JP2005304500A - Medicine comprising polypeptide - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a medicine comprising a new polypeptide available to angiogenesis, wound healing and so on. <P>SOLUTION: Disclosed is a medicine comprising an isolated polypeptide having at least 80% sequence identity to disclosