical with the random sequence of the full-length cDNA # HUMRSC786-1); Toll2 (DNAX # HSU88878-1); Toll3 (DNAX # HSU88879-1); Y Toll4 (DNAX # HSU88880-1, which is identical with the DNA sequence reported by Medzhitov et al., S upra). A partial Toil sequence (Toll5) is available from GenBank under DNAX # HSU88881-1. # 5 The additional human homologs of the Toil protein from Drosophila, designated as Toil-like receptors (huTLRsl-5) were recently cloned and showed the mirror structure of the counterpart of the Drosophila (Rock et al., Proc. Nati. Acad. Sci. USA • 95: 588-593 [1998]). Overexpression of the constitutively active mutant of a human TLR (homolog of the Toil protein - Medzhitov et al., S up ra; T LR 4 - Rock et al., S upra) leads to the activation of NF-? B and the induction of inflammatory cytokines and co-stimulating molecules. Medzhitov et al., S upra.

• The identification and characterization of the new polypeptides that are have homology to the Toll protein, designated herein as PR0358 polypeptides.

PRO1310 Proteins related to carboxypeptidases are of interest. Several carboxypeptidases are described in the literature, for example, Krause et al., Immunol. Rev. 161: 119-127 (1998) and Leiter, J. Endocrinol. 155 (2): 211-214 (1997). The identification and characterization of the • new polypeptides having homology to a carboxypeptidase, designated herein as PRO1310 polypeptides. 16 PR0698 10 The extracellular mucous membrane of the • Olfactory neuroepithelium is a highly organized structure in intimate contact with the chemosensory cilia that house the olfactory transduction machinery. The main component of proteins of this extracellular matrix is the ol f act omedina, a glycoprotein that is expressed in the olfactory oligo-ropy and that forms bonds • Intermolecular disulfide to produce a polymer (Yokoe et al., Proc. Nati. Acad. Sci. USA 90: 4655-4659 (1993), Bal et al., Biochemistry 32: 1047-1053 (1993) and Snyder et al., Biochemistry 30: 9143-9153 (1991)). It has been suggested that olmetamide can influence the maintenance, growth or differentiation of cilia chemosensors in apical dendrites of olfactory neurons. Given this important role, there is significant interest in the identification and characterization of new polypeptides that have homology to the factomedin ol. It is described in • present the identification and characterization of the new polypeptides having homology to the olymphenid protein, designated herein as PR0698 polypeptides. 17 PR0732 • Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of the mammalian recombinant DNA libraries to identify the coding sequences for the new proteins bound to • the membrane. The identification and characterization of the new ones is described herein. transmembrane polypeptides having sequence identity with the Diff33 protein, designated herein as PR0732 polypeptides.

PRO1120 25 Enzymatic proteins play important roles in the chemical reactions involved in food digestion, the biosynthesis of macromolecules, controlled release and the use of chemical energy, and other processes • 5 necessary to sustain life. Sulphatases are a family of secreted enzymatic proteins that play a variety of important metabolic roles and are thus of interest in research and industry (see, for example, Sleat et al., Biochem J., 324 (Pt. 1): 33-39 (1997)).

• Deficiencies of certain sulphatases are implicated in several human conditions including Sanfilippo D syndrome (see Litjens et al., Biochem J. 327 (Pt l): 899-94 (1997); Leipprandt; e t al. J. Inherit Metab. Dis. 18 (5): 647-648 (1995); and Freeman et al. Biochem J. 282 (pt 2): 605-614 (1992)). It is described in the present • Identification and characterization of the new polypeptides that have sequence identity to the protein sulphatase, designated herein as PRO1120 polypeptides. 19. PR0537 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the • new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PR0537 polypeptides. 20 PR0536 • Efforts have been made both by the industry and the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of the mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in • present the identification and characterization of the new secreted polypeptides, designated in the present as PR0536 polypeptides. 21 PR0535 Isomerase proteins play many important physiological roles in mammals.

Many different types of isomerase proteins have been identified and characterized including, for example, the protein disulfide isomerases and the peptidyl lo-prolyl isomerases. It has been reported that many immunofixed proteins, ie, proteins that serve as receptors for immunosuppressive drugs, show the activity of isomerase peptide idi lo-prolyl and that function to catalyze the interconversion of cis and trans of the peptide and the protein substrates for the immunofiber proteins. As such, there is significant interest in the identification and characterization of new polypeptides having sequence identity to the peptidyl-prolyl isomerase proteins. Described herein is the identification and characterization of the novel polypeptides having homology to the peptide 1 or-prolyl-putative isomerase protein, designated herein as PR0535 polypeptides. 22 PR0718 Efforts have been made both by the industry and the academia to identify new native transmembrane proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new transmembrane proteins. The identification and characterization of the new transmembrane polypeptides, designated in • present as PR0718 polypeptides. 23 PR0872 Enzymatic proteins play important roles in the chemical reactions involved in the digestion of food, the biosynthesis of • macromolecules, the controlled release and use of chemical energy, and other processes necessary to sustain life. The dehydrogens and desaturasas are a family of enzymes that play a variety of important metabolic roles and are thus subject of interest in research and industry (see Hable et al. • al., Mol. Gen. Genet. 257 (2): 167-176 (1998); Schneider, C. et al., Prot. Expr. Purif. 10 (2): 175-209 (1997)). Disclosed herein is the identification and characterization of novel polypeptides having sequence identity to dehydrogenase proteins, designated herein as PR0872 polypeptides. 25 -Ü-UÍ-b- ^ á-Éi 24. PRO1063 Collagens are the most abundant proteins of the extracellular matrix (ECM) in mammalian organisms. The collagens and others • 5 macromolecules of the ECM are deposited by resident cells and organized in a three-dimensional network. This ECM environment plays an essential role in guiding cell migration and cell-cell communication during morphogenic processes. The restructuring of the ECM during the remodeling occurs • as a cooperative multistage process involving localized degradation of existing macromolecules, rearrangement of the cytoskeleton, cellular translocation, and deposition of new ECM components. The enzymes that are involved in this restructuring are those such as collagenases and gelatinases that play important roles in the degradation of the • ECM. In light of the obvious important roles played by collagenase enzymes, there is interest Significant in the identification and characterization of new polypeptides that have homology to these proteins. The identification and characterization of the new polypeptides having homology to the type IV collagenase protein, designated herein as PRO1063 polypeptides. - - 25. PR0619 Immunoglobulins are antibody molecules, proteins that work both for receptors for antigens on the B cell membrane and as • 5 products secreted from plasma cells. Like all antibody molecules, immunoglobulins perform two important functions: they bind specifically to an antigen and participate in a limited number of biological effector functions. 10 Therefore, new members of the Ig superfamily are • always of interest.

Of particular interest are the new gene products associated with mu chains in the immature B cells. Shirasawa, et al., EMBO J. , 12 (5) -1827-1834 (1993); Dul, et al., Eur. J. Immunol. , 26 (4): 906-913 (1996). In addition, • molecular components and the assembly of the complexes of light chains mu substitutes in the lines of pre-B cells are of interest. Ohnishi and Takemori, J. Biol. Chem., 269 (45): 28347 -28353 (1994); Bauer, et al., Curr. Top. Microbiol., 137: 130-135 (1988). The new nucleic acids and peptides related to VpreBl, VpreB2 and VpreB3 by The sequence identity is of particular interest.

- - The assembly and manipulation of immunoglobulins can affect the entire industry related to antibodies and vaccines.

• The identification and characterization of the new polypeptides having homology to the VpreB proteins, designated herein as PR0619 polypeptides, is described herein. 26 PR0943 • Fibroblast growth factor (FGF) proteins show a variety of activities and act by binding to the cell surface of the factor receptor receptors. growth of fibroblasts. Many growth factor receptors of different fibroblasts have been identified and characterized, • including receptor 4 of the fibroblast growth factor, which has been shown to be a receptor High affinity for acidic and basic FGFs (Ron et al., J. Biol. Chem. 268: 5388-539 (1993) and Stark et al., Development 113: 641-651 (1991)). Given the obvious importance of the FGF family of proteins and cell surface receptors to Wherever they are linked, there is significant interest in the identification and characterization of new polypeptides having homology to the FGF receptor family. The identification and characterization of the new ones is described herein. • polypeptides having sequence identity to the fibroblast growth factor receptor 4 protein, designated herein as PR0943 polypeptides. 27 PR01188 • The identification of the p rohydles of nucleotides has been of interest due to the potential roles played by these molecules secreted in the depositional diseases of the calcium pyrophosphate dihydrate (CPPD), arthritis and other joint disorders (see Masuda et al., J. Rheumatol. (997) 24 (8): 1588-? 1594; and Terkeltaub et al., Arthritis Rheum ( 1998) 37 (6): 934 -9 1). It is described in the present Identification and characterization of the new polypeptides having homology identity to the pyrophosphohydrolases, designated herein as PR01188 polypeptides. - 28 PR01133 Netrins are molecules that guide the growth of axons and have a high similarity in the sequence and functioning of the axons. • 5 flies, nematodes and vertebrates. Additionally, netrin receptors have been identified in the three groups of animals, and have been shown to have crucial roles, preserved in the navigation of axons. The netrinas and their receptors also describe in the literature, for example, Varela- • Echavarria and Guthrie, Genes Dev. , 11 (5): 545-557 (1997); Guthrie, Curr. Biol., 7 (1): R6-R9 (1997); and Keynes and Cook, Neuron, 17 (6): 1031-1034 (1996). Due to its relationship with neurons, the netrins and its related proteins are of interest. Of particular interest are molecules that have sequence identity or similarity with netrin.

• The identification and characterization of the new polypeptides that are have homology identity to the netrins, designated herein as PR01133 polypeptides. 29 PR0784 Of interest are the receptor proteins linked to the membrane involved in the • tatißii ^. ^^. - intracellular signaling, metabolism, transport, and other routes. For example, proteins bound to the membrane of the endoplasmic reticulum and the golgi apparatus play important roles in the transport of proteins. The sec22 protein is a protein linked to the membrane of the endoplasmic reticulum involved in the fundamental reactions of the membrane traffic, where the secretory products are guided by routes from their synthesis site to their final destination. The roles of sec22 in transport pathways have been reported by numerous investigations (see Tang et al., Biochem Biophys Res Commun 243 (3): 885-891 (1998); Hay et al., J. Biol. Chem. 271 (10): 5671-5679 (1996) and Newman et al., Mol. Cell Biol. 10 (7): 3405-3414 (1990)). The identification and characterization of the new polypeptides having homology to sec22, designated herein as PR0784 polypeptides, is described herein.

. PR0783 Efforts have been made both by industry and academia to identify new membrane-bound, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new membrane-bound proteins. It is described in the present • identification and characterization of the new transmembrane polypeptides, designated herein as PR0783 polypeptides. 31. PRO820 10 Immunoglobulin molecules play • important roles in many physiological processes of important mammals. The structure of immunoglobulin molecules has been studied extensively and it has been documented quite well that intact immunoglobulins possess distinct domains, one of which is the constant domain or Fc region of the immunoglobulin molecule. The Fc domain of an immunoglobulin, although not directly involved in the recognition and The antigen binding mediates the ability of the immunoglobulin molecule, either in its complex or non-complex form with its respective antigen, to bind to the Fc receptors whether they circulate in the serum or on the surface of the the cells. The ability of an Fc domain of an immunoglobulin to bind to an Fc receptor molecule results in a variety of important activities, including, for example, in the formation of an immune response against the • unwanted foreign particles. Thus, molecules related to Fc receptors are of interest. The Fc receptors are further described in Tominaga et al., Biochem. Biophys. Res. Commun., 168 (2): 683-689 (1990); Zhang et al., Immuno. , 39 (6): 423-427 (1994).

The identification and • characterization of the new polypeptides having homology to the Fc receptor, designated herein as PRO820 polypeptides. 32. PRO1080 The folding of proteins and the assembly of JA protein complexes within the subcompacts of eukaryotic cells are catalyzed by different members of the family of the Hsp70 proteins. The surveillance function of Hsp70 proteins in these events is regulated by members of the protein family similar to DnaJ, which occurs through the direct interaction of the Hsp70 protein pairs and similar to DnaJ that seem to be specifically linked - - to each other. The diversity of the functions of DnaJ-like proteins using specific examples of DnaJ-Hsp70 interactions with polypeptides in the biogenesis pathways of the • 5 yeast proteins are further described in Cyr et al., Trends Biochem. Sci., 19 (4): 176-181 (1994). The DnaJ proteins and their involvement in the binding of the secretory precursor polypeptides to a translocon subcomplex and the machinery of t rans location of the polypeptide in the reticulum • Endoplasmic yeast is further described in Lyman and Schekman, Cell 88 (1): 85-96 (1997) and Lyman and Schekman, Experientia 52 (12): 1042-1049 (1996), respectively. Thus, proteins DnaJ are of interest, as are proteins related to DnaJ proteins, particularly those that have sequence identity with the • DnaJ proteins. The identification and characterization of the new ones is described herein. polypeptides having homology to DnaJ proteins, designated herein as PRO1080 polypeptides. - - 33 PRO1079 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the • present as PRO1079 polypeptides. 34 PR0793 Efforts have been made both for the industry as per the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the • selection of mammalian recombinant DNA libraries to identify the sequences of coding for the new proteins bound to the membrane. Disclosed herein is the identification and characterization of the new transmembrane polypeptides, designated herein as PR0793 polypeptides. 25 - - 35 PRO1016 Enzymatic proteins play important roles in the chemical reactions involved in the digestion of food, the biosynthesis of • 5 macromolecules, the controlled release and use of chemical energy, and other processes necessary to sustain life. Acyl trans ferases are enzymes which acyl the portions or radicals. Fertile acrylamides of glycerol-acrylamide phosphate phosphate can act • on the fatidic acid 1 as a substrate. Phosphoric acid is converted to a phosphatidic acid and thus plays a role in the formation of phosphatidylethanolamine found in the membranes.

See, Brown, et al., Plant Mol. Biol. , 26 (1): 211-223 (1994). Thus, the 11 rans f sas play an important role in the biosynthesis of the molecules that • require acylation. The identification and characterization of the new ones is described herein. polypeptides having homology to the aci 1 ransferase proteins, designated herein as PRO1016 polypeptides. 36. PRO1013 25 Efforts have been made both by the industry and by the academy to identify new native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the • coding sequences for the new proteins. Disclosed herein is the identification and characterization of the novel polypeptides, designated herein as PRO1013 polypeptides. 10 • 37. PR0937 The glypican family of heparan sulfate proteolycans are major cell surface proteoglycans of the development of the nervous system. It is believed that members of the glypincan family play a role in the regulation of cell cycle progression during the transition from proliferating neuronal progenitor cells to neurons differentiated. Lander et al. Perspect Dev. Neurobiol 3 (4): 347-358 (1996). It is similarly considered that proteoglycans of the glyphican family play other important roles in neuronal development (Lander et al., Supra), as well as in other tissues, such as members of the glypican family has also been found in kidney development (atanabe et al., J. Cell Biol. 130 (5): 1207-1218 (1995)). Accordingly, the identification of new members of the protein family of glyphics is of interest in research and industry.

The identification and characterization of the new polypeptides having sequence identity with the proteins of the glypican family, designated herein as PR0937 polypeptides, is described herein. 38. PR0842 Efforts have been made both by industry and academia to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated herein as PR0842 polypeptides, is described herein. - 39 PR0839 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the • present as PR0839 polypeptides. 40. PRO1180 Enzymes of met i lt rans farases catalyze the transfer of the methyl groups from a donor molecule to an acceptor molecule. Enzymes of met i lt rans f erasa play roles • extremely important in a number of different biological processes, including, for For example, in the electron transport chain in the plasma membrane in the prokaryotes and in the inner mitochondrial membrane in eukaryotic cells (see, for example, Barkovich et al., J. Biol. Chem. 272: 9182-9188 (1997), Dibrov et al., J ^ Biol. Chem. 272: 9175-9181 (1997), Lee et al., J.

Bacteriol .. 179: 1748-1754 (1997) and Marbois et al., Arch. Biochem. Biophys. 313: 83-88 (1994)). Enzymes of meth i Itrans ferase have been shown to be f essential for the biosynthesis of ubiquinone (coenzyme Q) and menaquinone (vitamin K2), both of which are essential components of the isoprenoid quinone of the electron transport chain of respiration. Given the obvious importance of the metiltransferase enzymes, there is a substantial interest in identifying new homologous polypeptides of methanestransferase. The identification and characterization of the novel polypeptides having homology to the enzymes of me t i 11 r ans ferasa, designated in the present as PRO1180 polypeptides. 41 PR01134 • Efforts have been made by both industry and academia to identify new secreted proteins, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in Present the identification and characterization of the new secreted polypeptides, designated herein as PR01134 polypeptides. 42. PRO830 • Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries for identify the coding sequences for the • new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PRO830 polypeptides. 15 43 PR01115 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native.

Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new protein proteins bound to the membrane. It is described in Present the identification and characterization of the new transmembrane polypeptides, designated herein as PR01115 polypeptides. 44. PR01277 • Efforts have been made both in the industry and in the academy to identify new native proteins. Many efforts are focused on the selection of DNA libraries, recombinant mammals to identify the sequences of coding for new receivers and other • proteins. Of interest is the identification of proteins that play important roles in various diseases and dysfunctions of humans. For example, the identification of ear proteins and functions that they perform in the listening process can lead to an understanding of the causes of the ailments and loss of hearing. Coch-B2 is one such protein that has been found to be expressed specifically in the inner ear (cochlea). It has been characterized and studied for its possible in hearing loss (Robertson et al., Genomics (1994) 23 (l): 52-50; Robertson et al., Genomics (1997) 46 (3): 345-354). The identification and characterization of the new polypeptides having sequence identity to Coch-B2, designated herein as PR01277 polypeptides 45. PR01135 • Glycosylation is an important mechanism for the modulation of the chemical and biological properties of the proteins in a specific manner to the tissue and to the stage. One of such important enzymes involved in glycosylation in Saccharomyces cerevisiae is alpha 1,2- • 10 mannosidase, an enzyme that catalyzes the conversion of Man9GlcNAc2 to Man8GlcNAc2 during the formation of the N-linked oligosaccharides the alpha 1, 2 - enzyme mannos idasa of Saccharomyces cerevisiae is a member of the class 1 alpha, 2-mannos idasas that are conserve yeasts from mammals. Given the important roles that alpha 1,2- • mannosidases play in glycosylation and the physiochemical activity regulated by glycosylation, there is a significant interest in identifying new polypeptides having homology to one or more mannosidases. The identification and characterization of the new polypeptides having homology to the protein alpha 1, 2 -manos ida sa, designated herein as polypeptides PR01135. - - 46 PR01114 Interferons (I FN) encompass a large family of secreted proteins that occur in dfc vertebrates. Although they were originally named for its antiviral activity, the growing evidence supports a critical role of I FN in cell growth and differentiation (Jaramillo et al., Cancer Investigation 13 (3): 327-338 (1995)). IFNs belong to a class of negative growth factors that ^ 10 have the ability to inhibit the growth of a wide variety of cells with normal and transformed phenotypes. It has been shown that therapy with I FN is beneficial in the treatment of human malignancies such as Karposi's sarcoma, chronic myelogenous leukemia, non-Hodgkin's lymphoma, and hairy cell leukemia as well as in the treatment of infectious diseases such as hepatitis B (Gamliel et al., Scanning Microscopy 2 (l): 485-492 (1988), Einhorn et al., Med. Oncol. & Tumor Pharmacot her. 10: 25-29 (1993), Ringenberg et al., Missouri Medicine 85 (l): 21-26 (1988), Saracco et al., Journal of Ga s t roenterology and Hepatology. : 668-673 (1995), Gonzale z -Mateos et al., Hepato-Gastroenterology 42: 893-899 (1995) and Malaguarnera et al. al., Pharmacotherapy 17 (5): 998-1005 (1997)).

Interferons can be classified into two main groups based on their main sequence. Interferons type I, IFN-a and IFN-β, are encoded by a superfamily of genes without • Intron consisting of a family of IFN-a genes and a single IFN-β gene thought to have arisen through a common ancestral gene. Type I interferons can be produced by most types of cells. The I FN type II, or IFN- ?, is It is restricted to lymphocytes (T cells and natural killer cells) and is stimulated by activators of non-specific cells or specific antigens.

Although both I FN type I and type II produce similar antipyretic and antiviral effects, they act on different cell surface receptors, where the binding is generally specific to the species (Langer et al., Immunol.

Today 9: 393-400 (1988)). Both IFN-a and IFN-β are competitively linked to the same high affinity type I receptor, whereas IFN-α it connects to a different type II receiver. The presence and number of I FN receptors on the surface of a cell - does not usually reflect the sensitivity of the cell to IFN, although it is clear that the effects of the I FN protein are mediated through the link to a cell surface interferon receptor. As • such, the identification and characterization of new interferon receptor proteins is of extreme interest The identification and characterization of new inferred receptor polypeptides designated herein as polypeptides "interferon receptors PRO 1114" is described herein. Thus, PR01114 polypeptides of the present invention represent a new cell surface interferon receptor. 47 PR0828 Glutathione peroxidases are of interest because they play important roles in the protection against the risk of coronary disease, atherosclerosis, platelet hyperaggregation and synthesis of proaggregates and proinflamma t compounds. The glutathione peroxidases are involved in the reduction of peroxides of hydrogen and in lipid peroxides, which in turn regulate the activities of the cyclooxygenase pathways and 1 ipoxygenase. This finally influences the production of eicosanoids and modulates the balance between a proagregator state and • Antiagregatory of platelets. These and other activities and functions of the glutathione peroxidases are described in more detail by Ursini et al., Biomed. Environ. Sci 10 (2-3): 327-332 (1997); Vitoux et al., Ann. Biol. Clin (Paris) 54 (5): 181-187 (1996); and Mirault et al., Ann N.Y.

• Acad. Sci 738: 104-115 (1994).

The identification and characterization of the new polypeptides that are have sequence identity to the glutathione peroxidases, designated herein as PR0828 polypeptides. • 48. PRO1009 20 Long chain acyl-CoA smtetase converts free fatty acids to acyl-CoA esters. It has been reported that this synthetase has interesting characteristics. Specifically, it has been reported that two children who had the syndrome of Alport, id oc cts, and mental retardation led to a large elimination where long-chain acyl-CoA synthetase 4 should have been localized. Thus, it is believed that the absence of this enzyme plays a role in the development of mental retardation or other signs associated with the Alport syndrome in the family. Piccini, et al., Genomics, 47 (3): 350-358 (1998). In addition, it has been reported that an inhibitor of acyl coenzyme A synthetase, triacsin C, inhibits the generation of superoxide anion and degranulation by human neutrophils. Thus • suggests that there is a role for acyl-CoA esters in the regulation of the activation of O2 generation and degranulation in the protein G or in subsequent stages. Korchak, et al., A_ 15 Biol. Chem., 269 (8): 30281-30287 (1994). The long chain acyl-CoA synthetase has also been discussed • briefly in a report describing the very long chain acyl-CoA synthetase. Uchiyama, et al., J. Biol. Chem., 271 (8): 30360 (1994). Thus, the long chain acyl-CoA 20 synthetase and the particular novel polypeptides having a sequence identity therewith are of interest.

The identification and characterization of the new polypeptides that are M-tf-i- «Mi.-a-i-ÍMkÉ-M-. - - have sequence identity with the long chain acyl-CoA synthetase, designated herein as PRO1009 polypeptides. • 49. PRO1007 Proteoglycans anchored with glycosylphosphatidylinositol (GPI) are generally located at the cell surface and are known to be involved in the regulation of responses of the cells to numerous growth factors, cell adhesion molecules and extracellular matrix components. The protein anchored to the GPI associated with metastasis (MAGPIAP) is one of these cell surface proteins that appear to be involved in the metastasis. Metastasis is the form of cancer where malignant or transformed cells travel and spread the cancer from one site to another. Therefore, the identification of the polypeptides related to metastasis and to the MAGPIAP is of interest.

The identification and characterization of the new polypeptides having sequence identity with MAGPIAP is described herein, designated herein as PRO1007 polypeptides. - - 50. PRO1056 The cellular membranes of mammals perform very important functions related to the structural integrity and the activity of several • 5 cells and tissues. Of particular interest in the physiology of the membrane is the study of ion channels of the transmembrane that act to directly control a variety of physiological, pharmacological and cellular processes. It has been identified that numerous ion channels include the calcium (Ca), sodium (Na), and potassium (K) channels, each of which has been analyzed in detail to determine their roles in the physiological processes in the vertebrate cells and insects These roles include such things as maintenance of cellular homeostasis, intracellular signaling, and the like. Given the obvious importance of ion channels, there is a significant interest in identifying and characterizing the new polypeptides having homology to one or more ion channels. Disclosed herein is the identification and characterization of novel polypeptides having homology to a chlorine channel protein, designated herein as PRO1056 polypeptides. - - 51. PR0826 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the ^ m present as PR0826 polypeptides. 52 PR0819 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of • the mammalian recombinant DNA libraries to identify the coding sequences for the 20 new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PR0819 polypeptides. - 53. PRO1006 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the • present as PRO1006 polypeptides. 54. PR01112 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the • selection of the mammalian recombinant DNA libraries to identify the coding sequences for the new proteins bound to the membrane. Disclosed herein is the identification and characterization of the new transmembrane polypeptides, designated herein as PR01112 polypeptides. 25 - - 55 PRO1074 Many enzymatic proteins linked to the membrane play important roles in the chemical reactions involved in metabolism, including the biosynthesis of macromolecules, controlled release and the use of chemical energy, tissue development, and other processes necessary for sustain life Galact os i 11 rans frasses are a family of enzymes that play a variety of important metabolic roles and thus are subjects of interest in research and industry. Numerous references have been published on the identification of gates and 11 rans fera sa s and the roles they play in cellular development, maintenance and cellular dysfunction.

The identification and characterization of the new polypeptides having homology to the galactose galactosides, designated herein as PRO1074 polypeptides, is described herein. 56 PRO1005 Efforts have been made both by the industry and by the academy to identify - "- - - ....-JM ... new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the • new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PRO1005 polypeptides. 57. PRO1073 • Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of the mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in • present the identification and characterization of the new secreted polypeptides, designated in the present as PRO1073 polypeptides. 58 PR01152 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native.

Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new proteins bound to • the membrane. The identification and characterization of the new transmembrane polypeptides, designated herein as polypeptides PR01152, are described herein. 59. PR01136 • Proteins that contain the PDZ domain help in the formation of cell-cell junctions and in the localization of receptors of membrane proteins and ion channels (Daniels et al., Nat. Struct. Biol. 5: 317-325 (1998) and Ullmer et al., FEBS Lett. 424: 63-68 (1998)). The PDZ domains interact with the C-terminal residues of a particular target membrane protein. Based on its binding specificities and homologies of sequence, the PDZ domains fall into two classes, class I and class II. In light of the obvious importance of the proteins that contain the PDZ domain, there is significant interest in identifying new polypeptides that have homology to those proteins. It is described in the present - "- - - i'h - - identification and characterization of the new polypeptides having homology with the proteins containing PDZ domain, designated herein as PR01136 polypeptides. 60 PR0813 Surfactant proteins play extremely important biological roles in the lung system of mammals. A mammalian protein that has been studied and well characterized is the • C protein associated with pulmonary surfactant. For example, Qanbar et al., Am. J. Physiol. 271: L572- L580 (1996) studied the effect of the immunocytochemistry of protein C associated with surfactant lung on the surface activity of the phospholipid mixtures. Specifically, the authors demonstrated that the palmi- • C protein associated with pulmonary surfactant greatly improved the reexpansion of lipids and the stability of the films and, therefore, was extremely important for the function of the surfactants. Given the obvious important roles played by surfactant proteins in mammalian organisms, there is significant interest in identifying new polypeptides having - - homology to one or more surfactant enzymes. The identification and characterization of the new polypeptides having identity homology to the associated protein is described herein. • with the pulmonary surfactant, designated herein as PR0813 polypeptides. 61. PRO809 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the 15 new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PRO809 polypeptides. 62. PR0791 Of particular interest are novel proteins that have sequence identity with known proteins. For example, new proteins that have some identity with the main histocompatibility complex (MHC) are - of interest. The MHC complex is a region of multiple sites that play important roles in determining whether the transplanted tissue will be accepted as its own (hi s t ocompatible) or rejected • as strange (histoincompatible). In addition, MHC plays a central role in the development of both cell-mediated and humoral immune responses. There are MHC class I, II and III antigens, all known in the art. The antigens of class I are the glycoproteins expressed on the • surface of almost all nucleated cells, where they present peptide antigens of self-altered cells necessary for the activation of T cells. The assembly of class I antigens MHC is further described in Kvist and Levy, Semin. Immunol. , 5 (2): 105-116 (1993) and Maffei, et al., Hum. Immunol. , 54 (2): 91-103 (1997). • The identification is described herein and characterization of the new polypeptides having sequence identity to several antigens MHC-I, designated herein as polypeptides PR0791. - - 63 PRO1004 Efforts have been made both by the industry and the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the • present as PRO1004 polypeptides. 64 PROllll Protein-protein interactions include the mechanisms of complex formation and signaling of receptors and antigens. As more is known about structural mechanisms • and functional factors that determine protein-protein interactions, can be manipulated more easily protein-protein interactions to regulate the particular result of the protein-protein interaction. Thus, the mechanisms that control protein-protein interactions are of interest to the scientific and medical community. 25 - - All proteins that contain leucine-rich repeats are thought to be involved in protein-protein interactions. The leucine-rich repeats are portions of • 5 short sequences present in a number of proteins with diverse functions and cellular locations. The crystal structure of the ribonuclease inhibitor protein has revealed that the leucine-rich repeats correspond to the beta-alpha structural units. These units are arranged so as to form a parallel beta sheet with a surface exposed to the solvent, so that the protein acquires a non-globular, unusual conformation. These two characteristics have been indicated as responsible for protein-binding functions of proteins containing leucine-rich repeats. See, Kobe and Deisenhofer, Trends Biochem. Sci. 19 (10): 15-421 (Oct. 1994). 20 A study has been reported on the leucine-rich proteoglycans that serve as organizers, counselors and tissue computers of the collagen fibrils during ontogeny and are involved in such pathological processes - such as wound healing, tissue repair, and stromal tumor formation. Iozzo, R. V., Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies that involve • 5 leucine-rich proteins in wound healing and tissue repair are De La Salle, C., et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995), which report mutations in the leucine-rich portions in a complex associated with the bleeding condition • of the Bernard-Soulier syndrome, Chlemetson, K. J., Thromb. Haemost. (Germany), 74 (1): 111-116 (July 1995), which reports that platelets have rich repeats in leucine and Ruoslahti, E. I., et. al., WO9110727-A by the Cancer Research Foundation of La Jolla reports that the decorin that binds to the ß transforming growth factor • has implications for the treatment of cancer, the healing of wounds and the formation of scars. Related to the function of this group of proteins is insulin-like growth factor (IGF), in that it is useful in wound healing therapies and associated conditions concerning tissue re-growth, such as connective tissue, skin and bones; in promoting the growth of the body in humans and animals; and in stimulating other processes related to growth. The labile acid subunits of IGF (ALS) are also of interest • 5 because they increase the half-life of IGF and are part of the IGF complex in vivo. Another protein that has been reported to have leucine-rich repeats is the SLIT protein that has been reported to be useful in the treatment of neurodegenerative diseases. such as Alzheimer's disease, nerve damage such as in Parkinson's disease and for the diagnosis of cancer, see, Artavanistsakonas, S. and Rothberg, J.M., WO9210518-Al by Yale University. Of particular interest is LIG-1, a membrane glycoprotein that is specifically expressed in glial cells in the mouse brain and has repeats rich in leucine and immunoglobulin-like domains. Suzuki, et al., J. Biol. Chem.

(U.S.), 271 (37): 22522 (1996). Other studies that report on the biological functions of proteins that have leucine-rich repeats include: Tayar, N., et al., Mol. Cell Endocrinol., (Ireland), 125 (1-2): 65-70 (Dec. 1996) (implication of the gonadot receptor ropina); Miura, - - Y., et al., Nippon Rinsho (Japan), 54 (7): 178-1789 (July 1996) (implication of apoptosis); Harris, P.C., et al., J. Am. Soc. Nephrol., 6 (4): 1125-1133 (Oct. 1995) (implication of kidney disease).

The identification and characterization of the new polypeptides having homology to the LIG, designated herein as PROllll polypeptides, is described herein. 65 PR01344 Factor C is a protein that is intimately involved with the coagulation cascade in a variety of organisms. The coagulation cascade has been shown to be involved in numerous different intermediate proteins, including factor C, whose activity is essential for the proper functioning of this cascade. The functioning of the abnormal coagulation cascade can result in a variety of serious abnormalities and, as such, the activities of the coagulation cascade proteins is of particular interest. As such, efforts have now been made to identify novel polypeptides having homology to one or more of the coagulation cascade proteins.

The identification is described herein • and characterization of the novel polypeptides having homology to the factor C protein, designated herein as PR01344 polypeptides. 66 PRO1109 10 The carbohydrate chains in the • glycoproteins are important not only for the conformation of proteins, transport and stability, but also for cell-cell and cell-matrix interactions. D-1, 4-15 ga lact os i 11 rans fer a sa is an enzyme that is involved in the production of carbohydrate chains in proteins, where the enzyme 1- 1, -ga lact os i 11 rans f erasa acts to transfer galactose to the terminal N-acetylglucosamine of the N-glycans of the complex type in the Golgi apparatus (Asano et al., EMBO J. 16: 1850-1857 (1997)). In addition, it has been suggested that D-1, 4-galactos and 11-rans frasa is directly involved in cell-cell interactions during the fertilization and embryogenes is through a - - subpopulation of this enzyme distributed on the cell surface. Specifically, Lu et al., Development 124: 4121-4131 (1997) and Larson et al., Biol. Reprod. 57: 442-453 (1997) have shown that • D-1, 4 -galact osiltransferase is expressed on the surface of sperm from a variety of mammalian species, thus suggesting an important role in fertilization. In light of the above, the new polypeptides that have sequence identity at 0-1.4- • galactos and Itrans ferases are of interest.

The identification and characterization of the new polypeptides that are have homology to the u-1, 4 -galact os and 11 rans fera sa, designated herein as PRO1109 polypeptides. • 67. PR01383 The nmb gene is a new gene that encodes a putative transmembrane glycoprotein that is differentially expressed in metastatic human melanoma cell lines and that show substantial homology to the precursor of pMEL17, a melanocyte-specific protein (eterman et al., Int.

J. Cancer 60: 73-81 (1995)). Given the interest in identifying the markers of the tumor-specific surface polypeptides of the cells, there is substantial interest in the new polypeptides having homology to nmb. The identification and characterization of the new polypeptides having homology to the nmb protein, designated herein as PR01383 polypeptides, is described herein. 68 PRO1003 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PRO1003 polypeptides. 69. PRO1108 Acid acetyl ransferase of acid 1 Fatty cell metabolism (LPAAT) is an enzyme that in lipid metabolism converts idio-lysosophosphate (LPA) into phosphatidic acid (PA). LPA is a phospholipid that acts as an intermediate in the metabolism of the phospholipid of the membrane. Several LPAAT enzymes have been identified in a variety of species (see, for example, Aguado et al., J. Biol. Chem. 273: 4096-4105 (1998), Sta ps et al., Biochem. J. 326 : 455-461 (1997), Eberhart et al., J. Biol. Chem. -272: 20299-20305 (1997) and West et al., DNA Cell Biol. 16: 691- f 10 701 (1997)). Given the obvious importance of LPAAT in a variety of different applications including the maintenance of the cell membrane, there is a substantial interest in identifying and characterizing the new polypeptides that have homology to the cell membrane.

LPAAT. The identification and characterization of the new polypeptides that are f have homology to the LPAAT protein, designated herein as PRO1108 polypeptides. 70. PR01137 A particular class of secreted polypeptides that are of interest in research and in the industry are ribosomes 11 rans ferases. Braren et al. describe the use of EST databases for the identification and cloning of new - - members of the family of the ribosyltransferase gene (Adv. Exp. Med. Biol. 419: 163-168 (1997)). Fertile ribos ilt rans have been identified by playing roles in a variety of • metabolic functions that include the post-translational modification of proteins (Saxty et al., J. Leukoc, Biol., 63 (1): 15-21 (1998)), and the mediation of the assembly of actin filaments and chemotaxis in neutrophil leukocytes polymorphonuclear res (Kefalas et al., Adv. Exp. Med. Biol. 419: 241-244. • (1997)).

The identification and characterization of the new polypeptides that are have homology to the ribos i 11 rans f sa, designated herein as PR01137 polypeptides. • 71 PR01138 Efforts have been made both for the industry as per the academy to identify new receptor proteins, native. Many efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new receptor proteins. Of particular interest - - is the identification of the membrane bound proteins found in the cells of the hematopoietic system, since they play roles < ^ k important in the fight against infections, 5 repair of damaged tissues, and other activities of the cells of the hematopoietic system. For example, the CD84 leukocyte antigen has recently been identified as a new member of the Ig superfamily (de la Fuente et 10 al., Blood, 90 (6): 2398-250 (1997)).

The identification and characterization of a new polypeptide having homology with the leukocyte antigen CD84 is described herein, designated herein as PR01138 polypeptides. 72 PRO1054 The proteins of the main complex of urinary proteins (MUP), proteins that are members of the lipocalin family, work to bind to volatile pheromones and interact with the neuroepi tel io vomeronasal of the olfactory system. As such, the proteins in the MUP family are intimately involved in the attraction process among mammals of different sexes. Many - - members of the MUP family have been identified and characterized and show a variation of amino acid sequence homology degrees (see, for example, Mucignat et al., Chem. Senses 23: 67-70 (1998), Ferrari et al., FEBS Lett 401: 73-77 (1997) and Bishop et al., EMBO J. 1: 615-620 (1982)). Given the physiological and biological importance of the MUP family of proteins, there is significant interest in the identification and characterization of new proteins. • 10 members of this family. The identification and characterization of the new polypeptides having homology to the MUP family of the proteins, designated herein as PRO1054 polypeptides, is described herein. 15 73 PR0994 • The L6 cell surface antigen, which is widely expressed in carcinomas of the lung, breast, colon, and ovary, has attracted attention as a potential therapeutic target for murine monoclonal antibodies and their humanized counterparts (Marken et al., Proc. Nati. Acad, Sci. USA 89: 3503-3507 (1992)). The cDNA encoding this cell surface antigen associated with the tumors has been expressed in COS cells and has been shown to encode a 202 amino acid polypeptide having three transmembrane domains. The L6 antigen has been shown to be related to a number of cell surface proteins that are • involved in the regulation of cell growth, which includes for example the proteins CD63 and CO-029, which are also widely expressed in tumor cells. As such, there is significant interest in identifying novel polypeptides that have antigen homology to L6 tumor cells as potential targets for cancer therapy. The identification and characterization of the new polypeptides having antigen homology is described herein. associated with tumor cells on the surface of L6 cells, designated herein as PR0994 polypeptides. • 74 PR0812 20 Proteins that bind to steroids play important roles in numerous physiological processes associated with steroid function. Specifically, a steroid that binds to the protein-associated polypeptide that has been well Characterized is component 1 of the protein of *? MMÉ £ ü- & - - prostatic link. Component 1 of the prostatic binding protein has been shown to be specific for the F subunit of the prostatic-binding protein, the main secretory glycoprotein of the prostate. • 5 ventral rats (Peeters et al., Eur. A; J. Biochem. 123: 55-62 (1982) and Liao et al., J. Biol. Chem. 257: 122-125 (1982)). The amino acid sequence of component 1 of the prostatic binding protein has been determined, where the sequence is highly rich in fe | 10 glutamic acid residues and is highly acidic. This protein plays an important role in the response of the prostate gland to steroid hormones. The identification and characterization of the new ones is described herein. polypeptides having homology to the prostatic steroid binding protein cl, designated herein as PR0812 polypeptides. 75. PRO1069 20 Of particular interest is the identification of new membrane-bound proteins involved in the conduction of ions such as channel inhibiting factor (CHIF) and MAT-8, which have been reported recently (see Wald et al., Am.

J. Physiol, 272 (5 part 2): F617-F623 (1997); - Capurro et al., Am. J. Physiol, 271 (3 part 1): C753-C762 (1996); Wald et al., Am. J. Physiol, 271 (2 part 2): F322-F329 (1996); and Morrison et al., A_ Biol. Chem 270 (5): 2176-2182 (1995)). • The identification and characterization of the new polypeptides having homology to CHIF and MAT-8, designated herein as PRO1069 polypeptides, is described herein. 10 • 76 PR01129 Cytochromes P-450 are a superfamily of hemoprot and ñanes that represent the main route for drugs and chemical oxidation (Horsmans, Acta Gastroenterol. Belg. 60: 2-10 (1997)). This superfamily is divided into families, subfamilies and / or simple enzymes. Recent reports have • provided a large amount of information concerning the cytochrome P-450 isozymes and has increased awareness of the life-threatening interactions with such commonly prescribed drugs such as cisapride and some ant ihi st ami ni cos (Michalets, Pharmacotherapy 18: 84-112 (1998) and Singer et al., J. Am. Acad.

Dermatol. 37: 765-771 (1997)). Given this information, - - there is a significant interest in identifying new members of the cytochrome P-450 family of proteins. The identification and characterization of the new polypeptides having homology to the cytochrome P-450 proteins, designated herein as polypeptides PR01129, is described herein. 77 PRO1068 10 Urotensins are proteins • Neurosecretations that are of interest due to their potential roles in a variety of physiological processes that include contraction of smooth muscles (Yano et al., Gen. Endocrinol Comp. 96 (3): 412-413 (1994)), the regulation of arterial blood pressure and the speed of the heart beats (Le Mevel et al., Am. J Physiol. 271 (Part 5 • 2): R1335-R1343 (1996)), and cortical secretion tero ide (Feuilloley et al., J. Steroid Biochem Mol. Biol. 48 (2-3): 287-292 (1994)).

The identification and characterization of the new polypeptides having homology to urotensin, designated in the Present as PRO1068 polypeptides. - - 77. PRO1066 Efforts have been made both by the industry and by the academy to identify • new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in present the identification and characterization of • new secreted polypeptides, designated herein as PRO1066 polypeptides. 79 PR01184 15 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries for identify the coding sequences for the new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PR01184 polypeptides. - - 80. PRO1360 Efforts have been made both by the industry and the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the # present as PRO1360 polypeptides. 81. PRO1029 Efforts have been made both for the industry as per the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of • the mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PRO1029 polypeptides.

J A ..- »- .. - 82 PR01139 Obesity is the most common nutritional condition which, according to recent epidemiological studies, affects approximately one third • 5 of all Americans 20 years of age or older. Kuczmarski et al., J. Am. Med. Assoc. 272, 205-11 (1994). Obesity is responsible for a variety of serious health problems, including cardiovascular disease, type diabetes II, insulin resistance, hypertension, • hypertrigl iceridemia, di s 1 ipoprot and inemia, and some forms of cancer. Pi-Sunyer, F.X., Anns. Int. Med. 119, 655-60 (1993); Colfitz, G.A., Am. J. Clin. Nutr. 55, 503S-507 (1992). The mutation of a single gene (obesity or "ob" mutation) has been shown to result in obesity and type II diabetes in mice. Friedman, Genomics 11, 1054-1062 (1991).

• Zhang et al., Nature 372, 425-431 (1994) have recently reported cloning and sequencing of the mouse ob gene and its human counterpart, and suggested that the ob gene product may function as part of an adipose tissue signaling pathway that acts to regulate the size of body gauze deposits. The experiments of parabiosis performed more than 20 years ago - - predicted that the obese mouse genetically contained two mutant copies of the ob gene (mouse ob / ob) that does not produce a satiety factor that regulates the absorption of food, while the mouse 5 diabetic (db / db) produces but does not respond to a satiety factor. Coleman and Hummal, Am. J. Physiol. 217, 1298-1304 (1969); Coleman, Diabetol. 9, 294-98 (1973). OB proteins are described, for example, in US Patents Nos.

Nos. 5,532,336; 5,552,522; 5,552,523; 5,552,514; • 5,554,727. Recent reports from three teams of independent researchers have shown that daily injections of the recombinant OB protein inhibit the absorption of food and reduces body weight and fat in ob ob mice ob / ob but not in db / db mice (Pelleymounter et al., Science 269, 540-43 • [nineteen ninety five]; Halaas et al., Science 269, 543-46 [1995]; Campfield et al., Science 269, 546-49 [1995]), suggesting that the ob protein is such as a satiety factor as proposed in the cross-circulation, early studies.

A receptor for the OB protein (OB-R) is described in Tartaglia et al., Cell 83, 1263-71- (1995). OB-R is a membrane separation receptor, unique, homologous to members of the class I cytokine receptor family (Tartaglia et al., Supra; Bazan, Proc. Na 11. Acad. Sci. USA 87, 6934-6938 [1990]). Two 5 'untranslated regions and several alternative 3' splice variants encoding OB-4 with cytoplasmic domains of different lengths have been described in mice, rats and humans (Chen et al., Cell 84, 491-495 [1996]; Chua et al., Science 271, • 994-996 [1996]; Tartaglia et al., Supra; Wang et al., FEBS Lett. 392: 87-90 [1996]; Phillips et al., Nature Genet. 13, 18-19 [1996]; Cioffi et al., Nature Med. , 2 585-589 [1996]). A receiver human nematode, which may be a receptor for the OB protein, is described in PCT Application Publication No. WO 96/08510, published on 21 • March 1996.

Bailleul et al., Nucí. Acids Res. 25, 2752- 2758 (1997) identified a splicing variant of human mRNA of the OB-R gene that potentially encodes a new protein, designated as a protein related to the leptin receptor gene (OB-25 RGRP). This protein shows no similarity to the sequence of the leptin receptor itself. The authors found that the OB-RGRP gene shares its promoter and two exons with the OB-R gene, and suggest that there is a requirement for an expression • Coordinated OB-R and OB-RGRP to generate the full physiological response to leptin i n vi vo. 3. PRO1309 Protein-protein interactions include ^^ 10 to the receptor and antigen complexes and signaling mechanisms. As more is known about the structural and functional mechanisms that generate or support proton-proton interactions, protein-protein interactions can be manipulated more easily to regulate the particular result of protein interaction. -protein. Thus, the mechanisms • Basics of protein-protein interactions are of interest to the scientific and medical community. It is thought that all proteins that contain leucine-rich repeats are involved in protein-protein interactions. The leucine-rich repeats are portions of short sequences present in a number of proteins with diverse cellular functions and locations. The crystal structure of the ribonuclease inhibitor protein has revealed that the leucine-rich repeats correspond to the units • structural beta-alpha. These units are arranged to form a parallel beta sheet with a surface exposed to the solvent, so that the protein acquires a non-globular, unusual shape. These two characteristics have been indicated responsible for the liaison functions to the • protein from proteins that contain leucine-rich repeats. See, Kobe and Deisenhofer, Trends Biochem. Sci. 19 (10): 415-21 (Oct. 1994); Kobe and Deisenhofer, Curr. Struct. Biol. 5 (3): 409-416 (1995).

A study has been reported on • Leucine-rich proteoglycans that serve as tissue organizers, which orient and sequence the 20 collagen fibrils during ontogenesis and which are involved in pathological processes such as wound healing, tissue repair, and stroma formation. tumor. Iozzo, R. V., Crit. Rev. Biochem. Mol. Biol., 32 (2 141-174 1997 Other studies involving leucine-rich proteins in wound healing and tissue repair are: De La Salle, C., et al., Vouv Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995), which report • 5 mutations in the leucine-rich portions in a complex associated with the bleeding condition of the Bern rd-Soul ier syndrome, Chlemetson, K. J., Thromb. Haemost. (Germany), 7 (1): 111-116 (July 1995), which report that platelets have repetitions rich in leucine and Ruoslahti, E. I., et • al., WO9110727-A by the La Jolla Cancer Research Foundation which reports that the binding of decorin that transforms the growth factor β has implications in the treatment of cancer, healing of wounds and in the formation of scars. Related by functions to this group F protein is insulin-like growth factor (IGF), in that it is useful in wound healing and is associated with therapies related to tissue re-growth, such as connective tissue, skin and bones; in the promotion of body growth in humans and animals; and in the stimulation of other processes related to growth. The acid labile subunits (ALS) of IGF are also of interest in that they increase the half-life and increase the IGF and are part of the IGF complex in vivo. • 5 Another protein that has been reported to have leucine-rich repeats is the SLIT protein that has been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage. such as in Parkinson's disease, and • diagnosis of cancer, see, Ar t avani s t sa konas, S. and Rothberg, J. M., WO9210518-A1 by Yale University. Of particular interest is the LIG-1, a membrane glycoprotein that is expressed specifically in the glial cells in the mouse brain and has repeats rich in leucine and immunoglobulin-like domains. Suzuki, et • al., J. Biol. Chem. (U.S.), 271 (37): 22522 (1996). Other studies that report on the functions biological proteins that have leucine-rich repeats include: Tayar, N., et al., Mol. Cell Endocrinol. , (Ireland), 125 (1-2): 65-70 (Dec. 1996) (implication of the gonadot receptor ropina); Miura, Y., et al., Nippon Rinsho (Japan), 54 (7): 1784-1789 (July 1996) (implication of apoptosis); Harris, P.C., et al., J. Am. Soc. Nephrol. , 6 (4): 1125-1133 (Oct. 1995) (implication of kidney disease).

• Efforts have been made by industry and academia to identify new proteins that have leucine-rich repeats to better understand protein-protein interactions. Of particular interest are those proteins that have repeats rich in leucine and • homology with the known proteins that have leucine-rich repeats such as platelet glycoprotein V, SLIT and ALS. Many efforts have focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for new membrane-bound proteins and • secreted that have repeats rich in leucine. 84 PRO1028 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of libraries of mammalian recombinant DNA to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the • present as PRO1028 polypeptides. 85 PRO1027 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in present the identification and characterization of the new secreted polypeptides, designated herein as PRO1027 polypeptides. • 86. PRO1107 20 Of particular interest are new proteins that have some sequence identity with the known proteins. Known proteins include PC-1, an ecto-enzyme that possesses alkaline phosphodiesterase I activities and pyrophos fat asa nucleotide, are further described in Belli et al Eur. J. Biochem., 228 (3): 669-676 (1995) Phosphodiesterases are also described in Fuss et al., J. Neurosci., 17 (23): 9095 - 9103 (1997) and Scott et al., Hepatology, 25 (4): 995-1002 (1997). The • Phosphodiesterase I, is described as a novel adhesin molecule and / or cytokine (related to autotaxin) involved in the function of oligodendrocytes. Fuss, supra Identification is described herein • and characterization of the novel polypeptides having homology with PCT-1, designated herein as PRO1107 polypeptides. 87 PRO1140 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new membrane-bound proteins. The identification and characterization of the new ones is described herein. transmembrane polypeptides, designated herein as PRO1140 polypeptides 88. PRO1106 How the mitochondria is responsible • 5 main energy generation, the proteins associated with the mitochondria are of interest. Recently, a cDNA was isolated from a novel Ca ++ dependent member of the mitochondrial solute carrier superfamily from the cDNA library of rabbit small intestine • as described in Weber, et al., PNAS USA, 94 (16): 8509-8514 (1997). It was reported that this transporter has four hand portions of the elongation factor in the N-terminal and is located in the peroxisome, although a fraction can be found in the mitochondria. So, this transporter, and the proteins that have identity • Sequence for this and other members of the mitochondrial solute carrier superfamily are of particular interest.

The identification and characterization of the new polypeptides having homology to a solute carrier protein is described herein. dependent on peroxisomal calcium, designated herein as PRO1106 polypeptides 89 PR01291 Butyrophyllin is a milk glycoprotein • 5 which constitutes more than 40% of the total protein associated with the membrane of the fat globules in the milk of mammals. The mRNA expression of the Butyrophylline has been shown to correlate with the start of production of milk fat towards? 10 the end of pregnancy and is maintained throughout breastfeeding. Butyrophilin has been identified in cattle, mice and humans (see Taylor et al., Biochim Biophys, Acta 1306: 1-4 (1996), Ishii et al., Biochim Biophys, Acta 1245: 285-292 (1995) , Mather et al., J ^ 15 Dairy Sci. 76: 3832-3850 (1993) and Banghart et al., J. Biol. Chem. 273: 4171-4179 (1998)) and is a type I transmembrane protein that is incorporated in the • fat globulin membrane. It has been suggested that butyrophilin plays a role as the main structure scaffold for the assembly of a complex with xanthine dehydrogenase / oxidase and other proteins that function in the sprouting and release of milk fat globules from the apical surface during lactation (Banghart et al., supra). 25 - - Since butyrophilin plays an obviously important role in the production of mammalian milk, there is a substantial interest in identifying new homologs of butyrophilin. It is described • here the identification and characterization of a new polypeptides that have homology to butyrophilin, designated here as PR01291. 90. PRO1105 10 Efforts have been made both for the • Industry as per the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of recombinant DNA libraries from mammal to identify the coding sequences for the new proteins bound to the membrane. It is described in the present • identification and characterization of the new transmembrane polypeptides, designated in the present as PRO1105 polypeptides. 91. PR0511 Proteins of interest include those that have sequence identity with RoBo-1, a new member of the urokinase plasminogen activator receptor / CD59 / Ly-6 / fami 1 ai of snake toxins selectively expressed in the bones and cartilages of the growth plate and described in Noel et al. al., J. Biol. Chem. 273 (7): 3878-3883 (1998). It is believed that RoBo-1 plays a novel role in the growth and remodeling of bones. Proteins also of interest include those that have sequence identity with the phospholipase inhibitors. • The identification and characterization of the new polypeptides having homology to the urokinase plasminogen activator receptors and the inhibitors of phospholipase, designated herein as PR0511 polypeptides. • 92. PRO1104 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the 25 new secreted proteins. The identification and characterization of the new secreted polypeptides, designated herein as PRO1104 polypeptides, is described. 93 PRO1100 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new membrane-bound proteins. The identification and characterization of the new transmembrane polypeptides, designated herein as PRO1100 polypeptides, is described herein. 94 PR0836 Of interest are luminal proteins, or proteins specific to the endoplasmic reticulum (ER). Of particular interest are proteins that have sequence identity with known proteins. Known proteins include proteins such as SLS1. In Sa ccha romyces cerevi s i a e, SLS1 has been reported to be a membrane-integral protein of the mitochondria involved in the metabolism of the mitochondria. Rouillard, et al., Mol. Gen. Genet. , 252 (6): 700 -708 (1996). In the yeast Ya rro wi to l ipo y t i ca, it has been reported that the • SLSl gene product (SLSlp) behaves like a lumenal ER protein. It is believed that SPS1 acts in the process of translocation of the preprotein, interacting directly with local trans polypeptides to facilitate its transfer and / or help in folding in the ER. Bosirame, et al., J. Biol. Chem., 271 (20): 11668-11675 (1996).

The identification and characterization of the new polypeptides that are have homology to SLS1, designated herein as PR0836 polypeptides. 95 PR01141 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new membrane-bound proteins. Disclosed herein is the identification and characterization of the new transmembrane polypeptides, designated herein as PR01141 polypeptides. 96 PR01132 Proteases are enzymatic proteins that are involved in a large number of very important biological processes in mammalian organisms and non mammals. Numerous protease enzymes • different from a variety of different organisms of mammals and non-mammals have been characterized and identified, which include serine proteases that show an activity specific to several proteins that contain serine. Enzymes of mammalian proteases play important roles in biological processes such • as, for example, the digestion of proteins, activation, inactivation, or modulation of the activity of the peptide hormones, and the alteration of the physical properties of proteins and enzymes.

Neuropsin is a new serine protease whose mRNA is expressed in the central nervous system. Mouse neuropsin has been cloned, and mouse studies have shown that it is involved in hippocampal plasticity. Neuropsin has also been indicated as associated with the modifications • 5 of the extracellular matrix and cellular migrations. See, generally, Chen, et al., Neurosci. , 7 (2): 5088-5097 (1995) and Chen, et al., J. Histochem. Cytochem. , 46: 313-320 (1998). Another serine protease of interest is serine proteinase from the enamel matrix. The maturation • Dental enamel succeeds with degradation of the organic matrix. Inhibition studies have shown that this degradation is complemented by a serine-type proteinase. The proteases associated with enamel maturation are described in, for example, Simmer, et al., J. Dent. Res. , 77 (2): 377-386 (1998), Overall and Limeback, • Biochem J., 256 (3): 965-972 (1988), and Moradian-Oldak, Connect. Tissue Res. , 35 (1 -): 231-238 (1996). The identification and characterization of the new polypeptides having homology to serine proteases, designated herein as PR01132 polypeptides, is described herein. 25 - - 97. PR01346 The abbreviations "TIE" or "tie" are acronyms, which are indicated for "Ig and EGF homology domains containing tyrosine kinase" • 5 and were coined to designate a new family of receptor tyrosine kinases that are almost exclusively expressed in vascular endothelial cells and early hematopoietic cells, and are characterized by the presence of a domain similar to EGF, and folding units • extracellular stabilized by int-chain disulfide bonds, generally referred to as "immunoglobulin-like (IG) -like folds". A cDNA fragment homologous to the tyrosine kinase of the human leukemia cells (tie) were described by Partanen et al., Proc. Nati Acad. Sci. USA 87, 8913-8917 (1990). The mRNA of this human receptor • "TIE" has been detected in all human embryonic mouse and fetal tissues, and it has been reported as localized in vascular and cardiac endothelial cells. Korhonen et al., Blood 80, 2548-2555 (1992); PCT Application Publication No. WO 93/14124 (published July 22, 1993). TIE rat homologs humans, referred to as "TIE-1", were identified - by Maisonpierre et al., Oncogene 8_, 1631-1637 (1993)). Another TAR receptor, designated "TIE-2" was originally identified in rats (Dumont et al., Oncogene 8_, 1293-1301 (1993)), while the homologue • Human TIE-2, referred to as "ork" is described in U.S. Patent No. 5,447,860 (Ziegler). The murine homolog of TIE-2 was originally called "tek". The cloning of the mouse TIE-2 receptor from a capillary cDNA library of brain was described in the Publication of • PCT Application No. WO 95/13387 (published May 18, 1995). TIE-2 is a tyrosine kinase receptor that is expressed almost exclusively by the vascular endothelium. Mice blocked with Tie-2 died from defects in the formation of the microvessels. In accordance with this it is believed that TIE receivers are actively involved in the • Angiogenesis, and may play a role in hemopoiesis as well. So, recent results (Lin et al., J. Clin. Invest. 100 (8), 2072-2078 [1997]) demonstrated the ability of a soluble TIE-2 receptor to inhibit tumor angiogenesis and has been interpreted as indicating that TIE-2 plays a role in the growth pathological vascular. In another study, TIE-2 expression was examined in the tissues of adults suffering from angiogenesis and in inactive tissues. The expression of TIE2 was localized by the immunohistochemistry to the endothelium of the neovessels in 5 tissues of rats suffering from angiogenesis during follicular maturation stimulated with hormones and uterine development and in the healing of wounds. It was also reported that the TIE-2 was expressed in the full spectrum of the inactive vasculature (arteries, veins, and capillaries) in a wide range of • adult tissues. Wong et al. , Circ. Res. 81 (4), 567-574 (1997). It has been suggested that TIE-2 has a double function in the angiogenesis of adults and in vascular maintenance. 15 The cloning of the expression of human TIE-2 ligands has been described in the Publication of • PCT Application No. WO 96/11269 (published April 18, 1996) and in the North American Patent No. 5,521,073 (published May 28, 1996). A vector designated as CgtlO which encodes an NL7d ligand of TIE-2"htie-2 ligand 1" or "hTLl" has been deposited under Accession No. of ATCC 75928. A plasmid encoding another TIE-2 ligand designated "htie-2 2" or "hTL2" is available under Accession No. ATCC 75928. This ligand has been described as an antagonist of the TAI-2 receptor. The identification of human and mouse ligands secreted for the TIE-2 receptor have been reported by Davis et al., Cell 87, 1161-1169 (1996). The human ligand designated "Angiopoiet ina-1", reflects its role in angiogenesis and potential action during hematopoiesis, is the same ligand as the ligand designated as "htie-2 1" or "hTL-1" in WO 96/11269. It has been described that the • Ang iopoiet ina-1 plays an angiogenic role subsequent and distinct from that of VEGF (Suri et al., Cell 87, 1171-1180 (1996)). Since the TIE-2 is apparently over-regulated during the requirement of Pathological angiogenesis for the growth of tumors (Kaipainen et al., Cancer Res. 54, 6571-6577 (1994)) it has been suggested that angiopoiet ina-1 is • additionally useful to specifically target the vasculature of the tumor (Davis et al., Supra). The identification and characterization of the new TIE ligand polypeptides, designated herein as PR01346 polypeptides, is described herein. 25 - - 98 PR01131 Low-density lipoprotein (LDL) receptor is a membrane-bound protein that plays a major role in homeostasis of the body. • 5 cholesterol, which mediates the cellular absorption of lipoprotein particles by agglutination of high affinity to their ligands, apolipoprotein (apo) B-100 and apoE. The ligand binding domain of the LDL receptor contains 7 repetitions rich in cysteine of approximately 40 • amino acids, where each repeat contains 6 cysteines, which form 3 mt-repeat disulfide bonds. These unique structural features provide the LDL receptor with its ability to interact specifically with apo B-100 and apoE, thus allowing the transport of these lipoprotein particles through the • cell membranes and the metabolism of their components. Soluble fragments containing The extracellular domain of the LDL receptor has been shown to retain the ability to interact with its specific lipoprotein ligands (Simmons et al., J. Biol. Chem. 272: 25531-25536 (1997)). The LDL receptors are also described in Javitt, FASEB A_, 9 (13): 1378-1381 (1995) and Herz and Willnow, Ann. NY Acad. Sci. , 737: 14-19 (1994). Thus, proteins that have sequence identity with LDL receptors are of interest.

• The identification and characterization of the new polypeptides having homology to LDL receptors, designated herein as PR01131 polypeptides, is described herein. 99 PR01281 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of the mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the present as PR01281 polypeptides. 100. PRO1064 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native.

- - Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new proteins bound to the membrane. Disclosed herein is the identification and characterization of the novel transmembrane polypeptides, designated herein as PRO1064 polypeptides. 101. PR01379 • Efforts have been made both by the industry and the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of the mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in • present the identification and characterization of the new secreted polypeptides, designated in the present as polypeptides PR01379. 102. PR0844 Proteases are enzymatic proteins that are involved in a large number of processes very important biological organisms - mammals and non-mammals. Numerous different protease enzymes from a variety of different mammalian and non-mammalian organisms have been characterized and identified. The enzymes of • mammalian proteases play important roles in many different biological processes including, for example, protein digestion, activation, inactivation, or modulation of the activity of peptide hormones, and the alteration of proteins. physical properties of proteins and enzymes. Thus, proteases are of interest. Also of interest are the protease inhibitors.

Of particular interest are the serina proteases. In one study it was reported that when the serine protease inhibitor ant i leucopro tinease (aLP) is injected, accumulates in the cartilage • articulate and ext rate rt i cu r a r of normal rats. This physiological pathway of accumulation in the cartilage, The loss of arthritic cartilage with proteoglycan eliminated is thought to maintain the local balance between function and proteinase inhibition. Burkhardt, et al., J. Rheumatol, 24 (6): 1145-1154 (1997). In addition, the aLP and others protease inhibitors have been reported to play a role in the in vitro growth of hematopoietic cells by the neutralization of proteinases produced by accessory cells of the bone marrow. Gosklink, et al., J. Exp. Med. , 184 (4): 1305-1312 (1996). Also of interest are the aLP mutants. Mutants resistant to the oxidation of aLPe have been reported to have significant therapeutic effects in models of animals that have emphysema. Steffens, et al., Agents Actions Suppl., 42: 111-121 (1993). Thus, • serine protease inhibitors are of interest.

The identification and characterization of the new polypeptides that are have homology to the serine protease inhibitors, designated herein as PR0844 polypeptides. • 103 PR0848 20 The membrane-bound proteins of interest include channels such as ion channels. In addition, the membrane-bound proteins of interest include enzymes linked to intracellular vacuoles or organelles, such as transferase.

For example, a peptide of interest is alpha 2,6-sailitransferase from GalNAc as described in Kurosawa, et al., J. Biol. Chem., 269 (2): 1402-1409 (1994). This peptide was constructed to be secreted, and retained its catalytic activity. The • expressed enzyme exhibited activity towards asialomucin and asialofetuin, but no other glycoprotein tested. Since sialylation is an important function, fecal syllables such as this one, and the peptides related by the sequence identity, they are of interest. • The identification and characterization of the new polypeptides having homology to the metals and to the cells is described herein, designated herein as PR0848 polypeptides. 104 PRO1097 • Efforts have been made by both industry and academia to identify new secreted proteins, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in Present the identification and characterization of the new secreted polypeptides, designated herein as PRO1097 polypeptides. 105 PR01153 • 5 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of recombinant DNA libraries from mammal to identify the sequences of • coding for the new transmembrane proteins. The identification and characterization of the new transmembrane polypeptides, designated in the present as PR01153 polypeptides. 106 PR01154 • N-aminopeptidase causes enzymatic degradation of peptide drugs administered peroramente. Thus, aminopeptidase N has been used in assays to develop and identify inhibitors to increase the efficiency of peptide drugs by inhibiting their degradation. The aminopeptidas are also from Interest to be used to degrade the peptides. The aminopeptidases, particularly the new aminopeptidases are therefore of interest. The aminopeptidase N and the inhibitors thereof are further described in Bernkop-Schnurch and • Marschutz, Pharm. Res., 14 (2): 181-185 ((1997); Lerche, et al., Mamm. Genome, 7 (9): 712-713 (1996); Papapet ropoulos, et al., Immunopharmacology, 32 (1) - 3): 153-156 (1996), Miyachi, et al., J. Med. Chem., 41 (3): 263-265 (1998), and Olsen, et al., Adv. Exp.

Med. Biol. , 421: 47-57 (1997). • The identification and characterization of the new polypeptides having aminopeptidase N homology, designated herein as PR01154 polypeptides. 107 PR01181 • Efforts have been made by both industry and academia to identify new secreted proteins, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in Present the identification and characterization of the new secreted polypeptides, designated herein as PR01181 polypeptides. 108. PR01182 5 Conglutinin is a bovine serum protein that was originally described as a vertebrate lectin protein and belongs to the family of type C lectins that have four characteristic domains, (1) a domain rich in N-terminal cysteine, (2) a domain similar to • Collagen, (3) a neck domain and (4) a carbohydrate recognition domain (CRD). Recent reports have shown that bovine conglutinin can inhibit hemagglutination through influenza A viruses as a result of their lectin properties (Eda et al., Biochem J 316: 43-48 (1996)). It has also been suggested that • lectins such as conglutinin can function as defense molecules independent of the immunoglobulin due to the mechanisms mediated by the complement. Thus, conglutinin has been shown to be useful for purifying immune complexes in vitro and for eliminating circulating immune complexes from plasma of patients in vivo (Lim et al., Biochem. Biophys. Res. Commun. 218: 260-266 (1996)).

The identification and characterization of new polypeptides having homology to the conglutinin protein, designated herein as polypeptides PR01182, is described herein. • 109 PR01155 Substance P and related proteins, neurokinin A and neurokinin B have been reported as compounds that generate the contraction of the ileum both directly through the action of a • receptor of muscle cells and indirectly through the stimulation of a neuronal receptor. This action leads to the release of acetylcholine that causes the contraction of muscles via the muscarinic receptors. It has also been reported that neurokinin B was found to be the most potent agonist for the neuronal P Substance receptor and that neurokinin B can be inhibited by encepha 1 inamide. Laufer, et al., PNAS USA, 82 (21): 7444-7448 (1985). In addition, it was reported that neurokinin B provides neuroprotection and improvement of knowledge, and therefore is believed to be useful for the treatment of neurodegenerative conditions, which include Alzheimer's disease. Wenk, et al., Behav. Brain - - Res 3 (1-2): 129-133 (1997) Tachykinins are also described in Chawla, et al., J. Comp.Neurol., 384 (3): 429-442 (1997). tachykinins, particularly those related • Neurokinin B are of interest.

The identification and characterization of the new polypeptides having homology to the neurokinin B protein is described herein, designated herein as PR01155 polypeptides. • 110. PR01156 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in present the identification and characterization of the new secreted polypeptides, designated herein as PR01181 polypeptides. - - 111. PRO1098 Efforts have been made both by the industry and the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the . new secreted polypeptides, designated in the • present as PRO1098 polypeptides. 112. PR01127 Efforts have been made both for the industry as per the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of • the mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated herein as polypeptides PR01127, is described herein. 113. PR01126 The matrix of the extracellular mucosa of the olfactory neuroepithelium is a highly organized structure in intimate contact with the cilia 5 chemosensors that house the olfactory transduction machinery. The main protein component of this extracellular matrix is the ol fact omedina, a glycoprotein that is expressed in the olfactory neuroepithelium and that forms bonds of intermolecular disulfides to produce a • polymer. (Yokoe et al., Proc. Nati, Acad. Sci. USA 90: 4655-4659 (1993), Bal et al., Biochemistry 32: 1047-1053 (1993) and Snyder et al., Biochemistry 30: 9143-9153 (1991)). It has been suggested that or fact omedina can influence the maintenance, growth or differentiation of the chemosensory cilia in the apical dendrites of the • Olfactory neurons. Given the important role, there is a significant interest in identifying and characterizing the new polypeptides that have homology to the ol-factomedin. The identification and characterization of the new polypeptides having homology to the protein or f-actomedin are described herein, designated herein as polypeptides PR01126. 114 PR01125 Of particular interest are proteins that have multiple Trp-Asp (WD) repeats. WD proteins are made up of repetitive units • highly conserved usually ending with WD. They have been found in eukaryotes but not in prokaryotes. They regulate cellular functions, such as cell division, the determination of the fate of cells, the transcription of genes, genetic transcription, signaling • transmembrane, RNA modification, and vesicular fusion. WDs are further described in Neer, et al., Nature, 371 (6495): 297-300 (1994); Jiang and Struhl, Nature, 391 (6666): 493-496 (1998); and DeSilva, et al., Genetics, 148 (2): 657-667 (1998). Thus, the new members of this superfamily are of complete interest. • 115 PR01186 20 The A protein of the venom of Dendroaspis polylepis polylepis (black m) comprises 81 amino acids, including ten residues of half cystine. Poisons are of interest on the other hand as weapons of war, and on the one hand, to be used in tests to determine the agents that reverse or inhibit the effects of poison or a similar poison. The venom of the black m is also described in Int. J. Biochem. , 17 (6): 695-699 (1985) and Joubert and Strydom, Hoppe Seylers Z Physiol. Chem., 361 (12): 1787-1794 (1980).

The identification and characterization of the new polypeptides having homology to protein A of snake venom, designated herein as PR01186 polypeptides, is described herein. 116 PR01198 Efforts have been made both by the industry and the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated herein as PR01198 polypeptides, is described herein. 117 PR01158 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new transmembrane proteins. It is described in the present identification and characterization of the new • transmembrane polypeptides, designated herein as PR01158 polypeptides. 118. PR01159 15 Efforts have been made both by the industry and the academy to identify new secreted, native proteins. Many of • these efforts are focused on the selection of mammalian recombinant DNA libraries for identify the coding sequences for the new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PR01159 polypeptides. 25 119. PR01124 Ion channels are considered as the way to the final frontier. The ion channels and the receivers that control these channels are • 5 responsible for the passage of ions, or nerve impulses to communicate one cell to another, thus, the ion channels are responsible for communication. In addition to its critical role in the brain, ion channels play a role critical in the heart as well as the pressure of the • blood. Ion channels are also linked to other important body functions and conditions, as well as conditions, such as cystic fibrosis. For all these reasons, the ion channels, such as sodium, potassium and chloride channels, as well as all their related proteins and receptors of interest. For example, it has been reported that cystic fibrosis results from a defect in the chlorine channel protein, regulator of the transmembrane conductance of cystic fibrosis. McGill, et al., Dig. Dis. Sci., 41 (3): 540-542 (1996). Chlorine channels are further described in at least Finn, et al., PNAS USA, 90 (12): 5691-569 (1993) and Finn, et al., Mol. Cell Biochem. , 114 (1-2): 21-26 (1992).

Also of interest are the molecules related to the adhesion molecules, as the adhesion molecules are known to be involved • 5 in signaling and cell-cell interactions. More generally, all proteins bound to the membrane, novel, are of interest. The proteins bound to the membrane and the receptors can play important roles in the formation, differentiation and maintenance of organisms • multicellular. The fate of many individual cells, for example, proliferation, migration, differentiation, or interaction with other cells, is typically governed by the information received from other cells and / or from the immediate environment. This information is often transmitted by secreted polypeptides (by • example, mitogenic factors, survival factors, cytotoxic factors, factors of differentiation, neuropeptides, and hormones) which, in turn, are received and interpreted by various cellular receptors or proteins bound to the membrane. Such proteins bound to the membrane and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, channels, transporters, and cellular adhesin molecules such as selectins and integrins. For example, the signal transduction that regulates cell growth and differentiation is regulated in part by the phosphorylation of several cellular proteins. Proteins tyrosine kinases, the enzymes that catalyze that process, can also act as growth factor receptors.

• Examples include the fibroblast growth factor receptor and the nerve growth factor receptor.

Proteins bound to the membrane include those that bind to the outer membrane and intracellular membranes and • organelles The proteins bound to the membrane and the receptor molecules also have several industrial applications, including diagnostic or therapeutic agents. The receptor immuneses, for example, can be used as therapeutic agents to block the receptor interaction. The proteins bound to the The membrane can also be used to separate the potential peptide or small molecular inhibitors from the relevant receptor / ligand interaction. • 5 Efforts have been made both by industry and academia to identify new native receptor proteins. Many efforts are focused on the selection of mammalian recombinant DNA libraries for identify the coding sequences for • new receptor proteins. We present here a polypeptide and nucleic acid that codes for itself which has the sequence identity with a protein of the chlorine channel and the molecule 1 of adhesion of lung endothelial cells (ECAM-1). • 120 PR01287 The fringe protein (peripheral) is a protein that specifically blocks the indentation mediated activation of the cuts in the dorsal compartment of the imaginal disk of the Drosophila wing. Fleming, et al., Development, 124 (15): 2973-81 (1997). Therefore, the protein fringe is of interest both for its role in development as well as for its ability to regulate indentations, particularly the signaling capabilities of indentations. Also of interest are the new polypeptides that may have • 5 a role in the development and / or regulation of molecules similar to indentations. Of particular interest are the new polypeptides having homology to the fringe protein.

Identification is described herein • and characterization of the new polypeptides having homology to the fringe (peripheral) protein, designated herein as PR01287 polypeptides. 121 PR01312 Efforts have been made both by the industry and by the academy to identify • new proteins bound to the membrane, native. Many of these efforts are focused on the selection of the mammalian recombinant DNA libraries to identify the coding sequences for the new transmembrane proteins. The identification and characterization of the new ones is described in the present transmembrane polypeptides, designated in-1-present as PR01312 polypeptides 122 PR01192 The proteins bound to the myelin membrane are of interest due to their possible implications in several nervous system disorders associated with inadequate myelination. Myelin is a cell sheath or covering, made up of glial cells, that surrounds axons and axonal processes that improves various properties • Electrochemical and provides trophic support to the neuron. Myelin is formed by the Schwann cells in the peripheral nervous system (PNS) and by ol i godendrocytes in the central nervous system (CNS). Inadequate myelination of central and peripheral neurons generates in a number of pathologies and leads to inadequate conduction of • signals within the nervous system. Among the various conditions of demyelination, the Multiple Sclerosis is the most notable.

The protein of the predominant integral membrane of the CNS myelin of amphibians, reptiles, birds and mammals are proteins proteol lipids (PLP) and PO, the main glycoprotein in the PNS myelin (Schlieess and Stoffel, Biol. Chem. Hoppe Seyler (1991) 372 (9): 865-874). In view of the importance of the proteins bound to the myelin membrane, efforts have been made both by the industry and by the academy to identify and characterize various myelin proteins (see Stratmann and Jeserich, J_. Neurochem (1995) 64 (6): 2427-2436). 123 PRO1160 • Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of the mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in • present the identification and characterization of the new secreted polypeptides, designated in the present as PRO1160 polypeptides. 124. PR01187 Efforts have been made both by the industry and by the academy to identify new secreted proteins, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PR01187 polypeptides. 125. PR01185 10 Efforts have been made both for the • Industry as per the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries for identify the coding sequences for the new secreted proteins. The identification and characterization of the • new secreted polypeptides, designated herein as PR01185 polypeptides. 20 126 PR0345 Human tetranectin is a 202 amino acid protein encoded by a gene spanning approximately 12 kbp of DNA (Berglund et al., FEBS Lett. 309: 15-19 (1992)). - tetranectin has been shown to be expressed in a variety of tissues and functions mainly as a protein linked to plasminogen. Tetranectin has been classified in a group other than the C-type lectin superfamily but has a structural and possibly functional similarity to the collective proteins (Nielsen et al., FEBS Lett 412 (2): 388-396 (1997)) . Recent studies have reported that variability in serum tetranectin levels may be predictive of the presence of several types of cancers including, for example, ovarian and colorectal cancers (Hogdall et al., Acta Oncol. -69 (1996), Hogdall et al., Eur. J. Cancer 31A (6): 888-89 (1995) and Tuxen et al., Cancer Treat., Rev. 21 (3): 215-245 (1995)) . As such, there is significant interest in the identification and characterization of new polypeptides that have structural and functional similarity to the ranee tet protein.

Disclosed herein is the identification and characterization of the novel polypeptides having tetranectin protein homology, designated herein as PR01345 polypeptides. 127. PR01245 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. The identification and characterization of the new secreted polypeptides, designated in the • present as PR01245 polypeptides. 128 PR0358 Serine protease inhibitors are interest because they inhibit catabolism and are sometimes associated with tissue regeneration. For example, a gene that encodes a • Plasma protein associated with liver regeneration has been cloned and has been called serpin-1 associated with regeneration (RASP-1). New, et al., Biochem. Biophys. Res. Commun., 223 (2): 404-412 (nineteen ninety six) . While serine protease inhibitors are of interest, particularly of interest are those that have a sequence identity with the known serine protease inhibitors - - such as RASP-1 The identification and characterization of the new polypeptides that are • have homology to RASP-1, designated herein as PR01245 polypeptides. 129. PR01195 Efforts have been made both for the industry as per the academy to identify • new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. Disclosed herein is the identification and characterization of the new secreted polypeptides, designated herein as PR01195 polypeptides. 130 PRO1270 It has been found that the recognition of carbohydrates by lectins plays an important role in several aspects of eukaryotic physiology. There are a number of different families of lectins from animals and plants, but are - - dependent on calcium, or type C, lectins that have recently gained the most attention. For example, the recognition of carbohydrate residues either in cells • 5 endothelial or leukocytes by the family of calcium-dependent lectins selectins, has been found to be of profound importance for leukocyte trafficking to sites of inflammation. Lasky, L., Ann. Rev. Biochem., 64 113-109 (1995). Biophysical analysis of these adhesive interactions has suggested that the lectin-carbohydrate linkage generated in this case allows adhesion between the leukocytes and the endothelium under high vascular cut-off conditions. A) Yes, The rapidity in the recognition rate of carbohydrates by such lectins allows a precipitous acquisition of the ligand, a need under high cut of vascular flow. The physiological use of type C lectins in this case is also supported by the relatively low affinities of these interactions, a requirement for the phenomenon of winding of leukocytes that has been observed to occur at sites of acute inflammation. The structures crystallins of the mannose binding protein - (Weis et al., Science 254, 1608-1615 [1991]; Weis et al., Nature 360 127-134 [1992]) and E-selectin (Graves et al., Nature 367 (6463), 532-538 [1994]), together with several mutagenesis analyzes (Erbe et al. • a l. , J. Cell. Biol. 119 (1), 215-227 [1992]; Drickamer, Nature 360, 183-186 [1992]; Iobst et al. L. , J. Biol. Chem. 169 (22), 15505-15511 [1994]; Kogan et al. , J. Biol. Chem. 270 (23), 14047-14055 [1995]), is consistent with the assumption that type lectins C are, in general, involved with the rapid recognition of carbohydrate pools. Similarly, these data suggest that Type C lectins perform a number of critical physiological phenomena through the recognition of relatively low, fast affinity of carbohydrates.

Given the obvious importance of lectin proteins in numerous biological processes, are currently making efforts to identify novel lectin proteins or proteins that have sequence homology to lectin proteins. The identification and characterization of the new polypeptides that are have homology to the lectin protein, - designated herein as PRO1270 polypeptides 131. PR01271 Efforts have been made both by the industry and by the academy to identify new proteins bound to the membrane, native. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the sequences of coding for the new proteins of • transmembrane. Disclosed herein is the identification and characterization of the new transmembrane polypeptides, designated herein as PR01271 polypeptides. 15 132. PR01375 The LICAM, G6PD and P55 proteins are • associated each with several states of known conditions. Thus, the genomic place of the homologs of the vegetable fungi of LICAM, G6PD and P55 of the human suffering genes were analyzed. This analysis led to the identification of putative protein 2 (PUT2), place AF026198 of GENBANK, Accession No. AF026198. (See data of GENBANK). Thus, the PUT2 and the proteins that have - sequence identity with the PUT2, are of interest 133. PR01385 Efforts have been made both by the industry and by the academy to identify new secreted, native proteins. Many of these efforts are focused on the selection of mammalian recombinant DNA libraries to identify the coding sequences for the new secreted proteins. It is described in • present the identification and characterization of the new secreted polypeptides, designated herein as PR01385 polypeptides. 134 PR01387 Proteins bound to the myelin membrane are of interest due to their possible • Implications for various nervous system conditions associated with inadequate myelination.

Myelin is a cell sheath, formed by glial cells, that surrounds axons and axonal processes that improves various electrochemical properties and provides trophic support to the neuron. Myelin is formed by the cells of Schwann in the peripheral nervous system (PNS) and - - by oligodendrocytes in the central nervous system (CNS). Inadequate myelination of central and peripheral neurons generates in a number of pathologies and leads to the inadequate conduction of signals within the nervous system. Among the various conditions of demyelination, Multiple Sclerosis is the most notable.

The predominant membrane protein 10 of the CNS myelin of amphibians, • reptiles, birds and mammals are the proteolipid proteins (PLP) and PO, the main glycoprotein in the PNS myelin (Schlieess and Stoffel, Biol. Chem. Hoppe Seyler (1991) 372 (9): 865-874). In view of the importance of proteins bound to the myelin membrane, efforts have been made both by the industry and by the academy to identify and • characterize several myelin proteins (see Stratmann and Jeserich, J_. Neurochem (1995) 64 (6): 2427-2436).

The identification and characterization of the new polypeptides having homology to the myelin protein, designated herein as PR01387 polypeptides. - - 135. PR01384 One class of receptor proteins that have been of interest is the NKG2 family of transmembrane type II molecules that are expressed in natural killer cells. These proteins, which have been shown to be covalently associated with CD94, are involved in recognition mediated by natural killer cells. different HLA allotypes (Plougastel, B. et al., Eur.

• J. Immunol. (1997) 27 (11): 2835-2839), and interact with the histocompatibility complex (MHC) class I either to inhibit or activate functional activity (Ho, El., Et al., Proc. Nati. Acad. Sci. (1998) 95 (11): 6320-6325). In accordance with this, the identification and characterization of new members of this family of receptor proteins is of • interest (see Houchins JP, et al., J. Exp. Med. (1991) 173 (): 1017-1020). twenty BRIEF DESCRIPTION OF THE INVENTION 1. PR0281 A cDNA clone (DNA16422-1209), which has homology with the transcript protein of the improved testis gene (TEGT) encoding the nucleic acid, encoding a new polypeptide, designated in the present application as " PR0281".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0281 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0281 polypeptide having the sequence of amino acid residues from about 1 or from about 15 to about - 345, inclusive of Figure 2 (SEQ ID NO: 2), or (b) the complement of the DNA molecule of (a).

• In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0281 polypeptide comprising DNA that hybridizes to the nucleic acid complement between about 80 or approximately 122 and approximately 1114 nucleotides, inclusive, of the • Figure 1 (SEC ID NO: 1). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about • 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the - ATCC Deposit No. 209929 (DNA16422-1209), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide • mature encoded by the human protein cDNA in ATCC Deposit No. 209929 (DNA16422-1209).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide • having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 15 to about 345, inclusive of Figure 2 (SEQ.

ID NO: 2), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0281 polypeptide having the sequence of the amino acid residues from 1 or from about 15 to about 345, • 5 inclusive of Figure 2 (SEQ ID NO: 2), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity , preferably at least approximately one sequence identity of 85%, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the test DNA molecule. In a specific aspect, the invention provides an isolated nucleic acid molecule • comprising the DNA encoding a PR0281 polypeptide, with or without the N-terminal signal sequence And / or initiation methionine, and its soluble, i.e., inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about the -1-position 1 of the amino acid to about position 14 of the amino acid in the sequence of Figure 2 (SEQ ID NO: 2). The multiple transmembrane domains have been identified tentatively as extending from about position 83 of the amino acid to about position 105, from about position 126 of the amino acid to about position 146, from about position 158 of the amino acid to about • approximately position 177, from about position 197 of the amino acid to about position 216, from about position 218 of the amino acid to about position 238, from about position 245 of the amino acid to about position 265, and from • approximately position 271 of the amino acid to approximately position 290 in the 20 amino acid sequence of PR0281 (Figure 2, SEQ ID NO: 2).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or approximately 15 to about 345, inclusive of Figure 2 (SEQ ID NO: 2), or (b) the DNA complement of (a).

Another modality is directed to fragments • of a sequence encoding PR0281 polypeptide that can be used as hybridization probes. Such nucleic acid fragments are approximately from 20 up to approximately 80 nucleotides in length, preferably approximately 20 to approximately 60 nucleotides in length, • more preferably from about 20 to about 50 nucleotides in length, and more preferably about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1).

In another embodiment, the invention provides - the isolated PR0281 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

• In a specific aspect, the invention provides the isolated native sequence * PR0281 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 15 to about 345 of Figure 2 (SEQ ID NO: 2).

In another aspect, the invention relates to an isolated PR0281 polypeptide, comprising an amino acid sequence that has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 15 to about 345, inclusive of Figure 2 (SEQ ID NO: 2).

In a further aspect, the invention relates to an isolated PR0281 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 15 to about 345, 10 inclusive of Figure 2 (SEQ ID NO: 2).

In still another aspect, the invention relates to an isolated PR0281 polypeptide, comprising the sequence of amino acid residues 1 or Approximately 15 to about 345, inclusive of Figure 2 (SEQ ID NO: 2), or a fragment sufficient to provide a binding site for an anti-PR0281 antibody. Preferably, the PR0281 fragment retains a qualitative biological activity of a native PR0281 polypeptide.

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0281 polypeptide having the sequence of the amino acid residues approximately from 1 or approximately 15 to • approximately 345, inclusive of Figure 2 (SEQ ID NO: 2), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one sequence identity 80%, preferably at least approximately 85% sequence identity, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a cell The host or host comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In still another embodiment, the invention relates to the agonists and antagonists of a native PR0281 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0281 antibody. In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0281 polypeptide, by contacting the native PR0281 polypeptide • with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0281 polypeptide, or an agonist or antagonist. • as defined herein above, in combination with a pharmaceutically acceptable carrier e. 2 PR0276 A cDNA clone (DNA16435-1208) has been identified that encodes a new polypeptide that has • two transmembrane domains and is designated in the present application as "PR0276". In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0276 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0276 polypeptide having the amino acid residue sequence in an approximate manner from 1 to about 251, inclusive of Figure 4 (SEQ ID NO: 6), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0276 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of • approximate manner between 180 and about 932 residues, inclusive, of Figure 3 (SEQ ID NO: 5). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about -80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209930 (DNA16435-1208), or (b) the complement of the DNA molecule of (a). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209930 (DNA16435-1208). In still a further aspect, the invention relates to an isolated nucleic acid molecule • comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of Sequence with the sequence of amino acid residues approximately from 1 to approximately 251, inclusive of Figure 4 (SEQ ID NO: 6), or the DNA complement of (a).

• In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 50 nucleotides, preferably at least about 100 nucleotides, and which is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule • encoding a PR0276 polypeptide having the sequence of amino acid residues roughly from 1 to about 251, inclusive of Figure 4 (SEQ ID NO: 6), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably • at least approximately a sequence identity of 85%, more preferably at least approximately a sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention ^ • ÉkÉMlÉlailÉIM-a - - provides an isolated nucleic acid molecule comprising the DNA encoding a PR0276 polypeptide in its soluble, ie, the inactivated or deleted variants of the • 5 transmembrane, or is complementary to such a coding nucleic acid molecule. The transmembrane domains are at approximately amino acids 98-116 and 152-172.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to ^ w the amino acid sequence of residues 1 to about 251, inclusive of Figure 4 (SEQ.

ID NO: 6), or (b) the DNA complement of (a).

Another embodiment is directed to the fragments of a sequence encoding the PR0276 polypeptide that can be used as probes of hybridization. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, • more preferably from about 20 to about 50 nucleotides in length, and more preferably in an approximate manner from 20 to about 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR0276 polypeptide encoded by any of the isolated nucleic acid sequences defined hereinbefore.

In a specific aspect, the invention provides the PR0276 polypeptide of isolated native sequence, which in certain embodiments, • includes an amino acid sequence comprising residues 1 through 251 of Figure 4 (SEQ ID NO: 6).

In another aspect, the invention relates to an isolated PR0276 polypeptide, comprising an amino acid sequence having at least About 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with the sequence of amino acid residues 1 to approximately 251, inclusive of Figure 4 (SEQ ID NO: 6).

In a further aspect, the invention is refers to an isolated PR0276 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to approximately 251 of Figure 4 (SEQ ID NO: 6).

In still another aspect, the invention relates to an isolated PR0276 polypeptide, comprising the sequence of amino acid residues 1 to about 251, inclusive of Figure 4 (SEQ ID NO: 6), or a sufficient fragment thereof to provide a binding site for an anti-PR0276 antibody. Preferably, the PR0276 fragment retains a qualitative biological activity of a native PR0276 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0276 polypeptide having the sequence of the amino acid residues of way • approximate from 1 to approximately 251, inclusive of Figure 4 (SEQ ID NO: 6), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately a sequence identity of 80% ", preferably at least about 85% sequence identity, more preferably * to the • less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

- In still another embodiment, the invention relates to the agonists and antagonists of a native PR0276 polypeptide, In a particular embodiment, the agonist or antagonist is a • anti-PR0276 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0276 polypeptide, by contacting the native PR0276 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional modality, the The invention relates to a composition comprising a PR0276 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 3. PR0189 A cDNA clone (DNA21624-1391) encoding a new polypeptide, designated in the present application as "PR0189" has been identified. The PR0189 polypeptides have a fatty cytosolic acid binding domain In one embodiment, the invention provides an isolated nucleic acid molecule comprising • the DNA encoding a PR0189 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding a PR0189 polypeptide having the amino acid residue sequence roughly from 1 to about 367, • inclusive of Figure 6 (SEQ ID NO: 8), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0189 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of Approximately 200 to about 1300 residues, inclusive, of Figure 5 (SEQ ID NO: 7). Preferably, hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209917 (DNA21624-1391), or (b) the complement of the DNA molecule of (a). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209917 (DNA21624-1391).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide - - having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% 5 sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from 1 to about 367, inclusive of Figure 6 (SEQ ID NO: 8); or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule, produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PR0189 polypeptide having the sequence of amino acid residues so • approximate from 1 to approximately 367, inclusive of Figure 6 (SEQ ID NO: 8), or (b) the The complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably the less Approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 367, inclusive of Figure 6 (SEQ ID NO: 8), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PR0189 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PR0189 polypeptide, which in one embodiment, includes an amino acid sequence comprising the residues 1 through 367 of Figure 6 (SEQ ID NO.

In another aspect, the invention relates to an isolated PR0189 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 367, inclusive of Figure 6 (SEQ ID NO: 8).

In a further aspect, the invention relates to an isolated PR0189 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to approximately 367 of Figure 6 (SEQ ID NO: 8).

- Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that • 5 encodes a PR0189 polypeptide having the sequence of the amino acid residues roughly from 1 to about 367, inclusive of Figure 6 (SEQ ID NO: 8), or (b) the complement of the DNA molecule of (a), and if the • The test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by growing a host cell or host that • comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to the agonists and antagonists of a PR0189 polypeptide native. In a particular embodiment, the agonist or antagonist is an anti-PR0189 antibody.

In a further embodiment, the invention is • refers to a method for identifying agonists or antagonists of a native PR0189 polypeptide, by contacting the native PR0189 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide. • Still in a further embodiment, the invention relates to a composition comprising a PR0189 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. • 4. PRO190 Applicants have identified a clone of cDNA encoding a new polypeptide having seven transmembrane domains and having sequence identity with the UDP-galactose and CMP-sialic acid transporters, wherein the polypeptide is designated in the present application as "PRO190".

- In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO190 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO190 polypeptide having amino acid residues 1 through 424 of Figure 9 (SEQ ID NO: 14), or is complementary to such a coding nucleic acid sequence, and remains stably bound thereto under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on June 2, 1998 with the ATCC as DNA2333-1392 which includes the nucleotide sequence encoding PRO190.

In another embodiment, the invention provides the isolated PRO190 polypeptide. In particular, the invention provides the PRO190 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 424 of Figure 9 (SEQ ID NO: 14). A further embodiment of the present invention is directed to an isolated PRO190 polypeptide, which excludes transmembrane domains.

- Optionally, the PRO190 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the vector deposited on June 2, 1998 with the ATCC as DNA23334-1392.

In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ. ID NO: 15 . PR0341 A cDNA clone has been identified (DNA262 1239) which encodes a new transmembrane polypeptide, designated in the present application as "PR0341".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0341 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least ^^^^^^^^ about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0341 polypeptide having the residue sequence of amino acids from about 1 or about 18 to about 458, inclusive of Figure 12 (SEQ ID NO: 20), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0341 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 380 or about 431 and about 1753 nucleotides, inclusive, of the Figure 11 (SEQ ID NO: 19). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one DNA molecule encoding to the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209792 (DNA26288-1239), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide • mature encoded by the human protein cDNA in ATCC Deposit No. 209792 (DNA26288-1239).

In still a further aspect, the invention refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity • of sequence, preferably at least about 85% sequence identity, of More preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 18 up to about 458, inclusive of Figure 12 (SEQ.

- - I D N O: 2 0) (b) e comp l ement of the DNA of (a In a further aspect, the invention relates to an isolated nucleic acid molecule that • 5 has at least 165 nucleotides and is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PR0341 polypeptide having the sequence of amino acid residues from 1 or approximately to about 458, inclusive of Figure 12 (SEQ ID NO: 20), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about one 80% sequence identity, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PR0341, with or without the N-terminal signal sequence - and / or the initiating methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule . The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 17 of the amino acid in the sequence of Figure 12 (SEQ ID NO: 20). Transmembrane domains have tentatively been identified as extending from about position 171 of the amino acid to about position 190 of the amino acid, from about position 220 of the amino acid to about position 239 of the amino acid, from about the position 259 from the amino acid to about position 275 of the amino acid, from about position 286 of the amino acid to about position 305 of the amino acid, from about position 316 of the amino acid to about position 335 of the amino acid, from about position 353 of the amino acid until approximately position 378 of the amino acid and from about position 396 of the amino acid to about position 417 of the amino acid in the amino acid sequence of PR0341 (Figure 12, SEQ ID NO: 20).

• In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least approximately • 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 18 to approximately 458, inclusive of Figure 12 (SEQ ID NO: 20), or (b) the DNA complement of (a).

• Another modality is directed to fragments of a sequence encoding PR0341 polypeptide which can be used as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60. nucleotides in length, more preferably - from about 20 to about 50 nucleotides in length and more preferably in an approximate manner from 20 to about 40 nucleotides in length and can be derived from the • nucleotide sequence shown in Figure 11 (SEQ ID NO: 19).

In another embodiment, the invention provides the isolated PR0341 polypeptide encoded by any of the nucleic acid sequences • isolates identified in the present above.

In a specific aspect, the invention provides the sequence PR0341 polypeptide isolated native, which in certain embodiments, includes a sequence of amino acids comprising residues 1 or approximately 18 • to about 458 of Figure 12 (SEQ ID NO: 20). In another aspect, the invention relates to an isolated PR0341 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, Preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence sequence. • amino acid residues 1 or approximately 18 to about 458, inclusive of Figure 12 (SEQ ID NO: 20).

In a further aspect, the invention is refers to an isolated PR0341 polypeptide, which • comprises a record of the amino acid sequence of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or • approximate manner 18 to approximately 458, inclusive of Figure 12 (SEQ ID NO: 20). In still another aspect, the invention relates to an isolated PR0341 polypeptide, comprising the sequence of amino acid residues 1 or approximately 18 to about 458, inclusive of Figure 12 (SEQ ID NO: 20), or a sufficient -fragment itself to provide a binding site for an anti-PR0341 antibody. Preferably, the PR0341 fragment retains a qualitative biological activity of a native PR0341 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0341 polypeptide having the sequence of amino acid residues from about 1 or roughly 18 to about 458, inclusive of Figure 12 (SEQ ID NO: 20), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about an 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with ( a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide. cell culture ptido.

In another embodiment, the invention provides • an expressed sequence tag (EST) designated herein as DNA12920 comprising the nucleotide sequence of SEQ. ID NO: 21 (see the Figure 13). 6. PRO180 • A cDNA clone (DNA26843-1389) encoding a new polypeptide having multiple transmembrane domains, designated in the present application as "PRO180" has been identified. In one embodiment, the invention provides J an isolated nucleic acid molecule comprising the DNA encoding a PRO180 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO180 polypeptide having the sequence of amino acid residues so • approximate from 1 to approximately 266, inclusive of Figure 15 (SEQ ID NO: 23), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a • PRO180 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 121 and about 918 nucleotides, inclusive, of Figure 14 (SEQ ID NO: 15 22). Preferably, hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, More preferably at least about 95% - - sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203099 (DNA26843-1389) , or (b) • the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203099 (DNA268 3- 1389). • Still in a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% • sequence identity, more preferably at least about 95% identity of The sequence with the amino acid residue sequence is approximately from 1 to approximately 266, inclusive of Figure 15 (SEQ ID NO: 23), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides, and which is produced by hybridizing a • Test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO180 polypeptide having the sequence of amino acid residues roughly from 1 to about 266, inclusive of Figure 15 (SEQ ID NO: 23), or (b) the complement of the • DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about one identity of • 95% sequence with (a) or (b), isolate the test DNA molecule. In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO180 polypeptide in its soluble, i.e., the variants inactivated or deleted from the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The transmembrane domains are shown in Figure 15. It is believed that PRO180 has a transmembrane domain • type II from approximately amino acids 13-33 of the SEC. ID NO: 23 In another aspect, the invention relates to an isolated nucleic acid molecule comprising Et 10 (a) the DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 to j ^^ about 266, inclusive of Figure 15 (SEQ ID NO: 23), or (b) the DNA complement of (a) .

Another embodiment is directed to fragments of a sequence encoding the PRO180 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to approximately 80 nucleotides in length, - preferably approximately 20 to approximately 60 nucleotides in length, more preferably from approximately 20 to approximately 50 nucleotides in length, and more • preferably roughly from 20 to about 40 nucleotides in length.

In another embodiment, the invention provides the asylated PRO180 polypeptide encoded by any of the nucleic acid sequences • isolated defined herein above.

In a specific aspect, the invention provides the isolated native sequence PRO180 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 266 of Figure 15 (SEQ ID NO: • 2. 3) .

In another aspect, the invention relates to an isolated PRO180 polypeptide, comprising. an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least-about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 up to about 266, inclusive of the Figure 15 (SEQ ID NO: 23).

In a further aspect, the invention relates to an isolated PRO180 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to 266 of Figure 15 (SEQ ID NO: 23).

In yet another aspect, the invention relates to an isolated PRO180 polypeptide, comprising the sequence of amino acid residues 1 to about 266, inclusive of Figure 15 (SEQ ID NO: 23), or a fragment thereof sufficient to provide a binding site for an anti-PRO180 antibody. Preferably, the PRO180 fragment retains a qualitative biological activity of a native PRO-180 polypeptide In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO180 polypeptide having the sequence of the amino acid residues so approximate from 1 to approximately 266, inclusive of Figure 15 (SEQ ID NO: 23), or (b) the • complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with (a) or (b), (ii) cultivating a host cell or host that comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In still another embodiment, the invention is • t-d-IMa - - refers to the agonists and antagonists of a native PRO180 polypeptide, In a particular embodiment, the agonist or antagonist is an anti-PRO180 antibody. • In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO180 polypeptide, by contacting the native PRO180 polypeptide with a candidate molecule and monitoring one • biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO180 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier • pharmaceutically.

In another embodiment, the invention provides an expressed sequence tag (EST) (DNA12922) comprising the nucleotide sequence of Figure 16 (SEQ ID NO: 24).

- - PR0194 Applicants have identified a cDNA clone encoding a new transmembrane polypeptide, wherein the polypeptide is • 5 designated in the present application as "PR0194".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0194 polypeptide. In a aspect, the isolated nucleic acid comprising the • DNA encoding PR0194 polypeptide having amino acid residues 1 to 264 of Figure 18 (SEQ ID NO: 28), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the • isolated nucleic acid comprises the DNA encoding PR0194 polypeptide having the residues of amino acids from about 18 to 264 of Figure 18 (SEQ ID NO: 28) or amino acid 1 or about 18 to X of Figure 18 (SEQ ID NO: 28), where X is any amino acid from 96 to 105 of Figure 18 (SEQ ID NO: 28), or is Complementary to such a nucleic acid-coding sequence, and remains stably bound thereto under conditions-at least moderate, and optionally, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector DNA26844-1394 deposited on June 2, 1998, as ATCC 209926 which includes the nucleotide sequence encoding PR0194.

In another embodiment, the invention provides the isolated PR0194 polypeptide. In particular, the invention provides the PR0194 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 264 of Figure 18 (SEQ ID NO: 28). Additional embodiments of the present invention are directed to PR0194 polypeptides comprising amino acids 18 through 264 of Figure 18 (SEQ ID NO: 28) or amino acid 1 or about 18 through X of Figure 18 (SEQ ID NO. : 28). Optionally, PR0194 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of DNA26844-1394 vector deposited on June 2, 1998, as ATCC 209926.

- - PRO203 Applicants have identified a cDNA clone encoding a new polypeptide having sequence identity with the glutathione-S-transferase, wherein the polypeptide is designated in the present splice as "PRO203".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO203 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO203 polypeptide having amino acid residues 1 to 347 of Figure 20 (SEQ ID NO: 30), or is complementary to such Encoding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding to PRO203 polypeptide having amino acid residues X to 347 of Figure 20 (SEQ ID NO: 30), where X is any amino acid from 83 to 92 of Figure 20 (SEQ ID NO: 30), or complementary to such a nucleic acid sequence coding, and remains stably attached to it - under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector DNA30862- • 1396 deposited on June 2, 1998, as ATCC 209920 which includes the nucleotide sequence encoding PRO203.

In another embodiment, the invention provides the PRO203 polypeptide isolated. In particular, the invention provides the PRO203 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 through 347 of Figure 20 (SEQ ID.

NO: 30). Additional embodiments of the present invention are directed to PRO203 polypeptides comprising amino acids X through 347 of Figure 20 (SEQ ID NO: 30), wherein X is any amino acid from 83 to 92 of Figure 20 (SEQ.

ID NO: 30). Optionally, the PRO203 polypeptide is obtained or can be obtained by expression of the polypeptide encoded by the cDNA insert of the vector DNA30862-1396 deposited on June 2, 1998, as ATCC 209920. In another embodiment, the invention provides a expressed sequence tag (EST) designated herein as DNA15618 comprising the nucleotide sequence of Figure 21 (SEQ ID NO: 31). 9. PRO290 A cDNA clone (DNA35680-1212) encoding a polypeptide designated in the present application has been identified as "PRO290". PRO290 polypeptides have sequence identity with NTII-1, PAN and beige.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO290 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO290 polypeptide having the sequence of amino acid residues roughly from 1 to about 1003, inclusive of Figure 23 (SEQ ID NO: 33), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO290 polypeptide comprising DNA that hybridizes to the nucleic acid complement of approximate way between 293 and about 3301 • waste, inclusive, of Figure 22 (SEQ ID NO: 32). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about • 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 209790 (DNA35380-1212), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209790 (DNA35380-1212).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 to about 1003, inclusive of the Figure 23 (SEQ ID NO: 33), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule - - encoding a PRO290 polypeptide having the amino acid residue sequence roughly from 1 to about 1003, inclusive of Figure 23 (SEQ ID NO: 33), or (b) the • complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 1003, inclusive of Figure 23 (SEQ ID NO: 33), or (b) the DNA complement of - - a) In another embodiment, the invention provides the isolated PRO290 polypeptide encoded by • any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO290 polypeptide, which in one embodiment, includes • an amino acid sequence comprising residues 1 to 1003 of Figure 23 (SEQ ID NO: 33).

In another aspect, the invention relates to an isolated PRO290 polypeptide, comprising an amino acid sequence having at least • approximately 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 up to about 1003, inclusive of Figure 23 (SEQ ID NO: 33).

- - In a further aspect, the invention relates to an isolated PRO290 polypeptide, comprising an amino acid sequence record • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 up • approximately 1003 of Figure 23 (SEQ ID NO: 33).

Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO290 polypeptide having the sequence of the amino acid residues so approximate from 1 to about 1003, inclusive of Figure 23 (SEQ ID NO: 33), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, preferably at least about 85% of - .. - - sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) • cultivating a host or host cell comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. • In yet another embodiment, the invention relates to agonists and antagonists of a native PRO290 polypeptide. In a particular embodiment, the agonist or antagonist is a anti-PRO290 antibody.

In a further embodiment, the invention is • refers to a method for identifying agonists or antagonists of a native PRO290 polypeptide, by contacting the native PRO290 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising - a PRO290 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. • PR0874 Applicants have identified a clone of CDNA encoding a new transmembrane polypeptide of mu ti t-e spaces, which is designated in the present application as "PR0874".

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0874 polypeptide. In a aspect, the isolated nucleic acid comprising the DNA encoding PR0874 polypeptide having amino acid residues 1 to 321 of Figure 25 • (SEQ ID NO: 36), or is complementary to such a coding nucleic acid sequence, and remains stably bound thereto under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding the PR0874 polypeptide having the residues of amino acids from about X to 321 of Figure 25 (SEQ ID NO: 36), where X is any amino acid from about 270 to about 279 of Figure 25 (SEQ ID NO: 36), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector DNA40621- 10 1440 deposited on June 2, 1998, as ATCC • 209922 which includes the nucleotide sequence encoding PR0874.

In another embodiment, the invention provides the PR0874 polypeptide isolated. In particular, the invention provides the PR0874 polypeptide of the isolated native sequence, which in one embodiment, • includes an amino acid sequence comprising residues 1 through 321 of Figure 25 (SEQ ID.

NO: 36). Additional embodiments of the present invention are directed to PR0874 polypeptides comprising amino acids X through 321 of the Figure 25 (SEQ ID NO: 36), where X is any amino acid from 270 to about 279 of the Figure 25 (SEQ ID NO: 36). Optionally, the PR0874 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the DNA40621-1440 vector deposited on June 2, 1998, as ATCC 209922. 11 PRO710 Applicants have identified a clone of CDNA encoding a new polypeptide having homology with the CDC45 protein, wherein the The polypeptide is designated in the present application • as "PRO710".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO710 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO710 polypeptide having the • amino acid residues 1 to 566 of Figure 27 (SEQ ID NO: 41), or is complementary to such The nucleic acid sequence encoding it, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding to the PRO710 polypeptide having the amino acid residues from about 33 to 566 of Figure 27 (SEQ ID NO: 41), or amino acid 1 or about 33 to X of Figure 27 (SEQ ID NO: 41) ), where X is any amino acid from 449 • 5 to 458 of Figure 27 (SEQ ID NO: 41), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions .

The isolated nucleic acid sequence can • understand the cDNA insert of vector DNA44161- 1434 deposited on May 27, 1998 as ATCC 209907 which includes the nucleotide sequence encoding PRO710. In another embodiment, the invention provides the isolated PRO710 polypeptide. In particular, the • invention provides the PRO710 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 566 of Figure 27 (SEQ ID NO: 41). Additional embodiments of the present invention are directed to PRO710 polypeptides comprising amino acids 33 to 566 of the Figure (SEQ ID NO: 41) or amino acid 1 or approximately 33 to X of Figure 27 (SEQ ID NO: 41), where X is any amino acid from 449 to 458 of Figure 27 (SEQ ID NO. : 41). Optionally, the PRO710 polypeptide is obtained or • can be obtained by expressing the polypeptide encoded by the cDNA insert of the DNA44161-1434 vector deposited on May 27, 1998, as ATCC 209907.

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA38190 comprising the nucleotide sequence of Figure 28 (SEQ ID NO: 42). 12 PR01151 A cDNA clone (DNA44694-1500), which has homology with the Clq protein encoding the nucleic acid, encoding a new polypeptide, designated in the present application as "PR01151".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01151 polypeptide. In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01151 polypeptide having the sequence of amino acid residues from approximately 1 or approximately 21 to approximately 259, inclusive of Figure 30 (SEQ ID NO: 47), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01151 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between approximately 272 or approximately 332 and approximately 1048 nucleotides, inclusive, of Figure 29 (SEQ ID NO: 46). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect the invention relates to an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203114 (DNA44694-1500), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203114 (DNA44694-1500).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% of sequence identity, more preferably -ÉHÉ-M-M - ^ - ii at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 21 to about 259, inclusive of Figure 30 (SEQ. • 5 ID NO: 47), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a DNA molecule under test • severe conditions with (a) a DNA molecule encoding a PR01151 polypeptide having the sequence of the amino acid residues from 1 or approximately 21 to about 259, inclusive of Figure 30 (SEQ ID NO: 47), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, preferably at least about one sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule . In a specific aspect, the invention - - provides an isolated nucleic acid molecule comprising the DNA encoding a PR01151 polypeptide, with or without the N-terminal signal sequence and / or the initiation methionine, or is complementary • for such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 20 of the amino acid in the sequence of the Figure 30 (SEQ ID NO: 47). • In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about • 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 21 to about 259, inclusive of Figure 30 (SEQ ID NO: 47), or (b) the DNA complement of (a).

Another embodiment is directed to the fragments - - of a sequence encoding the PR01151 polypeptide which may find use as hybridization probes. Such nucleic acid fragments w are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length; 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 29 (SEQ ID NO: 46). In another embodiment, the invention provides the isolated PR01151 polypeptide encoded by • any of the isolated nucleic acid sequences identified hereinbefore.

In a specific aspect, the invention provides the PR01151 isolated native sequence polypeptide, which in certain embodiments, includes an amino acid sequence comprising the waste 1 or approximately * 21 to - approximately 259 of Figure 30 (SEQ ID NO: 47).

In another aspect, the invention relates to an isolated PR01151 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 21 to about 259, inclusive of Figure 30 (SEQ ID NO. : 47).

In a further aspect, the invention relates to an isolated PR01151 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 21 to about 259, inclusive of Figure 30 (SEQ ID NO: 47).

In still another aspect, the invention relates to • 5 to an isolated PR01151 polypeptide, comprising the sequence of amino acid residues 1 or approximately 21 to about 259, inclusive of Figure 30 (SEQ ID NO: 47), or a fragment thereof sufficient to provide a binding site for an anti-i-PROl 151 antibody.

• Preferably, the PR01151 fragment retains a qualitative biological activity of a native PR01151 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01151 polypeptide having the The sequence of the amino acid residues is approximated from about 1 or approximately 21 to about 259, inclusive of Figure 30 (SEQ ID NO: 47), or (b) the complement of the DNA molecule of (a) , and if the test DNA molecule has At least about one sequence identity -MÉÉ-H-Hárita - -of 80%, preferably at least about 85% of sequence identity, more preferably at least about 90% of sequence identity, more preferably at least about 95% identity of sequence with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01151 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 151 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01151 polypeptide, contacting the native PR01151 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

In yet a further embodiment, the invention relates to a composition comprising a PR01151 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 13. PR01282 A cDNA clone (DNA45495-1550), which codes for a new polypeptide having sequence identity with the leucine-rich repeat proteins, has been identified and is designated in the present application as "PR01282".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01282 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01282 polypeptide having the amino acid residue sequence from about 24 or approximately 673, inclusive of Figure 32 (SEQ ID NO: 52), or (b) the • complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01282 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between • approximately 189 and approximately 2138 residues, inclusive, of Figure 31 (SEQ ID NO: 51). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule that • comprises DNA that has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203156 (DNA45495-1550), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203156 (DNA45495-1550).

In still a further aspect, the invention refers to an isolated nucleic acid molecule • comprising (a) DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, most preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with the sequence of the residues approximately from 24 to approximately 673, inclusive of Figure 32 (SEQ ID NO: 52), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least about 50 nucleotides, and preferably at least about 100 nucleotides, and is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a • PR01282 polypeptide having the sequence of amino acid residues approximately from 24 to about 673, inclusive of Figure 32 (SEQ ID NO: 52), or (b) the complement of the DNA molecule of (a) , and, if the DNA molecule has at least approximately an identity of • 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01282 polypeptide, with or without the N-terminal signal sequence and / or the initiation methionine, or its soluble, ie, the inactivated or deleted variants of the transmembrane domain, or is complementary to - - such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about • position 23 of the amino acid in the sequence of Figure 32 (SEQ ID NO: 52). The transmembrane domain has been tentatively identified as extending from approximately position 579 of the amino acid to approximately position 599 of the amino acid in the amino acid sequence of PR01282 (Figure 32, SEQ ID NO: 52).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (A) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 24 to about 673, inclusive of Figure 32 (SEQ ID NO: 52), or (b) the DNA complement of (a).

Another embodiment is directed to the fragments - - of a sequence encoding the polypeptide PR01282 that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more. preferably approximately from 20 to F approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01282 polypeptide encoded by Any of the isolated nucleic acid sequences defined herein.

• In a specific aspect, the invention provides isolated native sequence polypeptide PR01282, which in one embodiment, includes an amino acid sequence comprising residues 24 to 673 of Figure 32 (SEQ ID NO: 52).

In another aspect, the invention relates to an isolated PR01282 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, so more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 24 to about 673, inclusive of Figure 32 (SEQ ID NO: 52 ).

In a further aspect, the invention relates to an isolated PR01282 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 24 to 673 of Figure 32 (SEQ ID NO: 52).

In still another aspect, the invention relates to an isolated PR01282 polypeptide, comprising the sequence of amino acid residues 24 to - about 673, inclusive of Figure 32 (SEQ ID NO: 52), or a sufficient fragment thereof to provide a binding site for an anti-PR01282 antibody. Preferably, the PR01282 fragment retains a qualitative biological activity of a native PR01282 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01282 polypeptide having the sequence of the amino acid residues roughly from 24 to about 673, inclusive of Figure 32 (SEQ ID NO: 52), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one identity 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) ) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the culture lular.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01282 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PR01282 antibody. 10 • In a further embodiment, the invention relates to a method for identifying the agonists or antagonists of a native PR01282 polypeptide, by contacting the native PR01282 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

• Still in a further embodiment, the invention relates to a composition comprising a PR01282 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. - - 14 PR0358 Applicants have identified a clone of CDNA encoding the new human Toil polypeptides, designated in the present application as • 5 PR0358. In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding a PR0358 polypeptide having amino acids 20 to 575 of Figure 34 (SEQ ID NO: 57), or (b) the complement of the DNA molecule of (a). The complementary DNA molecule preferably remains stably bound to such encoding nucleic acid sequence under at least moderate conditions, and optionally, under highly stringent conditions.

In a further embodiment, the isolated nucleic acid molecule comprises a polynucleotide having at least about 90%, more preferably at least about 95% sequence identity with a polynucleotide that encodes a polypeptide comprising the sequence • from amino acids 1 to 811 of Figure 34 (SEQ ID NO: 57).

In a specific embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide • PR0358 native or variant, with or without the N-terminal signal sequence, and with or without the transmembrane regions of the respective full-length sequences. In one aspect, the nucleic acid The isolate comprises the DNA encoding a full-length native PR0358 polypeptide, mature, having the amino acid residues 1 to 811 of Figure 34 (SEQ ID NO: 57), or is complementary to such a coding nucleic acid sequence. In other In one aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a native PR0358 polypeptide without an N-terminal signal sequence, or is complementary to such a coding nucleic acid sequence.

In yet another embodiment, the invention relates to the inactivated or deleted forms of the transmembrane domain encoding the nucleic acid of the full length native PR0358 protein.

• In another embodiment, the invention provides an isolated nucleic acid molecule comprising the clone (DNA47361-1249) deposited on November 7, 1997, under the number ATCC 209431.

In a specific embodiment, the invention F provides a vector comprising the DNA encoding a polynucleotide having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about F 95% sequence identity with a polynucleotide encoding a polypeptide comprising the amino acid sequence 20 to 811 of Figure 34 (SEQ ID NO: 57), or the complement of such polynucleotide. In a particular embodiment, the vector comprises the DNA encoding the new Toll homologue (PR0358), with or without the sequence of N-thermal signal (approximately amino acids 1 - to 19), or an inactivated or deleted variant of the transmembrane domain (approximately amino acids 576-595) thereof, or the extracellular domain (approximately 20 amino acids a 595) of the mature protein, or a protein comprising any of these sequences. A host cell or host comprises such a vector is also provided.

In another embodiment, the invention provides • isolated PR0358 polypeptides. The invention further provides a PR0358 polypeptide of isolated native sequence, or variants thereof. In particular, the invention provides a polypeptide PR0358 of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising residues 20 to 575, or • 20 to 811, or 1 to 811 of Figure 34 (SEQ ID NO: 57). In still another embodiment, the invention relates to agonists and antagonists of a native PR0358 polypeptide. In a particular embodiment, the agonist or antagonist is a anti-PR0358 antibody.

- - In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of the native PR0358 polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0358 polypeptide, or an agonist or antagonist as defined herein above, in • combination with a pharmaceutically acceptable carrier.

The invention also relates to a A composition comprising an antibody that specifically binds a PR0358 polypeptide, in combination with an acceptable carrier • pharmaceutically.

The invention also relates to a method for treating septic shock comprising administering to a patient an effective amount of an antagonist of a PR0358 polypeptide. In a specific modality, the antagonist is a blocking antibody that specifically binds a native PR0358 -polypeptide . PRO1310 A cDNA clone (DNA47394-1572) encoding a new polypeptide having sequence identity with carboxypeptidase X2 has been identified and is designated in the present application as "PRO1310".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1310 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a ) a molecule of DNA encoding a PRO1310 polypeptide having the sequence of amino acid residues roughly from 26 to about 765, inclusive of Figure 36 (SEQ ID NO: 62), or (b) the - - complement of the DNA molecule of (a) In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a • PRO1310 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 401 and approximately 2593 residues, inclusive, of Figures 35A-B (SEQ ID NO: 61). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, More preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203109 (DNA47394-1572), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203109 (DNA47394-1572). • In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least • approximately 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of A sequence with the sequence of amino acid residues approximately from about 26 to about 765, inclusive of Figure 36 (SEQ.

• ID NO: 62), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides and which is produced by hybridizing a Test DNA molecule under severe conditions with (a) a DNA molecule which encodes a PRO1310 polypeptide having the sequence of amino acid residues approximately from about 26 to about 765, inclusive of Figure 36 (SEQ ID NO: 62), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85 sequence identity. %, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 26 to about 765, inclusive of Figure 36 (SEQ.

I D N O: 62 b) e comp l ement of the DNA of (a In another embodiment, the invention provides the isolated PRO1310 polypeptide encoded by • any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO1310 polypeptide, which in one embodiment, includes • an amino acid sequence comprising residues 26 to 765 of Figure 36 (SEQ ID NO: 62).

In another aspect, the invention relates to an isolated PRO1310 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 26 to about 765, inclusive of Figure 36 (SEQ ID NO: 62).

In a further aspect, the invention relates to an isolated PRO1310 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 26 to 10 about 765 of the Figure 36 (SEQ ID NO: 62).

In still another aspect, the invention relates to an isolated PRO1310 polypeptide, which comprises Sequence of amino acid residues 26 to about 765, inclusive of Figure 36 (SEQ ID NO: 62), or a sufficient fragment itself to • provide a binding site for an anti-PRO1310 antibody. Preferably, the PRO1310 fragment retains a qualitative biological activity of a native PRO1310 polypeptide.

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1310 polypeptide having the sequence of amino acid residues roughly from 26 to about 765, inclusive of Figure 36 (SEQ. ID NO: 62), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host which comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1310 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 310 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1310 polypeptide, by contacting the native PRO1310 polypeptide • with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1310 polypeptide, or an agonist or antagonist. • as defined herein above, in combination with a pharmaceutically acceptable carrier. 16 PR0698 Applicants have identified a clone of CDNA encoding a new polypeptide that has • homology with the ol fact omedin, where the polypeptide is designated in the present application as "PR0698".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0698 polypeptide. In a aspect, the isolated nucleic acid comprising the DNA encoding PR0698 polypeptide having amino acid residues 1 to 510 of Figure 38 (SEQ ID NO: 67), or is complementary to such a coding nucleic acid sequence, and it remains • Stably bound to it under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding the PR0698 polypeptide having the residues of amino acids from about 21 to 510 of the Figure 38 (SEQ ID NO: 67), or is complementary to such a coding nucleic acid sequence, and remains stably bound thereto under at least moderate conditions, and optional, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48320-1433 vector • deposited on May 27, 1998 as ATCC 209904 which includes the nucleotide sequence that codes to PR0698.

In another embodiment, the invention provides the isolated PR0698 polypeptide. In particular, the invention provides the PR0698 polypeptide of the The isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 510 of Figure 38 (SEQ ID NO: 67). Additional embodiments of the present invention are directed to PR0698 polypeptides • comprising amino acids 21 to 510 of Figure 38 (SEQ ID NO: 67). Optionally, PR0698 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the DNA48320-1433 vector deposited on 27 May 10, 1998, as ATCC 209904. • In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA39906 comprising the sequence nucleotides of Figure 39 (SEQ ID NO: 68). 17 PR0732 • Applicants have identified a clone of CDNA encoding a new polypeptide having homology to the human placenta D? Ff33 protein, wherein the polypeptide is designated in the present application as "PR0732".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0732 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding PR0732 polypeptide having amino acid residues 1 through 453 of Figure 41 (SEQ ID NO: 73), or is complementary to such a coding nucleic acid sequence , and remains stably attached to it under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the Isolated nucleic acid comprises the DNA encoding • the PR0732 polypeptide having the amino acid residues from about 29 to 453 of Figure 41 (SEQ ID NO: 73) or amino acid 1 or about 29 to X of Figure 41 (SEQ ID NO: 73), where X is any amino acid from 31 to 40 of Figure 41 (SEQ ID NO: 73), or is complementary to such a nucleic acid sequence • coding, and remains stably bound to it under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence can comprise the cDNA insert of the DNA48334-1435 vector deposited on June 2, 1998, as ATCC 209924 which includes the nucleotide sequence that codes to PR0732.

In another embodiment, the invention provides the isolated PR0732 polypeptide. In particular, the invention provides the PR0732 polypeptide of the • Isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 453 of Figure 41 (SEQ ID NO: 73). Additional embodiments of the present invention are directed to PR0732 polypeptides comprising amino acids 29 to 453 of the Figure • 41 (SEQ ID NO: 73) or amino acid 1 or approximately 29 to X of Figure 41 (SEQ ID NO: 73), where X is any amino acid from 31 to 40 of Figure 41 (SEQ ID NO. : 73). Optionally, The PR0732 polypeptide is obtained or can be obtained by expression of the polypeptide encoded by the cDNA insert of the vector DNA48334-1435 • deposited on June 2, 1998, as ATCC 209924.

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA20239 comprising the nucleotide sequence of Figure 42 (SEQ ID NO: 74).

In another embodiment, the invention provides - an expressed sequence tag (EST) designated herein as DNA38050 comprising the nucleotide sequence of Figure 43 (SEQ ID NO: 75).

• In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA40683 comprising the nucleotide sequence of Figure 44 (SEQ ID NO: 76).

In another embodiment, the invention provides • an expressed sequence tag (EST) designated herein as DNA42580 comprising the nucleotide sequence of Figure 45 (SEQ ID NO: 77).

PRO1120 A cDNA clone (DNA48606-1479) encoding a new polypeptide having • homology with the sulphatases, designated in the present application as "PRO1120". In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1120 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1120 polypeptide having the sequence of amino acid residues approximately as from 18 up to about 867, • inclusive of Figure 47 (SEQ ID NO: 84), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1120 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of • Approximately between 659 and approximately 3208 residues, inclusive, of Figures 46A-B (SEQ ID NO: 83). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, so more preferable at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203040 (DNA48606-1479), or (b) • the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203040 (DNA48606-1479).

In still a further aspect, the invention • refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide Which has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from about 18 to about 867, inclusive of Figure 47 (SEQ ID NO: 84), or the DNA complement of (FIG. to) . • In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100. nucleotides and that is produced by hybridizing a • test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1120 polypeptide having the sequence of amino acid residues roughly from -18 to approximately 867, inclusive of Figure 47 (SEQ ID NO: 84), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule • has at least approximately 80% sequence identity, preferably at least approximately a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the molecule DNA test.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1120 polypeptide, with or without the N-terminal signal sequence, or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified as extending to "start from approximately position 1 of the amino acid to approximately position 17 of the amino acid in the sequence of Figure 47 (SEQ ID.

NO: 84).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 18 to about 867, inclusive of Figure 47 (SEQ ID NO: 84), or (b) ) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PRO1120 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1120 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO1120 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 18 through 867 of Figure 47 (SEQ ID NO: 84).

In another aspect, the invention relates to an isolated PRO1120 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 18 to about 867, inclusive of Figure 47 (SEQ ID NO: 84).

In a further aspect, the invention relates to an isolated PRO1120 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 18 to approximately 867 of Figure 47 (SEQ ID NO: 84).

In yet another aspect, the invention relates to an isolated PRO1120 polypeptide, comprising the sequence of amino acid residues 18 to about 867, inclusive of Figure 47 (SEQ ID NO: 84), or a sufficient fragment thereof to (provide a binding site for an anti-PRO1120 antibody.) Preferably, the PRO1120 fragment retains a qualitative biological activity of a native PRO1120 polypeptide.

Still in a further aspect, the invention • provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1120 polypeptide having the The sequence of the amino acid residues is approximate from 18 to about 867, inclusive of Figure 47 (SEQ ID NO: 84), or (b) the # complement the DNA molecule of (a), and if the DNA test molecule has at least approximately a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the • cell culture.

In yet another embodiment, the invention relates to the agonists and antagonists of a native PRO1120 polypeptide, in a In particular, the agonist or antagonist is a • anti-i antibody - PR01120.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1120 polypeptide, contacting the native PRO1120 polypeptide with a candidate molecule and monitoring a • biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1120 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier. pharmaceutically. 19 PR0537 A cDNA clone (DNA49141-1431) encoding a new secreted polypeptide has been identified, • 5 designated in the present application as "PR0537".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0537 polypeptide. • In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule encoding a PR0537 polypeptide having the The sequence of amino acid residues is from about 1 or approximately 32 to about 115, inclusive of Figure 49 (SEQ ID NO: 95), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0537 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 97 or approximately 190 and about 441 nucleotides, inclusive, of the Figure 48 (SEQ ID NO: 94). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203003 (DNA49141-1431), or (b) the complement of the nucleic acid molecule molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203003 (DNA49141-1431).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the amino acid residue sequence from about 1 or from about 32 to about 115, inclusive of Figure 49 (SEQ ID NO: 95), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0537 polypeptide which has the sequence of amino acid residues from about 1 or approximately 32 to about 115, inclusive of Figure 49 (SEQ ID NO: 95), or (b) the complement of the • DNA of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about one identity of The 90% sequence, more preferably at least about 95% sequence identity with (a) or (b), isolates the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0537 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a molecule. encoding nucleic acid. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 31 of the amino acid in the sequence of Figure 49 (SEQ ID NO: 95). In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 10 up to 32 about 115, inclusive of Figure 49 (SEQ ID NO: 95), or (b) the DNA complement of (a).

Another modality is directed to fragments of a sequence encoding PR0537 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about approximately 40 nucleotides in length and can be derived from the nucleotide sequence shown in that of Figure 48 (SEQ ID NO: 94).

In another embodiment, the invention provides • the isolated PR0537 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR0537, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 32 to approximately 115 of Figure 49 (SEQ ID NO. : 15 95).

In another aspect, the invention relates to an isolated PR0537 polypeptide, comprising an amino acid sequence having at least one about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 32 to about 115, inclusive of Figure 49 (SEQ ID NO: 95).

• In a further aspect, the invention relates to an isolated PR0537 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 32 to about 115, inclusive of Figure 49 (SEQ ID NO: 95).

In still another aspect, the invention relates to an isolated PR0537 polypeptide, comprising the sequence of amino acid residues 1 or Approximately 32 to about 115, inclusive of Figure 49 (SEQ ID NO: 95), or a sufficient fragment itself to provide a binding site for an anti-PR0537 antibody. Preferably, the PR0537 fragment retains a qualitative biological activity of a polypeptide -a-B-a-M-t-l-i-i PR0537 native. In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a low test DNA molecule. • severe conditions with (a) a DNA molecule encoding a PR0537 polypeptide having the sequence of the amino acid residues from about 1 or about 32 to about 115, inclusive of Figure 49 (SEQ.

ID NO: 95), or (b) the complement of the molecule of • DNA of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, most preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with (a) or (b), (ii) by culturing a host or host cell comprising the DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

PR0536 25 A cDNA clone (DNA49142-1430), which codes for a new secreted polypeptide, designated in the present application as "PR0536" has been identified.

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PR0536 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , more preferably at least about 95% sequence identity with (a) a molecule of DNA encoding a PR0536 polypeptide having the sequence of amino acid residues from about 1 or from about 26 to about 313, inclusive of Figure 51 (SEQ.

ID NO: 97), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR0536 polypeptide comprising DNA that hybridizes to the nucleic acid complement between about 48 or about 123 and about 998 nucleotides, inclusive, of Figure 50 (SEQ ID NO: 96). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Repository No. 203002 (DNA49142-1430), or (b) the complement of the nucleic acid molecule molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203002 (DNA49142-1430).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with the amino acid residue sequence 1 or approximately 26 to approximately 313, inclusive of Figure 51 (SEQ ID NO: 97), or (b) the DNA complement of (a). In a further aspect, the invention relates to an isolated nucleic acid molecule that F has at least 10 nucleotides and is produced by hybridizing a DNA molecule under test severe conditions with (a) a DNA molecule encoding a PR0536 polypeptide having the amino acid residue sequence from about 1 or approximately 26 to about 313, inclusive of Figure 51 (SEQ.

ID NO: 97), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about one identity sequence of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the DNA molecule from proof.

In a specific aspect, the invention • provides an isolated nucleic acid molecule comprising the DNA encoding a PR0536 polypeptide, with or without the N-terminal signal sequence and / or the initiation methylene, or is complementary for such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from approximately • position 1 of the amino acid until approximately position 25 of the amino acid in the sequence of the Figure 51 (SEQ ID NO: 97).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or approximately 26 to about 313, inclusive of Figure 51 (SEQ ID NO: 97), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR0536 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to approximately 80 nucleotides in length, preferably approximately 20 to approximately 60 nucleotides in length, • more preferably from about 20 to about 50 nucleotides in length, and more preferably about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in that of Figure 50 (SEQ ID NO: 96).

In another embodiment, the invention provides the isolated PR0536 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PR0536 polypeptide of isolated native sequence, which in a certain embodiment, includes an amino acid sequence comprising residues 1 or approximately 26 up to about 313 of Figure 51 (SEQ ID NO: • 97).

In another aspect, the invention relates to an isolated PR0536 polypeptide, comprising a amino acid sequence having at least about 80% sequence identity, preferably at least about 85% • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 26 to about 313, inclusive of Figure 51 (SEQ ID NO: 97). In a further aspect, the invention relates to an isolated PR0536 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 26 up to about 313, inclusive of Figure 51 (SEQ ID NO: 97).

In still another aspect, the invention relates to an isolated PR0536 polypeptide, which comprises Sequence of amino acid residues 1 or approximately 26 to about 313, inclusive of Figure 51 (SEQ ID NO: 97), or a sufficient fragment itself to provide a binding site for an anti-PR0536 antibody.

Preferably, the PR0536 fragment retains a qualitative biological activity of a native PR0536 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0536 polypeptide having the sequence of the amino acid residues from ^ 5 approximately 1 or approximately 26 to approximately 313, inclusive of Figure 51 (SEQ ID NO: 97), or (b) the complement of the DNA molecule of (a), and if the DNA molecule of test has at least approximately a sequence identity of 80%, preferably at least ^ W about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of Sequence with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for F expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 20 21 PR0535 A cDNA clone (DNA49143-1429) has been identified, which has homology with the nucleic acid encoding a peptide isomerase lo-pr ol i lo putative, which encodes a new polypeptide, designated in the present application as "PR0535" In one embodiment, the invention provides an isolated nucleic acid molecule comprising • the DNA encoding a PR0535 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding a PR0535 polypeptide having the amino acid residue sequence from about 1 or approximately 26 up to • about 201, inclusive of Figure 53 (SEQ ID NO: 99), or (b) the molecule complement of DNA from (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0535 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between ^^ j ^ j approximately 78 or approximately 153 and approximately 680 nucleotides, inclusive, of Figure 52 (SEQ ID NO: 98). Preferably, hybridization occurs under severe conditions of • washing and hybridization.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203013 (DNA49143-1429), or (b) the complement of the molecule nucleic acid a) . In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203013 (DNA49143-1429).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least • about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the 10 amino acid residues 1 or roughly 26 up • about 201, inclusive of Figure 53 (SEQ ID NO: 99), or (b) the DNA complement of (a).

In a further aspect, the invention is refers to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a low test DNA molecule. • severe conditions with (a) a DNA molecule that encodes a PR0535 polypeptide that has the Sequence of the amino acid residues from 1 or approximately 26 to about 201, inclusive of Figure 53 (SEQ ID NO: 99), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately one Sequence identity of 80%, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95 sequence identity % with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide • PR0535, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, ie, inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from approximately • position 1 of the amino acid until approximately position 25 of the amino acid in the sequence of the Figure 53 (SEQ ID NO: 99). The transmembrane domain has tentatively been identified as extending from about position 155 of the amino acid to about position 174 in the amino acid sequence of the amino acid.

PR0535 (Figure 53, SEQ ID NO: 99).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 26 to about 201, inclusive of Figure 53 (SEQ ID NO: 99 ), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PR0535 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 52 (SEQ ID NO: 98).

• In another embodiment, the invention provides the isolated PR0535 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention • provides PR0535 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 26 to 201 of Figure 53 (SEQ ID NO: 99).

In another aspect, the invention relates to a • PR0535 polypeptide isolated, comprising an amino acid sequence that has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 26 to 201, inclusive of Figure 53 (SEQ ID NO: 99).

• In a further aspect, the invention relates to an isolated PR0535 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 26 to 201, inclusive of the Figure 53 (SEQ ID NO: 99).

In still another aspect, the invention relates to an isolated PR0535 polypeptide, comprising the sequence of amino acid residues 1 or Approximately 26 through 201, inclusive of Figure 53 (SEQ ID NO: 99), or a fragment sufficient to provide a binding site for an anti-PR0535 antibody. Preferably, PR0535 fragment retains a biological activity Qualitative of a native PR0535 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a low test DNA molecule.

• Severe conditions with (a) a DNA molecule encoding a PR0535 polypeptide having the sequence of the amino acid residues roughly from 1 or approximately 26 to 201, inclusive of Figure 53 (SEQ ID NO: 99), or (b) the complement of the DNA molecule of (a), and • if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) • culturing a host cell or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR0535 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0535 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0535 polypeptide, contacting the native PR0535 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0535 polypeptide, or an agonist or antagonist as defined hereinbefore, in combination with an acceptable carrier fa rmaily. • In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA30861 comprising the nucleotide sequence of Figure 54 (SEQ ID NO: 100).

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA36351 comprising the nucleotide sequence of Figure 55 (SEQ ID NO: 101). 22 PR0718 ^ ßf Applicants have identified a clone of CDNA encoding a new t and raespace membrane polypeptide, wherein the polypeptide is designated in the present application as "PR0718".

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PR0718 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PR0718 polypeptide having the amino acid residues 1 to 157 of Figure 57 (SEQ ID NO: 103), or is complementary to such a coding nucleic acid sequence, and remains • Stably bound to it under at least moderate conditions, and optionally, under highly severe conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding PR0718 polypeptide having amino acid residues X through 157 of Figure 57 (SEQ ID NO: 103), wherein X is any amino acid from 143 to 152 of Figure 57 (SEQ ID NO: 103), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions.

• The isolated nucleic acid sequence may comprise the cDNA insert of the DNA49647-1398 vector deposited on June 2, 1998, as ATCC 209919 which includes the nucleotide sequence encoding PR0718. 10 • In another embodiment, the invention provides the isolated PR0718 polypeptide. In particular, the invention provides PR0718 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 157 of Figure 57 (SEQ ID NO: 103). The additional modalities of this • invention are directed to the PR0718 polypeptides comprising amino acids X through 157 of the Figure 57 (SEQ ID NO: 103), where X is any amino acid from 143 to 152 of Figure 57 (SEQ ID NO: 103). Optionally, PR0718 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the DNA49647-1398 vector deposited on June 2, 1998, as ATCC 209919. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA15386 which comprises the nucleotide sequence of Figure 58 (SEQ. ID NO: 104).

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA16630 comprising the nucleotide sequence of Figure 59 (SEQ ID NO: 105).

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA16829 comprising the nucleotide sequence of Figure 60 (SEQ ID NO: 106).

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA28357 comprising the nucleotide sequence of Figure 61 (SEQ ID NO: 107).

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA43512 comprising the nucleotide sequence of Figure 62 (SEQ ID NO: 108). 23 PR0872 Applicants have identified a clone of CDNA, DNA49819-1439, which encodes a new polypeptide having homology to the dehydrogenases wherein the polypeptide is designated in the present application as "PR0872".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising • the DNA encoding a PR0872 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PR0872 polypeptide having the amino acid residue sequence from about 1 or approximately 19 to about 610, inclusive of Figure 64 (SEQ.

ID NO: 113), or (b) the complement of the DNA molecule of In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0872 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 68 and about 1843 residues, inclusive, of Figure 63 (SEQ. ID NO: 112). Preferably, the hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209931 (DNA49819-1439), which was deposited on June 2, 1998. In a modality Preferred, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209931 (DNA49819-1439).

• In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least approximately 85% sequence identity, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of residues 1 or approximately to about 610, inclusive of Figure 64 (SEQ ID NO: 113).

• In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding an extracellular domain (ECD) of PR0872, with or without the N-terminal signal sequence and / or the initiation methionine, and their soluble variants (ie, inactivated or deleted from the domain) (s) of transmembrane) or is complementary to such a molecule - - encoding nucleic acid. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 18 of the amino acid in the sequence of Figure 64 (SEQ ID NO: 113). The first region of the transmembrane domain has tentatively been identified as extending from about position 70 of the amino acid to about position 87 of the amino acid in the sequence of • amino acids of PR0872 (Figure 64, SEQ ID NO: 113).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 90% positive, • more preferably at least about 95% positive when compared to the sequence of amino acids of the residues 1 or approximately 19 to about 610, inclusive of Figure 64 (SEQ ID NO: 113).

Another embodiment is directed to fragments 25 of a sequence encoding PR0872 polypeptide - which may find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 up approximately 40 nucleotides in length. • In another embodiment, the invention provides the isolated PR0872 polypeptide encoded by any of the nucleic acid sequences isolates identified in the present above.

In a specific aspect, the invention • provides PR0872 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 19 to approximately 610 of Figure 64 (SEQ ID NO: 113).

In another aspect, the invention relates to an isolated PR0872 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 10 to about 610, inclusive of the Figure • 64 (SEQ ID NO: 113).

In a further aspect, the invention relates to an isolated PR0872 polypeptide, which comprises a record of the amino acid sequence of at least about 80% positive, preferably at least about 85% positive, • more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 19 to 610 of Figure 64 (SEQ ID NO: 113).

In another aspect, the invention relates to an extracellular domain of PR0872 comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or roughly 19 to approximately X of Figure 64 (SEQ ID.

• NO: 113), wherein X is any of amino acid residues 66 to 75 of that of Figure 64 (SEQ ID NO: 113).

In still another aspect, the invention relates to an isolated PR0872 polypeptide, comprising the sequence of amino acid residues 1 or F approximately 19 to about 610, inclusive of Figure 64 (SEQ ID NO: 113), or a The same fragment is sufficient to provide a binding site for an anti-PR0872 antibody. Preferably, the PR0872 fragment retains a qualitative biological activity of a native PR0872 polypeptide. In another aspect, the present invention is directed to fragments of a PR0872 polypeptide that are sufficiently long to provide an epitope against which a • anti body.

In yet another embodiment, the invention relates to the agonists and antagonists of a PR0872 polypeptide. In a particular modality, the The agonist or antagonist is an anti-PR0872 antibody.

^^ In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of a polypeptide PR0872 native.

Still in an additional modality, the • invention relates to a composition comprising a PR0872 polypeptide as defined herein above, in combination with a pharmaceutically acceptable carrier. 24. PRO1063 Applicants have identified a clone of cDNA encoding a new polypeptide having homology to human type IV collagenase, wherein the polypeptide is designated in the present application as "PRO1063".

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1063 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO1063 polypeptide having amino acid residues 1 to 301 of Figure 66 • (SEQ ID NO: 115), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly severe conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding the PRO1063 polypeptide having the amino acid residues of about 22 to 301 of Figure 66 (SEQ ID NO: 115), or is complementary to such The nucleic acid sequence encoding it, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA49820-1427 vector deposited on June 2, 1998, as ATCC 209932 which includes the nucleotide sequence encoding PRO1063.

In another embodiment, the invention provides • the PRO1063 polypeptide isolated. In particular, the invention provides the PRO1063 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 301 of Figure 66 (SEQ ID NO: 115). The additional modalities of this • invention is directed to the PRO1063 polypeptides comprising amino acids 22 to 301 of Figure 66 (SEQ ID NO: 115). Optionally, PRO1063 polypeptide is obtained or can be obtained by Expression of the polypeptide encoded by the cDNA insert of the vector DNA49820-1427 deposited on June 2, 1998, as ATCC 209932. F 25 PR0619 A cDNA clone (DNA49821-1562) encoding a new polypeptide, designated in the present application as "PR0619". The PR0619 polypeptides have sequence identity with the VpreB genes, particularly with the VpreB3.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0619 polypeptide.

• In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, • most preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0619 polypeptide having the sequence of amino acid residues from approximately 1 or approximately 21 to approximately 123, inclusive of Figure 68 (SEQ ID NO: 117), or (b) the complement of the • DNA from (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0619 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 81 or 141 and approximately 449 residues, inclusive, of Figure 67 (SEQ ID NO: 116). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209981 (DNA49821-1562), or (b) the complement of the DNA molecule of (a). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209981 (DNA49821-1562).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule Comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , more preferably at least about 95% sequence identity with the sequence of amino acid residues roughly from 1 or 21 to about 123, inclusive of Figure 68 (SEQ ID NO: 117), or the complement of the DNA of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0619 polypeptide having the amino acid residue sequence in a manner approximate from 1 or 21 to about 123, inclusive of Figure 68 (SEQ ID NO: 117), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95 percent sequence identity % with (a) or (b), isolate the test DNA molecule.

• In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0619 polypeptide, with or without the N-terminal signal sequence and / or the initiation methionine, which is in a soluble form. The signal peptide has been • tentatively identified as extending from about position 1 of the amino acid to about position 20 of the amino acid in the sequence of Figure 68 (SEQ ID.

NO: 117).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to The amino acid sequence of residues 1 or 21 - - up to about 123, inclusive of Figure 68 (SEQ ID NO: 117), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR0619 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 40 up to approximately 80 nucleotides in length, • preferably roughly from 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably about 20 to about 40 nucleotides in length.

• In another embodiment, the invention provides the isolated PR0619 polypeptide encoded by Any of the isolated nucleic acid sequences defined hereinbefore.

In a specific aspect, the invention provides the PR0619 sequence polypeptide Isolated native, which in one embodiment, includes an amino acid sequence comprising residues 1 or 21 to 123 of Figure 68 (SEQ ID NO: 117).

In another aspect, the invention relates to an isolated PR0619 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the F less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues 21 through about 123, inclusive of Figure 68 (SEQ ID NO: 117).

• In a further aspect, the invention relates to an isolated PR0619 polypeptide, which comprises an amino acid sequence register of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or 21 to 123 of Figure 68 (SEQ ID NO: 117).

Still in a further aspect, the invention • provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0619 polypeptide having the sequence of the amino acid residues so approximate from 1 or 21 to approximately 123, • inclusive of Figure 68 (SEQ ID NO: 117), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80% sequence identity , preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) cultivating a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. In yet another embodiment, the invention relates to agonists and antagonists of a native PR0619 polypeptide. In a particular embodiment, the agonist or antagonist is a • anti-PR0619 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0619 polypeptide, by contacting the native PR0619 polypeptide • with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention refers to a composition comprising a PR0619 polypeptide, or an agonist or antagonist as defined herein above, in • combination with a pharmaceutically acceptable carrier. 20 26. PR0943 A cDNA clone (DNA52192-1369) has been identified, which has homology with the fibroblast growth factor receptor 4 encoding to the nucleic acid, which encodes a new polypeptide, designated in the present application as "PR0943".

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PR0943 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PR0943 polypeptide having the sequence of amino acid residues from • about 1 or about 18 to about 504, inclusive of Figure 70 (SEQ.

ID NO: 119), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR0943 polypeptide comprising DNA that hybridizes to the nucleic acid complement between about 150 or approximately 201 and about 1661 nucleotides, inclusive, of Figure 69 (SEQ ID NO: 118). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203042 (DNA52192-1369), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203042 (DNA52192-1369). tü-MÜ-MÜI-i In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity • of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of sequence with the residue sequence of • amino acids 1 or approximately 18 to about 504, inclusive of Figure 70 (SEQ ID NO: 119), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced • hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a PR0943 polypeptide having the sequence of amino acid residues from 1 or approximately 18 to about 504, inclusive of Figure 70 (SEQ ID NO: 119), or (b) the complement of the DNA molecule of (a), and, if The DNA molecule has at least about - 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule • comprising the DNA encoding a PR0943 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e., inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified • as extending from about position 1 of the amino acid to about position 17 of the amino acid in the sequence of Figure 70 (SEQ ID NO: 119). The transmembrane domain has been tentatively identified as extending from about position 376 of the amino acid to about position 396 of the amino acid in the amino acid sequence of PR0943 (Figure 70, SEQ ID NO: 119 In another aspect, the invention relates to an isolated nucleic acid molecule comprising 5 (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to • the amino acid sequence of residues 1 or approximately 18 to about 504, inclusive of Figure 70 (SEQ ID NO: 119), or (b) the DNA complement of (a). Another embodiment is directed to fragments of a sequence encoding PR0943 polypeptide • which can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about approximately 50 nucleotides in length and more preferably approximately 20 to approximately 40 nucleotides in length and can be derived from the nucleotide sequence shown in that of Figure 69 (SEQ ID NO: 118).

• In another embodiment, the invention provides the isolated PR0943 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

• In a specific aspect, the invention provides the PR0943 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising the residues 1 or approximately 18 to approximately 504 of Figure 70 (SEQ ID NO: 119). • In another aspect, the invention relates to a PR0943 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 18 to about 504, inclusive of the Figure • 5 70 (SEQ ID NO: 119).

In a further aspect, the invention relates to an isolated PR0943 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 18 to about 504, inclusive of Figure 70 (SEQ ID NO: 119). • In still another aspect, the invention relates to an isolated PR0943 polypeptide, comprising the sequence of amino acid residues 1 or approximately 18 to about 504, inclusive of Figure 70 (SEQ ID NO: 119), or a fragment sufficient to provide a binding site for an anti-PR0943 antibody.

Preferably, the PR0943 fragment retains a qualitative biological activity of a native PR0943 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0943 polypeptide having the sequence of the amino acid residues so • approximate from 1 or approximately 18 to approximately 504, inclusive of Figure 70 (SEQ ID NO: 119), or (b) the complement of the DNA molecule of (a), and if the DNA molecule of test has at least about 80% sequence identity, preferably at least about 85% sequence identity, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering he polypeptide from the cell culture. -et- ^ - ri-tt-i In yet another embodiment, the invention relates to agonists and antagonists of a native PR0943 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0943 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0943 polypeptide, • contacting the native PR0943 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0943 polypeptide, or an agonist or antagonist • as defined herein above, in combination with an acceptable carrier pharmaceutically.

PR01188 A cDNA clone (DNA52598-1518) encoding a new polypeptide having homology with the pyrophos fos foh idrolase of the nucleotide and M-É - ^ - A is designated in the present application as PR01188 In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PR01188 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PR01188 polypeptide having the sequence of amino acid residues roughly from 22 to about 1184, inclusive of Figure 72 (SEQ ID NO: 124), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01188 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 199 and approximately 3687 residues, inclusive, of Figure 71 (SEQ ID NO: 123). Preferably, hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203107 (DNA52598-1518), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203107 (DNA52598-1518).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% of sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues roughly from 22 to about 1184, inclusive of the Figure 72 (SEQ ID NO: 124), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides and preferably at least about 100 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01188 polypeptide having the sequence of amino acid residues roughly from 22 to about 1184, inclusive of Figure 72 (SEQ ID NO: 124), or (b) the complement of the DNA of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about one sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule • comprising the DNA encoding a PR01188 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a coding nucleic acid molecule. He The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about • position 21 of the amino acid in the sequence of Figure 72 (SEQ ID NO: 124). In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 22 to 5 about 1184, inclusive of the Figure 72 (SEQ ID NO: 124), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PR01188 polypeptide encoded by # any of the isolated nucleic acid sequences defined hereinbefore.

In a specific aspect, the invention provides the PR01188 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the • residues 22 to 1184 of Figure 72 (SEQ ID NO: 124). In another aspect, the invention relates to an isolated PR01188 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, Preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence sequence. • amino acid residues 22 to approximately 1184, inclusive of Figure 72 (SEQ ID NO: 124).

In a further aspect, the invention relates to an isolated PR01188 polypeptide, which comprises a record of the amino acid sequence • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 22 to 1184 of Figure 72 (SEQ ID NO: 124). • In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01188 polypeptide having the sequence of the amino acid residues so 25 approximate from 22 to about 1184, inclusive of Figure 72 (SEQ ID NO: 124), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) cultivating a host cell or host that • comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. In still another embodiment, the invention relates to the agonists and antagonists of a • native PR01188 polypeptide, In a particular modality, the agonist or antagonist is a Anti- i PROl antibody 188.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01188 polypeptide, by contacting the native PR01188 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional modality, the • invention relates to a composition comprising a PR01188 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 10 • 28. PR01133 A cDNA clone (DNA53913-1490) has been identified, which encodes a new polypeptide having sequence identity with netrin-la and is designated in the present application as "PR01133".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01133 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least - about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01133 polypeptide having the • sequence of amino acid residues from about 19 to about 438, inclusive of Figure 74 (SEQ ID NO: 129), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to a • isolated nucleic acid molecule encoding a PR01133 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 320 and about 1579 residues, inclusive, of Figure 73 (SEQ ID NO: 128). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC No. 203162 (DNA53913-1490), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203162 (DNA53913-1490). • In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from about 19 to about 438, inclusive of Figure 74 (SEQ ID NO: 129), or (b) the DNA complement of (to) . In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and more preferably at least about 100 f 5 nucleotides and which is produced by hybridizing a DNA test molecule under conditions severe with (a) a DNA molecule encoding a PR01133 polypeptide having the sequence of the amino acid residues roughly from 19 to about 438, inclusive of Figure f 74 (SEQ ID NO: 129), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately one identity. of 80% sequence, preferably at least approximately a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the molecule DNA test.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, so - 3 4 - preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 19 to about 438, inclusive of Figure 74 (SEQ ID NO: 129), or (b) the DNA complement of (a).

Another modality is directed to fragments of a sequence encoding the PR01133 polypeptide • which can find use as hybridization probes. Such nucleic acid fragments are roughly from 20 to about 80 nucleotides in length, preferably approximately from 20 to approximately 60 nucleotides in length, more preferably from approximately 20 to • approximately 50 nucleotides in length, and more preferably approximately 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01133 polypeptide encoded by any of the nucleic acid sequences isolates defined herein.

- - In a specific aspect, the invention provides the PR01133 polypeptide of isolated native sequence, which in one embodiment, includes • an amino acid sequence comprising residues 19 to 438 of Figure 74 (SEQ ID NO: 129).

In another aspect, the invention relates to a PR01133 polypeptide isolated, comprising a • amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of • amino acid residues 19 to approximately 438, inclusive of Figure 74 (SEQ ID NO: 129). In a further aspect, the invention relates to an isolated PR01133 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residue 19 up to • 5 438 of Figure 74 (SEQ ID NO: 129).

In still another aspect, the invention relates to an isolated PR01133 polypeptide, comprising the sequence of amino acid residues 19 through about 438, inclusive of Figure 74 (SEQ ID NO: 129), or a sufficient fragment itself to provide a binding site for an anti-PR01133 antibody. Preferably, the PR01133 fragment retains a qualitative biological activity of a PR01133 polypeptide native.

Still in a further aspect, the invention • provides a polypeptide produced (i) by hybridizing a low test DNA molecule Severe conditions with (a) a DNA molecule encoding a PR01133 polypeptide having the sequence of the amino acid residues approximately from about 19 to about 438, inclusive of Figure 74 (SEQ ID NO: 129), or ( b) The complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the F minus approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under suitable conditions for the expression of F polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention is refers to the agonists and antagonists of a native PR01133 polypeptide. In a particular embodiment, the agonist or antagonist is a • anti-i-PRO 1133 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01133 polypeptide, contacting the native PR01133 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

- - Still in a further embodiment, the invention relates to a composition comprising a PR01133 polypeptide, or an agonist or antagonist • as defined herein above, in combination with a pharmaceutically acceptable carrier. 29. PR0784 A cDNA clone (DNA53978- • 1443), which codes for a new polypeptide, designated in the present application as "PR0784" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0784 polypeptide.

• In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PR0784 polypeptide having the sequence of amino acid residues approximately from about 16 to about 228, inclusive of Figure 76 (SEQ ID NO: 135), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0784 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between • approximately 182 and approximately 820 residues, inclusive, of Figure 75 (SEQ ID NO: 134). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule that ^ - comprises DNA that has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209983 (DNA53978-1443), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a • DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209983 (DNA53978-1,33).

In still a further aspect, the invention refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, More preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of residues approximately from about 16 to about 228, inclusive of Figure 76 (SEQ ID NO: 135), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least 50 nucleotides, and preferably at least 100 nucleotides, and is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0784 polypeptide having the • sequence of the amino acid residues approximately from 16 to approximately 228, inclusive of Figure 76 (SEQ ID NO: 135), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately an 80% sequence identity, so • preferable at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about a sequence identity of 95% with (a) or (b), isolate the test DNA molecule.

• In a specific aspect, the invention provides an isolated nucleic acid molecule which comprises the DNA encoding a PR0784 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to Such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 15 of the amino acid in the sequence of the • Figure 76 (SEC ID NO: 135). The first transmembrane domain has tentatively been identified as extending from about position 68 of the amino acid to about position 87 of the amino acid in the sequence of amino acids of PR0784 (Figure 76, SEQ ID NO: 135).

• In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about • 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 16 to about 228, inclusive of Figure 76 (SEQ ID NO: 135), or (b) the DNA complement of (a).

In another aspect, the invention relates to the hybridization probes comprising the .-J &xJ & Xfi- "-Á-V. - fragments of the coding sequence of PR0784, or the complementary sequence thereof. Hybridization probes preferably have at least about 20 • nucleotides up to about 80 nucleotides, and more preferably, at least about 40 to about 80 nucleotides.

In another embodiment, the invention provides the isolated PR0784 polypeptide encoded by • any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the PR0784 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the • residues 16 to 228 of Figure 76 (SEQ ID NO: 135).

In another aspect, the invention relates to an isolated PR0784 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 16 up to about ß 5 228, inclusive of the Figure 76 (SEQ ID NO: 135).

In a further aspect, the invention relates to an isolated PR0784 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 16 to 228 of Figure 76 (SEQ ID NO: 135).

In still another aspect, the invention relates to an isolated PR0784 polypeptide, comprising The sequence of amino acid residues 16 to about 228, inclusive of Figure 76 (SEQ ID NO: 135), or a fragment sufficient to provide a binding site for an anti-PR0784 antibody. Preferably, the fragment PR0784 retains a qualitative biological activity of a native PR0784 polypeptide In yet a further aspect, the invention provides a polypeptide produced (i) • 5 hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0784 polypeptide having the amino acid residue sequence roughly from 16 to about 228, inclusive of Figure 76 (SEQ ID NO: 135), or (b) • the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% of Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with (a) or (b), (ii) cultivating a host cell or host that comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR0784 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0784 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0784 polypeptide, by contacting the native PR0784 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0784 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier chemically. 30 PR0783 Applicants have identified a clone of CDNA encoding a new transmembrane polypeptide of mu ti t-spaces, wherein the polypeptide is designated in the present application as "PR0783".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0783 polypeptide. In a • aspect, the isolated nucleic acid comprising the DNA encoding PR0783 polypeptide having amino acid residues 1 to 489 of Figure 79 (SEQ ID NO: 138), or is complementary to such a coding nucleic acid sequence, and remains stably bound to it under conditions at • less moderate, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding the PR0783 polypeptide having the residues of amino acids 1 to X of Figure 79 (SEQ ID NO: 138), where X is any amino acid from 19 to 28 of Figure 79 (SEQ ID NO: 138), or is complementary • for such a coding nucleic acid sequence, and remains stably attached thereto conditions at least moderate, and optionally, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of DNA53996-1442 vector deposited on June 2, 1998, as ATCC 209921 which includes the nucleotide sequence that c or d i f i a a l P R07 8 3 In another embodiment, the invention provides the isolated PR0783 polypeptide. In particular, the The invention provides the polypeptide PR0783 of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 489 of Figure 79 (SEQ ID NO: 138). The additional modalities of this The invention is directed to PR0783 polypeptides • comprising amino acid 1 to approximately X of Figure 79 (SEQ ID NO: 138), where X is any amino acid from 19 to 28 of Figure 79 (SEQ ID NO: 138). Optionally, the polypeptide PR0783 is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the DNA53996-1442 vector deposited on 2 • June 1998, as ATCC 209921.

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA45201 comprising the nucleotide sequence of Figure 80 (SEQ ID NO: 139).

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA14575 comprising the nucleotide sequence of Figure 81 (SEQ ID NO: 140). • 31 PRO820 A cDNA clone (DNA56041-1416), which has sequence identity with the immunoglobulin Fc gamma receptors, which codes for a new polypeptide, designated in the present application as "PRO820". • In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO820 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about • 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO820 polypeptide having the sequence of the amino acid residues approximately from 1 or 16 to approximately 124, inclusive of Figure 83 (SEQ ID NO: 146), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, that is, 1-124, or in another embodiment, 16-124.

In another aspect, the invention relates to a • isolated nucleic acid molecule encoding a PRO820 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 115 or 160 and approximately 486 residues, inclusive, of Figure 82 (SEQ ID NO: 145). Preferably, hybridization occurs under severe washing and drying conditions.

• Hybridization.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Deposit No. 203021 (DNA56041-1416), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the • ATCC Deposit No. (DNA56041 - 1416).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least • about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from 1 or 16 to about 124, inclusive of Figure 83 (SEQ.

ID NO: 146), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO820 polypeptide having the sequence of amino acid residues so approximate from 1 or 16 to approximately 124, inclusive of Figure 83 (SEQ ID NO: 146), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95 percent sequence identity % with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 16 to about 124, inclusive of Figure 83 • (SEQ ID NO: 146), or (b) the DNA complement of In another embodiment, the invention provides the isolated PRO820 polypeptide encoded by any of the nucleic acid sequences • isolated defined herein above.

In a specific aspect, the invention provides the isolated native sequence PRO820 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 16 through 124 of Figure 83 (SEQ.

• NO: 146).

In another aspect, the invention relates to an isolated PRO820 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 6 16 up to • about 124, inclusive of Figure 83 (SEQ ID NO: 146).

In a further aspect, the invention relates to an isolated PRO820 polypeptide, which comprises a record of the amino acid sequence • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or 16 to 124 of Figure 83 (SEQ ID NO: 146). • In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO820 polypeptide having the sequence of the amino acid residues so approximates from 1 or 16 to approximately 124, inclusive of Figure 83 (SEQ ID NO: 146), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has the at least about 80% sequence identity, 5 preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of sequence with (a) or (b), (ii) cultivating a host cell or host that • comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. In still another embodiment, the invention relates to the agonists and antagonists of a • native PRO820 polypeptide. In a particular embodiment, the agonist or antagonist is a anti-PRO820 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO820 polypeptide, by contacting the native PRO820 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional modality, the • invention relates to a composition comprising a PRO820 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 10 • 32. PRO1080 A cDNA clone (DNA56047-1456) encoding a new polypeptide, designated in the present application as "PRO1080" has been identified. The PRO1080 polypeptides have sequence identity with DnaJ proteins.

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1080 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding a PRO1080 polypeptide having the sequence of amino acid residues roughly from 1 or 23 to about 358, inclusive of Figure 85 (SEQ ID NO: 148), or (b) the molecule's complement of DNA from (a). The term "or" as used herein is Refers to amino acids or nucleic acids and means that it refers to two alternative modalities provided in the present, that is, 1-358, or in another embodiment, 23-358. In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1080 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of Approximately between 159 or 225 and about 1235 residues, inclusive, of Figure 84 (SEQ ID NO: 147). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Repository No. 209948 (DNA56047-1456), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209948 (DNA56047-1,56). • In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 or 23 up to • about 358, inclusive of Figure 85 (SEQ ID NO: 148), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PRO1080 polypeptide having the sequence of amino acid residues roughly from 1 or 23 to about 358, inclusive of Figure 85 (SEQ ID NO: 148), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about • a sequence identity of 80%, preferably at least approximately one identity of % sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the DNA molecule from proof. In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PRO1080, with or without the N-terminal signal sequence and / or initiation methionine. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 22 of the amino acid in the sequence of Figure 85 (SEQ ID.

NO: 148). • In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about • 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or 23 to about 358, inclusive of Figure 85 (SEQ ID NO: 148), or (b) the DNA complement of In another embodiment, the invention provides the isolated PRO1080 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

• In a specific aspect, the invention provides the isolated native sequence PRO1080 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 23 through 358 of Figure 85 (SEQ.

NO: 148). • In another aspect, the invention relates to an isolated PRO1080 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at • less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 23 to about 358, inclusive of Figure 85 (SEQ ID NO: 148).

In a further aspect, the invention relates to an isolated PRO1080 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, • more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 23 to 358 of Figure 85 (SEQ ID NO: 148) . • Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that encodes a PRO1080 polypeptide having the sequence of the amino acid residues roughly from 1 or 23 to about 358, • inclusive of Figure 85 (SEQ ID NO: 148), or (b) the complement of the DNA molecule of (a), and if the The test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1080 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 080 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1080 polypeptide by contacting the native PRO1080 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1080 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier Pharmaco-pharmacistically In another embodiment, the invention provides an expressed sequence tag (EST) designated in • present as DNA36527 comprising the nucleotide sequence of Figure 86 (SEQ ID NO: 149). 33 PRO1079 A cDNA clone (DNA56050- 10 1455) encoding a new polypeptide, designated • in the present application as "PRO1079".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1079 polypeptide.

In one aspect, nucleic acid isolated • comprises DNA that has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding a PRO1079 polypeptide having the sequence of amino acid residues from about 30 to about 226, inclusive of Figure 88 (SEQ ID NO: 151), or (b) the complement of the DNA molecule of (a) ). • In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1079 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of approximately between 270 and about 860 • waste, inclusive, of Figure 87 (SEC ID NO: 150). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about • 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203011 (DNA56050-1455), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203011 (DNA56050-1455).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide • having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the residue sequence of • amino acids 30 to approximately 226, inclusive of Figure 88 (SEQ ID NO: 151), or the complement of the DNA of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides and Preferably at least about 100 nucleotides, and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1079 polypeptide having the sequence of • 5 amino acid residues approximately from 30 to about 226, inclusive of Figure 88 (SEQ ID NO: 151), or (b) the complement of the DNA molecule of (a), and, if the molecule DNA has at least approximately an identity of sequence of 80%, preferably at least • approximately a sequence identity of 85%, more preferably at least approximately a sequence identity of 90%, more preferably at least approximately one identity of 95% sequence with (a) or (b), isolate the test DNA molecule.

• In a specific aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1079 polypeptide, with or without the N-terminal signal sequence and / or initiation methionine. The signal peptide has tentatively been identified as extending from approximately position 1 of the amino acid to approximately position 29 of the amino acid in the sequence of the Figure (SEQ ID.

NO: 151 In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 30 to approximately 226, inclusive of Figure 88 (SEQ ID NO: 151), or (b) the DNA complement of (a). Another embodiment is directed to fragments of a sequence encoding the PRO1079 polypeptide • which can be used as hybridization probes. Such nucleic acid fragments are so approximates from 20 to about 80 nucleotides in length, preferably approximately 20 to approximately 60 nucleotides in length, more preferably from approximately 20 to approximately 50 nucleotides in length and more preferably approximately 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1079 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the sequence PRO1079 polypeptide • isolated native, which in one embodiment, includes an amino acid sequence comprising residues 30 to 226 of Figure 88 (SEQ ID NO: 151).

In another aspect, the invention relates to an isolated PRO1079 polypeptide, comprising an amino acid sequence having at least • approximately 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 30 to about 226, inclusive of Figure 88 (SEQ ID NO: 151).

In a further aspect, the invention relates to an isolated PRO1079 polypeptide, comprising an amino acid sequence record • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 30 to 226 # of Figure SEC. ID NO: 151).

In still another aspect, the invention relates to an isolated PRO1079 polypeptide, which comprises Sequence of amino acid residues 30 to approximately 226, inclusive of Figure 88 (SEQ ID NO: 151), or a sufficient fragment itself to • provide a binding site for an anti-PRO1079 antibody. Preferably, the PRO1079 fragment retains a qualitative biological activity of a native PRO1079 polypeptide.

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a DNA molecule under test • «-M-M-t-M-ib. -.- a-É-i-üÉ-É severe conditions with (a) a DNA molecule encoding a PRO1079 polypeptide having the sequence of the amino acid residues from about 30 to about 226, • inclusive of Figure 88 (SEQ ID NO: 151), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80% sequence identity , preferably at least about 85% of sequence identity, more preferably to the • less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell that comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the • cell culture. 34 PR0793 A cDNA clone (DNA56110-1437) encoding a new transmembrane polypeptide, designated in the present application as "PR0793" has been identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0793 polypeptide.

• In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, • most preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0793 polypeptide having the sequence of amino acid residues from about 1 to about 138, inclusive of Figure 90 (SEQ ID NO: 153), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0793 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 77 and about 490 nucleotides, inclusive, of Figure 89 ( SEC ID NO: 25 152). Preferably, hybridization occurs under severe washing and hybridization conditions In a further aspect, the invention relates to an isolated nucleic acid molecule that • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203113 (DNA56110-1437), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide Mature F encoded by the human protein cDNA in ATCC Deposit No. 203113 (DNA56110-1437). In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of Sequence with the sequence of amino acid residues 1 to about 138, inclusive of Figure 90 (SEQ ID NO: 153), or the DNA complement of (a).

In a further aspect, the invention is • refers to an isolated nucleic acid molecule having at least 10 nucleotides and that is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a PR0793 polypeptide having the sequence of amino acid residues from 1 to about 138, inclusive of Figure 90 (SEQ.

• ID NO: 153), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately a sequence identity of 80%, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least Approximately 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0793 polypeptide, with or without the initiating methionine, and its soluble, ie, inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The transmembrane domains have tentatively been identified as extending from about position 12 of the amino acid to about position 30 of the amino acid, from about position 33 of the amino acid to about position 52 of the amino acid, from about the position 69 of the amino acid to about position 89 of the amino acid and from about position 93 of the amino acid to about position 109 of the amino acid in the amino acid sequence of PR0793 (Figure 90, SEQ ID NO: 153).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 138, inclusive of Figure 90 (SEQ ID NO: 153), or (b) ) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PR0793 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in an approximate manner. from about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 89 (SEQ ID NO: 152).

In another embodiment, the invention provides the isolated PR0793 polypeptide encoded by any of the isolated nucleic acid sequences identified hereinbefore.

In a specific aspect, the invention provides the PR0793 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising waste 1 to approximately 138 of the • Figure 90 (SEC ID NO: 153).

In another aspect, the invention relates to an isolated PR0793 polypeptide, comprising a amino acid sequence having at least about 80% sequence identity, preferably at least about 85% ^ - sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 138, inclusive of Figure 90 (SEQ ID NO: 153).

In a further aspect, the invention is The invention relates to an isolated PR0793 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, 5 more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 138, inclusive of Figure 90 (SEQ ID NO: 153). • In yet another aspect, the invention relates to an isolated PR0793 polypeptide, comprising the sequence of amino acid residues 1 to about 138, inclusive of Figure 90 (SEQ ID NO: 153), or a sufficient fragment itself to provide a binding site for an antibody • anti-PR0793. Preferably, the PR0793 fragment retains a qualitative biological activity of a PR0793 polypeptide native.

Severe conditions with (a) a DNA molecule encoding a PR0793 polypeptide having the sequence of amino acid residues from about 1 to about 138, inclusive of Figure 90 (SEQ ID NO: 153), or (b) • the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA50177 comprising the nucleotide sequence of Figure 91 (SEQ ID NO: 154).

PRO1016 A cDNA clone (DNA56113-1378), which has sequence identity with the acyltransferases encoding a new polypeptide, designated in the present application as "PRO1016" has been identified.

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1016 polypeptide.

In one aspect, nucleic acid isolated comprises DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1016 polypeptide having the • sequence of the amino acid residues roughly from 1 or 19 to approximately 378, inclusive of Figure 93 (SEQ ID NO: 156), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two modalities alternatives provided in the present, that is, 1-37 in another modality, 19-37 In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1016 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 168 or 222 and approximately 1301 residues, inclusive, of Figure 92 ( SEC ID NO: 155). Preferably, hybridization occurs under severe hybridization wash conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203049 (DNA56113-1378), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203049 (DNA56113-1378). • In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least »About 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity The sequence with the sequence of the amino acid residues is approximately from 1 or 19 to approximately 378, inclusive of Figure 93 (SEQ.

^ ID NO: 156), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1016 polypeptide having the amino acid residue sequence so -ÉU-ri-il-É-itH-MII- ii-Mi-il-i approximated from 1 or 19 to approximately 378, inclusive of Figure 93 (SEQ ID NO: 156), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about • an 80% sequence identity, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about a sequence identity of 95% with (a) or (b), • isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule which comprises the DNA encoding a PRO1016 polypeptide, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, is • say, inactivated or deleted variants of the transmembrane domain, or is complementary to Such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 18 of the amino acid in the sequence of the Figure 93 (SEQ ID NO: 156). The transmembrane domains have tentatively been identified as extending from about position 305 of the amino acid to about position 330 of the amino acid and from about position 332 of the amino acid to about position 352 of the amino acid in the amino acid sequence of PRO1016 ( Figure 93, SEQ ID NO: 156).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or 19 to approximately 378, inclusive of Figure 93 (SEQ ID NO: 156), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PRO1016 polypeptide encoded by Any of the isolated nucleic acid sequences defined herein In a specific aspect, the invention provides the isolated native sequence PRO1016 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 19 through 378 of Figure 93 (SEQ ID NO: 156).

In another aspect, the invention relates to a • PRO1016 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with the sequence of amino acid residues 1 or 19 up to about 378, inclusive of Figure 93 (SEQ ID NO: 156).

In a further aspect, the invention relates to an isolated PRO1016 polypeptide, which comprises a record of the amino acid sequence of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive when compare with the amino acid sequence of residues 1 6 19 to 378 of Figure 93 (SEQ ID NO: 156).

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1016 polypeptide having the sequence of the amino acid residues roughly from 1 or 19 to about 378, inclusive of Figure 93 (SEQ ID NO: 156), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with ( a) or (b), (ii) cultivating a host cell or host that Y ^ ggg comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1016 polypeptide. In a particular embodiment, the agonist or antagonist is an anti i-PROl 016 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1016 polypeptide by contacting the native PRO1016 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1016 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 36 PRO1013 Applicants have identified a clone of CDNA encoding a new polypeptide having sequence identity with P120, wherein the • polypeptide is designated in the present application as "PRO1013".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1013 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO1013 polypeptide having amino acid residues 1 through 409 of Figure 95 (SEQ ID NO: 158), or is complementary to such Encoding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence can comprise the cDNA insert of the vector deposited on June 2, 1998 with the ATCC as DNA56410-1414 which includes the nucleotide sequence encoding PRO1013.

In another embodiment, the invention provides the isolated PRO1013 polypeptide. In particular, the invention provides the PRO1013 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 409 of Figure 95 (SEQ ID NO: 158). Optionally, the PRO1013 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the vector deposited on June 2, 1998 with the ATCC as DNA56410-1414. 10 • 37. PR0937 Applicants have identified a clone of CDNA encoding a new polypeptide that has homology with the proteins of the family of the glypican, wherein the polypeptide is designated in the present application as "PR0937".

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0937 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding PR0937 polypeptide having amino acid residues 1 through 556 of Figure 97 (SEQ ID NO: 160), or is complementary to such Encoding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding ^ P to PR0937 polypeptide having the amino acid residues from about 23 to 556 of Figure 97 (SEQ ID NO: 160), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under conditions at least moderate, and optionally, under highly severe conditions. The isolated nucleic acid sequence may comprise the cDNA insert of vector DNA56436-1448 deposited on May 27, 1998 as ATCC 209902 on which includes the nucleotide sequence encoding PR0937.

In another embodiment, the invention provides the isolated PR0937 polypeptide. In particular, the The invention provides PR0937 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 556 of Figure 97 (SEQ ID NO: 160). The additional modalities of this The invention relates to PR0937 polypeptides comprising amino acids 23 to 556 of Figure 97 (SEQ ID NO: 160). Optionally, PR0937 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the insert • cDNA of vector DNA56436- 1448 deposited on May 27, 1998 with the ATCC as 209902 38 PR0842 A cDNA clone (DNA56855-101447) encoding a new secreted polypeptide, designated in the present application as "PR0842" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0842 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding a PR0842 polypeptide having the sequence of amino acid residues roughly from 23 to about 119, inclusive of Figure 99 (SEQ ID NO: 165), or (b) the complement of the DNA molecule of (to) . • In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0842 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of approximately between 219 and approximately 509 • waste, inclusive, of Figure 98 (SEQ ID NO: 164). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203004 (DNA56855-1447), or (b) the complement of the DNA molecule molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203004 (DNA56855-1447).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from about 23 to about 119, inclusive of Figure 99 (SEQ.

ID NO: 165), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and Preferably at least about 100 nucleotides, and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0842 polypeptide having the sequence of amino acid residues approximately 23 up to about 119, inclusive of Figure 99 (SEQ ID NO: 165), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about a 10 sequence identity 80%, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

• In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0842 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, ie , inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. He Signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 22 of the amino acid in the sequence of the amino acid.

• Figure 99 (SEC ID NO: 165).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 23 to about 119, inclusive of Figure 99 (SEQ ID NO: 165), or (b) the DNA complement of (a).

Another embodiment is directed to fragments 20 of a sequence encoding PR0842 polypeptide which may find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length. approximate way from 20 up • approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR0842 polypeptide encoded by any of the nucleic acid sequences isolated defined in the present above. • In a specific aspect, the invention provides the PR0842 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 23 to 119 of Figure 99 (SEQ ID NO: 165).

• In another aspect, the invention relates to an isolated PR0842 polypeptide, comprising a Amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of residues 23 to about 119, inclusive of Figure 99 (SEQ ID NO: 165).

• In a further aspect, the invention relates to an isolated PR0842 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least approximately • 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 23 to 119 of Figure 99 (SEQ ID NO: 165). In still another aspect, the invention relates to an isolated PR0842 polypeptide, comprising • sequence of amino acid residues 23 to approximately 119, inclusive of Figure 99 (SEQ ID NO: 165), or a sufficient fragment itself to provide a binding site for an anti-PR0842 antibody. Preferably, the PR0842 fragment retains a qualitative biological activity of a native PR0842 polypeptide. Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that • 5 encodes a PR0842 polypeptide having the sequence of amino acid residues roughly from 23 to about 119, inclusive of Figure 99 (SEQ ID NO: 165), or (b) the complement of the DNA molecule of (a), and if the DNA test molecule has at least • approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by growing a host cell or host that • comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

PR0839 A cDNA clone (DNA56859-254545) encoding a new polypeptide, designated in the present application as "PR0839" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising • the DNA encoding a PR0839 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding a PR0839 polypeptide having the sequence of amino acid residues approximately from about 24 to about 87, • inclusive of Figure 101 (SEQ ID NO: 167), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0839 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of Approximately between 71 and about 262 residues, inclusive, of Figure 100 (SEQ ID NO: 166). Preferably, hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203019 (DNA56859- 1445), or (b) the complement of the DNA molecule molecule of • (to) . In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide mature encoded by the cDNA of the human protein in ATCC Deposit No. 203019 (DNA56859-1445).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide - * -_- • - • - • which has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from about 24 to about 87, inclusive of Figure 101 (SEQ ID NO: 167) , or (b) the DNA complement of (a).

• In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and Preferably at least about 100 nucleotides, and which is produced by hybridizing a DNA test molecule under severe conditions • with (a) a DNA molecule encoding a PR0839 polypeptide having the sequence of amino acid residues approximately from about 24 to about 87, inclusive of Figure 101 (SEQ ID NO: 167), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately an identity of sequence of 80%, preferably at least .ata- .. • ^ m ^ n.? . ^. - - approximately an identity of sequence of 85%, more preferably at least approximately a sequence identity of 90%, more preferably at least approximately an identity of • 95% sequence with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide • PR0839, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, ie, inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from approximately • position 1 of the amino acid to approximately position 23 of the amino acid in the sequence of the Figure 101 (SEQ ID NO: 167).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 24 up to about 87, except for Figure 101 (SEQ ID NO: 167), or (b) the DNA complement of (a).

Another modality is directed to fragments of a sequence encoding PR0839 polypeptide • which can find use as hybridization probes. Such nucleic acid fragments are proximately from 20 to about 80 nucleotides in length, preferably approximately from 20 to about 60 nucleotides in length, more preferably from about 20 to • approximately 50 n lengths, and most preferably approximately from 20 to approximately 40 nu < leotomes of length.

In another embodiment, the invention provides the isolated PRO 339 polypeptide encoded by any of the nucleic acid sequences. isolates defined herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR0839, which in one embodiment, includes an amino acid sequence comprising residues 24 to 87 of Figure 101 (SEQ ID NO: 167).

In another aspect, the invention relates to an isolated PR0839 polypeptide, comprising a amino acid sequence that has at least F about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of residues 24 to about 87, inclusive F of Figure 101 (SEQ ID NO: 167).

In a further aspect, the invention relates to an isolated PR0839 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 24 to 87 of Figure 101 (SEQ ID NO: 167). • In yet another aspect, the invention relates to an isolated PR0839 polypeptide, comprising the sequence of amino acid residues 24 to about 87, inclusive of Figure 101 (SEQ.

ID NO: 167), or a sufficient fragment itself to • provide a binding site for an anti-PR0839 antibody. Preferably, the PR0839 fragment retains a qualitative biological activity of a native PR0839 polypeptide. Still in a further aspect, the invention provides a polypeptide produced (i) • hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a PR0839 polypeptide having the sequence of the amino acid residues approximately from about 24 to about 87, inclusive of Figure 101 (SEQ ID NO: 167), or (b) the complement of the DNA molecule of (FIG. a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , • more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from • cell culture. 40 PRO1180 Applicants have identified a clone of cDNA (DNA56860-1510) having homology with the enzymes of meth i lt rans ferase that encode the nucleic acid, which encodes a new polypeptide, • designated in the present application as "PRO1180".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1180 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1180 polypeptide having the amino acid residue sequence from about 1 or approximately 24 to approximately 277, inclusive of Figure 103 • (SEQ ID NO: 169), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1180 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between • approximately 78 or approximately 147 and approximately 908 nucleotides, inclusive, of Figure 102 (SEQ ID NO: 168). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 209952 (DNA56860-1510). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209952 (DNA56860-1510). In still a further aspect, the invention relates to an isolated nucleic acid molecule • comprising the DNA encoding a polypeptide having at least about 80% identity of Sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity, Sequence with the sequence of amino acid residues 1 or approximately 24 to approximately 277, inclusive of Figure 103 (SEQ ID NO: 169).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1180 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary for such a coding nucleic acid molecule. He • Signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 23 of the amino acid in the sequence of the Figure 103 (SEQ ID NO: 169).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising the DNA encoding a polypeptide at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or roughly 24 to about 277, inclusive of Figure 103 (SEQ ID NO: 169 Another embodiment is directed to fragments of a sequence encoding the PRO1180 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length. Approximately from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1180 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the isolated native sequence PRO1180 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 24 to approximately 277 of Figure 103 (SEQ ID NO 169) ).

In another aspect, the invention relates to an isolated PRO1180 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 24 to about 277, inclusive of the Figure 103 (SEQ ID NO: 169).

In a further aspect, the invention is • refers to an isolated PRO1180 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 24 to approximately 277, inclusive of Figure 103 (SEQ ID NO: 169).

In still another aspect, the invention relates to an isolated PRO1180 polypeptide, comprising the sequence of amino acid residues 1 or approximately 24 to about 277, inclusive of Figure 103 (SEQ ID NO: 169), or a fragment sufficient to provide a binding site for an anti-i-PROl 180 antibody. • Preferably, the PRO1180 fragment retains a qualitative biological activity of a native PRO1180 polypeptide.

In another aspect, the present invention is directed to fragments of a PRO1180 polypeptide that are long enough to provide an epitope against which an antibody can be generated. In still another embodiment, the invention relates to the agonists and antagonists of a PRO1180 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1180 antibody.

In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of a polypeptide.

• PRO1180 native.

Still in a further embodiment, the invention relates to a composition comprising a PRO1180 polypeptide, or an agonist or antagonist as defined herein above, in • combination with a pharmaceutically acceptable carrier.

PR01134 15 A cDNA clone (DNA56865-1491) encoding a new secreted polypeptide, designated in the present application as "PR01134" has been identified.

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01134 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule encoding a PR01134 polypeptide having the amino acid residue sequence from about 1 or approximately 24 to about 371, inclusive of Figure 105 (SEQ ID NO: 171), or (b) the complement of the • DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR01134 polypeptide comprising the DNA that hybridizes to the complement of the nucleic acid between approximately 153 or approximately 222 and • about 1265 nucleotides, inclusive, of Figure 104 (SEQ ID NO: 170). Preferably, the Hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • 5 most preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203022 (DNA56865-1491), or (b) 10 the complement of the nucleic acid molecule of # (to) . In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203022 (DNA56865-1491). In still a further aspect, the invention relates to an isolated nucleic acid molecule • comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of Sequence with the sequence of amino acid residues 1 or approximately 24 to about 371, inclusive of Figure 105 (SEQ ID NO: 171), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a low test DNA molecule. severe conditions with (a) a DNA molecule that • encodes a PR01134 polypeptide having the sequence of amino acid residues from 1 or approximately 24 to about 371, inclusive of Figure 105 (SEQ ID NO: 171), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, so • preferably at least approximately a sequence identity of 85%, more preferably at least approximately a sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01134 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a molecule. encoding nucleic acid. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 23 of the amino acid in the sequence of the Figure 105 (SEQ ID NO: 171). • In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about • 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 24 to about 371, inclusive of Figure 105 (SEQ ID NO: 171), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01134 polypeptide that can be used as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length. approximately from 20 to about 40 • Nucleotides of length and can be derived from the nucleotide sequence shown in Figure 104 (SEQ ID NO: 170).

In another embodiment, the invention provides the isolated PR01134 polypeptide encoded by any of the nucleic acid sequences • isolates identified in the present above.

In a specific aspect, the invention provides the PR01134 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 24 to about 371 of Figure 105 (SEQ ID NO: 171) In another aspect, the invention relates to an isolated PR01134 polypeptide, comprising a • amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least approximately • 95% sequence identity with the sequence of amino acid residues 1 or approximately 24 to about 371, inclusive of Figure 105 (SEQ ID NO: 171). In a further aspect, the invention relates to an isolated PR01134 polypeptide, which • comprises a record of the amino acid sequence of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 24 to about 371, inclusive of Figure 105 (SEQ ID NO: 171) In still another aspect, the invention relates to an isolated PR01134 polypeptide, which comprises • sequence of amino acid residues 1 or approximately 24 to about 371, inclusive of Figure 105 (SEQ ID NO: 171), or a sufficient fragment itself to provide a binding site for an anti-HIV antibody. 13 Preferably, the PR01134 fragment retains a • Qualitative biological activity of a native PR01134 polypeptide.

Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that • encodes a PR01134 polypeptide that has the sequence of amino acid residues from approximately 1 or approximately 24 to approximately 371, inclusive of Figure 105 (SEQ ID NO: 171), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one identity 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity • sequence with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. • In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA52352 comprising the nucleotide sequence of SEQ. ID NO: 172 (see Figure 106).

In another embodiment, the invention provides • an expressed sequence tag (EST) designated herein as DNA55725 comprising the sequence nucleotides of the SEC. ID NO: 173 (see Figure 107). 42 PRO830 A cDNA clone DNA56866- 1342) which codes for a new secreted polypeptide, designated in the present application as "PRO830" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising • the DNA encoding a PRO830 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of DNA encoding a PRO830 polypeptide having the amino acid residue sequence from about 1 or approximately 34 up to • approximately 87, inclusive of Figure 109 (SEQ ID NO: 175), or (b) the molecule complement of DNA from (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO830 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between approximately 154 or approximately 253 and approximately 414 nucleotides, inclusive, of Figure 108 (SEQ ID NO: 174). Preferably, hybridization occurs under severe conditions of • washing and hybridization.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the • ATCC Deposit No. 203023 (DNA56866- 1342), or (b) the complement of the nucleic acid molecule of a) . In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203023 (DNA56866-1342).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least • about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the 10 amino acid residues 1 or so approximate 34 up • about 87, inclusive of Figure 109 (SEQ ID NO: 175), or (b) the DNA complement of (a).

In a further aspect, the invention is refers to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a low test DNA molecule. • severe conditions with (a) a DNA molecule that encodes a PRO830 polypeptide that has the Sequence of amino acid residues from 1 or approximately 34 to approximately 87, inclusive of Figure 109 (SEQ ID NO: 175), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about a sequence identity of 80%, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about • a 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide F PRO830, with or without the N-terminal signal sequence and / or the initiation methionine, or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 33 of the amino acid in the sequence of the • Figure 109 (SEC ID NO: 175).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or roughly 34 to about 87, • 5 inclusive of Figure 109 (SEQ ID NO: 175), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PRO830 polypeptide which can be used as hybridization probes.

• Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60. nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in • approximate manner from 20 to approximately 40 nucleotides in length and can be derived from the The nucleotide sequence shown in Figure 108 (SEQ ID NO: 174).

In another embodiment, the invention provides the isolated PRO830 polypeptide encoded by Any of the isolated nucleic acid sequences identified hereinbefore.

In a specific aspect, the invention provides the sequence PRO830 polypeptide • isolated native, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 34 to approximately 87 of Figure 109 (SEQ ID NO: 175). • In another aspect, the invention relates to an isolated PRO830 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, ^ ff more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 34 to about 87, inclusive of Figure 109 (SEQ ID NO: 175).

In a further aspect, the invention relates to an isolated PRO830 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about • 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 34 to approximately 87, inclusive of Figure 109 (SEQ ID NO: 175). • In still another aspect, the invention relates to an isolated PRO830 polypeptide, comprising the sequence of amino acid residues 1 or approximately 34 to about 87, inclusive of Figure 109 (SEQ ID NO: 175), or a sufficient fragment itself to provide a binding site for an anti-PRO830 antibody. Preferably, the PRO830 fragment retains a qualitative biological activity of a polypeptide PRO830 native.

Severe conditions with (a) a DNA molecule encoding a PRO830 polypeptide having the sequence of the amino acid residues from about 1 or approximately 34 to about 87, inclusive of Figure 109 (SEQ ID NO: 175) , or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the Test DNA under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

PR01115 A cDNA clone (DNA56868-1478) encoding a new transmembrane polypeptide, designated in the present application as "PR01115" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01115 polypeptide.

In one aspect, nucleic acid isolated • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01115 polypeptide having the amino acid residue sequence roughly from 21 to about 445, inclusive of Figure 111 (SEQ ID NO: 177), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR01115 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 249 and approximately 1523 residues, inclusive, of Figure 110 (SEQ ID NO: 176). Preferably, the hybridization occurs' low severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203024 (DNA56868-1478), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203024 (DNA56868-1478).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from about 21 to about 445, inclusive of the Figure 111 (SEQ ID NO: 177), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides and preferably at least about 100 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01115 polypeptide having the sequence of amino acid residues roughly from 21 to about 445, inclusive of Figure 111 (SEQ ID NO: 177), or (b) the complement of the DNA of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about one sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01115 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and one or more of its domains. inactivated or deleted transmembrane, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 20 of the amino acid in the sequence of Figure 111 (SEQ ID NO: 177). The transmembrane domains have tentatively been identified as extending from approximately positions 35-54, 75-97, 126-146, 185-204, 333-350 and 352-371 in the amino acid sequence of PR01115 (Figure 111, • SEQ ID NO: 177).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 21 to about 445, inclusive of Figure 111 (SEQ ID NO: 177), or (b) ) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01115 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01115 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01115, which in one embodiment, includes an amino acid sequence comprising residues 21 to 445 of Figure 111 (SEQ ID NO: 177).

In another aspect, the invention relates to an isolated PR01115 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 21 to about 445, inclusive of Figure 111 (SEQ ID NO: 177).

In a further aspect, the invention relates to an isolated PR01115 polypeptide, comprising a sequence of the amino acid sequence of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 21 to 445 of Figure 111 (SEQ ID NO: 177).

In yet another aspect, the invention relates to an isolated PR01115 polypeptide, comprising the sequence of amino acid residues 21 to about 445, inclusive of Figure 111 (SEQ ID NO: 177), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 115 antibody. Preferably, the PR01115 fragment retains a qualitative biological activity of a native PR01115 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) • hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01115 polypeptide having the sequence of the amino acid residues in a manner approximate from 21 to about 445, inclusive of Figure 111 (SEQ ID NO: 177), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a ) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the culture. cell phone 44. PR01277 A cDNA clone (DNA56869-1545) encoding a new polypeptide having homology with Coch-5B2 has been identified and is designated in the present application as "PR01277".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01277 polypeptide.

In one aspect, the nucleic acid isolated. comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% % sequence identity αfc with (a) a DNA molecule encoding a PR01277 polypeptide having the sequence of amino acid residues roughly from 27 to about 678, inclusive of Figure 113 (SEQ ID NO: 179), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01277 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 266 and about 2221 residues, inclusive, of Figure 112 (SEQ. ID NO: (? 178) Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Repository No. 203161 (DNA56869-1545), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203161 (DNA56869-1545).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 27 to about 678, inclusive of the Figure 113 (SEQ ID NO: 179), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides, and which is produced by hybridizing a DNA test molecule under severe conditions with (a ) a DNA molecule encoding a PR01277 polypeptide having the sequence of amino acid residues roughly from 27 to about 678, inclusive of Figure 113 (SEQ ID NO: 179), or (b) the molecule's complement DNA of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about one identity of 90% sequence, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01277 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e. inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 26 of the amino acid in the sequence of Figure 113 (SEQ ID NO: 179). The transmembrane domain has tentatively been identified as extending from about position 181 of the amino acid to about position 200 of the amino acid in the amino acid sequence of PR01277 (Figure 113, SEQ ID NO: 179).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 27 to about 678, inclusive of Figure 113 • (SEQ ID NO: 179), or ( b) the DNA complement of Another embodiment is directed to fragments of a sequence encoding PR01277 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length. Approximately from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01277 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PR01277 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 27 to 678 of Figure 113 (SEQ ID NO: 179).

In another aspect, the invention relates to an isolated PR01277 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 27 to about • 678, inclusive of Figure 113 (SEQ ID NO: 179) .

In a further aspect, the invention relates to an isolated PR01277 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 27 to 678 of Figure 113 (SEQ ID NO: 179).

In still another aspect, the invention relates to an isolated PR01277 polypeptide, comprising the sequence of amino acid residues 27 through - approximately 678, inclusive of Figure 113 (SEQ ID NO: 179), or a sufficient fragment itself to provide a binding site for an anti i-PROl 277 antibody. Preferably, the PR01277 fragment retains a qualitative biological activity of a native PR01277 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01277 polypeptide having the sequence of the amino acid residues roughly from 27 to about 678, inclusive of Figure 113 (SEQ ID NO: 179), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one identity 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host cell or host comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the culture lular.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01277 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 277 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01277 polypeptide by contacting the native PR01277 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01277 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 45 PR01135 Applicants have identified a clone of CDNA encoding a new polypeptide having homology to alpha 1, 2 -mannos ida sa, wherein the polypeptide is designated in the present application as "PR01135".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01135 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PR01135 polypeptide having amino acid residues 1 to 541 of Figure 115 (SEQ ID NO: 181), or is complementary to such a coding nucleic acid sequence, and remains stably bound thereto under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding the PR01135 polypeptide having the amino acid residues from about 22 to 541 of Figure 115 (SEQ ID NO: 181), or is complementary to such a coding nucleic acid sequence , and remains stably attached to it under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA56870-1492 vector deposited on June 2, 1998, as ATCC 209925 which includes the nucleotide sequence encoding PR01135.

In another embodiment, the invention provides the isolated PR01135 polypeptide. In particular, the invention provides the PR01135 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 541 of Figure 115 (SEQ ID NO: 181). Additional embodiments of the present invention are directed to PR01135 polypeptides comprising amino acids 22 to 541 of Figure 115 (SEQ ID NO: 181). Optionally, the PR01135 polypeptide is obtained or can be obtained by expression of the polypeptide encoded by the cDNA insert of the DNA56870-1492 vector deposited on June 2, 1998, as ATCC 209925. 46 PR01114 A cDNA clone (DNA57033-1403) encoding a new interferon receptor polypeptide, designated in the present application as "interferon receptor PR01114" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding an interferon PROl 114 receptor polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , more preferably at least about 95% sequence identity with (a) a DNA molecule encoding an interferon receptor polypeptide PR01114 having the amino acid residue sequence from about 1 or from about 30 to about 311 , inclusive of Figure 117 (SEQ ID NO: 183), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01114 interferon receptor polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 250 or about 337 and about 1182 nucleotides, inclusive, of Figure 116 (SEQ ID NO: 182). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .209905 (DNA57033-1403), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209905 (DNA57033-1403).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of residues 1 or approximately 30 to about 311, inclusive of the Figure 117 (SEQ ID NO: 183), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a receptor polypeptide of interferon PR01114 having the sequence of the amino acid residues from 1 or approximately 30 to about 311, inclusive of Figure 117 (SEQ ID NO: 183), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about a sequence identity of 85%, more preferably at least approximately a sequence identity of 90%, more preferably at least approximately a sequence identity of 95% with (a) or (b), isolating the molecule from DNA test.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide 'of the interferon receptor PR01114, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble , ie, the inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 29 of the amino acid in the sequence of Figure 117 (SEQ ID NO: 183). The transmembrane domain has tentatively been identified as extending from about position 230 of the amino acid to about position 255 in the amino acid sequence of the interferon receptor PR01114 (Figure 117, SEQ ID NO: 183).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 30 to approximately 311, inclusive of Figure 117 (SEQ ID NO: 183), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the interferon receptor PR01114 polypeptide which can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 116 (SEQ ID NO: 182).

In another embodiment, the invention provides the isolated PR01114 interferon receptor polypeptide, encoded by any of the isolated nucleic acid sequences identified in the present invention. In a specific aspect, the invention provides the sequence interferon PR01114 receptor polypeptide. isolated native, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 30 to approximately 311 of Figure 117 (SEQ ID NO: 183).

In another aspect, the invention relates to an isolated PR01114 interferon receptor polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 30 to about 311, inclusive of Figure 117 (SEQ ID NO: 183).

In a further aspect, the invention relates to an isolated PR01114 interferon receptor polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 30 to about 311, inclusive of Figure 117 (SEQ ID NO: 183 ).

In yet another aspect, the invention relates to an isolated PR01114 interferon receptor polypeptide, comprising the sequence of amino acid residues 1 or approximately 30 to about 311, inclusive of Figure 117 (SEQ ID NO: 183). ), or a fragment sufficient to provide a binding site for an antibody to the interferon ant i-PROl receptor 114. Preferably, the interferon receptor fragment PR01114 retains a qualitative biological activity of a polypeptide of the native interferon PR01114 receptor.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01114 interferon receptor polypeptide having the sequence of the residues of amino acids approximately from 1 or approximately 30 to approximately 311, inclusive of Figure 117 (SEQ ID NO: 183), or (b) the complement of the DNA molecule of (a), and if the Test DNA has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% % sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for the expression of the polypeptide tide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to the agonists and antagonists of a native PR01114 interferon receptor polypeptide. In a particular embodiment, the agonist or antagonist is an antibody to the interferon ant i-PROl 114 receptor.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01114 interferon receptor polypeptide by contacting the native PR01114 interferon receptor polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising an interferon receptor polypeptide PR01114, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier.

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA48466 comprising the nucleotide sequence of SEQ. ID NO: 184 (see Figure 118). 47 PR0828 Applicants have identified a clone of CDNA encoding a new polypeptide that has homology with glutathione peroxidases, wherein the polypeptide is designated in the present application as "PR0828". In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0828 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding PR0828 polypeptide having amino acid residues 1 to 187 of Figure 120 (SEQ ID NO: 189), or is complementary to such a coding nucleic acid sequence, and remains stably bound thereto under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding the PR0828 polypeptide having the amino acid residues from about 22 to 187 of Figure 120 (SEQ ID NO: 189), or is complementary to such a coding nucleic acid sequence , and remains stably attached to it under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence can comprise the cDNA insert of vector DNA57037-144 deposited on May 27, 1998 as ATCC 209903 which includes the nucleotide sequence encoding PR0828.

In another embodiment, the invention provides the isolated PR0828 polypeptide. In particular, the invention provides PR0828 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 187 of Figure 120 (SEQ ID NO: 189). Additional embodiments of the present invention are directed to PR0828 polypeptides comprising amino acids about 22 to 187 of the. Figure 120 (SEQ ID NO: 189). Optionally, the PR0828 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the vector DNA57037-1444 deposited on May 27, 1998, as ATCC 209903. 48. PRO1009 A cDNA clone (DNA57129-1413), which has sequence identity with a homologue of long chain acyl-CoA synthetase, a long chain acyl-CoA synthetase and a long chain acyl-CoA synthetase ligase, has been identified. encoding a new polypeptide, designated in the present application as "PRO1009".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1009 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1009 polypeptide having the sequence of amino acid residues roughly from 1 or 23 to about 615, inclusive of Figure 122 (SEQ ID NO: 194), or (b) the complement of the DNA molecule of (a). The term as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, i.e., 1-615 or 23-615.

• In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1009 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 41 or 107 and approximately 1885 residues, inclusive, of Figure 121 (SEQ ID NO: 193). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209977 (DNA57129-1413), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209977 (DNA57129-1413).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 or 23 to about 615, inclusive of Figure 122 (SEQ ID NO: 194), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1009 polypeptide having the sequence of amino acid residues so approximate from 1 or 23 to approximately 615, inclusive of Figure 122 (SEQ ID NO: 194), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b) ), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1009 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e. inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 22 of the amino acid in the sequence of Figure 122 (SEQ ID NO: 194). Transmembrane domains have tentatively been identified as extending from about amino acid positions 140-161, 213-229 and 312-334 in the amino acid sequence of PRO1009 (Figure 122, SEQ ID NO: 194).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 23 to approximately 615, inclusive of the Figure 122 (SEQ ID NO: 194), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PRO1009 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO1009 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 23 through 615 of Figure 122 (SEQ ID NO: 19).

In another aspect, the invention relates to an isolated PRO1009 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or 23 to about 615, inclusive of Figure 122 (SEQ ID NO: 194).

In a further aspect, the invention relates to an isolated PRO1009 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 23 to 615 of Figure 122 (SEQ ID NO: 194).

In still another aspect, the invention relates to an isolated PRO109 polypeptide, comprising the sequence of amino acid residues 1 or 23 to about 615, inclusive of Figure 122 (SEQ ID NO: 194), or a sufficient fragment thereof to provide a binding site for an anti-i-PROl 009 antibody. Preferably, the PRO1009 fragment retains a qualitative biological activity of a PRO1009 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01009 polypeptide having the sequence of the amino acid residues roughly from 1 or 23 to about 615, inclusive of Figure 122 (SEQ ID NO: 194), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with ( a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the culture polypeptide. ivo cellular.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1009 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 009 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1009 polypeptide by contacting the native PRO1009 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1009 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier.

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA50853 comprising the nucleotide sequence of Figure 123 (SEQ ID NO: 195). 49 PRO1007 Applicants have identified a clone of CDNA encoding a new polypeptide having sequence identity with MAGPIAP, wherein the polypeptide is designated in the present application as "PRO1007".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1007 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO1007 polypeptide having amino acid residues 1 through 346 of Figure 125 (SEQ ID NO: 197), or is complementary to such a coding nucleic acid sequence, and remains stably bound thereto under at least moderate conditions, and optionally, under highly stringent conditions. The isolated nucleic acid sequence can comprise the cDNA insert of the vector deposited on June 9, 1998 with the ATCC as DNA57690-1374 which includes the nucleotide sequence encoding PRO1007.

In another embodiment, the invention provides the isolated PRO1007 polypeptide. In particular, the invention provides the PRO1007 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 346 of Figure 125 (SEQ ID NO: 197). A further embodiment of the present invention is directed to an isolated extracellular domain of a PRO1007 polypeptide. Optionally, the PRO1007 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the vector deposited with the ATCC on June 9, 1998 as DNA57690-1374. 50. PRO1056 A cDNA clone (DNA57693-1424), which has homology to the nucleic acid encoding a chlorine channel protein encoding a new polypeptide, designated in the present application as "PRO1056" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1056 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1056 polypeptide having the amino acid residue sequence from about 1 or about 19 to about 120, inclusive of the Figure 127 (SEQ ID NO: 199), or (b) the complement of the DNA molecule of (a In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1056 polypeptide comprising the DNA that hybridizes to the complement of the nucleic acid between about 56 or about 110 and about 415 nucleotides, inclusive, of Figure 126 (SEQ ID NO: 198). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203008 (DNA57693-1424), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203008 (DNA57693-1424).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 19 to about 120, inclusive of the Figure 127 (SEQ ID NO: 199), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1056 polypeptide that has the sequence of amino acid residues from 1 or approximately 19 to about 120, inclusive of Figure 127 (SEQ ID NO: 199), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1056 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e. inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 18 of the amino acid in the sequence of Figure 127 (SEQ ID NO: 199). The transmembrane domain has tentatively been identified as extending from about position 39 of the amino acid to about position 58 of the amino acid in the amino acid sequence of PRO1056 (Figure 127, SEQ ID NO: 199).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 19 to about 120, inclusive of Figure 127 (SEQ ID NO: 199), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PRO1056 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 to approximately 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in an approximate manner from 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in that of Figure 126 (SEQ ID NO: 198).

In another embodiment, the invention provides the isolated PRO1056 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PRO1056 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 19 to about 120 of Figure 127 (SEQ ID NO: 199).

In another aspect, the invention relates to an isolated PRO1056 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 19 to about 120, inclusive of Figure 127 (SEQ ID NO. : 199).

In a further aspect, the invention relates to an isolated PRO1056 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 19 to about 120, inclusive of Figure 127 (SEQ ID NO: 199).

In still another aspect, the invention relates to an isolated PRO1056 polypeptide, comprising the sequence of amino acid residues 1 or approximately 19 to about 120, inclusive of Figure 127 (SEQ ID NO: 199), or a fragment sufficient to provide a binding site for an anti i-PROl 056 antibody. Preferably, the PRO1056 fragment retains a qualitative biological activity of a native PRO1056 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1056 polypeptide having the sequence of the amino acid residues roughly from 1 or approximately 19 to about 120, inclusive of Figure 127 (SEQ ID NO: 199), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of sequence with (a) or (b), (ii) by culturing a host or host cell comprising the DNA molecule • test under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention is refers to the agonists and antagonists of a • native PRO1056 polypeptide, In a particular embodiment, the agonist or ant agonist is an anti-i-PROl 056 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1056 polypeptide, • contacting the native PRO1056 polypeptide with a candidate molecule and monitoring a Biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1056 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier.

PR0826 A cDNA clone (DNA57694-1341) encoding a new secreted polypeptide, designated in the present application as "PR0826" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0826 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0826 polypeptide having the amino acid residue sequence from about 1 or from about 23 to about 99, inclusive of the Figure 129 (SEQ ID NO: 201), or (b) the complement of the DNA molecule of (a In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0826 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 13 or about 79 and about 309 nucleotides, inclusive, of Figure 128 (SEC ID NO: 200). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203017 (DNA57694-1341), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203017 (DNA57694-1341).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 23 to about 99, inclusive of Figure 129 (SEQ ID NO: 201), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0826 polypeptide which has the sequence of amino acid residues from 1 or approximately 23 to about 99, inclusive of Figure 129 (SEQ ID NO: 201), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0826 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 22 of the amino acid in the sequence of Figure 129 (SEQ ID NO: 201).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 23 to about 99, inclusive of Figure 129 (SEQ ID NO: 201) ), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR0826 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in an approximate manner. from about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 128 (SEQ ID NO: 200).

In another embodiment, the invention provides the isolated PR0826 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR0826, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 23 to approximately 99 of Figure 129 (SEQ ID NO: 201).

In another aspect, the invention relates to an isolated PR0826 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 23 to about 99, inclusive of Figure 129 (SEQ ID NO. : 201).

In a further aspect, the invention relates to an isolated PR0826 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 23 to about 99, inclusive of Figure 129 (SEQ ID NO: 201).

In yet another aspect, the invention relates to an isolated PR0826 polypeptide, comprising the sequence of amino acid residues 1 or approximately 23 to about 99, inclusive of Figure 129 (SEQ ID NO: 201), or a fragment sufficient to provide a binding site for an anti-PR0826 antibody. Preferably, the PR0826 fragment retains a qualitative biological activity of a native PR0826 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0826 polypeptide having the sequence of amino acid residues from about 1 or approximately 23 to about 99, inclusive of Figure 129 (SEQ ID NO: 201), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide gone from cell culture. 52 PR0819 A cDNA clone (DNA57695-1340) encoding a new secreted polypeptide, designated in the present application as "PR0819" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0819 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0819 polypeptide having the sequence of amino acid residues from about 1 or about 25 to about 52, inclusive of the Figure 131 (SEQ ID NO: 203), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0819 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 46 or about 118 and about 201 nucleotides, inclusive, of Figure 130 (SEQ ID NO: 202). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203006 (DNA57695-1340), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203006 (DNA57695-1340).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 25 to about 52, inclusive of Figure 131 (SEQ ID NO: 203), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0819 polypeptide which has the sequence of amino acid residues from 1 or approximately 25 to about 52, inclusive of Figure 131 (SEQ ID NO: 203), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0819 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 24 of the amino acid in the sequence of Figure 131 (SEQ ID NO: 203).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 25 to about 52, inclusive of Figure 131 (SEQ ID NO: 203), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR0819 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in an approximate manner. from about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 130 (SEQ ID NO: 202).

In another embodiment, the invention provides the isolated PR0819 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR0819, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 25 to about 52 of Figure 131 (SEQ ID NO: 203).

In another aspect, the invention relates to an isolated PR0819 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 25 to about 52, inclusive of Figure 131 (SEQ ID NO. : 203).

In a further aspect, the invention relates to an isolated PR0819 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 25 to about 52, inclusive of Figure 131 (SEQ ID NO: 203).

In still another aspect, the invention relates to an isolated PR0819 polypeptide, comprising the sequence of amino acid residues 1 or approximately 25 to about 52, inclusive of Figure 131 (SEQ ID NO: 203), or a fragment sufficient to provide a binding site for an anti-PR0819 antibody. Preferably, the PR0819 fragment retains a qualitative biological activity of a native PR0819 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0819 polypeptide having the sequence of amino acid residues from about 1 or approximately 25 to about 52, inclusive of Figure 131 (SEQ ID NO: 203), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (n) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (m) recovering the polypeptide of cell culture. 53. PRO1006 A cDNA clone (DNA57699-1412), having sequence identity with the virud protein which is considered a tyrosine kinase protein, which encodes a new polypeptide, designated in the present application as "PRO1006" in one embodiment, has been identified. The invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1006 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1006 polypeptide having the sequence of the amino acid residues roughly from 1 or 24 to about 392, inclusive of the Figure 133 (SEQ ID NO: 205), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, i.e., 1-392, or in another embodiment, 24-392.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1006 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 28 or 97 and approximately 1203 residues, inclusive, of Figure 132. (SEQ ID NO: 204). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No 203020 (DNA57699-1412), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203020 (DNA57699-1 12).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 or 24 to about 392, inclusive of Figure 133 (SEQ ID NO: 205), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1006 polypeptide having the sequence of amino acid residues so approximate from 1 or 24 to approximately 392, inclusive of Figure 133 (SEQ ID NO: 205), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95 percent sequence identity % with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 24 to approximately 392, inclusive of Figure 133 (SEQ ID NO: 205), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PRO1006 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

. In a specific aspect, the invention provides the PRO1006 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 or 24 through 392 of Figure 133 (SEQ ID NO: 205).

In another aspect, the invention relates to an isolated PRO1006 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 24 to about 392, inclusive of Figure 133 (SEQ ID NO: 205).

In a further aspect, the invention relates to an isolated PRO1006 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 24 to 392 of Figure 133 (SEQ ID NO: 205).

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1006 polypeptide having the sequence of the amino acid residues roughly from 1 or 24 to about 392, inclusive of Figure 133 (SEQ ID NO: 205), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with ( a) or (b), (ii) culturing a host cell or host comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of the cell phone In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1006 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 006 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1006 polypeptide by contacting the native PRO1006 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1006 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier.

PR01112 Applicants have identified a cDNA clone encoding a new polypeptide having multiple transmembrane domains and having some sequence identity with the peptide of Mycobacterium tuberculosis, a peptide found in a Dayhoff database designated as "MTY20B11_13", wherein the new polypeptide is designated in the present application as "PROl 112".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01112 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a ) a molecule of DNA encoding a PR01112 polypeptide having the sequence of amino acid residues from about 1 or approximately 14 to about 262 of Figure 135 (SEQ ID NO: 207), or (b) the complement of the DNA molecule of (to) In another aspect, the invention relates to a • isolated nucleic acid molecule encoding a PR01112 polypeptide comprising DNA that hybridizes to the nucleic acid complement between about 20 or 59 to 809 residues of Figure 134 (SEQ ID NO: 206). Preferably, the Hybridization occurs under severe conditions of • washing and hybridization.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, More preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit of DNA57702-1476 made on June 9 of 1998. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit of DNA57702-1476 made on June 9, 1998.

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of residues 1 or approximately 14 to about 262 of Figure 135 (SEQ. NO: 207).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01112 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e. inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 13 of the amino acid of Figure 135 (SEQ ID NO: 207). Transmembrane domains have tentatively been identified as extending from about amino acid positions 58-76, 99-113, 141-159 and 203-222 of Figure 135 (SEQ ID NO: 207).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 14 to 262 of Figure 135 (SEQ ID NO: 207).

Another embodiment is directed to fragments of a sequence encoding PR01112 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 60 to about 100 nucleotides in length.

In another embodiment, the invention provides • the isolated PR01112 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the sequence polypeptide PR01112 Isolated native, which in one embodiment, includes an amino acid sequence comprising residues 1 or 14 to approximately 262 of Figure 135 (SEQ ID NO: 207). In another aspect, the invention relates to an isolated PR01112 polypeptide, comprising a • amino acid sequence that has at least approximately 80% sequence identity, Preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence sequence. amino acid residues 1 or approximately 14 to approximately 262 of Figure 135 (SEQ ID NO: 207).

In a further aspect, the invention relates to an isolated PR01112 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 14 to approximately 262 of Figure 135 (SEQ ID NO: 207).

In still another aspect, the invention relates to an isolated PR01112 polypeptide, comprising the sequence of amino acid residues 1 or approximately 14 to approximately 262 of Figure 135 (SEQ ID NO: 207), or a fragment itself sufficient to provide a binding site for an anti-i-PROl 112 antibody. Preferably, the PR01112 fragment retains a qualitative biological activity of a native PR01112 polypeptide.

In another aspect, the present invention is directed to fragments of a PR01112 polypeptide that are long enough to provide an epitope against which an antibody can be generated. 55. PRO1074 Applicants have identified a clone of CDNA, DNA57704-1452, which encodes a new polypeptide having homology with galactosyl trans ferase, wherein the polypeptide is designated in the present application as "PRO1074".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1074 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1074 polypeptide having the amino acid residue sequence from 1 to about 331, inclusive of Figure 137 (SEQ ID NO: 209), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1074 polypeptide comprising the DNA that hybridizes to the complement of the nucleic acid sequence having approximately 322 to 1314 residues, inclusive, of Figure 136 (SEQ. ID NO: 208). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No 209953 (DNA57704 - 1 52), which was deposited on June 9, 1998, or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209953 (DNA57704-1452).

In still a further aspect, the invention • refers to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably • at least approximately 95% sequence identity with the sequence of the residues of amino acids 1 to about 331, inclusive of Figure 137 (SEQ ID NO: 209).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding an extracellular domain (ECD) of PRO1074, with or without initiating methionine, and its soluble variants (ie, inactivated or deleted from the transmembrane domain (s)) or is complementary to such a coding nucleic acid molecule. A region of the transmembrane type II domain has tentatively been identified as extending from about position 20 to 39 of the amino acid in the amino acid sequence of PRO1074 (Figure 137, SEQ ID NO: 209).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to approximately 331, inclusive of Figure 137 (SEQ ID NO: 209).

Another embodiment is directed to fragments of a sequence encoding the PRO1074 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length. Approximately from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides # the isolated PRO1074 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the isolated native sequence PRO1074 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 331 of Figure 137 (SEQ ID NO: 209).

In another aspect, the invention relates to an isolated PRO1074 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, Preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to 331, inclusive of Figure 137 (SEQ ID NO: 209).

In a further aspect, the invention relates to an isolated PRO1074 polypeptide, which comprises a record of the amino acid sequence • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 to approximately 331 of Figure 137 (SEQ ID NO: • 209).

In another aspect, the invention relates to an extracellular domain of PRO1074 comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% of Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues X to 331 of Figure 2 (SEQ. ID NO: 3), wherein X is any of amino acid residues 35 to 44 of Figure 137 (SEQ ID NO: 209).

In still another aspect, the invention relates to an isolated PRO1074 polypeptide, comprising the sequence of amino acid residues 1 to about 331, inclusive of Figure 137 (SEQ ID NO: 209), or a sufficient fragment itself to provide a binding site for an anti-i-PROl antibody 074. Preferably, the PRO1074 fragment retains a qualitative biological activity of a native PRO1074 polypeptide.

In another aspect, the present invention is directed to fragments of a PRO1074 polypeptide that are long enough to provide an epitope against which an anti body can be generated.

In yet another embodiment, the invention relates to the agonists and antagonists of a PRO1074 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1074 antibody.

In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of a polypeptide PRO1074 native.

Still in a further embodiment, the invention relates to a composition comprising a PRO1074 polypeptide as defined herein above, in combination with a pharmaceutically acceptable carrier. 56 PRO1005 A cDNA clone (DNA57708-1411) encoding a new polypeptide, designated in the present application as "PRO1005" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1005 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1005 polypeptide having the amino acid residue sequence from about 21 to about 185, inclusive of Figure 139 (SEQ. NO: 211), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1005 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 90 and about 584 residues, inclusive, of Figure 138 (SEQ. ID NO: 210). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203021 (DNA57708-1411), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203021 (DNA57708-1411).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 21 to about 185, inclusive of Figure 139 (SEC ID NO: 211), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 50 nucleotides, and preferably at least 100 nucleotides, and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1005 polypeptide having the sequence of amino acid residues roughly from 21 to about 185, inclusive of Figure 139 (SEQ ID NO: 211), or (b) the complement of the DNA of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about one sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1005 polypeptide, with or without the N-terminal signal sequence, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 20 of the amino acid in the sequence of Figure 139 (SEQ ID NO: 211).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 21 to about 185, inclusive of Figure 139 (SEQ ID NO: 211), or (b) ) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PRO1005 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1005 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the isolated native sequence PRO1005 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 21 to 185 of Figure 139 (SEQ ID NO: 211).

In another aspect, the invention relates to an isolated PRO1005 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 21 to about 185, inclusive of Figure 139 (SEQ ID NO: 211).

In a further aspect, the invention relates to an isolated PRO1005 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 21 to 185 of Figure 139 (SEQ ID NO: 211).

In yet another aspect, the invention relates to an isolated PRO1005 polypeptide, comprising the sequence of amino acid residues 21 to about 185, inclusive of Figure 139 (SEQ ID NO: 211), or a fragment thereof sufficient to provide a binding site for an anti-i-PROl 005 antibody. Preferably, the PRO1005 fragment retains a qualitative biological activity of a native PRO1005 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1005 polypeptide having the sequence of amino acid residues from about 21 to about 185, inclusive of Figure 139 (SEQ ID NO: 211), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one sequence identity 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or ( b), (ii) culturing a host cell or host comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cellulose culture. ar. 57 PRO1073 A cDNA clone (DNA57710-1451) encoding a new polypeptide, designated in the present application as "PROl 073" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1073 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1073 polypeptide having the amino acid residue sequence from about 32 to about 299, inclusive of Figure 141 (SEQ. ID NO: 213), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1073 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 438 and approximately 1241 residues, inclusive, of Figure 140 (SEQ. ID NO: 212). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203048 (DNA57710-1451), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203048 (DNA57710-1451).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from about 32 to about 299, inclusive of the Figure 141 (SEQ ID NO: 213), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides, and which is produced by hybridizing a test DNA molecule under severe conditions with (a ) a DNA molecule encoding a PRO1073 polypeptide having the sequence of amino acid residues roughly from 32 to about 299, inclusive of Figure 141 (SEQ ID NO: 213), or (b) the molecule's complement DNA of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about one identity of 90% sequence, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1073 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 31 of the amino acid in the sequence of Figure 141 (SEQ ID NO: 213) In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 32 to about 299, inclusive of Figure 141 (SEQ ID NO: 213), or (b) ) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PRO1073 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1073 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the PRO1073 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 32 to 299 of Figure 141 (SEQ ID NO: 213).

In another aspect, the invention relates to an isolated PRO1073 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 32 to about 299, inclusive of Figure 141 (SEQ ID NO: 213).

In a further aspect, the invention relates to an isolated PRO1073 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 32 to 299 of Figure 141 (SEQ ID NO: 213 In still another aspect, the invention relates to an isolated PRO1073 polypeptide, comprising the sequence of amino acid residues 32 to about 299, inclusive of Figure 141 (SEQ ID NO: 213), or a sufficient fragment itself to provide a binding site for an anti i-PROl 073 antibody. Preferably, the PRO1073 fragment retains a qualitative biological activity of a native PRO1073 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1073 polypeptide having the sequence of the amino acid residues from • about 32 to about 299, inclusive of Figure 141 (SEQ ID NO: 213), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. PR01152 A cDNA clone (DNA57711-1501) encoding a new transmembrane polypeptide, designated in the present application, has been identified. as "PR01152".

- - In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01152 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01152 polypeptide having the amino acid residue sequence from about 1 or approximately 29 to about 479, inclusive of the Figure 144 (SEQ ID NO: 216), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01152 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 58 or approximately 142 and - approximately 1494 nucleotides, inclusive, of Figure 143 (SEQ ID NO: 215). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203047 (DNA57711-1501), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203047 (DNA57711-1501).

In still a further aspect, the invention relates to an isolated nucleic acid molecule - - comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 29 to about 479, inclusive of Figure 144 (SEQ ID NO: 216), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 300 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01152 polypeptide which has the sequence of amino acid residues from 1 or approximately 29 to approximately 479, inclusive of Figure 144 (SEQ ID NO: 216), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01152 polypeptide, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, i.e. inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 28 of the amino acid in the sequence of Figure 144 (SEQ ID NO: 216). The various transmembrane domains have tentatively been identified as extending from about position 133 of the amino acid to about position 155 of the amino acid, from about position 168 of the amino acid to about position 187 of the amino acid, from about position 229 of the amino acid to about position 247 of the amino acid, from about position 264 of the amino acid to about position 285 of the amino acid, from about position 309 of the amino acid to about position 330 of the amino acid, from about position 371 of the amino acid to about position 390 of the amino acid and from about position 441 of the amino acid to about position 464 of the amino acid in the amino acid sequence of PR01152 (Figure 144, SEQ ID NO: 216).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 29 to approximately 479, inclusive of Figure 144 (SEQ ID NO: 216), or (b) elc omp l ement of the DNA of (a) ) Another embodiment is directed to fragments of a sequence encoding PR01152 polypeptide • which can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 143 (SEQ ID NO: 215).

In another embodiment, the invention provides the isolated PR01152 polypeptide encoded by Any of the isolated nucleic acid sequences identified hereinbefore.

In a specific aspect, the invention provides the sequence polypeptide PR01152 Isolated native, which in certain embodiments, - - includes an amino acid sequence comprising residues 1 or approximately 29 to approximately 479 of Figure 144 (SEQ ID NO: 216).

In another aspect, the invention relates to an isolated PR01152 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 29 to about 479, inclusive of Figure 144 (SEQ ID NO. : 216).

In a further aspect, the invention relates to an isolated PR01152 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least - approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 29 to approximately 479, inclusive of Figure 144 (SEQ ID NO: 216).

In yet another aspect, the invention relates to an isolated PR01152 polypeptide, comprising the sequence of amino acid residues 1 or approximately 29 to about 479, inclusive of Figure 144 (SEQ ID NO: 216), or a fragment sufficient to provide a binding site for an anti-i-PROl antibody 152. Preferably, the PR01152 fragment retains a qualitative biological activity of a native PR01152 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01152 polypeptide having the sequence of the amino acid residues roughly from 1 or approximately 29 to approximately 479, inclusive of Figure '144 (SEQ ID NO: 216), or (b) the complement of the - DNA molecule of (a), and if the DNA molecule The test sample has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% of sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of the cell culture.

In another embodiment, the invention provides a nucleic acid molecule designated herein as DNA55807 comprising the nucleotide sequence of SEQ. ID NO: 217 (see Figure 145). 59 PR01136 A cDNA clone (DNA57827-1493), which has protein homology to proteins containing the PDZ domain encoding the nucleic acid, encoding a new polypeptide, designated in the present application as - PR01136 'has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01136 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01136 polypeptide having the amino acid residue sequence from about 1 or from about 16 to about 632, inclusive of the Figure 147 (SEQ ID NO: 219), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01136 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between -about 216 or approximately 261 and about 2111 nucleotides, inclusive, of the Figure 146 (SEQ ID NO: 218). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203045 (DNA57827-1493), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203045 (DNA57827-1 93).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 16 to about 632, inclusive of Figure 147 (SEQ ID NO: 219), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01136 polypeptide which has the sequence of the amino acid residues from 1 or approximately 16 to about 632, inclusive of Figure 147 (SEQ ID NO: 219), or (b) the complement of the DNA molecule of (a), and , if the DNA molecule has at least about - a sequence identity of 80%, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01136 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 15 of the amino acid in the sequence of Figure 147 (SEQ ID NO: 219).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, - more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 16 to about 632, inclusive of Figure 147 (SEQ ID NO. : 219), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01136 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 to approximately 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 146 (SEQ ID NO: 218).

In another embodiment, the invention provides - the isolated PR01136 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PR01136 isolated native sequence polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 16 to approximately 632 of Figure 147 (SEQ ID NO: 219).

In another aspect, the invention relates to an isolated PR01136 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 16 to about 632, inclusive of Figure 147 (SEQ ID NO. : 219).

- - In a further aspect, the invention relates to an isolated PR01136 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably to less about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 16 to about 632, • inclusive of Figure 147 (SEQ ID NO: 219).

In still another aspect, the invention relates to an isolated PR01136 polypeptide, which comprises Sequence of the amino acid residues 1 or approximately 16 to about 632, inclusive of Figure 147 (SEQ ID NO: 219), or a • fragment sufficient to provide a binding site for an anti-i-PROl 136 antibody.

Preferably, the PR01136 fragment retains a qualitative biological activity of a native PR01136 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced (i) - by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01136 polypeptide having the sequence of the amino acid residues approximately from 1 or approximately 16 to approximately 632, inclusive of Figure 147 (SEQ ID NO: 219), or (b) the complement of the DNA molecule of (a), and if the DNA molecule The test sample has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering or the polypeptide of the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01136 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 136 antibody.

- - In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01136 polypeptide by contacting the native PR01136 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01136 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 60 PR0813 Applicants have identified a clone of CDNA (DNA57834-1339) having homology with protein C associated with the pulmonary surfactant encoding a new polypeptide, designated in the present application as "PR0813".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0813 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0813 polypeptide having the amino acid residue sequence from about 1 or approximately 27 to about 176, inclusive of the Figure 149 (SEQ ID NO: 221), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0813 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 109 or about 187 and about 148 nucleotides, inclusive, of Figure 148 (SEQ ID NO: 220). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No 209954 (DNA57834-1339). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209954 (DNA57834-1339).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% -21-of sequence identity, more preferably at least about 95% sequence identity with the sequence of residues 1 or approximately 27 to about 176, inclusive of the Figure 149 (SEQ ID NO: 221).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0813 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 26 of the amino acid in the sequence of Figure 149 (SEQ ID NO: 221).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 27 to approximately 176, inclusive of Figure 149 (SEQ ID NO: 221).

• Another embodiment is directed to fragments of a sequence encoding PR0813 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to approximately 80 nucleotides in length, • preferably roughly from 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably about 20 to about 40 nucleotides in length.

• In another embodiment, the invention provides the isolated PR0813 polypeptide encoded by Any of the isolated nucleic acid sequences identified hereinbefore.

In a specific aspect, the invention provides the sequence PR0813 polypeptide Isolated native, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 27 to approximately 176 of Figure 149 (SEQ ID NO: 221). • In another aspect, the invention relates to an isolated PR0813 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% of • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence sequence amino acid residues 1 or approximately 27 to approximately 176, inclusive of Figure 149 (SEQ ID NO: 221).

• In a further aspect, the invention relates to an isolated PR0813 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 25 90% positive, more preferably at least - about 95% positive when compared to the amino acid sequence of residues 1 or approximately 27 to about 176, inclusive of Figure 149 (SEQ ID NO. : 221).

In yet another aspect, the invention relates to an isolated PR0813 polypeptide, comprising the sequence of amino acid residues 1 or approximately 27 to about 176, inclusive of Figure 149 (SEQ ID NO: 221), or a • fragment sufficient to provide a binding site for an anti-PR0813 antibody. Preferably, the PR0813 fragment retains a qualitative biological activity of a polypeptide PR0813 native.

In another aspect, the present invention is • directed to fragments of a PR0813 polypeptide that are long enough to provide an epitope against which an antibody can be generated.

In yet another embodiment, the invention relates to the agonists and antagonists of a PR0813 polypeptide native. In a particular form, the agonist or antagonist is an anti-PR0813 antibody.

In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of a native PR0813 polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0813 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 61. PRO809 A cDNA clone (DNA57836-1338), having sequence identity with the heparan sulfate proteoglycans, encoding a new polypeptide, designated in the present application as "PRO809" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO809 polypeptide.

- In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO809 polypeptide having the sequence of the amino acid residues roughly from 1 or 19 to about 265, inclusive of the Figure 151 (SEQ ID NO: 223), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids, and means that it refers to two alternative embodiments provided herein, i.e., 1-265, or in another embodiment, 19-265.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO809 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 63 or 117 and approximately -867 residues, inclusive, of the Figure 150 (SEQ ID NO: 222). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203025 (DNA57836-1338), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203025 (DNA57836-1338).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule - comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from 1 or 19 to about 265 , inclusive of Figure 151 (SEQ ID NO: 223), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO809 polypeptide having the amino acid residue sequence in a manner approximate from 1 or 19 to approximately 265, inclusive of Figure 151 (SEQ ID NO: 223), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about a sequence identity of 80%, preferably at least approximately a sequence identity of 85%, more preferably at least - approximately a sequence identity of 90%, more preferably at least approximately a sequence identity 95% with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 19 to about 265, inclusive of Figure 151 (SEQ ID NO: 223), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PRO809 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO809 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 19 through 265 of Figure 151 (SEQ ID NO: 223).

In another aspect, the invention relates to an isolated PRO809 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues 19 to about 265, inclusive of Figure 151 (SEQ ID NO: 223).

In a further aspect, the invention relates to an isolated PRO809 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 19 to 265 of Figure 151 (SEQ ID NO: 223).

• Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO809 polypeptide having the Sequence of the amino acid residues approximately from 1 to 19 to about 265, inclusive of Figure 151 (SEQ ID NO: 223), or (b) the complement of the DNA molecule of (a), and the DNA test molecule has at least approximately a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO809 polypeptide. In a modality • in particular, the agonist or antagonist is an anti-PRO809 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO809 polypeptide, • contacting the native PRO809 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO809 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier. pharmaceutically. 62 PR0791 A cDNA clone (DNA57838-1337) has been identified, which has sequence identity with the class I antigens of MCH, which encodes a new - - polypeptide, designated in the present application as "PR0791".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0791 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule DNA encoding a PR0791 polypeptide having the sequence of amino acid residues roughly from 1 or 26 to about 246, inclusive of Figure 153 (SEQ ID NO: 225), or (b) the complement of the DNA of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, that is, 1-246, or in another embodiment, 26-246.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0791 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 9 or 84 and about 746 residues, inclusive, of Figure 152 ( SEC ID NO: 224). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule that encodes the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203014 (DNA57838-1337), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203014 (DNA57838-1337).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from 1 or 26 to about 246, inclusive of Figure 153 (SEQ ID NO: 225), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0791 polypeptide having the amino acid residue sequence in a manner approximate from 1 or 26 to approximately 246, inclusive of Figure 153 (SEQ ID NO: 225), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95 percent sequence identity % with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 26 to about 246, inclusive of Figure 153 (SEQ ID NO: 225), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PR0791 polypeptide encoded by - any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PR0791 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 26 through 246 of Figure 153 (SEQ ID NO: 225).

In another aspect, the invention relates to an isolated PR0791 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 26 to about 246, inclusive of Figure 153 (SEQ ID NO: 225).

In a further aspect, the invention relates to an isolated PR0791 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 26 to 246 of Figure 153 (SEQ ID NO: 225).

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0791 polypeptide having the sequence of the amino acid residues roughly from 1 or 26 to approximately 246, inclusive of Figure 153 (SEQ ID NO: 225), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) - culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR0791 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0791 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0791 polypeptide by contacting the native PR0791 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0791 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier chemically. - - 63. PRO1004 A cDNA clone (DNA57844-1410) encoding a new polypeptide, designated in the present application as "PRO1004" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1004 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1004 polypeptide having the amino acid residue sequence from about 25 to about 115, inclusive of Figure 155 (SEQ. NO: 227), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1004 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 191 and approximately 463 residues, inclusive, of Figure 154 ( SEC ID NO: 226). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203010 (DNA57844-1410), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203010 (DNA5784-1410).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide # having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from about 25 to about 115, inclusive of Figure 155 (SEQ ID NO: 227), or the DNA complement of (a) .

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides. nucleotides, and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1004 polypeptide having the sequence of amino acid residues roughly from to about 115, inclusive of Figure 155 (SEQ ID NO: 227), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately one identity. 80% sequence, preferably at least • about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the 10 DNA molecule tested.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PRO1004, with or without the N-terminal signal sequence and / or the initiation methionine, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from approximately position 1 of the amino acid to approximately position 24 of the amino acid in the sequence of Figure 155 (SEQ ID NO: 227).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising - - (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, of most preferably at least about 5 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues up to about 115, inclusive of Figure 155 (SEQ ID NO: 227) , or (b) the DNA complement of 10 (a). • Another embodiment is directed to fragments of a sequence encoding the PRO1004 polypeptide that can be used as probes of hybridization. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, More preferably from about 20 to about 50 nucleotides in length, and more preferably in an approximate manner from 20 to about 40 nucleotides in length.

In another embodiment, the invention provides - the isolated PRO1004 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO1004 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 25 to 115 of Figure 155 (SEQ ID NO: 227). • In another aspect, the invention relates to an isolated PRO1004 polypeptide, comprising an amino acid sequence having at least one about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 25 up to about 115, inclusive of Figure 155 (SEQ ID NO: 227).

In a further aspect, the invention relates to an isolated PRO1004 polypeptide, which comprises an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably less about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 25 to 115 of Figure 155 (SEQ ID NO: 227).

In yet another aspect, the invention relates to an isolated PRO1004 polypeptide, comprising the sequence of amino acid residues up to about 115, inclusive of Figure 155 (SEQ ID NO: 227), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 00 antibody. Preferably, the PRO1004 fragment retains a qualitative biological activity of a native PRO1004 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1004 polypeptide having the sequence of amino acid residues from about 25 up to about 115, inclusive of Figure 155 (SEQ ID NO: 227), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least • approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 64 PROllll A cDNA clone (DNA58721-1475) encoding a new polypeptide having sequence identity with the LIG has been identified and is designated in the present application as "PROllll".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PROllll polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule DNA encoding a PROllll polypeptide having the sequence of amino acid residues roughly from 1 to about 653, inclusive of Figure 157 (SEQ ID NO: 229), or (b) the complement of the DNA molecule of (to) . In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PROllll polypeptide comprising DNA that hybridizes to the nucleic acid complement of Approximately between about 57 and about 2015, including, from Figure 156 (SEQ ID NO: 228). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203110 (DNA58721-1475), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203110 (DNA58721-1475).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 to about 653, inclusive of the Figure 157 (SEQ ID NO: 229), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PROllll polypeptide having the sequence of amino acid residues approximately from 1 to approximately 653, inclusive of Figure 157 (SEQ ID NO: 229), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately one sequence identity of the 80%, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule - - In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PROllll polypeptide in its soluble form, ie, the variants inactivated or deleted from the transmembrane domain, or is complementary to such a nucleic acid molecule coding The transmembrane domains have tentatively been identified as extending from approximately amino acid positions 21-40 (type II) and 528-548 in the amino acid sequence of PROllll (Figure 157, SEQ ID NO: 229).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 653, inclusive of Figure 157 - (SEQ ID NO: 22 9), or (b) the comp l ement of the DNA of (to Another modality is directed to fragments • of a sequence encoding the PROllll polypeptide that can be used as hybridization probes. Such nucleic acid fragments are roughly from 20 to about 80 nucleotides in length, preferably approximately from 20 to • about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about approximately 40 nucleotides in length.

In another embodiment, the invention provides • the isolated PROllll polypeptide encoded by any of the nucleic acid sequences isolated defined hereinbefore.

In a specific aspect, the invention provides the PROllll polypeptide of isolated native sequence, which in one embodiment, includes An amino acid sequence comprising the residues 1 to 653 of Figure 157 (SEQ ID NO 229).

In another aspect, the invention relates to an isolated PROllll polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 653, inclusive of Figure 157 (SEQ ID NO: 229).

In a further aspect, the invention relates to an isolated PROllll polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to 653 of Figure 157 (SEQ ID NO: 229).

- - In still another aspect, the invention relates to an isolated PROllll polypeptide, comprising the sequence of amino acid residues 1 up to • about 653, inclusive of Figure 157 (SEQ ID NO: 229), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 111 antibody. Preferably, the PROllll fragment retains a biological activity Qualitative of a native PROllll polypeptide.

Severe conditions with (a) a DNA molecule encoding a PROllll polypeptide having the sequence of the amino acid residues roughly from 1 to about 653, inclusive of Figure 157 (SEQ ID NO: 229), or ( b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the minus about 90% sequence identity, - more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule low • suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention is refers to the agonists and antagonists of a native PROllll polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 111 antibody.

In a further embodiment, the invention relates to a method for identifying the agonists or antagonists of a native PROllll polypeptide, contacting the native PROllll polypeptide with a candidate molecule and monitoring a Biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PROllll polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier 65 PR01344 A cDNA clone (DNA58723-1588), which has homology to the factor C encoding the nucleic acid, which codes for a new polypeptide, designated in the present application as "PROl 344" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01344 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01344 polypeptide having the amino acid residue sequence from about 1 or approximately 24 to - about 720, inclusive of Figure 159 (SEQ ID NO: 231), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01344 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 26 or about 95 and about 2185 nucleotides, inclusive, of Figure 158 (SEQ ID NO: 230). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203133 (DNA58723-1588), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203133 (DNA58723-1588).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide • having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the residue sequence of • amino acids 1 or approximately 24 to approximately 720, inclusive of Figure 159 (SEQ ID NO: 231), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least 10 nucleotides and is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01344 polypeptide having the sequence of the amino acid residues from 1 or • approximately 24 to about 720, inclusive of Figure 159 (SEQ ID NO: 231), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about an 80% sequence identity, so preferably at least approximately one identity of • 85% sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), Isolate the DNA molecule from test.

In a specific aspect, the invention • provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PR01344, with or without the N-terminal signal sequence and / or the initiation methionine, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from approximately position 1 of the amino acid to about position 23 of the amino acid in the sequence of Figure 159 (SEQ ID NO: 231).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • about 95% positive when compared to the amino acid sequence of residues 1 or approximately 24 to about 720, inclusive of Figure 159 (SEQ ID NO: 231), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01344 polypeptide that can find use as hybridization probes.

Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 60 nucleotides in length. about 20 to about 50 nucleotides in length, and more preferably approximately 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 158 (SEQ ID NO: • 230).

In another embodiment, the invention provides the isolated PR01344 polypeptide encoded by any of the nucleic acid sequences isolates identified in the present above.

• In a specific aspect, the invention provides the PR01344 polypeptide of isolated native sequence, which in certain embodiments, includes a The amino acid sequence comprising residues 1 or approximately 24 to about 720 of Figure 159 (SEQ ID NO: 231). # In another aspect, the invention relates to an isolated PR01344 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 24 to about 720, inclusive of the Figure • 159 (SEQ ID NO: 231).

In a further aspect, the invention relates to an isolated PR01344 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 24 to about 720, inclusive of Figure 159 (SEQ ID NO: 231).

In yet another aspect, the invention relates to an isolated PR01344 polypeptide, comprising the sequence of amino acid residues 1 or approximately 24 to about 720, inclusive of Figure 159 (SEQ ID NO: 231), or a fragment sufficient to provide a binding site for an anti i-PROl 3 4 antibody.

Preferably, the PR01344 fragment retains a qualitative biological activity of a native PR01344 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01344 polypeptide having the sequence of the amino acid residues roughly from 1 or approximately 24 to approximately 720, inclusive of Figure 159 (SEQ ID NO: 231), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a cell host or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01344 polypeptide. In a particular embodiment, the agonist or antagonist is an anti i-PROl 344 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01344 polypeptide by contacting the native PR01344 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01344 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 66. PRO1109 A cDNA clone (DNA58737-1473), which has homology to the β-1,4-galact os i l rans transferase encoding the nucleic acid, encoding a new polypeptide, designated in the present application as " PRO1109".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1109 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1109 polypeptide having the amino acid residue sequence from about 1 or approximately 28 to about 344, inclusive of the Figure 161 (SEQ ID NO: 236), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1109 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 119 or about 200 and about 1150 nucleotides, inclusive, of Figure 160 (SEQ ID NO: 235). Preferably, the • Hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, More preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203136 (DNA58737-1473), or (b) the complement of the nucleic acid molecule of (to) . In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203136 (DNA58737-1473). In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity • of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of Sequence with the sequence of amino acid residues 1 or approximately 28 to approximately 344, inclusive of Figure 161 (SEQ ID NO: 236), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a low test DNA molecule.

Severe conditions with (a) a DNA molecule encoding a PRO1109 polypeptide having the sequence of amino acid residues from 1 or approximately 28 to about 344, inclusive of Figure 161 (SEQ ID NO: 236), or (b) The complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1109 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary for such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 27 of the amino acid in the sequence of the Figure 161 (SEQ ID NO: 236).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or approximately 28 to approximately 344, inclusive of Figure 161 (SEQ ID NO: 236), or (b) the DNA complement of (a).

Another modality is directed to fragments • of a sequence encoding the PRO1109 polypeptide that can be used as hybridization probes. Such nucleic acid fragments are approximately from 20 up to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, most preferably from about 20 to about 50 nucleotides in length, and more preferably about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 160 (SEQ ID NO: 235). In another embodiment, the invention provides the isolated PRO1109 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

• In a specific aspect, the invention provides the PRO1109 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising the residues 1 or approximately 28 to approximately 344 of Figure 161 (SEQ ID NO: 236).

In another aspect, the invention relates to a PRO1109 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or roughly 28 to approximately 344, inclusive of the Figure 161 (SEQ ID NO: 236).

In a further aspect, the invention relates to an isolated PRO1109 polypeptide, comprising a sequence record of -amino acids of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 28 to approximately 344, inclusive of Figure 161 (SEQ ID NO: 236).

In yet another aspect, the invention relates to an isolated PRO1109 polypeptide, comprising the sequence of amino acid residues 1 or approximately 28 to about 344, inclusive of Figure 161 (SEQ ID NO: 236), or a sufficient fragment to provide a binding site for an anti-PR110 antibody. Preferably, the PRO1109 fragment retains a qualitative biological activity of a native PRO1109 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1109 polypeptide having the sequence of the amino acid residues roughly from 1 or approximately 28 to approximately 344, inclusive of Figure 161 (SEQ ID NO: 236), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of sequence with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the p oligopeptide from cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1109 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1109 antibody In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1109 polypeptide, contacting the native PRO1109 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment the invention relates to a composition comprising a PRO1109 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 67 PR01383 A cDNA clone (DNA58743-1609), which has homology to the nucleic acid encoding the nmb protein expressed in the human melanoma cell, which encodes a new polypeptide, designated in the present application as "PR01383" has been identified. .

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01383 polypeptide In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01383 polypeptide having the amino acid residue sequence from about 1 or about 25 to about 423, inclusive of the Figure 163 (SEQ ID NO: 241), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01383 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 122 or about 194 and about 1390 nucleotides, inclusive, of Figure 162 (SEQ ID NO: 240). Preferably, the hybridization occurs under severe conditions of the product and of the product.

In a further aspect, the invention relates to an isolated nucleic acid molecule that • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203154 (DNA58743-1609), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203154 (DNA58 43-1609). In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with the sequence of amino acid residues 1 or approximately 25 to about 423, inclusive of Figure 163 (SEQ ID NO: 241), or (b) the DNA complement of # In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a low test DNA molecule.

Severe conditions with (a) a DNA molecule encoding a PR01383 polypeptide having the sequence of the amino acid residues from 1 or approximately 25 to about 423, inclusive of Figure 163 (SEQ ID NO: 241), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately a sequence identity of 90%, more preferably at least -about a 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01383 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, is say, the inactivated or eliminated variants of the • transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from approximately position 1 of the amino acid to about position 24 of the amino acid in the sequence of Figure 163 (SEQ ID NO: 241). The domain of • transmembrane has tentatively been identified as extending from approximately position 339 of the amino acid to about position 362 of the amino acid in the amino acid sequence of PR01383 (Figure 163, SEQ ID NO: 241).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, • more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 25 to about 423, inclusive of Figure 163 ( SEQ ID NO: 241), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01383 polypeptide that can find use as probes of hibr idi zac ion. Such nucleic acid fragments are roughly from 20 to about 80 nucleotides in length, preferably approximately from 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 162 (SEQ ID NO. 240 In another embodiment, the invention provides the isolated PR01383 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PR01383 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 25 to approximately 423 of Figure 163 (SEQ ID NO: 241).

In another aspect, the invention relates to an isolated PR01383 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 25 to about 423, inclusive of Figure 163 (SEQ ID NO. : 241).

• In a further aspect, the invention relates to an isolated PR01383 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 25 to about 423, inclusive of Figure 163 (SEQ ID NO: 241).

In yet another aspect, the invention relates to an isolated PR01383 polypeptide, which comprises the sequence of amino acid residues 1 or Approximately 25 to about 423, inclusive of Figure 163 (SEQ ID NO: 241), or a fragment sufficient to provide a binding site for an anti-PROL 383 antibody.

Preferably, the PR01383 fragment retains a qualitative biological activity of a polypeptide PR01 38 3 na t i vo In still a further aspect, the invention provides a polypeptide produced (i) • 5 hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01383 polypeptide having the sequence of the amino acid residues approximately from 1 or approximately 25 to about 423, inclusive of Figure 163 (SEQ ID NO: 241), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) cultivating a cell The host or host comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to the agonists and antagonists of a native PR01383 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 383 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01383 polypeptide, by contacting the native PR01383 polypeptide with a candidate molecule and monitoring one • biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01383 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier • Pharmaceutically. 68 PRO1003 Applicants have identified a clone of CDNA, DNA58846-1409, which encodes a new secreted polypeptide wherein the polypeptide is designated in the present application as "PRO1003". In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1003 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1003 polypeptide having the sequence of amino acid residues from about 1 or from about 25 to about 84, inclusive of the Figure 165 (SEQ ID NO: 246), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1003 polypeptide comprising the DNA that hybridizes to the complement of the nucleic acid between about 41 or approximately 113 and about 292 residues, inclusive of Figure 164 ( SEC ID NO: 245). Preferably, hybridization occurs under severe washing and hybridization conditions.

^? In a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least f about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209957 (DNA58846-1409), which was deposited on June 9, 1998. In a preferred embodiment, the nucleic acid comprises a DNA encoding thereto. mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209957 (DNA58846-1409).

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% • sequence identity, more preferably at least about 95% sequence identity with the sequence of residues 1 or approximately 25 to about 84, inclusive of Figure 165 (SEQ ID NO: 246). • In another aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide registry of at least about 80% positive, so preferably at least about 90% positive, more preferably at least about 95% positive when compared to the sequence of • amino acids from residues 1 or approximately 25 to approximately 84, inclusive of Figure 165 (SEQ ID NO: 246).

Another embodiment is directed to fragments of a sequence encoding the PRO1003 polypeptide that can be used as probes of hybridization. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, • more preferably from about 20 to about 50 nucleotides in length, and more preferably in an approximate manner from 20 to about 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1003 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PRO1003 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 25 to 84 of the Figure 165 (SEQ ID NO: 246).

In another aspect, the invention relates to an isolated PRO1003 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with the sequence of amino acid residues 1 or approximately 25 to about 84, inclusive of Figure 165 (SEQ ID NO: 246).

In a further aspect, the invention is • refers to an isolated PRO1003 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or approximately 25 to about 84, inclusive of Figure 165 (SEQ ID NO: 246).

In still another aspect, the invention relates to an isolated PRO1003 polypeptide, comprising the sequence of amino acid residues 1 or approximately to about 84, inclusive of Figure 165 (SEQ ID NO: 246), or a sufficient fragment itself to provide a binding site for an anti i-PROl 003 antibody. Preferably, the PRO1003 fragment retains an activity qualitative biological of a native PRO1003 polypeptide.

In another aspect, the present invention is directed to fragments of a PRO1003 polypeptide that are long enough to provide • an epitope against which an anti body can be generated. 69 PRO1108 15 Applicants have identified a clone of CDNA (DNA58848-1472) having homology with the nucleic acid encoding the LPAAT protein, which • encodes a new polypeptide, designated in the present application as "PRO1108". In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1108 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1108 polypeptide having the amino acid residue sequence from about 1 to about 456, inclusive of Figure 167 (SEQ. ID NO: 248), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1108 polypeptide comprising DNA that hybridizes to the nucleic acid complement between about 77 and about 1444 nucleotides, inclusive, of Figure 166 (SEQ. ID NO: 247). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No 209955 (DNA58848-1472). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209955 (DNA58848-1472).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 456, inclusive of FiG ra 1 67 (S EC ID NO: 2 4 8) In a specific aspect, the invention provides an isolated nucleic acid molecule • comprising the DNA encoding a PRO1108 polypeptide, with or without the initiating methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to such a nucleic acid molecule coding. The transmembrane domains have been • tentatively identified as type II domains that extend from about position 22 of the amino acid to about position 42 of the amino acid, from Approximately position 156 of the amino acid to about position 176 of the amino acid, from about position 180 of the amino acid to about position 199 of the amino acid, and from about position 369 of the amino acid to about position 388 of the amino acid in the amino acid sequence of PRO1108 (Figure 167, SEQ ID NO: 248).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 456, inclusive of Figure 167 (SEQ ID NO: 248).

Another embodiment is directed to fragments of a sequence encoding the PRO1108 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1108 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the isolated native sequence PRO1108 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to about 456 of Figure 167 (SEQ ID NO: 248).

In another aspect, the invention relates to an isolated PRO1108 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 456, inclusive of Figure 167 (SEQ ID NO: 248).

In a further aspect, the invention relates to an isolated PRO1108 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 to about 456, inclusive of Figure 167 (SEQ ID NO: 248).

In still another aspect, the invention relates to to an isolated PRO1108 polypeptide, comprising the sequence of amino acid residues 1 to about 456, inclusive of Figure 167 (SEQ ID NO: 248), or a sufficient fragment itself to provide a binding site for a Anti-i-PROl 108 antibody. Preferably, the PRO1108 fragment retains a qualitative biological activity of a native PRO1108 polypeptide.

In another aspect, the present invention is directed to fragments of a PRO1108 polypeptide that are long enough to provide an epitope against which an antibody can be generated.

In still another embodiment, the invention relates to the agonists and antagonists of a PRO1108 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1108 antibody. • In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of a native PRO1108 polypeptide. • Still in a further embodiment, the invention relates to a composition comprising a PRO1108 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. • 70 PR01137 Applicants have identified a clone of cDNA, DNA58849-149, which encodes a new polypeptide having homology to the r ibos i 1 t rans fera sa wherein the polypeptide is designated in the present application as "PR01137".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01137 polypeptide.

In one aspect, nucleic acid isolated • 5 comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01137 polypeptide having the amino acid residue sequence from about 1 or approximately 15 to about 240, inclusive of Figure 169 (SEQ ID NO: 250), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01137 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 77 or approximately 119 to approximately 796 residues, inclusive, of the 25 Figure 168 (SEQ ID NO: 249). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No 209958 (DNA58849-1494), which was deposited on June 9, 1998, or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209958 (DNA58849-1494).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or about 15 to about 240, inclusive of Figure 169 (SEQ ID NO: 250).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01137 polypeptide with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a nucleic acid molecule coding The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 14 of the amino acid in the sequence of Figure 169 (SEQ ID NO: 250).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 15 to approximately 240, inclusive of Figure 169 (SEQ ID NO: 250).

Another embodiment is directed to fragments of a sequence encoding PR01137 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01137 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01137, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 15 to 240 of Figure 169 (SEQ ID NO: 250) ).

In another aspect, the invention relates to an isolated PR01137 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 15 to 240, inclusive of Figure 169 (SEQ ID NO: 250).

In a further aspect, the invention relates to an isolated PR01137 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 15 to approximately 240 of Figure 169 (SEQ ID NO: 250).

In still another aspect, the invention relates to an isolated PR01137 polypeptide, comprising the sequence of amino acid residues 1 or approximately 15 to about 240, inclusive of Figure 169 (SEQ ID NO: 250), or a fragment sufficient to provide a binding site for an anti-i-PROl 137 antibody. Preferably, the PR01137 fragment retains a qualitative biological activity of a native PR01137 polypeptide.

In another aspect, the present invention is directed to fragments of a PR01137 polypeptide that are long enough to provide an epitope against which an antigen can be generated.

- - In yet another embodiment, the invention relates to the agonists and antagonists of a PR01137 polypeptide. In a particular modality, the • agonist or antagonist is an anti-PR01137 antibody.

In a further embodiment, the invention relates to selection tests to identify agonists or antagonists of a native PR01137 polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01137 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 71 PR01138 Applicants have identified a clone of CDNA, DNA58850-1495, which encodes a new polypeptide having homology to the CD84 leukocyte antigen wherein the polypeptide is designated in the present application as "PR01138".

- - In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01138 polypeptide. • In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity. sequence, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01138 polypeptide having the Sequence of amino acid residues from 1 or approximately 23 to about 335, inclusive of Figure 171 (SEQ ID NO: 253), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01138 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid sequence having approximately residues 38 or approximately from about 104 to about 1042, - 4 - inclusive, of Figure 170 (SEQ ID NO: 252). Preferably, hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209956 (DNA58850-1495), which was deposited on June 9, 1998, or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a A DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209956 (DNA58850-195).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity. of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 23 to about 335, inclusive of Figure 171 • (SEC ID NO: 253).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding an extracellular domain (ECD) of PR01138, with or without the N-terminal signal sequence and / or the methionine of • initiation, and its soluble variants (ie, inactivated or deleted from the domain (s) of transmembrane) or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 22 of the amino acid in the sequence of Figure 171 (SEQ ID NO: 253). A region of the t-anmembrane domain has been tentatively identified as extending from about position 224 of the amino acid to about position 250 of the amino acid. • amino acid in the amino acid sequence of PR01138 (Figure 171, SEQ ID NO: 253).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a registry of the polypeptide of • at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the sequence of amino acids of residues 1 or approximately 23 to about 335, inclusive of Figure 171 (SEQ ID NO: 253).

Another embodiment is directed to fragments 20 of a sequence encoding PR01138 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about -60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more. preferably approximately from 20 up to # approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01138 polypeptide encoded by any of the nucleic acid sequences isolates identified in the present above.

F In a specific aspect, the invention provides the PR01138 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 23 to 335 of Figure 171 (SEQ ID NO: 253). F In another aspect, the invention relates to an isolated PR01138 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least 25 about 90% sequence identity, - - more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 23 to 335, inclusive of Figure 171 (SEQ ID NO. : f 253).

In a further aspect, the invention relates to an isolated PR01138 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so F preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 23 to about 335 of Figure 171 (SEQ ID NO: 253). F In another aspect, the invention relates to an extracellular domain of PR01138 comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably preferably at least about 90% sequence identity, - - more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or about 23 to X of Figure 171 (SEQ ID NO. : 253), where X is f any of amino acid residues 219 to 228 of Figure 171 (SEQ ID NO: 253).

In still another aspect, the invention relates to an isolated PR01138 polypeptide, which comprises sequence of amino acid residues 1 or F approximately from about 23 to about 335, inclusive of Figure 171 (SEQ ID NO: 253), or a sufficient fragment itself to provide a binding site for an anti-PROL 138 antibody.

Preferably, the PR01138 fragment retains a qualitative biological activity of a native PR01138 polypeptide. F In another aspect, the present invention is directed to fragments of a PR01138 polypeptide that are long enough to provide an epitope against which an anti body can be generated.

In yet another embodiment, the invention relates to the agonists and antagonists of a PR01138 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR01138 antibody.

In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of a native PR01138 polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01138 polypeptide as defined herein above, in combination with a pharmaceutically acceptable carrier.

In another embodiment, the invention provides a nucleotide sequence designated herein as DNA49140 comprising the nucleotide sequence of Figure 172 (SEQ ID NO: 254). 72. PRO105 A cDNA clone (DNA58853-1423), which has homology with the main urinary proteins (MUPs) encoding the nucleic acid, which codes for a new polypeptide, designated in the present application as "PRO1054" has been identified.

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PRO1054 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of DNA encoding a PRO1054 polypeptide having the sequence of amino acid residues from • approximately 1 or approximately 19 to approximately 180, inclusive of Figure 174 (SEQ ID NO: 256), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1054 polypeptide comprising the DNA which - - hybridizes to the complement of the nucleic acid between about 46 or approximately 100 and about 585 nucleotides, inclusive, of the Figure 173 (SEQ ID NO: 255). Preferably, the • Hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about ^ 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203016 (DNA58853-1423), or (b) the complement of the nucleic acid molecule of (to) . In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203016 (DNA58853-1423). In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of • sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence sequence amino acid residues 1 or approximately 19 to about 180, inclusive of Figure 174 (SEQ ID NO: 256), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that encodes a PRO1054 polypeptide having the sequence of amino acid residues from 1 or approximately 19 to about 180, inclusive of Figure 174 (SEQ ID NO: 256), or (b) the complement of the DNA molecule of (a), and, if The DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) or (b), isolating the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule • comprising the DNA encoding a PRO1054 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a coding nucleic acid molecule. He The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about • position 18 of the amino acid in the sequence of Figure 174 (SEQ ID NO: 256). In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 19 to about 180 , inclusive of Figure 174 (SEQ ID NO: 256), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PRO1054 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 173 (SEQ ID NO: 255).

In another embodiment, the invention provides - the isolated PRO1054 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

• In a specific aspect, the invention provides the PRO1054 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 19 up to about 180 of Figure 174 (SEQ ID NO: • 256).

In another aspect, the invention relates to an isolated PRO1054 polypeptide, comprising a amino acid sequence having at least about 80% sequence identity, preferably at least about 85% • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 19 to about 180, inclusive of Figure 174 (SEQ ID NO: 256). In a further aspect, the invention relates to an isolated PRO1054 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably less about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 19 to about 180, inclusive of Figure 174 (SEQ ID NO: 256) .

In yet another aspect, the invention relates to an isolated PRO1054 polypeptide, comprising the sequence of amino acid residues 1 or approximately 19 to about 180, inclusive of Figure 174 (SEQ ID NO: 256), or a fragment sufficient to provide a binding site for an anti-i-PROl 05 antibody. Preferably, the PRO1054 fragment retains a qualitative biological activity of a native PRO1054 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced (i) - by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1054 polypeptide having the sequence of the amino acid residues of approximate manner from 1 or approximately 19 to about 180, inclusive of Figure 174 (SEQ ID NO: 256), or (b) the complement of the DNA molecule of (a), and if the DNA molecule of The test has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity. sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1054 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 054 antibody.

- In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1054 polypeptide, • contacting the native PRO1054 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional modality, the The invention relates to a composition comprising • a PRO1054 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 15 73. PR0994 A cDNA clone (DNA58855-1422), which has homology with the nucleic acid encoding the L6 antigen associated with the tumor, has been identified.it is. encodes a new polypeptide, designated in the present application as "PR0994".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0994 polypeptide.

- - In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0994 polypeptide having the sequence of amino acid residues roughly from 1 to about 229, inclusive of Figure 176 (SEQ. ID NO: 258), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0994 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 31 and about 717 nucleotides, inclusive, of Figure 175 (SEQ. ID NO: 257). Preferably, hybridization occurs under severe washing and hybridization conditions.

- - In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC No. 203018 (DNA58855-1422), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203018 (DNA58855-1422).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 up to about 229, inclusive • of Figure 176 (SEQ ID NO: 258), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least 10 nucleotides and that is produced • hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PR0994 polypeptide having the sequence of amino acid residues from 1 to approximately 229, inclusive of Figure 176 (SEQ ID NO: 258), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule • has at least approximately 80% sequence identity, preferably at least approximately a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the molecule DNA test.

- - In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0994 polypeptide, with or without the initiating methionine, and its soluble, ie, inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. Multiple transmembrane domains have tentatively been identified as extending from about position 10 of the amino acid to about position 31 of the amino acid, from about position 50 of the amino acid to about position 72 of the amino acid, from about position 87 of the amino acid to about position 110 of the amino acid and from about position 191 of the amino acid to about position 213 of the amino acid in the amino acid sequence of PR0994 (Figure 176, SEQ ID NO: 258).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 1 to approximately 229, inclusive of Figure 176 (SEQ ID NO: 258), or (b) the DNA complement of • Another embodiment is directed to fragments of a sequence encoding the PR0994 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 to about 80 nucleotides in length, preferably approximately from 20 to • approximately 60 nucleotides in length, more preferably from approximately 20 to approximately 50 nucleotides in length, and more preferably approximately 20 to approximately 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 175 (SEQ ID NO: 257).

- - In another embodiment, the invention provides the isolated PR0944 polypeptide encoded by any of the nucleic acid sequences • isolates identified in the present above.

In a specific aspect, the invention provides the PR0944 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising • residues 1 to approximately 229 of Figure 176 (SEQ ID NO: 258).

In another aspect, the invention relates to a PR0994 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, • preferable way to at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 229, inclusive of Figure 176 (SEQ ID NO: 258). In a further aspect, the invention relates to an isolated PR0994 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to 10 about 229, inclusive of Figure 176 • (SEC ID NO: 258).

In still another aspect, the invention relates to an isolated PR0994 polypeptide, comprising Sequence of amino acid residues 1 to approximately 229, inclusive of Figure 176 (SEQ ID NO: 258), or a sufficient fragment itself • to provide a binding site for an anti-PR0994 antibody. Preferably, the PR0994 fragment retains a qualitative biological activity of a native PR0994 polypeptide.

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0994 polypeptide having the sequence of the amino acid residues roughly from 1 to about 229, inclusive of Figure 176 (SEQ ID NO: 258), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80 sequence identity. %, preferably at least about 85% of sequence identity, more preferably to the • less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell that comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the • cell culture.

In still another embodiment, the invention relates to agonists and antagonists of a native PR0994 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0994 antibody. In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0994 polypeptide by contacting the native PR0994 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0994 polypeptide, or an agonist or antagonist. • as defined herein above, in combination with a pharmaceutically acceptable carrier. 74 PR0812 A cDNA clone (DNA59205-1421) has been identified, which has homology with the nucleic acid that • encodes the cl protein binding to the prostatic steroid, which encodes a new polypeptide, designated in the present application as "PR0812".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0812 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity. • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0812 polypeptide having the amino acid residue sequence from • approximately 1 or approximately 16 to approximately 83, inclusive of Figure 178 (SEQ ID NO: 260), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a • PR0812 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between about 55 or approximately 100 and about 303 nucleotides, inclusive, of Figure 177 (SEQ ID NO: 259). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203009 (DNA59205-1421), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203009 (DNA59205-1421).

• In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% of sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 16 up to • about 83, inclusive of Figure 178 (SEQ ID NO: 260), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least 100 nucleotides and is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0812 polypeptide having the sequence of the amino acid residues from 1 or approximately from about 16 to about 83, inclusive of Figure 178 (SEQ ID NO: 260), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about an 80% sequence identity, so preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b) , Isolate the DNA molecule from the test.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0812 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has been tentatively identified as extending from about position 1 of the amino acid until approximately • position 15 of the amino acid in the sequence of Figure 178 (SEQ ID NO: 260).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 20 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 16 to about 83, inclusive of Figure 178 (SEQ ID NO: 260), or (b) 25 the DNA complement of (a).

Another embodiment is directed to the fragments of a sequence encoding the PR0812 polypeptide which can be used as probes of • Hybridization. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, most preferably from about 20 to • approximately 50 nucleotides in length, and more preferably approximately 20 to approximately 40 nucleotides in length and can be derived from the sequence of nucleotides shown in Figure 177 (SEQ ID NO: 259).

• In another embodiment, the invention provides the isolated PR0812 polypeptide encoded by Any of the isolated nucleic acid sequences identified hereinbefore.

In a specific aspect, the invention provides the PR0812 sequence polypeptide Isolated native, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 16 to approximately 83 of Figure 178 (SEQ ID NO: 260). • In another aspect, the invention relates to an isolated PR0812 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence sequence. amino acid residues 1 or approximately 16 to approximately 83, inclusive of Figure 178 (SEQ ID NO: 260).

In a further aspect, the invention relates to an isolated PR0812 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 25 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 16 to approximately 83, inclusive of Figure 178 (SEQ ID NO: 260). • In yet another aspect, the invention relates to an isolated PR0812 polypeptide, comprising the sequence of amino acid residues 1 or approximately 16 to about 83, inclusive of Figure 178 (SEQ ID NO: 260), or a • fragment sufficient to provide a binding site for an anti-PR0812 antibody. Preferably, the PR0812 fragment retains a qualitative biological activity of a polypeptide PR0812 native.

Still in a further aspect, the invention • provides a polypeptide produced (i) by hybridizing a low test DNA molecule severe conditions with (a) a DNA molecule encoding a PR0812 polypeptide having the amino acid residue sequence roughly from 1 or approximately 16 to about 83, inclusive of Figure 178 (SEQ.

ID NO: 260), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85 % sequence identity, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the DNA test under suitable conditions for the • expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention is refers to the agonists and antagonists of a native PR0812 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0812 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0812 polypeptide, contacting the native PR0812 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0812 polypeptide, or an agonist or antagonist • as defined herein above, in combination with a pharmaceutically acceptable carrier. 75 PRO1069 10 Applicants have identified a clone of • cDNA, DNA59211-1450, which encodes a new polypeptide having homology to the CHIF wherein the polypeptide is designated in the present application as "PRO1069". In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1069 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1069 polypeptide having the amino acid residue sequence from 1 or • approximate manner 17 to approximately 89, inclusive of Figure 180 (SEQ ID NO: 262), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a • PRO1069 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid sequence having approximately residues 197 or approximately 245 to about 15 463, inclusive, of Figure 179 (SEQ ID NO: 261). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the protein cDNA Human in ATCC Deposit No. 209960 (DNA59211-1450), which was deposited on June 9, 1998. In a preferred embodiment, the nucleic acid comprises a DNA molecule encoding the same mature polypeptide encoded by the cDNA of human protein in ATCC Deposit No. 209960 (DNA59211-1450). • In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide that has at least about 80% sequence identity, preferably at least about 85% sequence identity, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 17 to about 89, inclusive of Figure 180 (SEQ ID NO: 262). In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding an extracellular domain (ECD) of PRO1069, with or without the N-terminal signal sequence and / or initiation methionine, and its soluble variants (ie, inactivated or deleted from the transmembrane domain (s)) or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 16 of the amino acid in the sequence of Figure 180 (SEQ ID NO: 262). A region of the transmembrane domain has tentatively been identified as extending from about position 36 of the amino acid to about position 59 of the amino acid in the amino acid sequence of PRO1069 (Figure 180, SEQ ID NO: 262).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 17 to approximately 89, inclusive of Figure 180 (SEQ ID NO: 262).

Another embodiment is directed to fragments of a sequence encoding the PRO1069 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1069 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PRO1069 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 17 to 89 of the • Figure 180 (SEC ID NO: 262).

In another aspect, the invention relates to an isolated PRO1069 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 15 95% sequence identity with the sequence of amino acid residues 1 or approximately 17 to approximately 89, inclusive of Figure f 180 (SEQ ID NO: 262).

In a further aspect, the invention relates to an isolated PRO1069 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 17 to about 89 of the • 5 Figure 180 (SEQ ID NO: 262).

In another aspect, the invention relates to an extracellular domain of PRO1069 comprising an amino acid sequence that has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 17 to X of Figure 180 (SEQ ID NO: 262), wherein X is • any of amino acid residues 32 to 41 of Figure 180 (SEQ ID NO: 262). In still another aspect, the invention relates to an isolated PRO1069 polypeptide, comprising the sequence of amino acid residues 1 or approximately 17 to about 89, Inclusive of Figure 180 (SEQ ID NO: 262), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 069 antibody. Preferably, the PRO1069 fragment retains a qualitative biological activity of a polypeptide • PRO1069 native.

In another aspect, the present invention is directed to fragments of a PRO1069 polypeptide that are long enough to provide an epitope against which an antibody can be generated.

In yet another embodiment, the invention relates to the agonists and antagonists of a PRO1069 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1069 antibody.

• In a further embodiment, the invention is refers to screening assays to identify agonists or antagonists of a native PRO1069 polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1069 polypeptide as defined herein above, in combination with a pharmaceutically acceptable carrier. • 76. PR01129 Applicants have identified a clone of CDNA (DNA59213-1487) that has homology with the members of the cytochrome P-450 family that encode the nucleic acid, which encodes a new Polypeptide, designated in the present application as • "PROL 129".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR01129 polypeptide.

In one aspect, nucleic acid isolated • comprises DNA that has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding a PR01129 polypeptide having the sequence of amino acid residues from about 1 or approximately up to 524, inclusive of Figure 182 (SEQ ID NO: 264), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01129 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 42 and about 1613 nucleotides, inclusive, of Figure 181 (SEQ. ID NO: 263). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No 209959 (DNA59213-1487). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209959 (DNA59213-1487).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately up to 524, inclusive of Figure 182 (SEC ID NO: 264).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01129 polypeptide, with or without the initiating methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. Transmembrane type II domains have tentatively been identified as extending from about position 13 of the amino acid to about position 32 of the amino acid and from about position 77 of the amino acid to about position 102 of the amino acid in the amino acid sequence of the amino acid. PR01129 (Figure 182, SEQ ID NO: 264).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 524, inclusive of Figure 182 (SEQ ID NO: 264).

Another embodiment is directed to fragments of a sequence encoding PR01129 polypeptide which can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length. • In another embodiment, the invention provides the isolated PR01129 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides sequence polypeptide PR01129 • isolated native, which in one embodiment, includes an amino acid sequence comprising the residues 1 to approximately 524 of Figure 182 (SEQ ID NO: 264).

In another aspect, the invention relates to an isolated PR01129 polypeptide, comprising a Amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • 5 more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 524, inclusive of Figure 182 (SEQ ID NO: 264).

In a further aspect, the invention is • refers to an isolated PR01129 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 to about 524, inclusive of Figure 182 (SEQ ID NO: 264).

In still another aspect, the invention relates to an isolated PR01129 polypeptide, comprising the sequence of amino acid residues 1 to about 524, inclusive of Figure 182 (SEQ ID NO: 264), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 129 antibody. Preferably, the PR01129 fragment retains a qualitative biological activity of a PR01129 polypeptide native.

In another aspect, the present invention is directed to fragments of a PR01129 polypeptide that are long enough to provide an epitope against which an antibody can be generated.

In still another embodiment, the invention relates to the agonists and antagonists of a PR01129 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR01129 antibody.

In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of a native PR01129 polypeptide.

Still in a further embodiment, the invention relates to a composition comprising - a PR01129 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. • 77. PRO1068 A cDNA clone (DNA59214-1449) has been identified, which encodes a new polypeptide having homology with urotensin and is designated in the present application as "PRO1068".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1068 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1068 polypeptide having the The sequence of amino acid residues is approximately from about 21 to about 124, inclusive of Figure 184 (SEQ ID NO: 266), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1068 polypeptide comprising the DNA that hybridizes to the complement of the nucleic acid in a manner between about 102 and about 413 residues, inclusive, of Figure 183 (SEQ. ID NO: 265). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a ) a molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203046 (DNA592-14-1449), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203046 (DNA592-14-1449).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide Which has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from about 21 to about 124, inclusive of Figure 184 (SEQ ID NO: 266), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides. nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1068 polypeptide having the sequence of amino acid residues roughly from 21 to about 124, inclusive of the Figure 184 (SEQ ID NO: 266), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least approximately a sequence identity of 85%, more preferably at least approximately a sequence identity of 90%, more preferably at least approximately a sequence identity of 95% with (a) or (b), isolating the molecule of test DNA.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1068 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 20 of the amino acid in the sequence of Figure 184 (SEQ ID NO: 266).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 21 to about 124, inclusive of Figure 184 (SEQ ID NO: 266), or (b) the DNA complement of Another embodiment is directed to fragments of a sequence encoding the PRO1068 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 60 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 50 nucleotides in length. approximately from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1068 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO1068 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 21 to 124 of Figure 184 (SEQ ID NO: 266).

In another aspect, the invention relates to an isolated PRO1068 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 21 to -about 124, inclusive of Figure 184 (SEQ ID NO: 266).

In a further aspect, the invention relates to an isolated PRO1068 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 21 to 124 of Figure 184 (SEQ ID NO: 266).

In still another aspect, the invention relates to an isolated PRO1068 polypeptide, comprising the sequence of amino acid residues 21 to about 124, inclusive of Figure 184 (SEQ ID NO: 266), or a fragment sufficient to provide a binding site for an anti i-PROl 068 antibody. Preferably, the PRO1068 fragment retains a qualitative biological activity of a native PRO1068 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1068 polypeptide having the sequence of the amino acid residues roughly from 21 to about 124, inclusive of Figure 184 (SEQ ID NO: 266), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one identity 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the culture. cell phone.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1068 polypeptide. In a particular embodiment, the agonist or antagonist is an anti i-PROl 068 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1068 polypeptide by contacting the native PRO1068 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1068 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier.

PRO1066 Applicants have identified a clone of CDNA (DNA59215-1425) encoding a new secreted polypeptide, designated in the present application as "PRO1066".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1066 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1066 polypeptide having the amino acid residue sequence from about 1 or approximately 24 to about 117, inclusive of the Figure 186 (SEQ ID NO: 268), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1066 polypeptide comprising DNA that hybridizes to the nucleic acid complement between about 176 or about 245 and about 527 nucleotides, inclusive, of Figure 185 (SEQ ID NO: 267). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No 209961 (DNA59215-1425). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209961 (DNA592-15-1425).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of residues 1 or approximately 24 to about 117, inclusive of Figure 186 (SEQ ID NO: 268).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1066 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 23 of the amino acid in the sequence of Figure 186 (SEQ ID NO: 268).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 24 to approximately 117, inclusive of Figure 186 (SEQ ID NO: 268).

Another embodiment is directed to fragments of a sequence encoding the PRO1066 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in an approximate manner. from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1066 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the isolated native sequence PRO1066 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 24 to about 117 of Figure 186 (SEQ ID NO: 268).

In another aspect, the invention relates to an isolated PRO1066 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 24 to about 117, inclusive of Figure 186 (SEQ ID NO. : 268).

In a further aspect, the invention relates to an isolated PRO1066 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 24 to about 117, inclusive of Figure 186 (SEQ ID NO: 268).

In yet another aspect, the invention relates to an isolated PRO1066 polypeptide, comprising the sequence of amino acid residues 1 or approximately 24 to about 117, inclusive of Figure 186 (SEQ ID NO: 268), or a sufficient fragment to provide a binding site for an anti i-PROl 066 antibody. Preferably, the PRO1066 fragment retains a qualitative biological activity of a native PRO1066 polypeptide.

In another aspect, the present invention is directed to fragments of a PRO1066 polypeptide that are long enough to provide an epitope against which an anti body can be generated. 79 PR01184 Applicants have identified a clone of CDNA (DNA59220-1514) encoding a new secreted polypeptide, designated in the present application as "PR01184".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01184 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01184 polypeptide having the amino acid residue sequence from about 1 or approximately 39 to 142 of Figure 188 (SEQ. ID NO: 270), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01184 polypeptide comprising DNA that hybridizes to the nucleic acid complement in about 106 or 220 to 531 residues of SEQ. ID NO: 269. Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC of DNA59220- 1514 In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the ADNc of the human protein in the ATCC Deposit of DNA592-201514.

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or about 39 to 142 of SEQ. ID NO: 270 In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01184 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble variants, or is complementary for such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from position 1 of the amino acid to approximately position 38 of the amino acid in the sequence of the SEC. ID NO: 270 In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 39 to 142 of SEC. ID NO: 270 Another embodiment is directed to fragments of a sequence encoding PR01184 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in an approximate manner. from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01184 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the isolated native sequence PR01184 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or about 39 to 142 of SEQ. ID NO: 270 In another aspect, the invention relates to an isolated PR01184 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or about 39 to 142 of SEQ. ID NO: 270 In a further aspect, the invention relates to an isolated PR01184 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 39 to 142 of SEQ. ID NO: 270 In yet another aspect, the invention relates to an isolated PR01184 polypeptide, comprising the sequence of amino acid residues 1 or about 39 to 142 of SEQ. ID NO: 270, or a sufficient fragment itself to provide a binding site for an anti i-PROl antibody 184. Preferably, the PR01184 fragment retains a qualitative biological activity of a native PR01184 polypeptide.

In another aspect, the present invention is directed to fragments of a PR01184 polypeptide that are long enough to provide an epitope against which an antisense can be generated. 80. PRO1360 A cDNA clone (DNA59488-1603), which codes for a polypeptide designated in the present application as "PRO1360" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1360 polypeptide.

In one aspect, nucleic acid isolated • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1360 polypeptide having the sequence of amino acid residues so approximate from 30 to about 285, inclusive of Figure 190 (SEQ ID NO: 272), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1360 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 140 and approximately 908 residues, inclusive, of FIG. 189 (SEQ. ID NO: 271). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, Most preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203157 (DNA59488-1603), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203157 (DNA59488-1603). 25 Still in an additional aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, so more preferably at least about 90% sequence identity, more preferably at least about 95% identity of sequence with the sequence of amino acid residues approximately from about 30 to about 285, inclusive of Figure 190 (SEQ ID NO: 272), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides, and which is produced by hybridizing a Test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1360 polypeptide having the sequence of amino acid residues roughly from 30 to about 285, inclusive of the Figure 190 (SEQ ID NO: 272), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, preferably to at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the DNA molecule test.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 30 to about 285, inclusive of Figure 190 (SEQ ID NO: 272), or (b) ) the DNA complement of Another embodiment is directed to fragments of a sequence encoding the PRO1360 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PRO1360 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO1360 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 30 to 285 of Figure 190 (SEQ ID NO: 272).

In another aspect, the invention relates to an isolated PRO1360 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 30 to about 285, inclusive of Figure 190 (SEQ ID NO: 272).

In a further aspect, the invention relates to an isolated PRO1360 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 30 to 20 285 of Figure 190 ( SEC ID NO: 272).

In still another aspect, the invention relates to an isolated PRO1360 polypeptide, comprising the sequence of amino acid residues 30 up to about 285, inclusive of Figure 190 (SEQ ID NO: 272), or a sufficient fragment itself to provide a binding site for an anti-PR01360 antibody. Preferably, the PRO1360 fragment retains a qualitative biological activity of a native PRO1360 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1360 polypeptide having the sequence of the amino acid residues roughly from 30 to about 285, inclusive of Figure 190 (SEQ ID NO: 272), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one identity 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the culture c elular In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1360 polypeptide. In a particular embodiment, the agonist or antagonist is an anti i-PROl 360 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1360 polypeptide, contacting the native PRO1360 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1360 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 81. PRO1029 A cDNA clone (DNA59493-1420) encoding a new secreted polypeptide, designated in the present application as "PRO1029" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1029 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1029 polypeptide having the amino acid residue sequence from about 1 or from about 20 to about 86, inclusive of the Figure 192 (SEQ ID NO: 274), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1029 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 39 or approximately 96 and approximately 296 nucleotides, inclusive, of the Figure 191 (SEQ ID NO: 274). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203050 (DNA59493-1420), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203050 (DNA59493-1420).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 20 to about 86, inclusive of Figure 192 (SEQ.

ID NO: 274), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1029 polypeptide having the amino acid residue sequence from 1 or approximately 20 to about 86, Inclusive of Figure 192 (SEQ ID NO: 274), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b) ), isolate the test DNA molecule. In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1029 polypeptide, with or without the N-terminal signal sequence and / or initiation methionine, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 19 of the amino acid in the sequence of Figure 192 (SEQ ID NO: 274).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (A) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 20 to about 86, inclusive of Figure 192 (SEQ ID NO: 274), or (b) the DNA complement of (a). Another embodiment is directed to fragments of a sequence encoding the PRO1029 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about approximately 50 nucleotides in length and more preferably approximately 20 to approximately 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 191 (SEQ ID NO: 273). In another embodiment, the invention provides the isolated PRO1029 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PRO1029 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising the residues 1 or approximately 20 to approximately 86 of Figure 192 (SEQ ID NO: 274).

In another aspect, the invention relates to a PRO1029 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or roughly to about 86, inclusive of the Figure 192 (SEQ ID NO: 274).

In a further aspect, the invention relates to an isolated PRO1029 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 20 to about 86, inclusive of Figure 192 (SEQ ID NO: 274).

In yet another aspect, the invention relates to an isolated PRO1029 polypeptide, comprising the sequence of amino acid residues 1 or approximately 20 to about 86, inclusive of Figure 192 (SEQ ID NO: 274), or a fragment sufficient to provide a binding site for an anti-iPROl 029 antibody. Preferably, the PRO1029 fragment retains a qualitative biological activity of a native PRO1029 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1029 polypeptide having the sequence of the amino acid residues from about 1 or approximately 20 to about 86, inclusive of Figure 192 (SEQ ID NO: 274), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering he polypeptide of the cell culture. 82 PR01139 Applicants have identified a new cDNA clone (DNA59497-1496) encoding a new human protein originally designated PR01139.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90 % sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01139 polypeptide having the sequence of amino acid residues roughly from 29 to about 131 of the Figure 194 (SEQ ID NO: 276), or (b) the complement of the DNA molecule of (a).

In another embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA that hybridizes to the complement of the polynucleotide sequence between about 80 and 391 residues, inclusive, of Figure 193 (SEQ ID NO: 275). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No 209941 (DNA59497-1496). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209941 (DNA59497-1496).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 29 to about 131 of Figure 194 (SEQ. ID NO: 276).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01139 native or variant polypeptide, with or without the N-terminal signal sequence, and with or without the transmembrane regions which have been identified as extending from about position 33 of the amino acid to about position 52 of the amino acid; from about position 71 of the amino acid to about position 89 of the amino acid; and from about position 98 of the amino acid to about position 120 of the amino acid, respectively of the amino acid sequence of Figure 194, SEQ. ID NO: 276. In one aspect, the isolated nucleic acid comprises the DNA encoding a full-length native PR01139 polypeptide having amino acid residues 1 to 131 of Figure 194, SEQ. ID NO: 276, or is complementary to such a coding nucleic acid sequence.

In another embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of the residues approximately from 29 to approximately 131 of Figure 194 (SEQ ID NO: 276).

In another embodiment, the invention provides the isolated PR01139 polypeptides. In particular, the invention provides the PR01139 native sequence polypeptide, isolated, which in one embodiment, includes an amino acid sequence comprising residues 29 to 131 of Figure 194 (SEQ ID NO: 276). The invention also provides the PR01139 polypeptide variants which are encoded by any of the isolated nucleic acid molecules defined hereinbefore. Specific variants include, but are not limited to, elimination variants (truncated) of full-length native sequence PR01139 which lack the N-terminal signal sequence and / or have at least one transmembrane domain 5 deleted or deleted. inactivated Variants specifically include the mature full-length polypeptide variants of Figure 194 (SEQ ID NO: 276) in which one or more of the transmembrane regions between the residues of amino acids 33-52, 71-8, and 98-120, respectively, have been eliminated or inactivated, and which additionally may have the N-terminal signal sequence (amino acid residues 1-28) and / or initiation methionine eliminated. In a further embodiment, the invention relates to an isolated PR01139 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of the residues of Approximately from 29 to about 131 of the Fi to ra 1 9 4 (S EC, I D NO: 2 7 6) In still another aspect, the invention relates to an isolated PR01139 polypeptide, comprising the sequence of amino acid residues 29 to about 131, inclusive of Figure 194 (SEQ ID NO: 276) or a sufficient fragment itself to provide a binding site for an anti i-PROl 139 antibody. Preferably, the PR01139 fragment retains a qualitative biological activity of a native PR01139 polypeptide.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01139 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 139 antibody.

In a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of a native PR01139 polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01139 polypeptide (including variants), or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier.

The invention also relates to a method for treating obesity which comprises administering to a patient an effective amount of an antagonist of a PR01139 polypeptide. In a specific embodiment, the antagonist is a blocking antibody that specifically binds to a native PR01139 polypeptide. 83 PRO1309 A cDNA clone has been identified (DNA595) 1571) which encodes a new polypeptide having leucine-rich repeats and is designated in the present application as "PRO1309".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1309 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1309 polypeptide having the sequence of amino acid residues roughly from about 35 to about 522, inclusive of Figure 196 (SEQ ID NO: 278), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1309 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 822 and approximately 2285 residues, inclusive, of Figure 195 (SEQ ID NO: 277). Preferably, the hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with ( a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203106 (DNA59588-1571), or (b) the complement of the DNA molecule of (a). In a In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203106 (DNA59588-1571).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least approximately 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the residue sequence of amino acids approximately from 35 to about 522, inclusive of Figure 196 (SEQ ID NO: 278), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides, and which is produced by hybridizing a DNA test molecule under severe conditions. with (a) a DNA molecule encoding a PRO1309 polypeptide having the sequence of amino acid residues roughly from 35 to about 522, inclusive of Figure 196 (SEQ ID NO: 278), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about a sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1309 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e. inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 34 of the amino acid in the sequence of Figure 196 (SEQ ID NO: 278). The transmembrane domain has tentatively been identified as extending from about position 428 of the amino acid to about position 450 of the amino acid in the amino acid sequence of PRO1309 (Figure 196, SEQ ID NO: 278).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 35 to about 522, inclusive of Figure 196 • (SEQ ID NO: 278), or (b) the DNA complement of Another embodiment is directed to fragments of a sequence encoding PR01277 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about 40 nucleotides in length. In another embodiment, the invention provides the isolated PRO1309 polypeptide encoded by any of the isolated nucleic acid sequences defined herein. In a specific aspect, the invention provides the PRO1309 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the • residues 35 to 522 of Figure 196 (SEQ ID NO: 278).

In another aspect, the invention relates to an isolated PRO1309 polypeptide, comprising a amino acid sequence that has at least • approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues up to about 522, inclusive of Figure 196 (SEQ ID NO: 278).

In a further aspect, the invention relates to an isolated PRO1309 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 35 to 522 of Figure 196 (SEQ ID NO: 278). • In still another aspect, the invention relates to an isolated PRO1309 polypeptide, comprising the sequence of amino acid residues 35 to about 522, inclusive of Figure 196 (SEQ ID NO: 278), or a fragment itself enough • to provide a binding site for an anti-i-PROl 309 antibody. Preferably, the PRO1309 fragment retains a qualitative biological activity of a native PRO1309 polypeptide. Still in a further aspect, the invention provides a polypeptide produced (i) • hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a PRO1309 polypeptide having the sequence of amino acid residues roughly from 35 to about 522, inclusive of Figure 196 (SEQ ID NO: 278), or (b) the complement of the DNA molecule of (FIG. a), and if the The test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1309 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 309 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1309 polypeptide by contacting the native PRO1309 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1309 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 84 PRO1028 Applicants have identified a cDNA clone encoding a new secreted polypeptide, wherein the polypeptide is designated in the present application as "PRO1028".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1028 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO1028 polypeptide having amino acid residues 1 through 197 of Figure 198 (SEQ ID NO: 281), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least conditions moderate, and optionally, under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on June 9, 1998 with the ATCC as DNA59603-1419 which includes the nucleotide sequence encoding PRO1028.

In another embodiment, the invention provides the PRO1028 polypeptide isolated. In particular, the invention provides the PRO1028 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 through 197 of Figure 198 (SEQ ID NO: 281). Optionally, the PRO1028 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the vector deposited on June 9, 1998 with the ATCC as DNA59603-1419. 85 PRO1027 A cDNA clone (DNA59605-1418), which has a collagen binding domain of fibronectin type II, which codes for a new polypeptide, designated in the present application as "PRO1027".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1027 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , more preferably at least about 95% sequence identity with (a) a molecule of • DNA encoding a PRO1027 polypeptide having the sequence of amino acid residues roughly from 1 or 34 to about 77, inclusive of Figure 200 (SEQ ID NO: 283), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and • means that it refers to two alternative modalities provided in the present, it is say, 1-77, or in another modality, 34-77.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1027 polypeptide comprising the DNA 'that hybridizes to the nucleic acid complement approximately between 31 or 130 and approximately 261 residues, inclusive, of Figure 199 (SEQ ID NO: 282). Preferably, hybridization occurs under severe washing and drying conditions.

• Hybridization.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203005 (DNA59605-1418), or (b) the complement of the molecule of DNA from (a). In a In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203005 (DNA59605-1418).

Still in a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% of sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from 1 or 34 to about 77, inclusive of Figure 200 (SEQ ID NO: 283), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1027 polypeptide having the amino acid residue sequence in a manner approximate from 1 or 34 to approximately 77, inclusive of Figure 200 (SEQ ID NO: 283), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about a sequence identity of 80%, preferably at least approximately a sequence identity of 85%, more preferably at least approximately a sequence identity of 90%, more preferably at least approximately a sequence identity 95% with (a) or (b), • 5 isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 34 to about 77, inclusive of Figure 200 (SEQ ID NO: 283), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PRO1027 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the PRO1027 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 or 34 through 77 of Figure 200 (SEQ ID NO: 283).

In another aspect, the invention relates to an isolated PRO1027 polypeptide, comprising an amino acid sequence having at least approximately 80% sequence identity, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 34 up to approximately 77, inclusive of Figure 200 (SEC • ID NO: 283).

In a further aspect, the invention relates to an isolated PRO1027 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 34 through 77 of Figure 200 (SEQ ID NO: 283) .

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that encodes a PRO1027 polypeptide having the • sequence of the amino acid residues approximately from 1 or 34 to approximately 77, inclusive of Figure 200 (SEQ ID NO: 283), or (b) the complement of the DNA molecule of (a), and the The test DNA molecule has at least approximately 80% sequence identity, preferably at least about 85% • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture In yet another embodiment, the invention relates to the agonists and antagonists of a • PRO1027 native polypeptide. In a particular embodiment, the agonist or antagonist is an anti-iPROl 02 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or • antagonists of a native PRO1027 polypeptide, by contacting the native PRO1027 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide. Still in a further embodiment, the invention relates to a composition comprising a PRO1027 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 86. PRO1107 Applicants have identified a clone of cDNA encoding a new polypeptide having sequence identity with PC-1, wherein the polypeptide is designated in the present application as "PRO1107".

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1107 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO1107 polypeptide having the amino acid residues 1 to 477 of the Figure 202 (SEQ ID NO: 285), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly severe conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding the PRO1107 polypeptide having the residues of • amino acids from about 23 to 477 of Figure 202 (SEQ ID NO: 285) or the amino acids of approximately 1 or 23 to 428 ± 5 of Figure 202 (SEQ ID NO: 285), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally , low highly severe conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA59606-1471 vector deposited on June 9, 1998 with the ATCC, which includes the nucleotide sequence encoding PRO1107. • In another embodiment, the invention provides the PRO1107 polypeptide isolated. In particular, the invention provides the PRO1107 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 477 of Figure 202 (SEQ ID NO: 285). Additional embodiments of the present invention are directed to PRO1107 polypeptides comprising amino acids 23 to 477 of the Figure 202 (SEQ ID NO: 285) or the amino acids of about 1 or 23 to 428 ± 5 of Figure 202 (SEQ ID NO: 285). Optionally, the polypeptide • PRO1107 is obtained or can be obtained by expressing the polypeptide encoded by the insert cDNA of the vector DNA59606- 1471 deposited with the ATCC on June 9, 1998. 7. PRO1140 Applicants have identified a 25 cDNA clone, DNA59607-1497, which encodes a new transmembrane polypeptide of mul-t-spaces wherein the polypeptide is designated in the present application as "PRO1140". # 5 In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1140 polypeptide.

In one aspect, nucleic acid isolated comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a molecule of DNA encoding a PRO1140 polypeptide having the • sequence of amino acid residues from 1 to about 255, inclusive of Figure 204 (SEQ ID NO: 287), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1140 polypeptide comprising DNA that - - hybridizes to the complement of the nucleic acid sequence having from about 210 to about 974 residues, inclusive, of Figure 203 (SEQ ID NO: 286). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Repository No. 209946 (DNA59607-1497), which was deposited on June 9, 1998, or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209946 (DNA59607-1497).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with the sequence of amino acid residues 1 to about 255, inclusive of Figure 204 (SEQ ID NO: 287).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding an extracellular domain (ECD) of PRO1140, with or without the initiating methionine, and its soluble variants (ie, inactivated or deleted from the transmembrane domain (s)) or is complementary to such a coding nucleic acid molecule. Referring to the amino acid sequence of PRO1140 (SEQ ID NO: 287) shown in Figure 204, The regions of the transmembrane domain have been tentatively identified as extending approximately from amino acid positions 101 to approximately 118, from approximately 141 to approximately 161, and from • approximate manner from 172 to approximately 191.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA encoding a registry of the polypeptide of • at least about 80% positive, preferably at least about 90% positive, more preferably at least about 95% positive when compared to the sequence of amino acids from residues 1 to about 255, inclusive of Figure 204 (SEQ ID NO: 287).

• Another modality is directed to fragments of a sequence encoding the PRO1140 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about 40 nucleotides in length. • In another embodiment, the invention provides the isolated PRO1140 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

• In a specific aspect, the invention provides the isolated native sequence PRO1140 polypeptide, which in one embodiment, includes an amino acid sequence comprising the residues 1 to 255 of Figure 204 (SEQ ID NO: 287).

In another aspect, the invention relates to an isolated PRO1140 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to 255, inclusive of the Figure 204 (SEQ ID NO: 287) In a further aspect, the invention relates to an isolated PRO1140 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 255 of Figure 204 (SEQ ID NO: 287).

In another aspect, the invention relates to an extracellular domain of PRO1140 comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 through X of Figure 204-1 (SEQ ID NO: 287), wherein X is any of amino acid residues 96 to 105 of Figure 204 (SEQ ID NO: 287).

• In yet another aspect, the invention relates to an isolated PRO1140 polypeptide, comprising the sequence of amino acid residues 1 to about 255, inclusive of Figure 204 (SEQ ID NO: 287), or a sufficient fragment thereof 10 to provide a link site for a • anti-i-PROl antibody 140. Preferably, the PRO1140 fragment retains a qualitative biological activity of a native PRO1140 polypeptide.

In another aspect, the present invention is directed to fragments of a PRO1140 polypeptide that are sufficiently long to provide • an epitope against which an anti body can be generated. 20 88. PRO1106 Applicants have identified a clone of CDNA encoding a new polypeptide having sequence identity with a soluble carrier dependent on peroxisomal calcium, wherein the polypeptide is designated in the present application as "PROl 106".

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PRO1106 polypeptide. In one aspect, the isolated nucleic acid comprising the DNA encoding the PRO1106 polypeptide having amino acid residues 1 through 469 of the Figure 206 (SEQ ID NO: 289), or is complementary to such a coding nucleic acid sequence, and remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. The acid sequence The isolated nucleic may comprise the cDNA insert of the vector DNA59609-1470 deposited on June 9, 1998 with the ATCC, which includes the nucleotide sequence encoding PRO1106.

In another embodiment, the invention provides the PRO1106 polypeptide isolated. In particular, the invention provides the PRO1106 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising waste 1 to 469 of Figure 206 (SEQ ID NO: 289). Optionally, the PRO1106 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the vector DNA59609-1470 deposited with the ATCC on June 9, 1998. 89. PR01291 A cDNA clone (DNA59610-1556) has been identified, which has homology with butyrophilin that encodes the nucleic acid, which encodes a new • polypeptide, designated in the present application as "PR01291".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01291 polypeptide.

• In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PR01291 polypeptide having the amino acid residue sequence from about 1 or approximately 29 to about 282, inclusive of Figure 208 • (SEQ ID NO: 291), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR01291 polypeptide comprising the DNA that • hybridizes to the nucleic acid complement of between about 61 or approximately 145 and about 906 nucleotides, inclusive, of Figure 207 (SEQ ID NO: 290). Preferably, the Hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, More preferably at least about 95% - - sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209990 (DNA59610-1556) , or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209990 (DNA59610-1556). 10 • In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% • sequence identity, more preferably at least about 95% identity of Sequence with the sequence of amino acid residues 1 or approximately 29 to about 282, inclusive of Figure 208 (SEQ ID NO: 291), or (b) the DNA complement of (a). In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a low test DNA molecule. • severe conditions with (a) a DNA molecule encoding a PR01291 polypeptide having the sequence of the amino acid residues from 1 or approximately 29 to about 282, inclusive of Figure 208 (SEQ ID NO: 291), or (b) the complement of the DNA molecule of (a), and, if • the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least Approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01291 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, is In other words, the variants inactivated or deleted from the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending roughly from • position 1 of the amino acid to approximately position 28 of the amino acid in the sequence of Figure 208 (SEQ ID NO: 291). The transmembrane domain has tentatively been identified as extending roughly from the position 258 of the amino acid to about position 281 of the amino acid in the amino acid sequence of PR01291 (Figure 208, SEQ ID NO: 291).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 29 to about 282, inclusive of Figure 208 (SEQ ID NO: 291), or (b) - e the coding of the DNA of (a) Another embodiment is directed to fragments of a sequence encoding PR01291 polypeptide • 5 that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 207 (SEQ ID NO: 290).

In another embodiment, the invention provides the isolated PR01291 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01291, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 29 to approximately 282 of Figure 208 (SEQ ID NO. : • 291).

In another aspect, the invention relates to an isolated PR01291 polypeptide, comprising an amino acid sequence having at least approximately 80% sequence identity, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 29 to about 282, inclusive of Figure 208 (SEQ ID NO: 291).

In a further aspect, the invention relates to an isolated PR01291 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 29 to about 282, • inclusive of Figure 208 (SEQ ID NO: 291).

In still another aspect, the invention relates to an isolated PR01291 polypeptide, comprising the sequence of amino acid residues 1 or approximately to about 282, • inclusive of Figure 208 (SEQ ID NO: 291), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 291 antibody. Preferably, the PR01291 fragment retains a qualitative biological activity of a native PR01291 polypeptide.

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01291 polypeptide having the sequence of the amino acid residues approximately from 1 or approximately 29 to approximately 282, inclusive of Figure 208 (SEQ ID NO: 291), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one sequence identity 80%, preferably at least • about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) cultivating a cell host or host comprising the DNA molecule • test under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In still another embodiment, the invention relates to agonists and antagonists of a native PR01291 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 291 antibody. In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01291 polypeptide, by contacting the native PR01291 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising • a PR01291 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier 90 PRO1105 • Applicants have identified a clone of CDNA encoding a new polypeptide having two transmembrane domains, wherein the polypeptide is designated in the present application as "PROl 105".

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PRO1105 polypeptide. In a aspect, the isolated nucleic acid comprising the DNA encoding the PRO1105 polypeptide having amino acid residues 1 through 180 of Figure 210 (SEQ ID NO: 293), or is complementary to such a coding nucleic acid sequence, and it remains stably attached thereto under at least moderate conditions, and optionally, under highly stringent conditions. In other aspects, the isolated nucleic acid comprises the DNA encoding the PRO1105 polypeptide having the residues of • 5 amino acids from about 20 to 180 of Figure 210 (SEQ ID NO: 293), or is complementary to such a coding nucleic acid sequence, and remains stably bound thereto under at least moderate conditions, and so optional, under highly stringent conditions. The • isolated nucleic acid sequence may comprise the cDNA insert of the DNA59612-1466 vector deposited on June 9, 1998 with the ATCC, which includes the nucleotide sequence that codes to PRO1105.

In another embodiment, the invention provides the PRO1105 polypeptide isolated. In particular, the invention provides the PRO1105 polypeptide of the The isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 180 of Figure 210 (SEQ ID NO: 293). Additional embodiments of the present invention are directed to PRO1105 polypeptides comprising amino acids 20 to 180 of - Figure 210 (SEQ ID NO: 293). Other embodiments of the present invention are directed to PRO1105 polypeptides comprising amino acids from about 1 to 79 and 100 up to • approximately 144 of Figure 210 (SEQ ID NO: 293). Optionally, the PRO1105 polypeptide is obtained or can be obtained by expressing the polypeptide encoded by the cDNA insert of the DNA59612-1466 vector deposited with the ATCC on 9 June 10, 1998. • 91. PR0511 A cDNA clone (DNA59613-1417) has been identified, which has some sequence identity with RoBo-1 and phospholipase inhibitors, which encodes a new polypeptide, designated in the present application as "PRO1026".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1026 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with ( a) a DNA molecule encoding a PRO1026 polypeptide having the sequence of the amino acid residues roughly from 1 or 26 to about 237, inclusive of Figure 212 (SEQ ID NO: 295), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, that is, 1-237, or in another embodiment, 26-237.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1026 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 233 or 308 and approximately 943 residues, inclusive, of Figure 212 ( SEC ID NO: 295). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of # DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203007 (DNA59613-1417), or (b) the complement of the DNA molecule of (a). In a In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203007 (DNA59613-1417).

Still in a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the 5 amino acid residues approximately from 1 6 26 to about 237, inclusive of Figure 212 (SEQ ID NO: 295), or the DNA complement of (a).

In a further aspect, the invention is refers to an isolated nucleic acid molecule • produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PRO1026 polypeptide having the sequence of amino acid residues so approximate from 1 or 26 to approximately 237, inclusive of Figure 212 (SEQ ID NO: 295), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, so preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b) , Isolate the DNA molecule from the test.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry ^ of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or 26 to about 237, inclusive of Figure 212 (SEQ ID NO: 295), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PRO1026 polypeptide encoded by any of the isolated f nucleic acid sequences defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO1026 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 26 through 237 of Figure 212 (SEQ.

NO: 295).

In another aspect, the invention relates to an isolated PRO1026 polypeptide, comprising an amino acid sequence having at least • approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of • the amino acid residues 26 to approximately 237, inclusive of Figure 212 (SEQ ID NO: 295).

In a further aspect, the invention relates to an isolated PRO1026 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 26 through 237 of Figure 212 (SEQ ID NO: 295) . Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that • 5 encodes a PRO1026 polypeptide having the sequence of amino acid residues roughly from 1 or 26 to about 237, inclusive of Figure 212 (SEQ ID NO: 295), or (b) the complement of the DNA from (a), and if the The test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to the agonists and antagonists of a PRO1026 native polypeptide. In a particular embodiment, the ant agonist agonist is an anti-PRO-026 antibody.

In a further embodiment, the invention is • refers to a method for identifying agonists or antagonists of a native PRO1026 polypeptide by contacting the native PRO1026 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide. Still in a further embodiment, the invention relates to a composition comprising a PRO1026 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 92. PRO1104 A cDNA clone (DNA59616-206565), which codes for a new polypeptide, designated in the present application as "PRO1104" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1104 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule DNA encoding a PRO1104 polypeptide having the • sequence of the amino acid residues from about 1 or approximately 23 to about 341, inclusive of Figure 214 (SEQ ID NO: 297), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, that is, 1-341, or in another embodiment, 23-204.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1104 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 109 or 175 and approximately 1131 residues, inclusive, of Figure 213 (SEQ ID NO: 296). Preferably, hybridization occurs under severe washing and drying conditions.

• Hybridization.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209991 (DNA59616-1465), or (b) the molecule's complement of DNA from (a). In a In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209991 (DNA59616-1465).

Still in a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the residue sequence of amino acids approximately from 1 or so • about 23 to about 341, inclusive of Figure 214 (SEQ ID NO: 297), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1104 polypeptide having the amino acid residue sequence approximately from 1 or approximately 23 to approximately 341, inclusive of Figure 214 (SEQ ID NO: 297), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably • 5 preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising • (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 15 90% positive, more preferably at least about 95% positive % positive when compared to the amino acid sequence of residues 1 or approximately 23 to approximately 341, inclusive of Figure 214 (SEQ ID NO: 297), or (b) 20 the DNA complement of (a) .

In another embodiment, the invention provides the isolated PRO1104 polypeptide encoded by any of the nucleic acid sequences isolates defined herein.

In a specific aspect, the invention provides the isolated native sequence PRO1104 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or approximately 23 to 341 of Figure 214 (SEQ ID NO: 297 ).

In another aspect, the invention relates to an isolated PRO1104 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or roughly 23 to about 341, inclusive of Figure 214 (SEQ ID NO: 297).

In a further aspect, the invention relates to an isolated PRO1104 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 % positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or approximately 23 to 341 of Figure 214 (SEQ ID NO: 297).

Still in a further aspect, the invention provides a polypeptide produced (i) • hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1104 polypeptide having the sequence of the amino acid residues so approximated from 1 or approximately 23 to approximately 341, inclusive of Figure 214 (SEQ ID NO: 297), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one identity of sequence 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of sequence with (a) or (b), (ii) cultivating a cell -. - a host or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. • 93 PRO1100 A cDNA clone (DNA59619-1464) encoding a new polypeptide having multiple transmembrane domains, designated in the present application as "PRO1100" has been identified. • In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1100 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1100 polypeptide having the amino acid residue sequence approximately from 1 or 21 to about 320, inclusive of Figure 216 (SEQ ID NO: 299), or (b) the complement of the DNA molecule of (a). The term "or" as used herein is • refers to amino acids or nucleic acids and means that it refers to two alternative modalities provided in the present, that is, 1-320, or in another modality, 21-320.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1100 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 33 or 93 and approximately ,992 residues, inclusive, of Figure 215 (SEQ ID NO: 298). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in ATCC Deposit No. 203041 (DNA59619-1464), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203041 (DNA596-19-1464).

In still a further aspect, the invention relates to an isolated nucleic molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino residues approximately from 1 or 21 to about 320, inclusive of Figure 216 (SEQ ID NO: 299), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1100 polypeptide having the amino residue sequence of approximately from 1 or 21 to about 320, inclusive of Figure 216 (SEQ ID NO: 299), or (b) the complement of the DNA molecule of (a), and, if • the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least Approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic molecule comprising the DNA encoding a PRO1100 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, is In other words, the variants inactivated or deleted from the transmembrane domain, or is complementary to such a coding nucleic molecule.

In another aspect, the invention relates to • an isolated nucleic molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • about 95% positive when compared to the amino sequence of residues 1 or 21 to about 320, inclusive of Figure 216 (SEQ ID NO: 299), or (b) the DNA complement from (a).

In another embodiment, the invention provides the isolated PROllOO polypeptide encoded by any of the nucleic sequences isolated defined hereinbefore.

In a specific aspect, the invention provides the PROllOO polypeptide of isolated native sequence, which in one embodiment, includes An amino sequence comprising residues 1 or 21 to 320 of Figure 216 (SEQ ID NO: 299).

In another aspect, the invention relates to a • 5 PROllOO polypeptide isolated, comprising an amino sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of amino residues 1 or 21 to about 320, inclusive of Figure 216 (SEQ ID NO: 299).

In a further aspect, the invention relates to a PROllOO polypeptide isolated, comprising an amino sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino sequence of residues 1 or 21 to 320 of Figure 216 (SEQ ID NO: 299) In yet a further aspect, the invention provides a polypeptide produced (i) • 5 hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PROllOO polypeptide having the sequence of the amino acid residues roughly from 1 or 21 to about 320, inclusive of Figure 216 (SEQ ID NO: 299), or (b) • the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% of Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host what comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PROllOO polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO-100 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PROllOO polypeptide, by contacting the native PROllOO polypeptide with a candidate molecule and monitoring one • biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO100 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 94 PR0836 A cDNA clone (DNA59620-1463), which has some sequence identity with the SLS1 encoding a new polypeptide, designated in the present application as "PR0836" has been identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0836 polypeptide.

• In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0836 polypeptide having the sequence of amino acid residues so approximate from 1 or 30 to approximately 461, inclusive of Figure 218 (SEQ ID NO: 301), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, that is, 1-461, or in another embodiment, 30-461.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0836 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 65 or 152 and approximately 1447 residues, inclusive, of the Figure 217 (SEQ ID NO: 300). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .209989 (DNA59620-1463), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209989 (DNA59620-1463).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 or 30 to about 461, inclusive of Figure 218 (SEQ ID NO: 301), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0836 polypeptide having the amino acid residue sequence in a manner approximate from 1 or 30 to approximately 461, inclusive of Figure 218 (SEQ ID NO: 301), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about a sequence identity of 80%, preferably at least approximately a sequence identity of 85%, more preferably at least approximately a sequence identity of 90%, • more preferably at least about 95% sequence identity with (a) or (b), isolating the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising • (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 30 to about 461, inclusive of Figure 218 (SEQ ID NO: 301), or (b) the DNA complement from (a).

In another embodiment, the invention provides the isolated PR0836 polypeptide encoded by any of the nucleic acid sequences isolates defined herein.

In a specific aspect, the invention provides the PR0836 polypeptide of isolated native sequence, which in one embodiment, includes • an amino acid sequence comprising residues 1 or 30 to 461 of Figure 218 (SEQ ID NO: 301).

In another aspect, the invention relates to a PR0836 polypeptide isolated, comprising one • amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of • the amino acid residues 30 to about 461, inclusive of Figure 21 (SEQ ID NO: 301).

In a further aspect, the invention relates to an isolated PR0836 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or 30 to 461 of Figure 218 (SEQ ID NO: 301).

In yet a further aspect, the invention provides a polypeptide produced (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0836 polypeptide having the sequence of the amino acid residues roughly from 1 or 30 to about 461, inclusive of Figure 218 (SEQ ID NO: 301), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity , preferably at least about 85% of Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host cell or host what comprises the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR0836 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0836 antibody. 10 • In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0836 polypeptide, by contacting the native PR0836 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0836 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier.

PR01141 A cDNA clone (DNA59625-1498) encoding a new transmembrane polypeptide, designated in the present application f as "PR01141" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01141 polypeptide. • In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01141 polypeptide having the amino acid residue sequence from about 1 or approximately 20 to about 247, inclusive of Figure 220 (SEQ ID NO: 303), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01141 polypeptide comprising DNA that hybridizes to the nucleic acid complement of between about 204 or approximately 261 and about 944 nucleotides, inclusive, of the Figure 219 (SEQ ID NO: 302). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .209992 (DNA59625-1498), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209992 (DNA59625-1498).

In still a further aspect, the invention • 5 refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% • sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 20 up to approximately 247, inclusive of Figure 220 (SEQ ID NO: 303), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01141 polypeptide that has the amino acid residue sequence from 1 or from Approximately 20 to about 247, inclusive of Figure 220 (SEQ ID NO: 303), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about one 80% sequence identity, so preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b) ), 10 isolate the test DNA molecule. • In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PR01141, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. He The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 19 of the amino acid in the sequence of Figure 220 (SEQ ID NO: 303). The domains of Transmembrane have tentatively been identified as extending from about position 38 of the amino acid to about position 57 of the amino acid, from about position 67 of the amino acid to about position 83 of the amino acid, from about position 117 of the amino acid. amino acid to about position 139 of the amino acid and from about position 153 of the amino acid to about the position 170 of the amino acid, in the amino acid sequence • of PR01141 (Figure 220, SEC ID NO: 303).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (A) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 20 to approximately 247, inclusive of Figure 220 (SEQ ID NO: 303), or (b) the DNA complement of (FIG. to) . Another embodiment is directed to fragments of a sequence encoding PR01141 polypeptide that can find use as hybridization probes. Such nucleic acid fragments • 5 are roughly from 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 10 nucleotides in length and more • preferably roughly from about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 219 (SEQ ID NO: 302). In another embodiment, the invention provides the isolated PR01141 polypeptide encoded by -P any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the isolated native sequence PR01141 polypeptide, which in certain embodiments, includes an amino acid sequence comprising the waste 1 or approximately 20 to approximately 247 of Figure 220 (SEQ ID NO 303).

In another aspect, the invention relates to an isolated PR01141 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 20 to about 247, inclusive of the Figure 220 (SEQ ID NO: 303).

In a further aspect, the invention relates to an isolated PR01141 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 20 to about 247, inclusive of Figure 220 (SEQ ID NO: 303).

In still another aspect, the invention relates to • 5 to an isolated PR01141 polypeptide, comprising the sequence of amino acid residues 1 or from about 20 to about 247, inclusive of Figure 220 (SEQ ID NO: 303), or a sufficient fragment itself to provide a binding site for an anti-i-PROl antibody 141.

• Preferably, the PR01141 fragment retains a qualitative biological activity of a native PR01141 polypeptide.

In still a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01141 polypeptide having the Sequence of amino acid residues from about 1 or from about 20 to about 247, inclusive of Figure 220 (SEQ ID NO: 303), or (b) the complement of the DNA molecule of (a), and if the DNA molecule of The test has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% of sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. • In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA33128 comprising the sequence nucleotides of the SEC. ID NO: 304 (see Figure 221).

In another embodiment, the invention provides an expressed sequence tag (EST) designated in present as DNA34256 comprising the nucleotide sequence of SEQ. ID NO: 305 (see Figure 222).

In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA47941 comprising the nucleotide sequence of SEQ. ID NO: 306 (see Figure 223).

• In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA54389 comprising the nucleotide sequence of SEQ. ID NO: 307 (see Figure 224). 10 • 96. PR01132 A cDNA clone (DNA59767-1489) encoding a new polypeptide having sequence identity with the serine proteases and the trypsinogen and is designated in the present application as "PR01132".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR01132 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding a PR01132 polypeptide having the sequence of amino acid residues approximately from about 23 to about 293, inclusive of Figure 226 (SEQ ID NO: 309), or (b) the complement of the DNA molecule of (a). • In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01132 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of Approximately 420 to about 1232 residues, inclusive, of Figure 225 (SEQ ID NO: 308). Preferably, the hybridization occurs under • severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Repository No. 203108 (DNA59767-1489), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the • ATCC Deposit No. 203108 (DNA59767 - 1489).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from about 23 to about 293, inclusive of Figure 226 (SEQ ID NO: 309), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides, and which is produced by hybridizing a DNA test molecule under severe conditions with ( a) a DNA molecule encoding a PRO1309 polypeptide having the sequence of amino acid residues roughly from • 23 to approximately 293, inclusive of Figure 226 (SEQ ID NO: 309), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately one identity of Sequence of 80%, preferably at least about a sequence identity of 85%, more preferably at least about a sequence identity of 90%, more preferably at least about one identity of % sequence with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (A) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 23 to approximately 293, inclusive of Figure 226 (SEQ ID NO: 309), or (b) the DNA complement of • Another embodiment is directed to the fragments of a sequence encoding the PR01132 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 to about 80 nucleotides in length, preferably approximately from 20 to • approximately 60 nucleotides in length, more preferably from approximately 20 to approximately 50 nucleotides in length, and more preferably approximately 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01132 polypeptide encoded by any of the isolated nucleic acid sequences defined hereinbefore.

In a specific aspect, the invention • provides the isolated native sequence PR01132 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 23 through 293 of Figure 226 (SEQ ID NO: 309). • In another aspect, the invention relates to an isolated PR01132 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of amino acid residues 23 to about 293, inclusive of Figure 226 (SEQ ID NO: 309).

In a further aspect, the invention relates to an isolated PR01132 polypeptide, which comprises a record of the amino acid sequence of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive when compare with the amino acid sequence of residues 23 through 293 of Figure 226 (SEQ ID NO: 309).

In still another aspect, the invention relates to to an isolated PR01132 polypeptide, comprising • sequence of amino acid residues 23 to approximately 293, inclusive of Figure 226 (SEQ ID NO: 309), or a sufficient fragment itself to provide a link site for a Anti-i-PROl 132 antibody. Preferably, the PR01132 fragment retains a qualitative biological activity of a native PR01132 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01132 polypeptide having the sequence of the amino acid residues so 25 approximate from 23 to about 293, inclusive of Figure 226 (SEQ ID NO: 309), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, F preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) cultivating a host cell or host that F comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. In still another embodiment, the invention relates to the agonists and antagonists of a native PR01132 polypeptide. In a particular embodiment, the agonist or antagonist is a Ant i-PROl 132 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01132 polypeptide, by contacting the native PR01132 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional modality, the • invention relates to a composition comprising a PR01132 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 10 • 97. PR01346 A cDNA clone (DNA59776-1600), which codes for a new polypeptide, designated in the present application as PR01346 (or NL7), has been identified which has homology with the known TIE ligands.

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding an NL7 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding an NL7 polypeptide having the • sequence of amino acid residues approximately from 51 to approximately 461, inclusive of Figure 228 (SEQ ID NO: 314), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to a • isolated nucleic acid molecule encoding an NL7 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 1-3 (ATG) and approximately 1381-1583 nucleotides (CGC, which precedes the TAG stop codon) , inclusive, of Figure 227 (SEQ ID NO: 313). Preferably, hybridization occurs • under severe conditions of hybridization washing. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203128 (DNA59776-1600), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Deposit No. 203128 (DNA59776-1600).

In still a further aspect, the invention refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, More preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 51 to about 461, inclusive of Figure 228 (SEQ ID NO: 314), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 1000 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a polypeptide NL7 that has the sequence of amino acid residues from 51 to about 461, inclusive of the Figure • 228 (SEQ ID NO: 314), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, preferably to less approximately a sequence identity of 85%, more preferably at least approximately a sequence identity of 90%, more ^ -F preferable at least approximately 95% sequence identity with (a) or (b), isolating the molecule DNA test.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide NL7, with or without the initiating methionine, or its soluble forms, ie the inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The transmembrane domain has been tentatively identified as extending from about position 31 of the amino acid to about position 50 of the amino acid in the amino acid sequence of NL7 (Figure 228, SEQ ID NO: 314).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 51 to about 461, inclusive of Figure 228 (SEQ ID NO: 314), or (b) ) the DNA complement of In another embodiment, the invention provides an isolated nucleic acid molecule, at least about 200 bases in length, which encodes a native NL7 polypeptide fragment.

In another embodiment, the invention provides an isolated NL7 polypeptide encoded by any of the isolated nucleic acid sequences defined hereinbefore.

In a specific aspect, the invention provides the isolated native sequence NL7 polypeptide, which in one embodiment, includes an amino acid sequence that comprises residues approximately from 51 to approximately 461 of Figure 228 (SEQ ID NO: 314 ).

In another aspect, the invention relates to an isolated NL7 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from about 51 to about 461, inclusive of Figure 228 (SEQ ID NO: 314).

In a further aspect, the invention is • refers to an isolated NL7 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 51 to 461 of Figure 228 (SEQ ID NO: 314).

In still another aspect, the invention relates to an isolated NL7 polypeptide, comprising the sequence of amino acid residues approximately from about 51 to about 461, inclusive of Figure 228 (SEQ ID NO: 314), or a fragment sufficient to provide a binding site for an anti-NL7 antibody. Preferably, the NL7 fragment retains a qualitative biological activity of a native NL7 polypeptide. Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that • 5 encodes an NL7 polypeptide having the sequence of amino acid residues roughly from 51 to about 461, inclusive of Figure 228 (SEQ ID NO: 314), or (b) the complement of the DNA molecule of (a), and if the molecule test DNA has at least about one • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host that • comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (lii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to the agonists and antagonists of a native NL7 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-NL7 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or • 5 antagonists of a native NL7 polypeptide, by contacting the native NL7 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising an NL7 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier. pharmaceutically. 98 PR01131 A cDNA clone (DNA59777-1480) encoding a new polypeptide having sequence identity with LDL receptors has been identified and is designated in the present application as "PR01131".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR01131 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule DNA encoding a PR01131 polypeptide having the • sequence of amino acid residues roughly from 1 to about 280, inclusive of Figure 230 (SEQ ID NO: 319), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a • PR01131 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of Approximately between 144 and about 983 residues, inclusive, of Figure 229 (SEQ ID NO: 318). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the • Deposit of ATCC No. 203111 (DNA59777-1480), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203111 (DNA59777-1480).

• Still in a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 to about 280, inclusive of Figure 230 • (SEQ ID NO: 319), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 • nucleotides and that is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01131 polypeptide having the sequence of amino acid residues approximately from 1 to about 280, inclusive of Figure 230 (SEQ ID NO: 319), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately an identity of % sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 100% identity 95% sequence with (a) or (b), isolate the A DN molecule from p ru eb a In a specific aspect, the invention provides an isolated nucleic acid molecule • which comprises the DNA encoding a PR01131 polypeptide in its soluble form, ie, the inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The domain of transmembrane (type II) has been identified tentatively as extending from about the amino acid positions 49-74 in the amino acid sequence of Figure 230, SEQ. ID NO: 319. In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residue 1 up to about 280, inclusive of Figure 230 SEC. ID NO: 319), or (b) the DNA complement of a) Another embodiment is directed to fragments of a sequence encoding PR01131 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01131 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01131, which in one embodiment, includes an amino acid sequence comprising residues 1 through 280 of Figure 230 (SEQ ID NO. 319).

In another aspect, the invention relates to an isolated PR01131 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 280, inclusive of Figure 230 (SEQ ID NO: 319). In a further aspect, the invention relates to an isolated PR01131 polypeptide, which • comprises a record of the amino acid sequence of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residue 1 up to 280 of Figure 230 (SEQ ID NO: 319).

In yet another aspect, the invention relates to an isolated PR01131 polypeptide, comprising the sequence of amino acid residues 1 to • about 280, inclusive of Figure 230 (SEQ ID NO: 319), or a sufficient fragment itself to provide a binding site for an anti-i-PROl antibody 131. Preferably, the PR01131 fragment retains a biological activity Qualitative of a native PR01131 polypeptide. • In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a low test DNA molecule.

Severe conditions with (a) a DNA molecule encoding a PR01131 polypeptide having the amino acid residue sequence roughly from 1 to about 280, inclusive of Figure 230 (SEQ ID NO: 319), or ( b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under • suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention is refers to the agonists and antagonists of a native PR01131 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 131 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01131 polypeptide, contacting the native PR01131 polypeptide with a candidate molecule and monitoring a Biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01131 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier In another embodiment, the invention provides • an expressed sequence tag (EST) designated herein as DNA43546 comprising the nucleotide sequence of Figure 231 (SEQ ID NO: 320). 99 PR01281 10 A cDNA clone (DNA59820- • 1549) encoding a new secreted polypeptide, designated in the present application as "PR01281" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01281 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PR01281 polypeptide having the sequence of amino acid residues approximately from about 16 to about 775, inclusive of Figure 233 (SEQ ID NO: 326), or (b) 5 the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01281 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of • approximate manner between 273 and approximately 2552 residues, inclusive, of Figure 232 (SEQ ID NO: 325). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203129 (DNA59820-1549), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid • comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203129 (DNA59820-1549).

In still a further aspect, the invention refers to an isolated nucleic acid molecule • comprising (a) DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, More preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues from about 16 up to approximately 775, inclusive of Figure 233 (SEQ ID NO: 326), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and more preferably at least about 100 nucleotides, and which is produced by hybridizing a DNA test molecule under severe conditions. • with (a) a DNA molecule encoding a PR01281 polypeptide having the sequence of amino acid residues from 16 to about 775, inclusive of Figure 233 (SEQ ID NO: 326), or (b) the complement of the DNA molecule from (a), and, if the DNA molecule • has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about a sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01281 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary for such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 15 of the amino acid in the sequence of Figure 233 (SEQ ID NO: 326).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 16 to about 775, inclusive of Figure 233 (SEQ ID NO: 326), or (b) the DNA complement of • Another embodiment is directed to fragments of a sequence encoding PR01281 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more • preferably roughly from 20 to about 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01281 polypeptide encoded by any of the nucleic acid sequences • isolated defined herein above.

In a specific aspect, the invention provides the isolated native sequence PR01281 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 16 to 775 of Figure 233 (SEQ ID NO: • 326).

In another aspect, the invention relates to an isolated PR01281 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 16 up to about # 775, inclusive of Figure 233 (SEQ ID NO: 326).

In a further aspect, the invention relates to an isolated PR01281 polypeptide, comprising an amino acid sequence register of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 16 to 775 of Figure 233 (SEQ ID NO: 326).

In still another aspect, the invention relates to an isolated PR01281 polypeptide, comprising Sequence of amino acid residues 16 to about 775, inclusive of Figure 233 (SEQ ID NO: 326), or a sufficient fragment itself to provide a binding site for an anti-PRI antibody 281. Preferably, the PR01281 fragment retains a qualitative biological activity of a native PR01281 polypeptide In yet a further aspect, the invention provides a polypeptide produced (i) • 5 hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01281 polypeptide having the sequence of amino acid residues from about 16 to about 775, inclusive of Figure 233 (SEQ. ID NO: 326), or (b) • the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately one identity. { 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with (a) or (b), (ii) culturing a host cell or host comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of cell culture. 100 PRO1064 A cDNA clone (DNA59827-1426) encoding a new transmembrane polypeptide, designated in the present application, has been identified. • as "PRO1064".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1064 polypeptide. • In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule encoding a PRO1064 polypeptide having the The sequence of amino acid residues is from about 1 or approximately 25 to about 153, inclusive of Figure 235 (SEQ ID NO: 334), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1064 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of • approximate manner between 532 or approximately 604 and approximately 990 nucleotides, inclusive, of Figure 234 (SEQ ID NO: 333). Preferably, hybridization occurs under severe washing and hybridization conditions. • In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) a molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203089 (DNA59827-1426), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203089 (DNA59827-1426).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 25 to about 153, inclusive of Figure 235 (SEQ ID NO: 334), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1064 polypeptide that has the sequence of amino acid residues from 1 or approximately 25 to about 153, inclusive of Figure 235 (SEQ ID NO: 334), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, so • 5 preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b) ), 10 isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PRO1064, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. He The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 24 of the amino acid in the sequence of Figure 235 (SEQ ID NO: 334). The domain of Transmembrane has tentatively been identified as extending from about position 89 of the amino acid to about position 110 of the amino acid in the amino acid sequence of PRO1064 (Figure 235, SEQ ID NO: • 5 334).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 25 to about 153, inclusive of Figure 235 (SEQ ID NO: 334), or (b) • the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PRO1064 polypeptide that can be used as hybridization probes. Such nucleic acid fragments are approximately from 20 up to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more Preferably approximately from about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 234 (SEQ ID NO: 333).

In another embodiment, the invention provides • the isolated PRO1064 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PRO1064 polypeptide of isolated native sequence, which in certain embodiments, • includes an amino acid sequence comprising residues 1 or approximately 25 up to about 153 of Figure 235 (SEQ ID NO: 334).

In another aspect, the invention relates to an isolated PRO1064 polypeptide, comprising a Amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 25 to about 153, inclusive of Figure 235 (SEQ ID NO: 334). • In a further aspect, the invention relates to an isolated PRO1064 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 20 to approximately 153, inclusive of Figure 235 (SEQ ID NO: 334).

In still another aspect, the invention relates to an isolated PRO1064 polypeptide, which comprises Sequence of amino acid residues 1 or approximately 25 to about 153, inclusive of Figure 235 (SEQ ID NO: 334), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 064 antibody .

• Preferably, the PRO1064 fragment retains a qualitative biological activity of a native PRO1064 polypeptide.

Still in a further aspect, the invention provides a polypeptide produced (i) • hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1064 polypeptide having the sequence of the amino acid residues from approximately 1 or approximately 25 to approximately 153, inclusive of Figure 235 (SEQ ID NO: 334), or (b) the complement of the • DNA molecule of (a), and if the test DNA molecule has at least approximately one identity of sequence 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of Sequence with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. • In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA45288 comprising the nucleotide sequence of SEQ. ID NO: 335 (see Figure 236). • 101 PR01379 A cDNA clone (DNA59828-1608) encoding a new secreted polypeptide, designated in the present application as "PR01379" has been identified.

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PR01379 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01379 polypeptide having the residue sequence of amino acids approximately from 18 to about 574, inclusive of Figure 238 (SEQ ID NO: 340), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01379 polypeptide comprising the DNA that hybridizes to the complement of the nucleic acid in a manner between about 61 and about 1731 residues, inclusive, of Figure 237 (SEQ. ID NO: 339). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the • ATCC Deposit No. 203158 (DNA59828-1608), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203158 (DNA59828-1608). • In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide Which has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from about 18 to about 574, inclusive of Figure 238 (SEQ ID NO: 340), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and • 5 more preferably at least about 100 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01379 polypeptide having the sequence of amino acid residues from 18 up to • approximately 574, inclusive of Figure 238 (SEQ ID NO: 340), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately an identity of sequence of 80%, preferably at least about a sequence identity of 85%, more preferably at least about • a sequence identity of 90%, more preferably at least approximately an identity of % sequence with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01379 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified • as extending from about position 1 of the amino acid to about position 17 of the amino acid in the sequence of Figure 238 (SEQ ID NO: 340).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 18 to approximately 574, inclusive of Figure 238 (SEQ ID NO: 340), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01379 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about • about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in about 20 to about 40 nucleotides in length. • In another embodiment, the invention provides the isolated PR01379 polypeptide encoded by any of the isolated nucleic acid sequences defined herein. In a specific aspect, the invention provides the PR01379 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the residues 18 to 574 of Figure 238 (SEQ ID NO: 340).

In another aspect, the invention relates to an isolated PR01379 polypeptide, comprising a Amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of amino acid residues 18 to about 574, inclusive of Figure 238 (SEQ ID NO: 340).

In a further aspect, the invention relates to an isolated PR01379 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 18 to 574 of Figure 238 (SEQ ID NO: 340). In still another aspect, the invention relates to an isolated PR01379 polypeptide, comprising the sequence of amino acid residues 18 to about 574, inclusive of Figure 238 (SEQ ID NO: 340), or a sufficient fragment itself to provide a binding site for an anti-PRI antibody 379. Preferably, the PR01379 fragment retains a qualitative biological activity of a native PR01379 polypeptide. • In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that encodes a PR01379 polypeptide having the sequence of amino acid residues roughly from 18 to about 574, inclusive of Figure 238 (SEQ ID NO: 340), or (b) the complement of the DNA molecule of (FIG. a), and if the The test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture 102. PR0844 A cDNA clone (DNA59838- • 1462), which has sequence identity with the protease inhibitors, which codes for a new polypeptide, designated in the present application as "PR0844" has been identified.

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PR0844 polypeptide.

In one aspect, nucleic acid isolated comprises DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, More preferably at least about 95% sequence identity with (a) a molecule of DNA encoding a PR0844 polypeptide having the sequence of amino acid residues roughly from 1 or 20 to about 111, inclusive of Figure 240 (SEQ ID NO: 345), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, that is, 1-111, or in another embodiment, 20-111.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR0844 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 5 or 62 and about 337 residues, inclusive, of Figure 239 ( SEC ID NO: 344). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .209976 (DNA59838-1462), or (b) the complement of the DNA molecule of (a). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209976 (DNA59838-1462).

In still a further aspect, the invention • refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably • at least approximately 95% sequence identity with the residue sequence of amino acids approximately from 1 or 20 to about 111, inclusive of Figure 240 (SEQ ID NO: 345), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0844 polypeptide having the amino acid residue sequence of way • approximate from 1 or 20 to about 111, inclusive of Figure 240 (SEQ ID NO: 345), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, so preferably at least approximately one identity of • 85% sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), Isolate the DNA molecule from test.

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or 20 to about 111, inclusive of Figure 240 (SEQ ID NO: 345), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PR0844 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides isolated native sequence PR0844 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 20 through 111 of Figure 240 (SEQ ID NO: 345).

In another aspect, the invention relates to an isolated PR0844 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 'or 20 to about 111, inclusive of Figure 240 (SEQ ID NO: 345 ).

• In a further aspect, the invention relates to an isolated PR0844 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least approximately • 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 20 to 111 of Figure 240 (SEQ ID NO: 345). Still in a further aspect, the invention provides a polypeptide produced (i) • hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a PR0844 polypeptide having the sequence of amino acid residues roughly from 1 or 20 to about 111, inclusive of Figure 240 (SEQ ID NO: 345), or (b) the complement of the DNA molecule of (a), and if the The test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from • cell culture.

In yet another embodiment, the invention relates to the agonists and antagonists of a PR0844 polypeptide native. In a particular embodiment, the agonist or antagonist is an anti-PR0844 antibody.

• In a further embodiment, the invention is refers to a method for identifying agonists or antagonists of a native PR0844 polypeptide, by contacting the native PR0844 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide. Still in a further embodiment, the invention relates to a composition comprising a PR0844 polypeptide, or an agonist or antagonist as defined herein above, in • combination with a pharmaceutically acceptable carrier. 103. PR0848 A cDNA clone (DNA59839- 10 1461) has been identified, which has sequence identity with the S ial i t rans fe, which encodes a new polypeptide, designated in the present application as "PR0848".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PR0848. • In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% identity. sequence, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR0848 polypeptide having the sequence of amino acid residues roughly from 1 or 36 to about 600, • 5 inclusive of Figure 242 (SEQ ID NO: 347), or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, • say, 1-600, or in another modality, 36-600.

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR0848 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 1 or 251 and approximately • 1945 residues, inclusive, of Figure 241 (SEQ ID NO: 346). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • More preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209988 (DNA59839-1461), or (b) the complement of the DNA molecule of (a). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209988 (DNA59839-1461). In still a further aspect, the invention relates to an isolated nucleic acid molecule • comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of sequence with the residue sequence of amino acids approximately from 1 or 36 to approximately 600, inclusive of Figure 242 (SEQ ID NO: 347), or the DNA complement of (a).

• In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR0848 polypeptide having the amino acid residue sequence so • approximate from 1 or 36 to approximately 600, inclusive of Figure 242 (SEQ ID NO: 347), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately a sequence identity of 80%, preferably at least approximately a sequence identity of 85%, more preferably at least • approximately 90% sequence identity, more preferably at least about a sequence identity of 95% with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (A) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • about 95% positive when compared to the amino acid sequence of residues 1 or 36 to about 600, inclusive of Figure 242 (SEQ ID NO: 347), or (b) the DNA complement of (a). • In another embodiment, the invention provides the isolated PR0848 polypeptide encoded by any of the isolated nucleic acid sequences defined herein. In a specific aspect, the invention provides the PR0848 sequence polypeptide • isolated native, which in one embodiment, includes an amino acid sequence comprising the residues 1 or 36 to 600 of Figure 242 (SEQ ID NO: 347).

In another aspect, the invention relates to an isolated PR0848 polypeptide, comprising a Amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of the amino acid residues 36 to about 600, inclusive of Figure 242 (SEQ ID NO: 347). • In a further aspect, the invention relates to an isolated PR0848 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 1 or 36 20 to 600 of Figure 242 (SEQ ID NO: 347).

Severe conditions with (a) a DNA molecule encoding a PR0848 polypeptide having the sequence of the amino acid residues roughly from 1 or 36 to about 600, inclusive of Figure 242 (SEQ ID NO: 347), or (b) • the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

• In yet another embodiment, the invention is refers to the agonists and antagonists of a native PR0848 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR0848 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR0848 polypeptide by contacting the native PR0844 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR0848 polypeptide, or an agonist or antagonist as defined herein above, in • combination with a pharmaceutically acceptable carrier. 104 PRO1097 15 A cDNA clone has been identified (DNA59841 1460), which encodes a new secreted polypeptide that has the domains in it of the proteins • of the family of gl i coprot ea sa and of the family of ChoActasa / COT / CPT, where the polypeptide is designated in the present application as "PRO1097".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1097 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity. • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PRO1097 polypeptide having the The sequence of amino acid residues is approximately from 1 or 21 to about 91, inclusive of Figure 244 (SEQ ID NO: 349), or (b) the complement of the DNA molecule of (a). The term "or" as used herein is refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, i.e., 1-91, or in another embodiment, 21-91.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1097 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 3 or 63 and approximately 275 residues, inclusive, of Figure 243 (SEQ ID NO: 348). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention is • 5 refers to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, • more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203044 (DNA59841-1460), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203044 (DNA59841-1460).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide that has at least approximately 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the amino acid residue sequence approximately from 1 or 21 to about 91, inclusive of Figure 244 (SEQ ID NO: 349), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1097 polypeptide having the sequence of amino acid residues so approximate from 1 or 21 to about 91, inclusive of Figure 244 (SEQ ID NO: 349), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about an 80% sequence identity, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about .-Y. a sequence identity of 95% with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention • provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1097 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine. The signal peptide has tentatively been identified as extending from about position 1 of the • amino acid up to approximately position 20 of the amino acid in the sequence of Figure 244 (SEQ ID NO: 349).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of the • less about 80% positive, preferably at least about 85% positive, of More preferably at least about 90% positive, most preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 21 up to about 91, inclusive of Figure 244 (SEQ.

NO: 349), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PRO1097 polypeptide encoded by any of the nucleic acid sequences • isolated defined herein above.

In a specific aspect, the invention provides the PRO1097 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the • waste 1 or 21 to 91 of Figure 244 (SEQ ID NO: 349).

In another aspect, the invention relates to a PRO1097 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 21 to about 91, inclusive of Figure 244 (SEQ ID NO: 349).

** - * - «. * - * - In a further aspect, the invention relates to an isolated PRO1097 polypeptide, comprising an amino acid sequence record • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 21 • to 91 of Figure 244 (SEQ ID NO: 349).

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1097 polypeptide having the • sequence of amino acid residues roughly from 1 or 21 to about 91, inclusive of Figure 244 (SEQ ID NO: 349), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80% sequence identity , preferably at least about 85% of Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host cell or host what • comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In still another embodiment, the invention is • refers to agonists and antagonists of a native PRO1097 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 097 antibody. In a further embodiment, the invention relates to a method for identifying agonists or • antagonists of a native PRO1097 polypeptide, contacting the native PRO1097 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising A PRO1097 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier # 105 PR01153 A cDNA clone (DNA59842-1502), which has two transmembrane domains and which is very rich in proline, encoding a new polypeptide, designated in the present application as "PROl 153".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01153 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01153 polypeptide having the The sequence of amino acid residues is approximately from 1 to about 197, inclusive of Figure 246 (SEQ ID NO: 351), or (b) the complement of the DNA molecule of (a).

• In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01153 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 92 and about 682 residues, inclusive, of Figure 245 (SEC ID NO: • 350). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention is refers to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 209982 (DNA59842-1502), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the • ATCC Deposit No. 209982 (DNA59842 - 1502).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide that has at least approximately 80% identity • of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from 1 to • about 197, inclusive of Figure 246 (SEQ ID NO: 351), or (b) the DNA complement of twenty In a further aspect, the invention relates to an isolated nucleic acid molecule that is produced by hybridizing a DNA molecule of Test under severe conditions with (a) a DNA molecule encoding a PR01153 polypeptide having the sequence of amino acid residues from 1 to about 197, inclusive of Figure 246 (SEQ ID NO: 351), or (b) the complement of • DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about a sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01153 polypeptide, and its soluble, i.e., inactivated or deleted variants of the transmembrane, or is complementary to such a coding nucleic acid molecule. The transmembrane domains have tentatively been identified as extending from approximately the amino acid position 10-28 and 85-110 in the amino acid sequence of PR01153 (Figure 246, SEQ ID NO: 351).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising • (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 to approximately 197, inclusive of Figure 246 (SEQ ID NO: 351), or (b) the DNA complement of In another embodiment, the invention provides the isolated PR01153 polypeptide encoded by any of the isolated nucleic acid sequences defined herein. In a specific aspect, the invention provides the PR01153 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the residues 1 to 197 of Figure 246 (SEQ ID NO: 351).

In another aspect, the invention relates to an isolated PR01153 polypeptide, comprising an amino acid sequence having at least • approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of • amino acid residues 1 to approximately 197, inclusive of Figure 246 (SEQ ID NO: 351).

In a further aspect, the invention relates to an isolated PR01153 polypeptide, comprising an amino acid sequence register of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 20 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 through 197 of Figure 246 ( SEC.ID NO: 351).

Still in a further aspect, the invention -fe., -. provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01153 polypeptide having the • sequence of the amino acid residues approximately from 1 to about 197, inclusive of Figure 246 (SEQ ID NO: 351), or (b) the complement of the DNA molecule of (a), and if the DNA molecule test has at least approximately a sequence identity of 80%, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under • suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 106. PR01154 A cDNA clone (DNA59846-1503) encoding a new aminopeptidase, designated in the present application as "PR01154" has been identified. - w- i &rX ffX In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01154 polypeptide. • In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01154 polypeptide having the The sequence of amino acid residues is approximately from 1 or 35 to about 941, inclusive of Figure 248 (SEQ ID NO: 353), or (b) mm the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01154 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 86 or 188 and approximately 2908 residues, inclusive, of Figure 247 (SEQ ID NO: 352). Preferably, the hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209978 (DNA59846-1503), or (b) the complement of the DNA molecule of (a). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209978 (DNA59846-1503).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule Comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues roughly from 1 or 35 to about 941, inclusive of Figure 248 10 (SEQ ID NO: 353), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that is produced by hybridizing a DNA molecule of test under severe conditions with (a) a DNA molecule encoding a PR01154 polypeptide having the sequence of amino acid residues roughly from 1 or 35 to about 941, inclusive of Figure 248 (SEQ ID NO: 353) , or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 35 to about 941, inclusive of Figure 248 (SEQ ID NO: 353), or (b) the DNA complement of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule consisting essentially of DNA encoding a polypeptide having amino acids 1 or 35 up to about 73 of SEQ. ID NO: 353 In another embodiment, the invention provides the isolated PR01154 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01154, which in one embodiment, includes an amino acid sequence comprising residues 1 or 35 to 941 of Figure 248 (SEQ ID NO: 353). • In a specific aspect, the invention provides a polypeptide having amino acids 1 or 35 up to about 73 of SEQ. ID NO: 353. In another aspect, the invention relates to an isolated PR01154 polypeptide, comprising a • amino acid sequence that has at least approximately 80% sequence identity, Preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence sequence. amino acid residues up to about 941, inclusive of Figure 24 (SEQ ID NO: 353).

In a further aspect, the invention is • refers to an isolated PR01154 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 1 or 35 to 941 of Figure 248 (SEQ ID NO: 353).

In still another aspect, the invention relates to an isolated PR01154 polypeptide, comprising the sequence of amino acid residues 1 or 35 • to about 941, inclusive of Figure 248 (SEQ ID NO: 353), or a fragment itself Sufficient to provide a binding site for an anti-PRI antibody 154. Preferably, the PR01154 fragment retains a qualitative biological activity of a native PR01154 polypeptide.

Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01154 polypeptide having the • sequence of the amino acid residues approximately from 1 or 35 to approximately 941, inclusive of Figure 248 (SEQ ID NO: 353), or (b) the complement of the DNA molecule of (a), and if the DNA test molecule has at least approximately a sequence identity of 80%, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under • suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01154 polypeptide. In a modality In particular, the agonist or antagonist is an anti-PR01154 antibody In a further embodiment, the invention relates to a method for identifying agonists or • antagonists of a native PR01154 polypeptide, by contacting the native PR01154 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional mode, the • invention relates to a composition comprising a PR01154 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier pharmaceutically. 107 PR01181 • A cDNA clone (DNA59847-1511) encoding a new secreted polypeptide, designated in the present application as "PR01181" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01181 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding a PR01181 polypeptide that has the amino acid residue sequence from • approximately 1 or approximately 16 to approximately 437, inclusive of Figure 250 (SEQ ID NO: 355), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a • PR01181 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between approximately 17 or approximately 62 and approximately 1327 nucleotides, inclusive, of Figure 249 (SEQ ID NO: 354). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Deposit No. 203098 (DNA59847-1511), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203098 (DNA598 7-1511).

• In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% of sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 16 up to • approximately 437, inclusive of Figure 250 (SEQ ID NO: 355), or (b) the DNA complement of In a further aspect, the invention is refers to an isolated nucleic acid molecule that • has at least 10 nucleotides and is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PR01181 polypeptide having the Sequence of the amino acid residues from 1 or approximately 16 to approximately 437, inclusive of Figure 250 (SEQ ID NO: 355), or (b) • the complement of the DNA molecule of (a), and, if the DNA molecule has at least about a sequence identity of 80%, preferably at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about a sequence identity of 95% with (a) or (b), *, • "-s? ¿- > .-, t & - isolate the test DNA molecule In a specific aspect, the invention provides an isolated nucleic acid molecule • comprising the DNA encoding a PR01181 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified as extending roughly from • position 1 of the amino acid to approximately position 15 of the amino acid in the sequence of Figure 250 (SEQ ID NO: 355). The transmembrane domain is in the positions of the amino acids 243-260 of Figure 250.

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or ? r-? íZA. approximately 16 to approximately 437, inclusive of Figure 250 (SEQ ID NO: 355), or (b) the DNA complement of (a).

• Another embodiment is directed to fragments of a sequence encoding PR01181 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably approximately from about 20 to about 40 nucleotides in length and can be derived from the sequence of • nucleotides shown in Figure 249 (SEQ ID NO: 354). In another embodiment, the invention provides the isolated PR01181 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01181, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 16 to approximately 437 of Figure 250 (SEQ ID NO. : 355).

In another aspect, the invention relates to a polypeptide PR01181 isolated, comprising one • amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of • the amino acid residues 1 or roughly 16 to approximately 437, inclusive of the Figure 250 (SEQ ID NO: 355).

In a further aspect, the invention relates to an isolated PR01181 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of the residues 1 or approximately 16 to approximately 437, inclusive of Figure 250 (SEQ ID NO: 355).

In yet another aspect, the invention relates to an isolated PR01181 polypeptide, comprising the sequence of amino acid residues 1 or approximately 16 to about 437, inclusive of Figure 250 (SEQ ID NO: 355), or a fragment sufficient to provide a binding site for an anti-i-PROl antibody 181. Preferably, the PR01181 fragment retains a qualitative biological activity of a native PR01181 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01181 polypeptide having the sequence of the amino acid residues roughly from 1 or approximately 16 to approximately 437, inclusive of Figure 250 (SEQ ID NO: 355), or (b) the complement of the DNA molecule of (a), and if the DNA molecule of • test has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of the cell culture. 108 PR01182 • A cDNA clone (DNA59848-1512) has been identified, which has homology with the conglutinin that encodes the nucleic acid, which encodes a new polypeptide, designated in the present application as "PROl 182".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01182 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of • DNA encoding a PR01182 polypeptide having the sequence of amino acid residues from about 1 or approximately 26 to about 271, inclusive of Figure 252 (SEQ ID NO: 357), or (b) the complement of the DNA molecule of (a).

• In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR01182 polypeptide comprising DNA that hybridizes to the nucleic acid complement between about 67 or approximately 142 and about 879 nucleotides, inclusive, of Figure 251 (SEQ ID NO: 356). Preferably, the Hybridization occurs under severe conditions of and »- -a < The ava a and of h i b r i d i z a c i on In a further aspect, the invention relates to an isolated nucleic acid molecule that • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203088 (DNA59848-1512), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203088 (DNA59848-1512). In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity Sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity, • sequence with the sequence of amino acid residues 1 or approximately 26 to approximately 271, inclusive of Figure 252 (SEQ ID NO: 357), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 10 nucleotides and which is produced by hybridizing a low test DNA molecule.

Severe conditions with (a) a DNA molecule encoding a PR01182 polypeptide having the sequence of the amino acid residues from 1 or • approximately 26 to approximately 271, inclusive of Figure 252 (SEQ ID NO: 357), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

• In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01182 polypeptide, with or without the N-terminal signal sequence and / or the initiation methionine, or is complementary for such a coding nucleic acid molecule. He F signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 25 of the amino acid in the sequence of the Figure 252 (SEQ ID NO: 357).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to The amino acid sequence of residues 1 or approximately 26 to about 271, inclusive of Figure 252 (SEQ ID NO: 357), or (b) the DNA complement of (a).

• Another embodiment is directed to fragments of a sequence encoding PR01182 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to approximately 80 nucleotides in length, • preferably roughly from 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably approximately from about 20 to about 40 nucleotides in length and can be derived from the sequence of • nucleotides shown in Figure 251 (SEQ ID NO: 356). In another embodiment, the invention provides the isolated PR01182 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PR01182 isolated native sequence polypeptide, which in certain embodiments, includes an amino acid sequence comprising • waste 1 or approximately 26 to approximately 271 of Figure 252 (SEQ ID NO: 357).

In another aspect, the invention relates to a PR01182 polypeptide isolated, comprising one • amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of • the amino acid residues 1 or roughly 26 to approximately 271, inclusive of the Figure 252 (SEQ ID NO: 357).

In a further aspect, the invention relates to an isolated PR01182 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of the residues 1 or approximately 26 to approximately 271, inclusive of Figure 252 (SEQ ID NO: 357).

In still another aspect, the invention relates to an isolated PR01182 polypeptide, which comprises • sequence of amino acid residues 1 or approximately 26 to approximately 271, inclusive of Figure 252 (SEQ ID NO: 357), or a sufficient fragment itself to provide a binding site for an anti-HIV antibody. 182. Preferably, the PR01182 fragment retains a qualitative biological activity of a polypeptide • PR01182 native.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01182 polypeptide having the The sequence of the amino acid residues is approximated from about 1 or approximately 26 to about 271, inclusive of Figure 252 (SEQ ID NO: 357), or (b) the complement of the DNA molecule of (a) , and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferable way at least about 95% identity of • sequence with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of the cell culture.

In yet another embodiment, the invention is "BF refers to the agonists and antagonists of a native PR01182 polypeptide. In a modality In particular, the agonist or antagonist is an anti-i-PROl 182 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01182 polypeptide, by contacting the native PROl 182 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide. f Still in a further embodiment, the invention relates to a composition comprising a PR01182 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier C ommercially. f 109. PR01155 A cDNA clone (DNA59849-1504) has been identified, which has sequence identity with the neurokinin B encoding a new polypeptide, designated in the present application as "PR01155".

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR01155 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of -am sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding a PR01155 polypeptide having the sequence of amino acid residues roughly from 1 to 19 to about 135, inclusive of Figure 254 (SEQ ID NO: 359), or (b) the molecule's complement of DNA from (a). He The term "or" as used herein is Refers to amino acids or nucleic acids and means that it discloses alternative modalities, that is, 1-135 or alternatively in another modality, 19-135. In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a • PR01155 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of Approximately between 158 or 212 and about 562 residues, inclusive, of Figure 253 (SEQ ID NO: 358). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Deposit No. 209986 (DNA59849-1504), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209986 (DNA598 9-1504). • In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 or 19 up to • about 135, inclusive of Figure 254 (SEQ ID NO: 359), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a DNA test molecule • under severe conditions with (a) a DNA molecule encoding a PR01155 polypeptide having the sequence of amino acid residues roughly from 1 or 19 to about 135, inclusive of Figure 254 (SEQ ID NO: 359), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about • a sequence identity of 80%, preferably at least approximately one identity of % sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the DNA molecule from proof. In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 19 up to about 135, including the Figure • 254 (SEQ ID NO: 359), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PR01155 polypeptide encoded by any of the isolated nucleic acid sequences defined herein. • In a specific aspect, the invention provides the isolated native sequence PR01155 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 19 through 135 of Figure 254 (SEQ ID NO: 359). In another aspect, the invention relates to an isolated PR01155 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the amino acid residue sequence 1 or 19 up • about 135, inclusive of Figure 254 (SEQ ID NO: 359).

In a further aspect, the invention relates to an isolated PR01155 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 20 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 19 through 135 of the Figure 254 (SEQ ID NO: 359).

In still a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01155 polypeptide having the sequence of the residues of amino acids approximately from 1 or 19 to about 135, inclusive of Figure 254 (SEQ ID NO: 359), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately a sequence identity of 80%, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under • suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01155 polypeptide. In a modality In particular, the agonist or antagonist is an ant i cue rpo ant i - PR01155 In a further embodiment, the invention relates to a method for identifying agonists or • antagonists of a native PR01155 polypeptide, by contacting the native PR01155 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional mode, the • invention relates to a composition comprising a PR01155 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier pharmaceutically. 110 PR01156 A cDNA clone (DNA59853-1505) encoding a new secreted polypeptide, designated in the present application as "PR01156" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01156 polypeptide. In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% identity. sequence, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01156 polypeptide having the sequence of amino acid residues so • approximate from 23 to about 159, inclusive of Figure 256 (SEQ ID NO: 361), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01156 polypeptide comprising the t-DNA hybridizing to the complement of the nucleic acid in a manner between about 281 and about 688 residues, inclusive, of Figure 255 (SEQ ID NO: 360). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that w ^. -. comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 209985 (DNA59853-1505), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 209985 (DNA59853-1505).

In still a further aspect, the invention • refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide Which has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues from about 23 to about 159, inclusive of Figure 256 (SEQ ID NO: 361), or (b) the DNA complement of • (to) .

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 50 nucleotides, and more preferably at least 100 nucleotides, and that is • produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01156 polypeptide having the sequence of amino acid residues from 23 up to about 159, inclusive of Figure 256 (SEQ ID NO: 361), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule • has at least approximately 80% sequence identity, preferably at least approximately a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the molecule DNA test.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01156 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has tentatively been identified as extending from approximately position 1 of the amino acid until approximately • position 22 of the amino acid in the sequence of Figure 256 (SEQ ID NO: 361).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, so • preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 23 to approximately 159, inclusive of Figure 256 (SEQ ID NO: 361), or (b) the DNA complement of (a).

In another aspect, the invention relates to hybridization probes comprising the fragments of the sequence encoding PR0784, or is a complementary sequence thereof. The hybridization probes preferably have at least about at least about 20 nucleotides to about 80 nucleotides, and more preferably at least about 20 to about 50 nucleotides.

In another embodiment, the invention provides the isolated PR01156 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01156, which in one embodiment, includes an amino acid sequence comprising residues 23 to 159 of Figure 256 (SEQ ID NO: 361).

In another aspect, the invention relates to an isolated PR01156 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at • less than about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 23 to about 159, inclusive of Figure 256 (SEQ ID NO: 361) . • In a further aspect, the invention relates to an isolated PR01156 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 23 to 159 of Figure 256 (SEQ ID NO: 361).

In still another aspect, the invention relates to an isolated PR01156 polypeptide, which comprises the sequence of amino acid residues 23 up to Approximately 159, inclusive of Figure 256 (SEQ ID NO: 361), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 156 antibody. Preferably, the PR01156 fragment retains a biological activity • Qualitative of a native PR01156 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a low test DNA molecule. severe conditions with (a) a DNA molecule that • encodes a PR01156 polypeptide having the sequence of amino acid residues roughly from 23 to about 159, inclusive of Figure 256 (SEQ ID NO: 361), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, • preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 111. PRO1098 • A cDNA clone (DNA59854-1459) encoding a new polypeptide, designated in the present application as "PRO1098" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising • the DNA encoding a PRO1098 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PRO1098 polypeptide having the sequence of amino acid residues roughly from 1 or 20 to about 78, inclusive of Figure 258 (SEQ ID NO: 363) , or (b) the complement of the DNA molecule of (a). The term "or" as used herein refers to amino acids or nucleic acids and means that it refers to two alternative embodiments provided herein, ie, 1-78, or in another embodiment, 20-78.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1098 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of • approximate manner between 58 or 115 and approximately 291 residues, inclusive, of Figure 257 (SEQ ID NO: 362). Preferably, hybridization occurs under severe washing and drying conditions. hybridization.

In a further aspect, the invention is • refers to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209974 (DNA59854-1459), or (b) the complement of the molecule of DNA from (a). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209974 (DNA59854-1459).

In still a further aspect, the invention • refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably • at least approximately 95% sequence identity with the residue sequence of amino acids approximately from 1 or 20 to about 78, inclusive of Figure 258 (SEQ ID NO: 363), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1098 polypeptide having the amino acid residue sequence of way • approximate from 1 or 20 to about 78, inclusive of Figure 258 (SEQ ID NO: 363), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately 80% sequence identity, so preferably at least approximately one identity of • 85% sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), Isolate the DNA molecule from test.

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or 20 to about 78, inclusive of Figure 258 (SEQ ID NO: 363), or (b) the DNA complement of (a).

In another embodiment, the invention provides the isolated PRO1098 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the PRO1098 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 or 20 to 78 of Figure 258 (SEQ ID NO: 363).

In another aspect, the invention relates to an isolated PRO1098 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or 20 to about 78, inclusive of Figure 258 (SEQ ID NO: 363) .

• In a further aspect, the invention relates to an isolated PRO1098 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least approximately • 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 20 to 78 of Figure 258 (SEQ ID NO: 363). Still in a further aspect, the invention provides a polypeptide produced (i) • hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a PRO1098 polypeptide having the sequence of the amino acid residues roughly from 1 or 20 to about 78, inclusive of Figure 258 (SEQ ID NO: 363), or (b) the complement of the DNA molecule of (a), and if the The test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of cell culture. 112. PR01127 A cDNA clone (DNA30283-1484) encoding a new secreted polypeptide, designated in the present application as "PR01127" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01127 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule • DNA encoding a PR01127 polypeptide having the sequence of amino acid residues roughly from 1 or 30 to about 67, inclusive of Figure 260 (SEQ ID NO: 365), or (b) the complement of the DNA of (a). He The term "or" as used herein is • refers to amino acids or nucleic acids and means that it refers to two alternative modalities, that is, 1-67, in one modality, or alternatively, 30-67. In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a • PR01127 polypeptide comprising DNA that hybridizes to nucleic acid complement approximately between 126 or 213 and about 326 residues, inclusive, of Figure 259 (SEQ ID NO: 364). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide f encoded by the human protein cDNA in ATCC Repository No. 203043 (DNA30283-1484), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203043 (DNA30283-1484). In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% , * a »of sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 or 30 up to • about 67, inclusive of Figure 260 (SEQ ID NO: 365), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a DNA test molecule • under severe conditions with (a) a DNA molecule encoding a PR01127 polypeptide having the sequence of amino acid residues roughly from 1 or 30 to about 67, inclusive of Figure 260 (SEQ ID NO: 365), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about • a sequence identity of 80%, preferably at least approximately one identity of % sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the DNA molecule from proof. In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01127 polypeptide without the N-terminal signal sequence and / or the initiating methionine. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 29 of the amino acid in the sequence of Figure 260 (SEQ.

NO: 365). • In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about • 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or 30 to about 67, inclusive of Figure 260 (SEQ ID NO: 365), or (b) the DNA complement of Another embodiment is directed to fragments of a sequence encoding PR01127 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to • about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably approximately from 20 to • approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01127 polypeptide encoded by Any of the isolated nucleic acid sequences defined herein.

• In a specific aspect, the invention provides isolated native sequence polypeptide PR01127, which in one embodiment, includes an amino acid sequence comprising residues 1 or 30 through 67 of Figure 260 (SEQ ID NO: 365) .

In another aspect, the invention relates to an isolated PR01127 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of 30 amino acid residues up to about 67, inclusive of Figure 260 (SEQ.

• ID NO: 365).

In a further aspect, the invention relates to an isolated PR01127 polypeptide, which comprises an amino acid sequence register of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or 30 to 67 of Figure 260 (SEQ ID NO: 365).

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01127 polypeptide having the sequence of the amino acid residues so • 5 from about 1 or 30 to about 67, inclusive of Figure 260 (SEQ ID NO: 365), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% of • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. In still another embodiment, the invention relates to agonists and antagonists of a native PR01127 polypeptide. In a particular embodiment, the agonist or antagonist is a Ant i-PROl antibody 127.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01127 polypeptide, • contacting the native PR01127 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising • a PR01127 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 15 113 PR01126 A cDNA clone (DNA60615- ^ 1483) has been identified, which has homology with the ol fact omedin encoding the nucleic acid, which encodes a new Polypeptide, designated in the present application as "PROL 126".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR01126 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90. % sequence identity, more preferably at least about 95% sequence identity with (a) one molecule DNA encoding a PR01126 polypeptide having the • sequence of amino acid residues from about 1 or approximately 26 to about 402, inclusive of Figure 262 (SEQ ID NO: 367), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to a • isolated nucleic acid molecule encoding a PR01126 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between about 110 or approximately 185 and about 1315 nucleotides, inclusive, of Figure 261 (SEQ ID NO: 366). Preferably, hybridization occurs under severe conditions of washing and hybridization.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of • DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209980 (DNA60615-1483), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA • in ATCC Deposit No. 209980 (DNA60615-1483).

In still a further aspect, the invention relates to an isolated nucleic acid molecule which comprises (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence residue • 5 amino acids 1 or approximately 26 to approximately 402, inclusive of Figure 262 (SEQ ID NO: 367), or (b) the DNA complement of (to) .

In a further aspect, the invention is • refers to an isolated nucleic acid molecule having at least 10 nucleotides and that is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a PR01126 polypeptide having the sequence of the amino acid residues from 1 or approximately 26 to about 402, • inclusive of Figure 262 (SEQ ID NO: 367), or (b) the complement of the DNA molecule of (a), and, if The DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, More preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention • 5 provides an isolated nucleic acid molecule comprising the DNA encoding a PR01126 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a coding nucleic acid molecule. He signal peptide has tentatively been identified • as extending from about position 1 of the amino acid to about position 25 of the amino acid in the sequence of Figure 262 (SEQ ID NO: 367). In another aspect, the invention relates to an isolated nucleic acid molecule comprising • (a) the DNA encoding a polypeptide record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately to about 402, inclusive of Figure 262 (SEQ ID NO: 367), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01126 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 261 (SEQ ID NO: 366).

In another embodiment, the invention provides the isolated PR01126 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01126, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 26 to f about 402 of Figure 262 (SEQ ID NO. : 367).

In another aspect, the invention relates to an isolated PR01126 polypeptide, comprising a amino acid sequence that has at least • approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least approximately 95% sequence identity with the sequence of amino acid residues 1 or approximately 26 to about 402, inclusive of the Figure 262 (SEQ ID NO: 367). In a further aspect, the invention relates to an isolated PR01126 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or roughly 26 to about 402 , inclusive of Figure 262 (SEQ ID NO: 367).

In still another aspect, the invention relates to an isolated PR01126 polypeptide, which comprises the sequence of amino acid residues 1 or approximately 26 to about 402, inclusive of Figure 262 (SEQ ID NO: 367), or a fragment sufficient to provide a binding site for an anti-i-PROl 126 antibody. Preferably, the PR01126 fragment retains a qualitative biological activity of a native PR01126 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01126 polypeptide having the sequence of the amino acid residues roughly from 1 or approximately 26 to approximately 402, inclusive of Figure 262 (SEQ ID NO: 367), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately an identity • 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity sequence with (a) or (b), (ii) cultivating a cell • host or host comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. In still another embodiment, the invention relates to the agonists and antagonists of a • PR01126 polypeptide native. In a particular embodiment, the agonist or antagonist is a Anti- i-PROl antibody 126.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01126 polypeptide, by contacting the native PR01126 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional modality, the • invention relates to a composition comprising a PR01126 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 10 • 114 PR01125 A cDNA clone (DNA60619-1482) has been identified, which has the conserved (WD) regions of Trp-Asp of the ransducin beta-t family, which codes for a new polypeptide, designated in the present application as "PR01125".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR01125 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding a PR01125 polypeptide having the sequence of amino acid residues roughly from 1 or 26 to about 447, inclusive of Figure 264 (SEQ ID NO: 369), or (b) the complement of the DNA of (a). How I know used in the present, "or" when referring to the • amino acids or nucleic acids, refers to two alternative modalities, that is, 1-447 and 26-447.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01125 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of • approximate manner between 47 or 122 and approximately 1387 residues, inclusive, of Figure 263 (SEQ ID NO: 368). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that - »-. : mtá.s comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 209993 (DNA60619-1482), or (b) • the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 209993 (DNA60619-1482).

In still a further aspect, the invention < P ^ refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide Which has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 or 26 to about 447, inclusive of Figure 264 (SEQ ID NO: 369), or the DNA complement of (a) ).

• In a further aspect, the invention relates to an isolated nucleic acid molecule produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01125 polypeptide having the < sequence of amino acid residues approximately from 1 or 26 to about 447, inclusive of Figure 264 (SEQ ID NO: 369), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, 20 more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01125 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, ie, inactivated or deleted variants of the • transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 25 of the amino acid in the sequence of the • Figure 264 (SEQ ID NO: 369).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (A) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, • more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 6 26 to about 447, inclusive of Figure 264 (SEQ ID NO: 369), or (b) the DNA complement of (a). In another embodiment, the invention provides the isolated PR01125 polypeptide encoded by any of the isolated nucleic acid sequences defined herein. • In a specific aspect, the invention provides the PR01125 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the residues 1 or 26 to 447 of Figure 264 (SEQ ID NO: 369).

In another aspect, the invention relates to an isolated PR01125 polypeptide, comprising a Amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues 26 to about 447, inclusive of Figure 264 (SEQ ID NO: 369). In a further aspect, the invention relates to an isolated PR01125 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 26 10 to 447 of the Figure 264 (SEQ ID NO: 369). • In still another aspect, the invention relates to an isolated PR01125 polypeptide, comprising the sequence of amino acid residues 26 up to about 447, inclusive of Figure 264 (SEQ ID NO: 369), or a sufficient fragment itself to provide a binding site for a • anti-i-PROl 125 antibody. Preferably, PR01125 fragment retains a biological activity Qualitative of a native PR01125 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a low test DNA molecule. severe conditions with (a) a DNA molecule encoding a PR01125 polypeptide having the amino acid residue sequence roughly from 26 to about 447, inclusive of Figure 264 (SEQ ID NO: 369), or ( b) • the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

• In yet another embodiment, the invention is refers to the agonists and antagonists of a native PR01125 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl 125 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01125 polypeptide by contacting the native PR01125 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide. 115 PR01186 A cDNA clone (DNA60621-1516) encoding a new polypeptide having sequence identity with the protein A of the poison • and is designated in the present application as "PROl 186".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01186 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% identity. sequence, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01186 polypeptide having the sequence of amino acid residues roughly from 20 to about 105, inclusive of the Figure 266 (SEQ ID NO: 371), or (b) • the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01186 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of • approximate manner between 148 and approximately 405 residues, inclusive, of Figure 265 (SEQ ID NO: 370). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule that • comprises DNA that has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203091 (DNA60621-1516), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a • DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203091 (DNA60621-1516).

In still a further aspect, the invention refers to an isolated nucleic acid molecule • comprising (a) DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, most preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with the sequence of amino acid residues approximately from 20 to about 105, inclusive of Figure 266 (SEQ ID NO: 371), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least about 50 nucleotides, and preferably at least about 100 nucleotides, and that is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a • PR01186 polypeptide having the sequence of amino acid residues roughly from 20 to about 105, inclusive of Figure 266 (SEQ ID NO: 371), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately an identity of F 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule. F In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 20 to about 105, inclusive of Figure 266 (SEQ ID NO: 371), or (b) the DNA complement of • Another embodiment is directed to the fragments of a sequence encoding the PR01186 polypeptide that can be used as probes of hybridization. Such nucleic acid fragments • are approximately from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, most preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about • approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01186 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01186, which in one embodiment, includes an amino acid sequence comprising residues 20 to 105 of Figure 266 (SEQ ID NO: • 371) In another aspect, the invention relates to an isolated PR01186 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 20 to about 105, inclusive of Figure 266 (SEQ ID NO: 371).

In a further aspect, the invention relates to an isolated PR01186 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 25 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 20 to 105 of Figure 266 (SEQ ID NO: 371).

• In yet another aspect, the invention relates to an isolated PR01186 polypeptide, comprising the sequence of amino acid residues 20 to about 105, inclusive of Figure 266 (SEQ ID NO: 371), or a sufficient fragment thereof 10 to provide a link site for a • anti-i-PROl 186 antibody. Preferably, the PR01186 fragment retains a qualitative biological activity of a native PR01186 polypeptide.

In still a further aspect, the invention provides a polypeptide produced by (i) hybridizing a DNA molecule under test • severe conditions with (a) a DNA molecule that encodes a PR01186 polypeptide that has the The sequence of the amino acid residues is approted from about 20 to about 105, inclusive of Figure 266 (SEQ ID NO: 371), or (b) the complement of the DNA molecule of (a), and if the molecule of test DNA has to the think approtely a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. • In yet another embodiment, the invention relates to agonists and antagonists of a native PR01186 polypeptide. In a modality In particular, the agonist or antagonist is an anti-i-PROl 186 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01186 polypeptide by contacting the native PR01186 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment the invention relates to a composition comprising a PR01186 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 116 PR01198 A cDNA clone (DNA60622-1525) encoding a new secreted polypeptide designated in the present application as "PR01198" has been identified.

• In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01198 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about • 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01198 polypeptide having the The sequence of amino acid residues is approtely from about 35 to about 229, inclusive of Figure 268 (SEQ ID NO: 373), or (b) the complement of the DNA molecule of (a).

• In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01198 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 156 and about 740 residues, inclusive, of Figure 268 (SEQ ID NO: • 373). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention is refers to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least approximately 85% sequence identity, more preferably at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203090 (DNA60622-1525), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the • ATCC Deposit No. 203090 (DNA60622-1525).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide that has at least approximately 80% identity • of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from 35 up to • about 229, inclusive of Figure 268 (SEQ ID NO: 373), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and more preferably at least about 100 nucleotides. nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01198 polypeptide having the sequence of amino acid residues from 35 up to • approximately 229, inclusive of Figure 268 (SEQ ID NO: 373), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately one sequence identity of the 80%, preferably at least approximately a sequence identity of 85%, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolating the molecule DNA test.

In a specific aspect, invention B provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PR01198, with or without the N-terminal signal sequence and / or the initiation methionine, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from approximately position 1 of the amino acid until approximately "-a.-Y * -AÜj-. '. position 35 of the amino acid in the sequence of Figure 268 (SEQ ID NO: 373).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 35 to approximately 229, inclusive of Figure 268 (SEQ ID NO: 373), or (b) the DNA complement of (a).

Another modality is directed to fragments *. of a sequence encoding the PR01198 polypeptide that can be used as probes of hybridization. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, More preferably from about 20 to about 50 nucleotides in length, and more preferably in an approximate manner from about 20 to about 40 nucleotides in length.

• In another embodiment, the invention provides the isolated PR01198 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention • provides the PR01198 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 35 to 229 of Figure 268 (SEQ ID NO: 373).

In another aspect, the invention relates to an isolated PR01198 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 35 up to about 229, inclusive of Figure 268 (SEQ ID NO: 373).

In a further aspect, the invention relates to an isolated PR01198 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 35 to 229 of Figure 268 (SEQ ID NO: 373).

In still another aspect, the invention relates to an isolated PR01198 polypeptide, comprising the sequence of amino acid residues 35 up to • approximately 229, inclusive of Figure 268 (SEQ ID NO: 373), or a sufficient fragment thereof to provide a binding site for an anti-PRI 198 antibody. Preferably, the PR01198 fragment retains a qualitative biological activity of a native PR01198 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01198 polypeptide having the • sequence of the amino acid residues approximately from 35 to approximately 229, inclusive of Figure 268 (SEQ ID NO: 373), or (b) the complement of the DNA molecule of (a), and if the DNA molecule test has at least approximately a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 117 PR01158 A cDNA clone (DNA60625-1507) encoding a new polypeptide has been identified. transmembrane, designated in the present application as "PR0115! In one embodiment, the invention provides an isolated nucleic acid molecule comprising • the DNA encoding a PR01158 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of DNA encoding a PR01158 polypeptide having the sequence of amino acid residues roughly from 20 to about 123, • inclusive of Figure 270 (SEQ ID NO: 375), or (b) the complement of the DNA molecule of (a). In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01158 polypeptide comprising the DNA that hybridizes to the nucleic acid complement of Approximately 220 to about 531 residues, inclusive, of Figure 269 (SEQ ID NO: 374). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 209975 (DNA60625-1507), or (b) the complement of the DNA molecule of (a). In a • preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209975 (DNA60625-1507).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule Comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% • sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues from about 20 to about 123, inclusive of Figure 270 (SEQ ID NO: 375), or (b) the DNA complement of # (to) .

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least about 50 nucleotides, and more preferably at least about 100 nucleotides and is produced by hybridizing a • Test DNA molecule under severe conditions with (a) a DNA molecule that encodes a PR01158 polypeptide having the sequence of amino acid residues from 20 to about 123, inclusive of Figure 256 (SEQ ID NO: 375), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more • preferable at least about 95% sequence identity with (a) or (b), isolating the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule • comprising the DNA encoding a PR01158 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified • as extending from about position 1 of the amino acid to about position 19 of the amino acid in the sequence of Figure 270 (SEQ ID NO: 375). The transmembrane domain has been tentatively identified as extending from approximately position 56 of the amino acid to approximately Position 80 of the amino acid in the amino acid sequence of PR01158 (Figure 270, SEQ ID NO 375).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • about 95% positive when compared to the amino acid sequence of residues 20 to about 123, inclusive of Figure 270 (SEQ ID NO: 375), or (b) the DNA complement of fifteen In another aspect, the invention relates to the hybridization probes comprising the fragments of the sequence encoding PR01158, or is a complementary sequence thereof. Hybridization probes preferably have at least about at least about 20 nucleotides to about 80 nucleotides, and more preferably at least about 20 to about approximately 50 nucleotides.

In another embodiment, the invention provides the isolated PR01158 polypeptide encoded by any of the nucleic acid sequences • isolated defined herein above.

In a specific aspect, the invention provides the PR01158 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the • residues 20 to 123 of Figure 270 (SEQ ID NO: 375).

In another aspect, the invention relates to a PR01158 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, • preferable way to at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 20 to about 123, inclusive of Figure 270 (SEQ ID NO: 375). In a further aspect, the invention relates to an isolated PR01158 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 20 to 123 10 of Figure 270 (SEQ ID NO: 375). • In still another aspect, the invention relates to an isolated PR01158 polypeptide, which comprises the sequence of amino acid residues 20 up to about 123, inclusive of Figure 270 (SEQ ID NO: 375), or a sufficient fragment itself to provide a link site for a • anti-i-PROl antibody 158. Preferably, the PR01158 fragment retains a biological activity Qualitative of a native PR01158 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a low test DNA m-sample. severe conditions with (a) a DNA molecule encoding a PR01158 polypeptide having the amino acid residue sequence roughly from 20 to about 123, inclusive of Figure 270 (SEQ ID NO: 375), or ( b) • the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. • 118 PR01159 A cDNA clone (DNA60627-1508) encoding a new secreted polypeptide, designated in the present application as "PR01159" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01159 polypeptide In one aspect, the isolated nucleic acid comprises the DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of • DNA encoding a PR01159 polypeptide having the sequence of amino acid residues from about 1 or from about 16 to about 90, inclusive of Figure 272 (SEQ.

ID NO: 377), or (b) the complement of the DNA molecule of (a). fP In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01159 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 92 or about 137 and about 361 nucleotides, inclusive, of the Figure 271 (SEQ ID NO: 376). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203092 (DNA60627-1508), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide • mature encoded by the cDNA of the human protein in ATCC Deposit No. 203092 (DNA60627-1508). In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with the sequence of amino acid residues 1 or approximately 16 to about 90, inclusive of Figure 272 (SEQ ID NO: 377), or (b) the DNA complement of (a).

In a further aspect, the invention is • refers to an isolated nucleic acid molecule having at least 10 nucleotides and that is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a PR01159 polypeptide having the sequence of the amino acid residues from 1 or from about 16 to about 90, • inclusive of Figure 272 (SEQ ID NO: 377), or (b) the complement of the DNA molecule of (a), and, if The DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention • provides an isolated nucleic acid molecule comprising the DNA encoding a PR01159 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a coding nucleic acid molecule. He signal peptide has tentatively been identified • as extending from about position 1 of the amino acid to about position 15 of the amino acid in the sequence of Figure 272 (SEQ ID NO: 377). In another aspect, the invention relates to an isolated nucleic acid molecule comprising • (a) the DNA encoding a polypeptide record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately to about 90, inclusive of Figure 272 (SEQ ID NO: 377), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01159 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are roughly from 20 to about 80 nucleotides in length, p-approximately approximately from 20 to • about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about approximately 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 271 (SEQ ID NO: • 376).

In another embodiment, the invention provides the isolated PR01159 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PR01159 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 16 up to • approximately 90 of Figure 272 (SEQ ID NO: 377).

In another aspect, the invention relates to an isolated PR01159 polypeptide, comprising a amino acid sequence that has at least • approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 16 to about 90, inclusive of Figure 272 (SEQ ID NO: 377). In a further aspect, the invention relates to an isolated PR01159 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or • approximate manner 16 to approximately 90, inclusive of Figure 272 (SEQ ID NO: 377).

In still another aspect, the invention relates to an isolated PR01159 polypeptide, which comprises sequence of amino acid residues 1 or • approximate manner 16 to approximately 90, inclusive of Figure 272 (SEQ ID NO: 377), or a sufficient fragment itself to provide a binding site for an anti-PRO-159 antibody.

Preferably, fragment PR01159 retains a qualitative biological activity of a native PR01159 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01159 polypeptide having the amino acid residue sequence in a manner 25 approximated from 1 or approximately 16 to approximately 90, inclusive of Figure 272 (SEQ ID NO: 377), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the Test DNA under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 119 PR01124 A cDNA clone (DNA60629-1481), which has sequence identity with a chlorine channel protein and lung endothelial cell adhesion molecule (EAM-1) encoding a new polypeptide, has been identified, designated in the present application as "PR01124".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01124 polypeptide In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01124 polypeptide having the sequence of amino acid residues roughly from 1 or 22 to about 919, inclusive of Figure 274 (SEQ ID NO: 379), or (b) the complement of the DNA molecule of (a). As used herein, "o", i.e., 1 or 22 and 25 or 88, is used to describe two alternative modes. For example, the invention includes amino acids 1 through 919 and in an alternative embodiment, provides amino acids 22 through 919, etc.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01124 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 25 or 88 and approximately 2781 residues, inclusive, of Figure 273 (SEQ ID NO: 378). In another aspect, the invention relates to • an isolated nucleic acid molecule that hybridizes to the complement of the SEC nucleic acid. ID NO: 378. Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention is • refers to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule that encodes the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209979 (DNA60629-1481), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 209979 (DNA60629-1481 In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 or 22 to about 919, inclusive of Figure 274 (SEQ ID NO: 379), or the DNA complement of (a).

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01124 polypeptide, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, i.e. inactivated or deleted variants of the transmembrane domain, or is complementary to such a coding nucleic acid molecule. The cytoplasmic end can also be excluded. The signal peptide has tentatively been identified as extending roughly from position 1 of the amino acid to approximately position 21 of the amino acid in the sequence of the • Figure 274 (SEQ ID NO: 379). Transmembrane domains have been tentatively identified as extending roughly from position 284 of the amino acid to approximately position 300 of the amino acid and from position 617 of the amino acid until approximately • position 633 of the amino acid in the amino acid sequence (Figure 274, SEQ ID NO: 379).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 22 to approximately 919, inclusive of the Figure 274 (SEQ ID NO: 379), or (b) the DNA complement from (a). - ** ltfS In another embodiment, the invention provides the isolated PR01124 polypeptide encoded by any of the nucleic acid sequences 4 »isolated defined in the present above.

In a specific aspect, the invention provides the PR01124 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the • residues 1 or 22 to 919 of Figure 274 (SEQ ID NO: 379).

In another aspect, the invention relates to a PR01124 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, • preferable way to at least about 85% sequence identity, more preferably to the At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues 22 to about 919, inclusive of Figure 274 (SEQ ID NO: 379) ).

In a further aspect, the invention relates to an isolated PR01124 polypeptide, comprising an amino acid sequence record f 5 of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or 22 to 919 of Figure 274 (SEQ ID NO: 379).

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01124 polypeptide having the F sequence of amino acid residues roughly from 1 or 22 to about 919, inclusive of Figure 274 (SEQ ID NO: 379), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80% sequence identity , preferably at least about 85% of Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by growing a host cell or host that f comprises the test DNA molecule under conditions suitable for the expression of the polypeptide; and (iii) recovering the polypeptide from the cell culture.

In still another embodiment, the invention is F refers to the agonists and antagonists of a native PR01124 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-i-PROl antibody 124. In a further embodiment, the invention relates to a method for identifying agonists or F antagonists of a native PR01124 polypeptide, by contacting the native PR01124 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01124 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. f 120. PR01287 A cDNA clone (DNA61755-1554) has been identified, which has homology with the fringe protein (peripheral) encoding the nucleic acid, which encodes a new polypeptide, designated in the present application as "PR01287". • In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01287 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01287 polypeptide having the amino acid residue sequence from about 1 or approximately 28 to about 532, inclusive of Figure 276 (SEQ ID NO: 381), or (b) the complement of the DNA molecule of (a). • In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01287 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between approximately 655 or approximately 736 and and about 2250 nucleotides, inclusive, of Figure 275 (SEQ ID NO: 380). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule that ^ ß? comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203112 (DNA61755-1554), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid • comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203112 (DNA61755-1554).

In still a further aspect, the invention refers to an isolated nucleic acid molecule • comprising (a) DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, most preferably at least about 90% sequence identity, more preferably at least about 95% identity of Pr sequence with the sequence of amino acid residues 1 or approximately 28 up to about 532, inclusive of Figure 276 (SEQ ID NO: 381), or (b) the DNA complement of In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 100 nucleotides and which is produced by hybridizing an A'DNA test molecule under severe conditions with (a) a DNA molecule encoding a PR01287 polypeptide that has the sequence of the amino acid residues from 1 or approximately 28 to approximately 532, inclusive of Figure 276 (SEQ ID NO: 381), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about an 80% sequence identity, so • preferable at least about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about a sequence identity of 95% with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01287 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a molecule of coding nucleic acid. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 27 of the amino acid in the sequence of Figure 276 (SEQ ID NO: 381).

• In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least approximately • 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 28 to approximately 532, inclusive of Figure 276 (SEQ ID NO: 381), or (b) the DNA complement of (a).

WU Another embodiment is directed to fragments of a sequence encoding PR01287 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 25 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner from about 20 to about 50 nucleotides in length. approximate from 20 to approximately 40 nucleotides in length and • can be derived from the nucleotide sequence shown in Figure 275 (SEQ ID NO: 380).

In another embodiment, the invention provides the isolated PR01287 polypeptide encoded by • any of the isolated nucleic acid sequences identified hereinbefore.

In a specific aspect, the invention provides the isolated native sequence PR01287 polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 28 to • about 532 of Figure 276 (SEQ ID NO: 20 381).

In another aspect, the invention relates to an isolated PR01287 polypeptide, comprising an amino acid sequence having at least approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 28 to about 532, inclusive of Figure 276 (SEQ ID NO: 381).

In a further aspect, the invention is • refers to an isolated PR01287 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or • approximate manner 28 to approximately 532, inclusive of Figure 276 (SEQ ID NO: 381).

In still another aspect, the invention relates to an isolated PR01287 polypeptide, which comprises the sequence of amino acid residues 1 or Approximately 28 to about 532, inclusive of Figure 276 (SEQ ID NO: 381), or a fragment sufficient to provide a binding site for an anti-PR01287 antibody. Preferably, the PR01287 fragment retains a • Qualitative biological activity of a native PR01287 polypeptide.

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a DNA molecule under test • severe conditions with (a) a DNA molecule encoding a PR01287 polypeptide having the sequence of the amino acid residues approximately from 1 or approximately 28 to about 532, inclusive of Figure 276 (SEQ ID NO: 381), or (b) the complement of the DNA molecule of (a), and if the DNA molecule of The test has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) cultivating a cell The host or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

• In yet another embodiment, the invention relates to the agonists and antagonists of a native PR01287 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PR01287 antibody. 10 • In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01287 polypeptide, by contacting the native PR01287 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional modality, the • invention relates to a composition comprising a PR01287 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 121 PR01312 A cDNA clone (DNA61873-1574) encoding a new transmembrane polypeptide designated in the present application has been identified • as "PR01312".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01312 polypeptide. • In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding a PR01312 polypeptide having the sequence of amino acid residues roughly from 15 to about 212, inclusive of Figure 278 (SEQ ID NO: 387), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01312 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 49 and approximately 642 residues, inclusive, of Figure 277 (SEC ID NO: 386). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention is refers to an isolated nucleic acid molecule that • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203132 (DNA61873-1574), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203132 (DNA61873-1574).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide • having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of • sequence with the sequence of the amino acid residues approximately from 15 to about 212, inclusive of Figure 278 (SEQ ID NO: 387), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and More preferably at least about 100 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01312 polypeptide having the sequence of amino acid residues from 15 to about 212, inclusive of Figure 278 (SEQ ID NO: 387), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has the less approximately an identity of • 80% sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 100% identity sequence of 95% with (a) or (b), isolate the molecule • Test DNA.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PR01312, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, is ^ I mean, the inactivated or deleted variants of the transmembrane domain, or is complementary to Such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending roughly from position 1 of the amino acid to approximately position 14 of the amino acid in the sequence of the Figure 278 (SEQ ID NO: 387). The transmembrane domain has tentatively been identified as extending roughly from position 141 of the amino acid to approximately position 160 of the amino acid in the sequence of • amino acids of PR01312 (Figure 278, SEQ ID NO: 387).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 15 to about 212, inclusive of Figure 278 (SEQ ID NO: 387), or (b) the DNA complement of (to) . Another embodiment is directed to fragments of a sequence encoding the PR01312 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about 50 nucleotides in length. up to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01312 polypeptide encoded by • any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the PR01312 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 15 to 212 of Figure 278 (SEQ ID NO: • 387 20 In another aspect, the invention relates to an isolated PR01312 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, Preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence sequence. • amino acid residues 15 to about 212, inclusive of Figure 278 (SEQ ID NO: 387).

In a further aspect, the invention relates to an isolated PR01312 polypeptide, which comprises a record of the amino acid sequence • at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 15 to 212 of Figure 278 (SEQ ID NO: 387).

• In yet another aspect, the invention relates to to an isolated PR01312 polypeptide, comprising the sequence of amino acid residues 15 to about 212, inclusive of Figure 278 (SEQ ID NO: 387), or a sufficient fragment itself to provide a binding site for a Antibody to i-PROl 312. Preferably, the PR01312 fragment retains a qualitative biological activity of a native PR01312 polypeptide.

Still in a further aspect, the invention • provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01312 polypeptide having the sequence of the amino acid residues so approximate from 15 to about 212, • inclusive of Figure 278 (SEQ ID NO: 387), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80% sequence identity , , preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) or (b), (ii) cultivating a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 25 122. PR01192 A cDNA clone (DNA62814-1521) encoding a new polypeptide having homology to the myelin PO protein and tp 5 designated in the present application as "PR01192" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01192 polypeptide. • In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding a PR01192 polypeptide that has the The sequence of amino acid residues is approximate from 22 to about 215, inclusive of Figure 280 (SEQ ID NO: 389), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01192 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 184 and about 764 • waste, inclusive, of Figure 279 (SEQ ID NO: 388). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention is refers to an isolated nucleic acid molecule that • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203093 (DNA62814-1521), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203093 (DNA62814-1521).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of F sequence with the sequence of amino acid residues approximately from 22 to about 215, inclusive of Figure 280 (SEQ ID NO: 389), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides. nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01192 polypeptide having the sequence of amino acid residues roughly from 22 to about 215, inclusive of Figure - - 280 (SEQ ID NO: 389), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about one 80% sequence identity, preferably at least • about a sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the 10 DNA molecule tested. • In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide PR01192, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, i.e., the inactivated or deleted variants of the • transmembrane domain, or is complementary to such a coding nucleic acid molecule. He The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 21 of the amino acid in the sequence of Figure 280 (SEQ ID NO: 389). The domain of Transmembrane has tentatively been identified as extending from about position 153 of the amino acid to about position 176 of the amino acid in the amino acid sequence of PR01192 (Figure 280, SEQ ID NO: • 389).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 22 to about 215, inclusive of Figure 280 (SEQ ID NO: 389), or (b) the DNA complement of • Another embodiment is directed to fragments of a sequence encoding PR01192 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to approximately 80 nucleotides in length, preferably approximately 20 to approximately 60 nucleotides in length, more preferably from approximately 20 to approximately 50 nucleotides in length, and more ^ preferably roughly from 20 to about 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01192 polypeptide encoded by any of the nucleic acid sequences • isolated defined herein above.

In a specific aspect, the invention provides the isolated native sequence PR01192 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 22 to 215 of Figure 280 (SEQ ID NO: • 389).

In another aspect, the invention relates to an isolated PR01192 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 22 to about • 215, inclusive of Figure 280 (SEQ ID NO: 389).

In a further aspect, the invention relates to an isolated PR01192 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so • preferable at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 22 to 215 of Figure 280 (SEQ ID NO: 389).

• In yet another aspect, the invention relates to an isolated PR01192 polypeptide, which comprises Sequence of amino acid residues 22 to about 215, inclusive of Figure 280 (SEQ ID NO: 389)., Or a sufficient fragment itself to provide a binding site for an anti-i-PROl 192 antibody. Preferably, the PR01192 fragment retains a qualitative biological activity of a native PR01192 polypeptide In still a further aspect, the invention provides a polypeptide produced (i) • 5 hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01192 polypeptide having the sequence of the amino acid residues roughly from 22 to about 215, inclusive of Figure 280 (SEQ ID NO: 389), or (b) • the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% of Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) • cultivating a host cell or host that comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In still another embodiment, the invention relates to agonists and antagonists of a native PR01192 polypeptide. In a particular embodiment, the agonist or ant agonist is an anti-i-PROl 192 antibody. In a further embodiment, the invention is refers to a method for identifying the agonists or antagonists of a native PR01192 polypeptide, by contacting the native PR01192 polypeptide with a candidate molecule and monitoring one • biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01192 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. • 123. PRO1160 A cDNA clone (DNA62872-1509) encoding a new secreted polypeptide, designated in the present application as "PRO1160" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1160 polypeptide.

In one aspect, nucleic acid isolated • 5 comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule encoding a PRO1160 polypeptide having the sequence of amino acid residues from about 1 or approximately 20 to approximately 90, inclusive of Figure 282 (SEQ ID NO: 394), or (b) the complement of the DNA molecule of (a).

• In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1160 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 40 or about 97 and about 309 nucleotides, inclusive, of the 25 Figure 282 (SEQ ID NO: 394). Preferably, the » • Hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention is • 5 refers to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least approximately 90% sequence identity, • more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203100 (DNA62872-1509), or (b) the complement of the nucleic acid molecule of (to) . In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide • mature encoded by the cDNA of the human protein in ATCC Deposit No. 203100 (DNA62872-1509).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide Having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably • at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 20 to about 90, inclusive of Figure 282 (SEQ ID NO: 394), or (b) the DNA complement of (a). • In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 100 nucleotides and which is produced by hybridizing a low test DNA molecule.

Severe conditions with (a) a DNA molecule encoding a PRO1160 polypeptide having the sequence of the amino acid residues from 1 or approximately 20 to about 90, • inclusive of Figure 282 (SEQ ID NO: 394), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, so that more preferable at least approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

• In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1160 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary for such a coding nucleic acid molecule. He • Signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 19 of the amino acid in the sequence of the Figure 282 (SEQ ID NO: 394).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 20 to about 90, inclusive of Figure 282 (SEQ ID NO: 394), or (b) the DNA complement of (a).

• Another embodiment is directed to fragments of a sequence encoding the PRO1160 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 up to approximately 80 nucleotides in length, • preferably roughly from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 281 (SEQ ID NO: 393). In another embodiment, the invention provides the isolated PRO1160 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the isolated native sequence PRO1160 polypeptide, which in certain embodiments, includes an amino acid sequence comprising • waste 1 or approximately 20 to approximately 90 of Figure 282 (SEQ ID NO: 394).

In another aspect, the invention relates to a PRO1160 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or roughly • 20 to approximately 90, inclusive of the Figure 282 (SEQ ID NO: 394).

In a further aspect, the invention relates to an isolated PRO1160 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or approximately 20 to about 90, inclusive of Figure 282 (SEQ ID NO: 394).

In still another aspect, the invention relates to an isolated PRO1160 polypeptide, which comprises • sequence of amino acid residues 1 or approximately 20 to about 90, inclusive of Figure 282 (SEQ ID NO: 394), or a fragment sufficient to provide a binding site for an anti-HIV antibody. 160. Preferably, the PRO1160 fragment retains a qualitative biological activity of a native PRO1160 polypeptide. • In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1160 polypeptide having the The sequence of the amino acid residues is approximated from about 1 or about 20 to about 90, inclusive of Figure 282 (SEQ ID NO: 394), or (b) the complement of the DNA molecule of (a) , and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, so more preferable at least about 95% identity of • sequence with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide of the cell culture. 124. PR01187 A cDNA clone (DNA62876- • 1517) encoding a new polypeptide having sequence identity with endo-bet a-1,4-lane and is designated in the present application as "PROl 187".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01187 polypeptide In one aspect, the isolated nucleic acid comprises the DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of • DNA encoding a PR01187 polypeptide having the sequence of amino acid residues roughly from 18 to about 120, inclusive of Figure 284 (SEQ ID NO: 399), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to a fljp isolated nucleic acid molecule encoding a PR01187 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 172 and approximately 480 residues, inclusive, of Figure 283 (SEQ ID NO: 398). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Repository No. 203095 (DNA62876-1517), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203095 (DNA62876-1517).

• In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% of sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the amino acid residue sequence approximately from 18 up to • about 120, inclusive of Figure 284 (SEQ ID NO: 399), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least about 50 nucleotides, and • preferable way to at least about 100 nucleotides and which is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PR01187 polypeptide having the sequence of amino acid residues approximately from about 18 to about 120, inclusive of Figure 284 (SEQ ID NO: 399), or (b) the complement of the • DNA molecule from (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • about 95% positive when compared to the amino acid sequence of residues 18 to about 120, inclusive of Figure 284 (SEQ ID NO: 399), or (b) the DNA complement of (a).

Another embodiment is directed to the jB fragments of a sequence encoding the PR01187 polypeptide that can be used as probes of hybridization. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, More preferably from about 20 to about 50 nucleotides in length, and more preferably in an approximate manner from about 20 to about 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01187 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention f provides the PR01187 isolated native sequence polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 18 to 120 of Figure 284 (SEQ ID NO: 399).

In another aspect, the invention relates to an isolated PR01187 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 18 to about 120, inclusive of Figure 284 (SEQ ID NO: 399).

In a further aspect, the invention is • refers to an isolated PR01187 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 18 to 120 of Figure 284 (SEQ ID NO: 399).

In still another aspect, the invention relates to an isolated PR01187 polypeptide, comprising the sequence of amino acid residues 18 up to about 120, inclusive of Figure 284 (SEQ ID NO: 399), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 187 antibody. Preferably, the PR01187 fragment retains a qualitative biological activity of a native PR01187 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01187 polypeptide having the • sequence of the amino acid residues approximately from about 18 to about 120, inclusive of Figure 284 (SEQ ID NO: 399), or (b) the complement of the DNA molecule of (a), and if the DNA molecule test has at least approximately a sequence identity of 80%, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under • suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01187 polypeptide. In a modality In particular, the agonist or antagonist is an anti-PR01187 antibody In a further embodiment, the invention relates to a method for identifying agonists or • antagonists of a native PR01187 polypeptide, by contacting the native PR01187 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional mode, the • invention relates to a composition comprising a PR01187 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier pharmaceutically. 125 PR01185 A cDNA clone (DNA62881- • 1515) encoding a new polypeptide having sequence identity with the repression protein of glucose, tupi, and is designated in the present application as "PR01185".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising - - the DNA encoding a PR01185 polypeptide In one aspect, the isolated nucleic acid comprises the DNA having at least about • 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a molecule of • DNA encoding a PR01185 polypeptide having the sequence of amino acid residues roughly from 22 to about 198, inclusive of Figure 286 (SEQ ID NO: 401), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01185 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 67 and approximately 597 residues, inclusive, of Figure 285 (SEQ ID NO: 400). Preferably, hybridization occurs under severe washing and hybridization conditions. 25 In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Deposit No. 203096 (DNA62881-1515), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203096 (DNA62881-1515).

• In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 22 up to • about 198, inclusive of Figure 286 (SEQ ID NO: 401), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least about 50 nucleotides, and • preferable way to at least about 100 nucleotides and which is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PR01185 polypeptide having the sequence of amino acid residues roughly from 22 to about 198, inclusive of the Figure • 286 (SEQ ID NO: 401), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide tag of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 22 to about 198, inclusive of Figure 286 (SEQ ID NO: 401), or (b) the DNA complement of fifteen Another embodiment is directed to the fragments of a sequence encoding the PR01185 polypeptide which can be used as probes of hybridization. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, More preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about 40 nucleotides in length.

• In another embodiment, the invention provides the isolated PR01185 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01185, which in one embodiment, includes an amino acid sequence comprising residues 22 through 198 of Figure 286 (SEQ ID NO: 401).

In another aspect, the invention relates to an isolated PR01185 polypeptide, comprising an amino acid sequence which has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of - - amino acid residues 22 to about 198, inclusive of Figure 286 (SEQ ID NO: 401).

In a further aspect, the invention is • refers to an isolated PR01185 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least • approximately 95% positive when compared to the amino acid sequence of residues 22 to 198 of Figure 286 (SEQ ID NO: 401).

In still another aspect, the invention relates to an isolated PR01185 polypeptide, comprising the sequence of amino acid residues 22 up to • about 198, inclusive of Figure 286 (SEQ ID NO: 401), or a sufficient fragment thereof to provide a binding site for an anti-i-PROl 185 antibody. Preferably, the PR01185 fragment retains a qualitative biological activity of a native PR01185 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01185 polypeptide having the F 5 sequence of the amino acid residues approximately from 22 to about 198, inclusive of Figure 286 (SEQ ID NO: 401), or (b) the complement of the DNA molecule of (a), and if the DNA molecule test has at least approximately a sequence identity of 80%, F preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under F suitable conditions for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01185 polypeptide. In a modality In particular, the agonist or antagonist is an anti-PR01185 antibody In a further embodiment, the invention relates to a method for identifying agonists or • antagonists of a native PR01185 polypeptide, contacting the native PR01185 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional mode, the • invention relates to a composition comprising a PR01185 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier pharmaceutically. 126. PR01345 • A cDNA clone (DNA64852- 1589) has been identified, which has homology with the protein tetranectin encoding the nucleic acid, which encodes a new polypeptide, designated in the present application as "PR01345".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising .- ^^ s ** ^. *** ^ t m .... - the DNA encoding a PR01345 polypeptide In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity , more preferably at least about 95% sequence identity with (a) a molecule of • DNA encoding a PR01345 polypeptide having the sequence of amino acid residues from about 1 or from about 32 to about 206, inclusive of Figure 288 (SEQ ID NO: 403), or (b) the complement of the DNA molecule of (a).

• In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR01345 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 7 or approximately 100 and about 624 nucleotides, inclusive, of Figure 287 (SEQ ID NO: 402). Preferably, the Hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that • comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203127 (DNA64852-1589), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide • mature encoded by the cDNA of the human protein in ATCC Deposit No. 203127 (DNA64852-1589). In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least It is about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity. • sequence with the sequence of amino acid residues 1 or approximately 32 to about 206, inclusive of Figure 288 (SEQ ID NO: 403), or (b) the DNA complement of • In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 100 nucleotides and which is produced by hybridizing a low test DNA molecule.

Severe conditions with (a) a DNA molecule encoding a PR01345 polypeptide having the sequence of the amino acid residues from 1 or • approximately 32 to approximately 206, inclusive of Figure 288 (SEQ ID NO: 403), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least Approximately 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolates the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01345 polypeptide, with or without the N-terminal signal sequence and / or the initiation methionine, or is complementary for such a coding nucleic acid molecule. He • Signal peptide has tentatively been identified as extending from about position 1 or 10 of the amino acid to about position 31 of the amino acid in the sequence of the Figure 288 (SEQ ID NO: 403).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 32 to about 206, inclusive of Figure 288 (SEQ ID NO: 403), or (b) the DNA complement of (a).

• Another embodiment is directed to the fragments of a sequence encoding the PR01345 polypeptide that can be used as hybridization probes. Such nucleic acid fragments are approximately from 20 up to approximately 80 nucleotides in length, • preferably roughly from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably approximately from 20 to about 40 n? Clots in length and can be derived from the sequence of • nucleotides shown in Figure 287 (SEQ ID NO: 402). In another embodiment, the invention provides the isolated PR01345 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PR01345 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising • waste 1 or approximately 32 to approximately 206 of Figure 288 (SEQ ID NO: 403).

In another aspect, the invention relates to a PR01345 polypeptide isolated, comprising a • amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at At least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or roughly 32 to approximately 206, inclusive of the Figure 288 (SEQ ID NO: 403).

In a further aspect, the invention relates to an isolated PR01345 polypeptide, comprising an amino acid sequence record of at least about 80% positive, so . _...- a-- - »..- - - preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 1 or approximately 32 to approximately 206, inclusive of Figure 288 (SEQ ID NO: 403).

In still another aspect, the invention relates to an isolated PR01345 polypeptide, comprising • sequence of amino acid residues 1 or approximately 32 to about 206, inclusive of Figure 288 (SEQ ID NO: 403), or a sufficient fragment itself to provide a binding site for an anti-HIV antibody. 345. Preferably, the PR01345 fragment retains a qualitative biological activity of a polypeptide • PR01345 native.

Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01345 polypeptide having the sequence of the amino acid residues so - ^ 1-ii-á-il-ÍM-itMI-M - - approximated from 1 or approximately 32 to approximately 206, inclusive of Figure 288 (SEQ ID NO: 403), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90 % sequence identity, more preferably at least about 95% identity of • sequence with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide of the cell culture.

In yet another embodiment, the invention is • refers to the agonists and antagonists of a native PR01345 polypeptide, in a modality In particular, the agonist or antagonist is an anti-i-PROl 345 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01345 polypeptide, -iM-tt-Mit-M-1 - - contacting the native PR01345 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

• Still in a further embodiment, the invention relates to a composition comprising a PR01345 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier pharmaceutically. • 127 PR01245 A cDNA clone (DNA64884-1527) encoding a new secreted polypeptide designated in the present application as "PR01245" has been identified.

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PR01245 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity of Sequence, more preferably at least - about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01245 polypeptide having the • sequence of amino acid residues approximately from 19 to about 104, inclusive of Figure 290 (SEQ ID NO: 408), or (b) the complement of the DNA molecule of (a).

. In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01245 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid in a manner between about 133 and about 390 residues, inclusive, of Figure 289 (SEQ ID NO: 407). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, ^^ ¡^^^^^^^ ags ^ - - most preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA of the human protein in the • ATCC Deposit No. 203155 (DNA64884 - 1245), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA of the human protein in the ATCC Deposit No. 203155 (DNA64884-1245). • In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues approximately from about 19 to about 104, inclusive of Figure 290 (SEQ ID NO: 408), or (b) the DNA complement of - - In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and • more preferably at least about 100 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01245 polypeptide having the sequence of amino acid residues from 19 up to • approximately 104, inclusive of Figure 290 (SEQ ID NO: 408), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately an identity of sequence of 80%, preferably at least about a sequence identity of 85%, more preferably at least about • a sequence identity of 90%, more preferably at least approximately an identity of % sequence with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide - PR01245, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such a coding nucleic acid molecule. The signal peptide has been tentatively identified • as extending roughly from position 1 of the amino acid to approximately position 18 of the amino acid in the sequence of Figure 290 (SEQ ID NO: 408).

In another aspect, the invention relates to • an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 19 to about 104, inclusive of Figure 290 (SEQ ID NO: 408), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding PR01245 polypeptide that can find use as probes - - hybridization. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about • about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in about 20 to about 40 nucleotides in length. • In another embodiment, the invention provides the isolated PR01245 polypeptide encoded by any of the isolated nucleic acid sequences defined herein. In a specific aspect, the invention provides the isolated native sequence PR01245 polypeptide, which in one embodiment, includes an amino acid sequence comprising the residues 19 to 104 of Figure 290 (SEQ ID NO: 408).

In another aspect, the invention relates to an isolated PR01245 polypeptide, comprising a Amino acid sequence having at least - about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with the sequence of amino acid residues 19 to about 104, inclusive of Figure 290 (SEQ ID NO: 408).

In a further aspect, the invention is • refers to an isolated polypeptide PR01245, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to • the amino acid sequence of residues 19 to 104 of Figure 290 (SEQ ID NO: 408). In still another aspect, the invention relates to an isolated PR01245 polypeptide, comprising the sequence of amino acid residues 19 to about 104, inclusive of Figure 290 (SEQ ID NO: 408), or a sufficient fragment itself - to provide a binding site for an anti-iPR01245 antibody. Preferably, the PR01245 fragment retains a qualitative biological activity of a native PR01245 polypeptide. • In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that encodes a PR01245 polypeptide having the • sequence of the amino acid residues roughly from 19 to about 104, inclusive of Figure 290 (SEQ ID NO: 408), or (b) the complement of the DNA molecule of (a), and if the The test DNA molecule has at least approximately 80% sequence identity, preferably at least about 85% • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 128. PR01358 A cDNA clone (DNA64890- • 1612) encoding a new polypeptide having sequence identity with RASP-1 and designated in the present application as "PR01358" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule which comprises ^ the DNA encoding a PR01358 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least • approximately 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PR01358 polypeptide having the sequence of amino acid residues roughly from about 19 to about 444, inclusive of Figure 292 (SEQ ID NO: 410), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01358 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 140 and about 1417 residues, inclusive, of Figure 292 (SEQ. ID NO: 410). Preferably, hybridization occurs under severe washing and hybridization conditions. • In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, • more preferably at least about 95% sequence identity with (a) a molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203131 (DNA64890-1612), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide - encoded by the human protein cDNA in ATCC Repository No. 203131 (DNA64890-1612).

In still a further aspect, the invention • 5 refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% • sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 19 up to about 444, inclusive of Figure 292 (SEQ ID NO: 410), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least about 50 nucleotides, and preferably at least about 100 nucleotides, and that is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01358 polypeptide having the sequence of -Mii-i-ttati-ai- - amino acid residues approximately from about 19 to about 444, inclusive of Figure 292 (SEQ ID NO: 410), or (b) the complement of the DNA molecule of (FIG. a), and, if the DNA molecule • 5 has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about approximately 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 19 to about 444, inclusive of Figure 292 (SEQ ID NO: 410), or (b) the DNA complement of (a).

- - Another embodiment is directed to the fragments of a sequence encoding PR01358 polypeptide that can be used as probes of • Hybridization. Such nucleic acid fragments are approximately from 80 nucleotides to approximately 120 nucleotides in length.

In another embodiment, the invention provides the isolated PR01358 polypeptide encoded by • any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the PR01358 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising the • residues 19 to 444 of Figure 292 (SEQ ID NO: 410). In another aspect, the invention relates to an isolated PR01358 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, Preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of the amino acid residues 19 to about 444, inclusive of Figure 292 (SEQ ID NO: 410).

In a further aspect, the invention relates to an isolated PR01385 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 19 to about 444, inclusive of Figure 292 (SEQ ID NO: 410).

In still another aspect, the invention relates to an isolated PR01358 polypeptide, comprising the sequence of amino acid residues 19 to about 444, inclusive of Figure 292 (SEQ ID NO: 410), or a fragment sufficient to provide a binding site for an anti-i-PROl antibody 358. Preferably, the PR01358 fragment retains a qualitative biological activity of a native PR01358 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01358 polypeptide having the sequence of the amino acid residues so • approximate from 19 to about 444, inclusive of Figure 292 (SEQ ID NO: 410), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably to • less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) by culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

- - In yet another embodiment, the invention relates to agonists and antagonists of a native PR01358 polypeptide. In a modality • in particular, the agonist or antagonist is an anti-i-PROl 358 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01358 polypeptide, • contacting the native PR01358 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01358 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier. pharmaceutically. 129 PR01195 A cDNA clone (DNA65412-1523) has been identified that encodes a new polypeptide that has identity of sequence with the rich acidic protein - - in mouse proline, and is designated in the present application as "PR01195".

In one embodiment, the invention provides • an isolated nucleic acid molecule comprising the DNA encoding a PR01195 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably • at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% Sequence identity with (a) a DNA molecule encoding a PR01195 polypeptide having the amino acid residue sequence in a manner • approximate from 23 to about 151, inclusive of Figure 294 (SEQ ID NO: 412), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01195 polypeptide comprising the DNA that hybridizes to the nucleic acid complement approximately between 124 and about 510 residues, inclusive, of Figure 293 (SEQ ID NO: 411). Preferably, hybridization occurs under severe washing and hybridization conditions.

• In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% identity of • sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203094 (DNA65412-1523), or (b) • the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203094 (DNA65412-1523).

In still a further aspect, the invention relates to an isolated nucleic acid molecule • - ^ ü ^^^^^^^ M ^^ .., ----- ^^ - ^ - - comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity , preferably at least about 85% sequence identity, • more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from about 23 to about 151, inclusive of Figure 294 • (SEQ ID NO: 412), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule that has at least about 50 nucleotides, and preferably at least about 100 nucleotides and that is produced by hybridizing a • Test DNA molecule under severe conditions with (a) a DNA molecule that encodes a PR01195 polypeptide having the sequence of amino acid residues roughly from 23 to about 151, inclusive of Figure 294 (SEQ ID NO: 412), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more • preferable at least about 95% sequence identity with (a) or (b), isolating the test DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule comprising • (a) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 23 up to • approximately 151, inclusive of Figure 294 (SEQ ID NO: 412), or (b) the DNA complement of a) .

Another embodiment is directed to the fragments of a sequence encoding the PR01195 polypeptide that can be used as probes of hybridization. Such nucleic acid fragments are roughly from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, • more preferably from about 20 to about 50 nucleotides in length, and more preferably in an approximate manner from 20 to about 40 nucleotides in length.

In another embodiment, the invention provides • the isolated PR01195 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

In a specific aspect, the invention provides the PR01195 polypeptide of isolated native sequence, which in one embodiment, includes • an amino acid sequence comprising residues 23 to 151 of Figure 294 (SEQ ID NO: 412).

In another aspect, the invention relates to an isolated PR01195 polypeptide, comprising an amino acid sequence having at least About 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with the sequence of amino acid residues 23 to about 151, inclusive of Figure 294 (SEQ ID NO: 412).

In a further aspect, the invention is refers to an isolated PR01195 polypeptide, which • comprises a record of the amino acid sequence of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 23 up to • 151 of Figure 294 (SEQ ID NO: 412).

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01195 polypeptide having the The sequence of the amino acid residues is approximated from about 23 to about 151, inclusive of Figure 294 (SEQ ID NO: 412), or (b) the complement of the DNA molecule of (a), and the DNA test molecule has at least • approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) • culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention is • refers to the agonists and antagonists of a native PR01195 polypeptide. In a modality In particular, the agonist or antagonist is an anti-PRO-195 antibody.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01195 polypeptide, by contacting the native PR01195 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01195 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 130 PRO1270 A cDNA clone (DNA66308-1537), which has homology with the nucleic acid encoding a lectin protein, encoding a new polypeptide, designated in the present application as "PRO1270" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1270 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably - "-" - -Trlr- at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% • sequence identity with (a) a DNA molecule encoding a PRO1270 polypeptide having the sequence of amino acid residues from about 1 or from about 17 to about 313, inclusive of Figure 296 (SEQ ID NO: 414), or (b) the complement of the • DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1270 polypeptide comprising DNA that hybridizes to the complement of the nucleic acid between about 103 or approximately 151 and about 1041 nucleotides, inclusive, of Figure 295 (SEQ ID NO: 413). Preferably, the Hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule that comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203159 (DNA66308-1537), or (b) the complement of the nucleic acid molecule of • (to) . In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203159 (DNA66308-1537). In still a further aspect, the invention relates to an isolated nucleic acid molecule • comprising (a) DNA encoding a polypeptide having at least about 80% identity of sequence, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% identity of Sequence with the sequence of amino acid residues 1 or approximately 17 to about 313, inclusive of Figure 296 (SEQ ID NO: 414), or (b) the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 285 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1270 polypeptide which has the sequence of the amino acid residues from 1 or approximately 17 to about 313, inclusive of Figure 296 (SEQ ID NO: 414), or (b) the complement of the DNA molecule of (a), and , if the DNA molecule has at least about 80% sequence identity, preferably at least approximately a sequence identity of 85%, more preferably at least about 90% sequence identity, so more preferably at least about 95% sequence identity with (a) or (b), isolating the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PRO1270 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, or is complementary to such an acid molecule encoding nucleic acid The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 16 of the amino acid in the sequence of the Figure 296 (SEQ ID NO: 414). • In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 17 to about 313, inclusive of Figure 296 (SEQ ID NO: 414), or (b) the DNA complement of (a).

Another embodiment is directed to fragments of a sequence encoding the PRO1270 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably in a manner of approximate from 20 to • about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 295 (SEQ ID NO: 413). In another embodiment, the invention provides the isolated PRO1270 polypeptide encoded by • any of the isolated nucleic acid sequences identified hereinbefore. In a specific aspect, the invention provides the isolated native sequence PRO1270 polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 17 up to - ^ - aMü-aüi approximately 313 of Figure 296 (SEC ID NO. 414).

In another aspect, the invention relates to an isolated PRO1270 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 17 to about 313, inclusive of Figure 296 (SEQ. NO: 414).

In a further aspect, the invention relates to an isolated PRO1270 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 17 to approximately 313, inclusive of Figure 296 (SEQ ID NO: 414).

In yet another aspect, the invention relates to an isolated PRO1270 polypeptide, which comprises the sequence of amino acid residues 1 or approximately 17 to about 313, inclusive of Figure 296 (SEQ ID NO: 414), or a fragment sufficient to provide a binding site for an anti i-PROl 270 antibody. Preferably, the PRO1270 fragment retains a qualitative biological activity of a native PRO1270 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PRO1270 polypeptide having the sequence of the amino acid residues so approximate from 1 or approximately 17 to approximately 313, inclusive of Figure 296 (SEQ ID NO: 414), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a cell host or host comprising the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. • In yet another embodiment, the invention relates to agonists and antagonists of a native PRO1270 polypeptide. In a modality In particular, the agonist or antagonist is an an 1-PROl 2 0 antibody.

• In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1270 polypeptide by contacting the native PRO1270 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PRO1270 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 131 PR01271 A cDNA clone (DNA66309-1538) encoding a new polypeptide having serine and threonine rich regions, designated in the present application as "PR01271" polypeptides has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01271 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01271 polypeptide having the sequence of amino acid residues roughly from 32 to about 208, inclusive of Figure 298 (SEQ. ID NO: 416), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01271 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 187 and approximately 717 residues, inclusive, of Figure 297 (SEQ. ID NO: 415). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the - - ATCC No. 203235 (DNA66309-1538), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide • encoded by the human protein cDNA in ATCC Deposit No. 203235 (DNA66309-1538).

In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide • having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% Sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 32 to about 208, inclusive of Figure 298 (SEQ ID NO: 416), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 ^^. - - nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01271 polypeptide having the sequence of ^ amino acid residues roughly from 32 to about 208, inclusive of Figure 298 (SEQ ID NO: 416), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least approximately an identity of sequence of 80%, preferably at least about one sequence identity of 85%, more preferably at least about 90% sequence identity, more preferably at least about one identity of 95% sequence with (a) or (b), isolate the test DNA molecule In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01271 polypeptide, with or without the N-terminal signal sequence and / or the initiating methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to Such a coding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about position 1 of the amino acid to about position 31 of the amino acid in the sequence of the • Figure 298 (SEQ ID NO: 416). The transmembrane domain has tentatively been identified as extending from about position 166 of the amino acid to about position 187 of the amino acid in the sequence of amino acids of PR01271 (Figure 298, SEC ID NO: • 416).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (A) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, • more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 32 to approximately 208, inclusive of Figure 298 (SEQ ID NO: 416), or (b) the DNA complement of (a). Another embodiment is directed to fragments of a sequence encoding the PR01271 polypeptide that can find use as hybridization probes. Such nucleic acid fragments • are approximately from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about approximately 50 nucleotides in length, and more • preferably roughly from 20 to about 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01271 polypeptide encoded by any of the isolated nucleic acid sequences defined herein.

• In a specific aspect, the invention provides the isolated native sequence PR01271 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 32 through 208 of Figure 298 (SEQ ID NO: 416). In another aspect, the invention relates to an isolated PR01271 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, • preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the amino acid residue sequence 32 to approximately • 208, inclusive of Figure 298 (SEQ ID NO: 416).

In a further aspect, the invention relates to an isolated PR01271 polypeptide, which comprises a record of the amino acid sequence of at least about 80% positive, preferably at least about 85% positive, • more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 32 to 208 of Figure 298 (SEQ ID NO: 416).

In still another aspect, the invention relates to an isolated PR01271 polypeptide, comprising the sequence of amino acid residues 32 to about 208, inclusive of Figure 298 (SEQ ID NO: 416), or a sufficient fragment thereof to provide a link site for a • anti-i-PROl antibody 271. Preferably, the PR01271 fragment retains a qualitative biological activity of a native PR01271 polypeptide.

Still in a further aspect, the invention provides a polypeptide produced (i) • hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule encoding a PR01271 polypeptide having the sequence of the amino acid residues so approximate from 32 to about 208, inclusive of Figure 298 (SEQ ID NO: 416), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about a sequence identity of 80%, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) cultivating a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01271 polypeptide. In a particular embodiment, the agonist or antagonist is a antibody ant i - PROl 271. • In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01271 polypeptide, by contacting the native PR01271 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in an additional modality, the The invention relates to a composition comprising a PR01271 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 25 • k-riia-a-1-k? Ii-132. PR01375 A cDNA clone (DNA67004-1614) encoding a new polypeptide having sequence identity with PUT2 has been identified and is designated C 5 in the present application as "PR01375" In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01375 polypeptide. • In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% identity.

Sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01375 polypeptide having the The sequence of amino acid residues is approximate from 1 to about 198, inclusive of Figure 300 (SEQ ID NO: 418), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to a -? T - - rr - 1? »^^^ M - ^. ^ I ^^^^ aü ^ i ^ i ^^^^^^ M ^ isolated nucleic acid molecule encoding a PR01375 polypeptide comprising DNA that hybridizes to the nucleic acid complement approximately between 104 and approximately 697 residues, inclusive, of Figure 299 (SEQ ID NO: 417). Preferably, hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in the ATCC Deposit No .203115 (DNA67004-1614), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203115 (DNA67004-1614).

- In yet a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues approximately from 1 to about 198, inclusive of the Figure 300 (SEQ ID NO: 418), or the DNA complement of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides, and which is produced by hybridizing a DNA test molecule under severe conditions with (a ) a DNA molecule encoding a PR01375 polypeptide having the sequence of amino acid residues roughly from 1 to about 198, inclusive of Figure -300 (SEQ ID NO: 418), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about one 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01375 polypeptide in its soluble form, i.e., variants inactivated or deleted from the transmembrane domain, or is complementary to such a coding nucleic acid molecule . The transmembrane domains have tentatively been identified as extending from about the amino acid positions 11-28 (type II) and 103-125 of the SEC. ID NO: 418 In another aspect, the invention relates to an isolated nucleic acid molecule comprising - - (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, so more preferable at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 198, inclusive of Figure 300 (SEQ ID NO: 418), or (b) the DNA complement of Another embodiment is directed to fragments of a sequence encoding PR01375 polypeptide that can find use as hybridization probes. Such nucleic acid fragments are approximately from 20 to approximately 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length, and more preferably from about 20 to about 40 nucleotides in length.

In another embodiment, the invention provides - the isolated PR01375 polypeptide encoded by any of the isolated nucleic acid sequences defined hereinbefore.

In a specific aspect, the invention provides isolated native sequence polypeptide PR01375, which in one embodiment, includes an amino acid sequence comprising residues 1 through 198 of Figure 300 (SEQ ID NO: 418).

In another aspect, the invention relates to an isolated PR01375 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 198, inclusive of Figure 300 (SEQ ID NO: 418).

In a further aspect, the invention relates to an isolated PR01375 polypeptide, which comprises an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 through 198 of Figure 300 (SEQ ID NO: 418).

In still another aspect, the invention relates to an isolated PR01375 polypeptide, comprising the sequence of amino acid residues 1 to about 198, inclusive of Figure 300 (SEQ ID NO: 418), or a fragment thereof sufficient to provide a binding site for an anti i-PROl 375 antibody. Preferably, the PR01375 fragment retains a qualitative biological activity of a native PR01375 polypeptide.

In yet a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01375 polypeptide having the sequence of the amino acid residues so - -approximated from 1 to approximately 198, inclusive of Figure 300 (SEQ ID NO: 418), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to agonists and antagonists of a native PR01375 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRI antibody 375.

In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01375 polypeptide, , J: - »- M --- r. .. - contacting the native PR01375 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

Still in a further embodiment, the invention relates to a composition comprising a PR01375 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. 133. PR01385 A cDNA clone (DNA68869-1610) encoding a new secreted polypeptide, designated in the present application as "PR01385" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01385 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least ? Faith? about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01385 polypeptide having the amino acid residue sequence from about 1 or approximately 29 to about 128, inclusive of Figure 302 (SEQ ID NO: 420), or (b) the complement of the DNA molecule of (a). • In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01385 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between approximately 26 or approximately 110 and approximately 409 nucleotides, inclusive, of Figure 301 (SEQ ID NO: 419). Preferably, the • H ibr idi zac ion occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203164 (DNA68869-1610), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203164 (DNA68869-1610).

In still a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% identity of sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 29 to about 128, inclusive of Figure 302 ... .. " - -. , & & amp; ... taiMa ^ ssaaa.

(S EC, I D NO: 4 2 0), or (b) the comp l ement of the A DN of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule having at least 245 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01385 polypeptide which has the sequence of the amino acid residues from 1 or approximately 29 to about 128, inclusive of Figure 302 (SEQ ID NO: 420), or (b) the complement of the DNA molecule of (a), and , if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide - - »'-» - * «.

- PR01385, with or without the N-terminal signal sequence and / or the initiation methionine, or is complementary to such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending from about position 1 of the amino acid to about position 28 of the amino acid in the sequence of Figure 302 (SEQ ID NO: 420).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 29 to about 128, inclusive of Figure 302 (SEQ ID NO: 420 ), or (b) the DNA complement of (a).

Another embodiment is directed to the fragments of a sequence encoding PR01385 polypeptide that can be used as probes of -MH-É -.-.-.- i- ^ hybridization. Such nucleic acid fragments are from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about 50 nucleotides in length and more preferably in an approximate manner. from about 20 to about 40 nucleotides in length and can be derived from the nucleotide sequence shown in Figure 301 (SEQ ID NO: 419).

In another embodiment, the invention provides the isolated PR01385 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

In a specific aspect, the invention provides the PR01385 polypeptide of isolated native sequence, which in certain embodiments, includes an amino acid sequence comprising residues 1 or approximately 29 to approximately 128 of Figure 302 (SEQ ID NO: 420). ? á-ílÉ-í -? - H - - In another aspect, the invention relates to an isolated PR01385 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at less about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 29 to about 128, inclusive of Figure 302 (SEQ ID NO. : 420).

In a further aspect, the invention relates to an isolated PR01385 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, most preferably at least about 90 % positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 or approximately 29 to about 128, inclusive of Figure 302 (SEQ ID NO: 420).

- - In still another aspect, the invention relates to an isolated PR01385 polypeptide, comprising the sequence of amino acid residues 1 or • approximate manner 29 to approximately 128, inclusive of Figure 302 (SEQ ID NO: 420), or a sufficient fragment itself to provide a binding site for an anti-i-PROl 385 antibody. Preferably, the PR01385 fragment retains a qualitative biological activity of a polypeptide • PR01385 native.

In yet a further aspect, the invention provides a polypeptide produced (i) by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01385 polypeptide having the • sequence of amino acid residues roughly from 1 or approximately 29 to about 128, inclusive of Figure 302 (SEQ ID NO: 420), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host or host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. 134. PR01387 A cDNA clone (DNA68872-1620), which has homology with the myelin encoding the nucleic acid, which codes for a new polypeptide, designated in the present application as "PROl 387" has been identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01387 polypeptide.

In one aspect, the isolated nucleic acid comprises the DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01387 polypeptide having the • sequence of amino acid residues from about 1 or approximately 20 to about 394, inclusive of Figure 304 (SEQ ID NO: 422), or (b) the complement of the DNA molecule of (a). • In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PR01387 polypeptide comprising the DNA that hybridizes to the nucleic acid complement between approximately 85 or approximately 142 and approximately 1226 nucleotides, inclusive, of Figure 203 (SEQ ID NO: 421). Preferably, hybridization occurs under severe washing and hybridization conditions. In a further aspect, the invention relates to an isolated nucleic acid molecule comprising the DNA having at least about 80% sequence identity, preferably at least about 85% identity of 4-3áá ...-..- t, ...... sequence, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) one molecule of • DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203160 (DNA68872-1620), or (b) the complement of the nucleic acid molecule of (a). In a preferred embodiment, the nucleic acid comprises a DNA encoding the same polypeptide • mature encoded by the human protein cDNA in ATCC Repository No. 203160 (DNA68872-1620).

In still a further aspect, the invention refers to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide having at least about 80% identity • of sequence, preferably at least about 85% sequence identity, of More preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 or approximately 20 up to approximately 394, inclusive of Figure 304 • u-u-S-h (SEQ ID NO: 422), or (b) the DNA complement of (a).

In a further aspect, the invention is • 5 refers to an isolated nucleic acid molecule having at least 395 nucleotides and which is produced by hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule encoding a PR01387 polypeptide having the Sequence of the amino acid residues from 1 or approximately 20 to about 394, inclusive of Figure 304 (SEQ ID NO: 422), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about a sequence identity of 80%, preferably at least approximately a sequence identity of 85%, more preferably at least • approximately 90% sequence identity, more preferably at least about a sequence identity of 95% with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a polypeptide - ** - ~? • • -.a-Atja-e ---.

PR01387, with or without the N-terminal signal sequence and / or the initiation methionine, and its soluble, i.e., the inactivated or deleted variants of the transmembrane domain, or is complementary to • such a coding nucleic acid molecule. The signal peptide has tentatively been identified as extending roughly from position 1 of the amino acid to approximately position 19 of the amino acid in the sequence of the Figure 304 (SEQ ID NO: 422). The domain of • The ansmembrane has tentatively been identified as extending roughly from position 275 of the amino acid to approximately position 296 of the amino acid in the sequence of amino acids of PR01387 (Figure 304, SEQ ID NO: 422).

• In another aspect, the invention relates to an isolated nucleic acid molecule comprising (A) DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 20 to about 394, inclusive of Figure 304 (SEQ ID NO: 422), or (b) the DNA complement of ( to) . • Another embodiment is directed to fragments of a sequence encoding the PR01387 polypeptide that can be used as hybridization probes. Such nucleic acid fragments are approximately from 20 to • approximately 80 nucleotides in length, preferably approximately 20 to approximately 60 nucleotides in length, more preferably from approximately 20 to approximately 50 nucleotides in length, and more preferably approximately 20 to approximately 40 nucleotides in length and • can be derived from the nucleotide sequence shown in Figure 303 (SEQ ID NO: 421).

In another embodiment, the invention provides the isolated PR01387 polypeptide encoded by any of the isolated nucleic acid sequences identified herein.

- - In a specific aspect, the invention provides the PR01387 polypeptide of isolated native sequence, which in certain embodiments, • includes an amino acid sequence comprising residues 1 or approximately 20 to approximately 394 of Figure 304 (SEQ ID NO: 422).

In another aspect, the invention relates to a • PR01387 polypeptide isolated, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about • 95% sequence identity with the sequence of amino acid residues 1 or roughly to about 394, inclusive of Figure 304 (SEQ ID NO: 422).

In a further aspect, the invention relates to an isolated PR01387 polypeptide, which comprises a record of the amino acid sequence - - of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least * s • approximately 95% positive when compared to the amino acid sequence of residues 1 or approximately 20 to approximately 394, inclusive of Figure 304 (SEQ ID NO: 422).

In still another aspect, the invention relates to • to an isolated PR01387 polypeptide, comprising the sequence of amino acid residues 1 or approximately 20 to about 394, inclusive of Figure 304 (SEQ ID NO: 422), or a fragment sufficient to provide a binding site for an anti-i-PROl 387 antibody. Preferably, the PR01387 fragment retains a qualitative biological activity of a native PR01387 polypeptide. Still in a further aspect, the invention provides a polypeptide produced by (i) hybridizing a test DNA molecule under severe conditions with (a) a DNA molecule that encodes a PR01387 polypeptide having the sequence of the amino acid residues roughly from 1 or approximately 20 to approximately 394, inclusive of Figure 304 (SEQ ID NO: 422), or (b) the complement of the • DNA molecule of (a), and if the test DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90 % sequence identity, more preferably • at least about 95% sequence identity with (a) or (b), (ii) by culturing a host cell or host comprising the test DNA molecule ba or suitable conditions for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

In yet another embodiment, the invention relates to the agonists and antagonists of a PR01387 polypeptide native. In a particular embodiment, the agonist or antagonist is an antibody to nt i-PROl 387.

In a further embodiment, the invention relates to a method for identifying agonists or • - - - - - - - - - - - - - - - antagonists of a native PR01387 polypeptide, by contacting the native PR01387 polypeptide with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

• Still in a further embodiment, the invention relates to a composition comprising a PR01387 polypeptide, or an agonist or antagonist as defined herein above, in combination with an acceptable carrier • Pharmaceuticals. 135 PR01384 A cDNA clone has been identified, referred to herein as "DNA71159", which encodes a new polypeptide having homology to the NKG2-D protein, designated in the present application • as "PR01384".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR01384 polypeptide.

In one aspect, the isolated nucleic acid comprises DNA having at least about Y. ^? **, - '.. .S .- ^ > .-... * • - - 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) a DNA molecule encoding a PR01384 polypeptide having the sequence of amino acid residues roughly from 1 to about 229, inclusive of Figure 306 (SEQ ID NO: 424), or (b) the complement of the DNA molecule of (a).

In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PR01384 polypeptide comprising DNA that hybridizes to nucleic acid complement approximately between 182 and about 868 • waste, inclusive, of Figure 305 (SEQ ID NO: 423). Preferably, the hybridization occurs under severe washing and hybridization conditions.

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably a A »> : - - at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% • 5 sequence identity with (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203135 (DNA71159-1617), or (b) the complement of the DNA molecule of (a). In a preferred embodiment, the nucleic acid comprises a • DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Repository No. 203135 (DNA71159-1617).

Still in a further aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide • which has at least approximately 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the residue sequence of amino acids approximately from 1 to - about 229, inclusive of Figure 306 (SEQ ID NO: 424), or the DNA complement of (a).

In a further aspect, the invention is • 5 refers to an isolated nucleic acid molecule having at least about 50 nucleotides, and preferably at least about 100 nucleotides, and which is produced by hybridizing a DNA test molecule under severe conditions with (a) a DNA molecule that encodes a • PR01384 polypeptide having the sequence of amino acid residues roughly from 1 to about 229, inclusive of Figure 306 (SEQ ID NO: 424), or (b) the complement of the DNA molecule of (a), and, if the DNA molecule has at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about a sequence identity of 90%, more preferably at least about 95% sequence identity with (a) or (b), isolate the test DNA molecule.

In a specific aspect, the invention ^ t miS tt ^ - 1 - provides an isolated nucleic acid molecule comprising the DNA encoding a PR01384 polypeptide with its inactivated or deleted transmembrane domain, or is complementary to such a coding nucleic acid molecule. The transmembrane domain has been tentatively identified as extending from about position 32 of the amino acid to about position 57 of the amino acid in the amino acid sequence of PR01384 (Figure 306, SEQ ID NO: 424).

In another aspect, the invention relates to an isolated nucleic acid molecule comprising (a) the DNA encoding a polypeptide registry of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, more preferably at least about 95% positive when compared to the amino acid sequence of residues 1 to about 229, inclusive of Figure 306 (SEQ ID NO: 424), or (b) ) the DNA complement of (a).

- - Another embodiment is directed to fragments of a sequence encoding PR01384 polypeptide that can find use as hybridization probes. Such nucleic acid fragments • are approximately from about 20 to about 80 nucleotides in length, preferably from about 20 to about 60 nucleotides in length, more preferably from about 20 to about approximately 50 nucleotides in length, and more preferably approximately 20 to approximately 40 nucleotides in length.

In another embodiment, the invention provides the isolated PR01384 polypeptide encoded by any of the isolated nucleic acid sequences defined herein. • In a specific aspect, the invention provides the PR01384 polypeptide of isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 229 of Figure 306 (SEQ ID NO: 424).

In another aspect, the invention relates to an isolated PR01384 polypeptide, which comprises an amino acid sequence having at least about 80% sequence identity, preferably at least about 85% • sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with the sequence of amino acid residues 1 to about 10 229, inclusive of the Figure 306 (SEQ ID NO: 424).

• In a further aspect, the invention relates to an isolated PR01384 polypeptide, comprising an amino acid sequence record of at least about 80% positive, preferably at least about 85% positive, more preferably at least about • 90% positive, more preferably at least approximately 95% positive when compared to the amino acid sequence of residues 1 to 229 of Figure 306 (SEQ ID NO: 424).

In still another aspect, the invention relates to an isolated PR01384 polypeptide, comprising the Sequence of amino acid residues 1 to - about 229, inclusive of Figure 306 (SEQ ID NO: 424), or a sufficient fragment itself to provide a binding site for an anti-i-PROl antibody 384. Preferably, he • fragment PR01384 retains a qualitative biological activity of a native PR01384 polypeptide.

In still a further aspect, the invention provides a polypeptide produced (i) by hybridizing a DNA molecule under test • severe conditions with (a) a DNA molecule encoding a PR01384 polypeptide having the sequence of the amino acid residues roughly from 1 to about 229, inclusive of Figure 306 (SEQ ID NO: 424), or (b) the complement of the DNA molecule of (a), and if the test DNA molecule has at least • approximately 80% sequence identity, preferably at least about 85% Sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 95% sequence identity with (a) or (b), (ii) culturing a host cell or host what comprises the test DNA molecule under conditions suitable for the expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture.

• In yet another embodiment, the invention relates to agonists and antagonists of a native PR01384 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRI antibody 384. 10 • In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PR01384 polypeptide, by contacting PR01384 polypeptide native with a candidate molecule and monitoring a biological activity mediated by said polypeptide.

• Still in a further embodiment, the invention relates to a composition comprising a PR01384 polypeptide, or an agonist or antagonist as defined herein above, in combination with a pharmaceutically acceptable carrier. ^^^^ s ^^^ - - 136. Additional Modalities In other embodiments of the present invention, the invention provides vectors comprising the DNA encoding any of the • polypeptides described before or after. A host or host cell comprising any such vector is also provided. By way of example, host cells or hosts can be CHO, E cells. co l i, or yeasts. A process is also provided for • producing any of the polypeptides described before or after and comprises culturing host cells or hosts under conditions suitable for the expression of the desired polypeptide and recovering the Desired polypeptide from the cell culture.

In other embodiments, the invention provides chimeric molecules comprising any of the polypeptides described above or subsequently, fused to a heterologous polypeptide or amino acid sequence. An example of such a chimeric molecule comprises any of the polypeptides described before or subsequently fused to an epitope tag sequence or to an Fc region of an immunoglobulin. i-. - ~.-i ^ yaajEfc ^ - - In another embodiment, the invention provides an antibody that specifically binds to any of the polypeptides described above or • later. Optionally, the antibody is a monoclonal antibody.

In still other embodiments, the invention provides oligonucleotide probes useful for isolating genomic sequences and cDNA nucleotide sequences, wherein those probes can be derived from any of the nucleotide sequences described above or later.

In other embodiments, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide.

In one aspect, the isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, More preferably at least about 82% -sequence identity, even more preferably at least about 83% sequence identity, even more preferably at least about 84% sequence identity, yet • 5 more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, yet more preferably at least approximately • 88% sequence identity, even more preferably at least about 89% sequence identity, even more preferably at least about 90% sequence identity, yet more preferably at least about 91% sequence identity, even more preferably at least about 92% identity • of sequence, even more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, yet More preferably at least about -97% sequence identity, even more preferably at least about 98% sequence identity, even more preferably at least about 99% sequence identity to (a) a DNA molecule encoding a PRO polypeptide having a full-length amino acid sequence as described herein, a full-length amino acid sequence that lacks the signal peptide as described in present or an extracellular domain of a protein • of transmembrane as described herein, or (b) the complement of the DNA molecule of (a).

In other aspects, the acid molecule An isolated nucleic acid comprising a nucleotide sequence having at least about 80% sequence identity, preferably • less about 81% sequence identity, more preferably at least about 82% sequence identity, even more preferably at least about 83% sequence identity, even more preferably at least about 84% sequence identity, even more preferably at least about % sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more preferably at least about • 88% sequence identity, even more preferably at least about 89% sequence identity, even more preferably at least about 90% sequence identity, even more preferably at least about 91% sequence identity, even more so • preferable at least about 92% sequence identity, even more preferably at least about 93% sequence identity, even more preferably at least about 94% sequence identity, still more preferably at least about 95% sequence identity, even more preferably at least • approximately 96% sequence identity, even more preferably at least approximately 97% sequence identity, still more preferably at least about 98% sequence identity, even more preferably at least about 99% sequence identity to (a) a DNA molecule having the sequence of encoding a full-length PRO polypeptide cDNA as described herein, the coding sequence of a full-length PRO polypeptide lacking the signal peptide as described herein or the coding sequence of an extracellular domain of a transmembrane PRO polypeptide as described herein, or (b) the complement of the DNA molecule of (a).

In a further aspect, the invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, even more preferably at least • about 83% sequence identity, even more preferably at least about 84% sequence identity, even more so preferably at least about 85% sequence identity, still more preferably at least about 86% sequence identity, even more preferably at least about 25 87% sequence identity, still more «£ í. ^ ". * ... YA - preferably at least about 88% sequence identity, still more preferably at least about 89% sequence identity, even more preferably at least about • 90% sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92% sequence identity, even more preferably at least about 93% sequence identity, even more so • preferable at least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, even more preferably at least about 97% sequence identity, even more preferably at least • approximately 98% sequence identity, even more preferably at least approximately 99% sequence identity to (a) a DNA molecule encoding the same mature polypeptide encoded by any of the human protein cDNAs, deposited with the ATCC as described herein, or (b) the complement of the molecule of DNA from (a).

- - Another aspect of the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide that is either a deleted transmembrane domain or an inactivated transmembrane domain, or is complementary to such a coding nucleotide sequence, in wherein the transmembrane domain (s) of such polypeptide are as described in the present. Therefore, it • contemplate the soluble extracellular domains of the polypeptides described herein.

Another modality is directed to fragments of a sequence encoding the PRO polypeptide, which can be used as, for example, hybridization probes or for coding fragments of a • PRO polypeptide which optionally can encode a polypeptide comprising a binding site of a anti-PRO antibody. Such nucleic acid fragments are usually at least about nucleotides in length, more preferably at least about 40 nucleotides in length, even more preferably at least about 50 nucleotides in length, still more preferably at least about 60 nucleotides in length, even more preferably at least about 70 nucleotides in length, even more preferably at least about 80 nucleotides in length, even more preferably at least about 90 nucleotides in length, even more preferably at least about 100 nucleotides in length, even more preferably at least approximately 110 nucleotides in length, still • more preferably at least about 120 nucleotides in length, even more preferably at least about 130 nucleotides in length, even more preferably at least about 140 nucleotides in length, even more preferably at least about 150 nucleotides in length, even more preferably at least about 160 nucleotides in length, even more preferably at least about 170 nucleotides in length, even more preferably at least about 180 nucleotides in length, even more preferably at least about 190 nucleotides in length, even more preferably at least approximately 200 nucleotides in length, still "- *** - - more preferably at least about 250 nucleotides in length, even more preferably at least about 300 nucleotides in length, even more preferably at least • about 350 nucleotides in length, even more preferably at least about 400 n-nucleotides in length, even more preferably at least about 450 nucleotides in length, even more preferably at least approximately 500 nucleotides in length, still • more preferably at least about 600 nucleotides in length, even more preferably at least about 700 nucleotides in length, even more preferably at least about 800 nucleotides in length, even more preferably at least about 900 nucleotides in length and still more • preferable at least about 1000 nucleotides in length, where in this context the term "About 20" means about 10% of the length of the reference nucleotide sequence of that length referred to. It is observed that the new fragments of a PRO polypeptide that encodes the sequence of nucleotides can be determined in a usual manner by aligning the nucleotide sequence encoding the PRO polypeptide with other known nucleotide sequences using any of a number of sequence alignment programs • well known and determining that the fragment (s) of the nucleotide sequence encoding the PRO polypeptide are new. All of such nucleotide sequences encoding the PRO polypeptide are contemplated in the present. Also contemplated are fragments of the PRO polypeptide encoded by these fragments of the nucleotide molecule, preferably those fragments of the PRO polypeptide comprising a binding site for an antibody anti-PRO.

In another embodiment, the invention provides the isolated PRO polypeptide, encoded by any of the nucleic acid sequences identified in the present above.

In a certain aspect, the invention relates to an isolated PRO polypeptide, comprising an amino acid sequence having at least about 80% Sequence identity, preferably at least It is necessary to measure á - - - about 81% sequence identity, more preferably at least about 82% sequence identity, even more preferably at least about 83% sequence identity, still • More preferably at least about 84% sequence identity, even more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably to the minus approximately 87% sequence identity, yet • more preferably at least about 88% sequence identity, even more preferably at least about 89% sequence identity, even more preferably at least about 90% sequence identity Sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92% • sequence identity, even more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, still more preferable to At least about 97% sequence identity, yet more preferably at least about 98% sequence identity, even more preferably at least about 99% sequence identity to a PRO polypeptide having a sequence of amino acids • full length as described herein, a full length amino acid sequence that lacks the signal peptide as described herein or an extracellular domain of a transmembrane protein as described herein. • In a further aspect, the invention relates to an isolated PRO polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, • even more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, even more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, even more preferably at least about 88% sequence identity, even more preferably at least about 89% sequence identity, yet • 5 more preferably at least about 90% sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92% sequence identity, yet more preferably at least approximately • 93% sequence identity, even more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, even more preferably at least about 97% identity • of sequence, even more preferably at least about 98% sequence identity, yet more preferably at least about 99% sequence identity to an amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC as described herein. 25 -j.5-h.c -3-fe £ - - - In a further aspect, the invention relates to an isolated PRO polypeptide, comprising an amino acid sequence with a record of at least about 80% positive, more preferably • at least about 82% positive, even more preferably at least about 83% positive, even more preferably at least about 84% positive, still more preferably at least about 85% positive, still more preferably at least about 86% positive, yet • more preferably at least about 87% positive, even more preferably at least about 88% positive, even more preferably at least about 89% positive, yet more preferably at least about 90% positive, still more preferably at least about 91% positive, still more • preferable at least about 92% positive, even more preferably at least about 93% positive, even more preferably at least about 94% positive, still more preferably at least about 95% positive, still more preferably at least about 96% positive, even more preferably at least approximately 97% positive, even more so Hi -.- SMt-tSiH-ialMi -.- - - preferably at least about 98% positive and even more preferably at least about 99% positive when compared to the amino acid sequence of a PRO polypeptide having a • 5 full length amino acid sequence as described herein, a full length amino acid sequence that lacks the signal peptide as described herein or an extracellular domain of a transmembrane protein as described herein . • In a specific aspect, the invention provides an isolated PRO polypeptide without the N-terminal signal sequence and / or methionine and is encoded by a nucleotide sequence encoding such an amino acid sequence as described above in • I presented. The processes for producing it are also described here, where Those processes which comprise culturing a host cell or host comprise a vector comprising the appropriate coding nucleic acid molecule, under conditions suitable for the expression of the PRO polypeptide, and recovering the PRO polypeptide from the cell culture.

- - Another aspect of the invention provides an isolated PRO polypeptide that is either a deleted transmembrane domain or a • inactivated transmembrane. The processes for producing same are also described herein, wherein those processes which comprise culturing a host cell or host comprise a vector comprising the encoding nucleic acid molecule, appropriate, under appropriate conditions for • expression of the PRO polypeptide, and recovering the PRO polypeptide from the cell culture.

Another embodiment of the present invention is directed to the use of a PRO polypeptide, or an agonist or antagonist thereof as previously described herein, or an anti-PRO antibody, for the • preparation of a medicament useful in the treatment of a condition that is sensitive to the PRO polypeptide, an agonist or antagonist thereof or an anti-PRO antibody.

- - BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a nucleotide sequence (SEQ ID NO: 1) of a sequence PR0281 cDNA • 5 native (UNQ244), where SEC. ID NO: 1 is a clone designated herein as "DNA16422-1209".

Figure 2 shows the amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEC. ID NO: 1 shown in the • Figure 1.

Figure 3 shows a nucleotide sequence (SEQ ID NO: 5) of a native sequence PR0276 cDNA (UNQ243), wherein SEQ. ID NO: 5 is a clone designated herein as "DNA16435-1208".

• Figure 4 shows the amino acid sequence (SEQ ID NO: 6) derived from the coding sequence 20 of SEC. ID NO: 5 shown in Figure 3.

Figure 5 shows a nucleotide sequence (SEQ ID NO: 7) of a native sequence PR0189 cDNA (UNQ163), wherein SEQ. ID NO: 7 is a clone 25 designated herein as "DNA21642-1391". j ^^^^^^^^^^^^^^ - ^^^^^^^ áfi ^ * - - Figure 6 shows the amino acid sequence (SEQ ID NO: 8) derived from the coding sequence of SEQ. ID NO: 7 shown in the • 5 Figure 5.

Figure 7 shows a nucleotide sequence designated herein as DNA14187 (SEQ ID NO: 9). Figure 8 shows a nucleotide sequence (SEQ ID NO: 13) of a native sequence PRO190 cDNA (UNQ164), wherein SEQ. ID NO: 13 is a clone designated here as "DNA23334-1392".

Figure 9 shows the sequence of ^ w amino acids SEQ ID NO: 14) derived from the coding sequence of the SEC. ID NO: 13 20 shown in Figure 8.

Figure 10 shows a nucleotide sequence designated herein as DNA14232 (SEQ ID NO: 15). Figure 11 shows a nucleotide sequence (SEQ ID NO: 19) of a native sequence PR0341 cDNA (UNQ300), wherein SEQ. ID NO: 19 is a clone designated here as • "DNA26288-1239".

Figure 12 shows the amino acid sequence (SEQ ID NO: 20) derived from the coding sequence of SEQ. ID NO: 19 10 shown in Figure 11. • Figure 13 shows a nucleotide sequence designated herein as DNA12920 (SEQ ID NO: 21). Figure 14 shows a nucleotide sequence (SEQ ID NO: 22) of a native sequence PRO180 cDNA (UNQ154), wherein SEQ. ID NO: 22 is a clone designated herein as "DNA26843-1389".

Figure 15 shows the amino acid sequence (SEQ ID NO: 23) derived from the coding sequence of SEQ. ID NO: 22 shown in Figure 14 - Figure 16 shows a nucleotide sequence designated herein as DNA12922 (SEQ ID NO: 24).

Figure 5 shows a nucleotide sequence (SEQ ID NO: 27) of a native sequence PR0194 cDNA (UNQ168), wherein SEQ. ID NO: 27 is a clone designated herein as "DNA26844-1394". 10 • Figure 18 shows the amino acid sequence (SEQ ID NO: 28) derived from the coding sequence of SEC. ID NO: 27 shown in Figure 17. Figure 19 shows a nucleotide sequence (SEQ ID NO: 29) of a native sequence PRO203 cDNA (UNQ177), wherein SEQ. ID NO: 29 is a clone designated herein as "DNA30862-1396".

Figure 20 shows the amino acid sequence (SEQ ID NO: 30) derived from the coding sequence of SEQ. ID NO: 29 25 shown in Figure 19.

- - Figure 21 shows a nucleotide sequence designated herein as DNA15618 (SEQ ID NO: 31).

• Figure 22 shows a nucleotide sequence (SEQ ID NO: 32) of a native sequence PRO290 cDNA (UNQ253), wherein SEQ. ID NO: 32 is a clone designated herein as "DNA35680-1212". 10 • Figure 23 shows the amino acid sequence (SEQ ID NO: 33) derived from the coding sequence of SEC. ID NO: 32 shown in Figure 22. Figure 24 shows a nucleotide sequence (SEQ ID NO: 35) of a PR0874 cDNA • of native sequence (UNQ441), where SEC. ID NO: 35 is a clone designated herein as "DNA40621-1440".

Figure 25 shows the amino acid sequence (SEQ ID NO: 36) derived from the coding sequence of SEQ. ID NO: 35 25 shown in Figure 24.

- - Figure 26 shows a nucleotide sequence (SEQ ID NO: 40) of a native sequence PRO710 cDNA (UNQ374), wherein SEQ. ID NO: 40 is a clone designated here as • 5"DNA44161-1434".

Figure 27 shows the amino acid sequence (SEQ ID NO: 41) derived from the coding sequence of SEQ. ID NO: 40 10 shown in Figure 26. • Figure 28 shows a nucleotide sequence designated herein as DNA38190 (SEQ ID NO: 42). Figure 29 shows a nucleotide sequence (SEQ ID NO: 46) of a PR01151 cDNA • of native sequence (UNQ581), where SEC. ID NO: 46 is a clone designated herein as "DNA44694-1500".

Figure 30 shows the amino acid sequence (SEQ ID NO: 47) derived from the coding sequence of SEQ. ID NO: 46 shown in Figure 29 - Figure 31 shows a nucleotide sequence (SEQ ID NO: 51) of a native sequence PR01282 cDNA (UNQ652), wherein SEQ. ID NO: 51 is a clone designated here as • 5"DNA45 95-1550".

Figure 32 shows the amino acid sequence (SEQ ID NO: 52) derived from the coding sequence of SEQ. ID NO: 51 10 shown in Figure 31.

Figure 33 shows a nucleotide sequence (SEQ ID NO: 56) of a native sequence PR0358 cDNA, wherein SEQ. ID NO: 56 is a clone 15 designated herein as "DNA47361-1154.

Figure 34 shows the amino acid sequence (SEQ ID NO: 57) derived from the coding sequence of SEQ. ID NO: 56 shown in Figure 33 Figures 35A-B show a nucleotide sequence (SEQ ID NO: 61) of a native sequence PRO1310 cDNA, wherein SEQ. ID NO: 61 is a clone 25 designated herein as "DNA47394-1572.

- - Figure 36 shows the amino acid sequence (SEQ ID NO: 62) derived from the coding sequence of SEC. ID NO: 61 shown in Figures 35A-B. • Figure 37 shows a nucleotide sequence (SEQ ID NO: 66) of a native sequence PR0698 cDNA (UNQ362), wherein SEQ. ID NO: 66 is a clone designated here as "DNA48320-1433". • Figure 38 shows the amino acid sequence (SEQ ID NO: 67) derived from the coding sequence of SEQ. ID NO: 66 15 shown in Figure 37.

Figure 39 shows a sequence of • nucleotides designated herein as DNA39906 (SEQ ID NO: 68). Figure 40 shows a nucleotide sequence (SEQ ID NO: 72) of a native sequence PR0732 cDNA (UNQ396), wherein SEQ. ID NO: 72 is a clone designated here as "DNA48334-1435". "». ».. t ^ - - Figure 41 shows the amino acid sequence (SEQ ID NO: 73) derived from the coding sequence of SEC. ID NO: 72 shown in Figure 40. • Figure 42 shows a nucleotide sequence designated herein as DNA20239 (SEQ ID NO: 74).

Figure 43 shows a sequence of • nucleotides designated herein as DNA38050 (SEQ ID NO: 75).

Figure 44 shows a sequence of 15 nucleotides designated herein as DNA40683 (SEQ ID NO: 76).

• Figure 45 shows a nucleotide sequence designated herein as DNA42580 (SEQ ID NO: 77).

Figures 46A-B show a nucleotide sequence (SEQ ID NO: 83) of a native sequence PRO1120 cDNA (UNQ559), wherein SEQ. ID NO: 83 is a clone designated here as - DNA 4 8 6 0 6 - 1 4 7 9 ' Figure 47 shows the amino acid sequence (SEQ ID NO: 84) derived from the • 5 SEC coding sequence. ID NO: 83 shown in Figures 46A-B Figure 48 shows a nucleotide sequence (SEQ ID NO: 94) of a PR0537 cDNA of native sequence (UNQ338), wherein SEC. ID • NO: 94 is a clone designated here as "DNA491 1-1431".

Figure 49 shows the sequence of amino acids (SEQ ID NO: 95) derived from the coding sequence of SEC. ID NO: 94 shown in Figure 48. • Figure 50 shows a sequence of nucleotides (SEQ ID NO: 96) of a native sequence PR0536 cDNA (UNQ337), wherein SEQ. ID NO: 96 is a clone designated herein as "DNA49142-1430".

Fig. 51 shows the amino acid sequence (SEQ ID NO: 97) derived from the coding sequence of SEQ. ID NO: 96 shown in Figure 50. • Figure 52 shows a nucleotide sequence (SEQ ID NO: 98) of a native sequence PR0535 cDNA (UNQ336), wherein SEQ. ID NO: 98 is a clone designated here as "DNA49143-1429". • Figure 53 shows the amino acid sequence (SEQ ID NO: 99) derived from the coding sequence of SEQ. ID NO: 98 15 shown in Figure 52.

Figure 54 shows a sequence of • nucleotides designated herein as DNA30861 (SEQ ID NO: 100). Figure 55 shows a nucleotide sequence designated herein as DNA36351 (SEQ ID NO: 101).

Figure 56 shows a sequence of . «- ^ ---.- A -., --......-, .. ^ ..... - nucleotides (SEQ ID NO: 102) of a native sequence PR0718 cDNA (UNQ386), wherein SEC. ID NO: 102 is a clone designated herein as "DNA 49647-1398". • Figure 57 shows the amino acid sequence (SEQ ID NO: 103) derived from the coding sequence of SEQ. ID NO: 102 shown in Figure 56. 10 • Figure 58 shows a nucleotide sequence designated herein as DNA15386 (SEQ ID NO: 104).

Figure 59 shows a nucleotide sequence designated herein as DNA16630 (SEQ ID NO: 105).

Figure 60 shows a sequence of 20 nucleotides designated herein as DNA16829 (SEQ ID NO: 106).

Figure 61 shows a nucleotide sequence designated herein as DNA28357 (SEQ ID NO: 107). -t-M- ^ lt-M-Míl-f-ii-i-.

- Figure 62 shows a nucleotide sequence designated herein as DNA43512 (SEQ ID NO: 108).

• Figure 63 shows a nucleotide sequence (SEQ ID NO: 112) of a native sequence PR0872 cDNA (UNQ439), wherein SEQ. ID NO: 112 is a clone designated herein as "DNA49819-1439". 10 • Figure 64 shows the amino acid sequence (SEQ ID NO: 113) derived from the coding sequence of SEC. ID NO: 112 shown in Figure 63. Figure 65 shows a nucleotide sequence (SEQ ID NO: 114) of a PRO1063 cDNA • of native sequence (UNQ128), where SEC. ID NO: 114 is a clone designated herein as "DNA49820-1427".

Figure 66 shows the amino acid sequence (SEQ ID NO: 115) derived from the coding sequence of SEQ. ID NO: 114 25 shown in Figure 65.

^^ ¡^ - - Figure 67 shows a nucleotide sequence (SEQ ID NO: 116) of a native sequence PR0619 cDNA (UNQ355), wherein SEQ. ID • NO: 116 is a clone designated herein as "DNA49821-1562".

Figure 68 shows the amino acid sequence (SEQ ID NO: 117) derived from the SEC coding sequence. ID NO: 116 • shown in Figure 67 Figure 69 shows a nucleotide sequence (SEQ ID NO: 118) of a PR0943 cDNA of native sequence (UNQ480), wherein SEC. ID NO: 118 is a clone designated herein as "DNA52192-1369". • Figure 70 shows the sequence of amino acids (SEQ ID NO: 119) derived from the coding sequence of SEQ. ID NO: 118 shown in Figure 69.

Figure 71 shows a sequence of 25 nucleotides (SEQ ID NO: 123) of a native sequence PR01188 - - cDNA (UNQ602), wherein SEQ. ID NO: 123 is a clone designated herein as "DNA52598-1518".

• Figure 72 shows the amino acid sequence (SEQ ID NO: 124) derived from the coding sequence of SEC. ID NO: 123 shown in Figure 71.

Figure 73 shows a sequence of • nucleotides (SEQ ID NO: 128) of a native sequence PR01133 cDNA (UNQ571), wherein SEC. ID NO: 128 is a clone designated herein as "DNA53913-1490". Figure 74 shows the amino acid sequence (SEQ ID NO: 129) derived from the • SEC coding sequence. ID NO: 128 shown in Figure 73. Figure 75 shows a nucleotide sequence (SEQ ID NO: 134) of a native sequence PR0784 cDNA (UNQ459), wherein SEQ. IDNO: 134 is a clone designated herein as "DNA53978-1443".

.H.-Sf. ^ £ ^ j ^ ¡^^^ £ ^^^.

- - Figure 76 shows the amino acid sequence (SEQ ID NO: 135) derived from the coding sequence of SEQ. ID NO: 134 • 5 shown in Figure 75.

Figure 77 shows a nucleotide sequence designated herein as DNA44661 (SEQ ID NO: 136). • Figure 78 shows a nucleotide sequence (SEQ ID NO: 137) of a native sequence PR0783 cDNA (UNQ458), wherein SEQ. ID NO: 137 is a clone designated here as "DNA53996-1442".

Figure 79 shows the amino acid sequence (SEQ ID NO: 138) derived from the coding sequence of SEQ. ID NO: 137 shown in Figure 7 Figure 80 shows a nucleotide sequence designated herein as DNA45201 (SEQ ID NO: 139). Figure 81 shows a nucleotide sequence designated herein as DNA14575 (SEQ ID NO: 140).

• Figure 82 shows a nucleotide sequence (SEQ ID NO: 145) of a native sequence PRO820 cDNA (UNQ503), wherein SEQ. ID NO: 145 is a clone designated herein as "DNA56041-1416". 10 • Figure 83 shows the amino acid sequence (SEQ ID NO: 146) derived from the coding sequence of SEC. ID NO: 145 shown in Figure 82. Figure 84 shows a nucleotide sequence (SEQ ID NO: 147) of a PRO1080 cDNA ^ of native sequence (UNQ537), where SEC. ID NO: 147 is a clone designated herein as "DNA56047-1456".

Figure 85 shows the amino acid sequence (SEQ ID NO: 148) derived from the coding sequence of SEQ. ID NO: 147 25 shown in Figure 84. ^^^^? ím? fe iáa ^ ásía? ß í á & Figure 86 shows a nucleotide sequence designated herein as DNA36527 (SEQ ID NO: 149).

Figure 5 shows a nucleotide sequence (SEQ ID NO: 150) of a native sequence PRO1079 cDNA (UNQ536), wherein SEQ. ID NO: 150 is a clone designated herein as "DNA56050-1455". 10 • Figure 88 shows the amino acid sequence (SEQ ID NO: 151) derived from the coding sequence of SEC. ID NO: 150 shown in Figure 87. Figure 89 shows a nucleotide sequence (SEQ ID NO: 152) of a PR0793 cDNA. • of native sequence (UNQ432), where SEC. ID NO: 152 is a clone designated herein as "DNA56110-1437".

Figure 90 shows the amino acid sequence (SEQ ID NO: 153) derived from the coding sequence of SEQ. ID NO: 152 25 shown in Figure 89.

- - Figure 91 shows a nucleotide sequence designated herein as DNA50177 (SEQ ID NO: 154).

Figure 5 shows a nucleotide sequence (SEQ ID NO: 155) of a native sequence PRO1016 cDNA (UNQ499), wherein SEQ. ID NO: 155 is a clone designated herein as "DNA56113-1378". 10 • Figure 93 shows the amino acid sequence (SEQ ID NO: 156) derived from the coding sequence of SEC. ID NO: 155 shown in Figure 92 15 Figure 94 shows a nucleotide sequence (SEQ ID NO: 157) of a PRO1013 cDNA ^ of native sequence (UNQ496), where SEC. ID NO: 157 is a clone designated herein as "DNA56410-1414".

Figure 95 shows the amino acid sequence (SEQ ID NO: 158) derived from the coding sequence of SEC. ID NO: 157 25 shown in Figure 94.

- - Figure 96 shows a nucleotide sequence (SEQ ID NO: 159) of a native sequence PR0937 cDNA (UNQ474), wherein SEQ. ID • 5 NO: 159 is a clone designated here as "DNA56436-1448".

Figure 97 shows the amino acid sequence (SEQ ID NO: 160) derived from the SEC coding sequence. ID NO: 159 shown in Figure 96.

Figure 98 shows a nucleotide sequence (SEQ ID NO: 164) of a PR0842 cDNA of native sequence (UNQ473), where SEC. ID NO: 164 is a clone designated herein as "DNA56855-1447". • Figure 99 shows the sequence of 20 amino acids (SEQ ID NO: 165) derived from the coding sequence of SEQ. ID NO: 164 shown in Figure 98.

Figure 100 shows a sequence of 25 nucleotides (SEQ ID NO: 166) of a cDNA of PR0839 - - native sequence (UNQ472), wherein SEC. ID NO: 166 is a clone designated herein as "DNA56859-1445".

• Figure 101 shows the amino acid sequence (SEQ ID NO: 167) derived from the coding sequence of SEC. ID NO: 166 shown in Figure 100.

Figure 102 shows a sequence of • nucleotides (SEQ ID NO: 168) of a native sequence PRO1180 cDNA (UNQ594), wherein SEC. ID NO: 168 is a clone designated herein as "DNA56860-1510". Figure 103 shows the amino acid sequence (SEQ ID NO: 169) derived from the • SEC coding sequence. ID NO: 168 shown in Figure 102. Figure 104 shows a nucleotide sequence (SEQ ID NO: 170) of a native sequence PR01134 cDNA (UNQ572), wherein SEQ. ID NO: 170 is a clone designated here as "DNA56865-1491".

? ^^^ S & faá ^^ & ^^^^ Figure 105 shows the amino acid sequence (SEQ ID NO: 171) derived from the coding sequence of SEC. ID NO: 170 • 5 shown in Figure 104.

Figure 106 shows a nucleotide sequence designated herein as DNA52352 (SEQ ID NO: 172). 10 • Figure 107 shows a nucleotide sequence designated herein as DNA55725 (SEQ ID NO: 173).

Figure 108 shows a nucleotide sequence (SEQ ID NO: 174) of a native sequence PRO830 cDNA (UNQ470), wherein SEQ. ID • NO: 174 is a clone designated herein as "DNA56866-1342". Figure 109 shows the amino acid sequence (SEQ ID NO: 175) derived from the coding sequence of SEQ. ID NO: 174 shown in Figure 10 Figure 110 shows a nucleotide sequence (SEQ ID NO: 176) of a native sequence PR01115 cDNA (UNQ558), wherein SEQ. ID NO: 176 is a clone designated herein as • 5"DNA56868-1478".

Figure 111 shows the amino acid sequence (SEQ ID NO: 177) derived from the coding sequence of SEC. ID NO: 176 10 shown in Figure 110. • Figure 112 shows a nucleotide sequence (SEQ ID NO: 178) of a native sequence PR01277 cDNA (UNQ647), wherein SEQ. ID NO: 178 is a clone designated here as "DNA56869-1545".

Figure 113 shows the amino acid sequence (SEQ ID NO: 179) derived from the SEC coding sequence. ID NO: 178 shown in Figure 112.

Figure 114 shows a nucleotide sequence (SEQ ID NO: 180) of a PR01135 cDNA of native sequence (UNQ573), wherein SEC. ID I aS i? Im - - NO: 180 is a clone designated here as "DNA56870-1492".

Figure 115 shows the sequence of • 5 amino acids (SEQ ID NO: 181) derived from the coding sequence of SEC. ID NO: 180 shown in Figure 114.

Figure 116 shows a sequence of nucleotides (SEQ ID NO: 182) of a PR01114 cDNA • of native sequence (UNQ557), where SEC. ID NO: 182 is a clone designated here as "DNA57033-1403".

Figure 117 shows the amino acid sequence (SEQ ID NO: 183) derived from the coding sequence of SEC. ID NO: 182 • shown in Figure 116 Figure 118 shows a nucleotide sequence designated herein as DNA48466 (SEQ ID NO: 184).

Figure 119 shows a sequence of 25 nucleotides (SEQ ID NO: 188) of a PR0828 cDNA - * - > - > -Í-MÍ-fe- £ -M-á- - - of native sequence (UNQ469), where SEC. ID NO: 188 is a clone designated herein as "DNA57037-1444".

• Figure 120 shows the amino acid sequence (SEQ ID NO: 189) derived from the coding sequence of SEC. ID NO: 188 shown in Figure 119.

Figure 121 shows a sequence of • nucleotides (SEQ ID NO: 193) of a native sequence PRO1009 cDNA (UNQ493), wherein SEQ. ID NO: 193 is a clone designated herein as "DNA57129-1413". Figure 122 shows the amino acid sequence (SEQ ID NO: 194) derived from the • SEC coding sequence. ID NO: 193 shown in Figure 121. Figure 123 shows a nucleotide sequence designated herein as DNA50853 (SEQ ID NO: 195).

- - Figure 124 shows a nucleotide sequence (SEQ ID NO: 196) of a native sequence PRO1007 cDNA (UNQ491), wherein SEQ. ID NO: 196 is a clone designated herein as • "DNAS 7690-1374".

Figure 125 shows the amino acid sequence (SEQ ID NO: 197) derived from the coding sequence of SEQ. ID NO: 196 shown in Figure 124 • Figure 126 shows a nucleotide sequence (SEQ ID NO: 198) of a native sequence PRO1056 cDNA (UNQ521), wherein SEQ. ID NO: 198 is a clone designated here as "DNA57693-1424".

• Figure 127 shows the amino acid sequence (SEQ ID NO: 199) derived from the SEC coding sequence. ID NO: 198 shown in Figure 126.

Figure 128 shows a nucleotide sequence (SEQ ID NO: 200) of a PR0826 cDNA of native sequence (UNQ467), where SEC. ID - - NO: 200 is a clone designated herein as "DNA57694-1341".

Figure 129 shows the sequence of • 5 amino acids (SEQ ID NO: 201) derived from the coding sequence of SEC. ID NO: 200 shown in Figure 128 Figure 130 shows a sequence of nucleotides (SEQ ID NO: 202) of a native sequence PR0819 r cDNA (UNQ466), wherein SEC. ID NO: 202 is a clone designated herein as "DNA57695- 1340".

Figure 131 shows the amino acid sequence (SEQ ID NO: 203) derived from the coding sequence of SEC. ID NO: 202 shown in Figure 130.

Figure 132 shows a sequence of nucleotides (SEQ ID NO: 204) of a native sequence PRO1006 cDNA (UNQ490), wherein SEQ. ID NO: 204 is a clone designated herein as "DNA57699-1412". 25 - - Figure 133 shows the amino acid sequence (SEQ ID NO: 205) derived from the coding sequence of SEC. ID NO: 204 shown in Figure 132. • Figure 134 shows a nucleotide sequence (SEQ ID NO: 206) of a native sequence PR01112 cDNA (UNQ555), wherein SEQ. ID NO: 206 is a clone designated herein as "DNA57702-1476". • Figure 135 shows the amino acid sequence (SEQ ID NO: 207) derived from the coding sequence of SEQ. ID NO: 206 shown in Figure 134 Figure 136 shows a sequence of • nucleotides (SEQ ID NO: 208) of a native sequence PRO1074 cDNA (UNQ531), wherein SEC. ID NO: 208 is a clone designated herein as "DNA57704-1452".

Figure 137 shows the amino acid sequence (SEQ ID NO: 209) derived from the coding sequence of the SEC. ID NO: 208 - - shown in Figure 136.

Figure 138 shows a nucleotide sequence (SEQ ID NO: 210) of a native sequence PRO1005 • 5 cDNA (UNQ489), wherein SEQ. ID NO: 210 is a clone designated herein as "DNA57708-1005".

Figure 139 shows the sequence of 10 amino acids (SEQ ID NO: 211) derived from the coding sequence of SEQ. ID NO: 210 shown in Figure 13: Figure 140 shows a sequence of 15 nucleotides (SEQ ID NO: 212) of a native sequence PRO1073 cDNA (UNQ530), wherein SEQ. ID NO: 212 is a clone designated herein as f "DNAS 7710-1451".

Figure 141 shows the amino acid sequence (SEQ ID NO: 213) derived from the coding sequence of SEC. ID NO: 212 shown in Figure 140 Figure 142 shows a sequence of ..a-to ^. ^^ ".. ... ..» * .. • __.-. "- - nucleotides designated herein as DNA5593: (SEQ ID NO: 214).

Figure 143 shows a sequence of nucleotides (SEQ ID NO: 215) of a native sequence PR01152 cDNA (UNQ582), wherein SEQ. ID NO: 215 is a clone designated herein as "DNA57711-1501".

Figure 144 shows the sequence of • amino acids (SEQ ID NO: 216) derived from the coding sequence of the SEC. ID NO: 215 shown in Figure 143 Figure 145 shows a nucleotide sequence designated herein as DNA55807 (SEQ ID NO: 217). • Figure 146 shows a sequence of nucleotides (SEQ ID NO: 218) of a native sequence PR01136 cDNA (UNQ574), wherein SEQ. ID NO: 218 is a clone designated here as "DNA57827-1493".

Figure 147 shows the sequence of a ^ tiM «M-i-r-amino acids (SEQ ID NO: 219) derived from the coding sequence of SEC. ID NO: 218 shown in Figure 146.

Figure 148 shows a nucleotide sequence (SEQ ID NO: 220) of a native sequence PR0813 cDNA (UNQ465), where SEQ. ID NO: 220 is a clone designated herein as "DNA57834-1339". 10 • Figure 149 shows the amino acid sequence (SEQ ID NO: 221) derived from the coding sequence of SEC. ID NO: 220 shown in Figure 148. Figure 150 shows a nucleotide sequence (SEQ ID NO: 222) of a PRO809 cDNA • of native sequence (UNQ464), where SEC. ID NO: 222 is a clone designated herein as "DNA57836-1338".

Figure 151 shows the amino acid sequence (SEQ ID NO: 223) derived from the coding sequence of SEQ. ID NO: 222 25 shown in Figure 150.

- - Figure 152 shows a nucleotide sequence (SEQ ID NO: 224) of a native sequence PR0791 cDNA (UNQ463), wherein SEQ. ID • NO: 224 is a clone designated herein as "DNA57838-1337".

Figure 153 shows the amino acid sequence (SEQ ID NO: 225) derived from the SEC coding sequence. ID NO: 224 • shown in Figure 152 Figure 154 shows a nucleotide sequence (SEQ ID NO: 226) of a PRO1004 cDNA of native sequence (UNQ488), wherein SEC. ID NO: 226 is a clone designated here as "DNA57844-1 10".

Figure 155 shows the sequence of amino acids (SEQ ID NO: 227) derived from the coding sequence of SEQ. ID NO: 226 shown in Figure 154.

Figure 156 shows a sequence of 25 nucleotides (SEQ ID NO: 228) of a PROllll cDNA -. s. - «cas - - of native sequence (UNQ554), where SEC. ID NO: 228 is a clone designated herein as "DNA58721-1475".

• Figure 157 shows the amino acid sequence (SEQ ID NO: 229) derived from the coding sequence of SEC. ID NO: 228 shown in Figure 156 Figure 158 shows a nucleotide sequence (SEQ ID NO: 230) of a native sequence PR01344 cDNA (UNQ699), wherein SEQ. ID NO: 230 is a clone designated herein as "DNA58723-1588". Figure 159 shows the amino acid sequence (SEQ ID NO: 231) derived from the coding sequence of SEQ. ID NO: 230 shown in Figure 158. Figure 160 shows a nucleotide sequence (SEQ ID NO: 235) of a native sequence PRO1109 cDNA (UNQ552), wherein SEQ. ID NO: 235 is a clone designated here as "DNA58737-1473". l e & ^ M ^ S ^ ^ * ^. ^ -. O ¿^ ^ ^ A? ^^^.

- Figure 161 shows the amino acid sequence (SEQ ID NO: 236) derived from the coding sequence of SEQ. ID NO: 235 • 5 shown in Figure 160.

Figure 162 shows a nucleotide sequence (SEQ ID NO: 240) of a native sequence PR01383 cDNA (UNQ719), wherein SEQ. ID NO: 240 is a clone designated here as "DNA58743-1609".

Figure 163 shows the amino acid sequence (SEQ ID NO: 241) derived from the SEC coding sequence. ID NO: 240 shown in Figure 162.

Figure 164 shows a nucleotide sequence (SEQ ID NO: 245) of a PRO1003 cDNA of native sequence (UNQ487), wherein SEC. ID NO: 245 is a clone designated herein as "DNA58846-1409".

Figure 165 shows the sequence of 25 amino acids (SEQ ID NO: 246) derived from the coding sequence of SEQ. ID NO: 245 shown in Figure 164.

Figure 166 shows a sequence of • 5 nucleotides (SEQ ID NO: 247) of a native sequence PRO1108 cDNA (UNQ551), wherein SEC. ID NO: 247 is a clone designated here as "DNA58848-1472".

Figure 167 shows the sequence of • amino acids (SEQ ID NO: 248) derived from the coding sequence of the SEC. ID NO: 247 shown in Figure 166.

Figure 168 shows a sequence of nucleotides (SEQ ID NO: 249) of a native sequence PR01137 cDNA (UNQ575), wherein SEQ. ID • NO: 249 is a clone designated herein as "DNA58849-1494". Figure 169 shows the amino acid sequence (SEQ ID NO: 250) derived from the coding sequence of SEC. ID NO: 249 shown in Figure 168. 25 . ~. ** ^ A .. »..

- - Figure 170 shows a nucleotide sequence (SEQ ID NO: 252) of a native sequence PR01138 cDNA (UNQ576), wherein SEQ. ID NO: 252 is a clone designated herein as "DNA58850-1495".

Figure 171 shows the amino acid sequence (SEQ ID NO: 253) derived from the coding sequence of SEQ. ID NO: 252 shown in Figure 170 • Figure 172 shows a nucleotide sequence designated herein as DNA49140 (SEQ ID NO: 254). Figure 173 shows a nucleotide sequence (SEQ ID NO: 255) of a native sequence PRO1054 cDNA (UNQ519), wherein SEQ. ID NO: 255 is a clone designated here as "DNA58853-1423".

Figure 174 shows the amino acid sequence (SEQ ID NO: 256) derived from the coding sequence of SEQ. ID NO: 255 25 shown in Figure 173.

Figure 175 shows a nucleotide sequence (SEQ ID NO: 257) of a native sequence PR0994 cDNA (UNQ518), wherein SEQ. ID • 5 NO: 257 is a clone designated here as "DNA58855-1422".

Figure 176 shows the amino acid sequence (SEQ ID NO: 258) derived from the SEC coding sequence. ID NO: 257 • shown in Figure 175 Figure 177 shows a nucleotide sequence (SEQ ID NO: 259) of a PR0812 cDNA of native sequence (UNQ517), wherein SEC. ID NO: 259 is a clone designated here as "DNA 59205-1421". • Figure 178 shows the sequence of amino acids (SEQ ID NO: 260) derived from the coding sequence of SEQ. ID NO: 259 shown in Figure 177.

Figure 179 shows a sequence of 25 nucleotides (SEQ ID NO: 261) of a PRO1069 - - native sequence cDNA (UNQ526), wherein SEQ. ID NO: 261 is a clone designated herein as "DNA59211-1450".

^ P 5 Figure 180 shows the amino acid sequence (SEQ ID NO: 262) derived from the coding sequence of SEQ ID NO 261 shown in Figure 179 Figure 181 shows a sequence of • nucleotides (SEQ ID NO: 263) of a native sequence PR01129 cDNA (UNQ568), wherein SEQ. ID NO: 263 is a clone designated herein as "DNA59213-1487". Figure 182 shows the amino acid sequence (SEQ ID NO: 264) derived from the ^ SEC coding sequence. ID NO: 263 shown in Figure 181. 20 Figure 183 shows a nucleotide sequence (SEQ ID NO: 265) of a native sequence PRO1068 cDNA (UNQ525), wherein SEQ. ID NO: 265 is a clone designated in the present as "DNA59214-1449".

- - Figure 184 shows the amino acid sequence (SEQ ID NO: 266) derived from the coding sequence of SEQ. ID NO: 265 PP 5 shown in Figure 183.

Figure 185 shows a nucleotide sequence (SEQ ID NO: 267) of a native sequence PRO1066 cDNA (UNQ524), wherein SEQ. ID 10 NO: 267 is a clone designated herein as • "DNA59215-1425".

Figure 186 shows the amino acid sequence (SEQ ID NO: 268) derived from the coding sequence of SEQ. ID NO: 267 shown in Figure 185.

• Figure 187 shows a nucleotide sequence (SEQ ID NO: 269) of a native sequence PR01184 cDNA (UNQ598), wherein SEQ. ID NO: 269 is a clone designated herein as "DNA59220-1514".

Figure 188 shows the sequence of 25 amino acids (SEQ ID NO: 270) derived from the *. "., - - coding sequence of SEQ ID NO: 269 shown in Figure 187 Figure 189 shows a sequence of • nucleotides (SEQ ID NO: 271) of a native sequence PRO1360 cDNA (UNQ709), wherein SEC. ID NO: 271 is a clone designated herein as "DNA59488-1603".

Figure 190 shows the sequence of • amino acids (SEQ ID NO: 272) derived from the coding sequence of the SEC. ID NO: 271 shown in Figure 189.

Figure 191 shows a nucleotide sequence (SEQ ID NO: 273) of a native sequence PRO1029 cDNA (UNQ514), wherein SEQ. ID • NO: 273 is a clone designated herein as "DNA59493-1420". Figure 192 shows the amino acid sequence (SEQ ID NO: 274) derived from the coding sequence of SEC. ID NO: 273 shown in Figure 191 25 - Figure 193 shows a nucleotide sequence (SEQ ID NO: 275) of a native sequence PR01139 cDNA (UNQ577), wherein SEQ. ID NO: 275 is a clone designated herein as • "DNA59497-1496".

Figure 194 shows the amino acid sequence (SEQ ID NO: 276) derived from the coding sequence of SEQ. ID NO: 275 shown in Figure 193 • Figure 195 shows a nucleotide sequence (SEQ ID NO: 277) of a native sequence PRO1309 cDNA (UNQ675), wherein SEQ. ID NO: 277 is a clone designated here as "DNA59588-1571".

• Figure 196 shows the amino acid sequence (SEQ ID NO: 278) derived from the SEC coding sequence. ID NO: 277 shown in Figure 195.

Figure 197 shows a nucleotide sequence (SEQ ID NO: 280) of a PRO1028 cDNA of native sequence (UNQ513), wherein SEC. ID - - NO: 280 is a clone designated herein as "DNA59603-1419".

Figure 198 shows the sequence of amino acids (SEQ ID NO: 281) derived from the coding sequence of SEQ. ID NO: 280 shown in Figure 197.

Figure 199 shows a sequence of nucleotides (SEQ ID NO: 282) of a PRO1027 cDNA • of native sequence (UNQ512), where SEC. ID NO: 282 is a clone designated herein as "DNA59605-1418".

Figure 200 shows the amino acid sequence (SEQ ID NO: 283) derived from the coding sequence of SEC. ID NO: 282 • shown in Figure 199 Figure 201 shows a nucleotide sequence (SEQ ID NO: 284) of a native sequence PRO1107 cDNA (UNQ550), wherein SEQ. ID NO: 284 is a clone designated herein as "DNA59606-1471". 25-1- Figure 202 shows the amino acid sequence (SEQ ID NO: 285) derived from the coding sequence of SEC. ID NO: 284 shown in Figure 201. • Figure 203 shows a nucleotide sequence (SEQ ID NO: 286) of a native sequence PRO1140 cDNA (UNQ578), wherein SEQ. ID NO: 286 is a clone designated herein as "DNA59607-1497". • Figure 204 shows the amino acid sequence (SEQ ID NO: 287) derived from the coding sequence of SEQ. ID NO: 286 15 shown in Figure 203.

Figure 205 shows a sequence of • nucleotides (SEQ ID NO: 288) of a native sequence PRO1106 cDNA (UNQ549), wherein SEC. ID NO: 288 is a clone designated herein as "DNA59609-1470".

Figure 206 shows the amino acid sequence (SEQ ID NO: 289) derived from the coding sequence of the SEC. ID NO: 288 - - shown in Figure 205.

Figure 207 shows a nucleotide sequence (SEQ ID NO: 290) of a PR01291 cDNA of native sequence (UNQ659), wherein SEC. ID NO: 290 is a clone designated herein as "DNA59610-1556".

Figure 208 shows the sequence of amino acids (SEQ ID NO: 291) derived from the • SEC coding sequence. ID NO: 290 shown in Figure 207.

Figure 209 shows a sequence of nucleotides (SEQ ID NO: 292) of a native sequence PRO1105 cDNA (UNQ548), wherein SEQ. ID NO: 292 is a clone designated here as • "DNA59612-1466".

Figure 210 shows the amino acid sequence (SEQ ID NO: 293) derived from the coding sequence of SEQ. ID NO: 292 shown in Figure 209 Figure 211 shows a sequence of - nucleotides (SEQ ID NO: 294) of a native sequence PR0511 cDNA (UNQ511), wherein SEQ. ID NO: 294 is a clone designated herein as "DNA59613-1417". • Figure 212 shows the amino acid sequence (SEQ ID NO: 295) derived from the coding sequence of SEQ. ID NO: 294 shown in Figure 211. 10 • Figure 213 shows a nucleotide sequence (SEQ ID NO: 296) of a native sequence PRO1104 cDNA (UNQ547), wherein SEQ. ID NO: 296 is a clone designated herein as "DNA59616-1465".

Figure 214 shows the sequence of • amino acids (SEQ ID NO: 297) derived from the coding sequence of the SEC. ID NO: 296 shown in Figure 213 Figure 215 shows a nucleotide sequence (SEQ ID NO: 298) of a cDNA of the native sequence PROLOg (UNQ546), wherein SEQ. ID NO: 298 is a clone designated herein as - 1 4 - DNA59619-1464" Figure 216 shows the sequence of A amino acids (SEQ ID NO: 299) derived from the SEC coding sequence. ID NO: 298 shown in Figure 215.

Figure 217 shows a nucleotide sequence (SEQ ID NO: 300) of a PR0836 cDNA of native sequence (UNQ545), wherein SEC. ID • NO: 300 is a clone designated here as "DNA59620-1463".

Figure 218 shows the sequence of amino acids (SEQ ID NO: 301) derived from the coding sequence of SEQ. ID NO: 300 shown in Figure 217. • Figure 219 shows a sequence of nucleotides (SEQ ID NO: 302) of a native sequence PR01141 cDNA (UNQ579), wherein SEQ. ID NO: 302 is a clone designated herein as "DNA59625-1498".

Figure 220 shows the sequence of - amino acids (SEQ ID NO: 303) derived from the coding sequence of SEQ. ID NO: 302 shown in Figure 219.

• Figure 221 shows a nucleotide sequence designated herein as DNA33128 (SEQ ID NO: 304).

Figure 222 shows a sequence of 10 nucleotides designated herein as DNA34256 • (SEC ID NO: 305).

Figure 223 shows a nucleotide sequence designated herein as DNA47941 (SEQ ID NO: 306).

Figure 224 shows a sequence of • nucleotides designated herein as DNA54389 (SEQ ID NO: 307). Figure 225 shows a nucleotide sequence (SEQ ID NO: 308) of a native sequence PR01132 cDNA (UNQ570), wherein SEQ. ID NO: 308 is a clone designated herein as "DNA59767-1489". ^ g?? * tm - mh? * - - Figure 226 shows the amino acid sequence (SEQ ID NO: 309) derived from the coding sequence of SEQ. ID NO: 308 • 5 shown in Figure 225.

Figure 227 shows a nucleotide sequence (SEQ ID NO: 313) of a native sequence PR01346 cDNA, wherein SEQ. ID NO: 313 is a clone designated herein as "DNA59776- • 1600".

Figure 228 shows the amino acid sequence (SEQ ID NO: 314) derived from the SEC coding sequence. ID NO: 313 shown in Figure 227.

• Figure 229 shows a nucleotide sequence (SEQ ID NO: 318) of a PR01131 cDNA of native sequence (UNQ569), wherein SEC. ID NO: 318 is a clone designated here as "DNA59777-1480".

Figure 230 shows the sequence of 25 amino acids (SEQ ID NO: 319) derived from the -? ii-M -? - ^ Hfi? afeH-ri -? - i-Mi -toaii? - - SEC coding sequence. ID NO: 31: shown in Figure 229.

Figure 231 shows a sequence of nucleotides designated herein as DNA43546 SEC. ID NO: 320) Figure 232 shows a nucleotide sequence (SEQ ID NO: 325) of a PR01281 cDNA of native sequence (UNQ651), wherein SEC. ID • NO: 325 is a clone designated here as "DNA59820-1549".

Figure 233 shows the sequence of amino acids (SEQ ID NO: 326) derived from the coding sequence of SEQ. ID NO: 325 shown in Figure 232. • Figure 234 shows a sequence of nucleotides (SEQ ID NO: 333) of a native sequence PRO1064 cDNA (UNQ111), wherein SEQ. ID NO: 333 is a clone designated here as "DNA59827-1426".

Figure 235 shows the sequence of 'X. - amino acids (SEQ ID NO: 334) derived from the coding sequence of SEC. ID NO: 333 shown in Figure 234.

• Figure 236 shows a nucleotide sequence designated herein as DNA45288 (SEQ ID NO: 335).

Figure 237 shows a sequence of nucleotides (SEQ ID NO: 339) of a PR01379 cDNA • of native sequence (UNQ716), where SEC. ID NO: 339 is a clone designated here as "DNA59828-1608".

Figure 238 shows the amino acid sequence (SEQ ID NO: 340) derived from the coding sequence of SEQ. ID NO: 339 • shown in Figure 237.

Figure 239 shows a nucleotide sequence (SEQ ID NO: 344) of a native sequence PR0844 cDNA (UNQ544), wherein SEQ. ID NO: 344 is a clone designated herein as "DNA59838-1462". 25 - - Figure 240 shows the amino acid sequence (SEQ ID NO: 345) derived from the coding sequence of SEQ. ID NO: 344 shown in Figure 239 • Figure 241 shows a nucleotide sequence (SEQ ID NO: 346) of a native sequence PR0848 cDNA (UNQ543), where SEQ. ID NO: 346 is a clone designated herein as "DNA59839-1461". • Figure 242 shows the amino acid sequence (SEQ ID NO: 347) derived from the coding sequence of SEQ. ID NO: 346 15 shown in Figure 241.

Figure 243 shows a sequence of • nucleotides (SEQ ID NO: 348) of a native sequence PRO1097 cDNA (UNQ542), wherein SEC. ID NO: 348 is a clone designated herein as "DNA59841-1460".

Figure 244 shows the amino acid sequence (SEQ ID NO: 349) derived from the coding sequence of the SEC. ID NO: 348 ^^ ¡^^^^^ tí ^ ij ^ yY - - shown in Figure 243 Figure 245 shows a nucleotide sequence (SEQ ID NO: 350) of a PR01153 cDNA • of native sequence (UNQ583), where SEC. ID NO: 350 is a clone designated herein as "DNA59842-1502".

Figure 246 shows the sequence of amino acids (SEQ ID NO: 351) derived from the • SEC coding sequence. ID NO: 350 shown in Figure 245.

Figure 247 shows a sequence of nucleotides (SEQ ID NO: 352) of a native sequence PR01154 cDNA (UNQ584), wherein SEQ. ID NO: 352 is a clone designated herein as • "DNA59846-1503".

Figure 248 shows the amino acid sequence (SEQ ID NO: 353) derived from the coding sequence of SEC. ID NO: 352 shown in Figure 247.

Figure 249 shows a sequence of - nucleotides (SEQ ID NO: 354) of a native sequence PR01181 cDNA (UNQ595), wherein SEQ. ID NO: 354 is a clone designated herein as "DNA59847-1511". • Figure 250 shows the amino acid sequence (SEQ ID NO: 355) derived from the coding sequence of SEQ. ID NO: 354 shown in Figure 249. 10 • Figure 251 shows a nucleotide sequence (SEQ ID NO: 356) of a native sequence PR01182 cDNA (UNQ596), wherein SEQ. ID NO: 356 is a clone designated herein as "DNA59848-1512".

Figure 252 shows the sequence of • amino acids (SEQ ID NO: 357) derived from the coding sequence of the SEC. ID NO: 356 shown in Figure 251 Figure 253 shows a nucleotide sequence (SEQ ID NO: 358) of a native sequence PR01155 cDNA (UNQ585), wherein SEQ. ID NO: 358 is a clone designated herein as' DNA 5 9 8 4 9 - 1 5 0 4 Figure 254 shows the amino acid sequence (SEQ ID NO: 359) derived from the • 5 SEC coding sequence. ID NO: 358 shown in Figure 253.

Figure 255 shows a nucleotide sequence (SEQ ID NO: 360) of a PR01156 cDNA of native sequence (UNQ586), wherein SEC. ID • NO: 360 is a clone designated here as "DNA59853-1505".

Figure 256 shows the sequence of amino acids (SEQ ID NO: 361) derived from the coding sequence of SEQ. ID NO: 360 shown in Figure 255. • Figure 257 shows a sequence of nucleotides (SEQ ID NO: 362) of a native sequence PRO1098 cDNA (UNQ541), wherein SEQ. ID NO: 362 is a clone designated herein as "DNA59854-1459".

Figure 258 shows the amino acid sequence (SEQ ID NO: 363) derived from the coding sequence of SEQ. ID NO: 362 shown in Figure 257 Figure 259 shows a nucleotide sequence (SEQ ID NO: 364) of a native sequence PR01127 cDNA (UNQ565), wherein SEQ. ID NO: 364 is a clone designated herein as "DNA60283-1484". 10 • Figure 260 shows the amino acid sequence (SEQ ID NO: 365) derived from the coding sequence of SEC. ID NO: 364 shown in Figure 259. Figure 261 shows a nucleotide sequence (SEQ ID NO: 366) of a PR01126 cDNA • native sequence (UNQ564), where SEC. ID NO: 366 is a clone designated herein as "DNA60615-1483".

Figure 262 shows the amino acid sequence (SEQ ID NO: 367) derived from the coding sequence of SEQ. ID NO: 366 25 shown in Figure 261.

Figure 263 shows a nucleotide sequence (SEQ ID NO: 368) of a native sequence PR01125 cDNA (UNQ563), wherein SEQ. ID • NO: 368 is a clone designated here as "DNA60619-1482".

Figure 264 shows the amino acid sequence (SEQ ID NO: 369) derived from the SEC coding sequence. ID NO: 368 • shown in Figure 263.

Figure 265 shows a nucleotide sequence (SEQ ID NO: 370) of a PR01186 cDNA of native sequence (UNQ600), wherein SEC. ID NO: 370 is a clone designated herein as "DNA60621-1516". • Figure 266 shows the sequence of amino acids (SEQ ID NO: 371) derived from the coding sequence of SEQ. ID NO: 370 shown in Figure 265 Figure 267 shows a sequence of 25 nucleotides (SEQ ID NO: 372) of a native sequence PR01198 - - cDNA (UNQ611), wherein SEQ. ID NO: 372 is a clone designated herein as "DNA60622-1525".

• Figure 268 shows the amino acid sequence (SEQ ID NO: 373) derived from the coding sequence of SEC. ID NO: 372 shown in Figure 267.

Figure 269 shows a sequence of • nucleotides (SEQ ID NO: 374) of a native sequence PR01158 cDNA (UNQ588), wherein SEC. ID NO: 374 is a clone designated herein as "DNA60625-1507". Figure 270 shows the amino acid sequence (SEQ ID NO: 375) derived from the • SEC coding sequence. ID NO: 374 shown in Figure 269. Figure 271 shows a nucleotide sequence (SEQ ID NO: 376) of a native sequence PR01159 cDNA (UNQ589), wherein SEQ. ID NO: 376 is a clone designated herein as "DNA60627-1508".

Figure 272 shows the amino acid sequence (SEQ ID NO: 377) derived from the coding sequence of SEQ. ID NO: 376 • 5 shown in Figure 271.

Figure 273 shows a nucleotide sequence (SEQ ID NO: 378) of a native sequence PR01124 cDNA (UNQ562), wherein SEQ. ID NO: 378 is a clone designated herein as • "DNA60629-1481".

Figure 274 shows the amino acid sequence (SEQ ID NO: 379) derived from the SEC coding sequence. ID NO: 378 shown in Figure 273.

• Figure 275 shows a nucleotide sequence (SEQ ID NO: 380) of a PR01287 cDNA of native sequence (UNQ656), wherein SEC. ID NO: 380 is a clone designated here as "DNA61755-1554".

Figure 276 shows the sequence of 25 amino acids (SEQ ID NO: 381) derived from the «- ^ - ktt ^ b ^^.

- - SEC coding sequence. ID NO: 380 shown in Figure 275 Figure 277 shows a sequence of • 5 nucleotides (SEQ ID NO: 386) of a native sequence PR01312 cDNA (UNQ678), wherein SEC. ID NO: 386 is a clone designated herein as "DNA61873-1574".

Figure 278 shows the amino acid sequence (SEQ ID NO: 387) derived from the coding sequence of SEC. ID NO: 386 shown in Figure 277.

Figure 279 shows a nucleotide sequence (SEQ ID NO: 388) of a native sequence PR01192 cDNA (UNQ606), wherein SEQ. ID NO: 388 is a clone designated herein as "DNA62814-1521". Figure 280 shows the amino acid sequence (SEQ ID NO: 389) derived from the coding sequence of SEQ. ID NO: 388 shown in Figure 279 25 ^ MHÉ-fl-lMÉI-i-lt-l-S-ÉI ^ - Figure 281 shows a nucleotide sequence (SEQ ID NO: 393) of a native sequence PRO1160 cDNA (UNQ590), where SEC. ID NO: 393 is a clone designated herein as • "DNA62872-1509".

Figure 282 shows the amino acid sequence (SEQ ID NO: 394) derived from the coding sequence of SEQ. ID NO: 393 10 shown in Figure 281. • Figure 283 shows a nucleotide sequence (SEQ ID NO: 398) of a native sequence PR01187 cDNA (UNQ601), wherein SEQ. ID NO: 398 is a clone designated here as "DNA62876-1517".

• Figure 284 shows the amino acid sequence (SEQ ID NO: 399) derived from the SEC coding sequence. ID NO: 398 shown in Figure 283.

Figure 285 shows a nucleotide sequence (SEQ ID NO: 400) of a PR01185 cDNA of native sequence (UNQ599), wherein SEC. ID ^ HMÜtHÜJigJü ^^, -, - - NO 400 is a clone designated here as DNA62881-1515 ' • Figure 286 shows the sequence of 5 amino acids (SEQ ID NO: 401) derived from the coding sequence of SEC. ID NO: 400 shown in Figure 285 Figure 287 shows a sequence of nucleotides (SEQ ID NO: 402) of a PR01345 cDNA • of native sequence (UNQ700), where SEC. ID NO: 402 is a clone designated herein as "DNA64852-1589".

Figure 288 shows the amino acid sequence (SEQ ID NO: 403) derived from the coding sequence of SEQ. ID NO: 402 • shown in Figure 287.

Figure 289 shows a nucleotide sequence (SEQ ID NO: 407) of a native sequence PR01245 cDNA (UNQ629), wherein SEQ. ID NO: 407 is a clone designated herein as "DNA64884-1527". 25 - - Figure 290 shows the amino acid sequence (SEQ ID NO: 408) derived from the coding sequence of SEQ. ID NO: 407 shown in Figure 289. • Figure 291 shows a nucleotide sequence (SEQ ID NO: 409) of a native sequence PR01358 cDNA (UNQ707), wherein SEQ. ID NO: 409 is a clone designated herein as "DNA64890-1612". • Figure 292 shows the amino acid sequence (SEQ ID NO: 410) derived from the coding sequence of SEQ. ID NO: 409 15 shown in Figure 291.

Figure 293 shows a sequence of • nucleotides (SEQ ID NO: 411) of a native sequence PR01195 cDNA (UNQ608), wherein SEC. ID NO: 411 is a clone designated herein as "DNA65412-1523".

Figure 294 shows the amino acid sequence (SEQ ID NO: 412) derived from the coding sequence of the SEC. ID NO: 411 - 11 1 - shown in Figure 293 Figure 295 shows a nucleotide sequence (SEQ ID NO: 413) of a PRO1270 cDNA • of native sequence (UNQ640), where SEC. ID NO: 413 is a clone designated herein as "DNA66308-1537".

Figure 296 shows the sequence of amino acids (SEQ ID NO: 414) derived from the • SEC coding sequence. ID NO: 413 shown in Figure 295 Figure 297 shows a sequence of nucleotides (SEQ ID NO: 415) of a native sequence PR01271 cDNA (UNQ641), wherein SEQ. ID NO: 415 is a clone designated herein as • "DNA66309-1538".

Figure 298 shows the amino acid sequence (SEQ ID NO: 416) derived from the coding sequence of SEQ. ID NO: 415 shown in Figure 297 Figure 299 shows a nucleotide sequence (SEQ ID NO: 417) of a native sequence PR01375 cDNA (UNQ712), wherein SEQ. ID NO: 417 is a clone designated herein as "DNA67004 -1614". • Figure 300 shows the amino acid sequence (SEQ ID NO: 418) derived from the coding sequence of SEQ. ID NO: 417 shown in Figure 299. 10 • Figure 301 shows a nucleotide sequence (SEQ ID NO: 419) of a native sequence PR01385 cDNA (UNQ720), wherein SEQ. ID NO: 419 is a clone designated here as "DNA68869-1610".

Figure 302 shows the amino acid sequence (SEQ ID NO: 420) derived from the coding sequence of SEQ. ID NO: 419 shown in Figure 301 Figure 303 shows a nucleotide sequence (SEQ ID NO: 421) of a native sequence PR01387 cDNA (UNQ722), wherein SEQ. ID NO: 421 is a clone designated herein as - - DNA68872-1620 ' Figure 304 shows the amino acid sequence (SEQ ID NO: 422) derived from the • 5 SEC coding sequence. ID NO: 421 shown in Figure 303.

Figure 305 shows a nucleotide sequence (SEQ ID NO: 423) of a PR01384 cDNA of native sequence (UNQ721), where SEC. ID • NO: 423 is a clone designated here as "DNA71159-1617".

Figure 306 shows the sequence of amino acids (SEQ ID NO: 424) derived from the coding sequence of SEQ. ID NO: 423 shown in Figure 305. • DETAILED DESCRIPTION OF THE PREFERRED MODALITIES 20 Definitions The terms "PRO polypeptide" and "PRO" as used herein and when immediately followed by a numerical designation are refer to several polypeptides, wherein the complete designation (ie, PRO / number) refers to specific polypeptide sequences as described herein. The terms "PRO / polypeptide number" and "PRO / number" where the term "number" provides a current numerical designation as used herein encompasses the native sequence polypeptides and the polypeptide variants (which are defined right now in the present). The PRO polypeptides described in present can be isolated from a variety • from sources, such as types of human tissues or from another source, or prepared by recombinant or synthetic methods.

A "native sequence PRO polypeptide" comprises a polypeptide having the same amino acid sequence as the PRO polypeptide • corresponding mature derivative. Such PRO polypeptides of the native sequence can be isolated from Mature or can be produced by recombinant or synthetic means. The term "PRO polypeptide of the native sequence" specifically encompasses the secreted or truncated forms that occur naturally from the specific PRO polypeptides (for example, a sequence of the extracellular domain), variant forms that occur naturally (for example, alternatively spliced forms) and allelic variants that occur naturally in the polypeptide. In • 5 various embodiments of the invention, the PR0281 native sequence polypeptide is a PR0281 native sequence, full-length or mature polypeptide, comprising amino acids 1 to 345 of Figure 2 (SEQ ID NO: 2), PR0276 of native sequence is a PR0276 of full-length native sequence or • mature comprising amino acids 1 to 251 of Figure 4 (SEQ ID NO: 6), native sequence PR0189 is a full-length or mature native sequence PR0189 comprising amino acids 1 to 367 of Figure 6 (SEQ ID NO: 8), the native sequence PRO190 polypeptide is a PRO190 polypeptide of native sequence length • complete or mature comprising amino acids 1 to 424 of Figure 9 (SEQ ID NO: 14), PR0341 Native sequence sequence is a full length or mature native sequence PR0341 comprising amino acids 1 to 458 of Figure 12 (SEQ ID NO: 20), the native sequence PRO180, iva is a PRO180 native sequence length complete or mature that comprises amino acids 1 to 266 of the Figure .y =.

(SEQ ID NO: 23), the PR0194 native sequence polypeptide is a full length or mature native sequence PR0194 polypeptide comprising amino acids 1 through 264 of Figure 18 (SEQ ID NO: 28), PRO203 native sequence polypeptide is a full-length or mature native sequence PRO203 polypeptide comprising amino acids 1 to 347 of Figure 20 (SEQ ID NO: 30), the native sequence PRO290 is a PRO290 of full-length or mature native sequence that • comprises amino acids 1 to 1003 of Figure 23 (SEQ ID NO: 33), the PR0874 native sequence polypeptide comprises amino acids 1 to 321 of Figure 25 (SEQ ID NO: 36), the polypeptide PRO710 of native sequence is a PRO710 polypeptide of full-length or mature native sequence comprising amino acids 1 to 566 of the Figure • 27 (SEQ ID NO: 41), the native sequence PR01151 is a native sequence length PR01151 Complete or mature comprising amino acids 1 to 259 of Figure 30 (SEQ ID NO: 47), native sequence PR01282 is a full-length or mature native sequence PR01282 comprising amino acids 1 or about 24 to 673 of the Figure 32 (SEQ ID NO: 52), native sequence PR0358 - - is a full-length or mature native sequence PR0358 polypeptide comprising amino acids 1 to 811 of Figure 34 (SEQ ID NO: 57) , the native sequence PRO1310 is a full-length or mature native sequence PRO1310 comprising amino acids 1 through 765 of Figure 36 (SEQ ID NO: 62), the native sequence PR0698 polypeptide is a PR0698 sequence polypeptide native full length or mature that comprises amino acids 1 to 510 of Figure 38 • (SEQ ID NO: 67), the PR0732 native sequence polypeptide is a full length or mature native sequence PR0732 polypeptide comprising amino acids 1 through 453 of Figure 41 (SEQ ID NO: 73), the native sequence PRO1120 is a full length or mature native sequence PRO1120 comprising amino acids 1 or approximately 18 a • 867 of Figure 47 (SEQ ID NO: 84), the native sequence PR0537 is a native sequence PR0537 The full length or mature length comprising amino acids 1 to 115 of Figure 49 (SEQ ID NO: 95), the native sequence PR0536 is a full-length or mature native sequence PR0536 comprising amino acids 1 through 313 of the Figure 51 (SEQ ID NO: 97), the native sequence PR0535 is - ^. "- 117 a full length or mature native sequence PR0535 comprising amino acids 1 to 201 of Figure 53 (SEQ ID NO: 99), the PR0718 native sequence polypeptide is a PR0718 polypeptide of • A full-length or mature native sequence comprising amino acids 1 to 157 of Figure 57 (SEQ ID NO: 103), the PR0872 native sequence polypeptide is a full-length or mature native sequence PR0872 polypeptide comprises amino acids 1 to 610 of Figure 64 • (SEQ ID NO: 113), the native sequence PRO1063 polypeptide is a full-length or mature native sequence PRO1063 polypeptide comprising amino acids 1 through 301 of Figure 66 (SEQ ID NO: 115), native sequence PR0619 is a full-length or mature native sequence PR0619 comprising amino acids 1 or • approximately 21 to 123 of Figure 68 (SEQ ID NO: 117), the native sequence PR0943 is a PR0943 of full length or mature native sequence comprising amino acids 1 to 504 of Figure 70 (SEQ ID NO: 119), native sequence PR01188 is a full-length or mature native sequence PR01188 comprising the amino acids 1 or approximately 22 to 1184 of Figure 72 (SEQ ID NO: 124), the native sequence PR01133 is a full-length or mature native sequence PR01133 comprising amino acids 1 or about 19 through 438 of Figure 74 (SEC . • 5 ID NO: 129), the native sequence PR0784 is a full length or mature native sequence PR0784 comprising amino acids 16 to 228 of Figure 76 (SEQ ID NO: 135), the PR0783 native sequence polypeptide is a PR0783 polypeptide of full-length or mature native sequence that • comprises amino acids 1 to 489 of Figure 79 (SEQ ID NO: 138), the native sequence PRO820 is a full-length or mature native sequence PRO820 comprising amino acids 1 or 16 up to 124 of Figure 83 (SEQ ID NO: 146), the native sequence PRO1080 is a full-length or mature native sequence PRO1080 comprising the • amino acids 1 or 23 to 358 of Figure 85 (SEQ ID NO: 148), the native sequence PRO1079 is a PRO1079 of full-length or mature native sequence comprising amino acids 1 or about 30 to 226 of Figure 88 (SEQ ID NO: 151), native sequence PR0793 is a full length or mature native sequence PR0793 comprising amino acids 1 to 138 of Figure 90 (SEQ ID NO: 153), the native sequence PRO1016 is a full length or mature native sequence PRO1016 comprising amino acids 1 or 19 to 378 of Figure 93 (SEQ ID NO: 156), • PRO1013 polypeptide of native sequence is a PRO1013 polypeptide of full-length or mature native sequence comprising amino acids 1 or to 409 of Figure 95 (SEQ ID NO: 158), the native sequence PR0937 polypeptide is a PR0937 polypeptide of native sequence length • complete or mature comprising amino acids 1 to 556 of Figure 97 (SEQ ID NO: 160), native sequence PR0842 is a full-length or mature native sequence PR0842 comprising the amino acids 1 or approximately 23 to 119 of Figure 99 (SEQ ID NO: 165), the native sequence PR0839 is a native sequence length PR0839 • complete or mature comprising amino acids 1 or approximately 24 to 87 of Figure 101 (SEC.

NO: 167), the native sequence PRO1180 polypeptide is a full-length or mature native sequence PRO1180 polypeptide comprising amino acids 1 to 277 of Figure 103 (SEQ ID NO: 169), the native sequence PR01134 is a PR01134 of full length or mature native sequence comprising amino acids 1 to 371 of Figure 105 (SEQ ID NO: 171), the native sequence PRO830 is a full length or mature native sequence PRO830 comprising amino acids 1 to 87 of Figure 109 (SEQ ID NO: 175), the native sequence PR01115 is a PR01115 native length sequence complete or mature comprising amino acids 1 or approximately 21 to 445 of Figure 111 (SEQ ID NO: 177), native sequence PR01277 is a full length or mature native sequence PR01277 comprising amino acids 1 or approximately 27 at 678 of Figure 113 (SEQ ID NO: 179), the PR01135 native sequence polypeptide is a full length or mature native sequence PR01135 polypeptide comprising amino acids 1 to 541 of Figure 115 (SEQ ID NO: 181), the native sequence PR01114 interferon receptor is a full-length or mature native sequence PR01114 interferon receptor, comprising amino acids 1 through 311 of Figure 118 (SEQ ID NO: 184), the polypeptide PR0828 of native sequence is a full-length or mature native sequence PR0828 polypeptide comprising amino acids 1 to 187 of Figure 120 (SEQ. ID NO: 189), native sequence PRO1009 is a full-length or mature native sequence PRO1009 comprising amino acids 1 or 23 to 615 of Figure 122 (SEQ ID NO: 194), PRO1007 polypeptide • Native sequence 5 is a full length or mature native sequence PRO1007 polypeptide comprising amino acids 1 or 31 through 346 of Figure 125 (SEQ ID NO: 197), the native sequence PRO1056 is a native sequence PRO1056 full or mature length comprising the • amino acids 1 to 120 of Figure 127 (SEQ ID NO: 199), native sequence PR0826 is a full length or mature native sequence PR0826 comprising amino acids 1 to 99 of Figure 129 (SEQ ID NO: 201), native sequence PR0819 is a full-length or mature native sequence PR0819 comprising amino acids 1 through 52 of the • Figure 131 (SEQ ID NO: 203), the native sequence PRO1006 is a native sequence PRO1006 of full length or mature comprising amino acids 1 or 24 to 392 of Figure 133 (SEQ ID NO: 205), the PR01112 native sequence polypeptide is a full-length or mature native sequence polypeptide PR01112 comprising the amino acids 1 or 14 to 262 of Figure 135 (SEQ.

ID NO: 207), the native sequence PRO1074 polypeptide is a full length or mature native sequence PRO1074 polypeptide comprising amino acids 1 to 331 of Figure 137 (SEQ ID NO: • 5 209), the native sequence PRO1005 is a full length or mature native sequence PRO1005 comprising amino acids 1 or approximately 21 to 185 of Figure 139 (SEQ ID NO: 211), the native sequence PRO1073 is a sequence PRO1073 full-length or mature native comprising • amino acids 1 or approximately 32 to 299 of Figure 141 (SEQ ID NO: 213), native sequence PR01152 is a full-length or mature native sequence PR01152 comprising the amino acids 1 to 479 of Figure 144 (SEQ ID NO: 216), the native sequence PR01136 is a full length or mature native sequence PR01136 • comprising amino acids 1 to 632 of Figure 147 (SEQ ID NO: 219), the PR0813 polypeptide of The native sequence is a full length or mature native sequence PR0813 polypeptide comprising amino acids 1 to 76 of Figure 149 (SEQ ID NO: 221), the native sequence PRO809 is a full-length native sequence PRO809 or mature which comprises amino acids 1 or 19 to 265 of Figure 151 (SEQ ID NO: 223), the native sequence PR0791 is a full-length or mature native sequence PR0791 comprising amino acids 1 or 26 through 246 of Figure 153 (SEQ ID NO: 225), the native sequence PRO1004 is a full length or mature native sequence PRO1004 comprising amino acids 1 or about 25 to 115 of Figure 155 (SEQ ID NO: 227) , the native sequence PROllll is a full length or mature native sequence PROllll comprising amino acids 1 through 653 of Figure 157 (SEQ ID NO: 229), the native sequence PR01344 is a PR01344 native length sequence complete or mature comprising amino acids 1 to 720 of Figure 159 (SEQ ID NO: 231), the native sequence PRO1109 is a full length or mature native sequence PRO1109 comprising amino acids 1 through 344 of Figure 161 (SEQ ID NO: 236), PR01383 of The native sequence is a full-length or mature native sequence PR01383 comprising amino acids 1 to 423 of Figure 163 (SEQ. ID NO: 241), the native sequence PRO1003 polypeptide is a full-length or mature native sequence PRO1003 polypeptide comprising amino acids 1 to -84 of Figure 165 (SEQ ID NO: 246), PRO1108 polypeptide of The native sequence is a full length or mature native sequence PRO1108 polypeptide comprising amino acids 1 to • 5 456 of Figure 167 (SEQ ID NO: 248), the PR01137 native sequence polypeptide is a full length or mature native sequence PR01137 polypeptide comprising amino acids 1 through 240 of Figure 169 (SEQ ID NO. : 250), the PR01138 polypeptide of native sequence is a • full-length or mature native sequence polypeptide PR01138 comprising amino acids 1 to 335 of Figure 171 (SEQ ID NO: 253), the native sequence PRO1054 is a sequence PRO1054 Full length or mature native comprising amino acids 1 to 180 of Figure 174 (SEQ ID NO: 256), PR0994 native sequence is a PR0994 • of full-length or mature native sequence comprising amino acids 1 to 229 of Figure 176 (SEQ ID NO: 258), native sequence PR0812 is a full length or mature native sequence PR0812 comprising amino acids 1 through 83 of Figure 178 (SEQ ID NO: 260), PRO1069 polypeptide of native sequence is a PRO1069 polypeptide of full-length or mature native sequence comprising amino acids 1 to 89 of Figure 180 (SEQ ID NO: 262), native sequence PR01129 polypeptide is a PR01129 polypeptide of native sequence length • complete or mature comprising amino acids 1 to 524 of Figure 182 (SEQ ID NO: 264), native sequence PRO1068 is a full length or mature native sequence PRO1068 comprising amino acids 1 or approximately 21 a 124 of the Figure 184 (SEQ ID NO: 266), the PRO1066 polypeptide • of native sequence is a PRO1066 polypeptide of full-length or mature native sequence comprising amino acids 1 to 117 of Figure 186 (SEQ ID NO: 268), the PR01184 polypeptide of The native sequence is a PR01184 polypeptide of full-length or mature native sequence comprising amino acids 1 or 39 to 142 of the • Figure 188 (SEQ ID NO: 270), the native sequence PRO1360 is a PRO1360 native sequence of full length or mature comprising amino acids 1 or about 30 to 285 of Figure 190 (SEQ ID NO: 272), the native sequence PRO1029 is a full-length or mature native sequence PRO1029 comprising the amino acids 1 to 86 of Figure 192 (SEQ ID NO: - - 274), the native sequence PR01139 is a full-length or mature native sequence PR01139 polypeptide comprising amino acids 1 to 131 or 29-131 of the Figure 194 (SEQ ID NO: 276), the • Native sequence PRO1309 is a full-length or mature native sequence PRO1309 comprising amino acids 1 or about 35 to 522 of Figure 196 (SEQ ID NO: 278), the PRO1028 native sequence polypeptide is a PRO1028 polypeptide of native length sequence • complete or mature comprising amino acids 1 or 20 through 197 of Figure 198 (SEQ ID NO: 281), the native sequence PRO1027 is a full length or mature native sequence PRO1027 that comprises amino acids 1 or 34 to 77 of Figure 200 (SEQ ID NO: 283), the native sequence PRO1107 polypeptide is a PRO1107 polypeptide of • full-length or mature native sequence comprising amino acids 1 or 23 to 477 of the Figure 202 (SEQ ID NO: 285), the native sequence PRO1140 polypeptide is a full-length or mature native sequence PRO1140 polypeptide comprising amino acids 1 to 255 of Figure 204 (SEQ ID NO: 287), the PRO1106 polypeptide of The native sequence is a full length or mature native sequence PRO1106 polypeptide comprising amino acids 1 or 17 through 469 of Figure 206 (SEQ ID NO: 289), the native sequence PR01291 is a native sequence PR01291 • Full-length or mature, comprising amino acids 1 to 282 of Figure 208 (SEQ ID NO: 291), the native sequence PRO1105 polypeptide is a full-length or mature native sequence PRO1105 polypeptide comprising the amino acids 1 or 20 to 180 of Figure 210 (SEQ.

• ID NO: 293), the native sequence PRO1026 is a full-length or mature native sequence PRO1026 comprising amino acids 1 or 26 through 237 of Figure 212 (SEQ ID NO: 295), PRO1104Native sequence is a full length or mature native sequence PRO1104 comprising amino acids 1 or approximately 23 to 341 of • Figure 214 (SEQ ID NO: 297), the native sequence PROllOO is a native sequence PROllOO of full length or mature comprising amino acids 1 or 21 to 320 of Figure 216 (SEQ ID NO: 299), native sequence PR0836 is a full length or mature native sequence PR0836 comprising amino acids 1 or 30 up 461 of Figure 218 (SEQ ID NO: 301), the native sequence PR01141 is a full length or mature native sequence PR01141 comprising amino acids 1 to 247 of Figure 220 (SEQ ID NO: 303) , the native sequence PR01132 is a Pf 5 PR01132 of full length or mature native sequence comprising amino acids 1 or about 23 to 293 of Figure 226 (SEQ ID NO: 309), the native sequence NL7 is a full-length or mature native sequence NL7 what comprises amino acids from about • position 51 to approximately position 461 of Figure 228 (SEQ ID NO: 314), native sequence PR01131 is a full-length or mature native sequence PR01131 comprising the amino acids 1 to 280 of Figure 230 (SEQ ID NO: 319), native sequence PR01281 is a full-length or mature native sequence PR01281 comprising amino acids 1 or about 16 to 775 of Figure 233 (SEC ID NO: 326), the native sequence PRO1064 is a full length or mature native sequence PRO1064 comprising amino acids 1 to 153 of Figure 235 (SEQ ID NO: 334), PR01379 native sequence is a PR01379 of native sequence full-length mature comprising the - - amino acids 1 or approximately 18 to 574 of Figure 238 (SEQ ID NO: 340), the native sequence PR0844 is a full-length or mature native sequence PR0844 comprising the amino acids 1 or • 5 20 to 111 of Figure 240 (SEQ ID NO: 344), native sequence PR0848 is a full-length or mature native sequence PR0848 comprising amino acids 1 or 36 through 600 of Figure 242 (SEQ. ID NO: 347), the native sequence PRO1097 is a full-length native sequence PRO1097 ^ m or mature which comprises amino acids 1 or 21 to 91 of Figure 244 (SEQ ID NO: 349), the native sequence PR01153 is a full-length or mature native sequence PR01153 comprising the amino acids 1 to 197 of Figure 246 (SEQ ID NO: 351), the native sequence PR01154 is a full length or mature native sequence PR01154 F comprising amino acids 1 or 35 to 941 of the Figure 248 (SEQ ID NO: 353), PR01181 of native sequence is a full length or mature native Fci sequence PR01181 comprising amino acids 1 to 437 of Figure 250 (SEQ ID NO: 355), Native sequence PR01182 is a full-length or mature native sequence PR01182 comprising amino acids 1 to 271 of the Figure = ^^^^ - - 252 (SEQ ID NO: 357), native sequence PR01155 is a full length or mature native sequence PR01155 comprising amino acids 1 or 19 through 135 of Figure 254 (SEQ. ID NO: 359), the • Native sequence PR01156 is a full length or mature native sequence PR01156 comprising amino acids 1 or approximately 23 to 159 of Figure 256 (SEQ ID NO: 361), the native sequence PRO1098 is a sequence PRO1098 full-length or mature native comprising • amino acids 1 or 20 to 78 of Figure 258 (SEQ ID NO: 363), native sequence PR01127 is a full length or mature native sequence PR01127 comprising amino acids 1 or about 30 to 67 of Figure 260 (SEQ ID NO: 365), the native sequence PR01126 is a full-length native sequence PR01126 or • mature comprising amino acids 1 to 402 of Figure 262 (SEQ ID NO: 367), PR01125 of The native sequence is a full-length or mature native sequence PR01125 comprising amino acids 26 to 447 of Figure 264 (SEQ ID NO: 369), the native sequence PR01186 is a full length or mature native sequence PR01186 comprising amino acids 1 or about 20 -MM-i-ái- "H-á-i-^ -t-tá-ti - - up to 105 of Figure 266 (SEQ ID NO: 371), the native sequence PR01198 is a native sequence PR01198 full or mature length comprising amino acids 1 or about 35 a • 5 229 of Figure 268 (SEQ ID NO: 373), native sequence PR01158 is a full-length or mature native sequence PR01158 comprising amino acids 1 or about 20 to 123 of Figure 270 (SEQ ID. NO: 375), PR01159 of native sequence is a native sequence PR01159 # of full length or mature comprising amino acids 1 to 90 of Figure 272 (SEQ ID NO: 377), native sequence PR01124 is a full length or mature native sequence PR01124 comprising amino acids 22 to 919 of Figure 274 (SEQ ID NO: 379), the native sequence PR01287 is a native sequence PR01287 • full-length or mature, comprising amino acids 1 to 532 of Figure 276 (SEQ ID NO: 381), the native sequence PR01312 is a full-length or mature native sequence PR01312 comprising amino acids 1 or about 15 to 212 of Figure 278 (SEQ ID NO: 387), the native sequence PR01192 is a Sequence PR01192 full-length or mature native comprising -an-ái-i-ii-iti) amino acids 1 or approximately 22 to 215 of Figure 280 (SEQ ID NO: 389), the native sequence PRO1160 is a full length or mature native sequence PRO1160 that understands the • 5 amino acids 1 to 90 of Figure 282 (SEQ ID NO: 394), native sequence PR01187 is a full-length or mature native sequence PR01187 comprising amino acids 1 or about 18 to 120 of Figure 284 ( SEC ID NO: 399), the PR01185 native sequence PR01185 is a full-length or mature native sequence PR01185 comprising amino acids 1 or approximately 22 to 198 of Figure 286 (SEQ ID NO: 401), the native sequence PR01345 is a PR01345 of In the full-length or mature native sequence comprising amino acids 1 to 206 of Figure 288 (SEQ ID NO: 403), native sequence PR01245 is a full-length or mature native sequence PR01245 comprising amino acids 1 or about 104 to 104 of FIGURE 290 (SEQ ID NO: 408), native sequence PR01358 is a full-length or mature native sequence PR01358 comprising amino acids 1 or about 19 to 444 of Figure 292 (SEQ. .

ID NO: 410), the native sequence PR01195 is a ^ jrfgá ^ - - PR01195 of full-length or mature native sequence comprising amino acids 1 or approximately 23 to 151 of Figure 294 (SEQ ID NO: 412), the native sequence PRO1270 is a • PRO1270 of full-length or mature native sequence comprising amino acids 1 to 313 of Figure 296 (SEQ ID NO: 414), native sequence PR01271 is a full-length or mature native sequence PR01271 comprising the amino acids 1 to 208 of Figure 298 (SEQ ID NO: 416), the native sequence PR01375 is a full length or mature native sequence PR01375 comprising amino acids 1 through 198 of Figure 300 (SEQ ID NO. : 418), PR01385 of The native sequence is a full length or mature native sequence PR01385 comprising amino acids 1 to 128 of Figure 302 (SEQ ID NO: 420), the native sequence PR01387 is a full-length or mature native sequence PR01387 comprising amino acids 1 to 394 of Figure 304 (SEQ ID NO: 422) and native sequence PR01384 is a full-length or mature native sequence PR01384 comprising amino acids 1 to 229 of Figure 306 (SEC ID NO: 424). The codons start and stop are shown in highlighted and underlined letters in the figures The 'domini or extracellular' or ECD 'of the PRO polypeptide refers to a form of • PRO polypeptide that is essentially free of the cytoplasmic and transmembrane domains. Ordinarily, an ECD of the PRO polypeptide has less than 1% of such cytoplasmic and / or transmembrane domains and preferably, will have less than 0.5% of such domains. It will be understood that • any transmembrane domain identified for the PRO polypeptides of the present invention are identified according to the criteria usually employed in the art to identify that type of hydrophobic domain. The exact limits of a transmembrane domain may vary but most do not have more than about 5 • amino acids at both ends of the domain as initially identified. Optionally, so Thus, an extracellular domain of a PRO polypeptide can contain from about 5 or fewer amino acids in both or in the transmembrane domain as initially identified.

The "PRO polypeptide variant" means - an active PRO polypeptide as defined above or later having at least about 80% amino acid sequence identity with the full-length native sequence PRO polypeptide as described herein , a sequence of the full-length native sequence PRO polypeptide lacking the signal peptide as described herein, an extracellular domain of a polypeptide as described in the present or any other fragment of a • full length PRO polypeptide sequence as described herein. Such PRO polypeptide variants include, for example, PRO polypeptides wherein one or more residues of amino acids are added, or deleted, at the N- or C-terminus of the full length, native amino acid sequence. Ordinarily, a variant of • PRO polypeptide will have at least approximately 80% amino acid sequence identity, so more preferably at least about 81% amino acid sequence identity, more preferably at least about 82% amino acid sequence identity, more preferably at least about 83% identity amino acid sequence, in a more ¡¡¡¡¡¡¡¡- ^ - - - preferable at least about 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably Preferably at least about 86% amino acid sequence identity, more preferably at least about 87% amino acid sequence identity, more preferably at least about 88% identity amino acid sequence, more preferably at least about 89% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, more preferably preferably at least about 91% amino acid sequence identity, more preferably at least about 92% amino acid sequence identity, more preferably at least about 93% identity amino acid sequence, more preferably at least about 94% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity, more preferably preferably at least about 96% amino acid sequence identity -, more preferably at least about 97% amino acid sequence identity, more preferably at least about 98% amino acid sequence identity W 5 and more preferably at least about 99% amino acid sequence identity "with the amino acid sequence of the native amino acid sequence, full length as described in present. Ordinarily, the polypeptides of the F variant PROs are at least about 10 amino acids in length, often at least about 20 amino acids in length, more often at least about 30 amino acids in length. length, more often at least about 40 amino acids in length, more often at least about 50 amino acids in length, more at F often at least about 60 amino acids in length, more often at least about 70 amino acids in length, more often at least about 80 amino acids in length, more often at least about 90 amino acids in length, more often at least about 100 amino acids in length, most often at Less than about 150 amino acids in length, more often at least about 200 amino acids in length, more often at least about 300 amino acids in length, or more.

P 5 The "percentage (%) of the amino acid sequence identity" with respect to the PRO polypeptide sequences identified herein, is defined as the percentage of the amino acid residues in a candidate sequence which is identical with the amino acid residues in • the specific PRO polypeptide sequence, after aligning the sequences and entering the spaces, if necessary, to achieve the maximum percentage of sequence identity, and without considering no conservative substitution as part of the sequence identity. The alignment for the purpose of determining the percentage of identity • Amino acid sequence can be achieved in several ways that are within the skills in the art, for example, using a publicly available computer program such as the BLAST, BLAST-2, ALIGN, or Megalign programs (DNASTAR). Those skilled in the art can determine the appropriate parameters to measure the alignment, which includes any algorithm - - necessary to achieve maximum alignment over the full length of the sequences being compared. However,% of identity values used in this were generated • 5 using the WU-BLAST-2 computer program (Altschul, et al., Methods in Enzymology 266: 460-480 (1996)). Most of the WU-BLAST-2 search parameters were set as default values. Those who did not settle as default values, that is, the parameters • adjustable, they were established with the following values: separation of the superposition = 1, fraction of superposition = 0.125, word threshold (T) = 11, and register of matrix = BLOSUM62. In the At present, a% of the amino acid sequence identity value was determined by dividing (a) the number of corresponding amino acid residues corresponding among the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and the comparison amino acid sequence of interest (ie, the sequence against which the PRO polypeptide of interest is being compared which may be a polypeptide of the PRO variant) as determined by WU-BLAST-2 by (b) the total number of amino acid residues of the PRO polypeptide of interest.

The "polypeptide of the PRO variant" or the "amino acid sequence of the PRO variant" • 5 means a nucleic acid molecule that encodes an active polypeptide as defined above and which has at least about 80% nucleic acid sequence identity with a nucleic acid sequence encoding a PRO polypeptide sequence • Native amino acids, full length, as described herein. Ordinarily, a polynucleotide of the vanant PRO will have at least approximately 80% sequence identity of nucleic acid, more preferably at least about 81% nucleic acid sequence identity, more preferably at least • approximately 82% nucleic acid sequence identity, more preferably at least approximately 83% nucleic acid sequence identity, more preferably at least about 84% nucleic acid sequence identity, more preferably at least about 85% sequence identity Nucleic acid, more preferably at least - about 86% nucleic acid sequence identity, more preferably at least about 87% nucleic acid sequence identity, more preferably at least • about 88% nucleic acid sequence identity, more preferably at least about 89% nucleic acid sequence identity, more preferably at least about 90% sequence identity Nucleic acid, more preferably at least • approximately 91% nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, more preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94% sequence identity of • nucleic acid, more preferably at least about 95% sequence identity of Nucleic acid, more preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably at least approximately 98% sequence identity of --- '' -ja? .í8t-it-s - ».« - ¡.. - > -ü- »» »» - < -? - - - 12 - nucleic acid, more preferably at least about 99% nucleic acid sequence identity to the nucleic acid sequence encoding the PRO polypeptide sequence of P 5 native sequence, full length , as described herein, the full-length native sequence PRO polypeptide sequence lacks the signal peptide as described herein, an extracellular domain of a PRO polypeptide as described herein or • any other fragment of the full length PRO polypeptide sequence as described herein. The variants do not encompass the sequence of the native nucleotide. Ordinarily, the polynucleotides of the PRO variant are at least about 30 • nucleotides in length, often at least about 60 nucleotides in length, plus Often at least about 90 nucleotides in length, more often at least about 120 nucleotides in length, more often at least about 150 nucleotides in length, more often at least about 180 nucleotides in length, more often at least about 210 nucleotides in length, more often at least about 240 nucleotides in length, more often at least about 270 nucleotides in length, more at • often at least about 300 nucleotides in length, more often at least about 450 nucleotides in length, more often at least about 600 nucleotides in length, most often at least about 900 nucleotides in length, or more.

• The "percentage (%) of the nucleic acid sequence identity" with respect to the nucleic acid sequences encoding the PRO, identified herein, is defined as the percentage of nucleotides in a candidate sequence, which is identical to the nucleotides in the • PRO nucleic acid sequence of interest, specific, after aligning the sequences and enter the spaces, if necessary, to achieve the maximum percentage of sequence identity. Alignment for the purpose of determining the percentage of nucleic acid sequence identity can be achieved in several ways that are within the skills in the art, for example, using a publicly available computer program such as the BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) programs. However,% of the identity values of • Nucleic acid sequence, were generated using the WU-BLAST-2 computer program (Altschul, et al., Methods in Enzymology 266: 460-480 (1996)). Most of the WU-BLAST-2 search parameters were set as default values.

Those that did not settle as values • default, that is, the adjustable parameters, were established with the following values: separation of the superposition = 1, fraction of superposition = 0.125, word threshold (T) = 11, and array record = BLOSUM62. For purposes of the present, a% of the nucleic acid sequence identity value was determined • dividing (a) the number of corresponding identical nucleotides between the acid sequence The nucleic acid molecule of the nucleic acid molecule encoding the PRO polypeptide of interest having a sequence derived from the nucleic acid encoding the native sequence PRO polypeptide and the comparative nucleic acid molecule of interest (ie. to say, the sequence against which the nucleic acid molecule encoding the PRO polypeptide of interest is being compared which may be a variant PRO polynucleotide) as determined by WU-BLAST-2 by (b) the total number of the • nucleotides of the nucleic acid molecule encoding the PRO polypeptide of interest.

In other embodiments, the polynucleotides of the PRO variant are nucleic acid molecules that encode an active PRO polypeptide and which are • capable of hybridizing, preferably under conditions of severe hybridization and washing, to the nucleotide sequences encoding a full-length PRO polypeptide as describes in the present. The polypeptides of the PRO variant can be those that are encoded by a polynucleotide of the PRO variant. • The term "positives, in the context of the sequence comparison performed as described above, includes the residues in the compared sequences that are not identical but have similar properties (e.g. as a result of conservative substitutions, see Table 1 For the purposes of the present, - -the% of the value of the positives is determined by dividing (a) the number of amino acid residues that register a positive value between the amino acid sequence of the PRO polypeptide of interest having a derived sequence of the native PRO polypeptide sequence and the comparison amino acid sequence of interest (ie, the amino acid sequence against which the PRO polypeptide sequence is being compared) as determined in the BLOSUM62 matrix of WU-BLAST-2 by (2) the total number of amino acid residues of the PRO polypeptide of interest.

"Isolated", when used herein, describes various polypeptides described herein, which means that the polypeptide has been identified and separated and / or recovered from a component of its natural environment. The contaminating components of their natural environment are materials that would typically interfere with the diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones and other protein or non-protein solutes. In preferred embodiments, the polypeptide will be purified (1) to a sufficient degree to obtain at least 15 residues from the * - - "'' - * - - * - .. X»., ^ - / J, s-.Egsá ^ iéa ^ N-terminal or internal amino acid sequence through the use of a rotary rate sequencer, or (2) homogenize by SDS-PAGE under non-reducing or reducing conditions using • Coomassie blue or, preferably, dyed with silver. The isolated polypeptide includes the i n s i t u polypeptide within the recombinant cells, since at least one component of the PRO polypeptide's natural environment will not be present. From ordinary way, however, the polypeptide • Isolate will be prepared by at least one purification step.

A nucleic acid encoding the polypeptide "Isolated" PRO is a nucleic acid molecule that is identified and separated from at least one contaminating nucleic acid molecule with which ^ is ordinarily associated in the natural source of the PRO polypeptide nucleic acid. A molecule of PRO polypeptide nucleic acid, isolated, is different from one that is in the form or as found in nature. The nucleic acid molecules of the PRO polypeptide, isolated therefore, are distinguished from the nucleic acid molecules of the PRO polypeptide, specific, as found '._ ----- ___ i ^ _B¿ ^. ^^ IS;' < £ -. ^, ^ - N; ^, ^ ^ > ^ .. - - in natural cells. However, an isolated PRO polypeptide nucleic acid molecule includes the PRO polypeptide nucleic acid molecules contained in the cells that • ordinarily they express the PRO polypeptide where, for example, the nucleic acid molecule is in a chromosomal location different from that of the natural cells.

The term "control sequences" refers to • to the DNA sequences necessary for the expression of a coding sequence operably linked in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. It is known that cells • eukaryotes use the promoters, po 1 and aden 11 signals, and enhancers. 20 Nucleic acid is operably linked "when placed in a functional relationship with another nucleic acid sequence, for example, DNA for a pre-sequence or leader secretory that is operably linked to DNA »? -Kn- * * & $ "- 'for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide, a promoter or enhancer is operably linked to a coding sequence if • affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned to facilitate translation. Generally, "operably linked" means that the DNA sequences that are linked are contiguous, and, in the case of • a secretory or secretory leader, contiguous and in a reading phase. However, breeders do not have to be contiguous. The link is carried out by means of ligation in restriction sites convenient. If such sites do not exist, the adapters or linkers of the synthetic oligonucleotide are used in accordance with the practice • conventional.

The term "antibody" is used in the broadest sense and specifically covers, for example, unique anti-PRO monoclonal antibodies (including the agonist, antagonist, and neutralizing antibodies), antibody compositions. anti-PRO with polypeptide specificity, single chain anti-PRO antibodies, and fragments of anti-PRO antibodies (see below). The term "monoclonal antibody" as used herein refers to an antibody obtained • from a population of substantially homogeneous antibodies, that is, the individual antibodies that comprise the population are identical except for possible naturally occurring mutations that may be present in smaller quantities. • The severity "of the hybridization reactions is easily determined by someone with ordinary skill in the art, and in general is an empirical calculation that depends on the length of the probe, the wash temperature, and the salt concentration. In general, the most • long they require higher temperatures to carry a formation of nucleic acid molecules suitable hybrids, while shorter probes need lower temperatures. Hybridization in general depends on the ability of the denatured DNA to re-form hybridized nucleic acid molecules when they are present the complementary strands in an environment below their melting temperature. The larger the desired degree of homology between the sequence of the probe and the hybridisable, the higher the temperature that can be used.

• As a result, it appears that relatively high temperatures will tend to make the reaction conditions more severe, while the lower temperatures will make them less severe. For additional details in explaining the severity of hybridization reactions, see • Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

"Severe conditions" or "high conditions" "severity", as defined herein, can be identified as those that: (1) employ high temperature and low ionic strength for the • washing, for example, 0.015 sodium chloride / 0.005 M sodium chloride / 0.1% sodium dodecyl sulfate 50 ° C, or that (2) used during the hybridization of a denaturing agent, such as formamide, for example, 50% formamide (v / v) with 0.1% bovine serum albumin / Ficoll 0. 1% / pol i vini lpi ideal id 0.1% / shock absorber 50 nM sodium phosphate at pH 6.5 with 750 mM sodium chloride, 75 M sodium citrate at 42 ° C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, Denhardt's solution 5 • x, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate at 42 ° C, washed at 42 ° C in 0.2 x SSC (sodium chloride / sodium) sodium treatment) and 50% formamide at 55 ° C, followed by a high severity wash consisting of SSC 0.1 x containing EDTA at 55 ° C. • The "moderately severe conditions" are identified as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of a washing solution and hybridization conditions (e.g. temperature, strength • ionic, and% SDS) less severe than those described above. An example of conditions Moderately severe is a condition such as an overnight incubation at 37 ° C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate ( pH 7.6), Denhardt's solution 5 x, % dextran sulfate, and 20 mg / ml DNA * juist * denatured salmon sperm, followed by washing the filters in SSC 1 x at approximately 37-50 ° C. The technician with skills in the subject will recognize how to adjust the temperature, strength • 5 ionic, etc., as necessary to accommodate factors such as the length of the probe and imimeters.

The term "marked epitope" as used herein refers to a chimeric polypeptide • comprising a PRO polypeptide fused to a "brand polypeptide". The tag polypeptide has enough residues to provide an epitope against which an antibody can be made, however short it does not interfere with the activity of the polypeptide to which it is to be fused. The brand polypeptide is preferably also • moderately unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 amino acid residues (preferably, between about 10 and 20 amino acid residues). 25-1 1 - As used herein, the term "mmunoadhesin" designates antibody-like molecules that combine the binding specificity of a heterologous protein (an "adhesin") with the • 5 effector functions of the constant domains of immunoglobulin ina. Structurally, immunoadheses comprise a fusion of an amino acid sequence with the desired binding specificity which is different from the recognition of the antigens and the link site • of an antibody (ie, it is "heterologous"), and a constant domain sequence of immunog 1 obu 11 na. The part of the adhesin of an immunoadhesive molecule is typically a A contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand. The sequence of the domain of the constant of • immunoglobulin in the immunoadheses can be obtained from any immunoglobulin, such as subtypes IgG-1, IgG-2, IgG-3, or IgG-4, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.

"Active" or "activity" for the purpose of the present refers to the polypeptide forms PRO that retain the biological and / or - - immunological activities of the PRO that occurs naturally, or natively, where "biological" refers to a biological function (either inhibitory or stimulatory) provoked PRO a PRO that occurs • naturally or natively, different from the ability to induce the production of an antibody against an antigenic epitope possessed by a PRO that occurs naturally or natively and an "immunological" activity refers to the ability to induce the production of an antibody against a • antigenic epitope possessed by a PRO that occurs naturally or natively.

The term "antagonist" is used in a broad sense, and includes any that partially or totally blocks, inhibits, or neutralizes a biological activity of a native PRO polypeptide • described in this. In a similar way, the term "agonist" is used in a broad sense and includes any molecule that mimics a biological activity of a native PRO polypeptide described herein. Suitable agonist or antagonist molecules specifically include the agonist or antagonist antibodies or the antibody fragments, fragments or variants of - - the amino acid sequence of the native PRO polypeptides, peptides, small organic molecules, etc. Methods for identifying the agonists or antagonists of a PRO polypeptide can comprise contacting a PRO polypeptide with a candidate agonist or an antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the PRO polypeptide. • 1 0"Treatment" refers to both therapeutic and prophylactic treatment or preventive measures, where the goal is to prevent or delay (decrease) the condition or condition objective pathological. Those who need treatment include those who already have the condition as well as those who are prone to have the condition or those where the condition will be avoided. "Chronic" administration refers to the administration of the agent or agents in a continuous manner as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time.

- - The administration "intermittent" is the treatment that not only occurs consecutively without interruption but is cyclic in nature.

• "Mammal" for treatment purposes refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sport animals, or pet animals, such as dogs, cats, cows, horses, sheep, pigs, goats, rabbits etc.

• Preferably, the mammal here is a human.

Administration "in combination with" one or more therapeutic agents includes administration simultaneous (concurrent) and consecutive in any order.

• "Carrier" as used herein includes acceptable carriers, excipients, or stabilizers Pharmaceutically, they are not toxic to the cells or to the mammal that is going to be exposed to the same in the doses and concentrations used. Often the physiologically acceptable carrier is a buffered solution of aqueous pH. The examples of physiologically acceptable carriers include - - buffers such as phosphate, citrate, and other organic acids; antioxidants include ascorbic acid; the low molecular weight polypeptides (less than about 10 residues); proteins, • 5 such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates which include glucose, mannose, or dextrins; agents • chelators such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or non-ionic surfactants such as TWEEN ™, polyethylene glycol (PEG), and PLURONICS ™.

The "antibody fragments" comprise • a portion of an intact antibody, preferably the antigen binding or the variable region of the intact antibody. Examples of antibody fragments include the Fab, Fab1, F (ab '> 2' and Pv; diabodies; linear antibodies (Zapata et al., Protein Eng. 8 (10): 1057-1062 [1995 ]), the molecules of single chain antibodies; and the multi-specie antibodies - formed from antiquated fragments.

Papain digestion of antibodies • produces two identical antigen binding fragments, called "Fab" fragments, each with a single antigen binding site, and a residual "Fc" fragment, a designation that reflects the ability to easily crystallize. He The treatment with pepsin generates an F (ab ') 2 fragment • which has two antigen combining sites and which is capable of cross-linking the antigen.

The "Fv" is a minimum antibody fragment which contains a complete antigen recognition and binding site. This region consists of a dimer of a variable domain of heavy chain and one of • light chain, in adjustment with a non-covalent association. It is in this configuration that there are three CDRs of each variable domain interaction defining an antigen binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen binding specificity to the antibody. However, even a single variable domain (or the The half of an Fv comprises only three CDRs specific for an antigen) that has the ability to recognize and bind antigens, although with a lower affinity than the full binding site. • 5 The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab fragments differ from Fab fragments by the addition of a few residues in the carboxy terminal of the heavy chain CH1 domain that includes one or more • cysteines from the antibody articulation region. The Fab'-SH is the designation herein for the Fab 'in which the cysteine residue (s) of the constant domains contain a free thiol group. F (ab ') 2 antibody fragments were originally produced as pairs of Fab' fragments which have cysteines • articulation between them. Other chemical couplings of the antibody fragments are also known.

The "light chains" of antibodies (immunoglobulins) of any vertebrate species can be assigned to one of two types distinct clearly, called kappa and lambda, in --- i ----: .. rf «-« - .- «.« a-á-fc. «. -g -.- t based on the amino acid sequences of their constant domains Depending on the amino acid sequence • from the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these can be further divided into subclasses (isotypes), for example, IgGl, IgG2, IgG3, • IgG4, IgA, and IgA2.

"Single chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of the antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises • a polypeptide linker between the VH and VL domains that allows the sFv to form the structure desired for antigen binding. For a review of sFv see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Spr inger-See lag, New York, pp. 269-315 (1994). The term "diabodies" refers to fragments of small antibodies with two antigen binding sites, whose fragments comprise a heavy chain variable domain (VH) connected to • a light chain variable domain (VL) in the same polypeptide chain (VH-VL). Using a linker that is too short to allow pairing between the two domains in the same chain, the domains are forced to pair with the complementary domains of another chain and create two • antigen binding sites. Diabodies are described in greater detail in, for example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Nati Acad. Sci. USA, 90: 6444-6448 (1993). 15 An "isolated" antibody is one that has been identified and separated and / or recovered from a • component of its natural environment. The polluting components of its environment Naturally, they are materials that would interfere with therapeutic and diagnostic uses for the antibody, and may include enzymes, hormones, and other protein or non-protein solutes. In preferred embodiments, the antibody will be purified (1) to be greater than 95% by weight of the antibody - - as determined by the Lowry method, and more preferably more than 99% by weight, (2) to a sufficient degree to obtain at least 15 residues from the sequence of N-terminal or internal amino acids 5 using a rotary rate sequencer, or (3) homogenizing by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver staining. The isolated antibody includes the antibody 10 in situ within the recombinant cells, • that at least one component of the antibody's natural environment will not be present. Ordinarily, however, the isolated antibody will be prepared by at least one purification step. The word "tag" when used herein refers to a detectable compound or composition • that is directly conjugated to the antibody to generate a "labeled" antibody. The label may be detectable by itself (eg, radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze the chemical alteration of a substrate compound or composition which is detectable.

JVaOFi - ^^ j ^ BSMa-81-fi-fe-.t-a-Bt-te - - -O? .- M - 1 - By "solid phase" is meant a non-aqueous matrix to which the antibody of the present invention can adhere. The examples of • 5 solid phases encompassed herein include those formed partially or completely of glass (for example, controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones. In certain modalities, depending on the • context, the solid phase can comprise the well of a test plate; in others it is a purification column (for example, an affinity chromatography column). This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149. • A "liposome" is a small vesicle composed of various types of lipids, phospholipids and / or surfactants that are useful for delivering a drug (such as a PRO polypeptide or an antibody thereof) to a mammal. The components of the liposome are arranged in a common manner in a bilayer formation, similar to the arrangement of lipids - of the biological membranes.

A "small molecule" is defined herein that has a molecular weight below • 5 approximately 500 Daltons.

II. Compositions and Methods of the Invention The present invention provides novel nucleotide sequences identified and isolated which encode the polypeptides referred to in • present invention as PRO polypeptides. In particular, the cDNAs encoding several PRO polypeptides have been identified and isolated, as described in more detail in the Examples later It is observed that the proteins produced in separate expression rounds can be different given PRO numbers but the UNQ number is • unique for any given DNA and for the protein it codes, and it will not be changed. However, for reasons of simplicity, in the present specification the protein encoded by the full-length native nucleic acid molecules described herein as well as all other native homologs and variants included in the previous definition of the PRO, will be referred to as - 1 2 - "PRO / number", regardless of its origin or mode of preparation.

As described in the following Examples, • 5 several cDNA clones have been deposited with the ATCC. The current nucleotide sequences of those clones can be easily determined by one skilled in the art by sequencing the deposited clone using standard methods in the art. technique. The predicted amino acid sequence can be determined from the nucleotide sequence using a routine technique. For the PRO polypeptides and the coding nucleic acids described herein. The applicants identified that it is considered better that the reading structure can be identified with the information of the sequence available at the same time. 1. PR0281 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0281. In particular, the cDNA encoding a PR0281 polypeptide has been identified and isolated, as described with greater detail in the subsequent Examples.

- - Using the computer program for sequence alignment WU-BLAST-2, it was found that a full-length native sequence PR0281 (shown in Figure 2 and in SEQ ID NO: 2) has a certain sequence identity of amino acids with a rat TEGT protein. Accordingly, it is hereby believed that PR0281 described in the present application is a new homolog of 10 TEGT identified and possessing the typical activity of • that protein. 2. PR0276 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0276 (UNQ243). In • in particular, the cDNA encoding a polypeptide PR0276 has been identified and isolated, as described with more detail in the later Examples.

As far as is known, the sequence DNA16435-1208 encodes a new factor designated herein as PR0276; using the programs computer for sequence alignment WU-BLAST- - - 2, significant sequence identities were not revealed to any known protein. The identifications of the sequence identity that were found are listed later in the • 5 e j emplos 3. PR0189 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated encoding the polypeptides referred to in the present application as PR0189. In particular, the Applicants have identified and isolated the cDNA encoding a PR0189 polypeptide, as described in more detail in the following Examples. According to the present knowledge of the Applicants, the nucleotide sequence of DNA21624-1391 encodes a new factor; using computer programs for BLAST and FastA sequence alignment, sequence identities were not revealed significant to any known protein. 4. PRO190 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO190. In particular, the Applicants have identified and isolated the cDNA encoding a PRO190 polypeptide, as described in greater detail in the following Examples. The clone • 5 coding for PRO190 was isolated from a human retina library. According to the present knowledge of the Applicants, the nucleotide sequence of DNA23334-1392 encodes a new transmembrane space generating protein, multiple; using computer programs • for BLAST and FastA sequence alignment, there is some sequence identity with the CMP-sialic acid and UDP-galactose transporters, which indicates that the PRO190 can be relate to a conveyor or that the PRO190 can be a new conveyor.

. PR0341 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0341 (UNQ300). In particular, the cDNA encoding a PR0341 polypeptide has been identified and isolated, as described with more detail in the later Examples.

- - Clone DNA26288-1239 was isolated from a human placental library. As far as is known, the sequence DNA26288 -1239 encodes a new • factor designated here as PR0341; using the computer program for sequence alignment WU-BLAST-2, no significant sequence identities were revealed to any known protein. 10 • 6. PR018Q Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO180 (UNQ154). In particular, the cDNA encoding a PRO180 polypeptide has been identified and isolated, as described with • more detail in the later Examples.

The clone DNA26843-1389 was isolated from a human placental library using oligos formed from DNA12922 isolated from an amylase selection. As far as is known, the sequence DNA26843 - 1389 encodes a new factor designated herein as PRO180. 7. PR0194 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. • 5 present application as PR0194. In particular, the Applicants have identified and isolated the cDNA encoding a PR0194 polypeptide, as described in more detail in the following Examples. The coding clone of PR0194 is isolated from a human fetal lung library. According to • present knowledge of the Requesters, the nucleotide sequence of DNA26844 -1394 encodes a new factor; using the computer programs for BLAST sequence alignment and FastA, significant sequence identities were not revealed to any known protein. 8. PRO203 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO203. In particular, the Applicants have identified and isolated the cDNA encoding a PRO203 polypeptide, as described in greater detail in the following Examples. > t »a - Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that the PRO203 polypeptide has sequence identity with the GST ATPase. From In accordance with this, it is believed herein that the PRO203 polypeptide described in the present application is a new identified member of the ATPase family and possesses the typical activity of the GST ATPase. 9. PRO290 Full-Length Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO290 (UNQ154). In In particular, the cDNA encoding a PRO290 polypeptide has been identified and isolated, as described in greater detail in the following Examples. • An analysis of the Dayhoff 20 database (version 35.45 of SwissProt 35), using a sequence alignment analysis WU-BLAST2 of the full length sequence shown in Figure 23 (SEQ ID NO: 33), was not revealed sequence identities between the amino acid sequence of PRO290 and the following Dayhoff sequences: P_R99800, CC4H_HUMAN, YCS2_YEAST, CEF35G12_13, HSFAN_1, MMU52461_1, MMU70015_1, HSU67615_1, CET01H10_8 and CELT28F2_6.

• It is believed in the present that PRO290 is an intracellular protein related to one or more of the above proteins.

. PR0874 Full-Length Polypeptides 10 The present invention provides novel • Identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0874. In particular, the Requesters have identified and isolated the cDNA that encodes a PR0874 polypeptide, as described in greater detail in the following Examples. The coding clone of PR0874 is isolated from a • human fetal lung library. In accordance with the present knowledge of the Requesters, the DNA nucleotide sequence 40621-1440 encodes a new factor. Although, computer programs were used for BLAST and FastA sequence alignment, some significant sequence identity was revealed with the proteins known s. _ ^! ¿^ ^ ^ ^^^^ g = ^^ -? ¿^ '-. , -, - ^ Cif- V-A ^ - A- 11. PRO710 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences that encode the polypeptides referred to in US Pat. • 5 present application as PRO710. In particular, the Applicants have identified and isolated the cDNA encoding a PRO710 polypeptide, as described in more detail in the following Examples. Using computer programs to sequence alignment BLAST and FastA, the • Applicants found that the PRO710 polypeptide has significant similarity with the CDC45 protein. In accordance with this, it is believed herein that the PRO710 polypeptide described in this application is a new CDC45 homolog iden tified. • 12. Full Length PR01151 Polypeptides The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01151. In particular, the cDNA encoding a PR01151 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using the computer program for sequence alignment WU-BLAST-2, a full-length native sequence PR01151 was found • 5 (shown in Figure 30 and in SEQ ID NO: 47) has some amino acid sequence identity with the precursor protein related to the 30 kD human adipocyte complement (ACR3_HUMAN). In accordance with this, it is believed in the present that the PR01151 described in the present application is a new identified member of the family of the complementary protein and that possesses the typical activity of that family. 13. Full-Length PR01282 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01282. In particular, it has identified and isolated the cDNA encoding a PR01282 polypeptide, as described in greater detail in the following Examples.

As far as is known, the DNA45495-2525 sequence encodes a new factor designated in the * i &t 'i? ft' i &ßl -. - present as PR01282. Using computer programs for sequence alignment WU-BLAST-2, certain sequence identities were revealed between PR01282 and other repeating proteins. • rich in leucine, as discussed in the following examples, which indicates that a new member of the superfamily of leucine-rich repeats has been identified. 14. Full Length PR0358 Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding a polypeptide referred to in the present application as PR0358. In particular, the Requesters have identified and isolated the cDNA encoding a new human Toll polypeptide (PR0358), as described in greater detail in the following Examples. Using • Computer programs for BLAST and FastA sequence alignment, the Requesters found that the coding sequence of PR0358 shows significant homology with the DNA sequences HSU88540_1, HSU88878_1, HSU88879_1, HSU88880_1, HS88881_1, and HSU79260_1 in the GenBank database. With the exception of HSU79260_1, remarkable proteins have been identified as receptors similar to human toll. % ..- < M'tm ~? * M e¡ ***, _ ,. ^ J-if 123 Accordingly, it is believed herein that the PR0358 proteins described in the present application are new human homologs. • 5 identified from the Tros protein of Drosophila, and probably play an important role in adaptive immunity. More specifically, PR0358 can be implicated in inflammation, septic shock, and response to pathogens, and play potential papers in the various medical conditions that are • aggravate through the immune response, such as, for example, diabetes, ALS, cancer, rheumatoid arthritis, and ulcers. The role of PR0358 as receptors for the recognition of the pathogenic pattern, the sensation of the presence of the conserved molecular structures present in the microbes, is further supported by the data described in the present application, shows that a receptor similar to the known human Toll, TLR2 is a direct mediator of the LPS signage.

. PR0131Q Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1310. In particular, cDNA encoding a PRO1310 polypeptide has been identified and isolated, as described in greater detail in the following Examples. • Using the computer program for sequence alignment WU-BLAST-2, a full-length native sequence PR01310 (shown in Figure 36 and in SEQ ID NO: 62) was found. has some amino acid sequence identity • with carboxypept idase X2. In accordance with this, it is believed herein that the PRO1310 described in the present application is a new identified member of the carboxypeptidase family and possesses the elimination activity of the terminal amino acid of carboxy lo. • 16. Full Length PR0698 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0698. In particular, Applicants have identified and isolated the cDNA encoding a PR0698 polypeptide, as described with more detail in the later Examples. .- > «-a *, -Jutßbtik.

- - Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that the PR0698 polypeptide has significant similarity to the protein 5 olfactomedin. Accordingly, it is hereby believed that the PR0698 polypeptide described in the present application can be a new homolog of ol f actomedin. 17. Full-Length PR0732 Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0732. In particular, Applicants have identified and isolated the cDNA encoding a PR0732 polypeptide, as described in more detail in the following Examples.

• Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that the PR0732 polypeptide has significant similarity to the human placenta Diff protein. Accordingly, it is hereby believed that the PR0732 polypeptide described in the present application can be a novel homolog Diff33 identified.

The present invention provides new identified and isolated nucleotide sequences that encode the polypeptides referred to in the present application as PRO1120. In particular, the cDNA encoding a PRO1120 polypeptide has been identified and isolated, as described in greater detail in the following Examples. ^^ 10 Using the computer programs for sequence alignment WU-BLAST-2, it was found that a full-length, native sequence PRO1120 (shown in Figure 47 and in SEQ ID NO: 84) has a certain identity of amino acid sequence 15 with the known sulfatase proteins, designated CELK09C4_1, and GL6S_HUMAN, respectively, in the Dayhoff database (version 35.45 SwissProt 35). Accordingly, it is believed herein that the PRO1120 described in the present application is a new identified member of the sulfatase family and possesses the typical activity of the sulphatases. 19. PR0537 Full-Length Polypeptides The present invention provides new and isolated nucleotide sequences that encode the polypeptides referred to in the present application as PR0537. In particular, the cDNA encoding a DNA has been identified and isolated.

• PR0537 polypeptide, as described in more detail in the following Examples. Clone DNA49141-1431 was isolated from a human placental library using a trapping technique that selects the nucleotide sequences that encode the secreted proteins. So, the clone • DNA49141-1431 codes for a secreted factor. As far as is known, the sequence DNA49141-1431 encodes a new factor designated herein as PR0537; using the computer program to alignment of WU-BLAST2 sequences, significant sequence identities were not revealed to any known protein. • . PR0536 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0536. In particular, the cDNA encoding a PR0536 polypeptide has been identified and isolated, as described with greater A - - detail in the following Examples.

Clone DNA49142-1430 was isolated from a human infant brain library using a trap technique that selects the nucleotide sequences encoding the secreted proteins. Thus, clone DNA49142-1430 encodes a secreted factor. As far as is known, the sequence DNA491 2-1430 encodes a new factor 10 designated herein as PR0536; using the computer program for sequence alignment WU-BLAST-2, sequence identities were not revealed if they were specific to any known protein. 21. Full-Length PR0535 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0535. In particular, the cDNA encoding a PR0535 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using the computer program to ^ * ^ = ^ _ = ^ _ ^ = l ^ _. f ^ - ^ «., ^ -. . and .. ^ _ ^ and &. "- - WU-BLAST2 sequence alignment, a full-length native sequence PR0535 was found (shown in Figure 53 and in SEQ ID NO: 99) has amino acid sequence identity with a P 5 protein isomerase peptide idyl-prol i lo putative. Accordingly, it is believed herein that PR0535 described in the present application is a new identified member of the isomerase protein family and possesses the activity typical of those proteins. F 22. PR0718 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0718. In particular, the Applicants have identified and isolated the cDNA encoding a PR0718 polypeptide, as described in greater detail in the following Examples. The clone encoding PR0718 is isolated from a human fetal lung library. According to the present knowledge of the Applicants, the nucleotide sequence of DNA49647-1398 encodes a new factor; using the programs computer for BLAST sequence alignment and - 1 45 - FastA, no significant sequence identities were revealed to any known protein. f 23. Full Length PR0872 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0872. In particular, the Requesters have identified and isolated the cDNA that encodes a PR0872 polypeptide, as described in more detail in the following Examples. Using the computer programs for BLAST and FastA sequence alignment, the Requesters found that the PR0872 polypeptide has sequence identity with dehydrogenases. Accordingly, it is hereby believed that the PR0872 polypeptide described in the present application can be a new identified member of the dehydrogenase family and possesses the activity of dehydrogenase. 24. PRO1063 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1063. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1063 polypeptide, as described in more detail in the following Examples. Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that the PRO1063 polypeptide has significant similarity to the type IV collagenase protein. In accordance with this, it is believed in the present than the PRO1063 polypeptide described • in the present application it can be a new collagenase homolog identified.

. PR0619 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. • this request as PR0619. In particular, cDNA encoding a PR0619 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using the computer program for sequence alignment WU-BLAST-2, it was found that a full-length native sequence PR0619 - - (shown in Figure 68 and in SEQ ID NO: 117) has certain amino acid sequence identity with VpreB3. Accordingly, it is believed herein that PR0619 described in the present application is a new identified member of the IgG superfamily and may possess the activity related to the assembly and / or components of the substitute light chain associated with it. B cells develop. 26. PR0943 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0943. In particular, the cDNA encoding a PR0943 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST-2, it was found that a full-length native sequence PR0943 (shown in Figure 70 and in SEQ ID NO: 119) has amino acid sequence identity with the protein of growth factor receptor 4.

Accordingly, it is hereby believed that the PR0943 described in the present application is a new identified member of the 5-fibroblast growth factor receptor family and possesses the typical activity of that phylia. 27. PR01188 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences which encode the polypeptides referred to in the present application as PR01188. In particular, the cDNA encoding a PR01188 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

As discussed in more detail in example 1 above, using computer programs for sequence alignment WU-BLAST-20 2, a full-length native sequence PR01188 (shown in Figure 72; NO: 124) has a certain amino acid sequence identity with the nucleophilic hydrolysis pi (SSU83114_1). In accordance with this, it is believed in the present that PR01188 described herein ^. - - application is a new identified member of the pyrophos fohydrolase family of the nucleotide and may possess the activity typical of that family of proteins. • 28. PR01133 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. present application as PR01133. In particular, it • has identified and isolated the cDNA encoding a PR01133 polypeptide, as described in more detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST-2, a full-length native sequence PR01133 was found • (shown in Figure 74 and in SEQ ID NO: 129) has some amino acid sequence identity with the netrina la, access Dayhoff AF002717_1. Accordingly, it is believed herein that PR01133 described in the present application shares at least one mechanism related to netrin. - - 29. Full-length PR0784 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. • this request as PR0784. In particular, the cDNA, designated herein as "DNA53978-1443", which encodes a PR0784 polypeptide, has been identified and isolated, as described in greater detail in the following Examples. 10 • Using the computer programs for BLAST and FastA sequence alignment, a full-length native sequence PR0784 (shown in Figure 76 and in SEC.

NO: 135) has a certain amino acid sequence identity with the sec22 homologues. In accordance with this, it is believed in the present that PR0784 • described in the present application is a new identified member of the sec22 family and can own the vesicle traffic activities typical of the sec22 family.

. PR0783 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0783. In particular, the Applicants have identified and isolated the cDNA encoding a PR0783 polypeptide, as described with • more detail in the later Examples. The clone coding for PR0783 was isolated from the human fetal kidney library. In accordance with the present knowledge of the Requesters, the nucleotide sequence of DNA53996-1442 encodes a new factor. However, using the • computer programs for BLAST and FastA sequence alignment, some sequence identity was found with the known proteins. 31. PRO820 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated • encoding the polypeptides referred to in the present application as PRO820. In particular, Applicants have identified and isolated the cDNA encoding a PRO820 polypeptide, as described in more detail in the following Examples. Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that several portions of the PRO820 polypeptide have sequence identity with the low affinity immunoglobulin Fc gamma receptor, the high affinity Fc receptor IgE and the high immunoglobulin epsilon receptor. • affinity. Accordingly, it is hereby believed that the PRO820 polypeptide described in the present application can be a new identified member of the Fc receptor family. 32. PRO1080 Full-Length Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1080. In particular, the Requesters have identified and isolated the cDNA encoding a PRO1080 polypeptide, as described in more detail in the following Examples. Using the programs • of computer for alignment of sequences BLAST and FastA, the database Dayhoff (version 35.45 SwissProt 35), the Applicants found the PRO1080 polypeptide have sequence identity with the 39.9 kd protein designated as YRY1_CAEEL ", a DnaJ homolog designated" AF027149_5", a DnaJ 2 homolog designated" RNU95727_1", and designated Dna3 / Cpr3 "AF011793 1". In accordance with this, we believe in the - ^. .. * ^ = ..?? & "., Aga- - * .- & tf ^ present that the PRO1080 polypeptide described in the present application can be a new identified member of the protein family similar to DnaJ and therefore can be involved in the • 5 biogenesis of the protein 33. PRO1079 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences that encode the polypeptides referred to in US Pat. • present application as PRO1079. In particular, the cDNA encoding a PRO1079 polypeptide has been identified and isolated, as described in greater detail in the following Examples. As far as is known, the DNA56050-1455 sequence encodes a new factor designated in the • present as PRO1079. Although computer programs were used for alignment of WU-BLAST2 sequences, certain sequence identities were revealed to the known proteins. 34. PR0793 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences which encode the polypeptides referred to in the present application as PR0793. In particular, the cDNA encoding a PR0793 polypeptide has been identified and isolated, as described with greater ^ .P detail in the later Examples.

Clone DNA56110-1437 was isolated from a tumor library of human skin. As far as is known, the DNA56110-1437 sequence encodes a new factor designated herein as • PR0793; using computer programs for sequence alignment WU-BLAST-2, no significant sequence identities were revealed to any known protein. 15 35. PRO1016 Full-Length Polypeptides The present invention provides novel • identified and isolated nucleotide sequences that encode the polypeptides referred to in present application as PRO1016. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1016 polypeptide, as described in more detail in the following Examples. Using computer programs to alignment of BLAST and FastA sequences, the - Applicants found that several portions of the PRO1016 polypeptide have sequence identity with the acyltransferases. In accordance with this, it is believed in the present that the PRO1016 polypeptide • described in the present application is a new identified member of the acyltransferase family and possesses the typical acyltalation capabilities of this family. 36. PRO1013 Full-Length Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1013. In particular, Applicants have identified and isolated the cDNA encoding a PRO1013 polypeptide, as described in more detail in the following Examples. He • clone coding for PRO1013 comes from the human breast tumor tissue library. So, the clone encoding PRO1013 can encode a secreted factor related to cancer. According to the present knowledge of the Applicants, the nucleotide sequence of DNA56410-1414 encodes a new factor. Using the programs of computer for BLAST sequence alignment and ..- .. - - g ^ -. a ^ "^ - - FastA, a certain sequence identity was found with KIAA0157 and P120. PR01013 has at least one region in common with growth factor and cytokine receptors. • 37. PR0937 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences that encode the polypeptides referred to in present application as PR0937. In particular, • Applicants have identified and isolated the cDNA encoding a PR0937 polypeptide, as described in more detail in the following Examples. Using computer programs to alignment of BLAST and FastA sequences, the Applicants found that the PR0937 polypeptide has significant sequence identity with the • members of the glypican family of proteins. In accordance with this, we believe in the Present that PR0937 polypeptide described in the present application is a new identified member of the glypican family possessing the properties typical of the glypican family. - - 38. Full-Length PR0842 Polypeptides The present invention provides new identified and isolated nucleotide sequences that encode the polypeptides referred to in US Pat. • 5 present application as PR0842. In particular, the Applicants have identified and isolated the cDNA encoding a PR0842 polypeptide, as described in greater detail in the following Examples.

As far as is known, the sequence DNA56855- • 1447 encodes a new secreted factor designated herein as PR0842. However, using the computer programs for sequence alignment WU-BLAST2, a certain identity of sequence to any known protein. 39. PR0839 Full-Length Polypeptides • The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0839. In particular, the cDNA encoding a PR0839 polypeptide has been identified and isolated, as described in greater detail in the following Examples. 25 - - As far as is known, the sequence DNA56859-1445 encodes a new factor designated herein as PR0839. However, using the computer programs for alignment of '-PF sequences WU-BLAST-2, revealed some sequence identity with known proteins. 40. PRQ1180 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences f encoding the polypeptides referred to in the present application as PRO1180. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1180 polypeptide, as described in greater detail in the subsequent Examples. Using the computer programs for BLAST and FastA sequence alignment, the • Applicants found that the PRO1180 polypeptide has significant similarity with the enzymes of me i 11 ra ns faith rasa. Accordingly, it is hereby believed that the PRO1180 polypeptide described in the present application is a new identified member of the family of met ilt rans ferase and possesses the typical activity of that family. 25 ~~ «. - < IS "-te? Á.jBfcM? Aa--, .-.,. F" - - - 41. Full-Length PR01134 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to herein application as PR01134. In particular, the cDNA encoding a PR01134 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Clone DNA56865-1491 was isolated from a human fetal liver and spleen library using a trapping technique that selects the nucleotide sequences encoding the secreted proteins. Thus, clone DNA56865-1491 encodes a secreted factor. As far as is known, the sequence DNA56865-1491 encodes a new factor designated herein as PR01134; using the computer program for sequence alignment WU-BLAST2, no significant sequence identities were revealed to any known protein. 42. PRO830 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences asm -8 -% at- - ^ iáS? - - encoding the polypeptides referred to in the present application as PRO830. In particular, the cDNA encoding a PRO830 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Clone DNA56866-1342 was isolated from a human fetal spleen / liver library using a trapping technique that selects the nucleotide sequences encoding the secreted proteins. Thus, clone DNA56866-1342 encodes a secreted factor. As far as is known, the sequence DNA56866-1342 encodes a new factor designated herein as PRO830; using the computer program for sequence alignment WU-BLAST-2, no significant sequence identities were revealed to any known protein. 43. PR01115 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01115. In particular, the cDNA encoding a -polypeptide PR01115 has been identified and isolated, as described in more detail in the following Examples.

As far as is known, the DNA56868-1478 sequence encodes a new factor designated herein as PR01115. Although, computer programs were used for sequence alignment WU-BLAST-2, certain sequence identities were revealed to the known proteins.

Four . PR01277 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01277. In particular, the cDNA encoding a PR01277 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using computer programs for sequence alignment WU-BLAST-2, a full-length, native sequence PR01277 was found (shown in Figure 113 and in SEQ ID NO: 179) has some amino acid sequence identity with the Coch-5B2 protein (designated "AF012252_1" in the Dayhoff database). Accordingly, it is believed herein that PR01277 described in the present application is a new identified member of the Coch-5B2 protein family and possesses the same activities and properties as Coch-5B2. 45. PR01135 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated which encode the polypeptides referred to in • this application as PR01135. In particular, the Applicants have identified and isolated the cDNA encoding a PR01135 polypeptide, as described in more detail in the following Examples.

Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that the PR01135 polypeptide • has significant similarity with the alpha 1, 2 -manans idasa protein. In accordance with this, one believes in present that PR01135 polypeptide described in the present application is a new identified member of the mannosidase enzyme family and possesses the typical activity of that protein family. 25 - - 46. Full Length PR01114 Polypeptides The present invention provides new identified and isolated nucleotide sequences that encode the polypeptides referred to in US Pat. • this request as PR01114. In particular, the cDNA encoding an interferon receptor PR01114 polypeptide has been identified and isolated, as described in greater detail in the following Examples. 10 • Using the computer programs for sequence alignment WU-BLAST-2, a full-length native sequence interferon receptor PR01114 polypeptide (shown in Figure 117 and in SEC. ID NO: 183) has sequence identity with the other known interferon receptors. In accordance with this, • believes in the present that the interferon receptor PR01114 possesses the typical activity of others interferon receptors. 47. PR0828 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0828. In particular, the Applicants have identified and isolated the cDNA encoding a PR0828 polypeptide, as described in greater detail in the following Examples. • 5 Using computer programs for BLAST and FastA sequence alignment, Requesters found that PR0828 polypeptide has sequence identity with glutathione peroxidases. In accordance with this, we believe in the Present that the PR0828 polypeptide described in • this application is a new identified member of the glutathione peroxidase family and other properties typical of glutathione peroxidases. 15 48. Full Length PRQ1009 Polypeptides The present invention provides novel • identified and isolated nucleotide sequences that encode the polypeptides referred to in present application as PRO1009. In particular, the cDNA encoding a PRO1009 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using the computer programs for - sequence alignment WU-BLAST-2, it was found that a full-length native sequence PRO1099 (shown in Figure 122 and in SEQ ID NO: 194) has a certain identity of amino acid sequence 5 with the homolog of the long chain acyl-CoA synthetase designated "F69893". Accordingly, it is hereby believed that the PRO1009 described in the present application is a new identified member of the long chain acyl-CoA synthetase family and possesses activity related thereto. • family. 49. PRO1007 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1007. In particular, • Applicants have identified and isolated the cDNA encoding a PRO1007 polypeptide, as described in greater detail in the subsequent Examples. Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that several portions of the PRO1007 polypeptide have sequence identity with the MAGPIAP. Accordingly, it is believed in the present that the PRO1007 polypeptide described in the present application is a new identified member of the MAGPIAP family and is associated with metastasis and / or cellular signaling and / or • cellular replication. 50. PRO1056 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated encoding the polypeptides referred to in the present application as PRO1056. In particular, cDNA encoding a PRO1056 polypeptide has been identified and isolated, as described in greater detail in the following Examples. 15 Using the computer programs for sequence alignment WU-BLAST-2, it was found that ^ f a full-length native sequence PRO1056 (shown in Figure 127 and in SEQ ID NO: 199) has amino acid sequence identity with a chlorine channel protein. Accordingly, it is believed herein that the PRO1056 described in the present application is a new identified homologue of the chlorine channel protein. 25 - - 51. Full Length PR0826 Polypeptides The present invention provides novel identified and isolated nucleotide sequences ^^ which encode the polypeptides referred to in the present application as PR0826. In particular, the cDNA encoding a PR0826 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Clone DNA57694-1341 was isolated from • a human fetal heart library using a trapping technique that selects the nucleotide sequences that encode the secreted proteins. Thus, the clone DNA57694 - 1341 encodes a secreted factor. As far as is known, the sequence DNA57694-1341 encodes a new factor designated herein as PR0826; using the program • computer for sequence alignment WU-BLAST-2, sequence identities were not revealed significant to any known protein. 52. PR0819 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0819. In particular, the cDNA encoding a PR0819 polypeptide has been identified and isolated, as described in greater detail in the following Examples. • Clone DNA57695-1340 was isolated from a human fetal liver and spleen library using a trapping technique that selects the nucleotide sequences encoding the secreted proteins. Thus, the clone DNA57695- 1340 • codes for a secreted factor. As far as is known, the sequence DNA57695-1340 encodes a new factor designated herein as PR0819; using the computer program for alignment of WU-BLAST-2 sequences, no significant sequence identities were revealed to any known protein. • 53. Full Length PRQ1006 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1006. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1006 polypeptide, as described in more detail in the following Examples. The coding clone of PRO1006 is isolated from a human uterus library. According to the present • knowledge of the Requesters, the 5 nucleotide sequence of DNA57699-1412 encodes a new factor; using computer programs for BLAST and FastA sequence alignment, some sequence identity was revealed with a putative tyrosine kinase protein. 54. PR01112 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. present application as PR01112. In particular, the Applicants have identified and isolated the cDNA encoding a PR01112 polypeptide, as described in more detail in Example 1 below. According to the present knowledge of the Applicants, the nucleotide sequence of DNA57702-1476 encodes a new factor, although some sequencing identity with other proteins was found using the computer programs for BLAST and FastA sequence alignment. known. - - 55. PRO1074 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated • encoding the polypeptides referred to in the present application as PRO1074. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1074 polypeptide, as described in more detail in the following Examples. Using computer programs to sequence alignment BLAST and FastA, the • Applicants found that the PRO1074 polypeptide has sequence identity with ga 1 a ct os 111 r ans f erasa. Accordingly, it is believed herein that the PRO1074 polypeptide described in the present application is a new identified member of the family of galactose 111 rans f erasa and possesses the activity of the galactosyltransferase. 56. PRO1005 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1005. In particular, it has identified and isolated the cDNA encoding a PRO1005 polypeptide, as described in greater detail in the following Examples.

^^ As far as is known, the DNA57708-514 sequence encodes a new factor designated herein as PRO1005. However, using the computer programs for sequence alignment WU-BLAST2, some sequence identity was revealed with the known proteins. • 1 0 57. PRO1073 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1073. In particular, the cDNA encoding a PRO1073 polypeptide has been identified and isolated, as described with greater • detail in the later Examples.

As far as is known, the DNA57710 sequence encodes a new secreted factor designated herein as PRO1073. However, using the computer programs for sequence alignment WU-BLAST2, a certain identity of sequence with the known proteins. - - 58. Full Length PR01152 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01152. In particular, the cDNA encoding a PR01152 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

The clone DNA57711-1501 was isolated from • a human infant brain library. As far as is known, the sequence DNA57711-1501 encodes a new factor designated herein as PR01152; using the computer program to alignment of WU-BLAST-2 sequences, no significant sequence identities were revealed to any known protein. • 59. PR01136 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01136. In particular, cDNA encoding a PR01136 polypeptide has been identified and isolated, as described in greater detail in the following Examples Using the computer programs for sequence alignment WU-BLAST2, it was found that • a full-length native sequence PR01136 (shown in Figure 147 and in SEQ ID NO: 219) has amino acid sequence identity with the proteins that contain the PDZ domain. In accordance with this, it is believed in the present that the10 PR01136 described in the present application is a • new identified member of the protein family that contains the PDZ domain and may possess the typical activity of this family. 60. Full Length PR0813 Polypeptides The present invention provides new identified and isolated nucleotide sequences F that encode the polypeptides referred to in the present application as PR0813. In particular, Applicants have identified and isolated the cDNA encoding a PR0813 polypeptide, as described in more detail in the following Examples. Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that PR0813-4 polypeptide has sequence similarity to protein C associated with pulmonary surfactant. Accordingly, it is believed in the present that the polypeptide PR0813 described in the present application is a new identified homologue of protein C associated with pulmonary surfactant. 61. PRO809 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO809. In particular, the Applicants have identified and isolated the cDNA encoding a PRO809 polypeptide, as described in more detail in the following Examples. According to the present knowledge of the Applicants, the nucleotide sequence of DNA57836-1338 encodes a new factor. 62. PR0791 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0791. In particular, the Applicants have identified and isolated the cDNA that encodes a PR0791 polypeptide, as described in greater detail in the following Examples. According to the present knowledge of the Applicants, the nucleotide sequence of DNA57838 -1337 encodes PP a new factor; however, using the computer programs for BLAST and FastA sequence alignment, there appears to be some sequence identity with the MHC-1 antigens, which indicates that PR0791 may be related to the same in structure and function. • 63. Full Length PRQ1004 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1004. In particular, the cDNA encoding a PRO1004 polypeptide has been identified and isolated, as described in greater detail in the following Examples. As far as is known, the sequence DNA57844-1410 encodes a new secreted factor designated herein as PRO1004. However, using the computer programs for alignment of 25 WU-BLAST2 sequences, a certain identity of ísua¡f. & «saaiatea, '.t. ^. , *. ^. .. & .. ^,. - - sequence with the known proteins 64. Full-Length PROllll Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PROllll. In particular, the cDNA encoding a PROllll polypeptide has been identified and isolated, as described with greater detail in the subsequent Examples. • Using the computer programs for sequence alignment WU-BLAST2, it was found that a native sequence PROllll, full-length (shown in Figure 157 and in SEQ ID NO: 229) has some amino acid sequence identity with the LIG. In accordance with this, we believe in the • present that the PROllll described in the present application is a new identified member of this glycoprotein family. 65. PR01344 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01344. In particular, the cDNA encoding a PR01344 polypeptide has been identified and isolated, as described in more detail in the following Examples. • Using computer programs for sequence alignment WU-BLAST2, a full-length native sequence PR01344 (shown in Figure 159 and in SEQ ID NO: 231) was found. has a certain amino acid sequence identity with the factor C protein of Carcinoscorpius rot undi cauda. Accordingly, it is hereby believed that PR01344 described in the present application is a new protein identified from the factor C and possesses the typical activity of that protein. 66. PRO1109 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1109. In particular, the cDNA encoding a PRO1109 polypeptide has been identified and isolated, as described with greater detail in the subsequent Examples.

Using computer programs for sequence alignment WU-BLAST2, a full-length native sequence PRO1109 was found • 5 (shown in Figure 161 and SEQ ID NO: 236) has certain amino acid sequence identity with the ga lact os ilt rans fera sa protein UDP-Ga 1: human GlcNAc. Accordingly, it is hereby believed that the PRO1109 described in the present application is a new identified ß- • ga lacose i 11 rans fease enzyme and has the activity typical of those enzymes. 67. PR01383 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. • this application as PR01383. In particular, the cDNA encoding a PR01383 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PR01383 -faith.,.%.-. (shown in Figure 163 and SEQ ID NO: 241) has some amino acid sequence identity with the nmb precursor of the putative human transmembrane protein (NMB_HUMAN). In accordance with • this, it is believed in the present that the PR01383 described in the present application is a new homologue nmb ident i f icado. 68. PRO1003 Full-Length Polypeptides 10 The present invention provides novel • Identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1003. In particular, the Requesters have identified and isolated the cDNA that encodes a PRO1003 polypeptide, as described in greater detail in the following Examples. The coding clone of PRO1003 is isolated from a library of human breast tumor tissue. The coding clone of PRO1003 is isolated using a trapping technique that selects the nucleotide sequences that encode the secreted proteins. Thus, the coding clone of PRO1003 can encode a secreted factor. According to the present knowledge of the Requesters, the sequence of nucleotides of UNQ487 (DNA58846-1409) encode a new factor; using computer programs for BLAST and FastA sequence alignment, no significant sequence identities were revealed to any known protein. • 69. Full-Length PRO1108 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. present application as PRO1108. In particular, it • has identified and isolated the cDNA encoding a PRO1108 polypeptide, as described in more detail in the following Examples. Using the computer programs for alignment of sequences BLAST and FastA, the Applicants found that the PRO1108 polypeptide has amino acid sequence similarity with the • LPAAT protein. In accordance with this, it is believed in the present that the PRO1108 described herein application is a new LPAAT homolog identified. 70. PR01137 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated encoding the polypeptides referred to in the present application as PR01137. In particular, the Applicants have identified and isolated the cDNA encoding a PR01137 polypeptide, as described in more detail in the following Examples. • 5 Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that the PR01137 polypeptide has sequence identity with the ribos ilt rans ferases. Accordingly, it is believed in the present that PR01137 polypeptide • described in the present application is a new identified member of the family of ribos i 1 trans f sa sa and possesses the activity of ribosyl transferase. 15 71. Full Length PR01138 Polypeptides The present invention provides novel • identified and isolated nucleotide sequences that encode the polypeptides referred to in present application as PR01138. In particular, the Applicants have identified and isolated the cDNA encoding a PR01138 polypeptide, as described in greater detail in the following Examples. Using computer programs to alignment of BLAST and FastA sequences, the Applicants found that PR01138 polypeptide has sequence identity with the CD84 leukocyte antigen. Accordingly, it is believed herein that the PR01138 polypeptide described in • the present application is a new identified member of the Ig superfamily and has the typical activity of other members of the Ig superfamily. 72. PRO1054 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1054. In particular, it has identified and isolated the cDNA encoding a PRO1054 polypeptide, as described in more detail in the following Examples. • Using computer programs to WU-BLAST2 sequence alignment, a full-length native sequence PRO1054 was found (shown in Figure 174 and SEQ ID NO: 256) has amino acid sequence identity with one or more of the major urinary proteins. From In accordance with this, it is hereby believed that the PRO1054 described in the present application is a new identified member of the MUP family and may possess the typical activity of that family. p 73. Full Length PR0994 Polypeptides The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0994. In particular, it has Identified and isolated the cDNA encoding a • PR0994 polypeptide, as described in more detail in the following Examples.

Using computer programs to sequence alignment WU-BLAST2, a full-length native sequence PR0994 was found (shown in Figure 176 and in SEC ID NO: 258) • has amino acid sequence identity with the L6 antigen associated with the tumor. In accordance With this, it is believed herein that PR0994 described in the present application is a novel homolog of the identified L6 antigen. 74 PR0812 Full-Length Polypeptides 25 The invention relates to a new proportion of identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0812. In particular, the cDNA encoding a PR0812 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PR0812 (shown in Figure 178 and in SEQ ID NO: 260) has some amino acid sequence identity with the linkage protein of the prostatic steroid. Accordingly, it is believed herein that PR0812 described in the present application is a new identified homolog of the prostatic steroid binding protein cl. 75. PRO1069 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1069. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1069 polypeptide, as described in greater detail in the following Examples. Using computer programs for BLAST and FastA sequence alignment, Requesters found that the PRO1069 polypeptide • 5 has sequence identity with CHIF. Accordingly, it is hereby believed that the PRO1069 polypeptide described in the present application is a new identified member of the CHIF polypeptide and is involved in the conduction of the ion or in the regulation of ion conduction. • 76. PR01129 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences that encode the polypeptides referred to in the present application as PR01129. In particular, the Requesters have identified and isolated the cDNA that • encodes a PR01129 polypeptide, as described in more detail in the following Examples. Using In the case of computer programs for BLAST and FastA sequence alignment, the Applicants found that PR01129 polypeptide has significant similarity with the cytochrome P-450 family of proteins. In accordance with this, we believe in the Present that the PR01129 polypeptide described in .jty present application is a new identified member of the cytochrome P-450 family and possesses the typical activity of that family. 77. PRO1068 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1068. In particular, the cDNA encoding a PR0812 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PRO1068 has amino acid sequence identity with urotensin. Accordingly, it is believed herein that the PRO1068 described in the present application is a new identified member of the urotensin family and may possess activity typical of the urotensin family. 78. PRO1066 Full-Length Polypeptides The present invention provides novel _- ----------to--. .. «^». "« Fc ^ JA O. ^ .. ».; ,,. ^^, "; yt3¿,. ^, ^," AMi'Jfik¿ .., -? _., Identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1066. In particular, the Requesters have identified and isolated the cDNA that • 5 encodes a PRO1066 polypeptide, as described in more detail in the following Examples. The coding clone of PRO1066 is isolated from a human pancreatic tumor tissue library using a trapping technique that selects the nucleotide sequences that encode the • secreted proteins. Thus, the coding clone of PRO1066 can encode a secreted factor. In accordance with the present knowledge of the Requesters, the nucleotide sequence of DNA59215-1425 encodes a new factor; using the computer programs for BLAST and FastA sequence alignment, the • sequence identities to any known prot 20 79. Two Full-Length PR01184 Polypeptide The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in present application as PR01184. In particular, - * »V - ^ Aa ^^^ isÁ ^^, * 'Applicants have identified and isolated the cDNA encoding a PR01184 polypeptide, as described in more detail in the following Examples. According to the present knowledge of the • 5 Applicants, the nucleotide sequence of DNA59220-1514 encodes a new secreted factor. 80. PRO1360 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1360. In particular, the cDNA encoding a PRO1360 polypeptide has been identified and isolated, as described with greater detail in the subsequent Examples.

As far as is known, the sequence DNA59844-1603 encodes a new factor designated heras PRO1360; using the programs As the computer for sequence alignment WU-BLAST2, no significant sequence identities were revealed to any known prot Certain sequence identities were revealed, as indicated later in the examples. 25 ^ j --- ^^^ a ^ - ^! ^^. ^ H --- ^; ^^^ - g, & j t? 7 t ^ - * ft.-, 81. PRO1029 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1029. In particular, the cDNA encoding a PRO1029 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

The clone DNA59493-1420 was isolated from a human fetal liver and spleen library using a trapping technique that selects the nucleotide sequences encoding the secreted prot. Thus, the clone DNA59493-1420 encodes a secreted factor. As far as is known, the DNA59 sequence 93-1420 encodes a new factor designated heras PRO1029; using the computer program for sequence alignment WU-BLAST2, sequence identities were not revealed to any known prot 82. PR01139 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences which encode the polypeptides referred to in the present application as PR01139. In particular, the Requesters have identified and isolated the cDNAs encoding PR01139, as described with greater • 5 detail in the later Examples. Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that the originally identified human PR01139 protexhibits a significant sequence homology with the protHSOBRGRP_l • associated with the OB receptor, described by Bailleul et al., Nucleic Acids Res. 25, 2752-2758 (1997) (EMBL Access No: Y12670). 83. Full-Length PRO1309 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1309. In particular, it has identified and isolated the cDNA encoding a PRO1309 polypeptide, as described in more detail in the following Examples.

Using the computer program for sequence alignment WU-BLAST2, it was found that a full-length native sequence PRO1309 (shown in Figure 196 and in SEQ ID NO: 278) has some sequence identity of amino acids with a protdesignated KIAA0416, given the # 5 designation AB007876_1 of Dayhoff. In addition, PRO1309 has leucine-rich repeats, in accordance with this, it is believed in the present that PRO1309 described in the present application is a new identified member of the protfamily with leucine-rich repeats and can • be involved in protein-protein interactions. 84. Full-Length PRO1028 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. • present application as PRO1028. In particular, Applicants have identified and isolated the cDNA that encodes a PRO1028 polypeptide, as described in more detail in the following Examples. According to the present knowledge of the Applicants, the nucleotide sequence of DNA59603- 1419 codifies a new factor, the computer programs for alignment of BLAST and FastA sequences showed some sequence identity with proteins such as those designated "A53050" and "EMU39529 1". 85. PRO1027 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1027. In particular, Applicants have identified and isolated the cDNA that • encodes a PRO1027 polypeptide, as described in more detail in the following Examples. The coding clone of PRO1027 is identified in a library of human uterine cervical tissue.

According to the present knowledge of the Applicants, the nucleotide sequence of DNA59605-1418 encodes a new factor. • 86. Full-Length PRO1107 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PRO1107. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1107 polypeptide, as described in more detail in the following Examples. Using the computer programs for BLAST and FastA sequence alignment, the Applicants found that the PRO1107 5 polypeptide has some similarity with the PC-1 protein, the human insulin receptor tyrosine kinase inhibitor, an alkaline phosphodiesterase, and the autotaxin . Accordingly, it is hereby believed that the PRO1107 polypeptide described in the present application is a new identified member • of the family of the f odi es t erasa. 87. PRO1140 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the new transmembrane polypeptides with mult i-spaces referred to in the present application as • PRO1140. In particular, the Requesters have identified and isolated the cDNA encoding a PRO1140 polypeptide, as described in more detail in the following Examples. Using computer programs for BLAST and FastA sequence alignment, some sequence identity was found with the known proteins. 25 - - 88. Full-Length PR01106 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. • 5 present application as PRO1106. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1106 polypeptide, as described in more detail in the following Examples. Using the computer programs for 10 BLAST and FastA sequence alignment, the • Applicants found that the PRO1106 polypeptide has some significant similarity with the soluble peroxisomal calcium-dependent carrier. Accordingly, it is believed herein that the PRO1106 polypeptide described in the present application is a new identified member of the mitochondrial carrier superfamily and poses the • activity of the typical transporter of this family. 89. Full Length PR01291 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01291. In particular, it has identified and isolated the cDNA encoding a PR01291 polypeptide, as described in more detail in the following Examples.

Using the computer program to • WU-BLAST2 sequence alignment, a full-length, native sequence PR01291 (shown in Figure 208 and SEQ ID NO: 291) was found to have some amino acid sequence identity with the butyrophilin protein. In accordance with this, it is believed in the present that the PR01291 described • in the present application it is a new homolog of butyrophilin identified and possesses the typical activity of that protein. 90. Full Length PRQ1105 Polypeptides The present invention provides novel nucleotide sequences identified and isolated • encoding the polypeptides referred to in the present application as PRO1105. In particular, Applicants have identified and isolated the cDNA encoding a PRO1105 polypeptide, as described in more detail in the following Examples. In accordance with the present knowledge of the Requesters, the nucleotide sequence of DNA59612-1466 encodes a new factor. However, there is a certain sequence identity with a peroxidase precursor designated in a Dayhoff database as "ATTS 1623_1".

P 5 91. Full-Length PR0511 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0511. In particular, the Requesters have identified and isolated the cDNA that encodes a • PR0511 polypeptide, as described in more detail in the following Examples. The coding clone of PR0511 is isolated from a human colon tissue library. According to the present knowledge of the Applicants, the nucleotide sequence of DNA59613-1417 encodes a new factor; using the computer programs for BLAST sequence alignment and • FastA, sequence identities were revealed with RoBo-1, phospholipase inhibitors and a protein designated as "SSC20F10_1", it is indicated that PR0511 may be related to one or more of these proteins. 92. Full-length PRO1104 Polypeptides The present invention provides new identified and isolated nucleotide sequences - - encoding the polypeptides referred to in the present application as PRO1104. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1104 polypeptide, as described • in more detail in the later Examples. According to the present knowledge of the Applicants, the nucleotide sequence of DNA59616-1465 encodes a new factor; using the computer programs for alignment of BLAST and FastA sequences, a certain identity appeared • of sequence with the proteins designated as "AB002107 1", "AF022991 1" and "SP96 DICDI". 93. Full-length PROlOO Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in • present request as PROLO. In particular, Applicants have identified and isolated the cDNA that encodes a PROllOO polypeptide, as described in greater detail in the subsequent Examples. According to the present knowledge of the Applicants, the nucleotide sequence of DNA59619-1464 encodes a new factor; using computer programs for alignment of BLAST and FastA sequences, only a certain sequence identity with known proteins was revealed. There is some sequence identity with the hypothetical yeast 42.5 KD protein ga intergenic region TSM1-ARE1 (ACCESS NO: 140496), designated "YSCT4_YEAST". 94. PR0836 Full-Length Polypeptides The present invention provides novel 10 nucleotide sequences identified and isolated • encoding the polypeptides referred to in the present application as PR0836. In particular, the Applicants have identified and isolated the cDNA encoding a PR0836 polypeptide, as described in greater detail in the following Examples. According to the present knowledge of the Requesters, the nucleotide sequence of DNA59620-1463 encodes • a new factor. Using computer programs for BLAST and 20 FastA sequence alignment, it appears to have some sequence identity with SLSl. 95. PR01141 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences - - encoding the polypeptides referred to in the present application as PR01141. In particular, the cDNA encoding a PR01141 polypeptide has been identified and isolated, as described with greater • detail in the later Examples.

Clone DNA59625-1498 was isolated from a library of human ileum tissue. As far as is known, the sequence DNA59625-1498 encodes a new factor designated herein as PR01141; using the computer program for sequence alignment WU-BLAST2, sequence identities were not revealed to any known protein. 96. Full Length PR01132 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01132. In particular, it has identified and isolated the cDNA encoding a PR01132 polypeptide, as described in more detail in the following Examples.

Using the computer program for 25 sequence alignment WU-BLAST2, it was found that - a full-length native sequence PR01132 (shown in Figure 226 and in SEQ ID NO: 309) has some amino acid sequence identity ^^ with serine proteinase 1 of the enamel matrix and 5 the neuropsin . Accordingly, it is believed herein that the PR01132 described in the present application is a new identified member of the serine protease family and may possess the protease activity typical of this family. • 1 0 97. PR01346 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as NL7 (UNQ701). In particular, the cDNA encoding an NL7 polypeptide has been identified and isolated, as described in more detail • in the later Examples.

As described in the following Examples, a clone DNA59776-1600 has been deposited with the ATCC. The current nucleotide sequence of the clone can be easily determined by one skilled in the art by sequencing the deposited clone using the methods customary in the art. The predicted amino acid sequence can be determined from the nucleotide sequence using standard techniques. For NL7 (PR01346) hereby, the Requesters • 5 consider that it is better for the reading structure to be identifiable with the information of the sequence available at the same time as it is presented.

Using the computer program to sequence alignment WU-BLAST2, it was found that • a full-length, native sequence NL7 (shown in Figure 228 and in SEQ ID NO: 314) has a certain amino acid sequence identity with the glycoprotein 4 associated with the mi ber f 1 i (MFA4_HUMAN); ficolina A - Mus musculus (AB007813_1); human lectin P35 (D63155S 6_1); Ficolin B - Mus musculus (AFO063217_1); tenascin R • human (restriction) (HS 518 E 13_1); the long form of a rat janusin precursor (A45445); precursor HFREP-1 of the fibrinogen-related protein (JN0596); a precursor of human Tenascin (TENA HUMAN); Human CDT6 (HS Y 16132_1); and angiopoiet ina 1 - Mus musculus (MMU83509_1). It is believed in the present that the NL7 described in the present application is a new homologue of the identified TIE ligand, and can - - play a role in angiogenesis and / or vascular maintenance and / or wound healing and / or inflammation and / or tumor development and / or growth. 98. PR01131 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01131. In particular, the cDNA encoding a PR01131 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using the computer program for sequence alignment WU-BLAST2, it was found that a full-length native sequence PR01131 (shown in Figure 230 and in SEQ ID NO: 319) has a certain amino acid sequence identity with a oxidized LDL receptor similar to lectin. Accordingly, it is believed herein that the PR01131 described in the present application may have at least one mechanism similar to that of the LDL receptors. - - 99. Full-Length PR01281 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. • this application as PR01281. In particular, the cDNA encoding a PR01281 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Clone DNA59820-1549 was isolated from • a human fetal liver library using a trapping technique that selects the nucleotide sequences that encode the secreted proteins. Thus, as far as is known, the sequence DNA59820 - 1549 encodes a new factor designated herein as PR01281. Using the computer program for sequence alignment WU-BLAST2, it was found • certain sequence identity with the known proteins, but it was determined that it is not significant. 100. PRO1064 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences that encode the polypeptides referred to in US Pat. present application as PRO1064. In particular, the cDNA encoding a PRO1064 polypeptide has been identified and isolated, as described in more detail in the following Examples. • 5 Clone DNA59827-1426 was isolated from a human fetal kidney library. As far as is known, the sequence DNA59827-1426 encodes a new factor designated herein as PRO1064; using the computer program for 10 sequence alignment WU-BLAST2, they were not revealed • significant sequence identities to any known protein. 101. PR01379 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01379. In particular, the cDNA encoding a PR01379 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Clone DNA59828 was isolated from a human fetal penile library. AFAIK knows, the PR01379 polypeptide encoded by the same - - is a new secreted factor. Using the computer program for sequence alignment WU-BLAST2, sequence identity was found between PR01379 and yeast protein "YHY8_YEAST" • hypothetical (Dayhoff database, version 35.45 SwissProt 35), particularly at the C-terminal ends. Sequence homologies were revealed with other known proteins, but it was determined that it is not significant. 10 • 102. Full-Length PR0844 Polypeptides The present invention provides new identified and isolated nucleotide sequences that encode the polypeptides referred to in US Pat. present application as PR0844. In particular, the Applicants have identified and isolated the cDNA encoding a PR0844 polypeptide, as described with • more detail in the later Examples. Using computer programs to alignment of BLAST and FastA sequences, the Applicants found that PR0844 polypeptide has sequence identity with the serine protease inhibitors. Accordingly, it is believed in the present that the PR0844 polypeptide described in The present application is a new identified serine protease inhibitor and is capable of inhibiting serine proteases. 103. PR0848 Full-Length Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR0848. In particular, the Requesters have identified and isolated the cDNA that encodes a PR0848 polypeptide, as described with • more detail in the later Examples. Using the computer programs for BLAST and FastA sequence alignment, the Requesters found that the PR0848 polypeptide has sequence identity with the sia 1 i 11 rans f esas. In accordance with this, it is believed in the present that the polypeptide PR0848 described in ^ the present application is a new identified member of the sia 1 i lt rans f erasa family and possesses the sialylation capabilities that are typical of this family. 104. PRO1097 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences - which encode the polypeptides referred to in the present application as PRO1097. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1097 polypeptide, as described in more detail in the following Examples. According to the present knowledge of the Applicants, the nucleotide sequence of DNA59841-1460 encodes a new factor. Using the computer programs for BLAST and FastA sequence alignment, some sequence identity was revealed with the proteins designated "CELK05G3_3", "CRU26344_1", "S PBC 16C 6_8", "P_W13844" and "AF013403". 105. PR01153 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01153. In particular, the cDNA encoding a PR01153 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using the computer program for sequence alignment WU-BLAST2, it was found that - 1 0 - a full-length native sequence PR01153 (shown in Figure 246 and in SEQ ID NO: 351) has some sequence identity of amino acids with the protein HPBRII-7 assigned to the Library of • 5 EMBL data in June 1992. Accordingly, it is hereby believed that PR01153 described in the present application may be related to HPBRII-7. 106. Full-length PR01154 Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01154. In particular, it has identified and isolated the cDNA encoding a PR01154 polypeptide, as described in greater detail in the following Examples. • Using the computer program to WU-BLAST2 sequence alignment, a full length, native sequence PR01154 was found (shown in Figure 248 and in SEQ ID NO: 353) is aligned with a KIAA0525 protein, designated AB011097. The PR01154 has a new N-terminal of 73 amino acids. In accordance with this, it is believed that PR01154 is novel. PR01154 also has significant sequence identity with aminopeptidase N, aminopeptidase of the membrane regulated with insulin, the enzyme degrading the hormone that releases the trotropine and the aminopeptidase of leucine from the placenta. Therefore, PR01154 is considered to be a new aminopeptidase, or peptide that degrades peptides. 107. Full-Length PR01181 Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01181. In particular, it has identified and isolated the cDNA encoding a PR01181 polypeptide, as described in greater detail in the following Examples. • Clone DNA59847-1511 was isolated from a human prostate tissue library using a trapping technique that selects the nucleotide sequences encoding the secreted proteins. Thus, clone DNA598 7-1511 encodes a secreted factor. As far as is known, the sequence DNA59847-1511 encodes a new factor - designated here as PR01181; using the computer program for sequence alignment WU-BLAST2, no sequence protein identities were revealed • known 108. PR01182 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated which encode the polypeptides referred to in • this application as PR01182. In particular, the cDNA encoding a PR01182 polypeptide has been identified and isolated, as described in greater detail in the following Examples. 15 Using the computer programs for sequence alignment WU-BLAST2, it was found that • a full-length native sequence PR01182 (shown in Figure 252 and in SEQ ID NO: 357) has amino acid sequence identity with the protein conglutinin. Accordingly, it is believed herein that PR01182 described in the present application is a new identified homolog of congluin. 25 109. Full-length PR01155 Polypeptides The present invention provides new identified and isolated nucleotide sequences that encode the polypeptides referred to in US Pat. present application as PR01155. In particular, the cDNA encoding a PR01155 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PR01155 (shown in Figure 254 and in SEQ ID NO: 359) has some amino acid sequence identity with the neurocimna B. Accordingly, it is believed herein that PR01155 described in the present application is a new identified member of the tachykinin family. 110. Full-Length PR01156 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01156. In particular, it has identified and isolated the cDNA encoding a PR01156 polypeptide, as described in greater detail in the following Examples.

Clone DNA59853-1505 was isolated from an adult human heart library using a trapping technique that selects the nucleotide sequences encoding the secreted proteins. Thus, clone DNA59853-1505 can encode a secreted factor. As far as is known, the DNA59853-1505 sequence encodes a new factor • designated here as PR01156. However, using the computer programs for sequence alignment WU-BLAST2, some sequence identity was revealed with the known proteins. 111. Full-Length PRO1098 Polypeptides The present invention provides novel • identified and isolated nucleotide sequences that encode the polypeptides referred to in present application as PRO1098. In particular, the Applicants have identified and isolated the cDNA encoding a PRO1098 polypeptide, as described in greater detail in the following Examples. The coding clone of PRO1098 is isolated from a library of human lung tissue. According & t ~~ i? tisl St * "to the present knowledge of the Applicants, the nucleotide sequence of DNA59854-1459 encodes a new factor; using computer programs for BLAST and FastA sequence alignment, sequence identities were not revealed to any known protein. There seems to be some sequence identity with proteins such as the "Env" polyprotein and a meth i-lt-rans ferase. 112. Full-Length PR01127 Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01127. In particular, it has identified and isolated the cDNA encoding a PR01127 polypeptide, as described in more detail in the following Examples. • Clone DNA60283-1484 encodes a secreted factor 20. As far as is known, the sequence DNA60283-1484 encodes a new factor designated herein as PR01127; using the computer programs for sequence alignment WU-BLAST2, the minimum sequence identity 25 was revealed to any known protein. 113. Full-Length PR01126 Polypeptides The present invention provides novel identified and isolated nucleotide sequences ^^ which encode the polypeptides referred to in the present application as PR01126. In particular, the cDNA encoding a PR01126 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PR01126 (shown in Figure 262 and in SEQ ID NO: 367) has a certain amino acid sequence identity. with the protein ol fact omedina. In accordance with this, it is believed herein that PR01126 described in the present application is a new identified homolog of the fact or omedi na and may possess the typical activity of that protein. 114. Full-Length PR01125 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01125. In particular, it - * - IS === - * -. - has identified and isolated the cDNA encoding a PR01125 polypeptide, as described in more detail in the following Examples.

• Using the computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PR01125 (shown in Figure 264 and in SEQ ID NO: 369) has some amino acid sequence identity with the transcriptional rco-1 repressor. From • In accordance with this, it is believed herein that PR01125 described in the present application is a new identified member of the WD superfamily. 115. Full Length PR01186 Polypeptides The present invention provides novel nucleotide sequences identified and isolated • encoding the polypeptides referred to in the present application as PR01186. In particular, it has identified and isolated the cDNA encoding a PR01186 polypeptide, as described in greater detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST2, it was found that - a full-length, native sequence PR01186 (shown in Figure 266 and in SEQ ID NO: 371) has amino acid sequence identity with the poison A protein of the venom Dendroaspis • polylepsis polylepsis. Accordingly, it is believed herein that PR01186 described in the present application is a new identified member of the poison protein A and may share a related mechanism. 10 • 116. Full-Length PR01198 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in present application as PR01198. In particular, the cDNA encoding a PR01198 polypeptide has been identified and isolated, as described with greater • detail in the later Examples.

As far as is known, the sequence DNA60622-1525 encodes a new factor designated herein as PR01198. However, using the computer programs for sequence alignment WU-BLAST2, a certain identity was found of sequence with the known proteins. - - 117. Full-Length PR01158 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01158. In particular, the cDNA encoding a PR01158 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Clone DNA60625-1507 is isolated from • a library of human lung tumor tissue. As far as is known, the sequence DNA60625-1507 encodes a new factor designated herein as PR01158. However, using the programs of computer for sequence alignment WU-BLAST2, certain sequence identities with known proteins were shown. • 118. PR01159 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01159. In particular, the cDNA encoding a polypeptide PR01159 has been identified and isolated, as described in greater detail in the following Examples.

Clone DNA60627-1508 was isolated from a tissue library of blood granulocytes • 5 human peripheral using a trapping technique that selects the nucleotide sequences that encode the secreted proteins. Thus, clone DNA60627-1508 encodes a secreted factor. As far as is known, the DNA60627-1508 sequence encodes a new factor 10 designated herein as PR01159; using the • computer program for sequence alignment WU-BLAST2, sequence identities were not revealed to any known protein. 119. Full-Length PR01124 Polypeptides The present invention provides novel nucleotide sequences identified and isolated • encoding the polypeptides referred to in the present application as PR01124. In particular, it has identified and isolated the cDNA encoding a PR01124 polypeptide, as described in more detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST2, it was found that a -a »fe-- PR01124 of full-length native sequence (shown in Figure 274 and in SEQ ID NO: 377) has amino acid sequence identity with the protein of the epithelial chloro channel of bos taurus. 5 PR01124 also has sequence identity with ECAM-1. Accordingly, it is believed herein that PR01124 described in the present application is a new protein identified from the cell membrane involved in the communication of the 10 cells either through the ion channels or the molecules of the cell. cell adhesion 120. PR01287 Full-Length Polypeptides The present invention provides new identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01287. In particular, cDNA encoding a PR01287 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using the computer program for sequence alignment WU-BLAST2, a full-length native sequence PR01287 (found in Figure 276 and in SEQ ID NO: 381) was found. ? fl-? **? ¡? &? & b0? * _ £ t > X * £ Ay - lJ L -V_. > A ,, 5 ^ - *. - -. », - - has amino acid sequence identity with the radical (peripheral) fringe protein of Gallus gallus (GGU82088_1). Accordingly, it is believed herein that PR01287 described in the present application is a new identified homolog of the fringe protein (peripheral) and may possess the typical activity of the fringe (peripheral) protein. 121. PR01312 Full-Length Polypeptides 10 The present invention provides novel • Identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01312. In particular, the cDNA encoding a PR01312 polypeptide has been identified and isolated, as described in more detail in the following Examples.

- * Using the computer programs for sequence alignment WU-BLAST2, 20 certain sequence identities with the known proteins were revealed, but it was determined that it is not significant. Therefore, as far as is known, the sequence DNA61873-1574 encodes a new transmembrane protein designated herein as PR01312. 122. PR01192 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in • 5 present application as PR01192. In particular, the cDNA encoding a PR01192 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using computer programs to • alignment of WU-BLAST2 sequences, a full-length, native sequence PR01192 (shown in Figure 280 and SEQ ID NO: 389) was found to have amino acid sequence identity with the glycoprotein similar to PO of trout (GEN12838 IP1). Accordingly, it is believed herein that PR01192 described in the present application is a new identified member of the myelin glycoprotein PO family. 20 123. Full-Length PRO1160 Polypeptides The present invention provides novel identified and isolated nucleotide sequences that encode the polypeptides referred to in US Pat. present application as PRO1160. In particular, the cDNA encoding a PRO1160 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

The DNA62872-1509 clone was isolated from a human breast tissue library using a trapping technique that selects the nucleotide sequences encoding the secreted proteins. Thus, the clone DNA62872 - 1509 encodes a secreted factor. As far as is known, the sequence • DNA62872-1509 codes for a new factor designated herein as PRO1160; using the computer program for sequence alignment WU-BLAST2, the sequence identities were not revealed to no known protein. 124. PR01187 Full-Length Polypeptides • The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01187. In particular, the cDNA encoding a PR01187 polypeptide has been identified and isolated, as described in more detail in the following Examples. 25 - - As far as is known, the sequence DNA62876-1517 encodes a new factor designated herein as PR01187; using the computer programs for sequence alignment WU-BLAST2, • 5 sequence identities were not revealed to any known protein. 125. PR01185 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated • encoding the polypeptides referred to in the present application as PR01185. In particular, the cDNA encoding a PR01185 polypeptide has been identified and isolated, as described with greater detail in the subsequent Examples.

As far as is known, the clone DNA62881 - 1515 • encodes a new factor designated here as PR01185; using the programs computer for sequence alignment WU-BLAST2, sequence identities were not revealed to any known protein. 126. PR01345 Full-Length Polypeptides 25 The new p e n e n t i n t i n a n t i n e s - identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01345. In particular, the cDNA encoding a DNA has been identified and isolated.

• PR01345 polypeptide, as described in more detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST2, a full-length native sequence PR01345 was found to be 10 • (shown in Figure 288 and in SEQ ID NO: 403) has amino acid sequence identity with the precursor protein of the lectin homolog type C of bos taurus (BTU22298_1). In accordance with this, it is believed herein that PR01345 described in the present application is a new identified member of the Type C lectin protein family and can • possess the typical activity of that family or of the tetranectin protein in particular. 20 127. Full-length PR01245 Polypeptides The present invention provides novel nucleotide sequences identified and isolated encoding polypeptides referred to in the present application as PR01245. In particular, the cDNA encoding a PR01245 polypeptide has been identified and isolated, as described in more detail in the following Examples.

• The DNA64884-1527 clone was identified using the methods that select the nucleotide sequences that encode the secreted proteins. As far as is known, the sequence DNA64884-1527 encodes a new secreted factor designated in the present one as PR01245. Using the computer programs for sequence alignment WU-BLAST2, certain sequence identities were revealed to the known proteins; however, it was determined that they are not significant. 15 128. Full Length PR01358 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01358. In particular, the cDNA encoding a PR01358 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using computer programs to .-i. . & Sai £ * S% xi;, ', £? R' '. ^^ ^ a.J, -., ^ I ^ j ^ '- - - sequence alignment WU-BLAST2, PR01358 found a native sequence full length (shown in Figure 292 and in SEQ ID NO: 410) has amino acid sequence identity with the • 5 RASP-1. In accordance with this, it is believed herein that the PR01358 described in the present application is identified a new member of the serpin family of serine protease inhibitors and can possess inhibition activity of the serine protease, the inhibitory activity of • Protein catabolism and / or is associated with tissue regeneration. 129. PR01195 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in US Pat. • this application as PR01195. In particular, the cDNA encoding a PR01195 polypeptide has been identified and isolated, as described in more detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PR01195 - (shown in Figure 294 and in SEQ ID NO: 412) has the identity of amino acid sequence with MMU28486_1, called proline-rich acidic protein of Mus musculus, place MMU28486, Access: U28486, GBTRANS database, assigned on 06-JUN-1995 by John W. Kasik. In accordance with this, it is believed herein that PR01195 described in the present application is a new identified member of the family of this protein. 10 • Polypeptides 130. Full-length PRO1270 The present invention provides novel nucleotide sequences identified and isolated encoding polypeptides referred to in the present application as PRO1270 15. In particular, the cDNA encoding a PRO1270 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using the computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PRO1270 (shown in Figure 296 and in SEQ ID NO: 414) has amino acid sequence identity with the lectin protein (XLU86699_1) from Xenopus laevis. In accordance with this, it is believed in the present that the PRO1270 described in the present application is a new identified member of the lectin protein family and may possess the typical activity • of that family 131. PR01271 Full-Length Polypeptides The present invention provides novel nucleotide sequences identified and isolated encoding the polypeptides referred to in the present application as PR01271. In particular, the cDNA encoding a PR01271 polypeptide has been identified and isolated, as described in more detail in the following Examples. As far as is known, the sequence DNA66309-1538 encodes a new factor designated herein as PR01271; using the computer programs for sequence alignment WU-BLAST2, significant sequence identities were not revealed to any known protein (the results are further described in the examples below). - - 132. Full-Length PR01375 Polypeptides The present invention provides novel nucleotide sequences identified and isolated • encoding the polypeptides referred to in the present application as PR01375. In particular, the cDNA encoding a PR01375 polypeptide has been identified and isolated, as described in more detail in the following Examples. ^^ 10 Using computer programs for sequence alignment WU-BLAST2, a full-length native sequence PR01375 (shown in Figure 300 and in SEQ ID NO: 418) was found to have amino acid sequence identity with 15 PUT2. Accordingly, it is believed herein that PR01375 described in the present application has at least one related mechanism. • from PUT2. 133. Full-Length PR01385 Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01385. In particular, it has identified and isolated the cDNA encoding a PR01385 polypeptide, as described in more detail in the following Examples.

Clone DNA68869-1610 was isolated from a human tissue library using a trapping technique that selects the nucleotide sequences encoding the secreted proteins. Thus, the clone DNA68869 -1610 encodes a secreted factor. As far as is known, the sequence DNA68869-1610 encodes a new designated factor in • the present as PR01385; using the computer program for sequence alignment WU-BLAST2, sequence identities were not revealed to any known protein. 15 134. Full Length PR01387 Polypeptides The present invention provides novel • Identified and isolated nucleotide sequences that encode the polypeptides referred to in present application as PR01387. In particular, the cDNA encoding a PR01387 polypeptide has been identified and isolated, as described in greater detail in the following Examples.

Using the computer programs for - - sequence alignment WU-BLAST2, it was found that a full-length native sequence PR01387 (shown in Figure 304 and in SEQ ID NO: 422) has amino acid sequence identity with the • protein precursor of myelin protein pO (MYP0_HETFR). Accordingly, it is believed herein that PR01387 described in the present application is a new identified member of the myelin protein family and may possess the typical activity of that family. • 135. PR01384 Full-Length Polypeptides The present invention provides novel identified and isolated nucleotide sequences encoding the polypeptides referred to in the present application as PR01384. In particular, the cDNA encoding a DNA has been identified and isolated.

• PR01384 polypeptide, as described in more detail in the following Examples. Using the computer programs for sequence alignment WU-BLAST2, it was found that a full-length native sequence PRO1120 (shown in Figure 306 and in SEQ ID NO: 424) 25 has amino acid sequence identity with he .- - - NKG2-D (AF054819_1, Dayhoff database, version 35.45 SwissProt 35). Accordingly, it is hereby believed that the PR01384 described in the present application is a new identified member of the NKG2 family and may possess the actuation / inactivation activities typical of the NKG2 family.

B. PRO variants In addition to sequence PRO polypeptides native, full length described in the • present, it is contemplated that PRO variants can be prepared. PRO variants can be prepared by introducing the appropriate nucleotide changes into the PRO DNA, and / or by synthesizing the PRO polypeptide. Those skilled in the art will appreciate that amino acid changes can alter the post-translational processes of the f PRO, such as changing the number or position of the glycosylation sites or altering the characteristics of anchoring the membrane.

Variations in the full-length native sequence PRO or in several PRO domains described herein may be made by example, using any of the techniques and - - guides for conservative and non-conservative mutations established, for example, in U.S. Patent No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding the PRO resulting in a change in the amino acid sequence of the PRO compared to the native sequence PRO. Optionally the variation is by substitution of at least one amino acid with any other amino acid in one or more of the • PRO domains. The guide to determine which amino acid residue can be inserted, replaced or eliminated without adversely affecting the desired activity can be found by comparing the sequence of the PRO with that of the homolog of the known protein molecules and minimizing the number of amino acid sequence changes made in the • regions of high homology. Amino acid substitutions can result in replacement of an amino acid with another amino acid having similar chemical and / or structural properties, such as the replacement of a leucine with a serine, i.e., the replacements of conservative amino acids. The insertions or deletions may optionally be in the range of 1 to 5 - amino acids. The allowed variation can be determined by the insertions, deletions or substitutions that are systematically made of the amino acids in the sequence and by testing the variants • resulting for the activity exhibited by the native, mature or full-length sequence.

Fragments of the PRO polypeptide are provided herein. Such fragments are can truncate at the N-terminal or C-terminal, or • may lack internal waste, for example, when compared to a full-length native protein. Certain fragments lack the amino acid residues that are not essential for a desired biological activity for the PRO polypeptide.

• PRO fragments can be prepared by any number of techniques conventional. The fragments of the desired peptide can be chemically synthesized. An alternative method involves the generation of PRO fragments by enzymatic digestion, for example, by treating the protein with a known enzyme for the cleavage proteins at the defined sites , < - «s8? I« -Yes? M ^ Sfe ^ ».«? S ^ aiS¿ -... "j? .j -_-, mi¿ a -» ..? - - by the particular amino acid residues, or by digestion of the DNA with the suitable restriction enzymes and isolating the desired fragment, yet another suitable technique involves • isolation and amplification of a DNA fragment encoding a fragment of the desired polypeptide, by the polymerase chain reaction (PCR). Oligonucleotides that define the desired terminal end of the DNA fragment are used in the 5 'and 3' primers in the PCR. Preferably, • the PRO polypeptide fragments share at least one biological and / or immunological activity with the native PRO polypeptide described herein.

In the particular modalities, the conservative substi tutions of interest are shown in Table 1 under the heading of substitutions. • preferred. If such substitutions result in a change in biological activity, then more Substantial changes, referred to as exemplary substitutions in Table 1, or as further described below with reference to the amino acid classes are introduced into the selected products. . ~ & t & k & .

- - Table 1 Residue Substitutions Substitutions Original Ej Preferred empties Ala A) val; leu; ile val Arg R) lys; gln; asn lys Asn N) gln; his; lys; arg gln Asp D) glu glu Cys C) be Gln Q) asn asn Glu E) asp asp Gly G) pro; ala ala H) asn; gln; lys; arg arg • He I) leu; val; met; to; leu phe; not r 1 eucina Leu L) ñor 1 eucina; i 1 e; ile val; met; to; phe Lys K) arg; gln; asn a rg Met M) leu; phe; lie leu Phe F) leu; val; ile; to; leu tyr Pro P) wing wing Ser S) thr thr • Thr T) be Trp W) tyr; phe tyr Tyr Y) trp; phe; thr; to be phe Val V) ile; leu; met; phe; leu wing; ñor l? euc ina Substantial modifications in the function or immunological identity of the polypeptide PROs are complemented by the selection of . ^ "^ Ja-f ^ - ^ | p -»? A (? ^ »A - ^ -? --.- £». ^ -. -a. * ¡A - - substitutions that differ significantly in its effect of maintaining (a) the structure of the polypeptide backbone in the area of the substitution, eg, as a sheet or • helical conformation, (b) the hydrophobicity load of the molecule at the target site, or (c) the density of the side chain. Naturally occurring wastes are divided into groups based on side chain properties common • (1) hydrofóbi cos: norleucina, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr; (3) acidic: asp, glu; 15 (4) basic: asn, gln, his, lys, arg; (5) residues that influence the orientation of the chain: gly, pro; and • (6) aromatics: trp, tyr, phe.

The non-conservative substitutions will exchange a member of one of these classes for another class. Such substituted residues may also be introduced at the conservative substitution sites or, more preferably, at the remaining (non-conserved) sites. .-ase.? i-aüJ.

- The variations can be made using methods known in the art such as PCR mutagenesis, alanine scanning, • 5 mutagenesis mediated by oligonucleotides (directed to the site). Site-directed mutagenesis [Cárter et al., Nucí. Acids Res. , A3: 4331 (1986); Zoller et al., Nucí. Acids Res. , 1_0: 6487 (1987)], the mutagenesis of the cassette or cartridge [Wells et al., 10 Gene, 3_4_: 315 (1985)], selection mutagenesis • restriction [Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)], or other known techniques can be performed on the cloned DNA to produce the DNA of the PRO variant. 15 Analysis of amino acids by exploration can also be used to • identify one or more amino acids along a contiguous sequence. Among the amino acids of Preferred exploration are the neutral, relatively small amino acids. Such amino acids include alanine, glycine, serine and cysteine. Alanine is typically a preferred amino acid of exploration among this group because it eliminates side chain beyond the beta-carbon and is less - - susceptible to alter the main conformation of the variant chain [Cunningham and Wells, Science, 244: 1081-1085 (1989)]. Alanine is also typically preferred because it is the amino acid most • 5 common. In addition, it is frequently found in both hidden and exposed positions [Creighton, The Proteins, (W.H. Freeman &Co. N.Y.); Chothia, J. Mol. Biol. , 150: 1 (1976)]. If the alanine substitution does not generate adequate amounts of variant, an isoteric amino acid may be used.

• C. Modifications of PRO Covalent modifications of PRO are included within the scope of this invention. A The type of covalent modification includes the amino acid residues targeted by the PRO polypeptide with an organic derivatizing agent that is • able to react with the selected side chains or the N- or C-terminal residues of the PRO. The ivatization with bi-functional agents is useful, for example, for cross-linking the PRO to a water-insoluble support matrix or surface for use in the method for the purification of anti-PRO antibodies, and vice versa. The agents of Crosslinking commonly used include, for example, 1, 1-bi s (dia zoacet i 1) -2-pheni let ano, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidoalicylic acid, imidoesters or functional obi, which include • esters of di-succinimidi such as 3,3'-dithiobis (succinimidylpropionate), bi-functional male imides such as bi-N-male imido-1,8-octane and agents such as methyl-3- [(p. azidophenyl) dithio] propioimidate. 10 • Other modifications include the deamidation of the glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, the hydroxylation of the proline and Lysine, the phosphorylation of the hydroxyl groups of the seryl or threonyl residues, the methylation of the a-amino groups of the side chains of lysine, argimna, and histidine [T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)], the acetylation of the N-terminal amine, and the amidation of any C-terminal carboxylic group.

Another type of covalent modification of the PRO polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is indicated herein with the purpose of eliminating one or more portions of • carbohydrates found in a native sequence PRO (either by removing the underlying glycosylation site or suppressing glycosylation by chemical and / or enzymatic means), and / or adding one or more glycosylation sites that are not present in the native sequence PRO. Also, the phrase • includes qualitative changes in the glycosylation of native proteins, which imply a change in the nature and proportions of several carbohydrate moieties present. In addition to the glycosylation sites for the PRO polypeptide can be completed by the • alteration of the amino acid sequence. The alteration can be done, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence PRO (for the glycosylation sites linked to oxygen). The amino acid sequence of the PRO polypeptide can optionally be altered to through the changes at the DNA level, particularly by mutation of the DNA encoding the PRO polypeptide at the preselected bases such as the codons that are generated that will be translated into the amino acids • desired Another means of increasing the number of carbohydrate moieties in the PRO polypeptide is by chemical or enzymatic coupling of the glycosides to the polypeptide. Such methods are • described in the art, for example, in the publication WO 87/05330 published on September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem. , pp. 259-306 (1981). The elimination of the carbohydrate portions present in the PRO polypeptide is • can be carried out chemically or enzymatically or by mutational substitution of codons coding amino acid residues that serve as targets for glycosylation. Chemical descaling techniques are known in the art and are described, for example, by Hakimuddin, et al., Arch. Biochem. Biophys., 259: 52 (1987) and by Edge et al., Anal. Biochem. , 118: 131 (1981). Enzymatic cleavage of the carbohydrate moieties in the polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al., Meth. Enzymol. , • 138: 350 (1987 Another type of covalent modification of the PRO comprises linking the polypeptide PRO to one of a variety of non-protein polymers, for example, polyethylene glycol, polypropylene glycol, or # pol ioxialqui logs, in the manner established in US Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.

The PRO of the present invention can also be modified in such a way as to form a chimeric molecule comprising one PRO fused to another, the • heterologous polypeptide or the amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of the PRO with a tag or tag polypeptide which provides an epitope to which the anti-tag antibody can be selectively linked. The epitope tag is usually placed in the - - amino- or carboxy-terminal PRO. The presence of such labeled forms of the PRO epitope can be detected using an antibody against the tag polypeptide. Also, the provision of the tag of • 5 epitope allows the PRO to be easily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Several tag polypeptides and their respective antibodies are well known in the art. The examples include • the tags or tags pol ihi st idina (poly-his) or poly-histidine-glycine (poly-his-gli); the tag polypeptide of HA flu and its antibody 12CA5 [Field et al., Mol. Cell. Biol. , 8: 2159-2165 (1988)]; the c-myc tag and antibodies 8F9, 3C7, 6E10, G4, B7 and 9E10 to them [Evan et al., Molecular and Cellular Biology, _5: 3610-3616 (1985)]; and the brands or tag of the • Herpes Simplex virus glycoprotein D (gD) and its antibody [Paborsky et al., Protein Engineering, 3_ (6): 547-553 (1990)]. Other tag polypeptides include the Flag peptide [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; the KT3 epitope peptide [Martin et al., Science, 255: 192-194 (1992)]; an a-tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266: 15163-15166 fe- ~ & (1991)]; and the peptide tag of protein 10 of the T7 gene [Lut z-Freyermuth et al., Proc. Nati Acad. Sci. USA, 87: 6393-6397 (1990)].

• In an alternative embodiment, the chimeric molecule may comprise a fusion of the PRO with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimeric molecule (also referred to as a "immunoadhes ina"), such fusion could be the region • Fc of an IgG molecule. Ig fusions preferably include the substitution of a soluble form (deleted or inactivated transmembrane domain) of a PRO polypeptide instead of the Minus one variable region within an Ig molecule. In a particularly preferred embodiment, the fusion of the immunoglobulin includes the • joint, CH2 and CH3, or the joint, the CH1, CH2 and CH3 regions of an IgG1 molecule. For the production of immunoglobulin fusions see also U.S. Patent No. 5,428,130 issued June 27, 1995.

- - D. Preparation of the PRO The description that follows relates mainly to the production of the PRO by cultured cells transformed or transfected with a vector containing the desired PRO nucleic acid. Of course, it is contemplated that alternative methods, which are well known in the art, can be employed to prepare the PRO. For example, the sequence of the PRO, or portions thereof, can be produced by the synthesis of the peptide # direct using solid phase techniques [see, for example, Stewart et al., Solid-Phase Peptide Synthesis, W.H. Freeman Co. , San Francisco, CA (1969); Merrifield, J. A. Soc., 85: 2149-2154 (1963)]. The synthesis of the protein can be carried out using manual techniques or by automation. The automated synthesis is • can complement, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using the manufacturer's instructions. Various portions of the desired PRO can be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO. 25 - - 1. Isolation of the DNA encoding the PRO The DNA that codes for the PRO can be obtained from a cDNA library prepared from the tissue that is believed to possess the mRNA of the PRO • desired and express it at a detectable level. Accordingly, the DNA of the human PRO can conveniently be obtained from a cDNA library prepared from human tissue, as described in the Examples. The gene encoding the PRO can also be obtained from a genomic library or by known synthetic methods (e.g., automated nucleic acid synthesis).

The libraries can be selected with probes (such as antibodies to the desired PRO or oligonucleotides of at least about 20-P 80 bases) designed to identify the gene of interest or the protein encoded by it. The Selection or separation of the cDNA or the genomic library with the selected probe can be conducted using standard procedures, such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). An alternative method to isolate the gene encoding the PRO is to use the PCR methodology [Sambrook et al., Supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)]. • The following Examples describe the techniques for selecting or separating a cDNA library. Oligonucleotide sequences selected as probes should be long enough and not enough ambiguity for it to be • minimize false positives. The oligonucleotide is preferably labeled such that it can be detected after hybridization to the DNA in the library being selected. The labeling methods are well known in the art, and include the use of radio labels such as ATP labeled with "P, biot initiation or • Enzyme labeled. Hybridization conditions include moderate and high severity severity, and are provided in Sambrook et al., Supra.

The sequences identified in such library selection methods can be compared and align with other known deposited and - - sequences available in public databases such as GenBank or other databases of private sequences. The sequence identity (at any nucleotide or amino acid level) within • defined regions of the molecule or through the full length sequence can be determined using methods known in the art and as described herein.

The nucleic acid that has the sequence of • Coding of the protein can be obtained by separating the selected cDNA or the genomic libraries using the deduced amino acid sequence described herein by The first time, and, if necessary, using the conventional primer extension procedures as described in Sambrook et al., • supra, to detect the precursors and process the mRNA intermediaries that may not have been transcribed inversely to the cDNA. 2. Selection and Transformation of Host Cells or Hosts Host or Host Cells Transfected or transformed with cloning vectors - or expression described herein for the production and culture of the PRO in modified conventional nutrient media such as those suitable for the induction of promoters, the selection of • transformants, or the amplification of genes that encode the desired sequences. The culture conditions, such as the medium, temperature, pH and the like, can be selected by the skilled artisan without a undue experimentation. In general, • Principles, protocols, and practical techniques to maximize the productivity of cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook et al., Supra.

The methods of cell transfection • Eukaryotic and prokaryotic cell transformation are known to technicians with skills Ordinary, for example, CaCl 2, CaP 4, by means of liposomes and electroporation. Depending on the host cell or host used, transformation is performed using standard techniques appropriate for such cells. The calcium treatment employing calcium chloride, as described in Sambrook et al., Supra, or electroporation is generally used for prokaryotes. Infection with Agroba c t eri um t um e fa ci s is used for the transformation of • certain plant cells, as described by Shaw et al., Gene, 2_3: 315 (1983) and by publication WO 89/05859 published June 29, 1989. For mammalian cells without such cell walls, you can use the method of precipitation of Graham's calcium phosphate and van • der Eb, Virology, 5_2: 456-457 (1978). The general aspects of the transformations of the host or host system of mammalian cells have been described in US Patent No. 4,399,216. Transformations in yeast are typically carried out according to the method of Van Solingen et al., J. Bact. , 130: 946 (1977) and • Hsiao et al., Proc. Nati Acad. Sci. (USA), 76: 3829 (1979). However, other methods to introduce DNA in the cells, such as by nuclear microinjection, electroporation, fusion of bacterial protoplasts with intact cells, or polycation, for example, polybrene, polynucleotide, can also be used. For various techniques Transformation of mammalian cells, see Keown et al., Methods in Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-352 (1988).

The host cells suitable for • 5 cloning or expression of the DNA in vectors here include prokaryotes, yeast, or higher eukaryotic cells. Suitable prokaryotes include but are not limited to eubacteria, such as Gram-negative or positive Gram-10 organisms, for example, Ent erobacter iaceae such as • £. coli Several strains of E. coli are publicly available, such as strain MM294 from E. coli K12 (ATCC 31,446); E. coli X1776 (ATCC 31,537); strain E. Coli W3110 (ATCC 27,325) and K5 772 (ATCC 53,635).

Other host cells or prokaryotic hosts include Ent erobacter iaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, • Klebsiel la, Proteus, Salmonella, for example, Salmonella typhimu r lum, Serratia, for example, Ser ratía ma rcescans, and Shigel la, as well as Bacilli such as B. subtitles 11 and B. 1 ichenif ormis (for example, B. 1 ichen i formí s 41P described in DD 266,710 published on April 12, 1989 ), Pseudomonas such as P. aeruginosa, and Streptomyces. These examples are illustrative rather than limiting. Strain - 3110 is a particularly preferred host or host host because it is a common host strain for fermentations of the recombinant DNA product. Preferably, the host cells u • 5 hosts secrete minimal amounts of proteolytic enzymes. For example, strain W3110 can be modified to effect a genetic mutation in genes encoding proteins endogenous to the host, with examples of such hosts including the strain 1A2 of E. coli W3110, which has the • complete tonA genotype; strain 9E4 of E. coli W3110, which has the complete genotype tonA ptr3; the strain 27C7 of E. coli W3110 (ATCC 55,244), which has the complete genotype tonA ptr3 phoA E15 (argF-15 lac) 169 degP ompT kanr; strain 37D6 of E. coli W3110, which has the complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degP ompT rbslilvG kanr; the strain • 40B4 of E. coli W3110, which is strain 37D6 with a deletion mutation of degP not resistant to the kanamycin; and a strain of £. coli having the mutant periplasmic protease described in U.S. Patent No. 4,946,783 issued August 7, 1990. Alternatively, the in vitro methods of cloning, e.g., PCR or other reactions of the nucleic acid polymerase are suitable.

- - In addition to prokaryotes, eukaryotic microbes such as fungi or filamentous yeasts are suitable for cloning or • 5 expression of the hosts for the vectors encoding the PRO polypeptide. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Others include Schi zosaccha romyces pombe (Beach and Nurse, Nature, 290: 140 [1981]; EP 139,383 published on May 2 • 1985); Kluyveromyces guests (Patent North American No. 4,943,529; Fleer et al. , Bio / Technology, 9: 968-975 (1991)) such as, for example, K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al. , J. Bacteriol. , 737 [1983]), K. fragilis (ATCC 12,424), K. bulgapcus (ATCC 16,045, K. wickeramii (ATCC 24,178), K. waltii (ATCC • 56,500), K. drosophilarum (ATCC 36,906, Van den Berg et al., Bio / Technology, 8: 135 (1990)), K. thermotole rans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et al., J. Basic Microbiol., 28: 265-278 [1988]); Candida; Trichoderma reesia (EP 244,234); Neurospora crassa (Case et al., Proc. Nati. Acad. Sci. USA, 76: 5259-5263 [1979]); Schwanniomyces such as - - Schwanniomyces occidentalis (EP 394,538 published October 31, 1990); and filamentous fungi such as, for example, Neurospora, Penicillium, Tolypocladium (WO 91/00357 published on January 10 • 5 of 1991), and Aspergillus hosts such as A. nidulans (Ballance et al., Biochem. Biophys., Res. Commun., 112: 284-289 [1983]; Tilburn et al., Gene, 26: 205- 221 [1983], Yelton et al., Proc. Nati, Acad. Sci. USA, 81: 1470-1474 [1984]) and A. niger (Kelly et al.

Hynes, EMBO J., 4: 475-479 [1985]). The yeasts • Met i lot repicas are suitable herein and include, but are not limited to yeasts capable of growing in methanol, selected from the genus consisting of Hansenula, Candida, Kloeckera, Pichia, Sa echa romyees, Torulops is, and Rhodotorula. A list of specific species that are examples of this class of yeasts can be • find in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982). The host or host cells suitable for the expression of the glycosylated PRO are derived from the multicellular organisms. Examples of invertebrate cells include cells from insects such as Drosophila S2 and Spodoptera Sf9, -1 - as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV1 line, transformed by SV40 (COS-7, ATCC CRL 1651); the human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen. Virol., 36:59 (1977)); hamster chondro ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Nati, Acad. Sci. USA, 77: 4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod., 23: 243-251 (1980)); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and the mouse mammary tumor (MMT 060562, ATCC CCL51). The selection of the appropriate host or host cells is considered to be within the skills in the art. 3. Selection and Use of a Replicable Vector Nucleic acid (eg, cDNA or genomic DNA) encoding a desired PRO can be inserted into a replicable vector for cloning (amplification of DNA) or for expression. Several vectors are publicly available. The vector - - may, for example, be in the form of a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence can be inserted into the vector with a variety of • 5 procedures. In general, the DNA is inserted into an appropriate restriction endonuclease site or sites using techniques known in the art. The vector components in general include, but are not limited to, one or more than one signal sequence, an origin of replication, one or • more marker genes, an enhancer element, a promoter, and a transcription termination sequence. The construction of suitable vectors containing one or more of these components employs standard ligation techniques that are known to a technician with skills.

• The PRO can be produced recombinantly not only directly, but also as a polypeptide fused to a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the sequence of The signal may be a component of the vector, or it may be a part of the DNA encoding the PRO that is inserted into the vector. The signal sequence may be a prokaryotic signal sequence selected from, for example, the phosphatase group alkaline, penicillin, lpp, or heat-stable enterotoxin II leaders. For yeast secretion the signal sequence may be, for example, the yeast invertase leader, the alpha factor leader (which includes the factor leaders th of Sa c ch a romyce s and Kl uyve romyces, the last • described in U.S. Patent No. 5,010,182), or the acid phosphatase leader, the leader of the glucoamylase of C. a l ca b s (EP 362,179 published April 4, 1990), or the signal described in WO 90/13646 published November 15, 1990. In mammalian cell expression, mammalian signal sequences can be used • to direct the secretion of the protein, such as the signal sequences of the polypeptides secreted from the same or related species, as well as viral secretory leaders.

Both the expression and cloning vectors contain a nucleic acid sequence which allows the vector to replicate in one or more selected host cells or hosts. Such sequences are well known for a variety of bacteria, yeasts, and viruses. The origin of the plasmid pBR322 replication is suitable for the • most Gram-negative bacteria, the origin of plasmid 2μ is suitable for yeast, and several viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. 10 Expression and cloning vectors will typically contain a selection gene, also called a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, for example, ampicillin, neomycin, methotrexate or tetracycline, (b) complement differences at uxot rical, or (c) supply critical nutrients not available from the complex medium, for example , the gene that codes for the D-alamine racemase for Ba ci lli.

An example of the selectable markers for mammalian cells are those that allow the identification of competent cells for - take the nucleic acid encoding the PRO, such as DHFR or thymidine kinase. An appropriate host or host cell when wild-type or wild-type DHFR is employed is the CHO cell line deficient • in the DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Nati Acad. Sci. USA, 7_7_: 4216 (1980). A suitable selection gene for use in yeast is the rp 1 gene present in yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (1979); Kingsman et al., Gene, 7: 141 • (1979); Tschemper et al., Gene, 10: 157 (1980)]. The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].

The expression and cloning vectors • usually contain a promoter operably linked to the nucleic acid sequence that encodes the PRO to direct mRNA synthesis. Promoters recognized by a variety of host cells or potential hosts are well known. Promoters suitable for use with prokaryotic hosts include systems β-lactamase and lactose promoters [Chang et al., - - Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters • such as the tac promoter [deBoer et al., Proc. Nati Acad. Sci. USA, 80: 21-25 (1983)]. Promoters for use in bacterial systems will also contain a Shine-Delgarno (S.D.) sequence operably linked to the DNA encoding the PRO. • Examples of suitable promoter sequences for use with yeast hosts include the promoters for 3-fos fogl icera kinase [Hitzeman et al., J. Biol. Chem. , 255: 2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Res. , 7: 149 (1968)]; "Holland, Biochemistry, 17: 4900 (1978)], such as the • enolase, dehydrogenase of g 1 i ce ra ldeh ído- 3-phosphate, hexokinase, want rboxi sa of pyruvate, f o f o f o rt i n sa ns, glucose-6-fat fat isomerase, 3-phosphate, 1-melra-3, pyruvate kinase, thiosephosphate isomerase, phosphoglucose isomerase, and glucokinase mutase.

Other yeast promoters, which are - - inducible promoters which have the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, • isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, melatonin, dehydrogenase of glyraldehyde do-3-phosphate, and enzymes responsible for the utilization of maltose and galactose. The 10 suitable vectors and promoters to be used in the • yeast expression are further described in EP 73, 657.

The transcription of the PRO polypeptide of the vectors in mammalian host or host cells is controlled, for example, by promoters obtained from the genomes of the viruses • such as polyoma virus, fowlpox virus (UK 2,211,504 published July 5, 1989), adenoviruses (such as Adenovirus 2), bovine papillomavirus, poultry sarcoma virus, cytomegalovirus, a retrovirus, hepatitis B virus and Simian Virus 40 (SV40), of the heterologous mammalian promoters, eg, the promoter of actin or an immunoglobulin promoter, and of the heat shock promoters, provided that such promoters are compatible with the systems of host cells or hosts.

• The transcription of a DNA encoding the PRO by higher eukaryotes can be increased by inserting an enhancer sequence into the vector. Enhancers are DNA-active elements, usually roughly 10 to 300 bp, which act on a promoter to increase their • transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, a-f et oprot eí na, insulin Typically, however, an enhancer will be used. a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the enhancer • early promoter of cytomegalovirus, the polyoma enhancer on the late side of the origin of replication, and adenovirus enhancers. The enhancer can be spliced into the vector at the 5 'or 3' position to the PRO coding sequence, but preferably located at a 5 'site of the promoter. 25 - Expression vectors used in host cells or eukaryotic hosts (yeasts, fungi, insects, plants, animals, humans, or nucleated cells of other multicellular organisms) will also contain sequences necessary for the termination of transcription and for the stabilization of the MRNA. Such sequences are commonly available from the 5 'and occasionally 3' untranslated regions of the cDNAs or DNAs viral or eukaryotic. These regions contain • segments of nucleotides transcribed as polyadeny fragments in the untranslated portion of the mRNA encoding the PRO.

Still other methods, vectors, and host cells or hosts suitable for adaptation to PRO synthesis in cell cultures of • Recombinant vertebrates are described in Gething et al., Nature, 293: 620-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058. 4. Detection of the Amplification / Expression Gene The amplification and / or expression of the gene can be measured in a sample directly, by example, by staining or Southern blotting - conventional, stained or Northern blotting to quantify mRNA transcription [Thomas, Proc. Nati Acad. Sci. USA, 77: 5201-5205 (1980)], spot spotting (DNA analysis), or • Hybridization i n s i t u, using an appropriately labeled probe, are based on the sequences provided herein. Alternatively, the antibodies can be used, which recognize specific double or duplex, that include DNA duplex, RNA duplex, and duplex • of DNA-RNA or double or DNA-protein duplex hybrids. The antibodies in turn can be labeled and assays can be carried out where the duplex or double binds to the surface, from so that after the formation of the duplex on the surface, the presence of the antibody bound to the duplex or double can be detected. • The expression of the gene, alternatively, can be measured by immunological methods, such as spotting immunohistochems of cells or sections of tissues and assays of cell cultures or body fluids, to directly quantify the expression of the gene product. Antibodies useful for staining and / or immunohistochemical assay of sample fluids can be either monoclonal or polyclonal, and can be prepared in any mammal. Conveniently, the antibodies can be prepared against a • PRO polypeptide of native sequence or against a synthetic peptide based on the DNA sequences provided herein or against the exogenous sequence fused to a PRO polypeptide DNA and encoding an epitope of the specific antibody. 10 • 5. Purification of the Polypeptide The forms of the PRO can be recovered from the culture medium or from the lysates of host cells or hosts. If the membrane bound, it can be released from the membrane using a suitable detergent solution (eg, Triton-X 100) or by enzymatic cleavage. The cells used • in the expression of the PRO can be broken by various physical or chemical means, such as freezing cyclization, sonication, mechanical disruption, or cell lysate agents.

It may be desired to purify the PRO from recombinant cell proteins or polypeptides.

The following procedures are exemplary of the appropriate purification procedures: by fractionation on an ion exchange column; precipitation with ethanol; Phase HPLC • inverse; chromatography on silica or on a cation exchange resin such as DEAE; chromatofencation; SDS-PAGE; precipitation with ammonium sulfate; gel filtration using, for example, Sephadex G-75; Sepharose columns of protein A to remove contaminants such as IgG; and chelating metal columns to link • PRO labeled epitope-tagged forms. Various methods of protein purification can be employed and such methods are known in the art and described for example in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Pur i ficat ion: Principies and Practice, Springer-Verlag, New York (1982). The purification stages • selected will depend, for example, on the nature of the purification processes used and of the particular PRO produced.

E. Uses for the PRO The nucleotide sequences (or their complements) that encode the PRO have several applications in the field of molecular biology, - - which include uses as hybridization probes, in the mapping of chromosomes and genes, and in the generation of RNA and antisense DNA. PRO nucleic acid will also be useful for the preparation of PRO polypeptides by the recombinant techniques described herein.

The PRO gene of the full-length native sequence, or portions thereof, can be used as hybridization probes for a cDNA library to isolate the full-length PRO cDNA or to isolate yet other cDNAs (e.g. those naturally occurring variants encoding the PRO or PRO of 15 other species) having a desired sequence identity to the native PRO sequence, described herein. Optional lime canvas, the wavelength • will be from about 20 to about 50 bases. The hybridization probes can be derived from at least partially the new regions of the nucleotide sequence, native, full length wherein those regions can be determined without undue experimentation or from genomic sequences including promoters, enhancer elements and peepers of the PRO . s, * imi tiwsggt,, ^ _ ^ »~ -.-. 'go -v--. «-. - «« .., .j-oe. - - of native sequence. By way of example, a selection or separation method will comprise isolating the coding region of the PRO gene that uses the known DNA sequence to synthesize a probe • 5 selected from approximately 40 bases. Hybridization probes can be labeled by a variety of labels, which include radionucleotides such as 32P or 35S, or enzymatic labels such as alkaline phosphatase coupled to the probe via 'avidin / biotin coupling systems. The probes • Labeling has a sequence complementary to that of the PRO gene of the present invention and can be used to select libraries of human cDNA, genomic DNA or mRNA to determine that members of such libraries will hybridize the probe. Hybridization techniques are described in more detail in the following Examples. • Any EST sequence described in the present application can be used similarly as probes, using the methods described herein.

Other useful fragments of the PRO nucleic acids include oligonucleotides-sense or antisense comprising the single-stranded nucleic acid sequence (either RNA or DNA) capable of binding to the mRNA of the target PRO (sense) or sequences of PRO DNA (ant i felt). The sense and antisense oligonucleotides, according to the present invention, comprise a fragment of the coding region of the PRO DNA. Such fragment generally comprises at least about 14 nucleotides, preferably about 14 • at 30 nucleotides. The ability to derive an oligonucleotide sense or antisense, based on a DNA sequence encoding a given protein is described, for example, in Stein and Cohen (Cancer Res. 48: 2659, 1988) and van der Krol et al. (BioTechniques 6: 958, 1988).

• The binding of the 1 or sense or antisense igonucleotides to the nucleic acid sequences The objective results in the formation of doubles or duplexes that block the transcription or translation of the target sequence by one of several means, including improved degradation of doubles or duplexes, premature termination of the transcription or translation, or by other means.

,, X & ¿¿¿&<;.,. J!? &(, ..

- - Antisense oligonucleotides can therefore be used to block the expression of PRO proteins. Sense or antisense oligonucleotides further comprise the oligonucleotides • > having modified sugar phosphodiester backbones (other than sugar bonds, such as those described in WO 91/06629) and wherein such sugar bonds are resistant to endogenous nucleases. Such oligonucleotides with resistant sugar bonds • are stable vi n (that is, capable of resisting enzymatic degradation), but retain the sequence specificity to be able to bind to the target nucleotide sequences.

Other examples of sense and antisense oligonucleotides include those • oligonucleotides that are covalently linked to the organic portions, such as those described in WO 90/10048, and other portions that increase the affinity of the oligonucleotide for a target nucleic acid sequence, such as pol i - (L-1 i s ina). In addition, intercalation agents, such as ellipticine, and alkylating agents or metal complexes can be attached to the sense and antisense oligonucleotides to modify the binding specificities of the sense or antisense oligonucleotide to the target nucleotide sequence. • The sense and antisense oligonucleotides can be introduced into a cell containing the target nucleic acid sequence by any method of gene transfer, which includes, for example, transfection of DNA mediated with CaPÜ, electroporation, or using gene transfer vectors such as the Epstein-Barr virus. In a preferred procedure, the sense and antisense oligonucleotide is inserted in a suitable retroviral vector. A cell containing the target nucleic acid sequence is contacted with the recombinant retroviral vector, either in vivo or ex vivo. Suitable retroviral vectors include, but are not limited to, those derived from the murine retrovirus M-MuLV, N2 (a retrovirus derived from MuLV), or the double copy vectors, designated DCT5A, DCT5B and DCT5C (see WO 90/13641).

The sense and antisense oligonucleotides - 1 - can also be introduced into a cell containing the target nucleotide sequence by the formation of a conjugate with a ligand binding molecule, as described in • WO 91/04753. Suitable ligand binding molecules, include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to surface receptors. cell Preferably, the conjugation of the • Ligand binding molecule does not substantially interfere with the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, or block the entry of the ligand. sense or antisense oligonucleotide or its conjugated version in the cell.

• Alternatively, a sense or antisense oligonucleotide can be introduced into a cell that contains the target nucleic acid sequence by the formation of an oligonucleotide complex, as described in WO 90/10448. The oligonucleotide oligo-sense or antisense complex preferably dissociates inside the cell by an endogenous lipase.

The probes can also be used in PCR techniques to generate a set of sequences for the identification of coding sequences • PRO related closely.

The nucleotide sequences that encode a PRO can also be used to build hybridization probes for mapping of genes that code that PRO and for the analysis • Genetic of individuals with genetic diseases. The nucleotide sequences provided here can map to a chromosome and specific regions of a chromosome using techniques Known, such as hybridization i n s i t u, binding analysis against known chromosomal markers, and selection of hybridization with • libraries.

When the coding sequences for the PRO encodes a protein which binds to another protein (for example, where the PRO is a receptor), the PRO can be used in assays to identify other proteins or molecules involved in the link interaction. By such methods, the inhibitors of receptor / ligand linkage interaction can be identified. The proteins involved in such binding interactions can also be used to screen for 5 peptides or small molecule inhibitors or agonists of the binding interaction. Also, the PRO receptor can be used to isolate the ligand or ligands correlated. Selection trials can be designed to find leading compounds or guides that mimic the activity • biological of a native PRO polypeptide or a receptor for the PRO. Such selection trials will include assays capable of highly specific selection of chemical libraries, making them Particularly suitable for identifying candidate small molecule drugs. The small molecules contemplated include compounds • synthetic organic or inorganic. The tests can be carried out in a variety of formats, which include protein-protein binding assays, biochemical screening or screening assays, immunoassays and cell-based assays, which are well characterized in the art.

The nucleic acids encoding a PRO or - its modified forms can also be used to generate either transgenic animals or "tagged" animals which, in turn, are useful in the • development and selection of useful reagents 5 therapeutically. A transgenic animal (e.g., a rat or mouse) is an animal that has cells that contain a transgene, said transgene was introduced into the animal or an ancestor of the animal in a prenatal stage, e.g., a stage embryonic. A transgene is a DNA that is integrated • in the genome of a cell from which a transgenic animal develops. In one embodiment, the cDNA encoding a PRO can be used to clone the genomic DNA encoding the PRO of According to the established techniques and the genomic sequences used to generate the transgenic animals that contain the cells that express the DNA encoding the PRO. Methods for generating transgenic animals, particularly animals such as mice or rats have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009. Typically, particular cells will be the target for incorporation of the PRO transgene with specific tissue enhancers. Transgenic animals that include a copy of a transgene that encodes a PRO introduced into a germ line of the animal in an embryonic stage can be used to examine the effect • 5 of the increased expression of the DNA encoding the PRO. Such animals can be used as test animals for reagents to confer protection from, for example, the pathological conditions associated with their overexpression. According to this facet of the invention, an animal is treated with the • reactive and the incidence of the pathological condition is reduced, compared with untreated animals carrying the transgene, which indicates a potential therapeutic intervention for the condition pathological.

Alternatively, non-human counterparts • of the PRO can be used to build a "marked" animal from the PRO that has a defective gene or altered that encodes the PRO as a result of the homologous recombination between the endogenous gene encoding the PRO and the altered genomic DNA encoding the PRO introduced into an embryonic stem cell of the animal. For example, the cDNA that encodes a PRO can be used to clone the genomic DNA encoding the PRO according to established techniques. A portion of the genomic DNA encoding a PRO can be deleted or replaced with another gene, such as a gene encoding a • 5 selectable marker that can be used to monitor the integration. Typically, several kilobases of unaltered flanking DNA (both at the 5 'and 3' ends) are included in the vector [see for example, Thomas and Capecchi, Cell, 51: 503 (1987) for a description of vectors of • homologous recombination]. The vector is introduced into a base cell or embryonic stem cell line (e.g., by electroporation) and the cells in which the introduced DNA is selected are selected. homology recombined with endogenous DNA [see for example, Li et al., Cell, 69: 915 (1992)]. The selected cells are then injected in a • blastocyst of an animal (for example, a mouse or rat) to form aggregation chimeras [see example, Bradley, in Te ra t o ca rc m om a n d Embryon i c S t em Ce l l s: A Pra c i ca l Approa ch, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then be implanted into a suitable pseudopregnant female animal and the embryo is to finish to create a "marked" animal. When the progeny are harvested, the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed more animals in which all the • animal cells will contain the homologously recombined DNA. Marked animals can be characterized, for example, by their ability to defend against certain pathological conditions and by developing pathological conditions due to the absence of the PRO polypeptide. • The nucleic acid encoding the PRO polypeptides can also be used in gene therapy. In the applications of therapy In genetics, the gene is introduced into the cells to achieve the optimal synthesis of an effective therapeutic gene product, for example for replacement • of a defective gene. "Genetic therapy" includes both conventional gene therapy where achieves a permanent effect by a simple treatment, and the administration of the genetic therapeutic agents, involving a single administration or the repeated administration of the therapeutically effective mRNA or DNA. RNAs or DNA Antisense can be used as agents - - Therapeutics to block the expression of certain genes i n vi vo. It has already been shown that short antisense oligonucleotides can be imported into cells where they act as P 5 inhibitors despite their low intracellular concentrations caused by their restricted absorption by the cell membrane. (Zamecnik et al., Proc. Nati, Acad. Sci. USA 83: 4143-4146 [1986]). The oligonucleotides can be modified to improve their absorption, for example, • substituting its negatively charged phosphodiester groups for non-charged groups.

There are a variety of techniques available to introduce nucleic acids into viable cells. The techniques vary depending on whether the nucleic acid is transferred to the cells • cultivated in the vine, or in the cells of the intended host. The right techniques for Nucleic acid transfer in mammalian cells includes the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the method of precipitation with calcium phosphate, etc. The techniques of Transfer of currently preferred genes include transfection with viral vectors (typically retroviral) and viral coated liposome-protein transfection (Dzau et al., Trends in Biotechnology 11, 205-210 [1993]). In some situations it is desirable to provide the nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, • etc. When liposomes are employed, proteins that bind to a cell surface membrane protein associated with endocytosis can be used to target and / or facilitate Absorption, for example, the capsid proteins or fragments of the same tropics for a particular cell type, the antibodies for the • proteins that undergo internalization in cycles, the proteins that point to the location intracellular and improve the intracellular half-life. The technique of endocytosis mediated with the receptor is described, for example, by Wu et al., J. Biol. Chem. 262, 4429-4432 (1987); and Wagner et al., Proc. Nati Acad. Sci. USA 87, 3410-3414 (1990). For review of gene labeling and gene therapy protocols see Anderson et al., Science 256, 808-813 (1992).

The PRO polypeptides described herein • They can also be used as molecular weight markers for the purposes of electrofor I s of the protein.

The nucleic acid molecules encoding the PRO polypeptides or fragments thereof • described herein are useful for the identification of chromosomes. In this regard, there is a current need to identify new chromosome markers, since only some chromosome labeling reagents, based on current sequence data, are currently available. Each PRO nucleic acid molecule • of the present invention, it can be used as a chromosome marker. The PRO polypeptides and the nucleic acid molecules of the present invention can also be used to classify the type of tissue, wherein the PRO polypeptides of the present invention are can express differently in one tissue when compared to another. The nucleic acid molecules of the PRO will be used to generate probes for PCR, Northern analysis, Southern analysis and Western analysis. f The PRO polypeptides described herein are also used as therapeutic agents. The PRO polypeptides of the present invention can be formed according to the known methods for preparing the pharmaceutically useful compositions, whereby the PCR product thereof is combined in a mixture with the pharmaceutically acceptable carrier vehicle. Therapeutic formulations are prepared to be stored by mixing The active ingredient having the desired degree of purity with physiologically acceptable carriers, excipients or stabilizers P (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of formulations lyophilized or aqueous solutions. Acceptable carriers, excipients or stabilizers are not toxic to containers at the dosages and concentrations employed, and include buffers such as phosphate, citrate and other organic acids; antioxidants that include ascorbic acid; the low molecular weight polypeptides (less than about 10 residues); proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as • polyvinyl pyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; the counterions that form • salts such as sodium; and / or non-ionic surfactants such as TWEEN ™, PLURONICS ™ or PEG.

The formulations that will be used i n vi must be sterile. This is easily completed by filtering through the sterile filtration membranes, before or after • of 1 io f 11 i ation and reconstitution.

The therapeutic compositions herein are generally placed in a container having a sterile access port, for example, a bag or vial of intravenous solution having a pierceable stopper by means of a needle for injection. hypodermic.

- - The route of administration is in accordance with known methods, for example, injection or infusion by intravenous routes, int r aper i tones, int racerebra les, intramuscular, infra ocular, int rearterial or int relesional, topical administration or by means of delivery systems sustained The dosages and concentrations of desired drugs of the pharmaceutical compositions • of the present invention may vary depending on the particular use displayed. The determination of the appropriate dosage or route of administration is well within the skills of a technician ordinary. Animal experiments provide reliable guidance for the determination of effective doses for human therapy. He • Escalation between species of effective doses can be done following the principles determined by Mordenti, J. and Chappell, W. "The use of interspecies scaling in toxicokinetics" Toxicokinetics and New Drug Development, Yacobi et al., Eds., Pergamon Press, New York 1989, p. 42-96.

When the administration is administered of a PRO polypeptide or agonist or antagonist thereof, the amounts of normal dosages may vary from about 10 ng / kg to 100 mg / kg of the body weight of the mammal or more per • day, preferably about 1 μg / kg / day up to 10 mg / kg / day, depending on the route of administration. The guide for the dosage and particular methods of supply are provided in the literature; see, for example, Patents North American Nos. 4,657,760; 5,206,344; or • 5,225,212. It is anticipated that the different formulations will be effective for different treatment compounds and different conditions, than that of the administration objective. to the organ or tissue, for example, may need the supply in a different way from that to a different tissue or organ. • Where the administration of sustained release of a PRO in a formulation with release characteristics suitable for the treatment of any condition or disorder requiring the administration of the PRO polypeptide is desired, the mi croencapsution of the PRO polypeptide is contemplated. 25 Micro-encapsulation of recombinant proteins -... ^ • -.- * «> • fea-aa-ei ».., and j -. ^ ... ..« - na ».. - * .- - - for sustained release has been successfully performed with human growth hormone (rhGB), interferon- (rhIFN-), interleukin-2, and MN rgpl20. Johnson et al., Nat. Med., 2: 795-799 • (nineteen ninety six); Yasuda, Biomed. Ther., 27: 1221-1223 (1993); Hora et al., Bio / Technology, 8: 755-758 (1990); Cleland, "Design and Production of Single Immunization Vaccines using Polylactide Polyglycolide Microsphere Systems", in Vaccine Design: The Subunit and Adjuvant Approach, Powell and • Newman, eds, (Plenum Press: New York, 1995), pp. 439-462; WO 97/03692, WO 96/40072, WO 96/07399; and U.S. Patent No. 5,654,010.

Sustained-release formulations of these proteins were developed using the polymer of acidic 11-l acidic-cog 1 -colic acid (PLGA) • due to its biocompatibility and a wide range of properties b i odeg radabl es. The products of The degradation of PLGA, lactic and glycolic acids, can be rapidly eliminated within the human body. In addition, the degradability of this polymer can be adjusted from months to years depending on its weight and molecular composition.

Lewis, "Controlled release of bioactive agents from - - lact ide / gl icol ide polymer", in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990) , pp. 1-41 This invention encompasses methods of selecting compounds to identify those that mimic the PRO polypeptide (agonists) or avoid the effect of the PRO polypeptide (antagonists). The selection trials for drug candidates • antagonists are designed to identify compounds that bind or complex with the PRO polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. Such selection trials will include treatable trials • for the high-throughput selection of chemical libraries, making them particularly suitable for identifying candidates for small molecule drugs.

Trials can be conducted in a variety of formats, including trials of protein-protein linkage, screening assays - biochemistry, immunoassays, cell-based assays, which are well characterized in the art.

• All assays for antagonists are common because they require contacting the drug candidate with a PRO polypeptide encoded by a nucleic acid identified in the present ba and conditions and for a sufficient time to allow these two components • interact.

In the erilace assays, the interaction is the bond and the complex formed can be isolated or detected in the reaction mixture. In a particular embodiment, the PRO polypeptide encoded by the gene identified herein or the candidate of the • drug is immobilized on a solid phase, for example, on a microtiter plate, by the covalent or non-covalent binding. The non-covalent binding is usually completed by coating the solid surface with a solution of the PRO polypeptide and drying it. Alternatively, an immobilized antibody, for example, a monoclonal antibody, specific for the PRO polypeptide that is immobilized - * aa «^ a ^ £. . * s ¿e < !,,: * .. * ^% e! & «.- ^ -...'- - * = fe¿. ~ .. - - can be used to anchor it to a solid surface. The test is performed by adding the immobilized component, which can be labeled by a detectable label, to the immobilized component, • 5 for example, the coated surface containing the anchored component. When the reaction is completed, the components that did not react are removed, for example, by washing, and the complexes anchored on the surface are detected solid. When the component originally did not • immobilized carries a detectable label, detection of the immobilized label on the surface indicates that the complex occurred. When the originally non-immobilized component carries a By labeling, the complex can be detected, for example, by using a labeled antibody that binds specifically to the immobilized complex. • If the candidate compound interacts with but does not bind to a particular PRO polypeptide encoded by a gene identified herein, its interaction with that polypeptide can be assayed by well-known methods to detect proton and proton interactions. Such assays include traditional methods, such as, for example, cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions can be impaired using the genetic system based on yeasts, described by Fields et al. (Fields and Song, Nature (London), 340: 245-246 (1989); Chien et al., Proc. Nati, Acad. Sci. USA, 88: 9578-9582 (1991)) as described by Chevray and Nathans, Proc. Nati Acad.

Sci. USA, 89: 5789-5793 (1991). Many activators • Transcriptional agents, such as yeast GAL4, consist of two physically discrete modular domains, one that acts as the domain that binds to DNA, and the other that functions as the transcription-activation domain. The yeast expression system described in previous publications (generally referred to as the "system • double hybrid "), takes advantage of this property, and employs two hybrid proteins, one in which the The target protein is fused to the DNA binding domain of GAL4, and another, in which the candidate activation proteins are fused to the activation domain. The expression of a GAL1-lacZ reporter gene under the control of an activated promoter with GAL4 depends on the reconstruction of the activity - of the GAL4 via the protein-protein interaction. The colonies containing the interacting polypeptides are detected with a chromogenic substrate for β-galactose-idasa. A complete 5 (MATCHMAKER ™) kit for identifying protein-protein interactions between two proteins using the two-hybrid technique is commercially available from Clontech. The system can also be extended to the protein domains of the map, 10 involved in the interactions of the protein • specific as well as the precise amino acid residues that are crucial for these interactions.

The compounds that interfere with the interaction of a gene encoding a polypeptide PRO identified herein and other intra- or extracellular components can be tested as follows: • usually a reaction mixture containing the product of the gene and the intracellular or extracellular component is prepared under conditions and for a time that allows interaction and binding of the two products. To test the ability of a candidate compound to inhibit binding, the reaction is activated in the absence and in the presence of the test compound. In addition, a - -placebo can be added to the third reaction mixture, to serve as a positive control. The binding (complex formation) between the test compound and the intra- or extracellular compound present in the mixture is monitored as described above. The formation of a complex in the control reaction (s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.

For an assay for the antagonists, the PRO polypeptide can be added to a cell together with the compound to be selected for a particular activity and the ability of the compound to inhibit the activity of interest in the presence of the PRO polypeptide indicates that the compound is an antagonist of the PRO polypeptide. Alternatively, antagonists can be detected by combining the PRO polypeptide and a potential antagonist with membrane bound PRO polypeptide receptors or recombinant receptors under conditions appropriate for a competitive inhibition assay. The PRO polypeptide can be labeled, such as by means of radioactivity, such that the number of PRO polypeptide molecules, linked to the receptor, can be used to determine the effectiveness of the potential antagonist. The gene that codes for the receptor can be identified PP 5 by numerous methods known to those skilled in the art, for example, separation by screening of the ligand and FACS classification. Coligan et al., Current Protocols, Immun., 1 (2): Chapter 5 (1991). Preferably, the cloning of The expression is used where the polyadenitic RNA is • prepared from a cell sensitive to the PRO polypeptide and a cDNA library created from this RNA is divided into sets and used to transfer COS or other cells cells that are not sensitive to the PRO polypeptide. Transfected cells that are grown on glass slides are exposed to the polypeptide • PRO labeled. The PRO polypeptide can be labeled by a variety of means that include the iodization or inclusion of a recognition site for a site-specific kinase protein. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive sets are identified and the subsets are prepared and re-transfected using a process of interactive sub-set and re-selection, which eventually produces a single clone that encodes the putative receptor.

• As an alternative method for receptor identification, the tagged PRO polypeptide can be linked by photoaffinity to the membrane or cell extract preparations expressing the receptor molecule. The material Reticulate is resolved by PAGE and exposed to • an X-ray film. The tagged complex containing the receptor can be removed, resolved into peptide fragments, and subjected to protein mis-sequencing. The sequence of amino acids obtained from the myo-sequencing could be used to design a set of degenerate oligonucleotide probes to select a • cDNA library that identifies the gene that encodes the putative receptor. In another assay for antagonists, mammalian cells or a membrane preparation expressing the receptor that would be incubated with a PRO polypeptide labeled in the presence of the candidate compound. The ability of the compound to improve or block this interaction could then be measured.

The most specific examples of • Potential antagonists include an oligonucleotide that binds to immunoglobulin fusions with the PRO polypeptide, and, in particular, the antibodies include, without limitation, poly- and monoclonal antibodies and fragments of antibodies, the single chain antibodies, the • anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments. Alternatively, A potential antagonist may be a closely related protein, for example, a mutated form of the PRO polypeptide that recognizes the receptor • but which has no effect, therefore competitively inhibits the action of the PRO polypeptide. 20 Another potential polypeptide antagonist PRO is an RNA or antisense DNA construct prepared using antisense technology, where, for example, an RNA or DNA molecule Antisense acts to directly block the translation of the mRNA by hybridizing to the target mRNA and preventing translation of the protein. The antisense technology can be used to control the expression of the gene through the formation of triple helix or of the antisense DNA or RNA, both methods are based on the binding of a polynucleotide to RNA or RNA. For example, the 5 'coding portion of the polynucleotide sequence, which encodes the mature PRO polypeptides herein, is used to design an antisense RNA oligonucleotide • or from approximately 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to the region of the gene involved in transcription (triple helix - see Lee et al., Nucí. Acids Res. , 6: 3073 (1979); Cooney et al., Science, 241: 456 (1988); Dervan et al., Science, 251: 1360 (1991)), which prevents transcription and • the production of the PRO polypeptide. The antisense RNA oligonucleotide hybridizes to mRNA in vi and blocks the translation of the mRNA molecule into the PRO polypeptide (antisense - Okano, Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988 The oligonucleotides The above described can be delivered to cells in such a manner that the antisense RNA or DNA can be expressed in order to inhibit the production of the PRO polypeptide. When antisense DNA is used, the • Oligodeoxyribonucleotides derived from the translation-initiation site, for example, between approximately positions -10 and +10 of the nucleotide sequence of the target gene.

Potential antagonists include • small molecules that bind to the active site, the receptor binding site, or the growth factor or other relevant binding site of the PRO polypeptide, thereby blocking the normal biological activity of the PRO polypeptide. Examples of small molecules include, but are not limited to, small peptides or molecules • similar to peptides, preferably soluble peptides, and synthetic, organic or inorganic no pept id id 1 i cos.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The ribozymes act through the specific hybridization of the sequence to the RNA - -'-. -j < s. < r a *. . ^ - ^^ _ g} Ma-b-f ?? C- > - »j-ii > .. i *. aj ", d i." - complementary objective, followed by endonucleolytic cleavage. The specific ribozyme cleavage sites within the potential RNA target can be identified by known techniques.

• For further details see, for example, Rossi, Current Biology, 4: 469-471 (1994), and PCT publication No. WO 97/33551 (published September 18, 1997).

The nucleic acid molecules in the • triple-helical formation used to inhibit transcription should be single-strand or composed of deoxynucleotides. The base composition of these oligonucleotides is designated in such a way that triple helix formation is promoted via Hoogsteen base pairing rules, which generally requires elasticities • considerable purines or pyrimidines in a single strand of a duplex. For more details see, for For example, PCT publication No. WO 97/33551, supra.

These small molecules can be identified by any one or more of the selection tests described above and / or by any other selection technique well known to those skilled in the art.

- PR0189 can be used in tests with W01A6.1 of C. elegans, phos fodie st erases, transporters and proteins that are linked to the P fatty acids, to determine the relative activities of PR0189 against these proteins. The results can be applied accordingly.

F. Anti-PRQ 10 Antibodies The present invention further provides anti-PRO antibodies. Exemplary antibodies include clonal, monoclonal, humanized, bi-specific, and heteroconjugated polyclonal antibodies. 1. Polyclonal Antibodies Anti-PRO antibodies may comprise antibodies to the antibodies. Methods for preparing polyclonal antibodies are well known to those skilled in the art. The Polyclonal antibodies can be generated in mammals, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and / or will be injected into the mammal by injections subcutaneous or multiple ra n ity. The agent immunizing may include the PRO polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a known protein that will be immunogenic in the mammal that tp5 is going to be immunized. Examples of such immunogenic proteins include but are not limited to key limpet hemocyanin, serum albumin, bovine t-iroglobulin, and soybean trypsin inhibitor. Examples of adjuvants that can be employees include Freund's complete adjuvant and • the adjuvant of MPL-TDM (monophos for i 1 Lipido A, dimer inomi tail of synthetic trehalose). The immunization protocol can be selected by someone skilled in the art without undue experimentation. 2. Monoclonal Antibodies • Anti-PRO antibodies can alternatively be monoclonal antibodies. The Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohier and Milstein, Nature, 256: 495 (1975). In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunizes with an immunizing agent to ^^^ generate lymphocytes that produce or are capable of producing antibodies that bind specifically to the immunizing agent. Alternatively, the lymphocytes can be immunized i n vi t ro. • The immunizing agent will typically include the PRO polypeptide of interest or a fusion protein thereof. In general, either peripheral blood lymphocytes ("PBLs") are used if cells are desired of human origin, or cells of the spleen or cells of the • lymphatic node if sources of non-human mammals are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusion agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principies and Practice, Academic Press, (1986) pp. 59-103]. The immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells from rodent, bovine and of human origin. Usually mouse or rat myeloma cell lines are employed. Hybridoma cells can be cultured in a culture medium that preferably contains one or more substances that inhibit growth or survival of immortalized cells, no -HÉ-Ba-BriÜ - M-H - - merged. For example, if the parental cells lack the hypoxanthine guanine phosphoribosyl transferase of the enzyme (HGPRT or HPRT), the culture medium for the hybridomas will typically include the • hypoxanthine, aminopterin, and thymidine ("HAT medium"), whose substances prevent the growth of cells deficient in HGPRT.

Immortal cell lines raised Preferred are those that merge • efficiently, and support expressions of stable high levels of the antibody by the cells that produce selected antibodies, and are sensitive to a medium such as the HAT medium. The The most preferred immortalized cell lines are the murine myeloma lines, which can be obtained, for example, from the Salk Institute Cell • Distribution Center, San Diego, California and the American Type Culture Collection, Manassas Virginia.

Also described are the mouse-human heteromyeloma cell lines and human myeloma for the production of human monoclonal antibodies [Kozbor, J. Immunol. , 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., - - New Yo r k, (1 98 7) pp. 5 1 - 63] The culture medium in which the hybridoma cells are grown can be assayed for • presence of monoclonal antibodies directed against the PRO. Preferably, the binding specificity of the monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by a binding assay m vi t ro, such as the radioimmunoassay (RIA) or the enzyme-linked immunosorbent assay (ELISA). Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., 107: 220 (1980).

After the desired hybridoma cells are identified, the clones can be subcloned by limiting dilution procedures and growth by standard methods [Goding, supra]. The culture medium suitable for this purpose includes, for example, Eagle Medium Modified with Dulbecco and RPMI-1640 medium.

Alternatively, the hybridoma cells can be grown as ascites in a mammal.

The monoclonal antibodies secreted by the subclones can be isolated or purified from the culture medium or the ascites fluid by conventional immunoglobulin purification methods such as, for example, chromatography of A-Sepharose, hydr oxi lapa tita, gel electrophoresis, dialysis, or affinity chromatography. • Monoclonal antibodies can also be made by recombinant DNA methods, such as those described in the patent.

North American No. 4,816,567. The DNA encoding the monoclonal antibodies of the invention can be easily isolated and sequenced using • conventional procedures (for example, using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA can be placed in the expression vectors, which are then transfected - 14 - into host cells such as simian COS cells, the - = Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin proteins, • 5 to obtain the synthesis of the monoclonal antibodies in the host cells or recombinant hosts. DNA can also be modified, for example, by substituting the coding sequence for the domains constants of heavy and light human chains in • Place of homologous murine sequences [U.S. Patent No. 4,816,467; Morrison et al., Supra] or by covalent attachment to the whole or part of the immunoglobulin coding sequence. of the coding sequence for a non-immunoglobulin polypeptide. Such a polypeptide which is not of unog 1 obu 11 na can be replaced by • constant domains of an antibody of the invention, or it can be replaced by the domains variables of a combination site of the antigen of an antibody of the invention to create a chimeric bivalent antibody.

The antibodies can be monovalent antibodies. The methods to prepare antibodies *. * -vA.-üfc-. ,? - - monovalent are well known in the art. For example, one method involves the recombinant expression of modified heavy chains and immunoglobulin light chains. The heavy chain • is truncated generally at any point in the Fc region to prevent cross-linking or cross-linking of the heavy chain. Alternatively, the relevant cysteine residues are replaced with another amino acid residue or are eliminated for avoid cross linking. • The i n vi t ro methods are also suitable for the preparation of monovalent antibodies. The digestion of antibodies produces fragments of In particular, Fab fragments, which can be supplemented using routine techniques known in the art. • 3. Human and Humanized Antibodies The anti-PRO antibodies of the invention can further comprise humanized antibodies or antibodies of humans. Humanized forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, chains of immunoglobulins or fragments thereof (such as EHf-M-fMM "i - - Fv, Fab, Fab ', F (ab') 2 or other antigen binding subsequences of the antibodies) which contain the minimal sequence derived from the non-human immunoglobulin. Antibodies • Humanized ones include human immunoglobulins (recipient antibody) in which the residues of a complementary determinant region (CDR) of the container are replaced by residues of a CDR of a non-human species (donor antibody) such as the mouse, rat or rabbit that have the specificity, • affinity and capacity desired. In some cases, the residues of the Fv structure of the human immunoglobulin are replaced by the corresponding non-human residues. The humanized antibodies may also comprise residues that are found neither in the recipient antibody nor in the imported CDR nor in the sequences of the structure.

F In general, the humanized antibody will substantially comprise all or at least one, and typically two, variable domains, in which all or sub-antrally all the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions of a human immunoglobulin consensus sequence. He Humanized antibody optimally will comprise The most important is a portion of a constant region of immunoglobulin (Fc), typically that of an immunoglobulin constant region (Fc), typically that of an immunoglobulin constant region (Fc). a human immunoglobulin [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323- P 5 329 (1988); and Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992)].

Methods for the humanization of non-human antibodies are well known in the art. technique. Generally, a humanized antibody • has one or more amino acid residues introduced therein from a source that is non-human. These non-human amino acid residues are often referred to as "imported" residues, which are typically take an "imported" variable domain. The humanization can be done essentially following the method of Winter and • collaborators [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-329 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)], replacing the CDR or CDRs sequences of the rodent with the corresponding sequences of a human antibody. According to this, such "humanized" antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein % fei - ^ _ a & ..- ..

- - Substantially less than one human variable domain, intact, has been replaced by the corresponding sequence of a non-human species. In practice, humanized antibodies are • typically human antibodies in which some CDR residues and possibly some FR residues are replaced by residues from analogous sites in rodent antibodies.

Human antibodies can also be • produce using various techniques known in the art, including the phage display libraries [Hoogenboom and Winter, J. Mol. Biol. , 227: 381 (1991); Marks et al., J. Mol. Biol. , 222: 581 (1991)]. The techniques of Cole et al., And Boerner et al. Are also available for preparing human monoclonal antibodies [Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol. , 147 (1): 86-95 (1991)]. Similarly, human antibodies can be made by introducing the human immunoglobulin site in the transgenic animals, for example, mice in which the endogenous immunoglobulin genes have been inactivated partially or completely. During the challenge, he is - - observed the production of human antibodies, which closely resembles that observed in humans in all estimates, including the restructuring of genes, assembly, and repertoire of antibodies f. This scope is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al., Bio / Technology 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368, f 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995). 4. Biespecific Antibodies The bispecific antibodies are monoclonal antibodies, humanized or preferably human, which have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for the PRO, the other is one for any other antigen, and preferably for a cell surface protein or receptor or receptor subunit. 25 - - Methods for preparing bicaseptic antibodies are well known in the art. Traditionally, the recombinant production of bispecific antibodies is based on co-expression • of two pairs of heavy chain / light chain immunoglobulins, wherein the two heavy chains have different specificities [Milstein and Cuello, Nature, 305: 537-539 (1983)]. Due to the random classification of the heavy chains and light immunoglobulin, these hybridomas • (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually performed by the affinity chromatography steps. Similar procedures are described in WO 93/08829, published on • May 13, 1993, and in Traunecker et al., EMBO J., 10: 3655-3659 (1991). The domains of antibody variables with the desired binding specificities (antigene-antigene combination sites) can be fused to constant domain sequences of immunoglobulin. The fusion is preferably with a j -. ^ i-fa. ^ - ..

- Immunoglobulin heavy chain constant domain, comprising at least part of the joint regions, CH2 and CH3. It is preferred to have the first heavy chain constant region • 5 (CH1) containing the site required for the present light chain link in at least one of the fusions. The DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chains, are inserted into the separate expression vectors, and co-t rans fectan • in an appropriate host organism. For additional details on the generation of bi-speci fi c antibodies see, for example, Suresh et al. , Methods in Enzymology, 121: 210 (1986). 15 According to another method described in WO 96/27011, the interface between a pair of molecules of • Antibodies can be engineered to maximize the percentage of heterodimers that are recovered from the recombinant cell culture. The preferred interface comprises at least a portion of the CH3 region of a constant domain of the antibody. In this method, one or more small amino acid side chains of the interface of the first antibody molecule are replaced -a-tfáí MaMHM | lHaMujMta - - with the longest side chains (for example, tyrosine or tryptophan). Compensating "cavities" of similar or identical size were created for the chain or long side chains, • at the interface of the second antibody molecule by replacing the long amino acid side chains with smaller ones (eg alanine or threonine). This provides a mechanism to increase the performance of the heterodimer on other terminal products not • desired such as homodimers.

The bispecific antibodies can be prepared as full-length antibodies or antibody fragments (for example, bispecific antibodies F (ab ') 2) • The techniques for generating bispecific antibodies from fragments of • antibodies have been described in the literature. For example, bispecific antibodies can be prepare using a chemical bond. Brennan et al. , Science 229: 81 (1985) describes a procedure in which the intact antibodies are pro teolically cleaved to generate the F (ab ') 2 fragments. These fragments are reduced in the presence of arsenite of sodium, the agent that forms complexes - of dithiol to stabilize neighboring dithiols and prevent the formation of intermolecular disulfide. The generated Fab 'fragments are then converted into robotic ion derivatives (TNB). One of the • Fab'-TNB derivatives are then reconverted to the Fab'-thiol by reduction with mercaptoet and lamina and mixed with an equimolar amount of the other Fab '-TNB derivative to form the specific antibody. Bispecific antibodies produced can be used as agents for the • selective immobilization of enzymes.

The Fab 'fragments can be recovered directly from the E. col i and chemically absorb to form bispecific antibodies. Shalaby et al. L. , J. Exp. Med. 175: 217-225 (1992) describes the production of an antibody F (ab ') 2 molecule • Fully humanized bispecific. Each Fab 'fragment was secreted separately to from E. It is subjected to chemical coupling in order to form the bispecific antibody. The bispecific antibody thus formed is capable of binding to cells overexpressing the ErbB2 receptor and T cells Normally, it also causes the violent activity of human cytotoxic lymphocytes against the targets of the human breast tumor.

Several techniques have been described to make and • isolate the bispecific antibody fragments directly from the recombinant cell culture. For example, bispecific antibodies have been produced using leucine closures. Kostelny et al. , J. Immunol. 148 (5): 1547-1553 (1992). The peptides of the closure of • Leucine from the Fos and Jun proteins bind to the Fab 'portions of two different antibodies by genetic fusion. Antibody homodimers are reduced to the joint region to form the monomers and then re-oxidize to form the antibody heterodimers. This method can also be used for the production of • antibody heterodimers. The "diabody" technology described by Hollinger et al., Proc.

Nati. Acad. Sci. USA 90: 6444-6448 (1993) has provided an alternative mechanism for the construction of the bispecific antibody fragments. The fragments comprise a heavy chain variable domain (V ^) connected to the domain light chain variable (VL) through a linker - - which is too short to allow pairing between the two domains in the same chain. Accordingly, the V ^ and VL domains of a fragment are forced to pair with the VL domains • 5 and VH complementary to another fragment, thus forming two antigen binding sites. Another strategy has also been reported for the construction of bispecific antibody fragments by the use of single-chain Fv dimers (sFv). See, Gruber et al. , J. Immunol. • 152: 5368 (1994).

Antibodies with more than two valencies are contemplated. For example, you can prepare antibodies r iespec í f i cos. Tutt et al. , J. Immunol. 147: 60 (1991).

• Exemplary bispecific antibodies can bind to two different epitopes in one PRO polypeptide given herein. Alternatively, an arm of the anti-PRO polypeptide can be combined with an arm that binds to an activation molecule in a leukocyte such as a T cell receptor molecule (e.g.

CD2, CD3, CD28, or B7), or the Fc receptors for IgG - - (Fc? R), such as Fc? RI (CD64), Fc? RII (CD32) and Fc? RIII (CD16) in which refers to the local cell defense mechanisms for the cell expressing the particular PRO polypeptide. These antibodies • they possess the link arm to the PRO and an arm that is linked to a cytotoxic agent or a chelator of the radionuclide, such as EOTUBE, DPTA, DOTA, or TETA. Another bispecific antibody of interest binds to the PRO polypeptide and in addition binds to the factor of woven (TF). • . Antibodies Heterogenated Antibodies Heteroconjugated antibodies are also within the scope of the present invention.

Antibodies with ugados are composed of two antibodies covalently linked. Such antibodies, for example, have been proposed as • targets of cells of the immune system to unwanted cells [US Patent No. 4,676,980], and for the treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. It is contemplated that the antibodies can be prepared using known methods in synthetic protein chemistry, including those that involve crosslinking agents. For example, with the improved anti-tumor activity is also? UÉ-U-U-db-i_á-? ^^^^ ^^^^ í. - - can be prepared using the cross functional heterobi linkers described in Wolff et al. Cancer Research, 53: 2560-2565 (1993). Alternatively, an antibody having the dual Fc regions can be engineered and therefore complement lysis and ADCC capabilities can be improved. See Stevenson et al. , Anti-Cancer Drug Design, 3: 219-230 (1989). 7. I nmunocon played • The invention also corresponds to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (for example a toxin). enzymatically active of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope • (ie a radioconjunction).

[0002] The chemically useful agents in the generation of such immunoconjugates have been described above. The enzymatically active toxins and the fragments thereof that can be used include the diphtheria A chain, the unlinked active fragments of the toxin x ». ^ *. ^ - - diphtheria, the chain of exotoxin A (from Ps eu dom on asa erugi nos), the ricin A chain, the abrin A chain, the modeccin A chain, alpha-sarcin, the proteins rí t is fordi i, the • diantine proteins, the Phyt ola ca am eri ca na proteins (PAPI, PAPII, and PAP-S), the momordica charantia inhibitor, curcina, crotina, sapaonaria officinalis inhibitor, gelonin, mitogeline, rest r ictocin, phenomycin, enomycin , and the t icotecenes. A variety of radionuclides are • available for the production of radioconjugated antibodies. Examples include Bi, I, In, 9ÜY, and '6Re. The conjugates of the antibody and the cytotoxic agent are made using a variety of protein coupling agents such as N-succinimidi 1-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), P biofunctional subproducts of imidoesters (such as HCL from dimethyl adipimidate), active esters (such as di succ in imide dihydrate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azi doben zoi lo) hexandiamine), bis-diazonium byproducts (such as bis- (p - diazonioben zoi lo) -ethylenediamine), diisocyanates (such as 2,6-diisocyanate tolylene), and the bis-active fluorine compounds (such as 1,5-dif luoro-2,4-dinit-benzene). For example, a castorium immunotoxin can be prepared as described in Vitetta et al. , Science, 238: 1098 (1987). The 1 - i sotiociana t obenci 1 - 3-met i ldiet t-riaminopent aethetic acid labeled with carbon 14 (MX-DTPA) is an exemplary chelating agent for the conjugation of the radionuclide with the antibody. See WO94 / 11026.

In another embodiment, the antibody can be conjugated to a "receptor" (such as streptavidin) for use in the pre-target of the tumor wherein the antibody-receptor conjugate is administered to the patient, followed by removal of a conjugate not linking the circulation using a clarifying agent and then administering the "ligand" (eg, avidin) which is conjugated with a cytotoxic agent (eg, a radionucleotide). 8. Immunoliposomes The antibodies described herein can also be formulated as immunoliposomes. Liposomes containing the antibody are prepared by the methods known in the art, such as described in Epstein et al. , P r o c. Nat 1. Acad. Sci. USA, 82: 3688 (1985); Hwang et al. , Proc. Nati Acad. Sci. USA, 77: 4030 (1980); and the • North American Patents Nos. 4,485,045 and 4,544,545. Liposomes with improved circulation time are described in U.S. Patent No. 5, 013, 556 Particularly useful liposomes are • they can be generated by the reverse phase evaporation method with a lipid composition comprising the phosphoryl icholine, cholesterol, and the phosphatide dihydroethanolamine derivative with PEG (PEG-PE). The Liposomes are forced to pass through the filters of defined pore size to produce the liposomes with the desired diameter. The fragments • Fab 'of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al. , J. Biol. Chem., 257: 286-288 (1982) via a disulfide exchange reaction. A chemotherapeutic agent (such as Doxor ubicin) is optionally contained within the liposome. See Gabizon et al. , J. National Cancer Inst., 81 (19): 1484 (1989). - - 9. Pharmaceutical Compositions of Antibodies Antibodies that specifically bind to a PRO polypeptide identified in the present invention, as well as to other molecules identified by the screening assays described hereinabove, can be administered for the treatment of various conditions in the form of pharmaceutical compositions. 10 • If the PRO polypeptide is intracellular and whole antibodies are used as inhibitors, intimalnalization antibodies are preferred. However, the liposomes or liposomes are also can be used to deliver the antibody, or an antibody fragment, into the cells. When antibody fragments are used, it is preferred • the smallest inhibitory fragment that specifically binds to the domain of the target protein.

For example, based on the variable region sequences of an antibody, the peptide molecules can be designed to retain the ability to bind to the target protein sequence. Such peptides can be synthesized chemically and / or produced by DNA technology - - recombinant. See, for example, Marasco et al. , P ro c. Nati Acad. Sci. USA, 90: 7889-7893 (1993). The formulation herein may also contain more than one active compound that is necessary for the • particular indication to be addressed, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may comprise an agent that improves its function, such as, for example, a cytotoxic agent, • cytokine, chemotherapeutic agent, growth inhibiting agent. Such molecules are suitably present in combination with amounts that are effective for the intended purpose. The active ingredients can also be entrapped in prepared microcapsules, for example, • by particle gathering techniques or by interfacial polymerization, for example, hydroxymethylcellulose or microcapsules of gelatin and poly (methylmethacrylate) microcapsules, respectively, in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules ) or in macroemul s ions.

-AMM - * - d-Mtri-H -? - tt-M- ^ áM -_- aM-l- «l - ^ - a-H - - Such techniques are described in Remington 's Pharmaceutical Sciences, upra The formulations that are going to be used F for administration should not be sterile. This is easily completed by filtering through the sterile filtration membranes.

The sustained release preparations are can prepare. The appropriate examples of • Sustained-release preparations include semipermeable matrices of the solid hydrophobic polymers containing the antibody, which matrices are in the form of articles formed, for example, films, or microcapsules. Examples of sustained release matrices include polyesters, • hydrogels (for example, pol i (2-hydroxyethyl i-methacrylate), or po 1 i (vi n i 1 a lcohol)), polylactides (U.S. Patent No. 3,773,919), L-glutamic acid copolymers and? e t i 1-L-glut amat o, non-degradable ethylene vinyl acetate, the copolymers of degradable lactic acid-degradable acid such as LUPRON DEPOT ™ (injectable microspheres) composed of lactic acid-acid copolymer Methyl glycolic acid and leuprolide acetate), and poly-D- (-) - 3-hydroxybutyl acid. While polymers such as ethylene vinyl acetate and lactic acid-glycolic acid are able to release • the molecules during a period of 100 days, certain hydrogels release proteins for shorter times. When the encapsulated antibodies remain in the body for a very long time, they can denature or add as result of exposure to humidity at 37 ° C, • resulting in a loss of biological activity and possible changes in immunogenicity. The rational strategies can be devised for the abilization depending on the mechanism involved. For example, if it is discovered that the aggregation mechanism is an intermolecular S-S link formation through the exchange T io-di your 1 furo, stabilization can be achieved by modifying the sulfhydryl residues, lyophilizing from the acidic solutions, controlling the moisture content, using the appropriate additives, and developing matrix compositions of the specific polymer.

- - G. Uses for Anti-PRO Antibodies The anti-PRO antibodies of the invention have various utilities. For example, anti-PRO antibodies can be used in diagnostic assays for a PRO, for example, for the detection of its expression in specific cells, tissues, or serum. Various diagnostic assay techniques known in the art can be used, such as competitive binding assays, direct sandwich assays or indirect and immunoprecipitation tests conducted • in either heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc. (1987) p. 147-158]. The antibodies used in diagnostic tests can be label with a detectable portion. The detectable portion should be capable of producing, either directly or indirectly, a detectable signal. For example, the • detectable portion can be a radioisotope, such as H, C, P, S, or I, a fluorescent compound or chemiluminescent, such as fluorescein isothiocyanate, rodamma, or luciferin, or an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. Any method known in the art can be used to conjugate the antibody with the detectable portion, including those methods JL, - - described by Hunter et al., Nature, 144: 945 (1962); David et al., Biochemistry, 13: 1014 (1974); Pain et al., J. Immunol. Meth., 4_0: 219 (1981); and Nygren, J. Histochem. and Cytochem., 30.:407 (1982). • Anti-PRO antibodies are also useful for affinity purification of PRO from the culture of recombinant cells or natural sources. In this process, the antibodies against the PRO are immobilized on a suitable support, such as a Sephadex resin or filter paper, using methods well known in the art. The immobilized antibody is then contacted with a sample containing the PRO to be purified, and subsequently the support is washed with a suitable solvent that will remove substantially all the material in the sample except the PRO, which binds to the immobilized antibody. Finally, the support is washed with another suitable solvent that will liberate the PRO from the antibody.

The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. fesfei.-vi A .. A- > ,. ^ - »..-, < ü-- .. ^ r ... t ~ ¡£ í .. * - 14 - All patents and references in the literature cited in the present specification are incorporated herein by reference in their entirety. • EXAMPLES Commercially available reagents referred to in the examples were used according to the manufacturer's instructions unless indicate otherwise. The source of those • Cells identified in the following examples, and throughout the specification, using the ATCC access numbers is the American Type Culture Collection, Manassas, VA. EXAMPLE 1: Selection or Separation of the Homology of 1 Extracellular Domain for # Identify the New Polypeptides and the cDNA that codes for the same 20 The extracellular domain (ECD) sequences (which include the sequence of the secretion signal, if any) from approximately 950 known secreted proteins from the base of Swiss-Prot public data were used to search •• - ~ "~ ° - -" - "- m- EST databases EST databases include public databases (eg Dayhoff, GenBank), and particular databases (eg LIFESEQ) ™, Incyte Pharmaceuticals, Palo • Alto, CA) The search was performed using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the sequences of the ECD protein to a translation of structure 6 of the 10 EST sequences Those comparisons with the Blast record of 70 (or in some cases 90) or older that did not encode known proteins were pooled and assembled into the DNA sequences of consensus with the "phrap" program (Phil Green, University of 15 Washington, Seattle, WA).

Using this homology selection of the extracellular domain, the consensus DNA sequences were assembled in relation to other EST 20 sequences identified using phrap. In addition, the consensus DNA sequences were often (but not always) extended using repeated cycles of WU-BLAST-2 and phrap to extend the consensus sequence as much as possible using the sources of the EST sequences described above. ("ír" "'" - ^ - ^ _-. - - .. - ». ^ _.... - ..« -., ... ^^^^^^^^^^^^ ^ _-Y -.......-. Ji ....

Based on the consensus sequences obtained as described above, the oligonucleotides were synthesized and used to identify by • PCR a cDNA library containing the sequence of interest and to be used as probes to isolate a clone from the full-length coding sequence for a PRO polypeptide. PCR primers forward or forward and backward or reverse in generally range from 20 to 30 nucleotides and often • are designed to give a PCR product of approximately 100-1000 bp in length. The sequences of the probe are typically 40-55 bp in length. In some cases, the additional oligonucleotides are synthesize when the consensus sequence is greater than about 1-1.5 kbp. To select multiple libraries for a full-length clone, • selected the DNA of the libraries by amplification with PCR, as per Ausubel et al., Current Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate the clones encoding the gene of interest using the oligonucleotide from the probe and one of the primer pairs. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with the oligo dT containing the Notl site, bound from the blunt portion to the Sali hemicinase adapters, excised with Notl, with an appropriate size by gel electrophoresis, and. cloned in a defined orientation in a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D not containing the Sfil site; see, Hol et al., Science, 253: 1278-1280 (1991)) in the unique sites Xhol and Notl.

EXAMPLE 2 Isolation of the cDNA Clones by Amylase Selection 1. Preparation of the barley cDNA library with the oligo dT The mRNA was isolated from a human tissue of interest using the reagents and protocols of Invitrogen, San Diego, CA (Fast Track 2). This RNA was used to generate a cDNA library primed with oligo dT in the pRK5D vector using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). In this procedure, a double-stranded cDNA larger than 1000 bp was sized and the CDNA bound with Sall / Notl in the excised vector »• Xhol / Notl. PRK5D is a cloning vector having a sp6 transcription initiation site followed by a Sfil restriction enzyme site that precedes the Xhol / Notl cloning sites of the cDNA. 2. Preparation of randomly primed cDNA library A second cDNA library was generated to preferentially represent the 5 'ends of the cDNAs. clones of primary cDNAs. Sp6 RNA was generated from the primary library (described above), and this RNA was used to generate a barley cDNA library Pr randomly in the vector pSST-AMY.O using reagents and protocols of Life Technologies (System of Super Script Plasmid, mentioned above). In this procedure the double-stranded cDNA was sized at 500-1000 bp, bluntly linked with the NotI adapters, cleaved with Sfil, and cloned into the cleaved Sfil / Notl vector. PSST-25 AMY.O is a cloning vector having a yeast alcohol dehydrogenase promoter that precedes the cDNA cloning sites and the mouse amylase sequence (the mature sequence without the secretion signal) followed by the terminator • 5 yeast dehydrogenase alcohol, after the cloning sites. Thus, the cDNAs cloned in this vector that are fused in the structure with the amylase sequence will lead to the secretion of the amylase from properly transfected yeast colonies. • 3. Transformation and Detection The DNA of the library described in paragraph 2 above was chilled on ice and added to it. the elect rocompet bacterium in DH10B (Life Technologies, 20 ml). The mixture of bacteria and vector was then subjected to electroporation as recommended by the manufacturer. Subsequently, the SOC medium (Life Technologies, 1 ml) and the The mixture was incubated at 37 ° C for 30 minutes. The transformants were then placed in 20 standard 150 mM LB plates, which contained ampicillin and incubated for 16 hours (37 ° C). Positive colonies were separated from the plates and the DNA was isolated from the pellets of bacteria using standard protocols, for example the CsCl gradient. The purified DNA was then placed in the yeast protocols mentioned below.

The yeast methods are divided into three categories: (1) Transformation of the yeast with the combined plasmid / cDNA vector; (2) Detection and isolation of yeast clones that secrete amylase; and (3) PCR amplification of the insert directly from the yeast colony and the • DNA purification for sequencing and subsequent analysis.

The yeast strain used was HD56-5A (ATCC-90785). This strain had the following genotype: MAT alpha, ura3-52, leu2-3, leu2-112, his3-ll, his3-15, MAL +, SUC +, GAL +. Preferably, the mutants • Yeast can be used because they have poor post-translational pathways. Such mutants can have deficient alleles of t rans 1 ocation in sec71, s e c! 2, s e c 62, truncated sec71 being most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that interfere with the normal operation of these genes, other proteins involved in this pathway -a -? - M-¿&&-É- > post-translation (for example, SEC61p, SEC72p, SEC62p, SEC63p, TDJlp or SSAlp-4p) or the complex formation and these proteins, can also be preferably used in combination with the • yeasts that express amylase.

The transformation was carried out based on the protocol underlined by Gietz et al., Nucí. Acid Res. , 20: 1425 (1992). The transformed cells are then inoculated from the agar into the broth of • YEPD complex medium (100 ml) and grown overnight at 30 ° C. The YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). It was grown overnight and then diluted to approximately 2 x 10 cells / ml (approx OD600 = 0.1) in a broth • fresh YEPD (500 ml) and regrown to 1 x 107 cells / ml (approx OD60o = 0.4-0.5). The cells were then harvested and prepared for transformation by transfer to bottles or GS3 rotor bottles in a Sorval GS3 rotor at 5,000 rpm for 5 hours. minutes, the supernatant was discharged, and then resuspended in sterile water, and centrifuged again in 50 ml falcon tubes at 3,500 rpm in a Beckman GS-6KR centrifuge. The supernatant was discharged and the cells were subsequently washed • with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM LY2OOCCH3), and resuspended in LiAc / TE 2. 5 ml Transformation took place by mixing the 10. prepared cells (100 μl) with fresh, denatured, fresh, salmon testis DNA (Lofstrand Labs, Gaithersburg, MD) and DNA transformation (1 μg, vol. < 10 μl) in mic rocent rifuga tubes. The mixture was mixed briefly generating a vortex, then 40% PEG / TE (600 μl, po 1 ie ti 1 eng 11 col - 4000 at 40%, 10 mM Tris-HCl, 1 M EDTA, Li 2 OOCCH 3 was added. 100 mM, pH 7.5).

• This mixture was mixed gently and incubated at 30 ° C while stirring for 30 minutes. The cells were then suddenly heated at 42 ° C for 15 minutes, and the reaction vessel was centrifuged in a centrifugal mi c rocent at 12,000 rpm for 5-10 seconds, decanted and resuspended in TE (500 μl, Tris- 10 mM HCl, 1 mM EDTA, pH 7.5) followed by recentrifugation. The cells were then diluted in TE (1 ml) and aliquots (200 μl) were sprayed onto the previously prepared selective medium in 150 mm growth plates (VWR).

• Alternatively, instead of multiple small reactions, the transformation was performed using a single large-scale reaction, where the quantities of reagents were scaled accordingly. 10 • The selective medium used was a dextrose-free, complete uracil devoid of agar. Synthetic (SCD-Ura) prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor 15 Press, Cold Spring Harbor, NY, p. 208-210 (1994). The transformed ones were grown at 30 ° C for 2-3 days. • The detection of colonies that secrete 20 amylase, was performed including red starch in the selective growth medium. The starch was coupled to the red dye (Reagent Red-120, Sigma) as described in the procedure by Biely et al., Ana 1. Biochem. , 172: 176-179 (1988). The coupled starch was incorporated into the SCD-Ura agar plates at a final concentration of 0.15% (w / v), and was buffered with potassium phosphate at a pH of 7.0 (50-100 mM final concentration).

Positive colonies were collected and labeled through fresh selective medium (on 150 mm plates) to obtain isolated wells and unique colonies ident i f i cabl es. The single colonies isolated in wells, positive for the secretion of amylase were detected by incorporation • Direct red starch on the SCD-Ura damped agar. Positive colonies were determined by their ability to break the resulting starch into a clear halo around the positive colony displayed directly. 4. Isolation of DNA by Amplification • by PCR When a positive colony was isolated, it collected a portion of it by means of a toothpick, and was diluted in sterile water (30 μl) in a 96-well plate. At this time, the positive colonies were either frozen and stored for subsequent analysis and amplified immediately. An aliquot was used - positive colonies were either frozen and stored for subsequent analysis and amplified immediately. An aliquot of cells (5 μl) was used as a template for the PCR reaction in a 25 μl volume containing: 0.5 μl Klentaq (Clontech, Palo Alto, CA); 4.0 μl of 10 mM dNTP (Perkin Elmer-Ce t us); 2.5 μl of Kentaq buffer (Clontech); 0.25 μl of forward oligo 1; 0.25 μl of inverse oligo 2; 12.5 10 μl of distilled water. The sequence of the forward • oligonucleotide 1 was: 5 '-TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT-3' (SEQ ID NO: 3) The sequence of the reverse oligonucleotide 2 was: 5 '-CAGGAAAC GCTATGACCACCTGCACACCTGCAAATCCATT-3' (SEQ ID NO: 4) The PCR was then carried out as follows: • a. Denatured 92 ° C, 5 minutes b. 3 cycles of: Denaturated 92 ° C, 30 seconds Heating and 59 ° C, 30 seconds Cooling Extension 72 ° C, 60 seconds 3 cycles of: Denatured 92 ° C, 30 seconds Heating and 57 ° C, 30 seconds Cooling Extension 72 ° C, 60 seconds ^^^ ,,,, - ^^ ------ ^^^ ----- ^ ---- ^ --- ^^^^^^^^^^^^^^^^^ ^^^^^^^ d. 3 cycles of: Denatured 92 ° C, 30 seconds Heating and 55 ° C, 30 seconds Cooling Extension 72 ° C, 60 seconds e- Retention 4 ° C The underlined regions of the oligonucleotides were subjected to cooling and heating for the ADH promoter region and the amylase region, respectively, and amplified W-? a region of 307 bp from vector pSST-AMY.O when no insert was present. Typically, the first 18 nucleotides of the 5 'end of these oligonucleotides contained cooling and heating sites for the sequencing primers. Thus, the total product of the PCR reaction of an empty vector was 343 bp. However, the cDNA fused to the signal sequence • 15 resulted in longer nucleotide sequences considera- bly.

Following the PCR, an aliquot of the reaction (5 μl) was examined by agarose gel electrophoresis on a 1% agarose gel using a Tr is -Bora to-EDTA (TBE) quenching system as described by Sambrook et al., supra. The clones resulted in a single strong PCR product larger than 400 bp when subsequently analyzed by DNA sequencing • after purification with a Qiaquick 96 PCR cleaning column (Qiagen Inc., Chatsworth, CA).

EXAMPLE 3: Isolation of cDNA Clones Using Signal Algorithm Analysis Several nucleic acid sequences encoding the polypeptide were identified by applying a proprietary signal sequence matching algorithm, developed by Genentech, Inc. (South San Francisco, CA) on the ESTs as well as the stacked and assembled fragments of ESTs from public (for example, GenBank) and / or private databases (LIFESEQC, Incyte Pharmaceuticals, 20 Inc., Palo Alto, CA). The signal sequence algorithm computes or calculates a secretion signal log based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon (s) (ATG) at the 5 'end of the signal sequence. sequence or low sequence fragment ^^^^ - - consideration. Nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codon. If the first ATG has the required amino acids, the second does not • is examined. If none meets the requirements, the candidate sequence is not recorded. To determine if the EST contains an authentic signal sequence, the DNA and corresponding amino acid sequences surrounding the ATG codon are record using a set of seven sensors or • known detectors (evaluation parameters) that are associated with secretion signals. The use of this algorithm results in the identification of numerous nucleic acid sequences that code for 1-peptides.

EXAMPLE 4: Isolation of the cDNA Clones that • Encode the Human PRQ281 to obtain a cDNA clone that encodes the PR0281, the methods described in Klein et al., Proc. Nati Acad. Sci. USA 93: 7108-7113 (1996) were employed with the following modifications. The transformation of the yeasts was carried out with the limiting amounts of the transformation DNA for reduce the number of yeast cells - "--- - ^" - ^ ----- - • - • - - multiple transforms. Instead of isolating the plasmid from the yeasts followed PRO to the transformation of E. As described in Klein et al., supra, PCR analysis was performed • in simple or simple yeast colonies. The PCR primers used were bipartite to amplify the insert and a small portion of the invertase gene (allowing to determine that the insert was in the structure with the invertase) and add on the sites of the unification primer 1.

An invertase library was transformed into yeasts and positive samples were selected on the plates of sucrose. The positive clones were rejected and the PCR products were sequenced. It was determined that the sequence of a clone, PR0281, contains a coding sequence of the signal peptide. Primers and oligonucleotide probes were designed using the nucleotide sequence of PR0281. A full-length plasmid library of human umbilical vein endothelial tissue cDNAs was titered and approximately 100,000 cfu were plated in 192 25 500 cfu collections / collection in 96-well round bottom plates . The plates were sealed and the collections were grown overnight at 37 ° C with shaking (200 rpm). PCR was performed on the individual cultures using • 5 primers. Agarose gel electrophoresis was performed and positive wells were identified by visualization of a band of the expected size. Individual positive clones were obtained by raising the colonies 10 followed by hybridization with the oligonucleotide • Labeling with J "P. These clones were characterized by PCR, were digested with restriction, and southern spotting analyzes were performed.

A full-length clone containing a single open reading structure with an apparent translation initiation site was identified in • positions 80-82 of the nucleotide, and a stop signal at positions 1115-1117 of the nucleotide (Figure 1; SEQ ID NO: 1). The predicted polypeptide precursor is 345 amino acids in length, has a calculated molecular weight of about 37,205 daltons and an estimated pl of about 10.15. The analysis of the sequence of the full-length PR0281 shown in Figure 2 (SEQ ID NO: 2) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 14, the domains of • transmembrane multiples approximately from the position of amino acid 83 to approximately the position of amino acid 105, approximately from the position of amino acid 126 to approximately the position of amino acid 146, approximate way from the position of the amino acid • 158 to approximately the position of amino acid 177, approximately from the position of amino acid 197 to approximately the position of amino acid 216, approximately from the Position of amino acid 218 to approximately the position of amino acid 238, approximately from the position of amino acid 245 to • approximately the position of amino acid 265, and approximately from the position of the amino acid 271 to approximately the position of amino acid 290 and a block of the amino acid sequence having homology with the receptor proteins coupled to the G protein roughly from amino acid 115 to about amino acid 155. The clone UNQS244 (DNA16422-1209) has been deposited with the ATCC on June 2, 1998 and assigned the no. of deposit ATCC 209929.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 2 (SEQ ID NO: 2), reveals significant homology between the amino acid sequence of PR0281 and the following Dayhoff sequences: H64634, AF033095_1, B64815, YBHL_ECOLI, EMEQUTR_1, AF064763 3, S53708, A69253, AF035413 12 and S63281.

EXAMPLE 5: Isolation of cDNA Clones Encoding Human PR0276 To obtain a cDNA clone encoding PR0281, the methods described in Klein et al., Proc. Nati Acad. Sci. USA 93: 7108-7113 (1996) were employed with the following modifications. The transformation of the yeasts was performed with the limiting amounts of the transformation DNA to reduce the number of transformed multiple yeast cells. Instead of isolating the plasmid from the yeasts followed PRO to the transformation of E. co l i as described in •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• PCR primers used were bipartite to amplify the insert and a small portion of the invertase gene (allowing to determine that the insert was in the structure with the invertase) and add over the primer sites of universal sequencing.

An invertase library was transformed into yeasts and selected on the positive ones on the sucrose plates. The positive clones were rejected and the PCR products were sequenced. It was determined that the sequence of a clone, PR0276, contains a coding sequence of the signal peptide. Primers and oligonucleotide probes were designed using the nucleotide sequence of PR0276. A full-length plasmid library of the endothelial tissue cDNAs of the Human umbilical vein was titrated and approximately 100,000 cfu were plated in 192 500 cfu collections / collection in 96-well round bottom plates. The plates were sealed and the collections were grown throughout the night at 37 ° C with stirring (200 rpm). The PCR is ^^^? g ^^^^ - ^^ "-A" iJtt- - ~~; - - performed on the individual cultures using primers. Agarose gel electrophoresis was performed and positive wells were identified by visualization of a band of the expected size. Individual positive clones were obtained by raising the colonies followed by hybridization with the 32 P-labeled oligonucleotide. These clones were characterized by PCR, were digested with restriction, and southern spotting analyzes were performed.

A full-length clone containing a single open reading frame with an apparent translation initiation site at positions 180-182 of the nucleotide, and a stop signal at positions 933-935 of the nucleotide was identified (Figure 3; SEC ID NO: 5). The predicted polypeptide precursor is 251 amino acids in length, has a calculated molecular weight of about 28,801 daltons and an estimated pl of approximately 9.58. The transmembrane domains are approximately at amino acids 98-116 and 152-172 of the sequence shown in Figure 4 (SEQ ID NO: 6). The clone DNA16435-1208 has been deposited with the ATCC on June 2, 1998 and ritfM-ÉMMitfM- - 14 1 -assigned the no. of deposit ATCC 209930.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 4 (SEQ ID NO: 6), reveals Significant homology between the amino acid sequence of PR0276 and the following Dayhoff sequences: ATT805_2, S69696, GRHR_RAT, NPCBAABCD_3, AB013149_1, P R85942 and AP000006_5.

EXAMPLE 6: Isolation of cDNA Clones Encoding Human PR0189 A clone designated herein was isolated as DNA14187 as described in Example 2 above of a human retinal tissue library. The DNA14187 sequence is shown in Figure 7 (SEQ ID NO: 9). Based on the sequence DNA14187 shown in Figure 7 (SEQ ID NO: 9), oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR0189. The forward and reverse PCR primers were generally in the range of 20 to 30 nucleotides and are often designed to give a PCR product of approximately 100-1000 bp in length. The sequences of the probe are typically 40-55 bp in length. To select several libraries for a full-length clone, the DNA of the libraries was selected by PCR amplification, as indicated by Ausubel et al. al., Current Protocols in Molecular Biology, with the • PCR primer pair. A positive library was then used to isolate the clones encoding the inerres gene using the probe oligonucleotide and one of the primer pairs. 15 A pair of PCR primers were synthesized (front and reverse): • PCR primer 5 '-TTGACCTATACAGAGATTCATC-3' (SEQ ID NO: 10); and reverse PCR primer 5 * -CTAAGAACTTCCCTCAGGATTTT-3 '(SEQ ID NO: 11). In addition, a synthetic hybridization probe of the oligonucleotide was constructed from the DNA14187 sequence having the following nucleotide sequence: - 5 'hybridization probe -ATGAAGATCAATTTCAAGAAGCATGCACTTCTCCTCTTGC-3' (SEQ ID NO: 12).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the pair of the PCR primer identified above. A positive library was then used to isolate the clones encoding the PR0189 gene using the probe oligonucleotide and one of the PCR primers.

RNA was isolated for the construction of cDNA libraries from human retinal tissue (LIB94). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, ligated with the blunt portion to the Sali hemicinase adapters, excised with NotI, appropriately sized by gel electrophoresis, and cloned in a defined orientation in a vector of suitable cloning - such as pRKB or pRKD; pRK5B which is a precursor of pRK5D not containing the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) at the unique Xhol sites and Notl.

DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR0189 and the derived protein sequence for 0 PR0189.

The complete nucleotide sequence of DNA21624-1391 is shown in Figure 5 (SEQ ID NO: 7). Clone DNA21624-1391 contains a single open reading frame with an apparent translation initiation site at positions 200-202 of the nucleotide and terminates at the stop codon at positions 1301-1303 of the nucleotide (Figure 5). The predicted polypeptide precursor is 0 of 367 amino acids in length (Figure 6). The protein of the full length PR0189 shown in Figure 6 has an estimated molecular weight of about 41,871 daltons and a pl of about 5.06. The clone DNA21624-1391 has been deposited with the ATCC. Regarding the sequence, - it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques.

Analyzing the amino acid sequence of the SEC. ID NO: 8, the putative N-glycosylation sites are at approximately amino acids 224-227, 246-249 and 285-288. A domain for the cytosolic fatty acid binding proteins is at amino acids 78-107 of the SEC. ID NO: 8. The corresponding nucleotides can be rumenally determined given the sequences provided herein.

Some sequence identity was found with the proteins W01A6.1, F35D11.11 and C. Elegans, designated in a Dayhoff database as CEW01A6_10 and CELF35 DI 1_11, respectively. Some sequence identity was found with an antigen with malaria and with restin, designated in a Dayhoff database as P_R05766 and AF014012_1, respectively. Some sequence identity was found with a microtubule binding protein and with myosin, designated in a Dayhoff database as AF041382_1 and S07537. Some sequence identity was also found with 1-fos fat idilinosi tol-4, 5-bi s fos fa t, designated as PIP1_RAT.

EXAMPLE 7: Isolation of cDNA Clones Encoding Human PRO190 A clone designated herein was isolated as DNA14232 as described in Example 2 above from a human fetal retinal tissue library. The DNA14232 sequence is shown in Figure 10 (SEQ ID NO: 15). Based on the DNA14232 sequence, the 11 gonuc 1 eotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a length coding sequence clone. complete for the PRO190. The forward and reverse PCR primers were generally in the range of 20 to 30 nucleotides and are often designed to give a PCR product of approximately 100-1000 bp in length. The sequences of the probe are typically 40-55 bp in length. To select multiple libraries for a full-length clone, the DNA from the libraries by PCR amplification, as indicated by Ausubel et al., Current Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate the clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.

A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5 '-CTATACCTACTGTAGCTTCT-3' (SEQ ID NO: 16); and reverse PCR primer 5 '-TCAGAGAATTCCTTCCAGGA-3' (SEQ ID NO: 17). Adjacent, a synthetic hybridization probe of the oligonucleotide was constructed from the DNA14232 sequence having the following nucleotide sequence: 5 'hybridization probe -ACAGTGCTGTAGTCATCCTGTAATATGCTCCTTGTCAACA-3' (SEQ ID NO: 18).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by &? "T • PCR amplification with the pair of the PCR primer identified above. A positive library was then used to isolate the clones encoding the PRO190 gene using the probe oligonucleotide and one of the PCR primers.

RNA was isolated for the construction of cDNA libraries from human retinal tissue (LIB94). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, ligated with the blunt portion to the hemicinase adapters of SalI, excised with NotI, appropriately sized by the ect ro res on gel, and cloned into an orientation defined in a suitable cloning vector (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D not containing the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) in the unique sites Xhol and Notl.

DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PRO190 [designated here as DNA23334-1392] (SEQ ID NO: 13) and the sequence of the derived protein for the PRO190.

The complete nucleotide sequence of DNA23334-1392 is shown in Figure 8 (SEQ ID NO: 13). Clone DNA23334-1392 contains a single open reading frame with an apparent translation initiation site at positions 193-195 of the nucleotide and terminates at the stop codon at positions 1465-1467 of the nucleotide (Figure 8). The predicted polypeptide precursor is 424 amino acids in length (Figure 9). The full-length PRO190 protein shown in Figure 9 has an estimated molecular weight of about 48,500 daltons and a pl of about 8.65. The clone DNA23334-1392 has been deposited with the ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. ending the amino acid sequence of the -, ». At-- - -SEC. ID NO: 14, the putative transmembrane domains are at approximately amino acids 16-36, 50-74, 147-168, 229-250, 271-293, 298-318 and 328-368 of SEQ. ID NO: 14. The N-glycoside sites are at approximately amino acids 128-131, 204-207, 218-221 and 274-377 of the SEC. ID NO: 14. Corresponding nucleotides can be determined routinely given the sequences provided herein.

The PRO190 has sequence identity with at least the following Dayhoff sequences designated as CEZK896 2, JC5023, GMS1 SCHPO and S44668.

EXAMPLE 8: Isolation of cDNA Clones Encoding Human PR0341 A clone designated herein was isolated as DNA12920 as described in Example 2 above from a human placental tissue library. The DNA12920 sequence is shown in Figure 13 (SEQ ID NO: 21). The DNA12920 sequence was then compared to several EST databases that include public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo g ^ | ^^^ g ^^^^^ - -Alto, CA) to identify homologous EST sequences. The comparison was made using the BLAST or BLAST2 computer program [Altschul, Methods in Enzymology 266: 460-480 (1996)]. Those comparisons that result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins were pooled and assembled into the consensus DNA sequences with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). This consensus sequence was designated herein as DNA25314. Oligonucleotide primers were based on the DNA25314 sequence, then synthesized and used to select a human placental cDNA library that results in the identification of clone DNA26288- 1239 shown in Figure 11. The cloning vector was pRK5B ( pRK5B is a precursor of pRK5D that does not contain the Sfil site, see Holmes et al., Science, 253: 1278-1280 (1991)), and the size cut of the cDNA was less than 2800 bp.

A full-length clone containing a single open reading frame with an apparent translation initiation site was identified at - positions 380-382 of the nucleotide and terminates at the stop codon at positions 1754-1756 of the nucleotide (FIG. 11; SEQ ID NO: 19). The predicted polypeptide precursor is 458 amino acids in length, has a calculated molecular weight of about 50,264 daltons and an estimated pl of about 8.17. Sequence analysis of the full length PR0341 shown in Figure 12 (SEQ ID NO: 20) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 17, the transmembrane domains roughly from amino acid 171 to approximately amino acid 190, approximately from amino acid 220 to approximately amino acid 239, approximately from amino acid 259 to approximately amino acid 275, approximately from e 1 amino acid 286 to approximately amino acid 305, approximately from amino acid 316 to approximately amino acid 335, approximately from amino acid 353 to approximately amino acid 378 and approximately from amino acid 396 to approximately amino acid 417 and potential N-glycosylation sites approximately from amino acid 145 to approximately amino acid 147 and approximately from the • amino acid 155 to approximately amino acid 158. Clone DNA26288 - 1239 has been deposited with the ATCC on April 21, 1998, and was assigned no. of deposit ATCC 209792.

An analysis of the Dayhoff database • (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 12 (SEQ ID NO: 20), highlights the homology between the amino acid sequence of PR0341 and the following Dayhoff sequences: S75696, H69788, D69852, A69888, B64918, F64752, LPU89276_1, G64962, S52977 and S44253.

EXAMPLE 9: Isolation of the cDNA Clones Coding for Human PRO180 A clone designated here as DNA12922 was isolated as described in Example 2 above from a tissue library of human placenta. The sequence DNA12922 is shown in ..efe. ~ ^ _ ¡-y ^ g \ - 14 - Figure 16 (SEQ ID NO: 24). The DNA12922 sequence was then compared to several EST databases that include public EST databases (eg, Genbank) and a particular DNA database 5 (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify the EST homologous sequences. The comparison was made using the BLAST or BLAST2 computer program [Altschul, Methods in Enzymology 266: 460-480 (1996)]. Those flfc 10 comparisons that result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were pooled and assembled into the consensus DNA sequences with the "phrap" program (Phil Green, 15 University of Washington, Seattle, Washington).

^ An oligonucleotide probe was formed based on the consensus sequence obtained above. That probe has the following sequence. 20 5 '-ACCTGTTAGAAATGTGGTGGTTTCAGCAAGGCCTCAGTTT (SEQ ID NO: 25). This probe was used to select a human placental library prepared as described in paragraph 1 of Example 2 above. He cloning vector was pRK5B (the pRK5B is a rife. »¿- > ? • * vi-, - 4 - precursor of pRK5D that does not contain the Sfil site; see Holmes et al., Science, 25 _: 1278-1280 (1991)), and the size cut of the cDNA was less than 2800 bp. A clone designated herein was obtained as • DNA26843-1389.

The complete nucleotide sequence of DNA26843-1389 is shown in Figure 14 (SEQ ID NO: 22). The clone DNA26843 - 1389 contains only one open reading structure with a site of • initiation of apparent translation at positions 121-123 of the nucleotide and ending at the stop codon at positions 919-921 of the nucleotide (Figure 14). The predicted polypeptide precursor is 266 amino acids in length (Figure 15). The protein of the full-length PRO180 shown in Figure 15 has an estimated molecular weight of about 29,766 daltons and a pl of about 8.39. The clone DNA26843 - 1389 has been deposited with the ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques. 25 Still analyzing the sequence of ^ & amino acids of the SEC. ID NO: 23, the transmembrane domains are at approximately amino acids 13-33 (type II), 54-73, 94-113, 160-180 and 122-141 of SEQ. ID NO: 23. The N- • mir i s sites are at approximately amino acids 57-62, 95-100, 99-104, 124-129 and 183-188 of the SEC. ID NO: 23. Corresponding nucleotides can be determined routinely given the sequences provided herein.

• An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST2 of the full length sequence shown in the Figure 15 (SEQ ID NO: 23), reveals some sequence identity between the amino acid sequence of PRO180 and the following sequences • Dayhoff: CEC33A11_2, CEG11E6_5, CELW03A5_1 and PEU83861_2 (4L subunit of NADH dehydrogenase, mi tocondr ion).

EXAMPLE 10: Isolation of cDNA Clones Encoding Human PR0194 A consensus DNA sequence was assembled relative to other EST sequences using phrap - as described in Example 1 above. This consensus sequence is herein as DNA19464. Based on the DNA19464 consensus sequence, the oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a clone from the full-length coding sequence for PR0194. PCR primers (forward and reverse) were synthesized based on the DNA19464 sequence. Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA19464 sequence To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the pair of the PCR primer identified above. A positive library was then used to isolate the clones encoding the PR0194 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from human fetal lung tissue (LIB25).

^ Gí m * ^ m - - DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR0194 [designated herein as DNA26844-1394)] (SEQ ID NO: 27) and the sequence of the protein derived for PR0194.

The complete nucleotide sequence of DNA26844-1394 is shown in Figure 17 (SEC.

• NO: 27). Clone DNA26844-1394 contains a single open reading structure with an apparent translation initiation site at positions 81-83 of the nucleotide and ends at the codon of arrest at positions 873-875 of the nucleotide (Figure 17). The predicted polypeptide precursor is 264 amino acids in length (Figure 18). The full-length PR0194 protein shown in Figure 18 has an estimated molecular weight of about 29,665 daltons and a pl of about 9.34. An analysis of the sequence of the full length PR0194 shown in Figure 18 (SEQ ID NO: 28) evidences the presence of several polypeptide domains important as shown in Figure 18. The clone - -DNA26844-1394 has been deposited with the ATCC on June 2, 1998 and was assigned the no. of deposit of the ATCC 209926.

An analysis of the amino acid sequence of full length PR0194 suggests that it does not exhibit significant sequence similarity with any known human protein itself. However, an analysis of the Dayhoff database (version 35.45 SwissProt 35), evidenced some homology between the PR0194 amino acid sequence and the following Dayhoff sequences: HUMORFT_l, CET07F10_5, ATFCA9_12, F64934, YDJX_ECOLI, ATAF00065719F29G20.19, H70002, S76980, H64934 and S76385.

EXAMPLE 11: Isolation of cDNA Clones Encoding Human PRO203 A clone designated herein was isolated as DNA15618 as described in Example 2 above from a human fetal lung tissue library. The sequence DNA15618 is shown in Figure 21 (SEQ ID NO: 31). Oligonucleotide probes were generated from the sequence of the DNA15618 molecule and used to select a human fetal lung library (LIB26) prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of • pRK5D that does not contain the Sfil site; see Holmes et al., Science, 253: 1278-1280 (1991)), and the size cutoff of the cDNA was less than 2800 bp.

A full-length clone was identified that contains a single open reading structure • with an apparent translation initiation site at positions 159-151 of the nucleotide and ending at the stop codon at positions 1200-1202 of the nucleotide (Figure 19; SEQ ID NO: 29). He The predicted polypeptide precursor is 347 amino acids in length, has a calculated molecular weight of about 39,870 daltons and an estimated pl of about 6.76. The sequence analysis of the full length PRO203 shown in Figure 20 (SEQ ID NO: 30) evidences the presence of the following: a type II transmembrane domain at about amino acid 64 to about amino acid 87; the possible N-glycosylation sites in approximately amino acid 147 up to - approximately amino acid 150, approximately from amino acid 155 to about amino acid 158, approximately from amino acid 237 to about amino acid 240, the sequence identity with the proteins of the domain associated with the heavy metals at about amino acid 23 to about amino acid 45, and the sequence identity with the 2-hydroxy acid dehydrogenase specific to the D-isomer at about amino acid 24 to about amino acid 34. The clone DNA30862- 1396 has been deposited with the ATCC on June 2, 1998, and assigned the no. of deposit ATCC 209920.

The analysis of the amino acid sequence of the full-length PRO203 suggests that it possesses sequence similarity with the GST ATPase, thus indicating that the PRO203 may be a new GST ATPase. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), reveals the homology between the amino acid sequence of PRO203 and the following Dayhoff sequences, AF008124_1, CFRCD1GEN_1, and P R82566.

-S3a. * 4l "£, EXAMPLE 12: Isolation of cDNA Clones Encoding Human PRO290 A DNA database with expressed sequence mark (EST) was searched (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) and identified a EST that has homology with beige and FAN. An oligonucleotide probe based on the identified EST sequence was then synthesized and used to select the human fetal kidney cDNA libraries in an attempt to identify a full-length cDNA clone. The oligonucleotide probe had the following sequence: 5 'TGACTGCACTACCCCGTGGCAAGCTGTTGAGCCAGCTCAGCTG 3' (SEQ ID NO: 3).

RNA was isolated for the construction of cDNA libraries from human fetal kidney tissue. The cDNA libraries used to isolate the cDNA clones encoding human PRO290 were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, bound with the blunt portion to the - ^ - ^ fUf- '' '-' "• ^ '• -a? ri¡Tl'f jilj __? _ ^? ^^^ _ ^^^. ^ hemicinase adapters from Salí, split with Notl, appropriately sized by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector (such • as pRKB or pRKD; pRK5B which is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.

One cDNA clone was identified and sequenced • In its whole. The complete nucleotide sequence of DNA35680-1212 is shown in Figure 22 (SEQ ID NO: 32). The clone DNA35680-1212 contains a single open reading structure with a site of initiation of apparent translation at positions 293-295 of the nucleotide and terminates at the stop codon at positions 3302-3304 of the nucleotide (Figure 22; SEQ ID NO: 32). The predicted polypeptide precursor is 1003 amino acids of length.

It is currently believed that the PRO290 polypeptide is related to FAN and / or beige. The clone DNA35680-1212 has been deposited with the ATCC and is assigned the no. of deposit of the ATCC 209790. It , -tt-t.U-H-tfHHig-ri-áÍM-i-M - - means that the deposited clone has the correct current sequence in place of the representations provided herein. The full length PRO290 protein shown in • Figure 23 has an estimated molecular weight of approximately 112,013 daltons and a pl of approximately 6.4.

EXAMPLE 13: Isolation of cDNA Clones Encoding to Human PR0874 • A consensus DNA sequence designated herein as DNA36459 was identified using phrap as described in Example 1 above. Based on the DNA36459 consensus sequence, oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a clone from the coding sequence for PR0874 . PCR primers (reverse front forward PCR primer) were synthesized TCGTGCCCAGGGGCTGATGTGC-3 SEQ ID NO 37) ... ^. ^,.,. «S .. > ^. ^ .... ", reverse PCR primer 5 * -GTCTTTACCCAGCCCCGGGATGCG-3 '(SEQ ID NO: 38). Additionally, a probe of the synthetic oligonucleotide hybridization was constructed from of the consensus DNA36459 sequence having the following nucleotide sequence: 5 'hybridization probe -GGCCTAATCCAACGTTCTGTCTTCAATCTGCAAATCTATGGGGTCCTGGG-3' (SEQ ID NO: 39). 10 ^? To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate the clones encoding the PR0874 gene using the Igonuc 1 eot removed probe and one of the PCR primers. The RNA was isolated for the construction of the cDNA libraries from human fetal lung tissue (LIB25).

Sequencing the DNA of the isolated clones as described above gave the Full length DNA sequence for PR0874 - [designated here as DNA40621-1440] (SEQ ID NO: 35) and the proton sequence derived for PR0874. • 5 The complete nucleotide sequence of the DNA40621-1440 is shown in Figure 24 (SEQ ID NO: 35). Clone DNA40621-1440 contains a single open reading structure ending at the stop codon at positions 964-966 of the nucleotide (Figure 24). The precursor of the polypeptide • predicted encoded by DNA40621-140 is 321 amino acids long (Figure 25). The protein of PR0874 shown in Figure 25 has an estimated molecular weight of approximately 36,194 daltons and a pl of about 9.85. The analysis of the amino acid sequence PR0874 shown in Figure 25 (SEQ ID NO: 36) reveals the • presence of the following: the type II transmembrane domain in approximately amino acids 57-80; the additional transmembrane domains at approximately amino acids 110-126, 215-231, and 254-274; potential N-glycosylation sites at approximately amino acids 16-19, 27-30, and 289-292; the identity of sequence with the proteins of the YBR002c - - hypothetical family in approximately amino acids 276-287; and the sequence identity with the ammonium transporter proteins at approximately amino acids 204-230. The clone DNA40621 - 1440 has been • 5 deposited with the ATCC on June 2, 1998, and the no. of deposit ATCC 209922.

Analysis of the amino acid sequence of the full-length PR0874 polypeptide suggests that he himself is a transmembrane protein with ^ - mult i-spaces. However, an analysis of the Dayhoff database (version 35.45 SwissProt 35) reveals the sequence identity between the amino acid sequence of PR0874 and the following Dayhoff sequences: S67049, AF054839_1, S73437, S52460, and HIVU80570_1.

• EXAMPLE 14: Isolation of cDNA Clones Encoding Human PRO710 A yeast selection assay was employed to identify the cDNA clones that encoded the potential secreted proteins. The use of yeast selection assay allowed the identification of a single cDNA clone whose sequence (designated here as DNA38190 is shown > & ^^ & fc ^ - - in Figure 28 (SEQ ID NO: 42). Based on the sequence DNA38190 shown in Figure 28, oligonucleotides 1) were synthesized to identify by PCR a cDNA library that • contains the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for the PRO710. To select several libraries for a full-length clone, the DNA was selected of the libraries by amplifying with • PCR, as indicated in Ausubel et al., Current Protocois in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate the clones that encode the gene from interest using the probe oligonucleotide and one of the primer pairs.

PCR primers were synthesized (forward and reverse 20 forward PCR primer 5 '-TTCCGCAAAGAGTTCTACGAGGTGG-3' (SEQ ID NO: 43) 5 'reverse PCR primer -ATTGACAACATTGACTGGCCTATGGG-3' (SEQ ID NO: 44) Additive, constructed a 25 oligonucleotide synthetic hybridization probe from - of DNA38190 sequence having the following nucleotide sequence: 5 'hybridization probe -GTGGATGCTCTGTGTGCGTGCAAGATCCTTCAGGCCTTGTTCCAGTGTGA-3' (SEQ ID NO: 45).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the pair of the PCR primer identified above. A positive library was then used to isolate the clones encoding the PRO710 gene using the probe oligonucleotide and one of the PCR primers.

RNA was isolated for the construction of cDNA libraries from human fetal kidney tissue (LIB227). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, ligated with the blunt portion to the hemicinase adapters of SalI, excised with NotI, appropriately sized by gel electrophoresis, and cloned in a defined orientation in a vector of suitable cloning (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D that does not contain • the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.

A full-length clone was identified that contains a single open reading structure • with an apparent translation initiation site at positions 67-69 of the nucleotide and ending at the stop codon at positions 1765-1767 of the nucleotide (Figure 26; SEQ ID NO: 40). The precursor of the predicted polypeptide is 566 amino acids in length, has a calculated molecular weight of approximately 65,555 daltons and an estimated pl of • approximately 5.44. The sequence analysis of the full-length PRO710 shown in the Figure 27 (SEQ ID NO: 41) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 32, a transmembrane domain approximately from the amino acid 454 up to about amino acid-476, a signature sequence of aminoacyl-trans trans RNA synthase class II approximately from amino acid 6 to about amino acid 26 and potential N-glycoside sites • Approximately from amino acid 111 to approximately amino acid 114, approximately from amino acid 146 to approximately amino acid 149 and approximately from amino acid 292 to approximately 10 amino acid 295. The clone DNA44161- • 1434 has been deposited with the ATCC on May 27, 1998, and was assigned the no. of deposit ATCC 209907.

An analysis of the amino acid sequence 15 of the full-length PRO710 polypeptide suggests that it possesses significant sequence similarity to the CDC45 protein, indicating by • Therefore, the PRO710 can be a new counterpart of CDC45. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), demonstrates the homology between the amino acid sequence of the PRO710 and the following Dayhoff sequences: HSAJ3728_1, CEF34D10_1, S64939, UMU50276_1, TRHY_SHEEP, CELT14E8_1, RNA1_YEAST , LVU89340_1, 25 HSU80736_1 and CEZK337_2.

- - EXAMPLE 15: Isolation of cDNA Clones Encoding Human PR01151 A consensus DNA sequence was assembled in relation to other EST sequences using phrap • 5 as described in Example 1 above. This consensus sequence is designated herein as DNA40665. Based on the DNA40665 consensus sequence, oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR01151.

PCR primers (forward and reverse) were synthesized: 5 'forward PCR primer -CCAGACGCTGCTCTTCGAAAGGGTC-3 * (SEQ ID NO: 48) 5' inverse PCR primer 5 -GGTCCCCGTAGGCCAGGTCCAGC-3 '(SEQ ID NO: 49) In addition, a synthetic hybridization probe of the oligonucleotide was constructed from the DNA40665 sequence having the following nucleotide sequence: 5 'hybridization probe -CTACTTCTTCAGCCTCAATGTGCACAGCTGGAATTACAAGGAGACGTACG-3' (SEQ ID NO: 50) To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones that • encode the PR01151 gene using the oligon leotido probe and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from kidney tissue fetal huma no.

The sequencing of the DNA of the clones PP isolated as described above gave the full-length DNA sequence for PR01151 [designated here as DNA44694-1500 [Figure 29, SEC. ID NO: 46]; and the sequence of the protein derived for PR01151.

The complete nucleotide sequence of DNA44694-1500 is shown in Figure 29 (SEQ ID NO: 46). Clone DNA44694 - 1500 contains a single open reading structure with an apparent translation initiation site at positions 272-274 of the nucleotide and ends at the codon of • 5 stop at positions 1049-1051 of the nucleotide (Figure 29). The predicted polypeptide precursor is 259 amino acids in length (Figure 30). The full-length PR01151 protein shown in Figure 30 has an estimated molecular weight of approximately 28,770 daltons and a pl • approximately 6.12. An analysis of the sequence of the full-length PR01151 shown in Figure 30 (SEQ ID NO: 47) evidences the presence of the following: a signal peptide of Approximately from amino acid 1 to approximately amino acid 20, a potential N-glycosylation site approximately from • amino acid 72 to approximately amino acid 75 and the blocks of the amino acid sequence that have homology with the proteins containing the Clq domain roughly from amino acid 144 to about amino acid 178, approximately from amino acid 78 to about amino acid 111 and so approximate from amino acid 84 to '^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ approximately amino acid 117. Clone UNQ581 (DNA44694-1500) has been deposited with the ATCC on August 11, 1998 and assigned the no. of deposit of ATCC 203114.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 30 (SEQ ID NO: 47), evidences the homology between the amino acid sequence of PR01151 and the following Dayhoff sequences: ACR3_HUMAN, HP25_TAMAS, HUMC1QB2_1, P_R99306, CA1F_HUMAN, JX0369, CA24_HUMAN, S32436, P_R28916 and CA54_HUMAN.

EXAMPLE 16: Isolation of cDNA Clones Encoding Human PRQ1282 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA33778. Based on the DNA33778 consensus sequence, the oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for the PR01282. PCR primers were synthesized (forward • 5 and inverse): forward PCR primer 5 'TCTTCAGCCGCTTGCGCAACCTC3' (SEQ ID NO: 53); and reverse PCR primer 5 'TTGCTCACATCCAGCTCCTGCAGG3' (SEQ ID NO: 54). Additionally, a synthetic hybridization probe of the oligonucleotide was constructed from the consensus DNA33778 sequence having the following nucleotide sequence of 5 'hybridization probe TGGATGTTGTCCAGACAACCAGCTGGAGCTGTATCCGAGGC3' (SEQ ID NO: 55).

To select multiple libraries from a source of a full-length clone, selected the DNA of the libraries by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01282 gene using the probe oligonucleotide and one of the PCR primers.

RNA was isolated for the construction of cDNA libraries from human fetal liver. • 5 DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR01282 [designated here as DNA45495-1550 [Figure 31, SEC. ID NO: 51]; and the sequence of the protein derived for PR01282. • The complete nucleotide sequence of PR01282 is shown in Figure 31 (SEQ ID NO: 51). The clone DNA45495-1550 contains a single structure of open reading with an apparent translation initiation site at positions 120-122 of the nucleotide, and ending at the stop codon at positions 2139-2141 of the nucleotide (Figure 51). The predicted polypeptide precursor is 673 amino acids in length. The signal peptide is at approximately amino acids 1-23; the transmembrane domain is at approximately amino acids 579-599; a mark of the cysteine pattern of the EGF-like domain starts at approximately amino acid 430; and leucine closure templates or templates start at approximately amino acids 197 and 269 of the SEC. ID NO: 52, see Figure 32. Clone DNA45495 - 1550 has been deposited with the ATCC and assigned the no.

• ATCC deposit 203156. The full-length PR01282 protein shown in Figure 32 has an estimated molecular weight of approximately 71,655 daltons and a pl of approximately 7.8.

An analysis of the Dayhoff database • (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 32 (SEQ ID NO: 52), revealed the identity of sequence between the amino acid sequence of PR01282 and the following Dayhoff sequences (data from the database incorporated for reference): • AB007876_1, RNPLGPV_1, MUSLRRP_1, ALS_PAPPA, AC004142_1, ALS_HUMAN, AB014462_1, DMTARTAN_1, HSCHON03_1 and S46224.

EXAMPLE 17: Isolation of cDNA Clones Encoding Human PR0358 Using the method described in Example 1 above, from a human retinal tissue library. A unique EST sequence was identified in the Incyte database, designated herein as INC3115949. Based on the EST sequence INC3115949, the oligonucleotides were synthesized for • 5 identify by PCR a cDNA library containing the sequence of interest, and to be used as probes to isolate a full-length coding sequence clone for PR0358. forward PCR primer • 5 '-TCCCACCAGGTATCATAAACTGAA-3' (SEQ ID NO: 58) 5 'reverse PCR primer -TTATAGACAATCTGTTCTCATCAGAGA-3' (SEQ ID NO: 59) A probe was also synthesized: 15 5 '-AAAAAGCATACTTGGAATGGCCCAAGGATAGGTGTAAATG-3' (SEQ ID NO: 60).

To select multiple libraries from a source of a full-length clone, selected the DNA of the libraries by PCR amplification with the pair of the PCR primer identified above. A positive library was then used to isolate the clones encoding the PR0358 gene using the probe oligonucleotide and one of the PCR primers.

- - RNA was isolated for the construction of cDNA libraries from the human spinal cord (LIB256). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, ligated with the blunt portion to the Sali hemicinase adapters, excised with NotI, appropriately sized by gel electrophoresis, and cloned in a defined orientation in a vector suitable cloning (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D not containing the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) at the unique Xhol and NotI sites.

DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR0358 (Figure 33, SEQ ID NO: 56) and the sequence of the derived protein for PR0358 (Figure 34, SEC.

NO: 57).

The complete nucleotide sequence of the identified clone (DNA47361-1154) is shown in Figure 33 (SEQ ID NO: 56). Clone DNA47361 - 1154 contains a single open reading structure with an apparent translation initiation site (initial signal • ATG) at the nucleotide positions underlined in Figure 33. The predicted polypeptide precursor is 811 amino acids in length, including a putative signal sequence (amino acids 1 to 19), an extracellular domain (amino acids 20 to 275, including the leucine-rich repeats in the • region from position 55 to position 575), a putative t ansmembrane domain (amino acids 576 to 595). The clone DNA47361 - 1154 has been deposited with the ATCC and assigned the no. of deposit ATCC 209431.

EXAMPLE 18: Isolation of cDNA Clones Encoding Human PRO1310 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA37164. Based on the consensus sequence DNA37164, oligonucleotides were synthesized 1) to identify a cDNA library by PCR containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for the PRO1310. • PCR primers (forward and reverse) were synthesized: forward PCR primer: 5 'GTTCTCAATGAGCTACCCGTCCCC3' (SEQ ID NO: 63) and 10 reverse PCR primer: • 5 'CGCGATGTAGTGGAACTCGGGCTC3' (SEQ ID NO: 64). Additionally, a synthetic hybridization probe of the oligonucleotide was constructed from the consensus DNA47394 sequence having the following nucleotide sequence: hybridization probe: 5 'ATCCGCATAAACCCTCAGTCCTGGTTTGATAATGGGAGCATCTGCATGAG3' (SEQ ID NO: 65 ).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PRO1310 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from liver tissue • human fetal.

DNA sequencing of the isolated clones as described above gave the full length DNA sequence for the PRO1310 é and the sequence of the protein derived for the PRO1310.

The complete nucleotide sequence of PRO1310 is shown in Figures 35A-B (SEQ ID NO: 61). Clone DNA47394-1572 contains a single open reading frame with an apparent translation initiation site at positions 326-328 of the nucleotide, and an apparent stop codon at positions 2594-2596 of the nucleotide.

(Figure 61). The predicted polypeptide precursor is 765 amino acids in length. The signal peptide is at approximately amino acids 1-25 of the SEC. ID NO: 62. Clone DNA47394 - 1572 has been deposited with the ATCC and assigned no. from deposit of ATCC 203109. The full-length PRO1310 protein shown in Figure 36 has an estimated molecular weight of about 85,898 daltons and a pl of about 6.87. • 5 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 36 (SEQ ID NO: 62), revealed the sequence identity between the amino acid sequence of the • PRO1310 and the following Dayhoff sequences: AF017639_1, P_W36817, JC5256, CBPH_HUMAN, MMU23184_1, CBPN_HUMAN, HSU83411_1, CEF01D4_7, RNU62897_1 and P W11851. EXAMPLE 19: Isolation of cDNA Clones Encoding Human PR0698 A yeast selection assay was used to identify the cDNA clones they encoded the potential secreted proteins. The use of yeast selection assay allowed the identification of a single cDNA clone whose sequence (designated here as DNA39906 is shown in Figure 39 (SEQ ID NO: 68). sequence DNA39906 shown in Figure 39, oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a clone of coding sequence. full length for PR0698. To select several libraries for a full-length clone, the DNA of the libraries was selected by PCR amplification, as indicated in Ausubel et al., Current 10 Protocols in Molecular Biology, with the primer pair • PCR. A positive library was then used to isolate the clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs. PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-AGCTGTGGTCATGGTGGTGTGGTG-3 '(SEQ ID NO: 69) 20 reverse PCR primer 5'-CTACCTTGGCCATAGGTGATCCGC-3' (SEQ ID NO: 70) Adi On the other hand, a synthetic hybridization probe of the oligonucleotide was constructed from the DNA39906 sequence having the following nucleotide sequence: -. ^ ¿^ -a-áS-- -. ' - 5 'hybridization probe -CATCAGCAAACCGTCTGTGGTTCAGCTCAACTGGAGAGGGTT-3' (SEQ ID NO: 71) • 5 To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the pair of the PCR primer identified above. A positive library jPb 10 was then used to isolate the clones encoding the PR0698 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from bone marrow tissue human spinal (LIB255). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, bound with the blunt portion to the hemicinase adapters of SalI, excised with NotI, appropriately sized by gel electrophoresis, and cloned in a defined orientation in a Suitable cloning vector (such as pRKB or pRKD; - -pRK5B which is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.

A full-length clone containing a single open reading frame with an apparent translation initiation site at positions 14-16 of the nucleotide and ending at the stop codon at positions 1544-1546 of the nucleotide was identified (Figure 37; SEC ID NO: 66). The predicted polypeptide precursor is 510 amino acids in length, has a calculated molecular weight of about 57,280 daltons and an estimated pl of about 5.61. Sequence analysis of the full-length PR0698 shown in Figure 38 (SEQ ID NO: 67) evidences the presence of the following: a signal peptide roughly from amino acid 1 to about amino acid 20, potential N-glycosylation sites approximately from amino acid 72 to approximately amino acid 75, approximately from amino acid 136 to approximately amino acid 139, approximately from amino acid 193 to , -i-t-i-a-i-a-W-t-i-i-. - - approximately amino acid 196, approximately from amino acid 253 to approximately amino acid 256, approximately from amino acid 352 to approximately amino acid 355 and approximately from amino acid 411 to approximately amino acid 414 and a block of amino acids having homology to legume lectin beta chain proteins roughly from amino acid 20 to about amino acid 39 and an amino acid block having homology to the HBGF / FGF family of proteins approximately from amino acid 338 to approximately amino acid 365. Clone DNA48320-1433 has been deposited with the ATCC on May 27, 1998, and was assigned no. of deposit ATCC 209904.

An analysis of the amino acid sequence of the full-length PR0698 polypeptide suggests that it itself possesses significant sequence similarity to the ol fact omedin protein, thus indicating that PR0698 may be a new homolog of the ol fact omedin. More specifically, an analysis of the database s ^ fs afe • uu - - Dayhoff (version 35.45 SwissProt 35), reveals the homology between the amino acid sequence of PR0698 and the following sequences Dayhoff, OLFM_RANCA, 173637, AB006686S3_1, RNU78105_1, 5 RNU72487_1, P_R98225, CELC48E7_4, CEF11C3_3 , XLU85970_1 and S42257.

EXAMPLE 20: Isolation of cDNA Clones Encoding Human PR0732 10 A yeast selection assay was employed • to identify the cDNA clones that encoded the potential secreted proteins. The use of yeast selection assay allowed the identification of a single cDNA clone whose The sequence (designated here as DNA42580 is shown in Figure 45 (SEQ ID NO: 77) The DNA42580 sequence was then compared to a variety of known EST databases to identify the homologies. include public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the BLAST or BLAST2 computer program [Altschul, 25 Methods in Enzymology 266: 460-480 (1996)) as a comparison for a translation of structure 6 of the EST sequence. Those comparisons that result in a Blast record of 70 (or in some cases, 90) or higher that did not code • Known proteins were pooled and assembled in consensus DNA sequences with the "phrap" program (Phil Green, University of Washington, Seattle, Washington).

Using the previous analysis, a • Consensus DNA sequence was assembled in relation to other EST sequences using phrap. This consensus sequence is referred to herein as a consensus. EST sequences owned by Genentech 15 are used in the consensus assembly and are designated herein as DNA20239 (Figure 32; SEQ ID NO: 74), DNA38050 (Figure 43; SEQ ID NO: 75) and DNA40683 (Figure 44; SEQ ID NO: 76).

Based on the consensus sequence, the oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a clone from full length coding sequence for - - PR0732. The forward and reverse primers were generally in the range from 20 to 30 nucleotides and are often designed to give a PCR product of approximately 100-1000 bp • of length. The sequence of the probe is typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. For select several libraries for a clone of • full length, the DNA of the libraries was selected by PCR amplification, as indicated by Ausubel et al., Current Protocols in Molecular Biology, with the PCR primer pair. A The positive library was then used to isolate the clones that encode the gene of interest using the 11 g or 1 g or 11 g of probe and one of • the primer pairs.

PCR primers were synthesized (forward and inverse): front PCR primer '-ATGTTTGTGTGGAAGTGCCCCG-3 '(SEQ ID NO: 78) forward PCR primer 25 5'-GTCAACATGCTCCTCTGC-3' (SEQ ID NO: 79) # s- - - Reverse PCR primer 5'-AATCCATTGTGCACTGCAGCTCTAGG-3 '(SEQ ID NO: 80) Reverse PCR primer 5'-GAGCATGCCACCACTGGACTGAC-3' (SEQ ID NO: 81) • 5 Additionally, a probe was constructed Synthetic hybridization of the oligonucleotide from the DNA44143 sequence having the following nucleotide sequence: 5 'hybridization probe -GCCGATGCTGTCCTAGTGGAAACAACTCCACTGTAACTAGATTGATCTATGCAC-3' • (SEQ ID NO: 82) To select multiple libraries from a source of a full-length clone, selected the DNA of the libraries by PCR amplification with the pair of the PCR primer identified above. A positive library • was then used to isolate the clones encoding the PR0732 gene using the probe oligonucleotide and one of the PCR primers.

RNA was isolated for the construction of cDNA libraries from human fetal lung tissue (LIB26). The cDNA libraries used to isolate cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, • bound with the blunt portion to Sali hemicinase adapters, cleaved with Notl, was appropriately sized by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D that does not contain • the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.

A full-length clone containing a single open reading structure with an apparent translation initiation site was identified in • positions 88-90 of the nucleotide and ends at the stop codon found in the positions 1447-1449 of the nucleotide (Figure 40; SEQ ID NO: 72). The predicted polypeptide precursor is 453 amino acids in length, has a calculated molecular weight of about 50,419 daltons and an estimated pl of about 5.78. The analysis of sequence of the full-length PR0732 shown = g ... "- '.. -_ ^ * and .. ~ -.- ** g- ^ kj ^ .it-» 5gJ% gfes5. ^,.

- - Figure 41 (SEQ ID NO: 73) shows the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 28, the domains of • transmembrane roughly from amino acid 37 to approximately amino acid 57, approximately from amino acid 93 to approximately amino acid 109, approximately from amino acid 126 to approximately amino acid 148, so • approximate from e 1 amino acid 151 to approximately amino acid 172, approximately from amino acid 197 to approximately amino acid 215, approximately from amino acid 231 to approximately amino acid 245, approximately from amino acid 260 to • approximately amino acid 279, approximately from amino acid 315 to about amino acid 333, roughly from amino acid 384 to about amino acid 403 and roughly from amino acid 422 to about amino acid 447, potential N-glycosylation sites approximately from amino acid 33 to about amino acid 36, approximately from amino acid 34 to approximately amino acid 37, approximately from amino acid 179 to • about amino acid 183, approximately from amino acid 298 to about amino acid 301, approximately from amino acid 337 to about amino acid 340 and so approximate from amino acid 406 to ^ about amino acid 409, a block of amino acids that has homology to the MIP family of proteins roughly from amino acid 119 to about amino acid 149 and a block of amino acids having homology to the endonuclease proteins nonspecific DNA / RNA approximately from amino acid 279 to approximately amino acid 386. Clone DNA48334-1435 has been deposited with the ATCC on 2 June 20, 1998, and was assigned the no. of deposit ATCC 209924.

An analysis of the amino acid sequence of the full-length PR0732 polypeptide suggests that he himself possesses significant sequence similarity to the Diff33 protein, thus indicating that PR0732 may be a new homolog of Diff33. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), demonstrates the homology between the amino acid sequence of PR0732 and the following Dayhoff sequences, HS179M20_2, MUSTETU_1, CER11H6_2, RATDRP_1, S51256, E69226, AE000869_1, JC4120, CYB_PARTE and P R50619.

EXAMPLE 21: Isolation of cDNA Clones Encoding Human PR01120 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as consen0352. The sequence f consen0352 was then extended using the repeated cycles of BLAST and phrap to extend the consensus sequence as much as possible using the sources of the EST sequences described above. The extended consensus sequence was designated herein as DNA34365. Based on the consensus sequence DNA34365, the oligonucleotides were synthesized 1) -S. . ~ v,. . afea ». Ji? G - '? Tefea -.- «y- ^ A- i.p .. ^., G .. - - to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone • 5 of PRO1120.

PCR primers (forward primer or PCR primers 10 5 '-GAAGCCGGCTGTCTGAATC-3' (SEQ ID NO: 85), • 5 '-GGCCAGCTATCTCCGCAG-3' (SEQ ID NO: 86), 5 '- were synthesized. AAGGGCCTGCAAGAGAAG-3 SEQ ID NO: 87 5 '-CACTGGGACAACTGTGGG-3' (SEQ ID NO: 88), 5 '-CAGAGGCAACGTGGAGAG-3 * (SEQ ID NO: 89), and 15 5' -AAGTATTGTCATACAGTGTTC-3 ' (SEQ ID NO: 90); reverse PCR primers: 5 '-TAGTACTTGGGCACGAGGTTGGAG-3' (SEQ ID NO: 91), and f 5 '-TCATACCAACTGCTGGTCATTGGC-3' (SEQ ID NO: 92). In addition, a 20 hr synthetic oligonucleotide probe was constructed from the consensus DNA34365 sequence having the following nucleotide sequence: 5 'hybridization probe -CTCAAGCTGCTGGACACGGAGCGGCCGGTGAATCGGTTTCACTTG-3' 25 (SEQ. ID NO: 93).To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by • PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PRO1120 gene using the probe oligonucleotide and one of the PCR primers.

RNA was isolated for the construction of the • cDNA libraries from human fetal kidney tissue.

DNA sequencing of clones 15 isolated as described above gave the full-length DNA sequence for PRO1120 [designated here as DNA48606- 1479 • [Figures 46A-B, SEC. ID NO: 83]; and the sequence of the protein derived for PRO1120. 20 The complete nucleotide sequence of PRO1120 is shown in Figures 46A-B (SEQ ID NO: 83). Clone DNA48606- 1479 contains a single open reading structure with a site of initiation of apparent translation in the positions - 608-610 of the nucleotide, and an apparent stop codon at positions 3209-3211 of the nucleotide. The predicted polypeptide precursor is 867 amino acids in length. The full-length PRO1120 protein shown in Figure 47 has an estimated molecular weight of approximately 100,156 daltons and a pl of approximately 9.44. Additional features of the PRO1120 polypeptide include a signal peptide at about amino acids 1-17; a sulfatase label is at approximately amino acids 86-98; the homology regions with the sulphatases are at approximately amino acids 87-106, 133-146, 216-229, 291-320, and 365-375; and the Ng 1 icos sites in approximately amino acids 65-68, 112-115, 132-135, 149-152, 171-174, 198-201, 241-245, 561-564, 608-611, 717 -720, 754-757, and 764-767.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 47 (SEQ ID NO: 84), revealed the sequence identity between the amino acid sequence of the * .- c ^ - ^ ¿-a --- ac-a »? t? - ..

- - PRO1120 and the following Dayhoff sequences: CELK09C4_1, GL6S_HUMAN, G65169, NCU89492_1, BCU44852_1, E64903, P_R51355, STS_HUMAN, GA6S_HUMAN, and IDS_M0USE. The clone DNA48606- 1479 has been • 5 deposited with the ATCC on July 1, 1998, and assigned the no. of deposit ATCC 203040.

EXAMPLE 22: Isolation of cDNA Clones Encoding Human PR0537 10 Using the Signal Sequence Algorithm • described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated as the Incyte EST group no. 29605. This sequence of the EST group is then compared with a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) 20 to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or older records that did not - - encode the known proteins, were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green , University of Washington, Seattle, Washington). The The consensus sequence obtained therefrom was designated herein as DNA48350.

In light of a sequence homology observed between the DNA48350 consensus sequence and an EST sequence encompassed within the Merck EST clone no. R63443, Merck EST clone R63443 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. Sequence of this cDNA insert is shown in Figure 48 and is designated herein as DNA49141-1431. PP Clone DNA49141-1431 contains a single open reading frame with an apparent translation initiation site in the 97- position. 99 of the nucleotide and ends at the stop codon at positions 442-444 of the nucleotide (Figure 48). The predicted polypeptide precursor is 115 amino acids in length (Figure 49). The protein of the full-length PR0537 shown in Figure 49 has an estimated molecular weight of approximately 13,183 daltons and a pl of approximately 12.13. The analysis of the sequence • 5 of the full-length PR0537 shown in Figure 49 (SEQ ID NO: 95) evidences the presence of the following: a signal peptide roughly from amino acid 1 to about amino acid 31, an N-site - Potential glycosylation approximately from • amino acid 44 up to about amino acid 47, the potential N-mi r i s toi 1 ation sites approximately from amino acid 3 to about amino acid 8 and a block of amino acids having homology with the oxidase proteins with multicope roughly from amino acid 97 to approximately amino acid 105. Clone DN A 49141-1431 has been deposited with the ATCC on June 23, 1998, and was assigned the no. of deposit ATCC 203003.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the The full length sequence shown in Figure 49 (SEQ ID NO: 95), demonstrates the homology between the amino acid sequence of PR0537 and the following Dayhoff sequences: A54523, CELF22H10_2, FKH4_M0USE, 0TX1_HUMAN, URB1_USTMA, KNOB_PLAFN, • 5 A32895_l, AF036332_1, HRG_HUMAN and HRP3_PLAFS.

EXAMPLE 23: Isolation of cDNA Clones Encoding Human PR0536 Using the Signal Sequence Algorithm described in Example 3 above allowed the • identification of a sequence of the group EST of the database Incyte, designated as ss. clu2437. Item . This sequence of the EST group was then compared to a variety of databases expressed sequence mark (EST) including public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing hoologies. The The search for homology was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymoloqy 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater than no encoded the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it • 5 was designated herein as DNA48351.

In light of a sequence homology observed between the DNA48351 consensus sequence and an EST sequence encompassed within the EST clone of Merck no. H11129, the Merck EST clone was purchased • H11129 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 50 and is designated herein as DNA49142-1430.

The clone DNA49142-1430 contains a single open reading structure with a site of initiation of apparent translation in positions 48-50 of the nucleotide and ends at the stop codon at positions 987-989 of the nucleotide (Figure 50). The predicted polypeptide precursor is 313 amino acids in length (Figure 51). The full length PR0536 protein shown in Figure 51 has an estimated molecular weight of about 34,189 daltons and a pl of about 4.8. The sequence analysis of the full-length PR0536 shown in Figure 51 (SEQ ID NO: 97) demonstrates the presence of the following: a signal peptide roughly from amino acid 1 to about amino acid 25, an approximate potential N-glycoside site from amino acid 45 to approximately the amino acid 48 and a block of the amino acid sequence having homology with the sulphatase proteins roughly from amino acid 16 to about amino acid 26. The clone DNA49142-15 1430 has been deposited with the ATCC on June 23, 1998, and he was assigned the no. of deposit ATCC 203002. • An analysis of the Dayhoff 20 database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 51 (SEQ ID NO: 97), puts shows the homology between the amino acid sequence of PR0536 and the following 25 Dayhoff sequences: APU46857 1, - - PK2_DICDI, H64743, F5I14_18, CEAM_ECOLI, GEN14267, H64965, TCU39815_1, PSBJ_ODOSI and P_R06980.

EXAMPLE 24: Isolation of the cDNA Clones that • 5 Encode the Human PR0535 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the group EST of the Incyte database, designated as ss. clul 2694. ini t. This sequence of the EST group is • then compared with a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pha rmaceutica 1 s, Palo Alto, CA) to identify existing homologies. The homology search was performed using the • BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, 25 University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA48352. Two EST sequences owned by Genentech, shown here in Figures 54 and 55, were used in the assembly. • 5 In light of a sequence homology observed between the DNA48352 consensus sequence and an EST sequence encompassed within the Merck EST clone no. H86994, the Merck EST clone was purchased H86994 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 52 and is designated herein as DNA49143-152929.

Clone DNA49143-1429 contains a single open reading structure with an apparent translation initiation site in the positions 78-80 of the nucleotide and ends at the stop codon at positions 681-683 of the nucleotide (Figure 52). The predicted polypeptide precursor is 201 amino acids in length (Figure 53). The protein of full-length PR0535 shown in Figure 53 has an estimated molecular weight of - - approximately 22,180 daltons and a pl of approximately 9.68. , The analysis of sequence X of the full-length PR0535 shown in the Figure 53 (SEQ ID NO: 99) highlights the • presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 25, a transmembrane domain approximately from amino acid 155 to approximately amino acid 174, a potential N-glycosylation site • approximate from amino acid 196 to approximately amino acid 199 and the marking sequences of the cis-trans isomer of peptidyl lo-prolyl or FKBP type approximately from the amino acid 62 to approximately amino acid 77, approximately from amino acid 87 to approximately amino acid 123 and approximately from amino acid 128 to approximately amino acid 141. The clone DNA49143-1429 has been deposited with the ATCC on June 23, 1998, and was assigned no. of deposit ATCC 203013.

An analysis of the Dayhoff 25 database (version 35.45 SwissProt 35), using the analysis ----? --- ¿^^ "< ^ _. ^ < . .jS »i_t ...... - &;,.,:, ._ "?» Í3i ^ --- «-.] - M --- jSfet ---. of sequence alignment WU-BLAST-2 of the full-length sequence shown in Figure 53 (SEQ ID NO: 99), evidences the homology between the amino acid sequence of PR0535 and the • following Dayhoff sequences: S71237, P_R93551, P_R28980, S71238, FKB2_HUMAN, CELC05C8_1, S55383, S72485, CELC50F2 6 and S75144.

EXAMPLE 25: Isolation of the cDNA Clones that Encode Human PR0718 • A cDNA sequence isolated in the amylase selection described in Example 2 (human fetal lung library) above, was designated herein as DNA43512 (see Figure 62, SEQ ID NO: 108). The DNA43512 sequence was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons give as result a Blast record of 70 (or in some -r * * • & cases, 90) or older that did not code for the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of • 5 Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA45625. EST sequences owned by Genentech, shown here in Figures 58-61, were used in the assembly. 10 • Based on the DNA45625 consensus sequence, the oligonucleotide probes were generated and used to select a human fetal lung library (LIB25) prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the Sfil site, see Holmes et al., Science, 253: 1278-1280 (1991)), and the size cut of the cDNA was lower of 2800 bp. The PCR primers (front reverse primer 5 'forward PCR primer -GGGTGGATGGTACTGCTGCATCC-3 SEQ ID NO: 109) 25 reverse PCR primer -5' -TGTTGTGCTGTGGGAAATCAGATGTG-3 '(SEQ ID NO: 110) were further synthesized. a synthetic hybridization probe of the oligonucleotide from the consensus DNA45625 sequence having the following nucleotide sequence 5'-hybridization probe -GTGTCTGGAGGCTGTGGCCGTTTTGTTTTCTTGGGCTAAAATCGGG-3 '(SEQ ID NO: 111) To select several libraries of one • source of a full length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR0718 gene using the probe oligonucleotide and one of the PCR primers.

• A full-length clone 20 containing a single open reading frame with an apparent translation initiation site at positions 36-38 of the nucleotide was identified and terminates at the stop codon found at positions 607-609 of the nucleotide (FIG. 56; SEQ ID NO: 102). The predicted polypeptide precursor is 157-amino acids in length, has a calculated molecular weight of about 17,400 daltons and an estimated pl of about 5.78. A sequence analysis of the full length PR0718 shown • 5 in Figure 57 (SEQ ID NO: 103) evidences the presence of the following: a type II transmembrane domain approximately from amino acid 21 to approximately amino acid 40, and other transmembrane domains in approximately the amino acid 58 up # approximately amino acid 78, about amino acid 95 to about amino acid 114, and about amino acid 127 to about amino acid 147, a sequence of Cellular binding approximately from amino acid 79 to approximately amino acid 81, and a potential N-gl and cos • approximate manner from amino acid 53 to approximately amino acid 56. Clone DNA49647-2098 was deposited with the ATCC on June 2, 1998 and assigned no. of deposit of ATCC 209919.

An analysis of amino acid sequence 25 of full-length PR0718 suggests that he himself it has no significant sequence similarity to any known protein. However, an analysis of the Dayhoff database (version 35.45 SwissProt 35), shows some degree of homology between the amino acid sequence of PR0718 and the following Dayhoff sequences: AF045606_1, AF039906_1, SPBC8D2_2, S63441, F64728, C0X1_TRYBB, F64375, E64173, RPYGJT 3, MTCY261 23.

EXAMPLE 26: Isolation of the cDNA Clones that • Encode Human PR0872 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a unique Incyte EST sequence, designated herein as clu 12709. ini t. The sequence clul20709. my t was then compared to an EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search is performed using the BLAST or BLAST2 computer program (Altschul, Methods m Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the known proteins were pooled and - - assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated in 1 present it as DNA48254.

In light of a sequence homology observed between the DNA48254 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3438068, the EST clone of • Incyte no. 3438068 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 63 and is the full-length DNA sequence for PR0872. Clone DNA 49819-1439 has been deposited with the ATCC on June 2, 1998, and • was assigned the no. of deposit ATCC 209931.

The complete nucleotide sequence of DNA49819-1439 is shown in Figure 63 (SEQ ID NO: 112). Clone DNA49819-1439 contains a single open reading structure with an apparent translation initiation site in the positions 14-1 of the nucleotide and ends at the stop codon at positions 1844-1846 of the nucleotide (Figure 63). The predicted polypeptide precursor is 610 amino acids in length (Figure 64). The full-length PR0872 protein shown in • Figure 64 has an estimated molecular weight of approximately 66,820 daltons and a pl of approximately 8.65. The analysis of the sequence of the full-length PR0872 shown in Figure 64 (SEQ ID NO: 113) reveals the presence of the following: a signal peptide in the • amino acid 1 to approximately 18, putative transmembrane domains at approximately amino acids 70-87-, 200-222 and 568-588; sequence identity with phytoene protein dehydrogenase bacterial type at approximately amino acids 71-105; sequence identity with a regulator of the 2-mark of the condensation chromosome (RCC1) in • approximately amino acids 201-211; the templates or patterns of the closure of leucine in approximately amino acids 214-235, 221-242, 228-249 and 364-385; a potential N-glycosylation site at about amino acids 271-274; and a glycosaminoglycan binding site at about amino acids 75-78. An analysis of the amino acid sequence of the full-length PR0872 polypeptide using the Dayhoff database (version 35.45 SwissProt 35), demonstrates the homology between the amino acid sequence of PR0872 and the following sequences • Dayhoff: PRCRTI_1, S75951, S74689, CELF37C4_3, CRTI_RHOCA, S76617, YNI2_METTL, MTV014_14, AOFB_HUMAN, and MMU70429 1.

EXAMPLE 27: Isolation of the cDNA Clones that Code to the Human PRO1063 • The use of the signal sequence algorithm described in Example 3 above allowed the identification of a unique Incyte EST group sequence, designated herein as ss. clul 19743. mit. The sequence s s. clu 119743. Inti t EST group of Incyte was then compared to a variety of sequence mark databases • expressed (EST) that include public EST databases (for example, Genbank) and a database of particular DNA (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-2548 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for the known proteins, were pooled and assembled into a consensus DNA sequence with • the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA48288.

In light of a sequence homology observed between the DNA48288 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2783726, the EST clone of Incyte 2783726 was purchased and the cDNA insert was obtained and was sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 65 and is designated herein as DNA49820-1427. 20 The full-length clone shown in the Figure 65 contains a single open reading structure with an apparent translation initiation site at positions 90-92 of the nucleotide and terminates at the stop codon found at positions 993-995 of the nucleotide (Figure 65; SEQ ID NO: 114). The predicted polypeptide precursor is 301 amino acids in length, has a calculated molecular weight of approximately 33,530 • 5 daltons and an estimated pl of approximately 4.80. The sequence analysis of the full-length PRO1063 shown in Figure 66 (SEQ ID NO: 115) evidences the presence of the following: a signal peptide approximately from the amino acid 1 to approximately amino acid 21, ^^^ Potential N-glycosylation sites approximately from amino acid 195 to approximately amino acid 198, approximately from amino acid 217 to approximately amino acid 220 and approximately from amino acid 272 to approximately amino acid 275, a binding site • of the cosaminoglyph gl i roughly from amino acid 267 to about the amino acid 270, a signal site with a C-terminal target of the microbodies roughly from amino acid 299 to about amino acid 301, a sequence of homology with the collagen binding domain of fibronectin type II in a manner Approximately, from amino acid 127 to about amino acid 168 and a homologous sequence of the class II protein of aldolase of p-luctose-biphosphate approximately from amino acid 101 to about amino acid 118. Clone DNA49820-1427 has been deposited with the ATCC on June 2, 1998, and assigned the no. of deposit ATCC 209932.

An analysis of the amino acid sequence of the full length PRO1063 polypeptide suggests that it possesses sequence similarity with the human type IV collagenase protein. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), reveals some degree of homology between the amino acid sequence of PRO1063 and the following Dayhoff sequences, S68303, CFU68533_1, P_P91139, RNU65656_1, PA2R_RABIT, MMU56734_1, FINC_XENLA, A48925, P_R92778 and FA12_HUMAN.

EXAMPLE 28: Isolation of cDNA Clones Encoding Human PR0619 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated 88434. EST group sequence was then compared to a variety of expressed sequence mark (EST) databases that include EST databases • 5 public (for example, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST computer program or BLAST2 (Altschul, Methods in Enzymology 266: 460- • 480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were piled up and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington).

In light of a sequence homology 20 observed between the consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 1656694, the EST clone of Incyte 1656694 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert 25 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 67 and is designated herein as DNA49821-1562. • 5 The full length clone shown in the Figure 67 contains a single open reading structure with an apparent translation initiation site at positions 81-83 of the nucleotide and ends at the stop codon found in the positions 450-452 of the nucleotide (Figure 67; • ID NO: 116). The predicted polypeptide precursor (Figure 68, SEQ ID NO: 117) is 123 amino acids in length including a PRO polypeptide predicted at about amino acids 1-20. The PR0619 has a calculated molecular weight of about 13,710 daltons and an estimated pl of about 5.19. The clone DNA49821 - 1562 has been deposited with • the ATCC on July 16, 1998, and the no. of deposit ATCC 209981. 20 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in the Figure 68 (SEQ ID NO: 99), reveals the significant homology between the amino acid sequence of PR0619 and the following Dayhoff sequences: S35302, D87009_l, HSU93494_1, HUMIGLAM5_1, D86999_2, HUMIGLYM1_1, HUMIGLYMKE_1, A29491_l, A29498_l, and VPR2 MOUSE.

EXAMPLE 29: Isolation of cDNA Clones Encoding Human PRQ943 A consensus DNA sequence was assembled in relation to other EST sequences using phrap • as described in Example 1 above. This consensus sequence was then extended using the repeated cycles of BLAST and phrap to extend the consensus sequence as much as possible using the sources of the EST sequences described above. The extended consensus sequence is designated in the present as DNA36360. Based on the DNA36360 consensus sequence, the oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR0943. 25 ^^^^^^ ¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿&¿. «" XVv &L. PCR primers (forward and reverse) were synthesized: 5 'forward PCR primer -CGAGATGACGCCGAGCCCCC-3' (SEQ ID NO: 120) • 5 reverse PCR primer 5 * -CGGTTCGACACGCGGCAGGTG-3 '(SEQ ID NO: 121) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA36360 sequence having the following nucleotide sequence: 5'-hybridization probe -TGCTGCTCCTGCTGCCGCCGCTGCTGCTGGGGGCCTTCCCGCCGG-3 '(SEQ ID NO: 122) To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by P PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR0943 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from brain tissue human fetal.

DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR0943 • (designated here as DNA52192-1369 [Figure 29, SEQ ID NO: 118]) and the sequence of the derived protein for PR0943.

The complete nucleotide sequence of DNA52192-1369 is shown in Figure 69 (SEQ ID NO: 118). Clone DNA52192-1369 contains a single open reading structure with an apparent translation initiation site at positions 150-152 of the nucleotide and ends at the codon of detention at positions 1661-1664 of the nucleotide (Figure 69). The predicted polypeptide precursor is 504 amino acids in length (Figure 70). The full-length PR0943 protein shown in Figure 70 has an estimated molecular weight of about 54.53 daltons and a pl of about 10.04. An analysis of the sequence of the full-length PR0943 shown in Figure 70 (SEQ ID NO: 119) evidences the presence of the following: a signal peptide of Approximately from amino acid 1 to approximately amino acid 17, a transmembrane domain approximately from amino acid 376 to approximately amino acid 396, tyrosine kinase phosphorylation sites • Approximately from amino acid 212 to approximately amino acid 219 and approximately from amino acid 329 to approximately amino acid 336, the potential N-glycoside sites are approximate from the amino acid 111 up to about • amino acid 114, approximately from amino acid 231 to approximately amino acid 234, approximately from amino acid 255 to approximately amino acid 258 and so approximate from amino acid 293 to about amino acid 296 and a sequence homology block of MHC protein and immunoglobulin approximately from amino acid 219 to about amino acid 236. The clone DNA52192 - 1369 has been deposited with the ATCC on July 1, 1998 and was assigned the no. of deposit of ATCC 203042.

An analysis of the Dayhoff 25 database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 70 (SEQ ID NO: 119), puts evidence the significant homology between the amino acid sequence of the • 5 PR0943 and the following Dayhoff sequences: B49151, A39752, FGR1_XENLA, S38579, RATHBFGFRB_1, TVHU2F, FGR2_MOUSE, CEK3_CHICK, P_R21080 and A27171_l.

EXAMPLE 30: Isolation of cDNA Clones that Encode Human PR01188 • A consensus DNA sequence was assembled in relation to other EST sequences using "phrap" as described in Example 1 above. This consensus sequence is designated in the present as DNA45679. Based on the DNA45679 consensus sequence, oligonucleotides 1) were synthesized to identify a cDNA library by PCR • containing the sequence of interest, and 2) to be used as probes to isolate a clone from full-length coding sequence for PR01188.

PCR primers were synthesized (forward and reverse 25 forward PCR primer 5 '-CTGGTGCCTCAACAGGGAGCAG-3' (SEQ ID NO: 125) 5 'reverse PCR primer -CCATTGTGCAGGTCAGGTCACAG-3' (SEQ ID NO: 126) Additionally, it was constructed a probe • Synthetic hybridization of the oligonucleotide from the consensus DNA45679 sequence having the following nucleotide sequence: hybridization probe • CTGGAGCAAGTGCTCAGCTGCCTGTGGTCAGACTGGGGTC-3 SEC. ID NO: 127 To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01188 gene using the probe oligonucleotide and one of the PCR primers.

RNA was isolated for the construction of cDNA libraries from human fetal kidney tissue.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for the PR01188 (designated herein as DNA52598-1518 [Figure 71, SEC. ID NO: 123]); and the sequence of the protein derived for PR01188. • The complete nucleotide sequence of PR01188 is shown in Figure 71 (SEQ ID NO: 123). The clone DNA52598-1518 contains a single open reading structure with a site of initiation of apparent translation at positions 136-138 of the nucleotide, and ending at the stop codon at positions 3688-3690 of the nucleotide. The predicted polypeptide precursor is 1184 amino acids in length. The protein of Full length PR01188 shown in Figure 72 has an estimated molecular weight of about 132,582 daltons and a pl of about 8.80. Additional features include: a signal peptide in Approximately amino acids 1-31; a portion A of the ATP / GTP binding site (circuit P) at approximately amino acids 266-273; an active site of the aldehyde shidogenase cysteine at about amino acids 188-199; he growth fac and the 2 mark of the family of cytokine recep at approximately amino acids 153-159; and the potential N-glycosylation sites at about amino acids 129-132, 132-135, 346-349, 420-423, 550- • 553, 631-634, 1000-1003, and 1056-1059.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure • 72 (SEQ ID NO: 124), revealed significant homology between the amino acid sequence of PR01188 and the following Dayhoff sequences: SSU83114_1, S56015, CET21B6_4, CELT19D2_1, and TSP1 MOUSE.

The clone DNA52598-1518 has been deposited with the ATCC and assigned the no. ATCC Deposit 203107. EXAMPLE 31: Isolation of cDNA Clones Encoding Human PR01133 A consensus DNA sequence was assembled relative to other EST sequences using phrap 25 as described in Example 1 above. This consensus sequence was then extended using the repeated phrap cycles. The extended consensus sequence is designated herein as DNA38102. Based on the sequence of • DNA38102 consensus, oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR01133.

The PCR primers (two front and one inverse) were synthesized: primer 1 PCR 15 5 '-TCGATTATGGACGAACATGGCAGC-3' (SEQ ID NO: 130); primer 2 PCR forward 5 '-TTCTGAGATCCCTCATCCTC-3' (SEQ ID NO: 131); and reverse primer 5 -AGGTTCAGGGACAGCAAGTTTGGG-3 '(SEQ ID NO: 132). Additionally, a synthetic oligonucleotide probe was constructed from the consensus DNA38102 sequence having the following nucleotide sequence: 5 'hybridization probe TTTGCTGGACCTCGGCTACGGAATTGGCTTCCCTCTACGGACAGCTGGAT3' (SEQ ID NO: 133 ).

To select multiple libraries from a source of a full-length clone, • 5 selected the DNA of the libraries by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01133 gene using the 10 oligonucleotide probe and one of the PCR primers.

• RNA was isolated for the construction of the cDNA libraries from the human fetal pouch tissue.

The DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for the • PR01133 and the sequence of the derived protein for PR01133. The complete nucleotide sequence of PR01133 is shown in Figure 73 (SEQ ID NO: 128). The clone DNA53913- 1490 contains a single open reading structure with a site of initiation of apparent translation at positions 266-268 of the nucleotide and ending at the stop codon at positions 1580-1582 of the SEC nucleotide. ID NO: 128. The predicted polypeptide precursor is 438 amino acids in length. He • Signal peptide is at approximately amino acids 1-18 of the SEC. ID NO: 129. The cysteine pattern marks of the EGF-like domain begin at 315 and 385 of the SEC. ID NO: 129 as shown in Figure 74. The clone DNA53913- 1490 has been deposited with the ATCC and assigned the no. from • ATCC deposit 203162. The full-length PR01133 protein shown in Figure 74 has an estimated molecular weight of approximately 49,260 daltons and a pl of approximately 6.15. 15 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis ^ P of sequence alignment WU-BLAST-2 of the full-length sequence shown in the Figure 74 (SEQ ID NO: 129), reveals some sequence identity between the amino acid sequence of PR01133 and the following Dayhoff sequences (data from the database incorporated for reference): AF002717_1, LMG1_HUMAN, B54665, UNC6_CAEEL, LML1_CAEEL, LMA5_M0USE, MMU88353_1, LMA1_HUMAN, HSLN2C64 1 and AF005258 1 EXAMPLE 32: Isolation of cDNA Clones Encoding Human PR0784 • An initial DNA sequence (SEQ ID NO: 136), referenced herein as DNA44661 and shown in Figure 77, was identified using a yeast selection , in a cDNA library of human fetal lung that preferentially represents the 5 'ends of the primary cDNA clones. The DNA44661 sequence was then compared to the ESTs of the public databases (eg, Genbank), and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA), using the BLAST or BLAST2 computer program [Altschul, Methods in Enzymology 266: 460-480 (1996)]. The ESTs were stacked and assembled into a consensus DNA sequence using the "phrap" computer program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained was designated herein as "DNA45436". Based on the DNA45436 consensus sequence, the oligonucleotides were synthesized to be used as probes to isolate a coding sequence clone from jjaft ¿Amáu -r-fa .. ^ j¡- .. - Jtc ^ ju full length for PR0784 from a cDNA library of the human fetal lung.

The full-length clone DNA53978-1443 • 5 shown in Figure 75 contains a single open reading frame with an apparent translation initiation site at positions 37-39 of the nucleotide and ends at the stop codon found at positions 821-823 of the nucleotide (Figure 75, SEQ ID NO: 134). The precursor of • predicted polypeptide (Figure 76; SEQ ID NO: 135) is 228 amino acids in length. PR0784 has a calculated molecular weight of about 25,735 daltons and an estimated pl of about 5.45. The PR0784 has the following characteristics: a signal peptide at about amino acid 1 to about 15; the transmembrane domains in about • amino acids 68 to approximately 87 and in approximately 183 to approximately 204; the potential N-mythyst sites at approximately amino acids 15-20, 51-56, 66-60, 163-168, and 206-211; and an RNA binding region of the RNP-1 protein at about amino acids 108 and about 117. 25 Clone DNA53978-1443 has been deposited with the ATCC on June 16, 1998, and assigned no. of deposit ATCC 209983. • 5 Based on an alignment analysis of BLAST and FastA sequences (using the ALIGN computer program) of the full-length sequence, PR0784 showed an amino acid sequence identity with the following 10 proteins: RNU42209_1, MMU91538_1, CGU91742_1, • CELF55A4_6, SC22_YEAST, and F48188.

EXAMPLE 33: Isolation of cDNA Clones Encoding Human PR0783 A yeast selection assay was used to identify the cDNA clones that encoded the potential secreted proteins. The use of • yeast selection assay allowed the identification of a single cDNA clone, designated in the present as DNA45201 (Figure 80; SEQ ID NO: 139).

The DNA45201 sequence was then used to search the brand databases of expressed sequence (EST) the presence of potential homologies. EST databases include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The search • was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the known proteins were assembled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). An EST sequence owned by Genentech in the assembly was used of consensus and is designated herein as DNA14575 (Figure 81; SEQ ID NO: 140).

Based on the consensus sequence, the oligonucleotides 1) were synthesized for Identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR0783. To select multiple libraries for a full-length clone, the DNA of the libraries was selected by PCR amplification, as indicated by Ausubel et al. , Current Protocols in Molecular Biology, with the PCR primer pair. A positive library • 5 then used to isolate the clones that encode the gene of interest using the probe oligonucleotide and one of the primer pairs.

PCR primers were synthesized (forward • and inverse): 5 'forward PCR primer -GACTGTATCTGAGCCCCAGACTGC-3' (SEQ ID NO: 141), 15 5 'forward PCR primer -TCAGCAATGAGGTGCTGCTC-3' (SEQ ID NO: 142), and 5 'reverse PCR primer -TGAGGAAGATGAGGGACAGGTTGG-3 '(SEQ ID NO: 143).

• Additiona lly, a synthetic hybridization probe of the oligonucleotide was constructed from the consensus sequence having the following nucleotide sequence: 5 'hybridoma probe -TATGGAAGCACCTGACTACGAAGTGCTATCCGTGCGAGAACAGCTATTCC-3' ( SEC ID NO: 144). 25 To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the primer pair PCR • 5 identified above. A positive library was then used to isolate the clones encoding the PR0783 gene using the oligonucleotide ol probe and one of the PCR primers.

RNA was isolated for the construction of the cDNA libraries from human fetal kidney tissue (LIB228). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using reagents commercially available such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT which contains the NotI site, it was bound with the blunt portion to the f hemichamsa adapters of Sali, it was excised with NotI, it was appropriately dimensioned by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D not containing the Sfil site; see, Hol es et al., Science, 253 : 1278-1280 (1991)) in the unique sites Xhol and Notl.

The DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR0783 [designated here as DNA53996-1442] (SEQ ID NO: 137) and the sequence of the protein derived therefrom. PR0783.

The complete nucleotide sequence of DNA53996-1442 is shown in Figure 78 (SEQ ID.

NO: 137). The clone DNA53996-1442 contains only one • open reading structure with an apparent translation initiation site at positions 310-312 of the nucleotide, and ending at the stop codon at positions 1777-1779 of the nucleotide (Figure 78). The predicted polypeptide precursor is 489 amino acids in length (Figure 79). The protein of the full-length PR0783 shown in • Figure 79 has an estimated molecular weight of approximately 52,219 daltons and a pl of approximately 8.47. An analysis of the sequence of the full length PR0783 shown in Figure 79 (SEQ ID NO: 138) evidences the presence of the following: the transmembrane domains located in approximately amino acids 23-42, 67-89, 111-135, 154-176, 194-218, 296-319, 348-370, 387-410 and 427-452; the leucine closure patterns located at approximately amino acids 263-283 and 399-420; a potential tyrosine kinase phosphorylation site at approximately amino acids 180-187; the potential N-glycosylation sites at approximately amino acids 105-108 and 121-124; a potential cAMP and cGMP-dependent protein kinase phosphorylation site, at approximately amino acids 288-291; and a region having sequence identity with the retinal binding protein rhodopsins bacterial at approximately amino acids 190-218.

An analysis of the Dayhoff database (version 35.45 SwissProt 35) shows some sequence identity between the amino acid sequence of PR0783 and the following Dayhoff sequences: YNC2_CAEEL, D64048, ATACO 02332_3 F4 P9.3, NY2R SHEEP, and VSH MUMPA.

The clone DNA53996-1442 has been deposited with the ATCC on June 2, 1998, and was assigned the no. of deposit of ATCC 209921.

- - EXAMPLE 34: Isolation of the cDNA Clones Coding to the Human PRO820 A DNA database of the expressed sequence mark (EST) (Merck / Wash. U) was searched and • 5 identified an EST designated EST no. AA504080, clone Merck 825136 (library 312, B cells of human angina). Homology searches revealed that this EST showed sequence identity with the immunoglobulin II Fc gamma receptor. The DNA sequencing gave the DNA sequence of • full length for the PRO820 and the sequence of the derived protein for the PRO820.

The complete nucleotide sequence of DNA56041-1416 is shown in Figure 82 (SEC.

NO: 145). The clone DNA56041 - 1 16 contains a single open reading structure with a site of • initiation of apparent translation in positions 115-117 of the nucleotide and ends in the codon of arrest at positions 487-489 of the nucleotide (Figure 82). The predicted polypeptide precursor is 124 amino acids in length (Figure 83). The full-length PRO820 protein shown in Figure 83 has a estimated molecular weight of approximately 140,080 - - daltons and a pl of approximately 7.48. The DNA56041-1416 clone has been deposited with the ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that • The sequences provided herein are based on known sequencing techniques Still analyzing the sequence of amino acids of the ID NO: 146, the peptide of • Putative signal is at approximately amino acids 1-15 of the ID NO: 146. The phosphorylation sites of protein kinase C are in approximately amino acids 20-22 and 43-45 of the ID NO: 146. A site of N-mi r i s t or i a tion is at approximately amino acids 89-94 of the ID NO: 146. A complex domain of • Histocompatibility principal and immunoglobulin is in approximately amino acids 83-90 of the ID NO: 146. Corresponding nucleotides can be determined routinely given the sequences provided herein.

- - EXAMPLE 35: Isolation of the cDNA Clones Coding to the Human PRO1080 A consensus DNA sequence was assembled in relation to other EST sequences using phrap • how and extended using the repeated cycles of BLAST and phrap to extend the consensus sequence as much as possible using the sources of the EST sequences described in Example 1 above. The consensus sequence is designates herein as DNA52640. One was used • EST owned by Genentech in the consensus assembly and designated here as DNA36527 (Figure 86; SEQ ID NO: 149).

In light of a sequence homology observed between the DNA36527 consensus sequence and an EST sequence encompassed within the EST clone of • Merck no. 526423, Merck EST clone 526423 was purchased and the cDNA insert was obtained and sequencing. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 84 and is designated herein as DNA56047-1456.

The complete nucleotide sequence of DNA56047-1456 is shown in Figure 84 (SEQ ID NO: 147). Clone DNA56047-1456 contains a single open reading frame with an apparent translation initiation site at positions 159-161 of the nucleotide and terminates at the stop codon at positions 1233-1235 of the nucleotide. ID NO: 147 (Figure 84). The predicted polypeptide precursor is 358 amino acids in length (Figure 85). The protein of • Full length PRO1080 shown in Figure 85 has an estimated molecular weight of approximately 40,514 daltons and a pl of approximately 6.08. The clone DNA56047 - 1456 has been deposited with the ATCC on June 9, 1998. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that • The sequences provided here are based on sequencing techniques known.

Also shown in Figure 85 are the approximate locations of the signal peptide, the binding site of the cells, the domain Nt-DnaJ, the region having sequence identity with the proteins of the Nt-DnaJ domain, and the sites of N-g 1 i c or s i 1 a c i on. The corresponding nucleotides can be determined routinely given the sequences • 5 provided herein.

EXAMPLE 36: Isolation of cDNA Clones Encoding Human PRO1079 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above, and is designated herein as DNA52714. Based on the information provided by the assembly, the clone for the Merck EST does not. H06898 was obtained and Sequencing, thus giving the nucleotide sequence designated herein as DNA56050-1455. The complete nucleotide sequence of DNA56050-1455 is shown in Figure 87 (SEQ ID NO: 150). The clone DNA56050 - 1455 contains only one open reading structure with an apparent translation initiation site at positions 183-185 of the nucleotide and ending at the stop codon at positions 861-863 of the nucleotide (Figure 87). The predicted polypeptide precursor is 226 amino acids in length (Figure 88). The protein of the full-length PRO1079 shown in Figure 88 has an estimated molecular weight of about 24,611 daltons and a pl of about 4.85. An analysis of the sequence • of the full length PRO1079 shown in Figure 88 (SEQ ID NO: 3) evidences the presence of the following characteristics: a signal peptide at approximately amino acids 1-29; the potential N-myristoylation sites in approximately amino acids 10-15, and 51-56; • homology with psaK and psaG proteins from photosynthesis to I in approximately amino acids 2 to 20; and homology with the proteins of the serine family of the prolyl endopeptidase in approximately amino acids 150 to 163.

An analysis of the amino acid sequence • of the full-length PRO1079 using the Dayhoff database (version 35.45 SwissProt 35), reveals some sequence identity between the amino acid sequence of PRO1079 and the following Dayhoff sequences: CEK10C3_4, MMU50734_1, D69503, AF051149 1, and VSMP CVMS.

The clone UNQ536 (DNA56050-1455) has been -? - .. -y "", .., ".. vfe? teSL 4" a0íi deposited with the ATCC on June 22, 1998, and was assigned the no. of deposit of ATCC 203011.

EXAMPLE 37: Isolation of the cDNA Clones that • 5 Encode Human PR0793 A cDNA clone (DNA56110-1437) encoding a native human PR0793 polypeptide was identified by a yeast selection in a cDNA library of the human skin tumor that preferentially represents the 5 'ends of the • primary cDNA clones. The yeast selection employed identified a unique EST clone designated herein as DNA50177 (Figure 91; SEQ ID NO: 154). The DNA50177 sequence was then compared with several EST databases that include public EST databases (for example, Genbank), and a particular DNA database (LIFESEQ ™, Incyte • Pharmaceuticals, Palo Alto, CA), to identify homologous EST sequences. The comparison is performed using the BLAST or BLAST2 computer program [Altschul, Methods in Enzymology 266: 460-480 (1996)]. Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the known proteins were assembled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). This consensus sequence was designated herein as DNA50972. • 5 In light of a sequence homology observed between the DNA50972 consensus sequence and an EST sequence encompassed within the Merck EST clone no. N33874, the Merck EST clone was purchased N33874 and the cDNA insert was obtained and • sequencing It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 89 and is designated herein as DNA56110-151437.

The full-length DNA56110-1437 clone • shown in Figure 89, contains a single open reading structure with a site of initiation of apparent translation in positions 77-79 of the nucleotide and ends at the stop codon at positions 491-493 of the nucleotide (Figure 89). The predicted polypeptide precursor is 138 amino acids in length (Figure 90). The The full-length PR0793 protein shown in Figure 90 has an estimated molecular weight of about 15,426 daltons and a pl of about 10.67. Analysis of the sequence ^^ of the full-length PR0793 shown in Figure 90 (SEQ ID NO: 153) evidences the presence of the following: transmembrane domains approximately from amino acid 12 to approximately amino acid 30 , approximately from amino acid 33 to approximately amino acid 52, so • approximated from amino acid 69 to approximately amino acid 89 and roughly from amino acid 93 to approximately amino acid 109, the N-15 mi site potential sites approximately from amino acid 11 to approximately amino acid 16, approximately from the • amino acid 51 to approximately amino acid 56 and approximately from amino acid 116 to Approximately amino acid 121 and an amino acid sequence block having homology to the aminoc protein 1 to 1 rans for class II RNA synthetase approximately from amino acid 49 to approximately amino acid 59. Clone DNA56110- 25 1437 has been deposited with the ATCC on August 11 - 1998, and was assigned the no. of deposit ATCC 203113.

An analysis of the Dayhoff database • (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 90 (SEQ ID NO: 153), reveals some homology between the amino acid sequence of the PR0793 and the following Dayhoff sequences: S47453, • AF015193_12, MTEHGNS9_2, E64030, H69784, D64995, CD53 MOUSE, GEN8006, AE001138 7 and COX2 STRPU.

EXAMPLE 38: Isolation of the cDNA Clones that Codify the Human PRO1016 A consensus DNA sequence was assembled in relation to other EST sequences using phrap • as described in Example 1 above. The consensus sequence obtained is designated in the present as DNA53502.

In light of a sequence homology observed between the DNA53502 consensus sequence and an EST sequence encompassed within the EST clone of Merck no. 38680, the Merck 38680 EST clone was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure • 92 The complete nucleotide sequence of DNA56113-1378 is shown in Figure 92 (SEQ ID NO: 155). The clone DNA56113-1378 contains only one open reading structure with a site of • initiation of apparent translation at positions 168-170 of the nucleotide and ending at the stop codon at positions 1302-1304 of the nucleotide (Figure 92). The precursor of The predicted polypeptide is 378 amino acids long (Figure 93). The full-length PRO1016 protein shown in Figure 93 has an estimated molecular weight of about 44,021 daltons and a pl of about 9.07. The clone DNA56113-1378 has been deposited with the ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that the sequences provided herein are based on the sequencing techniques known.

- - An analysis of the amino acid sequence of the full-length PRO1016 suggests that portions thereof have sequence identity • with acyltransferase, thus indicating that PRO1016 can be a new acyltransferase.

Still analyzing the amino acid sequence of the SEC. ID NO: 156, the putative signal peptide is at approximately • amino acids 1-18 of the SEC. ID NO: 156. The smear domain (s) are at approximately amino acids 332-352 and 305-330 of the SEC. ID NO: 156. The sequence of homology The protein class of aldolase class II is in amino acids 73-90 of the SEC. ID NO: 156. The protein • dioxygenase cleavage with the extradiol ring is at approximately amino acids 252-275 of SEC. ID NO: 156. Corresponding nucleotides can be determined routinely given the sequences provided herein. The designation names of the Dayhoff 25 data base specific to the sequences with the _---------- í-Í. "» * * »< ^ '* ~ &2t¡Éb & & - - which the PRO1016 has sequence identity, include the following: S52645, P_R59712, P_R99249, P R59713, BNAGPATRF 1, CELT05H4 15 and CELZK40_1.

EXAMPLE 39: Isolation of cDNA Clones Encoding Human PRO1013 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. The consensus sequence was then extended using the repeated cycles of BLAST and phrap to extend the consensus sequence as much as possible using the sources of the EST sequences.

In light of a sequence homology observed between the consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3107695, the EST clone of Incyte 3107695 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 94 and is designated herein as DNA56410-1414.

- - The complete nucleotide sequence of DNA564Í0-1414 is shown in Figure 94 (SEQ ID NO: 157). Clone DNA56 10-1414 contains a single open reading frame with an apparent translation initiation site at positions 17-19 of the nucleotide and terminates at the stop codon at positions 1244-1246 of the nucleotide (Figure 94). The precursor of The predicted polypeptide is 409 amino acids • length (Figure 95). The full-length PRO1013 protein shown in Figure 95 has an estimated molecular weight of about 46,662 daltons and a pl of about 7.18. The clone DNA56410-1414 has been deposited with the ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that • The sequences provided here are based on sequencing techniques known.

Still analyzing the amino acid sequence of the SEC. ID NO: 158, the putative signal peptide is at approximately amino acids 1-19 of the SEC. ID NO: 158. The sites *. ~ - ^ ~ J & SI &6 díBíM? Átftoa ^ ~ »... Ajz., -. 'A., .-. The N-glycosides are at approximately amino acids 75-58 and 322-325 of the SEC. ID NO: 159. A site of N-mi r i s t i i i i on is at approximately amino acids 184-189 of the • SEC. ID NO: 158. A growth factor and the domain of the cytokine receptor family is at approximately amino acids 134-149 of the SEC. ID NO: 158. Corresponding nucleotides can be determined routinely given the sequences provided herein.

The Blast analysis showed some sequence identity with other proteins. Specifically, 15 PRO1013 has some sequence identity with at least the designated Dayhoff sequences: D63877_l; MHU22019 1, AE000730 10, and AF019079 1. F EXAMPLE 40: Isolation of cDNA Clones Encoding to Human PR0937 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is referred to herein as DNA49651. Based on the consensus sequence Mgftfe :,? . j. ».,. . , lt. «_". »< f.gj¿.M »wi¿X,. ^. a .. -_ -.« .-. and - - - «st. •; JJ ¡.Afc - .-. »" '_' •. to. - * - - DNA49651, oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a clone from • full length coding sequence for PR0937.

PCR primers (forward reverse 10 forward PCR primer 5 '-CTCCGTGGTAAACCCCACAGCCC-3' (SEQ ID NO: 161), and reverse PCR 5 'primer -TCACATCGATGGGATCCATGACCG-3' (SEQ ID NO: 162) were synthesized. , a synthetic hybridization probe of the oligonucleotide was constructed from the DNA48651 sequence having the following nucleotide sequence: p 5 'hybridization probe -GGTCTCGTGACTGTGAAGCCATGTTACAACTACTGCTCAAACATCATGAG-3' (SEQ ID NO: 163).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers - identified above. A positive library was then used to isolate the clones encoding the PR0937 gene using the probe oligonucleotide and one of the PCR primers. • 5 RNA was isolated for the construction of cDNA libraries from human fetal kidney tissue (LIB227).

The sequencing of the DNA of the clones isolated as described above gave the full-length DNA sequence for PR0937 [designated here as DNA56436-1448] (SEQ ID NO: 159) and the sequence of the protein derived for PR093. 15 The complete nucleotide sequence of DNA56436-1448 is shown in Figure 96 (SEC.

• NO: 159). It contains a single open reading structure with an initiation site of apparent translation at positions 499-501 of the nucleotide and ends at the stop codon at positions 2167-2169 of the nucleotide (Figure 159). The predicted polypeptide precursor is 556 amino acids in length, has a molecular weight calculated from approximately 62,412 daltons and a pl ^ .- tf -... "- - estimated of approximately 6.62. A sequence analysis of the full-length PR0937 shown in Figure 97 (SEQ ID NO: 160) evidences the presence of the following characteristics: • a signal peptide at approximately amino acids 1-22; a portion A of the ATP / GTP binding site (circuit P) at about amino acids 515-523; a potential N-glycosylation site at about amino acids 514-517; and the 10 glyphican homology sites in approximately • amino acids 54-74, 106-156, 238-279, 309-345, 423-459, and 468-505.

Clone DNA56436-1448 has been deposited with 15 the ATCC on May 27, 1998, and was assigned no. of deposit ATCC 209902.

• An analysis of the amino acid sequence of the full-length PR0937 polypeptide suggests that it itself possesses significant sequence similarity to the glypican proteins, thus indicating that PR0937 may be a new glypican protein. More specifically, an analysis of the Dayhoff database (version 25 35.45 SwissProt 35), reveals the homology s - - - significant between the amino acid sequence of PR0937 and the following Dayhoff sequences: GPCK_MOUSE, GPC2_RAT, GPC5_HUMAN, GPC3_HUMAN, P R30168, CEC03H12 2, GEN13820, HS119E23_1, • 5 HDAC DROME, and AF017637_1 EXAMPLE 41: Isolation of cDNA Clones Encoding Human PR0842 Using the Signal Sequence Algorithm described in Example 3 above allowed the • identification of a sequence of the unique Incyte EST group, designated herein as the sequence of the Incyte EST group no. 69572. This sequence of the EST group was then compared to a variety of expressed sequence mark databases (EST) that include public EST databases (for example, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify the homologies existing. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or older people who did not code the known proteins, - were piled and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it • designated here as DNA54230.

In light of a sequence homology observed between the consensus sequence and an EST sequence encompassed within the EST clone of Merck no. AA477092, the EST clone of • Merck AA477092 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 98 and is designated herein as DNA56855-1447.

• The full-length clone shown in Figure 98 contains a single reading structure Open with an apparent translation initiation site at positions 153-155 of the nucleotide and ending at the stop codon found at positions 510-512 of the nucleotide (Figure 98; SEQ ID NO: 164). The predicted polypeptide precursor (Figure 99, SEQ ID NO: 165) is 119 amino acids - - in length. PR0842 has a calculated molecular weight of approximately 13,819 daltons and an estimated pl of approximately 11.16. Other features of PR0842 include a signal peptide at approximately amino acids 1-22, a potential phosphorylation site of protein kinase C at approximately amino acids 39-41 and two potential N-mi sites at about amino acids. 27-32 and 10 approximately amino acids 46-51. • An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 98 (SEQ ID NO: 164), puts shows the homology between the amino acid sequence of PR0842 and the following Dayhoff sequences: CEZK131_11, P_R80843, RAT5HT2X_1, S81882_l, A60912, MCU 60315_137MC137L, 20 U93422_l, p_P91996, U93462 1, and ZN18 HUMAN.

The clone DNA56855- 14 7 was deposited with the ATCC on June 23, 1998, and was assigned the no. of deposit ATCC 203004. 25 ».. '^ fc ^ aaifeiifafe & a --- ja-ie ^ ... ^ a ^ s and," -. . ».-- ,,, fa-w, -. ^ J% I¿ & - - EXAMPLE 42: Isolation of cDNA Clones Encoding Human PR0839 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of Incyte LIFESEQ ™, designated EST Group of Incyte No. 24479. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include the Jfc 10 bases of public EST data (eg, Genbank) and a database of particular DNA (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST computer program or BLAST2 (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were piled up and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA55709. 25 - - In light of a sequence homology observed between the DNA55709 consensus sequence and an EST sequence encompassed within the Merck EST clone no. 754525, Merck EST clone 754525 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 100 and is designated herein as DNA56859-1445. • The full length clone shown in Figure 100 contains a single open reading structure with a translation initiation site apparent at positions 2-4 of the nucleotide and ends at the stop codon found at positions 263-265 of the nucleotide (FIG. 100; • ID NO: 166). The predicted polypeptide precursor (Figure 101, SEQ ID NO: 167) is 87 amino acids in length. PR0839 has a calculated molecular weight of about 9,719 daltons and an estimated pl of about 4.67. Other features of PR0839 include a signal peptide in approximately amino acids 1-23, phosphorylation sites of protein kinase C, - - potentials, at approximately amino acids 37-39 and approximately amino acids 85-87, a potential phosphorylation site of casein kinase II, at approximately amino acids 37-40, identity • Sequence with the protein of the large subunit of the ribonucleotide of reductase at approximately amino acids 50-60, and sequence identity with the proteins the RNP-1 region of binding to the eukaryotic RNA at approximately amino acids 70-79. F An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the The full-length sequence shown in Figure 101 (SEQ ID NO: 167), reveals some homology between the amino acid sequence of the • PR0839 and the following Dayhoff sequences: CD14_MOUSE, XPR6_YARLI, HS714385_1, S49783, BB19_RABIT, GVPH-HALME, AB003135_1, P_R85453, LUU27081_2, and TP2B MOUSE.

Clone DNA56859-1445 has been deposited with the ATCC on June 23, 1998, and was assigned the 25th no. of deposit ATCC 209019. - > ..; J5fa-v - - EXAMPLE 43: Isolation of the cDNA Clones Encoding to the Human PRO1180 Using the Signal Sequence Algorithm • 5 described in Example 3 above allowed the identification of a single EST group sequence (sequence of Incyte EST group No. 14732). The sequence sequence of the Incyte EST group does not. 14732 was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify the homologies existing. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods m Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or older people who did not code the known proteins were piled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA55711.

- In light of a sequence homology observed between the DNA55711 consensus sequence and an EST sequence encompassed within the EST clone of • Merck no. T60891, the Merck T60891 EST clone was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 102 and is designated here as • DNA56860-1510.

The full-length clone shown in Figure 102 contains a single reading structure Open with an apparent translation initiation site at positions 78-80 of the nucleotide and ends at the stop codon found in the • positions 909-911 of the nucleotide (Figure 102, SEQ ID NO: 168). The predicted polypeptide precursor is 277 amino acids in length, has a calculated molecular weight of about 31,416 daltons and an estimated pl of about 8.88. The sequence analysis of the full length PRO1180 shown in Figure 103 (SEQ ID NO: 169) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 23, a pattern of closing leucine approximately from amino acid 10 to approximately • 5 amino acid 31, and a site of N-mi r i s potentially bound approximately from amino acid 64 to approximately amino acid 69, approximately from amino acid 78 to approximately amino acid 83, thus approximate from amino acid 80 to • approximately amino acid 85, approximately from amino acid 91 to approximately amino acid 96 and approximately from amino acid 201 to approximately amino acid 206. Clone DNA56860-1510 has been deposited with the ATCC on July 9, 1998, and was assigned no. deposit • ATCC 209952.

An analysis of the amino acid sequence of the full-length PRO1180 polypeptide suggests that it itself possesses significant sequence similarity to the met i lt rans ferase family of the proteins. More specifically, an analysis of Dayhoff database (version 35.45 SwissProt 35), - - highlights the homology between the amino acid sequence of PRO1180 and the following Dayhoff sequences, MTCI65_14, D69267, YH09_YEAST, BIOC_SERMA, ATAC00448415T1D16.16, SHGCPIR_18, SPBC3B9_4, • 5 AB009504_14, P_W17977 and A69952.

EXAMPLE 44: Isolation of the cDNA Clones Encoding to the Human PR01134 Using the Signal Sequence Algorithm described in Example 3 above allowed the • identification of a sequence of the EST group of the Incyte database, designated as 7511. This sequence of the EST group was then compared to a variety of sequence mark databases expressed (EST) that include public EST databases (eg, Genbank) and a particular DNA database (Lifeseq ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search is performed using the BLAST or BLAST2 computer program (Altschul, Methods m Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the known proteins were pooled and - - assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated in • present it as DNA55725. Two EST sequences owned by Genentech in the assembly were used and are shown in Figures 106 (SEQ ID NO: 172) and in Figure 107 (SEQ ID NO: 173).

In light of a sequence homology • observed between the consensus sequence DNA55725 and an EST sequence encompassed within the clone EST of Merck no. H94897, Merck EST clone H94897 was purchased and the cDNA insert was obtained and sequencing. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 106 and is designated herein as DNA56865-1491. 20 The DNA56865-1491 clone contains a single open reading structure with an apparent translation initiation site in the positions 153-155 of the nuclde and ends in the codon of arrest at positions 1266-1268 of the nuclde (Figure 104). The predicted polypeptide precursor is 371 amino acids in length (Figure 105). The full-length PR01134 protein shown in Figure 105 has an estimated molecular weight of • 5 approximately 41,935 daltons and a pl of approximately 9.58. The sequence analysis of the full-length PR01134 shown in Figure 105 (SEQ ID NO: 171) evidences the presence of the following: a signal peptide of approximately from amino acid 1 to • approximately amino acid 23, the potential N-gl i cos and lac ion sites roughly from amino acid 103 to about amino acid 106, approximately from the amino acid 249 to about amino acid 252 and roughly from amino acid 257 to about amino acid 260, and a block • of amino acids that have homology with the proteins of the tyrosinase binding region CuA of Approximately from amino acid 280 to approximately amino acid 306. Clone DNA56865-1491 has been deposited with the ATCC on June 23, 1998, and assigned no. ATCC deposit 203022. 25 - - An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 5 105 (SEQ. ID NO: 171), reveals the significant homology between the amino acid sequence of PR01134 and the following Dayhoff sequences: F20P5_18, AC002396_10, S47847, C64146, GSPA_BACSU, P_W10564, RFAI_ECOLI, Y258_HAEIN, 10 RFAJ_SALTY and P_R32985. • EXAMPLE 45: Isolation of the cDNA Clones Coding to the Human PRO830 Using the Signal Sequence Algorithm described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated 20251. This sequence of the EST group was then compared to a variety of sequence mark databases expressed (EST) that include public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search is performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the • Known proteins were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated in present as DNA55733. • In light of a sequence homology observed between the DNA55733 consensus sequence and an EST sequence encompassed within the EST clone of Merck no. H78534, Merck EST clone H78534 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert codes • a full-length protein. The sequence of this cDNA insert is shown in Figure 108 and is designated herein as DNA56866-1342.

The clone DNA56866- 1342 contains a single open reading structure with a site of initiation of apparent translation in the positions -M "- .. 154-156 of the nucleotide and terminates at the stop codon at positions 415-417 of the nucleotide (Figure 108). The predicted polypeptide precursor is 87 amino acids in length (Figure 109). The • The full-length PRO830 protein shown in Figure 109 has an estimated molecular weight of about 9,272 daltons and a pl of about 9.19. The sequence analysis of the full length PRO830 shown in the Figure 109 (SEQ ID NO: 175) evidences the presence of the following: a signal peptide roughly from amino acid 1 to about amino acid 33, the N-mi sites of potentials of Approximate way from amino acid 2 to approximately amino acid 7 and approximately from amino acid 8 to approximately amino acid 13 and a thioredoxin family of the homology block of proteins approximately from the amino acid 23 to approximately amino acid 39. Clone UNQ470 (DNA56866-1342) has been deposited with the ATCC on June 22, 1998, and assigned no. of deposit ATCC 203023.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 109 (SEQ ID NO: 175), puts shows significant homology between the amino acid sequence of the PRO830 and the following Dayhoff sequences: HSU88154_1, HSU88153_1, SAPKSGENE_1, HPU31791_5, GGCN0T2_1, CPU91421_1, CHKESTPCO 9_1, PQ0769, U97553_79 and B60095.

EXAMPLE 46: Isolation of the cDNA Clones Encoding Human PR01115 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the Incyte LIFE SEQ ™ EST group, designated sequence of the EST group of Incyte No. 165008. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (e.g., Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pha rmaceutica 1 s, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program - - (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, • were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA55726. 10 In light of a sequence homology observed between the DNA55726 consensus sequence and an EST sequence encompassed within the Merck EST clone no. R75784, the Merck EST clone was purchased R75784 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 111 and is designated herein as DNA56868-1478.

The full length clone shown in the Figure 110 contains a single open reading structure with a translation initiation site Apparent at positions 189-191 of the nucleotide and - - ends at the stop codon found at positions 1524-1526 of the nucleotide (Figure 110, SEQ ID NO: 176). The predicted polypeptide precursor (Figure 111, SEQ ID NO: 177) is 445 • amino acids in length. PR01115 has a calculated molecular weight of about 50,533 daltons and an estimated pl of about 8.26. Additional features include a signal peptide at approximately amino acids 1-20; the potential N-glycoside sites in • approximately amino acids 204-207, 295-298, and 313-316; and the putative transmembrane domains at approximately amino acids 35-54, 75-97, 126-146, 185-204, 333-350, and 353-371. 15 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in the Figure 101 (SEQ ID NO: 167), reveals some sequence identity between the amino acid sequence of PR01115 and the following Dayhoff sequences: AF053947_79, S73698, CEC47A10_4, CCOMTNDS5G_l, HS4LMP2AC_1, LMP2_EBV, PA24_M0USE, HCU33331_7, P-W05508, and AF002273_1.

- - The clone DNA56868 - 1478 has been deposited with the ATCC on July 23, 1998, and was assigned the no. of deposit ATCC 203024. • EXAMPLE 47: Isolation of cDNA Clones Encoding Human PR01277 A consensus DNA sequence was assembled in relation to other ESTs using the cycles repeats of BLAST and the "phrap" program as • described in Example 1 above. One or more of the ESTs of the assembly were derived from diseased coronary artery tissue. The consensus sequence obtained is designated herein as "DNA49434". 15 In light of a sequence homology observed between the DNA49434 consensus sequence and • an EST sequence encompassed within the EST clone of Incyte no. 3042605, the EST clone of Incyte 3042605 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 112 (SEQ ID NO: 178). 25 - Clone DNA56869-1545 contains a single open reading frame with an apparent translation initiation site at positions 188-190 of the nucleotide, and an apparent stop codon at positions 2222-2224 of the nucleotide (Figure 112). The predicted polypeptide precursor is 678 amino acids in length (Figure 113). The protein of the full length PR01277 shown in Figure 113 has a estimated molecular weight of approximately 73,930 • daltons and a pl of approximately 9.48. Additional features include a signal peptide at about amino acids 1-26; a transmembrane domain in approximately amino acids 181-200; and the potential N-glycosylation sites at about amino acids 390-393 and 520-523. • An analysis of the Dayhoff 20 database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 113 (SEQ ID NO: 179), reveals the Significant homology between the amino acid sequence of PR01277 and the following Dayhoff sequences: no.

, X? - ¿iésés &X¡ & S-j = -.- g-.l &; - .-- ^ Sfe- *. €,. ^ AF012252_1. Homology was also found between the amino acid sequence of PR01277 and the following Dayhoff sequences: AF006740_1, To CA36_HUMAN, HSU1_1, HUMC0L7A1X_1, CA17_HUMAN, 5 MMZ78163_1, CAMA_CHICK, HSU69263_1, YNX3_CAEEL, and MMRNAM3_1.

The clone DNA56869-1545 has been deposited with the ATCC and the no. ATCC deposit 203161.

• EXAMPLE 48: Isolation of cDNA Clones Encoding Human PR01135 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as • DNA52767. Based on the DNA52767 consensus sequence, the oligonucleotides were synthesized 1) to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR01135. 25 - - To select several libraries from a source of a full-length clone, the DNA of the libraries was selected using ^^ PCR amplification with PCR primer pairs based on the sequence DNA52767. A positive library was then used to isolate the clones encoding the PR01135 gene using the oligonucleotide ol probe and one of the PCR primers. The RNA was isolated for the construction of the cDNA libraries from muscle tissue • smooth of the human coronary arteries (LIB309). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using reagents commercially available such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, ligated with the F roma to the he icinase adapters of Salí, it was split with Notl, it was appropriately sized by elect rsores in gel, and cloned in a defined orientation in a suitable cloning vector (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D not containing the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) in the unique sites Xhol and Notl.

- - DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for the • PR01135 [designated here as DNA56870-1492] (SEQ ID NO: 180) and the sequence of the derived protein for PR01135.

The complete nucleotide sequence of DNA56870-1492 is shown in Figure 114 (SEQ.ID.

• NO: 180). The clone DNA56870-1492 contains a single open reading structure with an apparent translation initiation site at positions 62-64 of the nucleotide and ends at the codon of arrest at positions 1685-1687 of the nucleotide (Figure 114). The predicted polypeptide precursor is 541 amino acids in length (Figure 115). The • full-length PR01135 protein shown in Figure 115 has an estimated molecular weight of about 60,335 daltons and a pl of about 5.26. An analysis of the sequence of the full-length PR01135 shown in Figure 115 (SEQ ID NO: 181) evidences the presence of the following: a signal peptide of Approximately from amino acid 1 to approximately amino acid 21, a potential N-glycosylation site approximately from amino acid 53 to approximately amino acid 56, approximately from amino acid 75 • to approximately amino acid 78, approximately from amino acid 252 to about amino acid 255 and roughly from amino acid 413 to about amino acid 416 and a block of 10 amino acids having homology to glycosyl hydrolase family proteins approximately from amino acid 399 to approximately amino acid 414. Clone DNA56870-1492 has been deposited with the ATCC on June 2, 15 1998 and assigned the no. of deposit of ATCC 209925.

• An analysis of the amino acid sequence of the full-length PR01135 polypeptide suggests that it itself possesses significant sequence similarity to the alpha 1, 2-mannos idase protein, thus indicating that PR01135 may be a novel annosidase. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 25 35), reveals significant homology «Ti«. '«< »J--». ? M-w > go..a »> --A »^ jSBii3Kfe - jMtf-Ji-, < • *. . "» J ..ót »YY Y. between the amino acid sequence of PR01135 and the following Dayhoff sequences: DMC86E4_5, D86967_l, SPAC23A1_4, YH04_YEAST, B54408, SSMAN9MAN_1, CEZC410_4, S61631 and MSU14190_1. EXAMPLE 49: Isolation of cDNA Clones Encoding Human PR01114 An isolated cDNA sequence was found in the selection with amylase as described in Example 2 above, by the computer program for sequence alignment WU-BLAST -2, which has a certain sequence identity with other known interferon receptors. The cDNA sequence was designated herein as DNA48466 and is shown in Figure 118 (SEQ ID NO: 184). Based on the sequence identity, the probes were generated from the sequence of the DNA48466 molecule and used to select a human breastworm library (LIB135), prepared as described in paragraph 1 of Example 2 previous. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the Sfil site, see Holmes et al., Science, 253: 1278-1280 (1991)), and the size cut of the cDNA was smaller than 2800 bp. *. * k¿ - ^. r -i *. ^.

The oligonucleotide probes were employed as follows: forward PCR primer • 5 5 '-AGGCTTCGCTGCGACTAGACCTC-3' (SEQ ID NO: 185) 5 'reverse PCR primer -CCAGGTCGGGTAAGGATGGTTGAG-3' (SEQ ID NO: 186) 5 'hybridization -TTTCTACGCATTGATTCCATGTTTGCTCACAGATGAAGTGGCCATTCTGC-3' 10 (SEQ ID NO: 187). • A full-length clone containing a single open reading structure with an apparent translation initiation site was identified in positions 250-252 of the nucleotide and a stop signal at positions 1183-1185 of the nucleotide (Figure 116, SEQ ID NO: 182). The precursor of • predicted polypeptide is 311 amino acids in length, has a calculated molecular weight of approximately 35,076 daltons and an estimated pl of approximately 5.04. The analysis of the sequence of the interferon receptor of the full length PR01114 shown in Figure 117 (SEQ ID NO: 183) evidences the presence of the following: signal peptide approximately from amino acid 1 to approximately amino acid 29, a transmembrane domain roughly from amino acid 230 to approximately amino acid 255, the potential N-glycoside sites and potentials 5 amino acid 40 up to about amino acid 43 and roughly from amino acid 134 to about amino acid 137, a block of the amino acid sequence having homology with the tissue factor proteins roughly • from amino acid 92 to approximately amino acid 119 and a block of the amino acid sequence having homology to the integrin alpha chain proteins approximately from amino acid 232 to approximately amino acid 262. Clone DNA57033-1 03 has been deposited with the ATCC on May 27, 1998, and • assigned him the no. of deposit ATCC 209905.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in the Figure 117 (SEQ ID NO: 183), highlights the significant homology between the sequence of '- • rt? ¿^ Ifei amino acids of the interferon receptor PR01114 and the following Dayhoff sequences: G01418, INR1_M0USE, P_R71035, INGS_HUMAN, A26595_l, A26593_l, 156215 and TF_HUMAN. • 5 EXAMPLE 50: Isolation of cDNA Clones Encoding Human PR0828 A consensus DNA sequence was identified using the method described in Example 1 above. This consensus sequence is • designates herein as DNA35717. Based on the DNA35717 consensus sequence, the 1 or 1 oligonucleotides were synthesized to identify by PCR a cDNA library containing the sequence of , and 2) to be used as probes to isolate a full-length coding sequence clone for PR0828. • PCR primers (forward 20 and inverse) were synthesized: forward PCR primer 5 * -GCAGGACTTCTACGACTTCAAGGC-3 '(SEQ ID NO: 190); and reverse PCR primer 5 '-AGTCTGGGCCAGGTACTTGAAGGC-3' (SEQ ID NO: 191). In addition, a synthetic hybridization probe of the oligonucleotide was constructed from the consensus DNA35717 sequence having the following nucleotide sequence: hybridization probe • 5 '--CAACATCCGGGGCAAACTGGTGTCGCTGGAGAAGTACCGCGGATCGGTGT-3' (SEQ ID NO: 192) To select multiple libraries from a source of a full-length clone, selected the DNA of the libraries by f PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR0828 gene using the ol igonucleotido probe and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from human fetal lung tissue (LIB25).

DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR0828 [designated here as DNA57037-1.44] (SEQ ID NO: 188) and the sequence of the derived protein for PR0828.

The complete nucleotide sequence of DNA57037-1444 is shown in Figure 119 (SEQ ID NO: 188). The clone DNA57037 - 1444 contains a single open reading structure with a site of • 5 initiation of apparent translation at positions 34-36 of the nucleotide and ending at the stop codon at positions 595-597 of the nucleotide (Figure 119). The predicted polypeptide precursor is 187 amino acids in length (Figure 120). The full length PR0828 protein shown in • Figure 120 has an estimated molecular weight of approximately 20,996 daltons and a pl of approximately 8.62. A sequence analysis of the full length PR0828 shown in the Figure 120 (SEQ ID NO: 189) evidences the presence of the following: a signal peptide at approximately amino acids 1-21; identity of • sequences with the 2-mark of the glutathione peroxidases at approximately amino acids 82-89; Sequence identity with the selenocyte proteins of the glutathione peroxidases at about amino acids 35-60, 63-100, 107-134, and 138-159. The clone DNA57037 - 1444 has been deposited with the ATCC on May 27, 1998 and is assigned the no. of deposit of ATCC 209903.

An analysis of the amino acid sequence of the full length PR0828 polypeptide suggests that it has sequence similarity • 5 significant with glutathione peroxidases, thus indicating that PR0828 may be a new peroxidase enzyme. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), demonstrates the identity of the sequence between the amino acid sequence of the • PR0828 and the following Dayhoff sequences: AF053311_1, CELT09A12_2, AC004151_3, BTUE_ECOLI, CER05H10__3, P_P80918, PWU88907_1, and P_W22308.

EXAMPLE 51: Isolation of cDNA Clones Encoding ai PRO1009 Human A cDNA clone (DNA57129-1413) encoding • a native human PRO1009 polypeptide, was identified by a selection of yeasts, in a cDNA library of the human SK-Lu-1 adenocarcinoma cell lines that preferentially represent the 5 'ends of the primary cDNA clones. First the SEC was identified. ID NO: 195 (Figure 123), which was extended by the alignments of other EST sequences to form a consensus sequence. Oligonucleotide probes were synthesized based on the consensus sequence and used to select a cDNA library that gave the clone DNA57129-1413 from • 5 full length.

The full length clone DNA57129-1413 shown in Figure 121 contains a single open reading structure with a site of initiation of apparent translation in positions • 41-43 of the nucleotide and ends at the stop codon found at positions 1886-1888 of the nucleotide (Figure 121, SEQ ID NO: 193). The predicted polypeptide precursor (Figure 122; ID NO: 194) is 615 amino acids in length. Figure 122 also shows the approximate locations of the signal sequence, the domains • of transmembrane, the sites of my site, a glycosylation site and a linkage domain of the AMP. The PRO1009 has a calculated molecular weight of approximately 68,125 daltons and an estimated pl of about 7.82. The clone DNA57129-1 13 has been deposited with the ATCC and assigned the no. of deposit ATCC 209977. It is understood that the clone deposited has the current and correct sequence and - - that the representations herein may have normal and minor sequencing errors.

Based on an alignment analysis of • 5 WU-BLAST-2 sequences (using the ALIGN computer program) of the full-length sequence, the PRO1009 showed amino acid sequence identity with at least the following proteins that were designated in the Dayhoff database as follows: F69893, CEF28F8_2, BSY13917_7, BSY13917_7, • D69187, D69649, XCRPFB_1, E64928, YDID_ECOLI, BNACSF8_1 and RPU75363_2.

EXAMPLE 52: Isolation of the cDNA Clones that Codify the Human PRO1007 A consensus DNA sequence was assembled in relation to other EST sequences using phrap • as described in Example 1 above. This consensus sequence is designated herein as DNA40671.

In light of a sequence homology observed between the DNA40671 consensus sequence and an EST sequence encompassed within the EST clone of Merck no. T70513, the Merck T70513 EST clone was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure • 124.

The complete nucleotide sequence of DNA57690-1374 is shown in Figure 124 (SEQ ID NO: 196). The clone DNA57690 - 1374 contains only one open reading structure with a site of • initiation of apparent translation at positions 16-18 of the nucleotide and ending at the stop codon at positions 1054-1056 of the nucleotide (Figure 124). The precursor of The predicted polypeptide is 346 amino acids in length (Figure 125). The full-length PRO1007 protein shown in Figure 125 has a • estimated molecular weight of approximately 35,971 daltons and a pl of approximately 8.17. The clone DNA57690-1374 has been deposited with the ATCC on June 9, 1998. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that the sequences provided herein are based on the known sequencing techniques. The jafl »-» .--. ~ -. - .. -_. • ^^ _ «1 _ ^^ _ ^^^ L ^^ _ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ the present show the representative numbering.

An analysis of the amino acid sequence • of the full-length PRO1007 suggests that the portions thereof possess sequence identity with the MAGPIAP, thus indicating that the PRO1007 may be a new member of the family belonging to the MAGPIAP. 10 • Still analyzing the amino acid sequence of the SEC. ID NO: 197, the putative signal peptide is at approximately amino acids 1-30 of the SEC. ID NO: 197. The domain of transmembrane are at approximately amino acids 325-346 of the SEC. ID NO: 197. The sites of N - g 1 i c o s i 1 a c a on are in • approximately amino acids 118-121, 129-132, 163-166, 176-179, 183-186 and 227-130 of SEC. ID NO: 197. The homology of the protein of the Ly-6 / u-Par domain is in approximately amino acids 17-36 and 209-222 of the SEC. ID NO: 197. The corresponding nucleotides can be determined routinely given the sequences provided in this - - EXAMPLE 53: Isolation of the cDNA Clones Encoding to the Human PRO1056 Using the Signal Sequence Algorithm • 5 described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated herein as 6425. This sequence of the EST group was then compared to a variety of brand databases of expressed sequence (EST) that include the bases • of public EST data (for example, Genbank) and a particular DNA database (Lifeseq ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search is performed using the BLAST or BLAST2 computer program (Altschul, Methods m Enzymology 266: 460-480 (1996)). Those comparisons give as • resulted in a Blast record of 70 (or in some cases, 90) or more that did not code known proteins were assembled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated in present as DNA55736. '' r - i ii ul¡m? ? ? to? - - In light of a sequence homology observed between the DNA55736 consensus sequence and an EST sequence encompassed within the EST clone of • Merck no. R88049, the Merck R88049 EST clone was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 126 and is designated herein as DNA57693-1424.

Clone DNA57693-1424 contains a single open reading structure with a site of initiation of apparent translation at positions 56-58 of the nucleotide and ending at the stop codon at positions 416-418 of the nucleotide (Figure 126). The predicted polypeptide precursor is 120 amino acids in length (Figure 127). The The full-length PRO1056 protein shown in Figure 127 has an estimated molecular weight of about 13,345 daltons and a pl of about 5.18. The sequence analysis of the full length PRO1056 shown in the Figure 127 (SEQ ID NO: 199) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 18, a transmembrane domain approximately from the • 5 amino acid 39 to approximately amino acid 58, a potential N-glycosylation site approximately from amino acid 86 to approximately amino acid 89, phosphorylation sites of protein kinase C approximate from amino acid 36 to • approximately amino acid 38 and approximately from amino acid 58 to approximately amino acid 60, a phosphorylation site of tyrosine kinase in a manner approximated from amino acid 25 to approximately amino acid 32 and a block of the amino acid sequence having homology with the • Channels-forming colycin proteins roughly from amino acid 24 to approximately amino acid 56. The clone DNA57693-1424 was deposited with the ATCC on June 23, 1998, and was assigned no. of deposit ATCC 203008.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 127 (SEQ ID NO: 199), highlights the • 5 significant homology between the amino acid sequence of PRO1056 and the following Dayhoff sequences: PLM_HUMAN, A40533, ATNG_HUMAN, A55571, ATNG_SHEEP, S31524, GEN13025, RIC_MOUSE, A48678 and A10871_l. EXAMPLE 54: Isolation of the cDNA Clones Encoding to the Human PR0826 The use of the signal sequence algorithm described in Example 3 above allowed the Identification of a sequence of the EST group of the Incyte database, designated as 47283. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include the EST databases public (for example, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST computer program or BLAST2 (Altschul, Methods in Enzymology 266: 460-- 480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the known proteins, were piled up and • assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obεed therefrom was designated herein as DNA56000. 10 • In light of a sequence homology observed between the DNA56000 consensus sequence and an EST sequence encompassed within the Merck EST clone no. W69233, the Merck EST clone was purchased W69233 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. Sequence • of this cDNA insert is shown in Figure 128 and is designated herein as DNA57694-1341.

Clone DNA57694 - 1341 contains a single open reading structure with an apparent translation initiation site in the positions 13-15 of the nucleotide and ends at the stop codon at positions 310-312 of the nucleotide (Figure 128). The predicted polypeptide precursor is 99 amino acids in length (Figure 129). The protein of the full-length PR0826 shown in Figure 129 has an estimated molecular weight of about 11,050 daltons and a pl of about 7.47. Sequence analysis of the full length PR0826 shown in Figure 129 (SEQ ID NO: 201) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 22, potential N-my sites approximately from amino acid 22 to approximately amino acid 27 and approximately from amino acid 90 to approximately amino acid 95 and a block of amino acid sequence having homology with peroxidase in a manner approximate from amino acid 16 to approximately amino acid 48. Clone DNA57694-1341 has been deposited with the ATCC on June 22, 1998, and assigned no. of deposit ATCC 203017.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 129 (SEQ ID NO: 201), puts shows the significant homology between the sequence of • amino acids of PR0826 and the following Dayhoff sequences: CCU12315_1, SCU96108_6, CELF39F10_4 and HELT HELHO.

EXAMPLE 55: Isolation of cDNA Clones that Encode Human PR0819 • The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated as 49605 This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST • databases (for example, Genbank) and a particular DNA database (LIFESEQ). ™, Incyte 20 Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some r? ¡i - "i '- - - r - i - ---- ^^ • > -i¿M? á, ^^^ M ^^^^ i ^^^^^^ tí¡ itíÉ ^^ Á ^^^^^^^^^^^^^^^^ cases, 90) or greater that did not code the known proteins, were piled up and assembled in a consensus DNA sequence with the program " phrap "(Phil Green, University of • Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56015.

In light of a sequence homology 10 observed between the DNA56015 consensus sequence and PP an EST sequence encompassed within the clone EST of Merck no. H65785, Merck EST clone H65785 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 130 and is designated herein as • DNA57695-1340.

Clone DNA57695-1340 contains a single open reading frame with an apparent translation initiation site at positions 46-48 of the nucleotide and terminates at the stop codon at positions 202-204 of the nucleotide (Figure 130). The predicted polypeptide precursor is 52 amino acids in length (Figure 131). The protein of the full-length PR0819 shown in Figure 131 has an estimated molecular weight of approximately 5,216 daltons and a pl of • 5 approximately 4.67. Sequence analysis of the full-length PR0819 shown in Figure 131 (SEQ ID NO: 203) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 24, a site of potential N- • ny-direction approximately from amino acid 2 to approximately amino acid 7 and a region having homology to the immunoglobulin light chain approximately from amino acid 5 to approximately amino acid 33. DNA clone 57695 - 1340 has been deposited with the ATCC on June 23, 1998, and was assigned no. of deposit ATCC 203006.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 131 (SEQ ID NO: 203), highlights the Significant homology between the - amino acid sequence of PR0819 and the following Dayhoff sequences: HSU03899_1, HUMIGLITEB_1, VG28_HSVSA, AF031522 1, PAD1 YEAST and AF045484_1. • 5 EXAMPLE 56: Isolation of cDNA Clones Encoding Human PRO1006 An initial candidate sequence of the Incyte group sequence does not. 45748 was identified using the signal algorithm process described 10 in Example 3 above. This sequence is aligned • then with a variety of Incyte and public EST sequences and a consensus sequence is designated herein as DNA56036 is derived therefrom. 15 In light of a sequence homology observed between the DNA56036 consensus sequence and • an EST sequence encompassed within the clone EST of Merck no. 489737, the Merck EST clone was purchased 4 9737 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 132. 25 - - The complete nucleotide sequence of DNA57699-1412 is shown in Figure 132 (SEQ ID NO: 204). The clone DNA57699-1412 contains a single open reading structure with a site of • 5 initiation of apparent translation at positions 28-30 of the nucleotide and ending at the stop codon at positions 1204-1206 of the nucleotide (Figure 132). The predicted polypeptide precursor is 392 amino acids length (Figure 133). The PRO1006 protein of • full length shown in Figure 133 has an estimated molecular weight of about 46,189 daltons and a pl of about 9.04. The clone DNA57699-1412 has been deposited with the ATCC. With With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that the sequences provided herein • are based on known sequencing techniques. 20 Analyzing the amino acid sequence of the SEC. ID NO: 205, the putative signal peptide is at approximately amino acids 1-23 of SEC. ID NO: 205. The sites of N - g 1 i co s i 1 a c i on are at approximately amino acids 40-43, ^^ - - 53-56, 204-207 and 373-376 of the SEC. ID NO: 205. A site of N-mi r i s t ation is at approximately amino acids 273-278 of the SEC. ID NO: 205. ^^ The corresponding nucleotides can be determined routinely given the sequences provided herein.

EXAMPLE 57: Isolation of cDNA Clones Encoding to Human PR01112 10 Use of Signal Sequence Algorithm • described in Example 3 above allowed the identification of a specific EST group sequence. This sequence of the EST group was then compared to a variety of brand databases Expressed sequence (EST) that includes public EST databases (for example, Genbank) and a particular EST DNA database (LIFESEQ ™, • Incyte Pharmaceutica 1 s, Palo Alto, CA) to identify existing homologies. The search of homology was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater than no encoded the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it • was designated herein as DNA56018.

In light of a sequence homology observed between the DNA56018 consensus sequence and an EST sequence encompassed within the EST clone of Merck no. AA223546, the EST clone of • Merck AA223546 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 134 and is designated herein as DNA57702-1476.

The complete nucleotide sequence of DNA57702-1476 is shown in Figure 134 (SEQ ID.

NO: 206). The DNA clone 57702-1476 contains a single open reading frame with an apparent translation initiation site at positions 20-22 of the nucleotide and ends at the stop codon at positions 806-808 of the nucleotide of the SEC. ID NO: 206 (Figure 134). He The precursor of the predicted polypeptide is 262 amino acids in length (Figure 135). The full-length PR01112 protein shown in Figure 135 has an estimated molecular weight of about 5,379 daltons and a pl of about 8.93. Figure 135 also shows the approximate locations of the signal peptide and the transmembrane domains. The clone DNA57702- 1476 has been deposited with the ATCC on June 9 of 1998. It is understood that the deposited clone has the current nucleic acid sequence and that the sequences provided herein are based on known sequencing techniques. An analysis of the amino acid sequence of the full-length PR01112 polypeptide suggests that it has some sequence similarity with other proteins. More specifically, a analysis of the Dayhoff database (version 35.45 SwissProt 35), demonstrates the sequence identity between the amino acid sequence of PR01112 and at least the following Dayhoff sequences, (a peptide of mycobacterium tuberculosis), F64471, AE000690 6, XLU16364 1, E43259 (ATP synthase transporting H + -) and PIGSLADRXE_1 (MHC class II histocompatibility antigen).

EXAMPLE 58: Isolation of the cDNA Clones that • Coding the Human PRO1074 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a single Incyte EST group sequence (sequence of the Incyte group No. 42586). This The sequence of the group was then compared with a • variety of expressed sequence mark (EST) databases that include public EST databases (for example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST computer program • or BLAST2 (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons give as result, a Blast record of 70 (or in some cases, 90) or older that did not code for the known proteins was pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of 25 Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56251.

In light of a sequence homology • 5 observed between the DNA56251 consensus sequence and an EST sequence encompassed within the Merck EST clone no. AA081912, Merck EST clone AA081912 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The • Sequence of this cDNA insert is shown in Figure 136 and is the full-length DNA sequence for PRO1074. The clone DNA57704 -1452 has been deposited with the ATCC on 9 July 15, 1998, and was assigned the no. of deposit ATCC 209953.

• The complete nucleotide sequence of DNA57704 -1452 is shown in Figure 136 (SEC.

NO: 208). Clone DNA 57704-1452 contains a single open reading frame with an apparent translation initiation site at positions 322-324 of the nucleotide and terminates at the stop codon at positions 1315-1317 of the nucleotide (Figure 136). The predicted polypeptide precursor "VU &awte¡fc & iS? -». ^ And ».» »-a.Yw? -. - ~ #» is 331 amino acids in length (Figure 137) The full-length PRO1074 protein shown in Figure 137 has an estimated molecular weight of approximately 39,512 daltons and a pl of • approximately 8.03. A sequence analysis of the full-length PRO1074 shown in Figure 137 (SEQ ID NO: 209) evidences the presence of the following: a transmembrane domain at approximately 20 amino acids to 39; the potential N-glycosylation sites at about amino acids 72 to 75, 72 to 75, 154 to 157, 198 to 201, 212 to 215, and 326 to 329; a binding site of the cosaminoglycan gl i at approximately amino acids 239 to 242, and a domain Ly-6 / u-PAR in approximately amino acids 23 to 36.

• An analysis of the amino acid sequence of the PRO1074 full-length polypeptide suggests that he himself possesses similarity of significant sequence with beta 1, 3-ga lactos and Itrans ferase, thus indicating that PRO1074 can be a new member of the family galactos i Itrans ferase of proteins. An analysis of the sequence of amino acids of the full-length PRO1074 ^ JÉ ^ Íj ^ £ feStí ^^^^ fi ^ -? -? -? - ^? ^^? ^ HiS -í -? ^ Using the Dayhoff database (version 35.45 SwissProt 35), reveals the homology between the amino acid sequence of PRO1074 and the following Dayhoff sequences, AF029792_1, P_R57433, DMU41449_1, AC000348_14, P_R47479, CET09F5_2, CEF14B6 4, CET15D6 5, CEC54C8 4, and CEE03H4_10.

The clone DNA57704-1452 has been deposited with the ATCC on June 9, 1998, and was assigned the no. 10 of deposit ATCC 209953. • EXAMPLE 59: Isolation of the cDNA Clones Coding to the Human PRO1005 Using the Signal Sequence Algorithm described in Example 3 above allowed the identification of a sequence of the EST group from the LIFESEQ ™ database, sequence of the Incyte no. 49243. This sequence of the EST group was then compared to a variety of brand databases expressed sequence (EST) including public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search is performed using the BLAST computer program ^ ...- tv ^ »» ---... mu í i__ or BLAST2 (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the • Known proteins were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated in present as DNA56380.

In light of a sequence homology observed between the DNA56380 consensus sequence and an EST sequence encompassed within the EST clone of Merck no. AA256657, Merck EST clone AA256657 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 138 and is designated herein as DNA57708-1411.

The full length clone shown in the Figure 138 contains a single reading structure open with a translation initiation site apparent at positions 30-32 of the nucleotide and ending at the stop codon found at positions 585-587 of the nucleotide (Figure 138; SEQ ID NO: 210). The predicted polypeptide precursor • (Figure 139, SEC ID NO: 211) is 185 amino acids in length. The PRO1005 has a calculated molecular weight of approximately 20,331 daltons and an estimated pl of approximately 5.85. The clone DNA57708- 1411 has been deposited with the ATCC on June 23 of 1998, and was assigned the no. of deposit ATCC • 203021.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis of sequence alignment WU-BLAST-2 of the full-length sequence shown in Figure 139 (SEQ ID NO: 211), highlights the • homology between the amino acid sequence of PRO1005 and the following Dayhoff sequences: DDU07187_1, DDU87912_1, CELD1007_14, A42239, DDU42597_1, CYAG_DICDI, S50452, MRKC_KLEPN, P- R41998, and XYNA_RUMFL. ^^ fe ^^^ g ^^^^^^^^^ - j ^^^^^^^^^^^^ EXAMPLE 60: Isolation of the cDNA Clones I Encode Human PRO1073 An initial DNA sequence referred to herein as DNA55938 and shown in Figure • 5 142 (SEQ ID NO: 214) was identified using a selection of yeasts, in a cDNA library of human SK-Lu-1 adenocarcinoma cell lines which preferentially represents the extremes 'of the primary cDNA clones. Sequence DNA55938 was then compared with the ESTs of the • public databases (for example, Genbank), and a particular DNA database (LIFESEQ ™, Incyte Pha rma ce u 11 ca 1 s, Palo Alto, CA), using the BLAST or BLAST2 computer program [Altschul, Methods in Enzymology 266: 460-480 (1996)]. ESTs were stacked and assembled into a consensus DNA sequence using the program • "phrap" computer (Phil Green, U versity of Washington, Seattle, Washington). The sequence of The consensus was designated here as DNA56411.

In light of a sequence homology observed between the DNA56411 consensus sequence and an EST sequence encompassed within the EST clone of Merck no. H86027, the Merck EST clone was purchased £ iJ & s? Xtí? * Mi® H86027 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure • 140 The full length DNA57710-1451 clone shown in Figure 89 contains a single open reading structure with a site of initiation of apparent translation in positions • 345-347 of the nucleotide and ends at the stop codon found at positions 1242-1244 of the nucleotide (Figure 140, SEQ ID NO: 212). The predicted polypeptide precursor (Figure 141, SEC.

ID NO: 213) is 299 amino acids in length. The PRO1073 has a calculated molecular weight of approximately 34,689 daltons and an estimated pl • approximately 11.49. PRO1073 has the following additional characteristics: a peptide Signal identity in amino acids 1-31, sequence identity with the domain marker of the transcription factor bZIP in approximately the amino acids, a potential N-glycoside site in approximately amino acids 2-5, and sequence identity with protamine Pl proteins at approximately amino acids 158-183.

An analysis of the Dayhoff 5 database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 141 (SEQ ID NO: 213), reveals some sequence identity between the amino acid sequence of PRO1073 and the following Dayhoff sequences: • MMU37351_1, ATACO 025051 OT 9 J22.10, S59043, ENXNUPR_1, B47328, SR55_DROME, S26650, SON_HUMAN, VIT2_CHICK, and XLC4SRPRT_1.

Clone DNAS 7710 - 1451 has been deposited with the ATCC on July 1, 1998, and assigned the no. of deposit ATCC 203048.

EXAMPLE 61: Isolation of the cDNA Clones Encoding to the Human PR01152 A cDNA clone (DNA57711-1501) encoding a native human PR01152 polypeptide was identified using a yeast selection in a human infant brain cDNA library containing a DNA cDNA. preferentially represents the 5 'ends of the ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^ áj ^^^^^^^^^^^^^^^ g ^^^^^^^ 6 ^^^^^^^^^^^^^ ^ ^ ^^^^ clones of primary cDNAs. Specifically, yeast selection is used to identify a CDNA designated herein as DNA55807 (SEQ.ID.

NO: 217; see Figure 145). • 5 In light of a sequence homology observed between the DNA55807 consensus sequence and an EST sequence encompassed within the Merck EST clone no. R56756, the Merck EST clone was purchased R56756 and the cDNA insert was obtained and • sequencing It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 143. 15 The full-length DNA57711-1501 clone shown in Figure 143 contains only one • open reading structure with an apparent translation initiation site in the positions 58-60 of the nucleotide and ends at the stop codon at positions 1495-1497 of the nucleotide (Figure 143). The predicted polypeptide precursor is 479 amino acids in length (Figure 144). The full-length PR01152 protein shown in Figure 144 has an estimated molecular weight of H-U-HH-a. -ate "to ~ ^ - ^ a ---.- ^ - ^ - - • -. ^ * ^ v .---.? ..-.-. approximately 53,602 daltons and a pl of approximately 8.82. The sequence analysis of the full length PR01152 shown in Figure 144 (SEQ ID NO: 216) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 28, the transmembrane domains roughly from amino acid 133 to approximately the amino acid 155, approximately from amino acid 168 • to approximately amino acid 187, approximately from amino acid 229 to approximately amino acid 247, approximately from amino acid 264 to approximately amino acid 285, approximately from amino acid 309 to approximately amino acid 330, so PP approximated from amino acid 371 to approximately amino acid 390 and so approximate from amino acid 441 to approximately amino acid 464, the potential N-glycosylation sites approximately from amino acid 34 to approximately amino acid 37 and approximately from amino acid 387 to approximately amino acid 390 and a block of amino acid sequence having homology to the respiratory NADH-respiratory chain dehydrogenase subunit approximately from amino acid 243 to approximately amino acid 287. Clone DNA57711-1501 has been deposited with the ATCC on July 1, 1998, and assigned him the no. of deposit ATCC 203047.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 144 (SEQ ID NO: 216), brings out significant homology between the amino acid sequence of PR01152 and the following Dayhoff sequences: AF052239_1, SYNN9CGA_1, SFCYTB2_1, GEN12507, P_R11769, MTV025_109, C61168, S43171, P P61689 and P P61696.

EXAMPLE 62: Isolation of cDNA Clones Encoding Human PR01136 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated as 109142. ^ g ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^ gto ^^^^^^^^^ * ^^^^^^^^^^^ * sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include the public EST databases (for example, Genbank) and a database • of particular DNA (Lifeseq ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-1048 (1996)). Those comparisons give as • result a Blast record of 70 (or in some cases, 90) or greater that did not code the known proteins, were stacked and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated in • present as DNA56039.

In light of a sequence homology observed between the DNA56039 consensus sequence and an EST sequence encompassed within the Merck EST clone no. HSC1NF011, the Merck HSC1NF011 EST clone was purchased and the cDNA insert was obtained and was sequenced. It was found that this insert ^^^^^^^^^^^^^^^^^^? ^^^^? ^^^^^^^^ encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 146 and is designated herein as DNA57827-1493. • Clone DNA57827-1493 contains a single open reading structure with an apparent translation initiation site at positions 216-218 of the nucleotide and ends at the codon of arrest at positions 2112-2114 of the nucleotide • (Figure 146). The predicted polypeptide precursor is 632 amino acids in length (Figure 147). The full-length PR01136 protein shown in Figure 147 has an estimated molecular weight of Approximately 69,643 daltons and a pl of about 8.5. The analysis of the sequence of the full length PR01136 shown in the Figure • 147 (SEQ ID NO: 219) demonstrates the presence of the following: a signal peptide in a manner approximates from amino acid 1 to approximately amino acid 15 and potential N-glycosylation sites approximately from amino acid 108 to approximately amino acid 11, approximately from the amino acid 157 to approximately amino acid - 160, approximately from amino acid 289 to approximately airtá acid 291 and approximately from amino acid 384 to approximately amino acid 387. The clone • DNA57827-1493 has been deposited with the ATCC on July 1, 1998, and assigned the no. of deposit ATCC 203045.

An analysis of the Dayhoff 10 database (version 35.45 SwissProt 35), using the analysis • WU-BLAST-2 sequence alignment of the full length sequence shown in Figure 147 (SEQ ID NO: 219), highlights the significant homology between the 15 amino acid sequence of PR01136 and the following Dayhoff sequences: AF034746_1, AF034745_1, MMAFO 00168_19, HSMUPP1_1, AF060539_1, SP97_RAT, 138757, MMU93309_1, ^^ CEK01A6 4 and HSA224747 1.

EXAMPLE 63: Isolation of cDNA Clones Encoding Human PR0813 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a unique EST group sequence. (sequence of Incyte EST group No. 45501). The sss-t ^ ¿¿¿¿¡¡¡¡¡¡¡¡¡^ ^ ^ ^ ^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ 45501 was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by • 5 example, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six)) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of Consensus DNA with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56400.

In light of a sequence homology observed between the DNA56400 consensus sequence and an EST sequence encompassed within the Merck EST clone no. T90592, Merck EST clone T90592 was purchased and the cDNA insert was obtained and sequencing. It was found that this insert encodes - - a full-length protein. The sequence of this cDNA insert is shown in Figure 148 and is designated herein as DNA57834-1339. • The full-length clone shown in Figure 148 contains a single open reading frame with an apparent translation initiation site at positions 109-111 of the nucleotide and ends at the stop codon found in the • positions 637-639 of the nucleotide (Figure 149; SEQ ID NO: 221). The predicted polypeptide precursor is 176 amino acids in length, has a calculated molecular weight of approximately 19,616 daltons and an estimated pl of approximately 7.11. The sequence analysis of the full length PR0813 shown in Figure 149 (SEQ ID NO: 221) • reveals the presence of the following: a signal peptide approximately from the amino acid 1 to approximately amino acid 26 and potential N-miry-stearylation sites approximately from amino acid 48 to approximately amino acid 53, approximately from amino acid 153 to approximately amino acid 158, so • M * - »*" * - ~ - = - s - - -approximated from amino acid 156 to approximately amino acid 161 and approximately from amino acid 167 to approximately amino acid 172. Clone DNA57834 -1339 has been deposited with ATCC on June 9, 1998, and was assigned the ATCC deposit No. 209954.

An analysis of the amino acid sequence of the full length PR0813 polypeptide suggests that it possesses sequence similarity with the C protein associated with the pulmonary surfactant. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), reveals some degree of homology between the amino acid sequence of PR0813 and the following Dayhoff sequences, PSPC_MUSVI, P_P92071, G02964, P_R65489, P_P82977, P_R84555, S55542, MUSIGHAJ_1 and PH1158.

EXAMPLE 64: Isolation of the cDNA Clones Coding to the Human PRO809 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST group sequence. ¡3ÉÉK - ^ = ^ -..-. »-. ^ ------ ^ ------ ^^^^^^^^^^^ ¿^ ^ ^^^^^ The Incyte EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (for example, Genbank) and a • 5 particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those • Comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were stacked and assembled into a DNA sequence of consensus with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it • was designated herein as DNA56418.

In light of a sequence homology observed between the DNA56418 consensus sequence and an EST sequence encompassed within the Merck EST clone no. H74302, the Merck H74302 EST clone was purchased and the cDNA insert was obtained and sequencing. It was found that this insert encodes - - a full-length protein. The sequence of this cDNA insert is shown in Figure 150 and is designated herein as DNA57836-1338. • The complete nucleotide sequence of DNA57836-1338 is shown in Figure 150 (SEQ ID NO: 222). The clone DNA 57836 - 1338 contains a single open reading structure with a site of initiation of apparent translation in positions • 63-65 of the nucleotide and ends at the stop codon at positions 858-860 of the SEC nucleotide. ID NO: 222 (Figure 150). The predicted polypeptide precursor is 265 amino acids in length (Figure 151). The full-length PRO809 protein shown in Figure 151 has an estimated molecular weight of • approximately 29,061 daltons and a pl of approximately 9.18. Figure 151 also shows the approximate positions of the signal peptide and the N-glycoside sites. The corresponding nucleotides can be determined with reference to Figure 150. The clone DNA57836-1338 has been deposited with the ATCC on June 23, 1998. It is understood that the deposited clone has the current nucleic acid sequence and that the sequences provided herein are based on the known techniques of sequencing. • 5 An analysis of the amino acid sequence of the full-length PRO809 polypeptide suggests that it has some sequence similarity with the hepapine sulfate proteoglycan and with the cell-1 adhesion molecule of the endothelium. Plus • specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), reveals the sequence identity between the PRO809 amino acid sequence and the following Dayhoff sequences, PGBM_MOUSE, D82082_l and PW14158.

EXAMPLE 65: Isolation of cDNA Clones Encoding Human PR0791 Using the Signal Sequence Algorithm described in Example 3 above allowed the identification of a single EST group sequence. The sequence of the Incyte EST group was then compared to a variety of expressed sequence mark (EST) databases that include the bases public EST data (for example, Genbank) and a Sg ^ g »^^^^ - particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was carried out using the program of • 5 BLAST or BLAST2 computer (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were stacked and assembled in a DNA sequence of • consensus with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56429. 15 In light of a sequence homology observed between the DNA56429 consensus sequence and ^ P an EST sequence encompassed within the clone EST of Merck no. 36367, the Merck EST clone was purchased 36367 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 152 and is designated herein as DNA57838-1337. t- "- - --- -. ^ A--». .J. ^, The complete nucleotide sequence of DNA57838-1337 is shown in Figure 152 (SEQ ID NO: 224) The clone DNA57838 - 1337 contains a single open reading structure with an apparent translation initiation site at positions 9-11 of the nucleotide and terminates at the stop codon at positions 747-749 of the nucleotide of SEQ ID NO: 224 ( Figure 152. The precursor of the predicted polypeptide is 246 • amino acids in length (Figure 153) The protein of the full length PR0791 shown in Figure 153 has an estimated molecular weight of about 27,368 daltons and a pl of about 7.45. Figure 153 also shows the approximate locations of the signal peptide, the transmembrane domain, the N- • gl i cos i lac ion sites and a conserved region in the extracellular proteins. provided in l to present can be identified with reference to Figure 152. Clone DNA57838-1337 has been deposited with the ATCC on June 23, 1998. It is understood that the deposited clone has the current nucleic acid sequence and that the n ^ - ^ < - * _ -, ... ^ H -, "" .. ^. ^ .... ..... _ ... ,, .. ^ a --- .. ^^^ ..J, ^^. " ^ ... ,,.

The sequences provided herein are based on known sequencing techniques. • 5 An analysis of the amino acid sequence of the full length PR0791 polypeptide suggests that it has some sequence similarity with the MHC-I antigens, thus indicating that PR0791 can be related to the MHC-10 I antigens. More specifically, an analysis of the basis of • Dayhoff data (version 35.45 SwissProt 35), reveals some sequence identity between the amino acid sequence of PR0791 and the following Dayhoff sequences, AF034346_1, MMQ1K5_1 and HFE HUMAN.

EXAMPLE 66: Isolation of the cDNA Clones that P Code ai PRO1004 Human The use of the signal sequence algorithm described in Example 3 above allowed the identification of a sequence of the single EST group of Incyte, sequence of the EST group of Incyte no. 73681. This sequence of the EST group was then compared to a variety of brand databases of expressed sequence (EST) that include public EST databases (eg, Genbank) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in • Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were stacked and assembled into a DNA sequence of consensus with the "phrap" program (Phil Green, • Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56516.

In light of a sequence homology observed between the DNA56516 consensus sequence and an EST sequence encompassed within the EST clone of • Merck no. H43837, Merck EST clone H43837 was purchased and the cDNA insert was obtained and sequencing. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 154.

The full-length clone shown in Figure 154 contains a single open reading frame with an apparent translation initiation site at positions 119-121 of the nucleotide and ends at the stop codon found in the • 5 positions 464-466 of the nucleotide (Figure 154, SEQ ID NO: 226). The predicted polypeptide precursor is 115 amino acids in length (Figure 155, SEQ ID NO: 227). The PRO1004 full length protein shown in Figure 155 has a weight molecular estimate of approximately 13,649 daltons • and a pl of approximately 9.58. The analysis of the sequence of the full-length PRO1004 shown in Figure 155 (SEQ ID NO: 227) reveals the presence of the following characteristics: signal peptide at approximately amino acids 1-24, a C-terminal target signal from microbodies at approximately amino acids 113- • 115, a potential N-glycosylation site at approximately amino acids 71-74, and a domain having sequence identity with the dihydrofolate reductase proteins at about amino acids 22-48.

An analysis of the amino acid sequence 25 of the PRO1004 polypeptide using the Dayhoff database (version 35.45 SwissProt 35), demonstrates the homology between the amino acid sequence of the PRO1004 and the following Dayhoff sequences, CELR02D3_7, LECI_MOUSE, AF006691_3, ^ P SSZ97390 1, SSZ97395 1, and SSZ97400_1.

The clone DNA5784 - 1410 has been deposited with the ATCC on June 23, 1998, and was assigned the no. of reservoir ATCC 203010. 10 • EXAMPLE 67: Isolation of the cDNA Clones that Codify the Human PROllll A database of DNA with a trademark was searched of expressed sequence (EST) (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) and an EST was identified that has homology to the insulin-like growth factor binding protein. • RNA was isolated for the construction of the 20 cDNA libraries from the human fetal brain. The cDNA libraries used to isolate the cDNA clones encoding human PROllll were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. He * S * - < »-? ^ - -. . ~ . ^ ... ^^^ To ... _. _ * ^ E¡ :. *! & ietbt & .. ^ tl-. ^. ^ Y. _ ^., ...

CDNA was primed with oligo dT containing the NotI site, ligated with the blunt portion to the hemicinase adapters of SalI, excised with NotI, appropriately sized by 5 gel electrophoresis, and cloned in a defined orientation in a vector suitable cloning (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D not containing the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) at the unique sites Xhol and Notl . • The human fetal brain cDNA libraries (prepared as described above) were selected by hybridization with an oligonucleotide probe based on the Incyte EST sequence as described above: 5 '-CCACCACCTGGAGGTCCTGCAGTTGGGCAGGAACTCCATCCGGCAGATTG-3' (SEQ. NO: 251).

An identified cDNA clone was sequenced in its entirety. The complete nucleotide sequence of PROllll is shown in Figure 156 (SEQ ID NO: 228). The clone DNA58721 - 1475 contains a single open reading structure with a site of initiation of apparent translation in the positions 57-59 of the nucleotide and a stop codon at the positions 2016-2018 of the nucleotide (Figure 156; SEQ ID NO: 228). The predicted polypeptide precursor is 653 amino acids in length (Figure 157). The transmembrane domains are in positions 21-40 (type II) and 528-548. The clone DNA58721-1475 has been deposited with the ATCC and was assigned the no. ATCC deposit 203110. The full-length PROllll protein shown in Figure 157 has an estimated molecular weight of approximately 72,717 daltons and a pl of approximately 6.99.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 157 (SEQ ID NO: 229), reveals some identity sequence between the PROllll amino acid sequence and the following Dayhoff sequences: A58532, D86983_l, RNPLGPV_1, PGS2_HUMAN, AF038127_1, ALS_MOUSE, GPV_HUMAN, PGS2_BOVIN, ALS_PAPPA and 147020. • ^ '^ "^ • ^ a --- A- .. < - ~ ---- ^ -.. -.....

EXAMPLE 68: Isolation of cDNA Clones Encoding Human PR01344 A consensus DNA sequence was assembled in relation to other EST sequences using phrap • as described in Example 1 above. This consensus sequence is designated herein as DNA33790. Based on the DNA33790 consensus sequence, oligonucleotides 1) were synthesized to identify a cDNA library by PCR containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR01344.

PCR primers (forward and reverse 5 'forward PCR primer -AGGTTCGTGATGGAGACAACCGCG-3' (SEQ ID NO: 232) 5 'reverse PCR primer 5' -TGTCAAGGACGCACTGCCGTCATG-3 '(SEQ ID NO: 233) Adi c iona were synthesized A synthetic hybridization probe of the oligonucleotide was constructed from the DNA33790 sequence having the following nucleotide sequence: hybridization probe .-¿^ ^^^ - ¿^ ^ ¿^^^^^ - ^^^^^^^^ - j ^^ fe ^^ 5 '-TGGCCAGATCATCAAGCGTGTCTGTGGCAACGAGCGGCCAGCTCCTATCC-3' (S E C. I D N O: 2 3 4) To select several libraries of a • 5 source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones that encode the PR01344 gene using the • oligonucleotide probe and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from human fetal kidney tissue. The DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR01344 (designated here as DNA58723-1588 [FIG. 158, SEC. ID NO: 159]) and the sequence of the derived protein for PR01344.

The complete nucleotide sequence of DNA58723-1588 is shown in Figure 158 (SEQ ID NO: 230). The clone DNA58723-1588 contains only one open reading structure with an apparent translation initiation site at positions 26-28 of the nucleotide and ending at the stop codon at positions 2186-2188 of the nucleotide (Figure 158).

• The predicted polypeptide precursor is 720 amino acids in length, has an estimated molecular weight of about 80,199 daltons and a pl of about 7.77. A sequence analysis of the full length PR01344 shown in Figure 159 (SEQ ID NO: 231) highlights the presence of the • next: a signal peptide roughly from amino acid 1 to approximately amino acid 23, a sequence of the cysteine protein tag of the EGF-like domain so approximate from amino acid 260 to approximately amino acid 271, the potential N-glycosylation sites approximately from the • amino acid 96 to approximately amino acid 99, approximately from amino acid 279 to approximately amino acid 282, approximately from amino acid 316 to approximately amino acid 319, approximately from amino acid 451 to approximately amino acid 454 and approximately from amino acid 614 to approximately amino acid 617, a block of ------- .-I "- -.-Y- •,» yia¿a¡- .., ..-.- a »fc- .. v5mj. ^ J. - - amino acid sequence having homology with the trypsin family and the serine proteases approximately from amino acid 489 to about amino acid 505 and a sequence of • protein profile of the CUB domain approximately from amino acid 150 to approximately amino acid 166. Clone DNA58723-1588 has been deposited with the ATCC on August 18, 1998, and assigned no. of deposit ATCC 203133. 10 • An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in the Figure 159 (SEQ ID NO: 231), demonstrates the homology between the amino acid sequence of PR01344 and the following Dayhoff sequences: • S77063_l, CRAR_MOUSE, P_R74775, P_P90070, P_R09217, P P70475, HSBMP16 1 and U50330 1. 20 EXAMPLE 69: Isolation of cDNA Clones Encoding Human PRO1109 A consensus DNA sequence was assembled in relation to other EST sequences using phrap 25 as described in Example 1 above. This : i ^^^ gj¡H & ^ g ^ a ^^ jí - - consensus sequence is designated here as DNA52642. The consensus sequence was obtained by extending it using the repeated cycles of BLAST and phrap, a consensus sequence was previously obtained as much as possible using the sources of the EST sequences described above. Based on the DNA52642 consensus sequence, oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of • interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PRO1109.

PCR primers (forward and reverse) were synthesized: forward PCR primer 5 '-CCTTACCTCAGAGGCCAGAGCAAGC-3' (SEQ ID NO: 237) 5 'reverse PCR primer 5-GAGCTTCATCCGTTCTGCGTTCACC-3' (SEQ ID NO: 238) Additionally, a synthetic oligonucleotide oligonucleotide probe was constructed from the DNA52642 sequence having the following nucleotide sequence: "" • - - - - .t ^. ^ _ ^ ^^^^^ jjg ^ - ^ Hybridization probe 5 '-CAGGAATGTAAAGCTTTACAGAGGGTCGCCATCCTCGTTCCCCACC-3' (SEQ ID NO: 239) • 5 To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones that • encode the PRO1109 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from cell tissue of human SK-Lu-1 adenocarcinoma (LIB247).

DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PRO1109 (designated here as DNA58737-1473 [Figure 160, SEQ ID NO: 235]) and the sequence of the protein derived for PRO1109.

The complete nucleotide sequence of DNA58737-1473 is shown in Figure 160 (SEQ ID NO: 235). Clone DNA58737-1473 contains a single open reading frame with an apparent translation initiation site at positions 119-120 of the nucleotide and ends at the codon of • 5 stop at positions 1151-1153 of the nucleotide (Figure 160). The predicted polypeptide precursor is 344 amino acids in length (Figure 161). The full-length PRO1109 protein shown in Figure 161 has an estimated molecular weight of about 40,041 daltons and a pl of about 9.34. A sequence analysis of the full-length PRO1109 shown in Figure 161 (SEQ ID NO: 236) evidences the presence of the following: a signal peptide of Approximately from amino acid 1 to approximately amino acid 27, the potential N-glycosylation sites approximately from amino acid 4 to about amino acid 7, approximately from amino acid 220 to about amino acid 223 and roughly from amino acid 335 to about amino acid 338 and an amino acid sequence block having approximate homology with xylose isomerase proteins from amino acid 191 to about amino acid 201. The clone DNA58737 - 1473 has been deposited with the ATCC on August 18, 1998 and the no. of deposit of ATCC 203136. • 5 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 161 (SEQ ID NO: 236), highlights the significant homology between the sequence of • PRO1109 amino acids and the following Dayhoff sequences: HSUDPGAL_1, HSUDPB14_1, NALS_BOVIN, HSU10473_1, CEW02B12_11, YNJ4_CAEEL, AE000738_11, CET24D1_1, S48121 and CEGLY9_1. EXAMPLE 70: Isolation of cDNA Clones Encoding Human PR01383 • A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA53961. Based on the DNA53961 consensus sequence, Ig oligonucleotides were synthesized 1) to identify a cDNA library by PCR containing the sequence of the antibodies, and 2) to be used as probes to isolate a full-length coding sequence clone for PR01383.

PCR primers (forward and reverse) were synthesized: forward PCR primer 5 '-CATTTCCTTACCCTGGACCCAGCTCC-3' (SEQ ID NO: 242) 5 'reverse PCR primer -GAAAGGCCCACAGCACATCTGGCAG-3' (SEQ ID NO: 243) Additionally, a synthetic hybridization probe of the oligonucleotide was constructed from the DNA53961 sequence having the following nucleotide sequence 5 'hybridization probe -CCACGACCCGAGCAACTTCCTCAAGACCGACTTGTTTCTCTACAGC-3' (SEQ ID NO: 244) To select vain libraries from a source of a full length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01383 gene using the • ^^^ t ^ A ^ tj ^^ * ^ ,, £ .. - - probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from human fetal brain tissue. • DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR01383 (designated here as DNA58743-1609 [Figure 162, SEC. ID NO: 240]); and the sequence of • derived protein for PR01383.

The complete nucleotide sequence of DNA58743-1609 is shown in Figure 162 (SEQ ID.

NO: 240). Clone DNA58743-1609 contains a single open reading structure with an apparent translation initiation site in the positions • 122-124 of the nucleotide and ends at the stop codon at positions 1391-1393 of the nucleotide (Figure 162). The predicted polypeptide precursor is 423 amino acids in length (Figure 163). The full-length PR01383 protein shown in Figure 163 has an estimated molecular weight of approximately 46,989 daltons and a pl approximately 6.77. An analysis of the sequence g ^^^^^^ I | ^^. | ^ -..--- ^ --- ^ - .-- ^^^^ - ^^^^^^ jM ^ H ^^^^ U ^ ^^^^^^ | ^^ j ^ - | g ^^ 2 of the full-length PR01393 shown in Figure 163 (SEQ ID NO: 241) evidences the presence of the following: a signal peptide in a manner approximate from amino acid 1 to approximately • amino acid 24, a transmembrane domain approximately from amino acid 339 to approximately amino acid 362, and potential N-gly and ion sites approximately from amino acid 34 to 10 approximately amino acid 37, approximately from amino acid 58 to approximately amino acid 61, approximately from amino acid 142 to approximately amino acid 145, approximately from amino acid 197 to approximately amino acid 200, approximately from amino acid 300 to • approximately amino acid 303 and approximately from amino acid 364 to 2 0 approximately amino acid 367. The clone DNA58743-1609 has been deposited with the ATCC on August 25, 1998 and assigned the no. of deposit of ATCC 203154.

An analysis of the Dayhoff database ? M -.-- ^ ¿¿^ ^ ^ ^ ^ ^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^ | ^^ || ^^^^^^^^^^^ - (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 163 (SEQ ID NO: 241), highlights the • 5 homology between the amino acid sequence of PR01383 and the following Dayhoff sequences: NMB__HUMAN, QNR_COTJA, P_W38335, P115_CHICK, P_W38164, A45993_l, MMU70209_1, D83704_l and P_W39176.

EXAMPLE 71: Isolation of the cDNA Clones that • Encode Human PRQ1003 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of Incyte, unique, designated herein as 43055. The sequence was then compared to a variety of EST databases including the databases • Public ESTs (for example, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons give as A result of a Blast record of 70 (or in some cases, 90) or older that did not code for the known proteins was pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as a consensus.

In light of a sequence homology 10 observed between the consensus sequence and a • EST sequence encompassed within the EST clone of Incyte no. 2849382, the EST clone of Incyte no. 2849382 and the cDNA insert was obtained and sequenced. It was found that this insert 15 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 164 • The complete nucleotide sequence of DNA58846-1409 is shown in Figure 164 (SEQ ID NO: 245). Clone DNA58846-1409 contains a single open reading frame with an apparent translation initiation site at positions 41-43 of the nucleotide and ends at the stop codon at positions 293-295 of the nucleotide (Figure 164). The predicted polypeptide precursor is 84 amino acids in length (Figure 165). The full-length PRO1003 protein shown in Figure 165 has an estimated molecular weight of • approximately 9,408 daltons and a pl of approximately 9.28. The sequence analysis of the full length PRO1003 shown in Figure 165 (SEQ ID NO: 246) evidences the presence of a signal peptide in the amino acids 1 up to about 24, and a site of • phosphorylation of cAMP-dependent protein kinase and cGMP at approximately amino acids 58 to approximately 61.

An analysis of the amino acid sequence of the PRO1003 full-length polypeptide using the Dayhoff database (version 35.45 SwissProt 35), demonstrates the homology between the amino acid sequence of PRO1003 and the following Dayhoff sequences: AOPCZA363_3, SRTX_ATREN, A48298, MHVJHMS_1, VGL2_CVMJH, DHDHTC2_2, CORT_RAT, TAL6_HUMAN, P_W14123, and DVUFI 2.

- EXAMPLE 72: Isolation of cDNA Clones Encoding Human PRO1108 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA53237.

In light of a sequence homology 10 observed between the DNA53237 consensus sequence and • an EST sequence encompassed within the EST clone of Incyte no. 2379881, the EST clone of Incyte 2379881 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert 15 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 166 and is designated herein • as DNA58848-1472.

The complete nucleotide sequence of DNA58848-1472 is shown in Figure 166 (SEQ ID NO: 247). Clone DNA58848-1472 contains a single open reading structure with an apparent translation initiation site at positions 77-259 of the nucleotide and ends at the stop codon in ^ w ^ á ^^^^^ g ^ positions 1445-1447 of the nucleotide (Figure 166). The predicted polypeptide precursor is 456 amino acids in length (Figure 167). The protein of the full length PRO1108 shown in Figure 167 has an estimated molecular weight of about 52,071 daltons and a pl of about 9.46. A sequence analysis of the full-length PRO1108 shown in Figure 167 (SEQ ID NO: 248) evidences the presence of the following: type II transmembrane domain roughly • from amino acid 22 to approximately amino acid 42, approximately from amino acid 156 to approximately amino acid 176, approximately from amino acid 180 to approximately amino acid 199 and approximately from amino acid 369 to about amino acid 388, the potential N- • glycosylation sites approximately from amino acid 247 to about amino acid 250, approximately from amino acid 327 to approximately amino acid 330, approximately from amino acid 328 to approximately amino acid 331 and approximately from amino acid 362 to approximately amino acid 365 and a block of amino acids having homology with the receptor protein that retains the proteins of the ER lumen roughly from amino acid 153 to about amino acid 190. The clone DNA58848-1472 has been deposited with the ATCC on June 9. • 1998 and the no. of deposit of ATCC 209955.

An analysis of the amino acid sequence of the full-length PRO1108 polypeptide suggests that it has some sequence similarity with the LPAAT protein, thus indicating that the • PRO1108 can be a new LPAAT counterpart. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), reveals the significant homology between the amino acid sequence of PRO1108 and the following Dayhoff sequences, AF015811_1, CER07E3_2, YL35_CAEEL, S73863, CEF59F4_4, P_W06422, • MMU41736_1, MTV008_39, P_R99248 and Y67_BPT7.

EXAMPLE 73: Isolation of cDNA Clones Encoding Human PR01137 Extracellular Domain (ECD) Sequences (which include the secretion signal, if any) from approximately 950 secreted proteins known from the protein database ^ - - | tfj &j public Swiss-Prot were used to search expressed sequence mark (EST) databases. EST databases include public databases (for example, GenBank), and a database of • particular data (for example LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the BLAST OR BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the sequences of the ECD protein with a translation of • Structure 6 of the EST sequence. Using this procedure the Incyte EST No. 3459449, also referred to herein as "DNA7108", was identified as an EST having a Blast record. of 70 or greater that did not code for known proteins.

A consensus DNA sequence was assembled in relation to the sequence DNA7108 and other ESTs using the repeated cycles of BLAST and the "phrap" program (Phil Green, Univ. Of Washington, Seattle, WA). ). The consensus sequence obtained therefrom was referred to herein as DNA53952. 25 In light of a sequence homology observed between the DNA53952 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3663102, the EST clone of • Incyte 3663102 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 168. 10 • The complete nucleotide sequence of DNA58849-1494 is shown in Figure 168 (SEQ ID NO: 249). Clone DNA 58849-1494 contains a single open reading frame with an apparent translation initiation site at positions 77-79 of the nucleotide and ends at the stop codon at positions 797-799 of the nucleotide • (Figure 168) . The predicted polypeptide precursor is 240 amino acids in length (Figure 169). The protein of the full-length PR01137 shown in Figure 169 has an estimated molecular weight of about 26,064 daltons and a pl of about 8.65. An analysis of the sequence of the full-length PR01137 shown in Figure 169 (SEQ ID NO: 250) reveals the 'g ^^ - gg ^^^^ - ^ jgg ^^^^^^^^^^^ j ^^^^^^^^^^^^^^^^^^^^^^^^ ^, presence of a signal peptide at approximately amino acids 1 to 14 and a potential N-glycoside site at approximately amino acids 101-105.

An analysis of the amino acid sequence of the full-length PR01137 polypeptide suggests that it possesses significant sequence similarity to the ribos i Itrans ferase, thus indicating that PR01137 may be a new member of the ribos family i lt rans fera sa of proteins. An analysis of the amino acid sequence of the full length PR01137 polypeptide using the Dayhoff database (version 35.45 SwissProt 35), demonstrates the homology between the amino acid sequence of PR01137 and the following Dayhoff sequences: MMART5_1, NARG_MOUSE, GEN11909, GEN13794, GEN14406, MMRNART62_1, and P_R41876.

EXAMPLE 74: Isolation of cDNA Clones Encoding Human PR01138 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a single Incyte EST sequence, - - sequence of the Incyte group no. 165212. This group sequence was then compared to a variety of expressed sequence mark (EST) databases that include EST databases • 5 public (for example, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST computer program or BLAST2 (Altschul, Methods in Enzymology 266: 460- • 480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were piled up and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The sequence of • consensus obtained from it was designated here as DNA54224. The assembly includes the EST property of Genentech designated herein as DNA49140 (Figure 172; SEQ ID NO: 254), In light of a sequence homology observed between the DNA49140 consensus sequence and an EST sequence encompassed within the EST clone of ^^^^^ ^ ^^^^^^ «fe ^^^^^^^^^^ j ^^^^^^^ Incyte no. 3836613, the EST clone of Incyte no. 3836613 and the DNA.c insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The • Sequence of this cDNA insert is shown in Figure 170 and is the full-length DNA sequence for PR01138. The clone DNA58850-1495 has been deposited with the ATCC on June 9, 1998, and was assigned the no. of deposit ATCC 209956. • The complete nucleotide sequence of DNA58850-1495 is shown in Figure 170 (SEQ ID NO: 252). The clone DNA58850 - 1495 contains only one open reading structure with an apparent translation initiation site at positions 38-40 of the nucleotide and ending at the stop codon at positions 1043-1045 of the nucleotide (Figure 170). The predicted polypeptide precursor is 335 amino acids in length (Figure 171). The full-length PR01138 protein shown in Figure 171 has an estimated molecular weight of about 37,421 daltons and a pl of about 6.36. The analysis of the sequence of the full-length PR01138 shown in Ba ^ lte ^^^^ - ^ - ^ -----_ ^^^^^^^^^^^^^^^^^^^^^^^ gí ^^ j | g ^^^^ ^^ s - Figure 171 (SEQ ID NO: 256) reveals the presence of the following characteristics: a signal peptide in amino acids 1 to approximately 22, a transmembrane domain in • i about amino acids 224 to about 250: a pattern of closing leucine at about amino acids 229 to about 250; and the potential N-glycoside sites at about amino acids 98-101, 142-145, 148-151, 172-175, 176-179, 204-207, and • 291-295. An analysis of the amino acid sequence of the full-length PR01138 polypeptide suggests that it has sequence similarity significant with CD84, thus indicating that PR01138 may be a new member of the Ig superfamily of the polypeptides. Plus # particularly, an analysis of the amino acid sequence of PR01138 polypeptide length complete using the Dayhoff database (version 35.45 SwissProt 35), reveals the homology between the amino acid sequence of the PR01138 and the following Dayhoff sequences: HSU82988_1, HUMLY9_1, P_R97631, P_R97628, P_R97629, P_R97630, CD48_RAT, CD2_HUMAN, P_P93996, and HUMBGP_1.

- - The clone DNA58850-1495 has been deposited with the ATCC on June 9, 1998, and was assigned the no. of deposit of ATCC 209956. • EXAMPLE 75: Isolation of the cDNA Clones Encoding to the Human PRO1054 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a sequence of the EST group of the • Incyte database, designated as 66212. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include EST databases public databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify • existing homologies. The homology search was performed using the BLAST computer program or BLAST2 (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for the known proteins, were pooled and assembled into a consensus DNA sequence with Jgg? JY * - the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA55722. • 5 In light of a sequence homology observed between the consensus sequence DNA55722 and an EST sequence encompassed within the EST clone of Incyte no. 319751, the EST clone of Incyte 319751 and the cDNA insert was obtained and • sequencing It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 173 and is designated herein as DNA58853-1423.

The clone DNA58853- 1 23 contains only one • open reading structure with an apparent translation initiation site in the positions 46-48 of the nucleotide and ends at the stop codon at positions 586-588 of the nucleotide (Figure 173). The predicted polypeptide precursor is 180 amino acids in length (Figure 174). PRO1054 protein of full length shown in Figure 174 has an estimated molecular weight of - & *** .. approximately 20,638 daltons and a pl of approximately 5.0. The sequence analysis of the full length PRO1054 shown in Figure 174 (SEQ ID NO: 256) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 18, a pattern of leucine closure roughly from amino acid 155 to approximately amino acid 176 and blocks of the amino acid sequence that • have homology to the lipocalin proteins roughly from amino acid 27 to approximately amino acid 38 and approximately from amino acid 110 to approximately amino acid 120. Clone DNA58853-1423 has been deposited with the ATCC on June 23, 1998, and was assigned no. deposit • ATCC 203016.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in the Figure 174 (SEQ ID NO: 256), highlights the significant homology between the sequence of ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^ »^^ Y ^^^^^^« ^^^^ amino acids of the PRO1054 and the following Dayhoff sequences: MUP1_M0USE, MUP6_M0USE, MUP2_M0USE, MUP8_M0USE, MUP5_M0USE, MUP4_M0USE, S10124, MUPM MOUSE, MUP RAT and ECU70823 1. • EXAMPLE 76: Isolation of the cDNA Clones Encoding Human PR0994 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a sequence of the EST group of the • Incyte database, designated as 157555. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include EST databases public (for example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify the • existing homologies. The search for homology was made using the BLAST computer program or BLAST2 (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were piled up and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA55728.

In light of a sequence homology observed between the DNA55728 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2860366, the EST clone of Incyte 2860366 and the cDNA insert was obtained and • sequenced It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 175 and is designated herein as DNA58855-1422.

The clone DNA58855- 1 22 contains only one • open reading structure with an apparent translation initiation site in the positions 31-33 of the nucleotide and ends at the stop codon at positions 718-720 of the nucleotide (Figure 175). The predicted polypeptide precursor is 229 amino acids in length (Figure 176). The protein of full-length PR0994 shown in Figure 176 has an estimated molecular weight of approximately 25,109 daltons and a pl of approximately 6.83. The analysis of the sequence of the full-length PR0994 shown in Figure 176 (SEQ ID NO: 258) reveals the • presence of the following: transmembrane domains roughly from amino acid 10 to approximately amino acid 31, approximately from amino acid 50 to approximately amino acid 72, thus approximate from amino acid 87 to • approximately amino acid 110 and roughly from amino acid 191 to about amino acid 213, the potential N-glycosylation sites approximately from the amino acid 80 to approximately the amino acid 83, approximately from the amino acid 132 to approximately the amino acid 135, so • approximate from amino acid 148 to approximately amino acid 151 and so approximate from amino acid 163 to approximately amino acid 166 and a block of amino acids having homology to the cysteine-rich region proteins TNFR / NGFR roughly from amino acid 4 to approximately amino acid 11. The clone DNA58855- -Ü -É-Ü. ^ • iá ms ^ * ^ .. j-záki ^^. 1422 has been deposited with the ATCC on June 23, 1998, and was assigned no. of deposit ATCC 203018. • 5 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 176 (SEQ ID NO: 258), reveals the significant homology between the amino acid sequence of PR0994 and the following Dayhoff sequences: AF027204_1, TAL6_HUMAN, ILT4_HUMAN, JC6205, MMU57570_1, S40363, ETU56093_1, S42858, P_R66849 and P_R74751. EXAMPLE 77: Isolation of the cDNA Clones Encoding Human PR0812 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated as 170079 This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST 25 databases (for example, Genbank) and a database • nfí.í i rntif ¡rrr - * a * ¿- - ^ "^ - 5" * - »£ -" - - -of particular EST DNA (Lifeseq ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify Existing homologies The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996).) Those comparisons result in a Blast record of 70 (or in some cases, 90) or older ones that did not code for the known proteins were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington.) The consensus sequence obtained from the same was designated in the present as DNA55721.

In light of a sequence homology observed between the consensus sequence DNA55721 and an EST sequence encompassed within the EST clone of Incyte no. 388964, the EST clone of Incyte 388964 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 177 and is designated herein as DNA58205-1421.

Clone DNA58205-1421 contains a single open reading structure with a translation initiation site apparent in the positions • 5 55-57 of the nucleotide and ends at the stop codon at positions 304-306 of the nucleotide (Figure 177). The predicted polypeptide precursor is 83 amino acids in length (Figure 178). The protein of full-length PR0812 shown in Figure 178 has an estimated molecular weight of • approximately 9,201 daltons and a pl of about 9.3. The analysis of the sequence of the full-length PR0812 shown in Figure 178 (SEQ ID NO: 260) reveals the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 15, a site of F phosphorylation of the protein kinase deposited from cAMP and cGMP approximately from the amino acid 73 to approximately amino acid 76 and phosphorylation sites of protein kinase C approximately from amino acid 70 to approximately amino acid 72 and approximately from amino acid 76 to approximately amino acid 78. The clone DNA58205-1421 has been deposited with the ATCC on June 23, 1998, and was assigned no. of deposit ATCC 203009.

• An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 178 (SEQ ID NO: 260), puts evidence the significant homology between the sequence of • amino acids of PR0812 and the following Dayhoff sequences: P_W35802, P_W35803, PSC1_RAT, S68231, GEN13917, PSC2_RAT, CC10_HUMAN, UTER_RABIT, AF008595_1 and A56413. EXAMPLE 78: Isolation of the cDNA Clones Encoding to the Human PRO1069 • The use of the signal sequence algorithm described in Example 3 above allowed the Identification of a single Incyte EST sequence, designated herein as 100727. This sequence was then compared to a particular EST DNA database (LIFESEQIM, Incyte Pharmaceuticals, Palo Alto, CA) to identify the homologies existent'es. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated herein as DNA56001. • In light of a sequence homology observed between the DNA56001 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3533881, the EST clone of Incyte no. 3533881 and the cDNA insert was obtained and sequenced. It was found that this insert • encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 179 and is the full-length DNA sequence for the PRO1069. The clone DNA59211-1450 has been deposited with the ATCC on June 9, 1998, and was assigned the no. of deposit of ATCC 209960. 25 ^^^ .--- ^ - ^^^^^^^^^^^^^ gjgjSílj ^ jgK ^^ - - The complete nucleotide sequence of DNA59211-1450 is shown in Figure 179 (SEQ ID NO: 261). The clone DNA59211 - 1450 contains a single open reading structure with a site of • 5 initiation of apparent translation at positions 197-199 of the nucleotide and ending at the stop codon at positions 464-466 of the nucleotide. The predicted polypeptide precursor is 89 amino acids in length (Figure 180). The protein of the full length PRO1069 shown in the • Figure 180 has an estimated molecular weight of approximately 9,433 daltons and a pl of approximately 8.21. The sequence analysis of the full-length PRO1069 shown in the Figure 180 (SEQ ID NO: 262) evidences the presence of the following characteristics: a signal peptide in amino acids 1 to approximately 16, a transmembrane domain in approximately amino acids 36 up to approximately 59; the potential N-my sites to the amino acids 41-46, 45-50, and 84-89; and homology to extracellular proteins SC P / Tpx-1 / Ag5 / PR-1 / Sc7 at approximately amino acids 54 through approximately 66.

An analysis of the amino acid sequence of the full-length PRO1069 polypeptide suggests that it has sequence similarity • significant with CHIF, thus indicating that PRO1069 may be a new member of the CHIF superfamily of polypeptides. More particularly, an analysis of the amino acid sequence of the PRO1069 polypeptide in length complete using the Dayhoff database • (version 35.45 SwissProt 35), reveals the homology between the amino acid sequence of PRO1069 and the following Dayhoff sequences: CHIF_RAT, A55571, PLM_HUMAN, A40533, ATNG_BOVIN, RIC MOUSE, PETD SYNY3, VTBl XENLA, A05009, and S75086.

The clone DNA59211-1450 has been deposited with • ATCC on June 9, 1998, and the no. of deposit of ATCC 209960. EXAMPLE 79: Isolation of cDNA Clones Encoding to Human PR01129 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST group sequence And- Tf. -, ... _ ** ^ .. - ^ .... - ^ * - i? ^^^^^? *** ^^ ".. of Incyte designated herein as 98833. The sequence sequence of the Incyte EST group does not. 98833 was then compared to a variety of expressed sequence mark (EST) databases • 5 that include public EST databases (for example, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program • (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The • consensus sequence obtained from it was designated herein as DNA56038. 20 In light of a sequence homology observed between the DNA56038 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 1335241, the EST clone of Incyte 1335241 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 181 and is designated herein • 5 as DNA59213-1487.

The full length clone shown in Figure 181 contains a single open reading structure with a translation initiation site apparent at positions 42-44 of the nucleotide and • ends at the stop codon found at positions 1614-1616 of the nucleotide (Figure 181, SEQ ID NO: 263). The predicted polypeptide precursor is 524 amino acids in length, has a molecular weight calculated from approximately 60,310 daltons and an estimated pl of approximately 7.46. The analysis of the sequence of the full-length PR01129 shown in • Figure 182 (SEQ ID NO: 264) reveals the presence of the following: the domains of transmembrane type II approximately from amino acid 13 to approximately amino acid 32 and approximately from amino acid 77 to approximately amino acid 102, a sequence of the heme-iron ligand label of the cysteine of the cytochrome P-450 approximately from the amino acid 461 to about amino acid 470 and potential N-glycosylation sites approximately from amino acid 112 to about amino acid 115 and so • approximate from amino acid 168 to approximately amino acid 171. Clone DNA59213-1487 has been deposited with the ATCC on June 9, 1998, and assigned no. of deposit ATCC 209959.

An analysis of the amino acid sequence • of the full-length PR01129 polypeptide suggests that it possesses sequence similarity with the cytochrome P-450 family of the proteins. More specifically, an analysis of the database Dayhoff (version 35.45 SwissProt 35), reveals some degree of homology between the amino acid sequence of PR01129 and the • following Dayhoff sequences, AC004523_1, S45702, AF054821_1 and 153015. EXAMPLE 80: Isolation of the cDNA Clones Encoding to the Human PRO1068 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the LIFESEQ ™ database, designated Incyte group no. 141736. This sequence of the EST group was then compared to a variety of expressed sequence (gT) -label databases that include the bases public EST data (for example, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST 10 or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were piled up and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56094. 20 In light of a sequence homology observed between the DNA56094 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 004974, the EST clone of Incyte 004974 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 183 and is designated herein as DNA59214-1449 (SEQ ID NO: 265).

The full-length clone shown in Figure 183 contains a single open reading structure with a translation initiation site apparent at positions 42-44 of the nucleotide and f terminates at the stop codon found at positions 414-416 of the nucleotide (Figure 183, SEQ ID NO: 265). The predicted polypeptide precursor (Figure 184, SEQ ID NO: 266) is 124 amino acids in length The PRO1068 polypeptide has the following additional characteristics, as indicated in Figure 184: a sequence of the signal peptide f at approximately amino acids 1-20, a sequence of the urotensin II label in approximately amino acids 118-123, a cell binding sequence at approximately amino acids 64-66, and a phosphorylation site of cAMP-dependent protein kinase and cGMP at approximately amino acids 112-115. 25 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in the Figure • 184 (SEQ ID NO: 266), revealed the homology between the amino acid sequence of PRO1068 and the following Dayhoff sequences: HALB0P_1, MTV043_36, 150498, and P_R78445.

The clone DNA59214-1449 has been deposited with • the ATCC on July 1, 1998, and the no. of deposit ATCC 203046.

EXAMPLE 81: Isolation of the cDNA Clones that Codify the Human PRO1066 The use of the signal sequence algorithm described in Example 3 above allowed the • identification of a sequence of the Incyte EST group, designated herein as 79066. The sequence of the Incyte EST group is not. 79066 was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular DNA database 25 (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those # Comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, 10 University of Washington, Seattle, Washington). The • consensus sequence obtained from it was designated herein as DNA56121.

In light of a sequence homology 15 observed between the DNA56121 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 1515315, the EST clone of • Incyte 1515315 and the cDNA insert was obtained and sequenced. It was found that this insert 20 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 185 and is designated herein as DNA59215-1.

The full-length clone shown in Figure 185 contains a single open reading frame with an apparent translation initiation site at positions 176-178 of the nucleotide and ends at the stop codon found at 5 positions 527-529 of the nucleotide (Figure 185, SEQ ID NO: 267). The predicted polypeptide precursor is 117 amino acids in length, has a calculated molecular weight of about 12,911 daltons and an estimated pl of about 5.46. He sequence analysis of the PRO1066 in length • complete shown in Figure 186 (SEQ ID NO: 268) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 23, a phosphorylation site of the protein kinase dependent on cAMP and cGMP roughly from amino acid 38 to about • amino acid 41 and the potential N-mi r i s sites to the amino acid to approximately amino acid 10, approximately from amino acid 63 to approximately amino acid 68 and approximately from amino acid 83 to approximately amino acid 88. The clone UNQ524 (DNA59215-1425) has been deposited with the ATCC on 9 June 1998, and the no. of deposit ATCC 209961.

^^ An analysis of the amino acid sequence 9 of the full-length PRO1066 polypeptide suggests that it possesses sequence similarity to the known human protein. However, an analysis of the Dayhoff database (version 35.45 SwissProt 35) reveals some degree of homology 10 between the amino acid sequence of PRO1066 and the • following sequences Dayhoff, MOTI_HUMAN, AF025667_1, MTCY19H9_8 and RABIGKCH_1.

EXAMPLE 82: Isolation of the cDNA Clones That Codify the Human PR01184 The use of the algorithm of the signal sequence described in Example 3 on the ESTs allowed the • identification of a candidate sequence designated herein as DNA56375. This sequence was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular DNA EST database (LIFESEQ ™, Incyte Pharmaceuticals , Palo Alto, CA) 25 to identify existing homologies. The ^^^ * ^ ^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^ "- ^^^^^^^^^^ homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods In Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record • of 70 (or in some cases, 90) or older who did not code for known proteins, they were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The The consensus sequence obtained therefrom was designated here as DNA56375.

In light of a sequence homology observed between the DNA56375 consensus sequence and a sequence EST encompassed within the EST clone of Incyte no. 1428374, the EST clone of Incyte 1428374 was purchased and the cDNA insert was obtained and sequenced. It was found that this PP insert encodes a full-length protein. The sequence of this cDNA insert is shown in the Figure 187.

The full length clone shown in the Figure 187 contains a single open reading structure with a translation initiation site apparent at positions 106-108 of the nucleotide and ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ in the stop codon found at positions 532-534 of the nucleotide (Figure 187; SEQ ID NO: 269). The predicted polypeptide precursor is 42 amino acids in length, has a weight • calculated molecular weight of approximately 15,960 daltons and an estimated pl of approximately 9.64. Sequence analysis of the full length PR01184 shown in Figure 188 (SEQ ID NO: 270) evidences the presence of a peptide of signal at approximately amino acids 1-38. He • clone DNA59220-1514 has been deposited with the ATCC on June 9, 1998. It is understood that the deposited clone has the current sequence and that the representations are presented here. 15 An analysis of the amino acid sequence of the full-length PR01184 polypeptide suggests • that he himself possesses some sequence identity with the protein called TIM from Drosophila virilis, designated "DVTIMS02_1" in the Dayhoff database (version 35.45 SwissProt 35). Other sequences of the Dayhoff database (version 35.45 SwissProt 35) that have some degree of sequence identity with PR01184 include: WIS1_SCHP0, F002186_l, ATAC00239124 and MSAIPRP 1. i? X * 1 t - - i '"? __ jjf, ^^^^^^^^^^^^^^^^^^^^ j ^^^^^^^^^^^^^^ »^; EXAMPLE 83: Isolation of the cDNA Clones Coding to the Human PRO1360 ^^ The use of the algorithm of the signal sequence 5 described in Example 3 above allowed the identification of an EST sequence of the Incyte database, designated as DNA10572. This EST sequence was then compared to a variety of expressed sequence mark 10 (EST) databases that include public EST databases • (e.g., Genbank, Merck / Wash. U.) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the 20 known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA57314. - ..,. . ..- "iA-t ^,.,. .- * ii ??? É * ^ m ^ .. * ^ s ^^ ~. ^ ~ - ...... ^ .. > "Ji -. ^ - r ... -_.-..... ....." In light of a sequence homology observed between the DNA57314 consensus sequence and an EST sequence encompassed within the EST clone of • 5 Merck no. AA406443, Merck EST clone AA406443 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 189 and is designated herein • as DNA59488-1603.

The full-length clone shown in Figure 189 contains a single reading structure Open with an apparent translation initiation site at positions 54-56 of the nucleotide and ends at the stop codon found in the • positions 909-911 of the nucleotide (Figure 189; SEQ ID NO: 271). The predicted polypeptide precursor (Figure 190; SEC. ID NO: 272) is 285 amino acids in length. The PRO1360 has a calculated molecular weight of approximately 31,433 daltons and an estimated pl of approximately 7.32. The clone DNA59488-1603 has been deposited with the ATCC on August 25, 1998 and assigned the no. of deposit ATCC 203157.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 190 (SEQ ID NO: 272), revealed the identity sequence between the amino acid sequence of PRO1360 and the following Dayhoff sequences: UN51_CAEEL, YD4B_SCHP0, AF000634_1, GFO_ZYMMO, YE1J_SCHP0, D86566_l, ZMGFO_l, S76976, PPSA_SYNY3, and CEF28B1 4.

EXAMPLE 84: Isolation of the cDNA Clones Coding to the Human PRO1029 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated as 18763. This The sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some • cases, 90) or older that did not code for the known proteins were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The sequence of The consensus obtained from it was designated in • present it as DNA57854.

In light of a sequence homology observed between the DNA57854 consensus sequence and an EST sequence encompassed within the clone EST of Merck no. T98880, the Merck T98880 EST clone was purchased and the cDNA insert was obtained and • sequencing It was found that this insert encodes a full-length protein. Sequence of this cDNA insert is shown in Figure 189 and is designated herein as DNA59493-1420.

Clone DNA59493-1420 contains a single open reading frame with an apparent translation initiation site at positions 39-41 of the nucleotide and terminates at the stop codon at positions 297-299 of the nucleotide (Figure 191). The predicted polypeptide precursor is 86 amino acids • 5 in length (Figure 192). The full-length PRO1029 protein shown in Figure 192 has a calculated molecular weight of about 9,548 daltons and an estimated pl of about 8.52. The analysis of the length PRO1029 sequence complete shown in Figure 192 (SEQ ID NO: 274) • demonstrates the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 19, a block of amino acids having homology with the The rhodopsin retina binding site protein approximates from amino acid 50 to approximately amino acid 61, a binding site of the • prenyl group roughly from amino acid 83 to approximately amino acid 86 and a site of Potential N-glycosylation approximately from amino acid 45 to approximately amino acid 48. Clone DNA59493-1420 was deposited with the ATCC on July 1, 1998 and assigned no. of deposit ATCC 203050. 25 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in the Figure • 192 (SEQ ID NO: 274), reveals the significant homology between the amino acid sequence of PRO1029 and the following Dayhoff sequences: S66088, AF031815_1, MM4A6L_1, PSEIS52a-l, S17699 and P_R63635. 10 • EXAMPLE 85: Isolation of cDNA Clones Encoding Human PR01139 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the group EST of the database Incyte, designated as 4461. This sequence of the group EST was then compared with a • variety of expressed sequence mark (EST) databases that include public EST 20 databases (for example, Genbank) and a particular EST DNA database LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST computer program or BLAST2 (Altschul, Methods in Enzymology 266: 460- - - 480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were piled up and • assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA57312. 10 • The DNA57312 consensus sequence includes a public EST of 172 nucleotides in length (T62095, Merck / public database of the University of Washington). This EST clone was identified in the present as a coding sequence for the putative protein, was purchased from Merck, and sequenced to provide the coding sequence of PR01139 (Figure 193). As noted above, the amino acid sequence deduced from DNA59497-1496 showed a significant sequence identity with the deduced amino acid sequence of HSOBRGRP_l. The full length protein (Figure 194) contains a putative signal peptide in re amino acid residues 1 and approximately 28, and three domains of - "- • - *** * > - * - - - - putative transmembrane (approximate amino acid residues 33-52, 71-89, 98-120).

EXAMPLE 86: Isolation of the cDNA Clones that • Coding the Human PRO1309 A DNA database with expressed sequence mark (EST) (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) was searched and an EST was identified that shows homology with the SLIT. 10 • RNA was isolated for the construction of cDNA libraries from the human fetal brain. The cDNA libraries used to isolate the cDNA clones encoding PRO1309 Human, were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. He • cDNA was primed with oligo dT that contains the Notl site, bound with the blunt portion to the Sali hemicinase adapters, excised with NotI, appropriately sized by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) at the unique sites Xhol and Notl The cDNA libraries (prepared as • described above), were selected by hybridization with a synthetic oligonucleotide probe derived from the Incyte EST sequence as described above: 5 '-TCCGTGCAGGGGGACGCCTTTCAGAAACTGCGCCGAGTTAAGGAAC-3' (SEQ ID NO: 279). • An identified cDNA clone was sequenced in its entirety. The complete nucleotide sequence of DNA59588-1571 is shown in Figure 195 (SEQ.

ID NO: 277). Clone DNA59588-1571 contains a single open reading structure with an apparent translation initiation site in the positions • 720-722 of the nucleotide and a stop codon at positions 2286-2288 of the nucleotide (Figure 195; SEC. ID NO: 277). The predicted polypeptide precursor is 522 amino acids in length. The signal peptide is at approximately 1-34 and the transmembrane domain is at approximately 428-450 of SEQ. ID NO: 278. The clone DNA59588 - 1571 has been deposited with the ATCC on July 1, 1998 and was assigned the no. ATCC deposit 203106. The full-length PRO1309 protein shown in Figure 196 has an estimated molecular weight of approximately 58,614 daltons and a pl • approximately 7.42.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure • 196 (SEQ ID NO: 278), reveals the sequence identity between the amino acid sequence of PRO1309 and the following Dayhoff sequences: AB007876_1, GPV_MOUSE, ALS_RAT, P_R85889, LUM_CHICK, AB014462 1, PGSl CANFA, CEM88 7, A58532 and GEN11209.

EXAMPLE 87: Isolation of the cDNA Clones that • Coding to the Human PRO1028 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a certain sequence of the EST group of the Incyte database. This group sequence EST was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by - for example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were stacked and assembled in a sequence of • Consensus DNA with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA59603. 15 In light of a sequence homology observed between the DNA59603 consensus sequence and • an EST sequence encompassed within the EST clone of Incyte no. 1497725, the EST clone of Incyte 1497725 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 197 and is designated herein as DNA59603-1419. , '^ k & k ^ gá? AX ^? - - The complete nucleotide sequence of DNA59603-1419 is shown in Figure 197 (SEQ ID NO: 280). The clone DNA59603 - 1419 contains only one • Open reading structure with an apparent translation initiation site at positions 21-23 of the nucleotide and ending at the stop codon at positions 612-614 of the nucleotide (Figure 197). The precursor of pollpeptide predicted is 197 amino acids from • length (Figure 198). The full-length PRO1028 protein shown in Figure 198 has an estimated molecular weight of about 20,832 daltons and a pl of about 8.74. The clone DNA59603-1419 has been deposited with the ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that • The sequences provided here are based on sequencing techniques known Analyzing the amino acid sequence of the SEC. ID NO: 281, the putative signal peptide is at approximately amino acids 1-19 of the SEC. ID NO: 281. An N-glycosylation site is at approximately amino acids 35-38 of the SEC. ID NO: 281. A type C lectin domain is at approximately amino acids 108-117 of the SEC. ID NO: 281, indicating that PR0513 can be related to or be a lectin. The corresponding nucleotides of these amino acid or other sequences can be determined routinely given the sequences provided herein.

EXAMPLE 88: Isolation of the cDNA Clones Encoding to the Human PRO1027 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a certain sequence of the EST group of the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of • Consensus DNA with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56399.

In light of a sequence homology • observed between the DNA56399 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 937605, the EST clone of Incyte 937605 was purchased and the cDNA insert was obtained and sequencing. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure • 199 and is designated herein as DNA59605-1418. 20 The complete nucleotide sequence of DNA59605-1418 is shown in Figure 199 (SEC.

NO: 282). The clone DNA 59605 - 1418 contains a single open reading structure with a site of initiation of apparent translation at positions 31-33 of the nucleotide and ending at the stop codon at positions 262-264 of the nucleotide (Figure 199). The precursor of the predicted polypeptide is 77 amino acids of • 5 length (Figure 200). The full-length PRO1027 protein shown in Figure 200 has an estimated molecular weight of about 8,772 daltons and a pl of about 9.62. The clone DNA59605-1418 has been deposited with the ATCC. With With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that the sequences provided herein are based on known sequencing techniques. 15 Analyzing the amino acid sequence of the SEC. ID NO: 283, the putative signal peptide is at approximately amino acids 1-33 of SEC. ID NO: 283. The link domain to fibronectin type II collagen begins at about amino acid 30 of the SEC. ID NO: 283. The corresponding nucleotides of these amino acid sequence or others can be determined routinely given the sequences provided herein. The PRO1027 may be involved in tissue formation or repair.

^^ The following Dayhoff designations seem have some sequence identity with PRO1027: SFT2_YEAST; ATM3E9_2; A69826; YM16_MARPO; E64896; U60193_2; MTLRAJ205_1; MCU60315_70; SPAS_SHIFL; Y S54213. ^ 10 EXAMPLE 89: Isolation of cDNA Clones Encoding Human PRO1107 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a certain sequence of the EST group of the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that • include public EST databases (for example, Genbank) and an EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, • U versity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56402.

In light of a 10 sequence homology observed between the DNA56402 consensus sequence and • an EST sequence encompassed within the EST clone of Incyte no. 3203694, the EST clone of Incyte 3203694 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert 15 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 201 and is designated herein • as DNA59606-1471.

The complete nucleotide sequence of DNA59606-1471 is shown in Figure 201 (SEQ ID NO: 284). Clone DN A 59606 - 1471 contains a single open reading structure with an apparent translation initiation site in the positions 244-246 of the nucleotide and ends at the stop codon at positions 1675-1677 of the nucleotide of the SEC. ID NO: 284 (Figure 201). The predicted polypeptide precursor is 477 amino acids in length (Figure 202). The protein • 5 of the full-length PRO1107 shown in Figure 202 has an estimated molecular weight of about 54,668 daltons and a pl of about 6.33. The clone DNA59606 - 1471 has been deposited with the ATCC on June 9, 1998. regarding the sequence, it is understood that the clone • deposited contains the current nucleic acid sequence and that the sequences provided herein are based on known sequencing techniques. 15 An analysis of the amino acid sequence of the PRO1107 full-length polypeptide suggests • that he himself possesses significant sequence similarity to phosphodiesterase I / pi r f os fa t asa of the nucleotide, the human insulin receptor tyrosine kinase inhibitor, alkaline phosphodiesterase and autotaxin, thus indicating that PRO1107 may have at least one or all of the activities of these proteins, and that PRO1107 is a new phosphodiesterase. More specifically, a And the analysis of the Dayhoff database (version 35.45 SwissProt 35), reveals the sequence identity between the amino acid sequence of PRO1107 and at least the following 5 Dayhoff sequences: AF005632_1, P_R79148, RNU78787_1, AF060218_4, A57080 and HUMATXT_1.

EXAMPLE 90: Isolation of the cDNA Clones Encoding to the Human PRO1140 10 Using the Signal Sequence Algorithm # described in Example 3 above allowed the identification of a single Incyte EST sequence, sequence of Incyte group No. 135917. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (for example, Genbank) and a database • of particular EST DNA (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify the existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or older ones that did not code the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, U versity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56416.

In light of a sequence homology observed between the DNA56416 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3345705, the EST clone of Incyte no. 3345705 was obtained and its insert was sequenced. It was found that this insert encodes a full-length protein. The sequence, designated herein as DNA 59607-1497, which is shown in Figure 203, is the full-length DNA sequence for PRO1140. The clone DNA59607-1497 has been deposited with the ATCC on July 9, 1998, and was assigned the no. of deposit of ATCC 209946.

The complete nucleotide sequence of DNA59607-1497 is shown in Figure 203 (SEC.

NO: 286). Clone DNA59607-1497 contains a single open reading frame with an apparent translation initiation site at positions 210-212 of the nucleotide and terminates at the stop codon at positions 975-977 of the nucleotide (Figure 203). The predicted polypeptide precursor • i is 255 amino acids long (Figure 204). The full-length PRO1140 protein shown in Figure 204 has an estimated molecular weight of about 29,405 daltons and a pl of about 7.64. The analysis of the sequence of the full length PRO1140 shown in the • Figure 204 (SEQ ID NO: 287) evidences the presence of three transmembrane domains at approximately amino acids 101 to 118, 141 to 161 and 172 to 191. 15 An analysis of the amino acid sequence of the PRO1140 polypeptide in length complete • using the Dayhoff database (version 35.45 SwissProt 35), reveals the homology between the amino acid sequence of PRO1140 and the following Dayhoff sequences: AF023602_1, AF000368_1, CIN3_RAT, AF003373_1, GEN13279, and AF003372 1.

E n c l o n DNA 5 9 6 0 7 - 1 4 9 7 h a sted by the ATCC on June 9, 1998, and was assigned no. of deposit of ATCC 209946. 9 __ EXAMPLE 91: Isolation of the cDNA Clones that Encode the Human PRO1106 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a unique EST sequence of Incyte. This sequence of the EST group was then compared with a variety of sequence mark databases • expressed (EST) that include public EST databases (for example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify the existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460- F 480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or older that did not code for the known proteins were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The sequence of The consensus obtained therefrom was designated herein as DNA56423 In light of a sequence homology observed between the DNA56423 consensus sequence and • an EST sequence encompassed within the EST clone of Incyte no. 1711247, the EST clone of Incyte no. 1711247 was obtained and its insert was sequenced. It was found that this insert encodes a full-length protein. Sequence, designated herein as DNA59609-1470, which • shown in Figure 205, is the full-length DNA sequence for PRO1106. Clone DNA59609-1470 has been deposited with the ATCC on June 9, 1998, and was assigned no. deposit ATCC 209963.

The complete nucleotide sequence of • DNA59609-1470 is shown in Figure 205 (SEQ ID NO: 288). The clone DNA 59609 - 1470 contains only one Open reading structure with an apparent translation initiation site at positions 61-63 of the nucleotide and ends at the stop codon at positions 1468-1470 of the SEC nucleotide. ID NO: 288 (Figure 205). The precursor of predicted polypeptide is 469 amino acids As & length (Figure 204). The protein of the full length PRO1106 shown in Figure 206 has an eated molecular weight of approximately 52,689 daltons and a pl of approximately 8.68. It is understood that one skilled in the art can construct the polypeptide or nucleic acid encoding the same to exclude any or all of these domains. For example, the region (s) of the transmembrane domain and / or either the terminal ammo or carboxyl terminus can be excluded. The clone DNA59609-1470 has been deposited with the ATCC on June 9, 1998, and was assigned the no. ATCC deposit 209963. It is understood that the deposited clone has the current nucleic acid sequence and that the sequences provided herein are based on known sequencing techniques.

An analysis of the amino acid sequence of the full-length PRO1106 polypeptide suggests that it itself possesses significant sequence similarity with the soluble peroxisomal ca-dependent carrier, thus indicating that PRO1106 can be a new transporter. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), demonstrates the sequence identity between the amino acid sequence of PRO1106 and at least the following Dayhoff sequences, AF004161_1, • 5 IG002N01_25, GDC_BOVIN and BT1_MAIZE.

EXAMPLE 92: Isolation of the cDNA Clones Encoding to the Human PR01291 Using the Signal Sequence Algorithm described in Example 3 above allowed the • identification of a sequence of the EST group of the Incyte database, designated as 120480. This sequence of the EST group was then compared to a variety of sequence mark databases expressed (EST) that include public EST databases (for example, Genbank) and a particular EST DNA database (Lifeseq ™, Incyte • Pharmaceuticals, Palo Alto, CA) to identify exig homologies. The homology search is performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code the known proteins were assembled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56425.

In light of a sequence homology observed between the DNA56425 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2798803, the EST clone of • Incyte 2798803 and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 207 and is designated herein as DNA59610-1556.

• Clone DNA59610-1556 contains a single open reading frame with an apparent translation initiation site at positions 61-63 of the nucleotide and terminates at the stop codon at positions 907-909 of the nucleotide (Figure 207). The predicted polypeptide precursor is 282 amino acids in length (Figure 208). The protein of the full-length PR01291 shown in Figure 208 has an eated molecular weight of about 30,878 daltons and a pl of about 5.27. The sequence analysis of the full length PR01291 shown in the • Figure 208 (SEQ ID NO: 291) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 28, a transmembrane domain approximately from amino acid 258 up to about the amino acid • 281 and the potential N-glycosylation sites approximately from amino acid 112 to approximately amino acid 115, approximately from amino acid 160 to approximately amino acid 163, approximately from amino acid 190 to approximately amino acid 193, so • approximate from amino acid 196 to approximately amino acid 199, so approximates from amino acid 205 to approximately amino acid 208, approximately from amino acid 216 to approximately amino acid 219 and approximately from amino acid 220 to approximately approximately amino acid 223. Clone DNA59610-1556 has been deposited with the ATCC on June 16, 1998 and assigned no. of deposit ATCC 209990. • 5 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 208 (SEQ ID NO: 291), highlights the Significant homology between the amino acid sequence of PR01291 and the following Dayhoff sequences: HSU90552_1, HSU90144_1, AF033107_1, HSB73_1, HSU90142_1, GGCD80_1, P_W34452, MOG_MOUSE, B39371 and P_R71360. EXAMPLE 93: Isolation of the cDNA Clones Coding to the Human PRO1105 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of consensus DNA with the "phrap" program (Phil Green, • Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56430.

In light of a sequence homology observed between the DNA56430 consensus sequence and an EST sequence encompassed within the EST clone of • Incyte no. 1853047, the EST clone of Incyte 1853047 was purchased and the cDNA insert was obtained and was sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 197 and is designated herein as DNA59612-166.

The complete nucleotide sequence of DNA59612-1466 is shown in Figure 209 (SEQ ID NO: 292). The clone DNA59612 - 1466 contains a single open reading structure with a site of • initiation of apparent translation at positions 28-30 of the nucleotide and ending at the stop codon at positions 568-570 of the nucleotide (Figure 209). The predicted polypeptide precursor is 180 amino acids length (Figure 210). PRO1105 protein from • full length shown in Figure 210 has an estimated molecular weight of approximately 20,040 daltons and a pl of approximately 8.35. The clone DNAS 9612 -1466 has been deposited with the ATCC on 9 June 15, 1998. It is understood that the deposited clone has the current nucleic acid sequence and that the sequences provided in the • present are based on known sequencing techniques. 20 Analyzing the amino acid sequence of the SEC. ID NO: 210, a signal peptide is at approximately amino acids 1-19 of SEC. ID NO: 293 and the transmembrane domains are in approximately amino acids 80-99 and 145-162 of the SEC. ID NO: 293. It is understood that the person skilled in the art could form a polypeptide with all or any combination or individual selection of these regions. It is also understood that the corresponding nucleic acids can be routinely identified and prepared based on the information provided herein.

EXAMPLE 94: Isolation of cDNA Clones Encoding Human PR0511 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, • University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56434.

In light of a sequence homology 10 observed between the DNA56434 consensus sequence and • an EST sequence encompassed within the EST clone of Incyte no. 1227491, EST clone of Incyte 1227491 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert 15 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 211 and is designated herein as DNA59613-1417.

The complete nucleotide sequence of DNA59613-1417 is shown in Figure 211 (SEQ ID NO: 294). Clone DN A59613-1417 contains a single open reading structure with an apparent translation initiation site in the positions 233-235 of the nucleotide and ends at the stop codon at positions 944-946 of the nucleotide (Figure 211). The predicted polypeptide precursor is 237 amino acids in length (Figure 212). The full-length PR0511 protein shown in Figure 212 has an estimated molecular weight of about 25,284 daltons and a pl of about 4.74. The clone DNA59613-1417 has been deposited with the ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence, and that the sequences provided herein are based on known sequencing techniques.

Analyzing the amino acid sequence of the SEC. ID NO: 295, the putative signal peptide is at approximately amino acids 1-25 of the SEC. ID NO: 295. Potential N-glycosylation sites are at approximately amino acids 45-48, 73-76, 107-110, 118-121, 132-135, 172-175, 175-178 and 185-188 of the SEC. ID NO: 295. The conserved region of the arthropod defensins is at approximately amino acids 176-182 of the SEC. ID NO: 295. A kringle domain starts at approximately amino acids 128 of the SEC. ID NO: 295 and a ly-6 / u-PAR domain starts at approximately amino acid 6 of the SEC. ID NO: 295. The corresponding nucleotides of these sequence • 5 amino acids and others can be determined routinely given the sequences provided herein.

The designations that appear in the 10-day data base with which PR0511 has some sequence identity are as follows: SSC20F10_1; SF041083; P_W26579; S44208; JC2394; PSTA_DICDI; A27020; S59310; RAG1_RABIT; and MUSBALBC1_1.

EXAMPLE 95: Isolation of the cDNA Clones Encoding to the Human PRO1104 The use of the algorithm of the signal sequence f described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and an EST DNA database.

(LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 • (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The • consensus sequence obtained fit was designated herein as DNA56446.

In light of a sequence homology 15 observed between the DNA56446 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2837496, the EST clone of • Incyte 2837496 and the cDNA insert was obtained and sequenced. It was found that this insert 20 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 213 and is designated herein as DNA59616-1465.

The complete nucleotide sequence of DNA59616-1465 is shown in Figure 213 (SEQ ID NO: 296). Clone DNA59616-1465 contains a single open reading structure with an apparent translation initiation site in the positions • 109-111 of the nucleotide and ends at the stop codon at positions 1132-1134 of the nucleotide (Figure 213). The predicted polypeptide precursor is 341 amino acids in length (Figure 214). The protein of PRO1104 full length shown in Figure 214 has a • estimated molecular weight of approximately 36,769 daltons and a pl of approximately 9.03. The clone DNA59616- 1465 has been deposited with the ATCC on June 16, 1998. It is understood that the clone deposited has the current nucleic acid sequence and that the sequences provided herein are based on the techniques of • known sequencing.

By analyzing Figure 214, a putative signal peptide is at approximately amino acids 1-22 of the SEC. ID NO: 297. The N-myristoylation sites are at approximately amino acids 41-46, 110-115, 25 133-138, 167-172 and 179-184 of SEQ. ID NO: 297 «- * -. w. ... - ._. ,, «. ~ «» .M *. ? . * *. /l^A.~áte-&;a&-^^...t.«,m. "........ &. .

EXAMPLE 96: Isolation of the cDNA Clones Encoding the Human PROLOGUE • The use of the algorithm of the signal sequence 5 described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (for • example, Genbank) and a particular EST DNA database (Lifeseq ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six)) . Those comparisons result • a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington).

In light of a sequence homology 25 observed between the consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2305379, the EST clone of Incyte 2305379 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert • encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 215 and is designated herein as DNA59619-1464.

The complete nucleotide sequence of DNA59619-1464 is shown in Figure 215 (SEQ ID NO: 298). The clone DNA 59619-1464 contains a single open reading structure with a translation initiation site apparent in the positions 33-35 of the nucleotide and ends at the stop codon at positions 993-995 of the nucleotide of SEQ. ID NO: 298 (Figure 215). He • precursor of the predicted polypeptide is 320 amino acids in length (Figure 216). The protein of the full-length PROOF shown in Figure 216 has an estimated molecular weight of about 36,475 daltons and a pl of about 7.29. The clone DNA 59619 - 1 64 has been deposited with the ATCC on July 1, 1998. understands that the deposited clone has the current nucleic acid sequence and that the sequences provided herein are based on known sequencing techniques.

During the analysis of the amino acid sequence of SEC. ID NO: 299, the approximate locations of the signal peptide, the transmembrane domains, a site of N -g 11 co s i 1 a, a site of N-mi r i s t i i i a, a • CUB domain and a sodium channel domain sensitive to amiloride. It is believed that PROLOO can function as a channel. The corresponding nucleic acids for these amino acids and others can be determined routinely given the SEC. ID NO: 299 EXAMPLE 97: Isolation of cDNA Clones Encoding Human PR0836 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database. This sequence of the EST group was then compared to a variety of bases from expressed sequence mark (EST) data that - Check Sj = S & JSte. include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify the homologies • existing. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods m Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or older people who did not code the known proteins, • were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained was designated in the present as DNA56453.

In light of a sequence homology • observed between the DNA56453 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2610075, the EST clone of Incyte 2610075 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 217 and is designated herein as DNA 5 9 62 0 - 1 4 6 3 The complete nucleotide sequence of DNA59620-1463 is shown in Figure 217 (SEQ ID. • 5 NO: 300). Clone DNA59620-1463 contains a single open reading frame with an apparent translation initiation site at positions 65-67 of the nucleotide and ends at the stop codon at positions 1448-1450 of the nucleotide of the SEC. ID NO: 300 (Figure 217). He • precursor of the predicted polypeptide is 461 amino acids in length (Figure 218). The full-length PR0836 protein shown in Figure 218 has an estimated molecular weight of about 52,085 daltons and a pl of about 5.36. The analysis of the sequence of the full-length PR0836 shown in the • Figure 218 (SEQ ID NO: 301) reveals the presence of the following: a signal peptide, the sites of N-gl i cos i lation, sites of N i i i i on i la tion, a domain conserved in the family YJL126w / YLR351 c / yhcX of the proteins, and a region that has sequence identity with the SLSl. The clone DNA59620- 1463 has been deposited with the ATCC on June 16, 1998. It is understood that the clone - 'j¡ > a ~ SiU eto & ,, a = sfc A; g_ -.- «tes. deposited has the current nucleic acid sequence and that the sequences provided herein are based on the known techniques of nucleic acid. • An analysis of the amino acid sequence of the full-length polypeptide PR0836 suggests that it has sequence similarity to the SLSl, thus indicating that PR0836 can be involved in the protein localization • of the ER. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), reveals some sequence identity between the amino acid sequence of PR0836 and at least the following sequences Dayhoff, S58132, SPBC3B9_1, S66714, CRU40057 1 and IMA_CAEEL.

• EXAMPLE 98: Isolation of the cDNA Clones Encoding Human PR01141 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a sequence of the EST group of the Incyte database, designated as 11873 This sequence of the EST group was then compared with a variety of sequence mark databases . . * Sfeaat -. ^ .. expressed (EST) that include public EST databases (for example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify • existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or older that did not code • Known proteins were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The sequence of The consensus obtained therefrom was designated herein as DNA56518.

• In light of a sequence homology observed between the DNA56518 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2679995, EST clone of Incyte 2679995 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The The sequence of this cDNA insert is shown in Figure 219 and is designated herein as DNA59625-1498.

The clone DNA59625-1498 contains only one • Open reading structure with an apparent translation initiation site at positions 204-206 of the nucleotide and ending at the stop codon at positions 945-947 of the nucleotide (Figure 219). The predicted polypeptide precursor is 247 amino acids long (Figure 220). The • protein of the full-length PR01141 shown in Figure 220 has an estimated molecular weight of about 26,840 daltons and a pl of about 8.19. The analysis of the sequence of the full-length PR01141 shown in Figure 220 (SEQ ID NO: 303) evidences the presence of the following: a signal peptide of • approximate manner from amino acid 1 to approximately amino acid 19 and domains of transmembrane approximately from amino acid 38 to approximately amino acid 57, approximately from amino acid 67 to approximately amino acid 83, approximately from amino acid 117 to approximately amino acid 139 and so approximate from amino acid 153 to approximately amino acid 170. Clone DNA59625-1498 has been deposited with the ATCC on June 16, 1998 and assigned no. deposit • 5 ATCC 209992.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the The full length sequence shown in Figure 220 (SEQ ID NO: 303), evidences the significant homology between the amino acid sequence of PR01141 and the following Dayhoff sequences: CEVF36H2L_2, PCRB7PRJ_1, AB000506_1, LEU95008_1, MRU87980_15, YIGM_ECOLI, STU65700_1, GHU62778_1, CYST_SYNY3 and AF009567_1.

EXAMPLE 99: Isolation of cDNA Clones Encoding Human PR01132 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA35934. Based on the consensus sequence DNA35934, the oligonucleotides were synthesized 1) f ~ íY - - to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full length coding sequence clone for • PR01132 PCR primers (forward and reverse) were synthesized: forward PCR primer: 10 5 '-TCCTGTGACCACCCCTCTAACACC-3' (SEQ ID NO: 310) and • Reverse PCR primer: 5 '-CTGGAACATCTGCTGCCCAGATTC-3' (SEQ ID NO: 311). Additionally, a synthetic oligonucleotide oligonucleotide probe was constructed from the consensus sequence having the following nucleotide sequence: 5'-GTCGGATGACAGCAGCAGCCGCATCATCAATGGATCCGACTGCGATATGC-3 ' • (SEC ID NO: 312).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones that encode the PR01132 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from the human fetal kidney. • 5 DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for the PR01132 and the sequence of the protein derived for on PR01132. • The complete nucleotide sequence of PR01132 is shown in Figure 225 (SEQ ID NO: 308). The clone DNA59767 - 1489 contains only one open reading structure with an apparent translation initiation site at positions 354-356 of nucleotide y. ends in the codon of • stop at positions 1233-1235 of the nucleotide (Figure 308). The predicted polypeptide precursor is 293 amino acids in length. The signal peptide is at approximately amino acids 1-22 and the histidine active site is at approximately amino acids 104-109 of SEQ. ID NO: 309. The clone DNA5976 - 1489 has been deposited with the ATCC (which has the current sequence in place A 'of the representations based on the sequencing techniques as presented here) and was assigned the no. of deposit of ATCC 203108. The protein of PR01132 full length shown P in Figure 226 has an estimated molecular weight of about 32,020 daltons and a pl of about 8.7.

An analysis of the Dayhoff 10 database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 226 (SEQ ID NO: 309), revealed the sequence identity between the amino acid sequence of PR01132 and the following Dayhoff sequences: SSU76256_1, P_W10694, MMAE000663_6, AF013988_1, U66061_8, MMAE000665_2, MMAE00066415, MMAE00066414, MMAE000665_4 and MMAE00066 12.

EXAMPLE 100: Isolation of cDNA Clones Encoding to NL7 (PRQ1346) Human A unique EST sequence was found (# 1398422) in the LIFESEQ ™ database as described in Example 1 above. This sequence of The consensus is designated herein as DNA45668. In Based on the DNA45668 consensus sequence, the oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for the NL7.

PCR primers (forward 10 and inverse) were synthesized: • Front PCR primer: 5 '-CACACGTCCAACCTCAATGGGCAG-3' (SEQ ID NO: 315) Reverse PCR primer: 15 5'-GACCAGCAGGGCCAAGGACAAGG-3 '(SEQ ID NO: 316) Adi cíona lmen e, a hybridization probe was constructed Synthesis of the oligonucleotide ol from the consensus DNA45668 sequence having the following nucleotide sequence: Hybridization probe: 5 '-GTTCTCTGAGATGAAGATCCGGCCGGTCCGGGAGTACCGCTTAG-3' (SEQ ID NO: 317) To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones that • encode the NL7 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from a human fetal kidney library (LIB227). 10 • DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for NL7 (designated here as DNA59776-1600 [Figure 227, SEC.

ID NO: 313]) and the sequence of the derived protein for NL7 (PR01346).

The complete nucleotide sequence of NL7 (PR01346) is shown in Figure 227 (SEQ ID NO: 313). Clone DNA59776-1600 contains a single open reading frame with an apparent translation initiation site at positions 1-3 of the nucleotide and an apparent stop codon at positions 1384-1386 of the nucleotide. He The predicted polypeptide precursor is 461 - amino acids in length. The protein contains an apparent type II transmembrane domain at amino acid positions approximately from about 31 to about 50; the C-terminal domain marker of the beta and gamma chains of fibrinogen beginning at approximately the position of amino acid 409, and a pattern of leucine closure beginning at approximately amino acid positions 140, 147, 154 and 161, respectively . He clone DNA59776-1600 has been deposited with the ATCC and • was assigned the no. ATCC deposit 203128. The full-length NL7 protein shown in Figure 228 has an estimated molecular weight of approximately 50,744 daltons and a pl approximately 6.38.

Based on an alignment analysis of • WU-BLAST2 sequences (using the WU-BLAST2 computer program) of the length sequence In complete, the NL7 showed amino acid sequence identity with the glycoprotein associated with the human microfibri (1 MFA4_HUMAN); known TIE-2 ligands and ligand homologs, ficolin, serum lectin and protein link of TGF-1. ? riaute-ciMB- »and-. / -.

- EXAMPLE 101: Isolation of cDNA Clones Encoding Human PR01131 A cDNA sequence isolated in the selection • > with amylase described in Example 2 above was designated herein as DNA43546 (see Figure 231, SEQ ID NO: 320). The DNA43546 sequence was then compared to a variety of expressed sequence mark (EST) databases that include 10 public EST databases (e.g.

• Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record • of 70 (or in some cases, 90) or older that did not code for known proteins, they were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington) . The consensus sequence obtained therefrom was designated herein as DNA45627. 25 Based on the DNA45627 consensus sequence, the oligonucleotide probes were generated and used to select a human library prepared as described in paragraph 1 of • Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D not containing the Sfil site, see Holmes et al., Science, 253: 1278-1280 (1991)), and the cDNA size cut was less than 2800 bp. 10 • PCR primers (forward and reverse) were synthesized: 5 'forward PCR primer -ATGCAGGCCAAGTACAGCAGCAC-3' (SEQ ID NO: 321); 15 inverse PCR primer 5 '-CATGCTGACGACTTCCTGCAAGC-3' (SEQ ID NO: 322); and inverse PCR 1 primer • 5 '-CCACACAGTCTCTGCTTCTTGGG-3' (SEQ ID NO: 323) Additionally, a synthetic hybridization probe of the oligonucleotide was constructed from the consensus DNA45627 sequence having the following nucleotide sequence: hybrid probe 5 * -ATGCTGGATGATGATGGGGACACCACCATGAGCCTGCATT-3 '25 (SEQ ID NO: 324).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by • PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01131 gene using the probe oligonucleotide and one of the PCR primers.

• A full-length clone containing a single open reading structure with an apparent translation initiation site at positions 144-146 of the nucleotide was identified, and a signal stop at positions 984-986 of the nucleotide (Figure 229; SEQ ID NO: 318). The predicted polypeptide precursor is 280 • amino acids in length, has a calculated molecular weight of approximately 31,966 daltons and a pl Approximately estimated 6.26. The sequence of the transmembrane domain is at approximately 49-74 of the SEC. ID NO: 319 and the region that has sequence identity with the LDL receptors is approximately 50-265 of the SEC. ID NO: 319. The PR01131 contains the potential N-glycosylation sites at amino acid positions 95-98 and 169-172 of SEC. ID NO: 319. The clone DNA59777-1480 has been deposited with the ATCC and assigned the no. of deposit of ATCC 203111. • An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in the Figure 230 (SEQ ID NO: 319), exposes some • sequence identity between the amino acid sequence of PR01131 and the following Dayhoff sequences: AB010710_1, 149053, 149115, RNU56863_1, LY4A_MOUSE, 155686, MMU56404_1, 149361, AF030313_1 and MMU09739 1.

EXAMPLE 102: Isolation of cDNA Clones Encoding Human PR01281 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA35720. Based on the DNA35720 sequence, the oligonucleotides 1) were synthesized for Identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR01281. The PCR primers (forward and reverse) were synthesized: forward PCR primers: 5 '-TGGAAGGCTGCCGCAACGACAATC-3' (SEQ ID NO: 327); 10 5 '-CTGATGTGGCCGATGTTCTG-3' (SEQ ID NO: 328); and • 5 '-ATGGCTCAGTGTGCAGACAG-3' (SEQ ID NO: 329). reverse PCR primers: 5 '-GCATGCTGCTCCGTGAAGTAGTCC-3' (SEQ ID NO: 330); and 5 '-ATGCATGGGAAAGAAGGCCTGCCC-3' (SEQ ID NO: 331). Additionally, a synthetic hybridization probe of the oligonucleotide was constructed from the sequence DNA35720 which had the following • Nucleotide sequence: hybridization probe 5 '-TGCACTGGTGACCACGAGGGGGTGCACTATAGCCATCTGGAGCTGAG-3' (SEQ ID NO: 332).

To select multiple libraries from a source of a full-length clone, selected the DNA of the libraries through PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01281 gene using the • probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from human fetal liver.

DNA sequencing of clones • isolated as described above gave the full-length DNA sequence for PR01281 (designated here as DNA59820-1549 [Figure 232, SEQ ID NO: 325]) and the protein sequence derived for PR01281.

The complete nucleotide sequence of • PR01281 is shown in Figure 232 (SEQ ID NO: 325). The clone DNA59820-1549 contains only one Open reading structure with an apparent translation initiation site at positions 228-230 of the nucleotide and an apparent stop codon at positions 2553-2555 of the nucleotide. The predicted polypeptide precursor is 775 amino acids in length. The protein of PR01281 - - full length shown in Figure 233 has an estimated molecular weight of approximately 85,481 daltons and a pl of approximately 6.92. Additional features include a signal peptide is at approximately amino acids 1-15; and the potential N-gly and costing sites are at approximately amino acids 138-141 and 361-364.

An analysis of the Dayhoff 10 database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 233 (SEQ ID NO: 326), revealed the sequence identity between the amino acid sequence of PR01281 and the following Dayhoff sequences: S44860, CET24D1_1, CEC38H2_3, CAC2_HAECO, B3A2_HUMAN, S22373, CEF38A3_2, CEC34F6_2, CEC34F6_3, and • CELT22B11 3.

The DNA59820 - 1549 clone has been deposited with the ATCC and assigned the no. of deposit of ATCC 203129. -_ - _____ * J = l. ^^^^ - ÍB- < . ». Lrf .. ^» yJ - «-; < B «a» '.. St to »., -And« ».a-.? 7ÍhX¿¡ ..

- - EXAMPLE 103: Isolation of the cDNA Clones Encoding Human PRO1064 A cDNA sequence isolated in the amylase selection was found as described in • Example 2 above, by the computer program for sequence alignment WU-BLAST-2, which has no significant sequence identity with any known human protein. This cDNA sequence was designated in the present as DNA45288. The sequence DNA45288 is • then compared with several EST databases that include public EST databases (eg, Genbank) and a particular DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify the homologous EST sequences. The comparison was made using the BLAST or BLAST2 computer program [Altschul, • Methods in Enzymology 266: 460-480 (1996)]. Those comparisons that result with a Blast record of 70 (or in some cases, 90) or older who did not code for the known proteins were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). This The consensus sequence was designated herein as - - DNA48609. Oligonucleotide primers were based on the DNA48609 sequence, then synthesized and used to select a human fetal kidney cDNA library that results in the identification of clone DNA59827-1426 shown in Figure 234. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the Sfil site, see Holmes et al., Science, 253: 1278-1280 (1991)), and the size cut of the cDNA was less than 2800 bp.

PCR primers were synthesized (forward and reverse 5 'forward PCR primer -CTGAGACCCTGCAGCACCATCTG-3' (SEQ ID NO: 336) 5 'reverse PCR primer -GGTGCTTCTTGAGCCCCACTTAGC-3' (SEQ ID NO: 337) Additionally, a Synthetic hybridization probe of the oligonucleotide from the DNA48609 sequence having the following nucleotide sequence: 5 'hybridization probe -AATCTAGCTTCTCCAGGACTGTGGTCGCCCCGTCCGCTGT-3 SEQ ID NO: 33! - - A full-length clone containing a single open reading structure with an apparent translation initiation site at positions 532-534 of the nucleotide and a signal from • 5 stop at positions 991-993 of the nucleotide (Figure 234, SEQ ID NO: 333). The predicted polypeptide precursor is 153 amino acids in length, has a calculated molecular weight of about 17,317 daltons and an estimated pl approximately 5.17. The analysis of the sequence • of the full-length PRO1064 shown in Figure 235 (SEQ ID NO: 334) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 24, a transmembrane domain approximately from amino acid 89 to approximately amino acid • 110, a block of homology of the indole-3-glycerol phosphate synthase approximately from the amino acid 74 to approximately amino acid 105 and a homology block of the protein repeat proteins of the Myb DNA binding domain approximately from amino acid 114 to approximately amino acid 137. The clone DNA59827-1426 has been deposited with the ATCC on August 4, 1998, and was assigned the no. of deposit ATCC 203089.

An analysis of the Dayhoff 5 database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 235 (SEQ ID NO: 334), puts shows the homology between the amino acid sequence of 10 PRO1064 and the following Dayhoff sequences: MMNP15PRO_l, BP187PLYH _1, CELF42G8_4, MMU58888_1, GEN14270, TUB8_SOLTU, RCN_MOUSE, HUMRBSY79_1, SESENODA 1 and A21467 1.

EXAMPLE 104: Isolation of cDNA Clones Encoding Human PR01379 A consensus DNA sequence was assembled • in relation to other EST sequences using phrap as described in Example 1 above. This The consensus sequence is designated herein as DNA45232. Based on the DNA45232 consensus sequence, oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) for used as probes to isolate a clone from A • - - full length coding sequence for PR01379.

PCR primers (forward 5 and inverse) were synthesized: forward PCR primer 5 '-TGGACACCGTACCCTGGTATCTGC-3' (SEQ ID NO: 341) 5 'reverse PCR primer -CCAACTCTGAGGAGAGCAAGTGGC-3' (SEQ ID NO: 342) 10 Additionally , a probe was built • Synthetic hybridization of the oligonucleotide from the consensus DNA45232 sequence having the following nucleotide sequence: 5 'hybridization probe -TGTATGTGCACACCCTCACCATCACCTCCAAGGGCAAGGAGAAC-3' (SEQ ID NO: 343).

• To select multiple libraries from a source of a full-length clone, you selected the DNA of the libraries by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01379 gene using the probe oligonucleotide and one of the PCR primers.

- - RNA was isolated for the construction of cDNA libraries from human fetal kidney tissue.

• DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR01379 which is designated herein as DNA59828-1608 and is shown in Figure 237 (SEQ ID.

NO: 339); and the sequence of the derived protein • for PR01379 (SEC ID NO: 340).

The complete nucleotide sequence of PR01379 is shown in Figure 237 (SEQ ID NO: 339). Clone DNA59828 - 1608 contains a single open reading structure with an apparent translation initiation site in the positions • 10-12 of the nucleotide and an apparent stop codon at positions 1732-1734 of the nucleotide.

The predicted polypeptide precursor is 574 amino acids in length. The full-length PR01379 protein shown in Figure 238 has an estimated molecular weight of about 65,355 daltons and a pl of about 8.73. The additional features include a peptide from - - signal is at approximately amino acids 1-17 and potential N-glycosylation sites are at approximately amino acids 160-163, 287-290, and 323-326. • An analysis of the Dayhoff database ver- sion 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 10 238 (SEQ ID NO: 340), revealed the identity of • sequence between the amino acid sequence of PR01379 and the following Dayhoff sequences: YHY8_YEAST, AF040625_1, HP714394_1, and H I V 18 U 45630_1.

Clone DNA59828 - 1608 has been deposited with the ATCC and assigned the no. of deposit of ATCC 203158.

EXAMPLE 105: Isolation of cDNA Clones Encoding to Human PR0844 A DNA database with expressed sequence mark (EST) was searched (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) and a EST showing sequence identity with the aLP.

Based on the information and findings provided herein, the clone was further examined for this EST, clone Incyte no. 2657496 from a cancerous lung library.

Sequencing of the insert DNA for this clone gave a sequence (designated herein as DNA59838-1462; SEQ ID NO: 344) which includes the full-length DNA sequence for PR0844 and the protein sequence derivative for PR0844. • The complete nucleotide sequence of DNA59838-1462 is shown in Figure 239 (SEQ ID NO: 344). The clone DNA59838 - 1462 contains only one open reading frame with an apparent translation initiation site at positions 5-7 of the nucleotide and ending at the stop codon at positions 338-340 of the SEC nucleotide. ID NO: 344 (Figure 239). He The precursor of the predicted polypeptide is 111 amino acids in length (Figure 240). The full-length PR0844 protein shown in Figure 240 has an estimated molecular weight of approximately 12,050 daltons and a pl of approximately 5.45. Clone UNQ544 DNA59838-1462 has been deposited with the ATCC on June 16, 1998. It is understood that the deposited clone has the current nucleic acid sequence and that the sequences provided herein are based on known sequencing techniques.

An analysis of the amino acid sequence of the full length PR0844 polypeptide suggests that it itself possesses significant sequence similarity to the serine protease inhibitors, thus indicating that PR0844 may be a new proteinase inhibitor. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), reveals the significant homology between the amino acid sequence of PR0844 and at least the following sequences Dayhoff, ALK1__HUMAN, P_P82403, P P82402, ELAF HUMAN and P P60950.

EXAMPLE 106: Isolation of cDNA Clones Encoding Human PR0848 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA55999.

In light of a sequence homology observed between the consensus sequence DNA55999 and an EST sequence encompassed within the EST clone of Incyte no. 2768571, EST clone of Incyte 768571 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes - a full-length protein. The sequence of this cDNA insert is shown in Figure 241 and is designated herein as DNA59839-1461.

The complete nucleotide sequence of DNA59839-1461 is shown in Figure 241 (SEQ ID NO: 346). The clone DNA59839-1461 contains a single open reading structure with a site of initiation of apparent translation in positions • 146-148 of the nucleotide and ends at the stop codon at positions 1946-1948 of the SEC nucleotide. ID NO: 346 (Figure 241). The predicted polypeptide precursor is 600 amino acids in length (Figure 242). The full-length PR0848 protein shown in Figure 242 has an estimated molecular weight of • approximately 68,536 daltons. The clone DNA59839- 1461 has been deposited with the ATCC on June 16 of 1998. It is understood that the deposited clone has the current nucleic acid sequence and that the sequences provided herein are based on known sequencing techniques. 25 - - An analysis of the amino acid sequence of the full length PR0848 polypeptide suggests that it may itself be a new serum and Itrans ferase. More specifically, an analysis of the Dayhoff database (version 35.45 SwissProt 35), demonstrates the sequence identity between the amino acid sequence of PR0848 and at least the following Dayhoff sequences, P_R78619 (GalNAc- alpha-2, 6- sialyltransferase), CAAG5_CHICK (alpha-n-10 acetylgalactosamide alpha-2,6-sialitransferase), • HSU14550_1, CAG6_HUMAN and P_R63217 (alpha-2, 3- sial and 11 rans fera sa human).

EXAMPLE 107: Isolation of the cDNA Clones that Codify the Human PRO1097 The use of the signal sequence algorithm described in Example 3 above allowed the • identification of a single EST group sequence from the Incyte database. This group sequence EST was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Stick Alto, CA) to identify the existing - homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56006.

In light of a sequence homology observed between the DNA56006 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2408105, the EST clone of Incyte 2408105 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 243 and is designated herein as DNA59841-1460.

The complete nucleotide sequence of DNA59841-1460 is shown in Figure 243 (SEC. ^^^^^^^^ jA ^^^^^^^^ - - NO: 348). Clone DNA59841-1460 contains a single open reading frame with an apparent translation initiation site at positions 3-5 of the nucleotide and ends at the stop codon at positions 276-278 of the nucleotide (Figure 243). The predicted polypeptide precursor is 91 amino acids in length (Figure 244). The full-length PRO1097 protein shown in Figure 244 has an estimated molecular weight of about 10,542 • daltons and a pl of about 10.04. Clone DNA59841-1460 has been deposited with the ATCC on July 1, 1998. It is understood that the deposited clone has the current nucleic acid sequence and that the sequences provided herein are based on the sequencing techniques. known.

By analyzing Figure 244, the signal peptide is at approximately amino acids 1- 20 of SEC. ID NO: 349. The domain of the family protein g 1 i cop r o t a s a begins at approximately amino acid 56, and the peptide of the acyltransferase family ChoAc t a s a / COT / C PT 25 starts at approximately amino acid 49 of ^ ÉJIBftstó ^^ - - SEC. ID NO: 349 EXAMPLE 108: Isolation of cDNA Clones Encoding Human PR01153 • The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of databases of expressed sequence mark data (EST) that • include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pha rma ceutica 1 s, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 • (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or 20 older ones that did not code for the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom * 25 was designated herein as DNA56008.

In light of a sequence homology observed between the DNA56008 consensus sequence and an EST sequence encompassed within the EST clone of 5 Incyte no. 2472409, the EST clone of Incyte 2472409 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 245 and is designated herein • as DNA59842-1502.

The full-length clone shown in Figure 245 contains a single reading structure Open with an apparent translation initiation site at positions 92-94 of the nucleotide and ends at the stop codon found in the • positions 683-685 of the nucleotide (Figure 245; SEQ ID NO: 350). The predicted polypeptide precursor (Figure 246; SEQ ID NO: 351) is 197 amino acids in length. PR01153 has a calculated molecular weight of approximately 21,540 daltons and an estimated pl of approximately 8.31. The DNA59842- 1502 clone has been deposited with the ATCC and assigned the no. of deposit ATCC 209982. It is understood that the has the current and correct sequence is in the deposited clone while in the present are the representations based on the current sequencing that may have minor errors.

Based on a sequence alignment analysis WU-BLAST-2 (using the ALIGN computer program) of the full-length sequence, PR01153 showed some amino acid sequence identity with the following Dayhoff designations as follows: S57447; SOYHRGPC_l; S46965; P_P82971; VCPHEROPH_l; EXTN_TOBAC; MLCB2548_9; ANXA RABIT; JC5437 and SSGP VOLCA.

EXAMPLE 109: Isolation of cDNA Clones Encoding Human PR01154 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceutical s, Palo - 1 - Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 • (nineteen ninety six)) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The • consensus sequence obtained from it was designated herein as DNA56025.

In light of a sequence homology 15 observed between the DNA56025 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2169375, the EST clone of Incyte 2169375 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert 20 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 247 and is designated herein as DNA59846-1503.

The full-length clone shown in Figure 247 contains a single open reading frame with an apparent translation initiation site at positions 86-88 of the nucleotide and ends at the stop codon found in the • positions 2909-2911 of the nucleotide (Figure 247, SEQ ID NO: 352). The predicted polypeptide precursor (Figure 248, SEQ ID NO: 353) is 941 amino acids in length. PR01154 has a calculated molecular weight of approximately 107,144 daltons and an estimated pl of approximately 6.26. He • DNA59846-1503 clone has been deposited with the ATCC and assigned the no. of deposit ATCC 209978.

Based on an alignment analysis of 15 WU-BLAST-2 sequences (using the ALIGN computer program) of the full-length sequence, PR01154 showed some identity of • amino acid sequence with the following Dayhoff designations as follows: AB011097_1, 20 AMPN_HUMAN, RNU76997_1, 159331, GEN14047, HSU62768_1, P_R51281, CET07F10_1, SSU66371_1, and AMPRE HUMAN.

EXAMPLE 110: Isolation of cDNA Clones Encoding Human PR01181 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database, designated in the present as 82468. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include the bases 10 of public EST data (for example, Genbank) and a • Particular EST DNA database (LIFESEQ ™, Incyte Pha rma ceu t i ca 1 s, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record • of 70 (or in some cases, 90) or older that did not code for the known proteins, they were stacked and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56029. 25 - - In light of a sequence homology observed between the DNA56029 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2186536, the EST clone of 5 Incyte 2186536 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 249 and is designated herein as DNA59847-1511. • Clone DNA5984 -1511 contains a single open reading structure with an apparent translation initiation site in the positions -17-19 of the nucleotide and ends at the stop codon at positions 1328-1330 of the nucleotide (Figure 249). The predicted polypeptide precursor • it is 437 amino acids long (Figure 250). The full length PR01181 protein shown in Figure 250 has an estimated molecular weight of about 46,363 daltons and a pl of about 6.22. The analysis of the sequence of the full-length PR01181 shown in Figure 250 (SEQ ID NO: 355) reveals the The presence of the following: an approximate signal peptide from amino acid 1 to approximately amino acid 15, the potential N-glycosylation sites approximately from amino acid 46 to approximately amino acid • 49, approximately from amino acid 189 to approximately amino acid 192 and approximately from amino acid 382 to approximately amino acid 385 and blocks of amino acid sequences having homology to proteins of the Ly-6 / u-PAR domain approximately from amino acid 287 to approximately amino acid 300 and approximately from amino acid 98 to approximately amino acid 111. The clone DNA59847-1511 has been deted with the ATCC on August 4, 1998 and assigned the no. of det ATCC 203098.

An analysis of the Dayhoff 20 database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 250 (SEQ ID NO: 355), puts shows the homology between the amino acid sequence of PR01181 and the following Dayhoff sequences: - - AF041083_1, P_W26579, RNMAGPIAN_1, CELT13C2_2, LMSAP2GN_1, S61882, CEF35C5_12, DP87_DICDI, GIU47631_1 and P_R07092. # 5 EXAMPLE 111: Isolation of the cDNA Clones Encoding Human PR01182 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a unique EST group sequence of the Incyte database, designated in this • as 82468. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (for example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pha rmaceut i ca 1 s, Palo Alto, CA) to identify existing homologies. The search • Homology was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzy oloqy 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, j3¿fejÉB - v * .g¿J-'j «? a-, Y - - University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56033.

In light of a sequence homology observed between the DNA56033 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2595195, EST clone of Incyte 2595195 was purchased and the cDNA insert was obtained and was sequenced. It was found that this insert • encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 251 and is designated herein as DNA59848-1512. The clone DNA59848-1512 contains a single open reading frame with a site of • initiation of apparent translation at tions 67-69 of the nucleotide and ending at the codon of arrest at tions 880-882 of the nucleotide (Figure 251). The predicted polypeptide precursor is 271 amino acids in length (Figure 252). The full-length PR01182 protein shown in Figure 252 has an estimated molecular weight of approximately 28,665 daltons and a pl of - - approximately 5.33. The analysis of the sequence of the full-length PR01182 shown in Figure 252 (SEQ ID NO: 357) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 25, a block of amino acids having homology to the C-type lectin domain proteins roughly from amino acid 247 to about 10 amino acid 256 and a block of f-amino acid sequences having homology to the Clq domain proteins roughly from amino acid 44 to approximately amino acid 77. Clone DNA 59848-1512 has been deted with the ATCC 15 on August 4, 1998 and assigned no. of det ATCC 203088. f An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis 20 WU-BLAST-2 of the full length sequence shown in Figure 252 (SEQ ID NO: 357), sets in evidence the significant homology between the amino acid sequence of PR01182 and the following 25 Dayhoff sequences: PSPD_BOVIN, CL43 BOVIN, CONG BOVIN, ^ «== - == .- ~ v ~ ~ - • ^ a - ^ 'ai- | tefa¡í« - ^? »-» a-a - j--. Aji-v-iY.ii-rf ", * & - & < «. .- «- a-a. '& ¿¿¿t * £ & P W18780, P R45005, P R53257 and CELEGAP7 1 EXAMPLE 112: Isolation of cDNA Clones Encoding Human PR01155 • The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of bases from expressed sequence mark data (EST) that • include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pha rmaceut i cal s, Palo Alto, CA) to identify the homologies existing. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods m Enzymology 266: 460-480 • (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or older ones that did not code for the known proteins were pooled and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated herein as DNA56102.

In light of a sequence homology observed between the DNA56102 consensus sequence and an EST sequence encompassed within the EST clone of 5 Incyte no. 2858870, the EST clone of Incyte 2858870 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 253 and is designated herein • as DNA59849-1504.

The full-length clone shown in Figure 253 contains a single reading structure Open with an apparent translation initiation site at positions 158-160 of the nucleotide and ends at the stop codon found in the • positions 563-565 of the nucleotide (Figure 253; SEQ ID NO: 358). The predicted polypeptide precursor (Figure 254, SEQ ID NO: 359) is 135 amino acids in length. PR01155 has a calculated molecular weight of about 14,833 daltons and an estimated pl of about 9.78. The clone DNA59849-1504 has been deposited with the ATCC and assigned to it the no. ATCC Deposit 209986. It is understood that the current clone has the correct sequence while in the present there are only the representations that tend to have minor sequencing errors. • 5 Based on a sequence alignment analysis WU-BLAST-2 (using the ALIGN computer program) of the full-length sequence, PR01155 showed some amino acid sequence identity with the following Dayhoff designations as follows: TKNK_BOVIN; • PVB19X587_1; AF019049_1; P_W00948; S72864; P_W00949; 162742; AF038501_1; TKNG_HUMAN; and YAT1_RH0BL. Based on the information provided herein, PR01155 may play a role in the provision of neu ropr ot eccion and cog tiva improvement.

EXAMPLE 113: Isolation of the cDNA Clones that • Encode the PR01156 Human The use of the signal sequence algorithm described in Example 3 above allowed the identification of a unique EST group sequence from the Incyte database, designated herein as 138851. This sequence from the EST group was then compared to a variety of brand databases expressed sequence (EST) which include the bases - of public EST data (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The search • 5 homology was perfd using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater than no encoded the known proteins, they were • stacked and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated herein as DNA56261.

In light of a sequence homology • observed between the DNA56261 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3675191, EST clone of Incyte 3675191 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 255 and is designated herein - - as DNA 5 9 8 5 3 - 1 5 0 5 The full-length clone shown in Figure 255 contains a single reading structure • open with an apparent translation initiation site at positions 212-214 of the nucleotide and ending at the stop codon found at positions 689-691 of the nucleotide (Figure 255, SEQ ID NO: 360). The predicted polypeptide precursor 10 (Figure 256, SEQ ID NO: 361) is 159 amino acids • of length. PR01156 has a calculated molecular weight of about 17,476 daltons and an estimated pl of about 9.15, a signal peptide sequence at about 15 amino acids to about 22, and potential N-glycoside and ion sites at about amino acids 27-30 and 41-44 • The clone DNA59853 - 1505 has been deposited with 20 the ATCC on July 16, 1998 and was assigned the no. of deposit ATCC 209985.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using a 25 sequence alignment analysis WU-BLAST-2 (using ^^^^^ ¡^^^^^^^^^^^ á ^^^^^^^ j - ^^^^^^ gtí. the ALIGN computer program of the full length sequence shown in Figure 256 (SEQ ID NO: 361), revealed some homology between the amino acid sequence of PR01156 and the following Dayhoff sequences: D45027_l, P_R79914, JC5309, KBF2_HUMAN, AF010144_1, GEN14351, S68681, P_R79915, ZMTAC 3, and HUMCPG0_1.

EXAMPLE 114: Isolation of the cDNA Clones that Encode the Human PRO1098 • The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This group sequence EST was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by • example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was perfd using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result a Blast record of 70 (or in some cases, 90) or ^ fc ^ tea ^ fe .-. s.- older than did not code the known proteins, they were piled and assembled in a consensus DNA sequence with the program "phrap" (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56377.

In light of a sequence homology observed between the DNA56377 consensus sequence and an EST sequence encompassed within the EST clone of • Incyte no. 3050917, the EST clone of Incyte 3050917 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 257 and is designated herein as DNA59854-1459. • The complete nucleotide sequence of DNA59854-1459 is shown in Figure 257 (SEQ ID NO: 362). Clone DNA 59854-1459 contains a single open reading frame with an apparent translation initiation site at positions 58-60 of the nucleotide and terminates at the stop codon at positions 292-294 of the - nucleotide of the SEC . ID NO: 362 (Figure 257). The predicted polypeptide precursor is 78 amino acids in length (Figure 258). The PRO1098 full-length protein shown in the • Figure 258 has an estimated molecular weight of about 8,396 daltons and a pl of about 7.66. Clone DNA59854-1459 has been deposited with the ATCC on June 16, 1998. It is understood that the deposited clone has the nucleic acid sequence and that the • sequences provided herein are based on known sequencing techniques By analyzing Figure 258, the signal peptide appears to be at approximately amino acids 1-19 of SEC. ID NO: 363, a site • of N -g 1 i cos i 1 a c i on seems to be at approximately amino acids 37-40 of the SEC.

ID NO: 363, and the sites of N-mi r i s t o i 1 a l a l ation appear to be approximately 15-20, 19-24 and 60-65 of the SEC. ID NO: 363 - - EXAMPLE 115: Isolation of the cDNA Clones Encoding to the Human PR01127 The use of the signal sequence algorithm described in Example 3 above allowed the • identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by example, Genbank) and an EST DNA database # particular (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six)) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of consensus DNA with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA57959.

In light of a sequence homology -. «- and.jftj- ..- -J ...- - - observed between the consensus sequence DNA57959 and an EST sequence encompassed within the clone EST of Merck no. 685126, the EST clone of Merck 685126 was purchased and the cDNA insert was obtained and • sequencing It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 259 and is designated herein as DNA60283-1484. 10 • The full-length clone shown in Figure 259 contains a single open reading structure with an apparent translation initiation site at positions 126-128 of the nucleotide and terminates at the stop codon found at positions 327-329 of the nucleotide (Figure 259; SEQ ID NO: 364). The predicted polypeptide precursor • (Figure 260, SEQ ID NO: 365) is 67 amino acids in length which includes a signal peptide in approximately 1-29 of the SEC. ID NO: 365. PR01127 has a calculated molecular weight of about 7,528 daltons and an estimated pl of about 4.95. The clone DNA 60283 - 1484 has been deposited with the ATCC on July 1, 1998 and assigned the no. of deposit ATCC 203043. It is understood that the deposited clone has the current sequence, whereas representations that may have minor sequencing errors are present here. • An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in the Figure 260 (SEQ ID NO: 365), reveals some homology between • the amino acid sequence of PR01127 and the following Dayhoff sequences: AF037218_48, P_W09638, HBA_HETP0, S39821, KR2_EBV, CET20D3_8, HCU37630_1, HS193B12_10, S40012 and TRITUBC_1. EXAMPLE 116: Isolation of cDNA Clones Encoding Human PR01126 • The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program • (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of consensus DNA with the "phrap" program (Phil Green, • University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56250.

In light of a sequence homology observed between the DNA56250 consensus sequence and an EST sequence encompassed within the EST clone of • Incyte no. 1437250, the EST clone of Incyte 1437250 was purchased and the cDNA insert was obtained and was sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 261 and is designated herein as DNA60615-1483. 25 Clone DNA60615-1483 contains a single open reading structure with an apparent translation initiation site in positions 110-112 of the nucleotide and ends in the codon of • 5 stop at positions 1316-1318 of the nucleotide (Figure 261). The predicted polypeptide precursor is 402 amino acids in length (Figure 262). The full-length PR01126 protein shown in Figure 262 has an estimated molecular weight of about 45,921 daltons and a pl of about 8.60. The analysis of the sequence of the full-length PR01126 shown in Figure 262 (SEQ ID NO: 367) evidences the presence of the following: a signal peptide of Approximately from amino acid 1 to approximately amino acid 25 and the potential N-glycosylation sites approximate from amino acid 66 to approximately amino acid 69, approximately from amino acid 138 to approximately amino acid 141 and approximately from amino acid 183 to approximately amino acid 186. Clone DNA60615-1 83 has been deposited with the ATCC on June 16, 1998 and assigned no. deposit ATCC 209980.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 262 (SEQ ID NO: 357), reveals significant homology between the amino acid sequence of PR01126 and the following Dayhoff sequences: 173636, NOMR_HUMAN, MMUSMY0C3_1, HS454G6_1, P_R98225, RNU78105_1, RNU72487_1, AF035301_1, • CEELC48E7 4 and CEF11C3 3.

EXAMPLE 117: Isolation of the cDNA Clones Encoding Human PR01125 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a unique EST group sequence • From the Incyte database. This sequence of the EST group was then compared to a variety of bases from expressed sequence mark data (EST) including public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify homologies existing. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or • older people who did not code the known proteins, were piled and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated herein as DNA56540. WW In light of a sequence homology observed between the DNA56540 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 1486114, EST clone of Incyte 1486114 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert F encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 253 and is designated herein as DNA60615-1483.

The full length clone shown in the Figure 263 contains a single reading structure open with a translation initiation site apparent at positions 47-49 of the nucleotide and ending at the stop codon found at positions 1388-1390 of the nucleotide (Figure 263, SEQ ID NO: 368). The precursor of the polypeptide • 5 predicted (Figure 264, SEQ ID NO: 369) is 447 amino acids in length. PR01125 has a calculated molecular weight of about 49,798 daltons and an estimated pl of about 9.78. The clone DNA60615-1483 has been deposited with the ATCC and was assigned the no. ATCC Deposit 209993. It is understood that the clone has the current sequence and that the sequences herein are representations based on current techniques that may tend to have minor errors. 15 Based on a sequence alignment analysis WU-BLAST-2 (using the ALIGN computer program) of the full length sequence, the PR01125 showed some identity of sequence with the following Dayhoff designations: RC01_NEUCR; S58306; PKWA_THECU; S76086; P_R85881; HET1_P0DAN; SPU92792_1; APAF HUMAN; S76414 and S59317.

T r ° £ 3Íí * A¡ > & amp: x < EXAMPLE 118: Isolation of cDNA Clones Encoding Human PR01186 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by example, Genbank) and an EST DNA database • particular (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six)) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or • older people who did not code the known proteins were piled and assembled in a sequence of consensus DNA with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56748. the light of a sequence homology observed between the DNA56748 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3476792, the EST clone of Incyte 3476792 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 265 and is designated herein as DNA60621-1516. 10 • The full-length clone shown in Figure 265 contains a single open reading structure with an apparent translation initiation site at positions 91-93 of the nucleotide and 15 ends at the stop codon found at positions 406-408 of the nucleotide (Figure 265; SEQ ID NO: 370). The predicted polypeptide precursor • (Figure 266, SEQ ID NO: 371) is 105 amino acids in length. The signal peptide in about 20 1-19 of SEQ. ID NO: 371. PR01186 has a calculated molecular weight of about 11,715 daltons and an estimated pl of about 9.05. The clone DNA60621-1516 was deposited with the ATCC on August 4, 1998 and was assigned the no. of 25 ATCC deposit 203091.

- J - ^ ^ J - ^^^^ a-fegái ^ feaaBafe.-.'- 'ia;. a > »» Aá fc¿a ». '.. x.,.,. -. Hmj.-jfe.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the • full length sequence shown in Figure 266 (SEQ ID NO: 371), reveals some homology between the amino acid sequence of PR01186 and the following Dayhoff sequences: VPRA_DENPO, LFE4_CHICK, AF034208_1, AF030433_1, A55035, COL_RABIT, CELB0507_9, S67826_l, S34665 and • CRU73817 1.

EXAMPLE 119: Isolation of cDNA Clones Encoding Human PR01198 An initial DNA sequence referred to herein as DNA52083 was identified using a selection of yeasts in a cDNA library of • the endothelial cells of the human umbilical vein that pre-encloses the 5 'ends of the primary cDNA clones. The DNA52083 was compared ESTs from public databases (for example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pha rmaceu t i ca 1 s, Palo Alto, CA), using the BLAST or BLAST2 computer program [Altschul, Methods in Enzymology 266: 460-480 (1996)]. The ESTs were stacked and assembled into a consensus DNA sequence with the "phrap" computer program (Phil Green, University of Washington, Seattle, Washington). One or more of the • EST was obtained from the biopsy of human breast tissue. This consensus sequence was designated herein as DNA52780.

In light of a sequence homology 10 observed between the DNA52780 consensus sequence and • an EST sequence encompassed within the EST clone of Incyte no. 3852910, the EST clone of Incyte 3852910 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert 15 encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 267 and is designated herein • as DNA60622-1525.

The full length clone DNA 60622-1525 shown in Figure 265 (SEQ ID NO: 372) contains a single open reading frame with an apparent translation initiation site at positions 54 through 56 of the nucleotide and ends at the stop codon found at positions 741 to 743 of the nucleotide. The predicted polypeptide precursor, which is shown in Figure 268 (SEQ ID NO: 373) is 229 amino acids in length. PR01198 has a calculated molecular weight of • approximately 25,764 daltons and an estimated pl of approximately 9.17. There is a sequence of the signal peptide at about amino acids 1 to 34. There is sequence identity with the protein of the family 31 of glycosyl hydrolases in approximately amino acids 142 up • approximately 175.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis of sequence alignment WU-BLAST-2 of the full length sequence shown in Figure 268 (SEQ ID NO: 373), reveals some homology between • the amino acid sequence of PR01198 and the following Dayhoff sequences: ATF6H11_6, UCRI_RAT, TOBSUP2NT_l, RCUERF3_1, AMU88186_1, P_W22485, S56579, AF040711 1, DPP4 PIG.

The clone DNA60622-1525 has been deposited with the ATCC on August 4, 1998 and was assigned the no. 25 of deposit ATCC 203090.

EXAMPLE 120: Isolation of cDNA Clones Encoding Human PRQ1158 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (for • example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pha r aceut i cal, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA57248. 25 In light of a sequence homology observed between the DNA57248 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2640776, the EST clone of 5 Incyte 2640776 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 269 and is designated herein as DNA60625-1507. • The full length clone shown in Figure 269 contains a single open reading structure with a translation initiation site apparent at positions 163 to 165 of the nucleotide and terminates at the stop codon found at positions 532 to 534 of the nucleotide (Figure 269; • SEC. ID NO: 374). The predicted polypeptide precursor (Figure 270, SEQ ID NO: 375) is 123 amino acids in length. PR01158 has a calculated molecular weight of about 13,113 daltons and an estimated pl of about 8.53. Additional features include a signal peptide at approximately amino acids 1-19, a transmembrane domain in approximately »* - •» IB- --.-- vi1 i & MSfe-. > ? -. . » amino acids 56-80, and a potential N-glycosylation site at approximately amino acids 36-39. The clone DNA60625-1507 has been deposited with the ATCC on July 16, 1998 and assigned the no. from • ATCC deposit 209975.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure • 270 (SEQ ID NO: 375), reveals some homology between the amino acid sequence of PR01158 and the following Dayhoff sequences: ATACO 0310510 Fl 8A8.10, P_R85151, PHS2_SOLTU, RNMHCIBAC_1, RNA1FMHC_1, 168771, RNRT1A10G_1, PTPA_HUMAN, HUMGACA_1, and CHKPTPA 1.

• EXAMPLE 121: Isolation of cDNA Clones Encoding Human PR01159 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared with a variety of bases from expressed sequence mark (EST) data that ..- Afe »- * .. ^ - v. % S - = M- * ¿-. »^ JSk¡- ~. include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing • homologies. The search for '"homology was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996).) Those comparisons result in a Blast record of 70 (or in some cases, 90). or 10 older ones that did not code the known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington.) The consensus sequence obtained from the same 15 was designated herein as DNA57221.

In light of a sequence homology • observed between the DNA57221 consensus sequence and an EST sequence encompassed within the 20 Incyte no EST clone. 376776, the EST clone of Incyte 376776 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 25 271 and is designated herein as HttMaai¡aHMág ^. ^ - j¿. ".».,. . "D N A 6 0 6 2 7 - 1 5 0 8.

The clone DNA60627-1508 contains a single open reading structure with a site of • initiation of apparent translation at positions 92-94 of the nucleotide and ending at the stop codon at positions 362-364 of the nucleotide (Figure 271). The predicted polypeptide precursor is 90 amino acids in length (Figure 272). The full length PR01159 protein shown • in Figure 272 it has an estimated molecular weight of about 9,840 daltons and a pl of about 10.13. The analysis of the sequence of the full length PR01159 shown in the Figure 272 (SEQ ID NO: 377) evidences the presence of the following: a signal peptide roughly from amino acid 1 to • approximately amino acid 15 and a potential N-glycosylation site approximately from amino acid 38 to approximately amino acid 41. Clone DN A 6062-1508 has been deposited with the ATCC on August 4, 1998 and assigned no. of deposit ATCC 203092.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 272 (SEQ ID NO: 377), highlights the • Significant homology between the amino acid sequence of PR01159 and the following Dayhoff sequences: AF016494_6, AF036708_20, DSSCUTE_1, D89100_l, S28060, MEFA_XENLA, AF020798_12, G70065, E64423, JQ2005. 10 • EXAMPLE 122: Isolation of cDNA Clones Encoding Human PR01124 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a sequence of the unique EST group of the Incyte database. This sequence of the EST group was then compared to a variety of bases from • expressed sequence mark (EST) data that includes public EST databases (by example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 - (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of • Consensus DNA with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56035.

In light of a sequence homology • observed between the DNA56035 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 2767646, EST clone of Incyte 2767646 was purchased and the cDNA insert was obtained and was sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in • Figure 273 and is designated herein as DNA60629-1481. The full-length clone shown in FIG.

Figure 273 contains a single open reading structure with an apparent translation initiation site at positions 25-27 of the nucleotide and ends at the stop codon found at positions 2782-2784 of the nucleotide (Figure 273, SEQ ID NO: 378). The predicted polypeptide precursor (Figure 274, SEQ ID NO: 379) is 919 amino acids in length. The PR01124 has a weight Molecular calculated from approximately 101,282 daltons and an estimated pl of approximately 5.37. The clone DNA60629- 1481 has been deposited with the ATCC and the no. of deposit ATCC 209979. It is understood that the deposited clone has the sequence current, whereas only in the present ^ P provide representations are based on current sequencing techniques that may include normal and minor errors.

Based on a sequence alignment analysis WU-BLAST-2 of the full-length sequence, PR01124 showed some identity of • significant amino acid sequence with the chlorine channel protein and with ECAM-1.

Specifically, the following Dayhoff designations were identified as having sequence identity with PR01124: ECLC_BOVIN, AF001261_1, P_W06548, SSC6A10_1, AF004355_1, S76691, AF017642, BYU06866_2, CSA_DICDI and SAU47139_2. 25 EXAMPLE 123: Isolation of cDNA Clones Encoding Human PR01287 A DNA database with expressed sequence mark (EST) was searched (LIFESEQ ™, Incyte • 5 Pharmaceuticals, Palo Alto, CA) and an EST was identified that shows homology with the fringe protein (peripheral). This sequence of the EST group was then compared to a number of EST databases including public EST databases (for example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceut i cal s, Palo Alto, CA) to identify the homologous EST sequences. The comparison was made using the BLAST or BLAST2 computer program (Altschul, 15 Methods m Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained was designated here as DNA40568.

Based on the DNA40568 consensus sequence, the oligonucleotides were synthesized 1) to identify by PCR a cDNA library containing the sequence of interest and to be used as probes to isolate a clone from the full-length coding sequence for the PR01287. The forward or forward and reverse or reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of approximately 100-1000 bp in length. The sequences of the probe are typically • 40-55 bp in length. In some cases, the additional oligonucleotides are synthesized when the consensus sequence is greater than about 1- 1.5 kbp. To select several libraries for a full-length clone, the DNA of the libraries was selected by PCR amplification, as per Aus bel et al., Current Protocols in • Molecular Biology, upra, with the PCR primer pair. A positive library was then used to isolate the clones encoding the gene of interest using the oligonucleotide from the probe and one of the primer pairs.

PCR primers were synthesized (reverse forward 25 UÉÍ ^^^^ l? ^^ l ^^ Mt ^^^^^ j ^^^^^^^ - - 5 'forward PCR primer - CTCGGGGAAAGGGACTTGATGTT É-3' (SEQ ID NO: 382) reverse PCR primer 1 5 '-GCGAAGGTGAGCCTCTATCTCGTGCC-3' (SEQ ID NO: 383) • 5 reverse PCR primer 5 '-CAGCCTACACGTATTGAGG-3' (SEQ ID NO: 384) In addition, a synthetic hybridization probe of the oligonucleotide was constructed from the consensus DNA40568 sequence having the following nucleotide sequence • probe of hibr idi zac ion 5 '-CAGTCAGTACAATCCTGGCATAATATACGGCCACCATGATGCAGTCCC-3' (SEQ ID NO: 385).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by • PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01287 gene using the probe oligonucleotide and one of the PCR primers.

RNA was isolated for the construction of the 25 cDNA libraries from bone marrow tissue human spinal The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing the NotI site, ligated with the blunt portion to the Sali hemicinase adapters, excised with NotI, sized appropriately by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector • (such as pRKB or pRKD; pRK5B which is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) at the unique Xhol and Notl sites. The DNA sequencing of the isolated clones as described above yielded the full-length DNA sequence for PR01287 (designated here as DNA61755-1554 [Figure 20 275, SEQ ID NO: 380]) and the sequence of the derived protein for PR01287.

The complete nucleotide sequence of DNA61755-1554 is shown in Figure 275 (SEQ ID NO: 380). The full-length clone contains - -fc-i. _? _ ^^ ~ z¿e ^! ^ í \ ^^ £ ¡^?: __, - _ - .. ".. yy. -%, .. - a single open reading structure with an apparent translation initiation site at positions 655-657 of the nucleotide and a stop signal at positions 2251-2253 of the • nucleotide (Figure 275, SEQ ID NO: 380). The predicted polypeptide precursor is 532 amino acids in length has a calculated molecular weight of about 61,351 daltons and a pl of about 8.77. The analysis of the sequence of the full length PR01287 shown in • Figure 276 (SEQ ID NO: 381) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 27 and the N-15 g 1 sites approximately from amino acid 315 to approximately amino acid 318 and approximately from amino acid 324 • up to approximately amino acid 327. The clone DNA61755-1554 has been deposited with the ATCC on 11 August 20, 1998 and the no. of deposit of ATCC 203112.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis of sequence alignment WU-BLAST-2 of the full-length sequence shown in Figure 276 (SEQ ID NO: 381), evidences the significant homology between the amino acid sequence of PR01287 and the following sequences. Dayhoff: CET24D1_1, EZRI_BOVIN, GGU19889_1, CC3_YEAST, S74244, NALS_MOUSE, MOES_PIG, S28660, S44860 and YNA4_CAEEL.

EXAMPLE 124: Isolation of the cDNA Clones Encoding Human PR01312 • A DNA55773 was identified in a human fetal kidney cDNA library using a selection of yeast which preferentially represents the 5 'ends of the primary cDNA clones. Based on the DNA55773 sequence, oligogonomes were synthesized to be used as probes to isolate a clone from the full length coding sequence for PR01312.

The full-length clone DNA61873-1574 shown in Figure 277 contains a single open reading frame with an apparent translation initiation site at positions 7-9 of the nucleotide and ends at the stop codon found at positions 643 -645 from "S. i.-to." A "^" & -nucleotide The precursor of the predicted polypeptide is 212 amino acids in length (Figure 278, SEQ ID NO: 387) PR01312 has a calculated molecular weight of approximately 24,024 daltons and a pl • estimated approximately 6.26. Other features include a signal peptide at about amino acids 1-14; a transmembrane domain at approximately amino acids 141-160, and potential N-glycosylation sites in approximately amino acids 76-79 and 93-96.

• An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the The full-length sequence shown in Figure 278 (SEQ ID NO: 387) reveals some homology between the amino acid sequence of PR01312 and the • following Dayhoff sequences: GCINTALPH_1, GIBMUC1A_1, P_R96298, AF001406_1, PVU88874_1, P_R85151, AF041409_1, CELC50F2_7, C45875, and AB009510_21.

The clone DNA61873-1574 has been deposited with the ATCC and assigned the no. of deposit ATCC 25 203132.

EXAMPLE 125: Isolation of cDNA Clones Encoding Human PR01192 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA35924. Based on the consensus sequence DNA35924, the oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for the PR01192.

The PCR primers were synthesized (forward reverse primer PCR 5 '-CCGAGGCCATCTAGAGGCCAGAGC-3' (SEQ ID NO: 390) reverse PCR primer: 5 '-ACAGGCAGAGCCAATGGCCAGAGC-3' (SEQ ID NO: 391). a synthetic hybridization probe of the oligonucleotide from the consensus DNA35924 sequence having the following nucleotide sequence: ßmh? l? li? M? ^ Mt SlK ^^ Hybridization probe: 5 '-GAGAGGACTGCGGGAGTTTGGGACCTTTGTGCAGACGTGCTCATG-3' (SEQ ID NO: 392).

To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones that • encode the PR01192 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from liver tissue and human fetal spleen.

The sequencing of the DNA of the clones • isolated as described above gave the full length DNA sequence for PR01192 which is designated herein as DNA62814-1521 and shown in Figure 279 (SEQ ID NO: 388); and the sequence of the derived protein for PR01192 shown in Figure 280 (SEQ ID NO: 389). 25 • •• - i -i r? R * i? A- i-m - ,, ..-.... m ^ u ^? ^^^^^^^^ ^^^ The complete nucleotide sequence of PR01192 is shown in Figure 279 (SEQ ID NO: 388). The DNA62814 - 1521 clone contains a single open reading structure with a site of • initiation of apparent translation at positions 121-123 of the nucleotide and an apparent stop codon at positions 766-768 of the nucleotide. The predicted polypeptide precursor is 215 amino acids in length. The precursor of The predicted polypeptide has the following • characteristics: a signal peptide is at approximately amino acids 1-21; a transmembrane domain in approximately amino acids 153-176; the potential N-glycosylation sites at about amino acids 39-42 and 118-121; and homology with the pO myelin proteins at approximately amino acids 27-68 and 99-128 of • Figure 280. The full length PR01192 protein shown in Figure 280 has a weight Molecular estimate of approximately 24,484 daltons and a pl of approximately 6.98.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis of sequence alignment WU-BLAST-2 of the full-length sequence shown in Figure 280 (SEQ ID NO: 389), revealed the homology between the amino acid sequence of PR01192 and the following Dayhoff sequences: GEN12838, MYPO HUMAN, AF049498_1, GEN14531, P_W14146, HS46KDA_1, CINB_RAT, OX2G_RAT, D87018_l, and D86996_2.

The clone DNA62814-1521 has been deposited with the ATCC on August 4, 1998, and was assigned the 0 no. of deposit of ATCC 203093.

EXAMPLE 126: Isolation of cDNA Clones Encoding Human PRO1160 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA40650. Based on the DNA40650 consensus sequence, the oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for the PRO1160.

- - PCR primers (forward and reverse) were synthesized: 5 'forward PCR primer-GCTCCCTGATCTTCATGTCACCACC-3' (SEQ ID NO: 395) • 5 'reverse PCR primer 5' -CAGGGACACACTCTACCATTCGGGAG-3 '(SEQ ID NO: 396) In addition, a synthetic hybridization probe of the oligonucleotide was constructed from the DNA40650 sequence having the following nucleotide sequence hybridization probe -CCATCTTTCTGGTCTCTGCCCAGAATCCGACAACAGCTGCTC -3 SEC. ID NO: 397) To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PRO1160 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from breast tissue human.

DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for the • PRO1160 (designated herein as DNA62872-1509 [Figure 281, SEQ ID NO: 393]) and the sequence of the protein derived for PRO1160.

The complete nucleotide sequence of DNA62872-1509 is shown in Figure 281 (SEC.

• NO: 393). Clone DNA62872-1509 contains a single open reading frame with an apparent translation initiation site at positions 40-42 of the nucleotide and ends at the codon of arrest at positions 310-312 of the nucleotide (Figure 281). The predicted polypeptide precursor is 90 amino acids in length (Figure 282). The • PRO1160 full-length protein shown in Figure 282 has an estimated molecular weight of about 9,039 daltons and a pl of about 4.37. An analysis of the sequence of the full-length PRO1160 shown in Figure 282 (SEQ ID NO: 394) evidences the presence of the following: a signal peptide of approximately from amino acid 1 to ? iß_?? -jSta ÍMa-M-a-M-aU-a .te ^ -s ^? ? approximately amino acid 19 and a phosphorylation site of protein kinase C roughly from amino acid 68 to about amino acid 70. Clone DNA62872- • 1509 has been deposited with the ATCC on August 4, 1998 and was assigned the do not. of deposit of ATCC 203100.

An analysis of the Dayhoff 10 database (version 35.45 SwissProt 35), using the analysis • WU-BLAST-2 sequence alignment of the full length sequence shown in Figure 282 (SEQ ID NO: 394), evidences the significant homology between the 15 amino acid sequence of PRO1160 and the following Dayhoff sequences: B30305, GEN13490, 153641, S53363, HA34_BRELC, SP96_DICDI, S36326, SSU51197_10, MUC1_XENLA, TCU32448_1 and AF000409 1.

EXAMPLE 127: Isolation of cDNA Clones Encoding Human PR01187 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a unique EST group sequence. of the Incyte database. This group sequence ? -? - Í - É-Í ---- Í --- ß-i -? -.- «-«. I «ai ^^ -É_fc_¿-ÍÉÍ EST was then compared with a variety of bases of expressed sequence mark data (EST) that includes public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result • a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA57726. • In light of a sequence homology 20 observed between the DNA57726 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 358563, EST clone of Incyte 358563 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. Sequence > The largest of this cDNA insert is shown in Figure 283 and is designated herein as DNA62876-1517.

The full-length clone shown in Figure 283 contains a single open reading structure with an apparent translation initiation site at positions 121-123 of the nucleotide and ends at the stop codon found in the positions 481-483 of the nucleotide (Figure 283; • ID NO: 398). The predicted polypeptide precursor (Figure 284, SEQ ID NO: 399) is 120 amino acids in length. The signal peptide is at approximately amino acids 1-17 of SEC. ID NO: 399. PR01187 has a calculated molecular weight of approximately 12,925 daltons and an estimated pl of approximately 9.46. The clone DNA62876- • 1517 has been deposited with the ATCC on August 4, 1998 and was assigned the no. of deposit ATCC 203095. It is understood that the deposited clone has the current sequence and that the representations that may have minor sequencing errors are here.

An analysis of the Dayhoff database ? ^ "^ Ksg¡ | ¡^^^ (35.55 SwissProt 35 version), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 284 (SEQ ID NO: 399 ), reveals some sequence identity (and therefore some relationship) between the amino acid sequence of PR01187 and the following Dayhoff sequences: MGNENDOBX_l, CELF41G3_9, AMPG_STRLI, HS BBOVHERL_2, LEEXTEN10_1, AF029958_1 and P_W04957. 10 • EXAMPLE 128: Isolation of cDNA Clones Encoding to Human PR01185 Using the algorithm of the signal sequence described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of bases from • expressed sequence mark (EST) data that includes public EST databases (by example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 . «AvaiB ^^ S. (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of • Consensus DNA with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56426.

In light of a sequence homology • observed between the DNA56426 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3284411, the EST clone of Incyte 3284411 was purchased and the cDNA insert was obtained and is sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 285 and is designated herein as DNA62881-1515. 20 The full-length clone DNA 62881-1515 shown in Figure 285 contains a single open reading structure with an apparent translation initiation site in positions 4-6 of the nucleotide and terminates at the stop codon found at positions 598-600 of the nucleotide (Figure 285; SEQ ID NO: 400). The predicted polypeptide precursor (Figure 286, SEQ ID NO: 401) is 198 amino acids in length. He • Signal peptide is at approximately amino acids 1-21 of the SEC. ID NO: 401. PR01185 has a calculated molecular weight of approximately 22,105 daltons and an estimated pl of approximately 7.73. The clone DNA 62881 - 1515 has been deposited with the ATCC and was assigned the no. of deposit ATCC • 203096.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis of sequence alignment WU-BLAST-2 of the full length sequence shown in Figure 286 (SEQ ID NO: 401), reveals some identity of • sequence between the amino acid sequence of PR01185 and the following Dayhoff sequences: TUP1_YEAST, AF041382_1, MAOM_SOLTU, SPPBPHU9_1, 141024, E PC PLC FAIL_1, HSPLEC_1, YKL4 CAEEL, A44643, TGU65922 1.

EXAMPLE 129: Isolation of cDNA Clones Encoding Human PR01345 A consensus DNA sequence was assembled in relation to other EST sequences using phrap • as described in Example 1 above. This consensus sequence is designated herein as DNA47364. Based on the DNA47364 consensus sequence, the oligonucleotides 1) were synthesized to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone. for PR01345.

PCR primers (forward and reverse) were synthesized: forward PCR primer 5 * -CCTGGTTATCCCCAGGAACTCCGAC-3 '(SEQ ID NO: 404) 5' reverse PCR primer 5 -CTCTTGCTGCTGCGACAGGCCTC-3 '(SEQ ID NO: 405) Additionally , a synthetic hybridization probe of the oligonucleotide was constructed from the DNA47364 sequence having the following nucleotide sequence.

- -Jt --- Maa - t- .. • - "a > - ^. '^ Y- - - -i ** ¡- ~ -'- -. - 5' -CGCCCTCCAAGACTATGGTAAAAGGAGCCTGCCAGGTGTCAATGAC-3 '( SEC ID NO: 406) To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was then used to isolate the clones encoding the PR01245 gene using the oligonucleotide ol probe and one of the PCR primers. The RN was isolated for the construction of the cDNA libraries from the human breast carcinoma tissue.

DNA sequencing of the isolated clones as described above gave the full-length DNA sequence for PR01345 (designated herein as DNA64852-1589 [Figure 287, SEQ ID NO: 402]) and the protein sequence derivative for PR01345.

The complete nucleotide sequence of DNA64852-1589 is shown in Figure 287 (SEQ ID O: 402). The clone DNA64852 - 1589 contains only one ttM ^ i ^ í? uk ^^^ ß ^ t ^ ba ^ Yes ^. ~ -a. open reading structure with an apparent translation initiation site at positions 7-9 or 34-36 of the nucleotide and ending at the stop codon at positions 625-627 of nucleotide 5 (Figure 287). The predicted polypeptide precursor is 206 amino acids in length (Figure 288). The full length PR01345 protein shown in Figure 288 has an estimated molecular weight of approximately 23,190 daltons and a pl approximately 9.40. An analysis of the sequence • of the full-length PR01345 shown in Figure 288 (SEQ ID NO: 403) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 31 or approximately from amino acid 10 to approximately amino acid 31 and a sequence of • the label of the type C lectin domain roughly from amino acid 176 to approximately amino acid 190. The clone DNA64852- 1589 has been deposited with the ATCC on August 18, 1998 and assigned the no. of deposit of ATCC 203127.

An analysis of the Dayhoff database ^^^ ¡g¡ jg g £ íjf¡ ^ / g ^ - - (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 288 (SEC. ID NO: 403), highlights the • Significant homology between the amino acid sequence of PR01345 and the following Dayhoff sequences: BTU22298_1, TETN_CARSP, TETN_HUMAN, MABA_RAT, S34198, P_W13144, MACMBPA_1, A46274, PSPD RAT AND P R32188. 10 • EXAMPLE 130: Isolation of the cDNA Clones Encoding to the Human PR01245 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of bases from • expressed sequence mark (EST) data that includes public EST databases (by example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of • Consensus DNA with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56019.

In light of a sequence homology • observed between the DNA56019 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 1327836, the EST clone of Incyte 1327836 was purchased and the cDNA insert was obtained and was sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in • Figure 289 and is designated herein as DNA64884-1527. 20 The full-length clone shown in the Figure 289 contains a single open reading structure with an apparent translation initiation site at positions 79-81 of the nucleotide and terminates at the stop codon found at positions 391-393 of the nucleotide (Figure 289, SEQ ID NO: 407). The predicted polypeptide precursor (Figure 290, SEQ ID NO: 408) is 104 amino acids in length, with a signal peptide sequence • at about amino acid 1 to about amino acid 18. PR01245 has a calculated molecular weight of about 10,100 daltons and an estimated pl of about 8.76. 10 • An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in Figure 290 (SEQ ID NO: 408), reveals some homology between the amino acid sequence of PR01245 and the following Dayhoff sequences: SYA_THETH, GEN11167, P MTV044_4, AB011151_1, RLAJ2750_3, SNELIPTRA_1, S63624, C28391, A37907, and S14064. 20 The clone DNA6488 - 1527 has been deposited with the ATCC on August 25, 1998 and assigned the no. of deposit ATCC 203155.

^^^^^^^^ ¡^ - ^^ »EXAMPLE 131: Isolation of the cDNA Clones Encoding the Human PR01358 The use of the signal sequence algorithm described in Example 3 above allowed the • identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by example, Genbank) and an EST DNA database • particular (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or • older people who did not code for the known proteins were piled and assembled in a sequence of consensus DNA with the "phrap" program (Phil Green, University of Washington, Seattle, Washington).

In light of a sequence homology observed between the consensus sequence and a EST sequence encompassed within the EST clone of & ^^ g ^ m - - Incyte no. 88718, the EST clone of Incyte 88718 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 291 and is designated herein as DNA64890-1612.

The full length clone shown in Figure 291 contains a single open reading frame with an apparent translation initiation site at positions 86 to 88 of the nucleotide and terminates at the stop codon found at positions 1418 to 1420 of the nucleotide ( Figure 291, SEQ ID NO: 409). The precursor of the predicted polypeptide (Figure 292, SEQ ID NO: 410) is 444 amino acids in length. The signal peptide is at approximately amino acids 1-18 of SEC. ID NO: 410. PR01358 has a calculated molecular weight of approximately 50,719 daltons and an estimated pl of approximately 8.82. Clone DNA 64890-1612 has been deposited with the ATCC and assigned the no. of deposit ATCC 203131.

BMMUÉMMÍ - - An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full length sequence shown in the Figure • 5 292 (SEQ ID NO: 410), revealed the sequence identity between the amino acid sequence of PR01358 and the following Dayhoff sequences: P_W07607, AB000545_1, AB000546_1, A1AT_RAT, AB015164_1, P_P50021, C0TR_CAVP0, and HAMHPP_1. The 10 variants claimed in this application exclude • these sequences.

EXAMPLE 132: Isolation of cDNA Clones Encoding Human PR01195 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a unique EST group sequence • From the Incyte database. This sequence of the EST group was then compared to a variety of bases from expressed sequence mark data (EST) including public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify homologies existing. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result in a Blast record of 70 (or in some cases, 90) or • Older people who did not code for the known proteins were assembled and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from it was designated herein as DNA55716. • In light of a sequence homology observed between the DNA55716 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3252980, the EST clone of Incyte 3252980 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert • encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 293 and is designated herein as DNA65412-1523.

The full length clone shown in the Figure 293 contains a single reading structure Open with a translation initiation site - - apparent at positions 58-60 of the nucleotide and ending at the stop codon found at positions 511-513 of the nucleotide (Figure 293; SEQ ID NO: 411). The predicted polypeptide precursor • (Figure 294, SEQ ID NO: 412) is 151 amino acids in length. The signal peptide sequence is at approximately amino acids 1-22 of SEC. ID NO: 412. PR01195 has a calculated molecular weight of approximately 17,277 daltons and a pl estimated approximately 5.33. The clone DNA65412- • 1523 has been deposited with the ATCC on August 4, 1998 and was assigned the no. of deposit ATCC 203094.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the • full length sequence shown in Figure 294 (SEQ ID NO: 412), reveals some identity of The sequence between the amino acid sequence of PR01195 and the following Dayhoff sequences: MMU28486_1, AF044205_1, P_W31186, CELK03C7_1, F69034, EF1A_METVA, AF024540_1, SSU90353_1, MRSP_STAAU and P R97680. 25 ^ A ^^^^^^^^^^^^^^ X ^^ j ^^^ - - EXAMPLE 133: Isolation of the cDNA Clones Encoding the Human PRO1270 Using the algorithm of the signal sequence described in Example 3 above allowed the • identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not encode the known proteins, were piled and assembled in a sequence of consensus DNA with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA57951.

In light of a sequence homology - - observed between the consensus sequence DNA57951 and an EST sequence encompassed within the clone EST of Merck no. 124878, the EST clone of Merck 124878 was purchased and the cDNA insert was obtained and • sequencing It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 295 and is designated herein as DNA66308-1537. 10 • Clone DNA66308 - 1537 contains a single open reading frame with an initiation site apparent translational nucleotide positions 103-105 and ending at the stop codon arrest at positions 1042-1044 of the nucleotide (Figure 295). The predicted polypeptide precursor is 313 amino acids in length (Figure 296). The • PRO1270 full-length protein shown in Figure 296 has an estimated molecular weight of about 34,978 daltons and a pl of about 5.71. The sequence analysis of the full-length PRO1270 shown in Figure 296 (SEQ ID NO: 414) evidences the presence of the following: a signal peptide of approximately from amino acid 1 to - »---. . ...... .. -. "_. j.- '... , _ .. . ~ $ Jñ¿fáj¡fc_ HMilttlUiíta - - about amino acid 16, a site of potential N gl icosilación approximated from amino acid 163 to about amino acid 166 and the binding sites 9 glycosaminoglycan approximately from amino acid 74 to approximately amino acid 77 and approximately from amino acid 289 to approximately amino acid 292. Clone DNA66308-1537 has been deposited with the ATCC on 1998 and assigned the no. . deposit An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis of sequence alignment WU-BLAST-2 of the full length sequence shown in Figure 296 (SEQ ID NO: 414), highlights the • Significant homology between the amino acid sequence of PRO1270 and the following sequences Dayhoff: XLU86699_1, S49589, FIBA_PARPA, FIBB_HUMAN, P_R47189, AF004326_1, DRTENASCN_1, AF004327_1, P W01411 and FIBG BOVIN. ^^ 4 ^^^ ¿¿¿¿¿¿¿¿¿¿^? ^ ^ Fc ^^^ ¿^ ^? - - EXAMPLE 134: Isolation of the cDNA Clones Encoding the Human PRQ1271 The use of the algorithm of the signal sequence described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (by example, Genbank) and an EST DNA database • Particular (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods m Enzymology 266: 460-480 (nineteen ninety six) ) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or • older people who did not code for the known proteins were piled and assembled in a sequence of consensus DNA with the "phrap" program (Phil Green, Umversity of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA57955.

In light of a sequence homology & ~ -d ---- Ba. - - observed between the consensus sequence DNA57955 and an EST sequence encompassed within the clone EST of Merck no. AA625350, the Merck AA clone AA625350 was purchased and the cDNA insert was obtained and • sequenced It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 297 and is designated herein as DNA66309-1538. 10 • Clone DNA66309-1538 contains a single open reading structure with an apparent translation initiation site at positions 94-96 of the nucleotide and ends at the codon of arrest at positions 718-720 of the nucleotide (Figure 297). The predicted polypeptide precursor is 208 amino acids in length (Figure 298). The • full-length PR01271 protein shown in Figure 298 has an estimated molecular weight of about 21,531 daltons and a pl of about 8.99. Sequence analysis of the full-length PR01271 shown in Figure 298 (SEQ ID NO: 416) evidences the presence of the following: a signal peptide of approximately from amino acid 1 to - - approximately amino acid 31 and a transmembrane domain approximately from amino acid 166 to approximately amino acid 187. Clone DNA66309-1538 has been deposited with • the ATCC on September 15, 1998 and the no. of deposit ATCC 203235.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis of sequence alignment WU-BLAST-2 of the full-length sequence shown in Figure 298 (SEQ ID NO: 416), evidences the significant homology between the amino acid sequence of PR01271 and the following sequences Dayhoff: S57180, S63257, AGA1_YEAST, BPU43599_1, YS8A_CAEEL, S67570, LSU54556_2, S70305, VGLX_HSVEB, and D88733 1.

EXAMPLE 135: Isolation of the cDNA Clones that Encode the Human PR01375 A Merck / Wash database was searched. U and an east of Merck was identified. This sequence was then placed in a program that aligns it with other sequences of the public base Swiss-Prot, the public EST databases (eg, - - GenBank / Wash. U.), and a particular database (eg LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the BLAST Ó BLAST-2 computer program [Altschul et al. • al., Methods in Enzymology 266: 460-480 (1996)] as a comparison of the sequences of the extracellular domain protein (ECD) with a translation of the structure 6 of the EST sequences. Those comparisons result in a Blast record out of 70 (or in some cases, 90) or older than not • They encoded the known proteins, were stacked and assembled in a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). A consensus DNA sequence was assembled in relation to other EST sequences using phrap.

• This consensus sequence is designated herein as "DNA67003". Based on the DNA67003 consensus sequence, the nucleic acid (SEQ ID NO: 417) was identified in a library of the human pancreas. DNA sequencing of the clone gave the length DNA sequence complete for PR01375 and the sequence of the - - derived protein for PR01375 The complete nucleotide sequence of PR01375 is shown in Figure 299 (SEQ ID NO: 5 417). Clone DNA67004-1614 contains a single open reading frame with an apparent translation initiation site at positions 104-106 of the nucleotide and an apparent stop codon at positions 698-700 of the nucleotide of the SEC. ID NO: 417. The precursor of the polypeptide • predicted is 198 amino acids in length. The transmembrane domains are at approximately amino acids 11-28 (type II) and 103-125 of SEC. ID NO: 418. The clone DN A 67004 - 1614 has been deposited with the ATCC and the no. ATCC deposit 203115. The full-length PR01375 protein shown in Figure 300 has a • estimated molecular weight of approximately 22,531 daltons and a pl of approximately 8.47. 20 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in the Figure 300 (SEQ ID NO: 418), revealed the identity of ^^ j ^^^^^^ a - - sequence between the amino acid sequence of PR01375 and the following Dayhoff sequences: AF026198_5, CELR12C12_5, S73465, Y011_MYCPN, S64538 1, P P8150, MUVSHPO10 1, VSH MUMPL and W CVU59751 5 EXAMPLE 136: Isolation of cDNA Clones Encoding Human PR01385 Using the Signal Sequence Algorithm described in Example 3 above allowed the • identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (eg, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (nineteen ninety six)) . Those comparisons result in a Blast record of 70 (or in some cases, 90) or greater that did not code for known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA57952. • In light of a sequence homology observed between the consensus sequence DNA57952 and an EST sequence encompassed within the EST clone of Incyte no. 3129630, the EST clone of Incyte 3129630 and the cDNA insert was obtained and • sequenced It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 301 and is designated herein as DNA68869-1610.

Clone DNA68869-1610 contains a single open reading structure with an apparent translation initiation site in the positions 26-28 of the nucleotide and ends at the stop codon at positions 410-412 of the nucleotide (Figure 301). The predicted polypeptide precursor is 128 amino acids in length (Figure 302). The full length PR01385 protein shown in Figure 302 has an estimated molecular weight of - - about 13,663 daltons and a pl of about 10.97. The sequence analysis of the full-length PR01385 shown in Figure 302 (SEQ ID NO: 420) evidences the presence of the following: a signal peptide roughly from amino acid 1 to approximately amino acid 28, and the glycosyl and laminoglycan binding sites roughly from amino acid 82 to about amino acid 85 and approximately from the • amino acid 91 to approximately amino acid 94. DNA clone 68869 - 1610 has been deposited with the ATCC on August 25, 1998 and assigned no. of deposit ATCC 203164. 15 An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the analysis • of sequence alignment WU-BLAST-2 of the full-length sequence shown in the Figure 302 (SEQ ID NO: 420), evidences the lower homology between the amino acid sequence of PR01385 and the following Dayhoff sequences: CELT14A8_1, LMNACHRA1_1, HXD9_HUMAN, CHKCMLF_1, HS5PP34_2, DMDRING_1, A37107_l, MMLUNGENE_1, PUM DROME and DMU25117 1.

- - EXAMPLE 137: Isolation of cDNA Clones Encoding Human PR01387 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST group sequence from the Incyte database. This sequence of the EST group was then compared to a variety of expressed sequence mark (EST) databases that include public EST databases (for • example, Genbank) and a particular EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the BLAST or BLAST2 computer program (Altschul, Methods in Enzymology 266: 460-480 (1996)). Those comparisons result • a Blast record of "O (c in some cases, 90) or greater that did not code for known proteins, were stacked and assembled into a consensus DNA sequence with the "phrap" program (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was designated herein as DNA56259. 25 - - In light of a sequence homology observed between the DNA56259 consensus sequence and an EST sequence encompassed within the EST clone of Incyte no. 3507924, EST clone of 5 Incyte 3507924 was purchased and the cDNA insert was obtained and sequenced. It was found that this insert encodes a full-length protein. The sequence of this cDNA insert is shown in Figure 301 and is designated herein as DNA68872-1620. • Clone DNA68872-1620 contains a single open reading frame with an apparent translation initiation site at positions 15-85-87 of the nucleotide and terminates at the stop codon at positions 1267-1269 of the nucleotide (Figure 303). The predicted polypeptide precursor is 394 amino acids in length (Figure 304). The full-length PR01387 protein shown in Figure 302 has an estimated molecular weight of about 44,339 daltons and a pl of about 7.10. The analysis of the sequence of the full-length PR01387 shown in Figure 304 (SEQ ID NO: 422) reveals the The presence of the following: a signal peptide of j ^^^^ j ^^ gg ^ j |! ^ | ^ g ^ g ^^^^^^ V ^ * a ^^^ ü - - approximate way from amino acid 1 to approximately amino acid 19, a domain of transmembrane approximately from amino acid 275 to approximately amino acid 296, the potential N-glycosylation sites approximately from amino acid 76 to approximately amino acid 79, approximately from amino acid 231 to approximately amino acid 234, thus approximate from amino acid 302 to approximately amino acid 305, approximately from amino acid 307 to approximately amino acid 310 and approximately from amino acid 376 to approximately amino acid 379, and blocks of amino acid sequences having homology to the myelin protein P0 approximately from • amino acid 210 to approximately amino acid 239 and approximately from amino acid 92 to approximately Amino Acid 121. The clone DNA 68872 - 1620 has been deposited with the ATCC on August 25, 1998 and was assigned the no. of deposit ATCC 203160.

An analysis of the Dayhoff database ^^^ U £ ÜMI £ M «É - (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 304 (SEQ ID NO: 422), reveals the homology between the amino acid sequence of PR01387 and the following Dayhoff sequences: P_W36955, MYP0_HETFR, HS46KDA_1, AF049498_1, MYO0_HUMAN, AF030454_1, A53268, SHPTCRA_1, P_W14146 and GEN12838. 10 • EXAMPLE 138: Isolation of cDNA Clones Encoding Human PR01384 A consensus DNA sequence was assembled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated herein as DNA54192. Based on the consensus sequence • DNA54192, Ig oligonucleotides were synthesized 1) to identify a cDNA library by PCR containing the sequence of interest, and 2) to be used as probes to isolate a full-length coding sequence clone for PR01384.

PCR primers (forward - - and reverse) were synthesized: forward 5 'PCR primer - TGCAGCCCCTGTGACACAAACTGG-3 * (SEQ ID NO: 425) reverse PCR primer - 5 5' -CTGAGATAACCGAGCCATCCTCCCAC-3 '(SEQ ID NO: 426) In addition, a synthetic hybridization probe of the oligonucleotide was constructed from the consensus DNA54192 sequence having the following nucleotide sequence: hybridization probe: 5'-GGAGATAGCTGCTATGGGTTCTTCAGGCACAACTTAACATGGGAAG-3 '(SEQ ID NO: 42 ) To select several libraries from a source of a full-length clone, the DNA of the libraries was selected by PCR amplification with the PCR primers identified above. A positive library was used in onces to isolate the clones encoding the PR054192 gene using the probe oligonucleotide and one of the PCR primers. RNA was isolated for the construction of cDNA libraries from human fetal liver.

The DNA sequencing of the clones - - isolated as described above gave the full length DNA sequence for PR01384 (designated herein as DNA71159-1617 [Figure 305, SEQ ID NO: 423]); and the sequence of • derived protein for PR01384.

The complete nucleotide sequence of PR01384 is shown in Figure 305 (SEQ ID NO: 423). The clone DNA71159-1617 contains only one open reading structure with a site of • initiation of apparent translation at positions 182-184 of the nucleotide and an apparent stop codon at positions 869-871 of the nucleotide. The predicted polypeptide precursor is 229 amino acids in length. The full-length PR01384 protein shown in Figure 306 has an estimated molecular weight of approximately 26,650 • daltons and a pl of about 8.76. Additional features include a domain of type II transmembrane at approximately amino acids 32-57; and potential N-glycosylation sites at approximately amino acids 68-71, 120-123, and 134-137.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the sequence alignment analysis WU-BLAST-2 of the full-length sequence shown in Figure 306 (SEQ ID NO: 424), revealed the homology between the amino acid sequence of PR01384 and the following Dayhoff sequences: AF054819_1, HSAJ1687_1, AF009511_1, AB010710_1, GEN13595, HSAJ673_1, GEN13961, AB005900_1, LECH_CHICK, AF021349_1, and NK13_RAT. 10 • Clone DNA71159-1617 has been deposited with the ATCC and the no. of deposit of ATCC 203135.

EXAMPLE 139: Using the PRO as a Hybridization Probe The following method describes the use of a • nucleotide sequence that encodes a PRO as a h ige di i c it ion probe. The DNA comprising the coding sequence of a mature or full length PRO as described herein can be used as a probe that selects the homologous DNAs. (such as those encoding naturally occurring variants encoding the PRO) in human tissue cDNA libraries or in human tissue genomic libraries.

• Hybridization and washing of the filters that contain either the DNA of the library, are carried out under the following highly severe conditions. The hybridization of the probe derived from the PRO radiolabelled to the filters was performed in a 50% formamide solution, 5x SSC, 0.1% SDS, • 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, Denhardt 2x solution, and 10% dextran sulfate at 42 ° C for 20 hours. The washing of the filters was carried out in an aqueous solution of SSC O.lx and 0.1% SDS at 42 ° C.

The DNAs that had a sequence identity • desired with the DNA encoding the native sequence PRO, full length can be identified then using standard techniques known in the art EXAMPLE 140: Expression of the PRO in E. This example illustrates the preparation of a non-glycosylated form of a PRO by the recombinant-expression in E. col i The DNA sequence encoding the PRO is initially amplified using the PCR primers F 5 selected. The primers should contain the restriction enzyme sites corresponding to the restriction enzyme sites in the selected expression vector. A variety of expression vectors can be employed. An example of a The suitable vector is pBR322 (derived from E. Co l i; F ve r Bolívar et al., Gene, 2_: 95 (1977)) which contains the genes for resistance to ampicillin and tetracycline. The vector is digested with the restriction enzyme and dephosphorylated. The sequences PCR amplified are then ligated into the vector. The vector preferably will include sequences coding for a resistance gene to the F antibiotic, a trp promoter, a polyhis leader (which includes the first six STII codons, the sequence polyhis, and the cleavage site of the entrokinase), the specific PRO coding region, the lambda transcriptional terminator, and an argU gene.

The ligation mixture is then used to transform a strain of £. c or l i selected MMM-Í-a-i-M-h-t- «á • i-i-i-i-MÉ-Hi-Mki. - - using the methods described in Sambrook et al., supra. Transformants are identified by their ability to grow on LB plates and antibiotic-resistant colonies are thus selected. The plasmid DNA 5 can be isolated and confirmed by restriction analysis and DNA sequencing.

The selected clones can be grown overnight in a culture medium Liquid such as LB broth supplemented with • antibiotics. The culture can be used subsequently throughout the night to inoculate a large-scale culture. The cells are then grown to a desired optical density, during which the expression promoter is activated.

After culturing the cells during • several more hours, the cells can be harvested by centrifugation. Cell pellets obtained by centrifugation can be solubilized using various agents known in the art, and the solubilized PRO protein can then be purified using a metal chelating column under conditions that allow a binding out of the protein.

- - The PRO can be expressed in E. co l i in a poly-His tagged form, using the following procedure. The DNA that codes to the PRO • was initially amplified using the selected PCR primers. The primers will contain the restriction enzyme sites corresponding to the restriction enzyme sites in the selected expression vector, and other useful sequences that provide a translation initiation • Reliable and efficient, rapid purification in a metal chelating column, and proteolytic elimination with ent e roan. Poly-His-tagged sequences, amplified with PCR then ligated into an expression vector, which is used to transform an E host. co l i based on strain 52 (W3110 fuhA (tonA) Ion galE rpoHts (htpRts) clpP (lacIq) The transformants were first grown in LB containing 50 mg / mL of carbenicillin at 30 ° C with shaking until an optical density was reached or O. D.600 of 3-5. The cultures were then diluted 50 to 100 times in a CRAP medium (prepared by mixing 3.57 g of (NH4) S? 4, 0.71 g of sodium citrate-2H20, 1.07 g of KCl, 5.36 g of Difco yeast extract, 5.36 g of SF hycase from Sheffield in 500 mL of water, as well as 110 mM MPOS, pH 7.3, 0.55% glucose (w / v) and MgS? 4 7 mM) and grown for about 20-30 hours at 30 ° C with shaking. HE • the samples were removed to verify expression by SDS-PAGE analysis, and the bulk culture centrifuged to pellet cells. The cell pellets were frozen until purification and refolded. 10 • E paste resuspended. co l i from fermentations of 0.5 to 1 L (pellets of 6-10 g) in 10 volumes (w / v) in guanidine 7 M, Tris 20 m, buffer of pH 8. Sodium sulfite added solid and tetrathionate sodium to make the final concentrations of 0.1 M and 0.02 M, respectively, and the solution stirred throughout • the night at 4 ° C. This step results in a denatured protein with all the residues of cysteine blocked by sulpholysis. The solution centrifuged at 40,000 rpm in a Beckman Ultracentrifuge for 30 minutes. The supernatant diluted with 3-5 volumes of the metal quenching column buffer (guanidm 6 M, Tris 20 mM, pH 7.4) and filtered through - 0.22 micron filters for clarification. The clarified extract loaded onto a Qiagen Ni-NTA metal chelating column of 5 ml, equilibrated in the buffer of the metal chelate column. The column ed with an additional buffer solution containing 50 mM imidazole (Ca lbiochem, Utrol grade), pH 7.4. The protein eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. The protein concentration estimated by its absorbance at 280 nm using the extinction coefficient calculated on the basis of its amino acid sequence. The proteins were refolded by slow dilution of a sample in a freshly prepared refolding or redouble buffer solution, which consisted of: 20 mM Tris, pH 8.6, 0.3 M NaCl, 20 2.5 M urea, 5 mM cysteine, 20 mM glycine and EDTA 1 mM. The refolding volumes were chosen so that the final concentration of the protein between 50 to 100 micrograms / ml. The refolding solution gently stirred at 4 ° C for 12-36 hours. The refolding reaction cooled ^ i ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^ - - quickly by adding TFA to a final concentration of 0.4% (pH of about 3). Before further purification of the protein, the solution filtered through a 0.22 micron filter and acetonitrile added to a final concentration of 2-10%. The refolding protein subjected to chromatography on a Poros Rl / H reversed phase column using a mobile buffer of 0.1% TFA with elution with a acetonitrile gradient from 10 to 80%. The • Aliquots of the fractions with an absorbance of A280 were analyzed in the SDS polyacrylamide gels and the fractions containing the homogeneous refolded protein were pooled. In general, appropriately redoubled species of most proteins were eluted at the lowest concentrations of acetomtril since those species are the most compact with their hydrophobic interiors coated from the interaction with the reverse phase resin. The species that formed aggregates usually elute at higher acetonitrile concentrations. In addition to solving the erroneously redoubled forms of the proteins from the desired form, the stage of the reverse phase also eliminates endotoxin from samples. | f) j¡¡ (j ^ I- ^ I- £ ^^^^ ¡gg¡ £ j £ 5JJ2SS -? - a? a? £ ^^ - - Fractions containing the desired folded PRO PRO polypeptide were conjugated and the acetonitrile removed using a current? • Soft nitrogen directed to the solution. The proteins were formulated in 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or by gel filtration using GF Superfine resins (Pharmacia) equilibrated in the formulation buffer and were sterile filtered.

Many of these PRO polypeptides described herein were successfully expressed as described above.

EXAMPLE 141: Expression of PRO in Mammalian Cells This example illustrates the preparation of a potentially glycosylated form of PRO by recombinant expression in mammalian cells.

The vector, pRK5 (see EP 307,247, published on March 15, 1989), was used as the vector of expression. Optionally, the DNA that codes to the PRO ^^ ^ -É-MüM-y. - - was ligated into pRK5 with the selected restriction enzymes to allow insertion of PRO DNA using ligation methods such as those described in Sambrook et al., supra. The resulting vector was called pRK5-PR0.

In one embodiment, the selected host cells can be 293 cells. Human 293 cells (ATCC CCL 1573) were grown to confluence in tissue culture plates in a medium such as DMEM supplemented with fetal calf serum and optionally, with the components of nutrients and / or antibiotics. About 10 μg of pRK5-PR0 DNA was mixed with about 1 μg of the DNA encoding the VA RNA gene [Thimmappaya et al., Cell, 3: 1: 543 (1982)] and dissolved in 500 μl of Tris-HCl 1 mM, 0.1 mM EDTA, 0.227 M CaCl2. To this mixture was added, drop by drop, 500 μL of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaP04, and a precipitate was allowed to form for 10 minutes at 25 ° C. The precipitate was suspended and added to the 293 cells and allowed to settle for approximately four hours at 37 ° C. The culture medium was aspirated and 2 mL of 20% glycerol in 20% PBS was added for 30-1-seconds. The 293 cells were then washed with a serum-free medium, fresh medium was added and the cells were incubated for approximately 5 days.

Approximately 24 hours after the transferences, the culture medium was removed and replaced with culture medium (alone) or with a culture medium containing 200 μCi / mL of 35S-cysteine and 200 μCi / mL of j's- methionine After 12 hours of incubation, the conditioned medium was collected, concentrated on a rotary filter, and loaded on 15% SDS gel. The processed gel can be dried and exposed to a film for a selected period of time to reveal the presence of the PRO polypeptide. Cultures containing transfected cells may undergo further incubation (in a serum-free medium) and the medium was tested in selected bioassays.

In an alternative technique, the PRO can be introduced into the 293 cells transiently using the dextran sulfate method described by Somparyrac et al., Proc. Nati Acad. Sci., 12: 7575 (1981). The 293 cells are grown to a maximum density in a spinner flask and 700 μg of pRK5-PRO DNA are added. The cells are first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate was incubated in cell pellets for four hours. The cells are then treated with 20% glycerol for 90 seconds, washed with a tissue culture medium, and 5 μg / ml bovine insulin is re-introduced into the spinner flask containing the tissue culture medium. and 0.1 μg / ml of bovine transferrin. After about four days, the conditioned medium is centrifuged and filtered to remove the cells and debris. The sample containing the expressed PRO can then be concentrated and purified by any selected method, such as dialysis and / or column chromatography.

In another embodiment, the PRO can be expressed in CHO cells. PRK5-PRO can be transfected into CHO cells using known reagents such as CaPÜ4 or DEAE-dextran. As described above, the cell cultures can be incubated, and the medium is replaced with the medium ** culture (alone) or the medium containing a radiolabel such as 35S-met ionin. After determining the presence of the PRO polypeptide, the culture medium can be replaced with a serum free medium. Preferably, the cultures are incubated for about 6 days, and then the conditioned medium is harvested. The medium containing the expressed PRO can then be concentrated and purified by any method being read.

The PRO marked with the epitope can also be expressed in host CHO cells or hosts. The PRO can be subcloned from the vector pRK5. The subclone insert can be subjected to PCR to be fused in a structure with a selected epitope tag such as a poly-his tag in a Baculovirus expression vector. The PRO insert labeled with poly-his can then be subcloned into an SV40 drive vector containing a selection marker such as DHFR for the selection of stable clones. Finally, the CHO cells can be transfected (as described above) with the SV40 drive vector. Labeling can be done, as described * fa- previously, to verify the expression. The culture medium containing the expressed poly-His-labeled PRO can then be concentrated by any selected method, such as by affinity chromatography of the Ni-chelate.

PRO can also be expressed in CHO and / or COS cells by the transient expression procedure or in CHO cells, or by another stable expression method.

Stable expression in CHO cells was performed using the following procedure. The proteins are expressed as an IgG construct (immunoadhes ina), in which the coding sequences for the soluble forms (e.g., extracellular domains) of the respective proteins are fused to an IgG1 constant region sequence containing the hinged portion, the CH2 and the CH2 domains and / or is a form labeled with pol i-Hi s.

After amplification with PCR, the respective DNAs were subcloned into a CHO expression vector using standard techniques such as - - described in Ausubel et al., Current Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression vectors were constructed to have compatible restriction sites 5 'and 3' of the DNA of interest to allow convenient transport of the cDNAs. The expression used of the vector in CHO cells is as described in Lucas et al., Nucí. Acids Res. 24: 9 1774-1779 (1996), and uses the SV40 early promoter / enhancer to drive the expression of the cDNA of interest and the dihydro-folate reductase (DHFR). The expression of DHFR allows selection for stable maintenance of the plasmid after transfection.

Twelve micrograms of the desired plasmid DNA were introduced into approximately 10 million CHO cells using the commercially available transfection reagents Superfect® (Quiagen), Dosper or Fugene (Boehringer Mannheim). The cells were grown and described in Lucas et al., Supra. Approximately 3 x 10"7 cells were frozen in an ampule for further growth and production as described below ^ s ^^ mm tm The ampoules containing the plasmid DNA were sealed by placing them in a water bath and mixed by a vortex motion. The contents were placed through a pipette in a centrifuge tube containing 10 mLs of the medium and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated and the cells were resuspended in 10 mL of the selective medium (0.2 μm of filtered PS20 with 0.2 μm of 5% diafiltered fetal bovine serum). The cells were then taken in aliquots in a 100 mL centrifuge device containing 90 mL of the selective medium. After 1-2 days, the cells were transferred to a 250 mL flask filled with 150 mL selective growth medium and incubated at 37 ° C. After another 2-3 days, the 250 L, 500 mL and 2000 mL flasks were seeded with 3 x 103 cells / mL. The cell medium was exchanged with a fresh medium by centrifugation and resuspension in the production medium. Although any suitable CHO medium can be employed, a production medium described in US Patent No. 5,122,469, issued June 16, 1992, was actually used. The 3L production flask was seeded riHttaU¡ÉiAi? iH £ -Htt - ^ - HÍl¡a- & ttM¡-í-f - a ^ - ^ - ^ with 1.2 x 106 cells / mL. On day 0, the pH number of the cells was determined. On day 1, samples were obtained from the flask and spraying with filtered air was started. On day 2, samples were obtained from the flask, the temperature was changed to 33 ° C, and 30 mL of 500 g / L of glucose and 0.6 mL of 10% antifoam were added (for example, a poly id emulsion). 1 if loxane to 35%, Emulsion of Medical Grade 365 of Dow Corning). Throughout the production, the pH was adjusted as necessary to stay at around 7.2. After 10 days, or until the viability was decreased below 70%, the cell culture was harvested by centrifugation and filtered through a 0.22 μm filter. The filtrate was either stored at 4 ° C or immediately loaded onto columns for purification.

For the poly-His tagged constructs, the proteins were purified using a Ni-NTA column (Qiagen). Prior to purification, the imidazole was added to the conditioned medium to a concentration of 5 mM. The conditioned medium was pumped to a 6 mL Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml / min. at 4 ° C. After loading, the column was washed with an additional equilibration buffer and the protein eluted with an equilibrium buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted in a storage buffer containing 10 mM Hepes, NaCl 0.14 M and 4% mannitol, pH 6.8, with a G25 Superfine column (Pharmacia) and stored at -80 ° C.

The immunoadhesive constructs (containing Fc) were purified from the conditioned medium as follows. The conditioned medium was pumped into a 5 mL Protein A column (Pharmacia) which was equilibrated in 20 mM α-phosphate buffer, pH 6.8. After loading, the column was washed extensively with an equilibrium buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting fractions of 1 mL in tubes containing 275 μL of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalinated in storage buffer as described above for proteins ..:. *. • ', m marked poly-His. The homogeneity was assessed by polyacrylamide 1 SDS gels and by sequencing the N-terminal amino acids by Edman degradation.

EXAMPLE 142: Expression of PRO in Yeast The following method describes the recombinant expression of a PRO in yeast.

First, yeast expression vectors are constructed for intracellular production or secretion of the PRO from the promoter ADH2 / GAPDH. DNA encoding a PRO and a promoter are inserted into the appropriate restriction enzyme sites in the selected plasmid to direct intracellular PRO expression. For secretion, the DNA encoding the PRO can be cloned to the selected plasmid, along with the DNA encoding the ADH2 / GAPDH promoter, a signal peptide from the native PRO or other mammalian signal peptide, or for example, a factor Alpha of the - - yeast or a signal sequence / secretory leader of the invertase, and the linker sequences (if needed) for the expression of the PRO.

Yeast cells such as yeast strain AB110 can then be transformed with the expression plasmids described above and cultured in the selected fermentation medium. Transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gels with Coomassie Blue staining.

Recombinant PRO can be subsequently isolated and purified by removing yeast cells from the fermentation medium by centrifugation and then concentrating the medium using the selected cartridge filters. The concentrate containing the PRO can be further purified using the selected column chromatography resins.

Many of these PRO polypeptides described herein were successfully expressed as - - described earlier.

EXAMPLE 143: Expression of PRO in Insect Cells Infected with Baculovirus The following method describes the recombinant expression of PRO in insect cells infected with Baculovirus.

The coding sequence for the PRO is fused in the 5 'direction of an epitope tag contained within a baculovirus expression vector. Such epitope tags include the poly-his tags and the immunoglobulin tags (like the Fc regions of IgG). A variety of plasmids are used, which include plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, the sequence encoding the PRO or the desired portion of the PRO coding sequence such as the sequence encoding the extracellular domain of a transmembrane protein or the sequence encoding the mature protein if the protein is extracellular is amplified by PCR with the primers complementary to the 5 'and 3' regions. The 5 'primer can incorporate flanking (selected) restriction enzyme sites. The product is then digested with those selected restriction enzymes and subcloned into the express vector.

The recombinant baculovirus is generated by the co-transfusion of the above plasmid and BaculoGold ™ virus DNA (Pharmingen) in Spodop te ra fu gipeda ("Sf9") cells (ATCC CRL 1711) using lipofectin (available commercially from GIBCO-BRL). After 4-5 days of incubation at 28 ° C, the released viruses are harvested and used for subsequent amplifications. Viral infection and protein expression are performed as described by O'Reilley et al., Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford University Press (1994).

The poly-his-labeled PRO can then be purified, for example, by affinity chromatography of Ni + -kelate as follows. Extracts are prepared from Sf9 cells infected with the recombinant virus as described by Rupert et al., Nature, 362: 175-179 aüÉHM-a-MI-ii * ^^^^; - - (1993). Briefly, the Sf9 cells are washed, resuspended in sonication buffer (25 mL of Hepes, pH 7.9, 12.5 mM MgCl2, 0.1 mM EDTA; 9 glycerol 10%; NP-40 at 0.1%; 0.4 M KCl), and subjected to sound twice for 20 seconds on ice. The sonicates are clarified by centrifugation and the supernatant is diluted 50-fold in charge buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through ^ P 10 of a 0.45 μm filter. The Ni + -NTA agarose column (commercially available from Qiagen) is prepared with a bed volume of 5 mL, washed with 25 mL of water and equilibrated with 25 mL of charge buffer. The extract of the cells, filtering is loaded in the column at 0.5 mL per minute. The column is washed to a base line A280 with charge buffer, at which point the collection of the fraction begins. Next, the column is washed with a secondary wash buffer (50 mM phosphate, mM NaCl, 10% glycerol, pH 6.0), which is eluted with a non-specific binding protein. After reaching the baseline A280 again, the column is developed with a gradient of Imidazole from 0 to 500 mM in the secondary wash buffer. They are collected fractions of a mL and analyzed by SDS-PAGE - and stained with silver or with Western staining with the Ni2 + -NTA conjugate up to alkaline phosphatase (Qiagen). The fractions containing the PRO labeled Hisio eluted, are combined and dialyzed again against the charge buffer.

Alternatively, purification of the IgG-labeled PRO (or Fc-labeled) can be performed using known chromatography techniques, including, for example, column chromatography of Protein A or G protein.

Many of the PRO polypeptides described herein were successfully expressed as described above.

EXAM PLO 144: Preparation of the Antibodies that Link to the PRO This example illustrates the preparation of the monoclonal antibodies that can bind specifically to a PRO.

Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding, supra. The ^ ygj ^^ g ^ gj ^^^^^ j ^^^^ @ ^^^^^^^^^^ | ^^^^^^^ Jjjg ^^ immunogens that may be employed include the purified PRO , the fusion proteins that contain the PRO, and the cells that express the recombinant PRO on the cell surface. The selection of the immunogen can be prepared by those skilled in the art without undue experimentation.

Mice, such as Balb / c, are immunized with the PRO immunogen emulsified in a complete Freund's adjuvant and injected subcutaneously or intraperitoneally with an amount of 1-100 micrograms. Alternatively, the immunogen is emulsified in an MPL-TDM adjuvant (Ribi Immunochemi ca 1 Research, Hamilton, MT) and injected into the pads of the hind legs of the animals. Immunity was allowed to grow in the mice for 10 to 12 days thereafter with the additional immunogen emulsified in the selected adjuvant. Subsequently, for several weeks, the immunity to the mice was increased with additional immunization injections. Serum samples were periodically obtained from the mice by retro-orbital bleeding for the test in the ELISA assays to detect anti-PRO antibodies After an adequate antibody titer has been detected, animals "positive" for the antibodies can be injected with a final intravenous injection of the PRO. Three to four days later, the mice were sacrificed and the spleen cells harvested. Spleen cells were then fused (using 35% polyethylene glycol) to a selected murine myeloma cell line such as P3X63AgU.l, available from ATCC, No. CRL 1597. The fusions generated hybridoma cells which can then be plated of 96-well tissue culture containing the HAT medium (hypoxant ina, aminopterin, and thymidine) to inhibit the proliferation of unfused cells, myeloma hybrids, and spleen cell hybrids.

Hybridoma cells can be selected in an ELISA assay for reactivity against the PRO. The determination of the "positive" hybridoma cells secrete the desired monoclonal antibodies against the PRO, is within the skills in the art. j ^ yg '«^ * > «. -ÉÉ-a- ..

Hybridoma positive cells can be injected intraperitoneally into syngeneic Balb / c mice to produce ascites containing the anti-PRO monoclonal antibodies. Alternatively, the hybridoma cells can be grown in tissue culture flasks or in spinner bottles. The purification of the monoclonal antibodies produced in the ascites can be complemented using ammonium sulfate precipitation, followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the binding of the antibody to protein A or protein G may be employed.

EXAMPLE 145: Purification of PRO Polypeptides Using Specific Antibodies PRO native or recombinant polypeptides can be purified by a variety of standard techniques in the art of protein purification. For example, the pro-PRO polypeptide, the mature PRO polypeptide, or the pre-PRO polypeptide are purified by immunosorbant imaging using antibodies specific for the PRO polypeptide of interest. In general, a column ^ .. ^^^^. ^ .... ^. ^ - ^. fiaafe ^ ..

- - Immunoaffinity is constructed by covalently coupling the anti-PRO polypeptide antibody to an activated chromatographic resin. • Polyclonal immunoglobulins are prepared from immune serum either by precipitation with ammonium sulfate or by purification on immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway, N.J.). Similarly, monoclonal antibodies are prepared from the mouse ascites fluid by precipitation with ammonium sulfate or chromatography on immobilized Protein A. The partially purified immunoglobulin is covalently bound to a chromatographic resin such as SEPHAROSE activated with CnBr (Pharmacia LKB Biotechnology). The antibody is attached to the resin, the resin is blocked, and the derived resin is washed according to the manufacturer's instructions.

Such an immunoaffinity column is used in the purification of the PRO polypeptide by preparing a fraction from the cells containing the PRO polypeptide in a -soluble form. This preparation is derived by the solubilization of the whole cell or a subcellular fraction obtained via differential centrifugation by the addition of detergent or by other methods well known in the art. Alternatively, the soluble PRO polypeptide containing a signal sequence can be secreted in a useful amount into the medium in which the cells are grown.

A preparation containing the soluble PRO polypeptide is passed over the immunity column, and the column is washed under conditions that allow preferential absorbance of the PRO polypeptide (eg, high ionic buffer in the presence of detergents). Then, the column is eluted under conditions that break the binding of the PRO / antibody polypeptide (e.g., a buffer with low pH such as about pH 2-3, or a high concentration of a chaotrope such as urea or thiocyanate ion) , and the PRO polypeptide is harvested. ^^ and ^^^ gg ^^ ---- ^^ - ^^^^^^^^^^^^^^ i ^ j | li? il ^ - - EXAMPLE 146: Selection of the Drug This invention is particularly useful for selecting compounds by using PRO polypeptides or binding fragments thereof in • 5 any of a variety of drug selection techniques. The PRO polypeptide or fragment employed in such a test can be either free in solution, fixed to a solid support, transported on a cell surface, or localized intracellularly.

One method of drug selection uses cells • eukaryotic or prokaryotic host which are stably transformed with recomb nant nucleic acids that express the PRO polypeptide or fragments thereof. The drugs are selected against such transformed cells in competitive binding assays. Such cells, either in a viable or fixed form, can be used for standard binding assays. One can measure, for example, the formation of complexes between the PRO polypeptide or a fragment of it and the agent to be tested. Alternatively, one can examine the decrease in complex formation between the PRO polypeptide and its target cell or the target receptors caused by the agent that is going to try. and - -, ~ * a8 &-s.

- - Thus, the present invention provides methods for selecting drugs or any other agent that can affect a condition or disorder • 5 associated with the PRO polypeptide. These methods comprise contacting said agent with a PRO polypeptide or fragment thereof and carrying out the assay (I) for the presence of a complex between the agent and the polypeptide or fragments thereof.

PRO, or (ii) for the presence of a complex between the PRO polypeptide or fragment and the cell, by methods well known in the art. In such competitive binding assays, the PRO polypeptide or fragment is typically labeled. After of the appropriate incubation, the free PRO polypeptide or fragment is separated from that which is present in linked form, and the amount of the free label or that does not form complexes is a measure of the particular agent's ability to bind to the PRO polypeptide or to interfere with PRO / cell polypeptide complexes.

Another technique for drug selection provides a high-efficiency selection for compounds that have a binding affinity A-JÜI. - suitable for a polypeptide and is described in detail in WO 84/03564, published September 13, 1984. It was briefly established, a large number of different small peptide test compounds are synthesized on a solid substrate, such as plastic tips or some other surface. As applied to a PRO polypeptide, the test compound of a peptide is reacted with the PRO polypeptide and washed. The bound PRO polypeptide is detected by methods well known in the art. The purified PRO polypeptide can also be coated directly on plates for use in the aforementioned drug selection techniques. In addition, non-neutrali antibodies can be used before to capture the peptide and immobilize it in the solid support.

This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding to the PRO polypeptide specifically compete with a test compound to bind to a PRO polypeptide or fragments thereof. In this manner, the antibodies can be used to detect the presence of any peptide that shares one or more antigenic determinants with the PRO polypeptide.

EXAMPLE 147 Rational Drug Design The objective of the rational drug design is to produce structural analogues of the biologically active polypeptide of interest (ie, a PRO polypeptide) or of small molecules with which it interacts, for example, agonists, antagonists, or inhibitors. Any of these examples can be used in the form of drugs which are more active or stable forms of the PRO polypeptide or which allow or interfere with the function of the PRO in vi vo polypeptide (eg, Hodgson, Bio / Technology, 9_: 19-21 (1991)).

In one approach, the three-dimensional structure of the PRO polypeptide, or of a PRO polypeptide inhibitor complex, is determined by X-ray crystallography, by computer modeling or, more typically, by a combination of the two methodologies. Both the shape and charges of the PRO polypeptide can be obtained to elucidate the structure and determine the ¿B- - ^ - M -.- l - ^. ^ - active sites of the molecule. Less often, useful information regarding the structure of the PRO polypeptide can be obtained by modeling based on the structure of the proteins • homologies. In both cases, the relevant structural information is used to design analogs of molecules similar to the PRO polypeptide or to identify efficient inhibitors. Using the examples of the rational design of drugs, may include molecules that have improved activity or stability as shown by Braxton and Wells, Biochemistry, 3: 7796-7801 (1992) or which act as inhibitors, agonists, or antagonists of the native peptides as shown by Athauda et al. , J. Biochem. , 113: 742-746 (1993).

It is also possible to isolate an antibody specific to the target, selected by functional assay, as described above, and then solve it in its crystalline structure. This methodology, in principle, generates a core of drug on which the subsequent design of drugs can be based. It is possible to divert the crystallography of the protein together by the generation of anti-idiotypic antibodies (anti- - ids) to a pharmacologically active, functional antibody. As a mirror image of an image in the mirror, the binding site of the anti-ids would be expected to be an analogue of the receiver • original. The anti-ids could then be used to identify and isolate peptides from chemistry or biologically produced libraries or peptides. The isolated peptides would then act as the nucleus of the drug.

By virtue of the present invention, sufficient amounts of the PRO polypeptide may be available to perform such analytical studies as X-ray crystallography. In addition, The knowledge of the amino acid sequence of the PRO polypeptide will here provide a guide for those who employ computer modeling techniques in place of or in addition to X-ray crystallography. 20 Deposit of the Material The following materials have been deposited with the American Type Culture Collection, 10801 Umversity Blvd., Manassas, VA 20110-2209, USA (ATCC): - Table 2 Material Dep. ATCC No Date of Deposit DNA16422-1209 209929 June 2, 1998 • DNA16435-1208 209930 July 2, 1998 DNA21624-1391 209917 June 2, 1998 DNA23334-1392 209918 June 2, 1998 DNA26288-1239 209792 April 21, 1998 DNA26843-1389 203099 August 4, 1998 DNA26844-1394 209926 June 2, 1998 • DNA30862-1396 209920 July 2, 1998 DNA35680-1212 209790 April 21, 1998 DNA40621-1440 209922 2 Jumo 1998 DNA44161-1434 209907 May 27, 1998 DNA44694-1500 203114 August 11, 1998 DNA 5495-1550 203156 August 25, 1998 DNA47361-1154 209431 November 7, 1997 DNA47394-1572 203109 August 11, 1998 DNA48320-1433 209904 May 27, 1998 DNA48334-1435 209924 June 2, 1998 DNA48606-1479 203040 July 1, 1998 DNA49141-1431 203003 June 23, 1998 DNA49142-1430 203002 23 June 1998 DNA49143-1429 203013 June 23, 1998 DNA49647-1398 209919 June 2, 1998 - - DNA49819-1439 209931 June 2, 1998 DNA49820-1427 209932 June 2, 1998 DNA49821-1562 209981 June 16, 1998 1998 DNA52192-1369 203042 July 1, 1998 • DNA52598-1518 203107 August 11, 199! DNA53913-1490 203162 August 25, 1991 DNA53978-1443 209983 June 16, 1998 DNA53996-1442 209921 June 2, 1998 DNA56041-1416 203012 June 23, 1998 DNA56047-1456 209948 June 9, 1998 • DNA56050-1455 203011 June 23, 1998 DNA56110-1437 203113 August 11, 199. DNA56113-1378 203049 July 1, 1998 DNA56410-1414 209923 June 2, 1998 DNA56436-1448 209902 May 27, 1998 DNA56855-1447 203004 June 23, 1998 1998 DNA56859-1445 203019 June 23, 1998 DNA56860-1510 209952 June 9, 1998 DNA56865-1491 203022 June 23, 1998 DNA56866-1342 203023 June 23, 1998 DNA56868-1478 203024 June 23, 1998 DNA56869-1545 203161 August 25, 1998 DNA56870-1492 209925 June 2, 1998 DNA57033-1403 209905 May 27, 1998 DNA57037-1444 209903 May 27, 1998 .-j £ ifi-¿i - - DNA57129-1413 209977 June 16, 1998 DNA57690-1374 209950 June 9, 1998 DNA57693-1424 203008 June 23, 1998 DNA57694-1341 203017 July 23, 1998 DNA57695-1340 203006 June 23, 1998 DNA57699-1412 203020 June 23, 1998 DNA57702-1476 209951 June 9, 1998 DNA57704-1452 209953 June 9, 1998 DNA57708-1411 203021 June 23, 1998 DNA57710-1451 203048 July 1, 1998 DNA57711-1501 203047 July 1, 1998 DNA57827-1493 203045 July 1, 1998 DNA57834-1339 209954 June 9, 1998 DNA57836-1338 203025 July 23, 1998 DNA57838-1337 203014 June 23, 1998 DNA57844-1410 203010 June 23, 1998 DNA58721-1475 203110 August 2, 1998 DNA58723-1588 203133 August 18, 1998 DNA58737-1473 203136 August 18, 1998 DNA58743-1609 203154 August 25, 1998 DNA58846-1409 209957 July 9, 1998 DNA58848-1472 209955 July 9, 1998 DNA58849-1494 209958 June 9, 1998 DNA58850-1495 209956 June 9, 1998 DNA58853-1423 203016 July 23, 199! DNA58855-1422 203018 June 23, 1998 DNA59205-1421 203009 June 23, 1998 DNA59211-1450 209960 June 9, 1998 DNA59213-1487 209959 June 9, 1998 • DNA59214-1449 203046 July 1, 1998 DNA59215-1425 209961 June 9, 1998 DNA59220-1514 209962 June 9, 1998 DNA59488-1603 203157 August 25, 1998 DNA59493-1420 203050 July 1, 1998 DNA59497-1496 209941 June 4, 1998 DNA59588-1571 203106 August 2, 1998 DNA59603-1419 209944 June 9, 1998 DNA59605-1418 203005 23 June 1998 DNA59606-1471 209945 June 9, 1998 DNA59607-1497 209946 June 9, 1998 DNA59609-1470 209963 June 9, 1998 DNA59610-1556 209990 June 16, 1998 DNA59612-1466 209947 June 9, 1998 DNA59613 -1417 203007 June 23, 1998 DNA59616-1465 209991 June 16, 1998 DNA59619-1464 203041 July 1, 1998 DNA59620-1463 209989 June 16, 1998 DNA59625-1498 209992 June 17, 1998 DNA59767-1489 203108 II August 1998 DNA59776-1600 203128 August 18, 1998 Hey? - - DNA59777-1480 203111 August 11, 1998 DNA59820-1549 203129 August 18, 1998 DNA59827-1426 203089 August 4, 1998 DNA59828-1608 203158 August 25, 1998 • DNA59838-1462 209976 June 16, 1998 DNA59839 -1461 209988 June 16, 1998 DNA59841-1460 203044 July 1, 1998 DNA59842-1502 209982 June 16, 1998 DNA59846-1503 209978 June 16, 1998 DNA59847-1511 203098 August 4, 1998 • DNA59848-1512 203088 4 August 1998 DNA59849-1504 209986 June 16, 1998 DNA59853-1505 209985 June 16, 1998 DNA59854-1459 209974 June 16, 1998 DNA60283-1484 203043 July 1, 1998 DNA60615-1483 209980 June 16, 1998 DNA60619 -1482 209993 June 16, 1998 DNA60621-1516 203091 August 4, 1998 DNA60622-1525 203090 August 4, 1998 DNA60625-1507 209975 June 16, 1998 DNA60627-1508 203092 August 4, 1998 DNA60629-1481 209979 16 of June 1998 DNA61755-1554 203112 August 2, 1998 DNA61873-1574 203132 August 18, 1998 DNA62814-1521 203093 August 4, 1998 -? - .. ^ .-., ._ ... .... .. ^ ^ *? A ^ ifá.

DNA62872-1509 203100 August 4, 1998 DNA62876-1517 203095 August 4, 1998 DNA62881-1515 203096 August 4, 1998 DNA64852-1589 203127 August 18, 1998 • DNA64884-1527 203155 August 25, 1998 DNA64890-1612 203131 August 18, 1998 DNA65412-1523 203094 August 4, 1998 DNA66308-1537 203159 August 25, 1998 DNA66309-1538 203235 September 15, 1998 • DNA67004-1614 203115 August 11, 1998 DNA68869-1610 203164 August 25, 1998 1998 DNA68872-1620 203160 August 25, 1998 DNA71159-1617 203135 August 18, 1998 These deposits were made under the conditions of the Budapest Treaty in the International Recognition of the Deposit of Microorganisms with the Purpose of the Patent Procedure and the Regulations in relation to it (Budapest Treaty). This ensures the maintenance of a viable culture of the deposit for 30 years 10 from the date of deposit. The deposits will be available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, -% - - Inc. and ATCC, which ensures a permanent and unrestricted availability of the progeny of the deposit culture to the public after the issuance of the relevant North American patent or • 5 after any application for American or foreign patent, whichever comes first, and ensure the progeny availability to that which is determined by the American Patent and Trademark Commissioner pursuant to 35 USC §122 and the rules of the Commissioner according to it (which includes 37 CFR §1.14 with particular reference to 886 OG 638).

The assignee of the present application agrees 15 that if a culture of the materials in the deposit should die, be lost or destroyed when cultivated under suitable conditions, the materials will be quickly replaced after notification with other like material. The availability of the deposited material is not considered a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws. 25 - > -A Ss-fi-ac- ^ r -3 The above written specification is considered sufficient to enable someone skilled in the art to practice the invention. The present invention is not limited in • 5 the scope of the deposited construct, since the deposited modality is intended to be a single illustration of certain aspects of the invention and any construct or construction that has a functional equivalent and is within reach of this invention. The deposit of material in the • present does not constitute an admission that the description described herein is inadequate to allow practice in any aspect of the invention, which includes the best mode of Also, it is not considered as limiting the scope of the claims to the specific illustrations that it represents. Specifically, various modifications of the invention in addition to those shown and described herein are will become apparent to those skilled in the art of the foregoing description and who fall within the scope of the appended claims.

It is noted that in relation to this date, the best method known to the applicant ^^^ áÉ-É-i-M to carry out the aforementioned invention, is that which is clear from the present description of the invention. • 5 Having described the invention as above, property is claimed as contained in the following

Claims

- - RE I V I N D I CAC I ON E S 1. - The isolated nucleic acid having at least 80% sequence identity with • with respect to a nucleotide sequence encoding a polypeptide, characterized in that it comprises an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 2 10 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO. : 20), Figure 15 (SEQ ID NO: 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 15 (SEQ ID NO: 36), FIGURE 27 (SEQ ID NO: 41), FIGURE 30 (SEQ ID NO: 47), FIGURE 32 (SEQ ID NO: 52), FIGURE 34 (SEQ ID NO. : 57), Figure 36 (SEQ ID NO: 62), Figure 38 (SEQ ID NO: 67), Figure 41 (SEQ ID NO: 73), Figure 47 (SEQ ID NO: 84), Figure 49 (SEQ ID NO: 95), Figure 51 (SEQ ID NO: 97), Figure 53 (SEQ ID NO: 99), Figure 57 (SEQ ID NO: 103), Figure 64 (SEQ. ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119), Figure 72 (SEQ ID 25 NO: 124), Figure 74 (SEQ ID NO: 129), Figure 76 -ii? -iite-M-di-f-i-l-a? - (SEQ ID NO: 135), Figure 79 (SEQ ID NO: 138), Figure 83 (SEQ ID NO: 146), Figure 85 (SEQ ID NO: 148), Figure 88 (SEQ ID NO. : 151), Figure 90 (SEQ ID NO: 153), Figure 93 (SEQ ID NO: 156), • Figure 95 (SEQ ID NO: 158), Figure 97 (SEQ ID NO: 160), Figure 99 (SEQ ID NO: 165), Figure 101 (SEQ ID NO: 167), Figure 103 (SEC ID NO: 169), Figure 105 (SEQ ID NO: 171), Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 10 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181), Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO. : 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (SEQ ID NO: 201), Figure 131 (SEC. 15 NO: 203), FIGURE 133 (SEQ ID NO: 205), FIGURE 135 (SEQ ID NO: 207), FIGURE 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEC. NO: 213), Figure 144 (SEQ ID NO: 216), Figure 147 (SEQ ID NO: 219), Figure 149 (SEQ ID NO: 221), 20 Figure 151 (SEQ ID NO: 223), Figure 153 (SEC. NO: 225), Figure 155 (SEQ ID NO: 227), Figure 157 (SEQ ID NO: 229), Figure 159 (SEQ ID NO: 231), Figure 161 (SEQ ID NO: 236), Figure 163 (SEC. NO: 241), Figure 165 (SEQ ID NO: 246), Figure 167 25 (SEQ ID NO: 248), Figure 169 (SEQ ID NO: 250), ii-i-ß? -? - Mi-a -? - a -? - H Figure 171 (SEQ ID NO: 253), Figure 174 (SEQ ID NO: 256), Figure 176 (SEQ ID NO: 258), Figure 178 (SEQ ID NO: 260), Figure 180 (SEQ ID NO: 262), Figure 182 (SEQ ID NO: 264), Figure 184 (SEQ ID 5 NO: 266), Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276), Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), 10 Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID • NO: 287), Figure 206 (SEQ ID NO: 289), Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 15 (SEQ ID NO: 301), FIGURE 220 (SEQ ID NO: 303), FIGURE 226 (SEQ ID NO: 309), FIGURE 228 (SEQ ID NO: 314), FIGURE 230 (SEQ ID NO. : 319), Figure 233 (SEQ ID NO: 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEC. 20 NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361), Figure 258 (SEQ ID NO: 363), Figure 260 (SEQ ID NO: 365), FIGURE 262 (SEQ ID NO: 367), FIGURE 264 (SEQ ID NO: 369), FIGURE 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 5 (SEQ ID NO. : 379), Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID 10 NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 • (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO. : 420), Figure 304 (SEQ ID NO: 422) and Figure 306 (SEQ ID NO: 424).
2. The nucleic acid according to claim 1, characterized in that the nucleotide sequence comprises a nucleotide sequence selected from the group consisting of 20 of the sequence shown in Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 5), Figure 5 (SEQ ID NO: 7), Figure 8 (SEQ ID NO: 13) , Figure 11 (SEQ ID NO: 19), Figure 14 (SEQ ID NO: 22), Figure 17 (SEQ ID NO: 27), Figure 19 (SEQ ID NO: 25 29), Figure 22 (SEQ ID NO: 32), Figure 24 (SEC. - - ID NO: 35), Figure 26 (SEQ ID NO: 40), Figure 29 (SEQ ID NO: 46), Figure 31 (SEQ ID NO: 51), Figure 33 (SEQ ID NO: 56 ), Figure 35 (SEQ ID NO: 61), Figure 37 (SEQ ID NO: 66), Figure 40 (SEQ. • 5 ID NO: 72), Figure 46 (SEQ ID NO: 83), Figure 48 (SEQ ID NO: 94), Figure 50 (SEQ ID NO: 96), Figure 52 (SEQ ID NO: 98 ), Figure 56 (SEQ ID NO: 102), Figure 63 (SEQ ID NO: 112), Figure 65 (SEQ ID NO: 114), Figure 67 (SEQ ID NO: 116), Figure 10 69 (SEQ ID NO: 118), Figure 71 (SEQ ID NO: 123), • Figure 73 (SEQ ID NO: 128), Figure 75 (SEQ ID NO: 134), Figure 78 (SEQ ID NO: 137), Figure 82 (SEQ ID NO: 145), Figure 84 (SEC. ID NO: 147), Figure 87 (SEQ ID NO: 150), Figure 89 (SEC. 15 NO: 152), Figure 92 (SEQ ID NO: 155), FIGURE 94 (SEQ ID NO: 157), FIGURE 96 (SEQ ID NO: 159), FIGURE 98 (SEQ ID NO: 164), Figure 100 (SEQ ID NO: 166), Figure 102 (SEQ ID NO: 168), Figure 104 (SEQ ID NO: 170), Figure 108 (SEQ ID NO: 174), Figure 110 (SEQ ID NO: 176), Figure 112 (SEQ ID NO: 178), Figure 114 (SEQ ID NO: 180), Figure 116 (SEQ ID NO: 182), Figure 119 (SEQ. ID NO: 188), Figure 121 (SEQ ID NO: 193), Figure 124 (SEQ ID NO: 196), Figure 126 (SEQ ID NO: 198), Figure 128 25 (SEQ ID NO: 200), Figure 130 (SEQ ID NO: 202), - Figure 132 (SEQ ID NO: 204), Figure 134 (SEQ ID NO: 206), Figure 136 (SEQ. ID NO: 208), Figure 138 (SEQ ID NO: 210), Figure 140 (SEQ ID NO: 212), Figure 143 (SEQ ID NO: 215), Figure 146 (SEQ ID NO: 218) , Figure 148 (SEQ ID NO: 220), Figure 150 (SEQ ID NO: 222), Figure 152 (SEQ ID NO: 224), Figure 154 (SEQ ID NO: 226), Figure 156 (SEQ. ID NO: 228), Figure 158 (SEQ ID NO: 230), Figure 160 (SEQ ID NO: 235), Figure 162 (SEQ ID NO: 240), 10 Figure 164 (SEQ ID NO: 245) , Figure 166 (SEQ ID NO: 247), Figure 168 (SEQ ID NO: 249), Figure 170 (SEQ ID NO: 252), Figure 173 (SEQ ID NO: 255), Figure 175 (SEC ID NO: 257), Figure 177 (SEQ ID NO: 259), Figure 179 (SEQ ID NO: 261), Figure 181 15 (SEQ ID NO: 263), Figure 183 (SEQ ID NO: 265) ), Figure 185 (SEQ ID NO: 267), Figure 187 (SEQ ID NO: 269), Figure 189 (SEQ ID NO: 271), Figure 191 (SEQ ID NO: 273), Figure 193 (SEC ID NO: 275), Figure 195 ( SEC. ID NO: 277), Figure 197 (SEQ ID NO: 280), Figure 199 (SEQ ID NO: 282), Figure 201 (SEQ ID NO: 284), Figure 203 (SEQ ID NO: 286) , Figure 205 (SEQ ID NO: 288), Figure 207 (SEQ ID NO: 290), Figure 209 (SEQ ID NO: 292), Figure 211 (SEQ ID NO: 294), Figure 213 (SEQ. ID NO: 296), Figure 215 (SEQ ID NO: 298), Figure 217 (SEC. -iia-di &-M "« - - - - - - - - - - NO: 300), Figure 219 (SEQ ID NO: 302), Figure 225 (SEQ ID NO: 308), Figure 227 ( SEQ ID NO: 313), Figure 229 (SEQ ID NO: 318), Figure 232 (SEQ ID NO: 325), Figure 234 (SEQ ID NO: 333), Figure 237 (SEQ ID NO: 339 ), Figure 239 (SEQ ID NO: 344), Figure 241 (SEQ ID NO: 346), Figure 243 (SEQ ID NO: 348), Figure 245 (SEQ ID NO: 350), Figure 247 (SEC ID NO: 352), Figure 249 (SEQ ID NO: 354), Figure 251 (SEQ ID NO: 356), Figure 253 (SEQ ID NO: 358), Figure 255 (SEQ ID NO: 360) , Figure 257 (SEQ ID NO: 362), FIGURE 259 (SEQ ID NO: 364), FIGURE 261 (SEQ ID NO: 366), FIGURE 263 (SEQ ID NO: 368), FIGURE 265 (SEQ ID NO: 370), Figure 267 (SEQ ID NO: 372), Figure 269 (SEQ ID NO: 374), Figure 271 (SEQ ID NO: 376), Figure 273 (SEQ ID NO: 378), Figure 275 (SEQ. ID NO: 380), Figure 277 (SEQ ID NO: 386), Figure 279 (SEQ ID NO: 388), Figure 281 (SEQ ID NO: 393), Figure 283 (SEQ ID NO: 398), Figure 285 (SEQ ID NO: 400), Figure 287 (SEQ ID NO: 402), Figure 289 (SEQ ID NO: 407), Figure 291 (SEQ ID NO: 409), Figure 293 (SEQ ID NO: 411), Figure 295 (SEQ ID NO: 413), Figure 297 (SEQ ID NO: 415), Figure 299 (SEQ ID NO: 417), Figure 301 (SEQ ID NO: 419), Figure 303 (SEQ ID O: 421) and Figure 305 (SEQ ID NO: 423). -É-a-ÍM-M-ii-i-MI-i -k-ai- - - 3. - The nucleic acid according to claim 1, characterized in that the nucleotide sequence comprises a sequence • 5 nucleotides selected from the group consisting of the full-length coding sequence of the sequence shown in Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 5), Figure 5 (SEQ. ID NO: 7), Figure 8 (SEQ ID NO: 13), 10 Figure 11 (SEQ ID NO: 19), Figure 14 (SEQ ID NO: • 22), Figure 17 (SEQ ID NO: 27), Figure 19 (SEQ ID NO: 29), Figure 22 (SEQ ID NO: 32), Figure 24 (SEQ ID NO: 35), Figure 26 (SEQ ID NO: 40), Figure 29 (SEQ ID NO: 46), Figure 31 (SEQ ID NO: 46) 15 51), Figure 33 (SEQ ID NO: 56), Figure 35 (SEQ ID NO: 61), Figure 37 (SEQ ID NO: 66), Figure 40 (SEQ ID NO: 72), Figure 46 (SEQ ID NO: 83), Figure 48 (SEQ ID NO: 94), Figure 50 (SEQ ID NO: 96), Figure 52 (SEQ ID NO: 98), Figure 56 (SEQ. 20 ID NO: 102), Figure 63 (SEQ ID NO: 112), Figure 65 (SEQ ID NO: 114), Figure 67 (SEQ ID NO: 116), Figure 69 (SEQ ID NO: 118) , Figure 71 (SEQ ID NO: 123), Figure 73 (SEQ ID NO: 128), Figure 75 (SEQ ID NO: 134), Figure 78 (SEQ ID NO: 137), Figure 82 (SEQ ID NO: 145), Figure 84 (SEQ ID - NO: 147), Figure 87 (SEQ ID NO: 150), Figure 89 (SEQ ID NO: 152), Figure 92 ( SEQ ID NO: 155), Figure 94 (SEQ ID NO: 157), Figure 96 (SEQ ID NO: 159), Figure 98 (SEQ ID NO: 164), Figure 100 5 (SEQ ID NO: 166), Figure 102 (SEQ ID NO: 168), Figure 104 (SEQ ID NO: 170), Figure 108 (SEQ ID NO: 174), Figure 110 (SEQ ID NO: 176), Figure 112 ( SEQ ID NO: 178), Figure 114 (SEQ ID NO: 180), Figure 116 (SEQ ID NO: 182), Figure 119 (SEQ ID: Wk 10 NO: 188), Figure 121 (SEQ ID NO. : 193), Figure 124 (SEQ ID NO: 196), Figure 126 (SEQ ID NO: 198), Figure 128 (SEQ ID NO: 200), Figure 130 (SEQ ID NO: 202), Figure 132 (SEQ ID NO: 204), FIGURE 134 (SEQ ID NO: 206), FIGURE 136 (SEQ ID NO: 208), FIGURE 138 (SEQ ID NO: 210), FIGURE 140 (SEQ ID NO. : 212), Figure 143 (SEQ ID NO: 215), Figure 146 ^ (SEQ ID NO: 218), Figure 148 (SEQ ID NO: 220), Figure 150 (SEQ ID NO: 222), Figure 152 (SEQ ID NO: 224), Figure 154 (S? C. ID NO: 226), Figure 156 20 (SEQ ID NO: 228), Figure 158 (SEQ ID NO: 230), Figure 160 (SEQ ID NO: 235), Figure 162 (SEQ ID NO: 240) , Figure 164 (SEQ ID NO: 245), Figure 166 (SEQ ID NO: 247), Figure 168 (SEQ ID NO: 249), Figure 170 (SEQ ID NO: 252), Figure 173 (SEQ. ID 25 NO: 255), Figure 175 (SEQ ID NO: 257), Figure 177 Fc. -flrY (SEQ ID NO: 259), Figure 179 (SEQ ID NO: 261), Figure 181 (SEQ ID NO: 263), Figure 183 (SEQ ID NO: 265), Figure 185 (SEQ ID NO: 267), Figure 187 (SEQ ID NO: 269), Figure 189 (SEQ ID NO: 271), • Figure 191 (SEQ ID NO: 273), Figure 193 (SEQ ID NO: 275), Figure 195 (SEQ ID NO: 277), Figure 197 (SEQ ID NO: 280), Figure 199 (SEC ID NO: 282), Figure 201 (SEQ ID NO: 284), Figure 203 (SEQ ID NO: 286), Figure 205 (SEQ ID NO: 288), Figure 207 10 (SEQ ID NO: 290), Figure 209 (SEQ ID NO: 292), • Figure 211 (SEQ ID NO: 294), Figure 213 (SEQ ID NO: 296), Figure 215 (SEQ ID NO: 298), Figure 217 (SEQ ID NO: 300), Figure 219 (SEQ. ID NO: 302), Figure 225 (SEQ ID NO: 308), Figure 227 (SEC. 15 NO: 313), Figure 229 (SEQ ID NO: 318), Figure 232 (SEQ ID NO: 325), Figure 234 (SEQ ID NO: 333), Figure 237 (SEQ ID NO: 339), Figure 239 (SEQ ID NO: 344), Figure 241 (SEQ ID NO: 346), Figure 243 (SEQ ID NO: 348), Figure 245 (SEQ ID NO: 350), Figure 247 (SEQ ID NO: 352), Figure 249 (SEQ ID NO: 354), Figure 251 (SEQ ID NO: 356), Figure 253 (SEQ ID NO: 358), Figure 255 (SEQ. ID NO: 360), Figure 257 (SEQ ID NO: 362), Figure 259 (SEQ ID NO: 364), Figure 261 (SEQ ID NO: 366), Figure 263 25 (SEQ ID NO: 368), Figure 265 (SEQ ID NO: 370), JL Figure 267 (SEQ ID NO: 372), Figure 269 (SEQ ID NO: 374), Figure 271 (SEQ ID NO: 376), Figure 273 (SEQ ID NO: 378), Figure 275 (SEQ. ID NO: 380), Figure 277 (SEQ ID NO: 386), Figure 279 (SEQ ID NO: 388), Figure 281 (SEQ ID NO: 393), Figure 283 (SEQ ID NO: 398), Figure 285 (SEQ ID NO: 400), Figure 287 (SEQ ID NO: 402), Figure 289 (SEQ ID NO: 407), Figure 291 (SEQ ID NO: 409), Figure 293 (SEQ ID NO: 411), Figure 295 (SEQ ID NO: 413), 10 Figure 297 (SEQ ID NO: 415), Figure 299 (SEC. • NO: 417), Figure 301 (SEQ ID NO: 419), Figure 303 (SEQ ID NO: 421) or Figure 305 (SEQ ID NO: 423). 4. The isolated nucleic acid characterized in that it comprises the full-length coding sequence of the DNA deposited under the ATCC access number shown in Table 2. 5. - A vector characterized in that it comprises the nucleic acid according to claim 1. 6. - The vector according to claim 5, characterized in that it is 25 operably linked to the control sequences - - recognized by a host cell transformed with the vector. - 7.- A host cell or host 5 characterized in that it comprises the vector according to claim 5. 8. - The host cell according to claim 7, characterized in that said cell is a CHO cell. • 9. - The host cell according to claim 7, characterized in that said cell is an E. co l i. 10. The host cell according to claim 7, characterized in that said cell is a yeast cell. 11. A process for the production of PRO polypeptides, characterized in that it comprises culturing the host cell of claim 7 under conditions suitable for the expression of said PRO polypeptide and recover said PRO polypeptide from the cell culture. - - 12. - The PRO polypeptide of native sequence, isolated, characterized in that it has at least 80% sequence identity with • with respect to an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO. : 8), Figure 9 (SEQ ID NO: 14), 10 Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: • 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 (SEQ ID NO: 36), Figure 27 (SEQ ID NO: 41), Figure 30 (SEQ ID NO: 47), Figure 32 (SEQ ID NO: 47) 15 52), Figure 34 (SEQ ID NO: 57), Figure 36 (SEQ ID NO: 62), Figure 38 (SEQ ID NO: 67), Figure 41 (SEQ ID NO: 73), Figure 47 (SEQ ID NO: 84), Figure 49 (SEQ ID NO: 95), Figure 51 (SEQ ID NO: 97), Figure 53 (SEQ ID NO: 99), Figure 57 (SEQ. 20 ID NO: 103), Figure 64 (SEQ ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119) , Figure 72 (SEQ ID NO: 124), Figure 74 (SEQ ID NO: 129), Figure 76 (SEQ ID NO: 135), Figure 79 (SEQ ID NO: 138), 25 Figure 83 (SEQ ID NO: 146), Figure 85 (SEC. -j- &IH-a -.- MiM - ¿-II- - - NO: 148), Figure 88 (SEQ ID NO: 151), Figure 90 (SEQ ID NO: 153), Figure 93 ( SEQ ID NO: 156), Figure 95 (SEQ ID NO: 158), Figure 97 (SEQ ID JP NO: 160), Figure 99 (SEQ ID NO: 165), Figure 101 5 (SEQ ID NO. : 167), Figure 103 (SEQ ID NO: 169), Figure 105 (SEQ ID NO: 171), Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181), Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID £ 10 NO: 189), Figure 122 (SEC. NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (SEQ ID NO: 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), Figure 144 (SEQ ID NO: 216), Figure 147 (SEQ ID NO: 219), Figure 149 (SEQ. ID NO: 221), Figure 151 (SEQ ID NO: 223), Figure 153 (SEQ ID NO: 225), Figure 155 (SEQ ID NO: 227), Figure 157 20 (SEQ ID NO: 229), FIGURE 159 (SEQ ID NO: 231), FIGURE 161 (SEQ ID NO: 236), FIGURE 163 (SEQ ID NO: 241), FIGURE 165 (SEQ ID NO. : 246), Figure 167 (SEQ ID NO: 248), Figure 169 (SEQ ID NO: 250), Figure 171 (SEQ ID NO: 253), Figure 174 (SEC. 25 NO: 256), Figure 176 (SEQ ID NO: 258), Figure 178 -áSg | Hálfa_i¿t- £ kÉ -_--- ttM ^ il (SEQ ID NO: 260), Figure 180 (SEQ ID NO: 262), Figure 182 (SEQ ID NO: 264), Figure 184 (SEQ ID NO: 266), Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276), Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (SEQ ID NO: 289), Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO. : 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361), Figure 258 (SEQ ID NO: 363), Figure 260 (SEQ ID NO: 365), Figure 262 (SEQ ID NO: 367), Figure 264 (SEQ ID NO: 369), Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), FIGURE 272 (SEQ ID NO: 377), FIGURE 274 (SEQ ID NO: 379), FIGURE 276 (SEQ ID NO: 381), FIGURE 278 (SEQ ID NO. : 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO. : 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422) and Figure 306 (SEQ ID NO: 424). 13. The isolated PRO polypeptide characterized in that it has at least 80% sequence identity with respect to the amino acid sequence encoded by the nucleotide deposited under the ATCC access number shown in Table 2. 14. A chimeric molecule characterized because it comprises a polypeptide according to claim 12, fused with a heterologous amino acid sequence. 25 .aa-sa - - 15.- The chimeric molecule according to claim 14, characterized in that the heterologous amino acid sequence is an epitope tag sequence. 16. - The chimeric molecule according to claim 14, characterized in that the heterologous amino acid sequence is an Fc region of an immunoglobulin. 10 17. An antibody characterized in that it binds specifically to a PRO polypeptide according to claim 12. 18. The antibody according to claim 17, characterized in that the antibody is a monoclonal antibody. 19. - The antibody in accordance with 20 claim 17, characterized in that the antibody is a humanized antibody. 20. The antibody according to claim 17, characterized in that the antibody is an antibody fragment. ^^ ¡^ «2 ^ ---- ^^ --------------- ^ < ^^^^^^^^^^^^^^ fe $ ^ Y - - 21. - An isolated nucleic acid molecule characterized in that it has at least 80% sequence identity with respect to a nucleic acid comprising a nucleotide sequence selected from the group consisting of that shown in Figure 1 (SEQ. ID NO: 1), Figure 3 (SEQ ID NO: 5), Figure 5 (SEQ ID NO: 7), Figure 8 (SEQ ID NO: 13), Figure 11 (SEQ ID 10 NO: 19) , Figure 14 (SEQ ID NO: 22), Figure 17 (SEQ ID NO: 27), Figure 19 (SEQ ID NO: 29), Figure 22 (SEQ ID NO: 32), Figure 24 (SEC. ID NO: 35), Figure 26 (SEQ ID NO: 40), Figure 29 (SEQ ID NO: 46), Figure 31 (SEQ ID NO: 51), Figure 33 15 (SEQ ID NO: 56) , Figure 35 (SEQ ID NO: 61), Figure 37 (SEQ ID NO: 66), Figure 40 (SEQ ID NO: 72), Figure 46 (SEQ ID NO: 83), Figure 48 (SEQ. ID NO: 94), Figure 50 (SEQ ID NO: 96), Figure 52 (SEQ ID NO: 98), Figure 56 (SEQ ID NO: 102), 20 Figure 63 (SEQ ID NO: 112) , Figure 65 (SEQ ID NO: 114), Figure 67 (SEQ ID NO: 116), Figure 69 (SEQ ID NO: 118), Figure 71 (SEQ. ID NO: 123), Figure 73 (SEQ ID NO: 128), Figure 75 (SEQ ID NO: 134), Figure 78 (SEQ ID NO: 137), Figure 82 25 (SEQ ID NO: 145) , Figure 84 (SEQ ID NO: 147), .-_. -..- ^ -. «^ At» ¿- ^^ 8-fey ^^ - .. ^ a iY-A - ^. ^ - A-. .. .. i .. ^^. jáÜSS. Figure 87 (SEQ ID NO: 150), Figure 89 (SEQ ID NO: 152), Figure 92 (SEQ ID NO: 155), Figure 94 (SEQ ID NO: 157), Figure 96 (SEC. NO: 159), Figure 98 (SEQ ID NO: 164), Figure 100 (SEQ ID NO: 166), Figure 102 (SEQ ID NO: 168), Figure 104 (SEQ ID NO: 170), Figure 108 (SEQ ID NO: 174), Figure 110 (SEQ ID NO: 176), Figure 112 (SEQ ID NO: 178), Figure 114 (SEQ ID NO: 180), Figure 116 (SEQ ID NO: 182), Figure 119 (SEQ ID NO: 188), 10 Figure 121 (SEQ ID NO: 193), Figure 124 (SEC. • NO: 196), Figure 126 (SEQ ID NO: 198), Figure 128 (SEQ ID NO: 200), Figure 130 (SEQ ID NO: 202), Figure 132 (SEQ ID NO: 204), Figure 134 (SEQ ID NO: 206), Figure 136 (SEQ ID NO: 208), Figure 138 15 (SEQ ID NO: 210), Figure 140 (SEQ ID NO: 212), Figure 143 (SEQ. ID NO: 215), Figure 146 (SEQ ID NO: 218), Figure 148 (SEQ ID NO: 220), Figure 150 (SEQ ID NO: 222), Figure 152 (SEQ ID NO: 224), Figure 154 (SEQ ID NO: 226), Figure 156 (SEQ ID NO: 228), Figure 158 (SEQ ID NO: 230), Figure 160 (SEQ ID NO: 235), Figure 162 (SEQ. ID NO: 240), Figure 164 (SEQ ID NO: 245), Figure 166 (SEQ ID NO: 247), Figure 168 (SEQ ID NO: 249), Figure 170 (SEQ ID NO: 252), Figure 173 (SEQ ID NO: 255), Figure 175 (SEQ ID NO: 257), Figure 177 (SEC. -aii-M-iM-i - ^ -.-.- M-8-Í-S-. - NO: 259), Figure 179 (SEQ ID NO: 261), Figure 181 (SEQ ID NO: 263), Figure 183 (SEQ ID NO: 265), Figure 185 (SEQ ID NO: 267), Figure 187 (SEQ ID NO: 269), Figure 189 (SEQ ID NO: 271), Figure 191 5 (SEQ ID NO: 273), Figure 193 (SEQ ID NO: 275), Figure 195 (SEC ID NO: 277), Figure 197 (SEQ ID NO: 280), Figure 199 (SEQ ID NO: 282), Figure 201 (SEQ ID NO: 284), Figure 203 (SEQ ID NO: 286) , Figure 205 (SEQ ID NO: 288), Figure 207 (SEQ ID NO: 290), Figure 209 (SEQ ID NO: 292), Figure 211 P (SEQ ID NO: 294), Figure 213 ( SEQ ID NO: 296), Figure 215 (SEQ ID NO: 298), Figure 217 (SEQ ID NO: 300), Figure 219 (SEQ ID NO: 302), Figure 225 (SEQ ID NO: 308 ), Figure 227 (SEQ ID NO: 313), Figure 229 (SEQ ID NO: 318), Figure 232 (SEQ ID NO: 325), Figure 234 (SEQ ID NO: 333), Figure 237 ( SEQ ID NO: 339), Figure 239 (SEQ ID NO: 344), Figure 241 (SEQ ID NO: 346), Figure 243 (SEQ ID NO: 348), Figure 245 (SEQ ID NO: 350 ), Figure 247 20 (SEQ ID NO: 3) 52), Figure 249 (SEC. ID NO: 354), Figure 251 (SEQ ID NO: 356), Figure 253 (SEQ ID NO: 358), Figure 255 (SEQ ID NO: 360), Figure 257 (SEQ ID NO: 362), Figure 259 (SEQ ID NO: 364), Figure 261 (SEQ ID NO: 366), Figure 263 (SEQ ID NO: 368), Figure 265 (SEQ ID NO: 370), Figure 267 ^ ¡¡^ Íg (SEQ ID NO: 372), Figure 269 (SEQ ID NO: 374), Figure 271 (SEQ ID NO: 376), Figure 273 (SEQ ID NO: 378), Figure 275 ( SEC ID NO: 380), Figure 277 (SEQ ID NO: 386), Figure 279 (SEQ ID NO: 388), • Figure 281 (SEQ ID NO: 393), Figure 283 (SEQ ID NO: 398), Figure 285 (SEQ ID NO: 400), Figure 287 (SEQ ID NO: 402), Figure 289 (SEQ ID NO: 407), Figure 291 (SEQ ID NO: 409), Figure 293 (SEQ ID NO: 411), Figure 295 (SEQ ID NO: 413), Figure 297 10 (SEQ ID NO: 415), Figure 299 (SEQ ID NO: 417), P Figure 301 (SEQ ID NO: 419), Figure 303 (SEQ ID NO: 421) and Figure 305 (SEQ ID NO: 423). 22. - A nucleic acid molecule, 15 isolated, characterized in that it has at least 80% sequence identity with respect to a full-length coding sequence of a nucleotide sequence selected from the group consisting of that shown in Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 5), Figure 5 (SEQ ID NO: 7), Figure 8 (SEQ ID NO: 13), Figure 11 (SEQ ID NO: 19), Figure 14 (SEQ ID NO: 22), Figure 17 (SEQ ID NO: 27), Figure 19 (SEQ ID NO: 29), Figure 22 (SEQ ID NO: 25 32), Figure 24 (SEQ ID NO: 35), Figure 26 (SEQ. ID NO: 40), Figure 29 (SEQ ID NO: 46), Figure 31 (SEQ ID NO: 51), Figure 33 (SEQ ID NO: 56), Figure 35 (SEQ ID NO: 61), Figure 37 (SEQ ID NO: 66), Figure 40 (SEQ ID NO: 72), Figure 46 (SEQ. • 5 ID NO: 83), Figure 48 (SEQ ID NO: 94), Figure 50 (SEQ ID NO: 96), Figure 52 (SEQ ID NO: 98), Figure 56 (SEQ ID NO: 102) ), Figure 63 (SEQ ID NO: 112), Figure 65 (SEQ ID NO: 114), Figure 67 (SEQ ID NO: 116), Figure 69 (SEQ ID NO: 118), 10 Figure 71 (SEQ ID NO: 123), Figure 73 (SEC. • NO: 128), Figure 75 (SEQ ID NO: 134), Figure 78 (SEQ ID NO: 137), Figure 82 (SEQ ID NO: 145), Figure 84 (SEQ ID NO: 147), Figure 87 (SEQ ID NO: 150), Figure 89 (SEQ ID NO: 152), Figure 92 15 (SEQ ID NO: 155), FIGURE 94 (SEQ ID NO: 157), FIGURE 96 (SEQ ID NO: 159), FIGURE 98 (SEQ ID NO: 164), FIGURE 100 (SEQ ID NO. : 166), Figure 102 (SEQ ID NO: 168), Figure 104 (SEQ ID NO: 170), Figure 108 (SEQ ID NO: 174), Figure 110 (SEC. 20 NO: 176), Figure 112 (SEQ ID NO: 178), Figure 114 (SEQ ID NO: 180), Figure 116 (SEQ ID NO: 182), Figure 119 (SEQ ID NO: 188), Figure 121 (SEC. NO: 193), Figure 124 (SEQ ID NO: 196), Figure 126 (SEQ ID NO: 198), Figure 128 (SEQ ID NO: 200), Figure 130 (SEQ ID NO: 202), Figure 132 (SEQ ID NO: 204), Figure 134 (SEQ ID NO: 206), Figure 136 (SEQ ID NO: 208), Figure 138 (SEQ. ID NO: 210), Figure 140 (SEQ ID NO: 212), Figure 143 (SEQ ID NO: 215), Figure 146 (SEQ ID NO: 218), Figure 148 5 (SEQ ID NO: 220 ), Figure 150 (SEQ ID NO: 222), Figure 152 (SEQ ID NO: 224), Figure 154 (SEQ ID NO: 226), Figure 156 (SEQ ID NO: 228), Figure 158 (SEC ID NO: 230), Figure 160 (SEQ ID NO: 235), Figure 162 (SEQ ID NO: 240), Figure 164 (SEQ ID F 10 NO: 245), Figure 166 (SEQ ID NO: 247), Figure 168 (SEQ ID NO: 249), Figure 170 (SEQ ID NO: 252), Figure 173 (SEQ ID NO: 255), Figure 175 (SEQ ID NO: 257), Figure 177 ( SEQ ID NO: 259), Figure 179 (SEQ ID NO: 261), Figure 181 (SEQ ID NO: 263), Figure 183 (SEQ ID NO: 265), Figure 185 (SEQ ID NO: 267), Figure 187 (SEQ ID NO: 269), Figure 189 (SEQ ID NO: 271), Figure 191 (SEQ ID NO: 273), Figure 193 (SEQ ID NO: 275), Figure 195 ( SEC ID NO: 277), Figure 197 (SEC. ID NO: 280), Figure 199 20 (SEQ ID NO: 282), Figure 201 (SEQ ID NO: 284), Figure 203 (SEQ ID NO: 286), Figure 205 (SEQ ID NO: 288) , Figure 207 (SEQ ID NO: 290), Figure 209 (SEQ ID NO: 292), Figure 211 (SEQ ID NO: 294), Figure 213 (SEQ ID NO: 296), Figure 215 (SEQ. ID 25 NO: 298), Figure 217 (SEQ ID NO: 300), Figure 219 -----.-Kgsi-aÉ & - (SEQ ID NO: 302), Figure 225 (SEQ ID NO: 308), Figure 227 (SEQ ID NO: 313), Figure 229 (SEQ ID NO: 318), Figure 232 (SEQ ID NO: 325), Figure 234 (SEQ ID NO: 333), Figure 237 (SEQ ID NO: 339), Figure 239 (SEQ ID NO: 344), Figure 241 (SEQ ID NO: 346), Figure 243 (SEQ ID NO: 348), Figure 245 (SEQ ID NO: 350), Figure 247 (SEQ ID NO: 352), Figure 249 (SEQ ID NO: 354), Figure 251 (SEQ ID NO: 356), Figure 253 (SEQ ID NO: 358), Figure 255 (SEQ ID NO: 360), Figure 257 (SEQ ID NO: 362), Figure 259 (SEQ ID NO: 364), Figure 261 (SEQ ID NO: 366), Figure 263 (SEQ ID NO: 368), Figure 265 (SEQ ID NO: 370), Figure 267 (SEQ ID NO: 372), Figure 269 (SEQ ID NO. : 374), Figure 271 (SEQ ID NO: 376), Figure 273 (SEQ ID NO: 378), Figure 275 (SEQ ID NO: 380), Figure 277 (SEQ ID NO: 386), Figure 279 (SEQ ID NO: 388), Figure 281 (SEQ ID NO: 393), Figure 283 (SEQ ID NO: 398), Figure 285 (SEQ ID NO: 400), Figure 287 (SEQ ID NO: 402), Figure 289 (SEQ ID NO: 407), Figure 291 (SEQ ID NO: 409), Figure 293 (SEQ ID NO: 411), Figure 295 (SEQ ID NO: 413), Figure 297 (SEQ ID NO: 415), Figure 299 (SEQ ID NO: 417), Figure 301 (SEQ ID NO: 419), Figure 303 ( SEQ ID NO: 421) and Figure 305 (SEQ ID NO: 423). - & * - ** - - 23.- An isolated extracellular domain of the PRO polypeptide. 24. - An isolated PRO polypeptide lacking its associated signal peptide. 25. - An isolated polypeptide having at least about 80% identity of the amino acid sequence to an extracellular domain of a PRO polypeptide. 26. - An isolated polypeptide having at least about 80% of the amino acid sequence identity for a PRO polypeptide lacking its associated signal peptide. j ^^^ rffi £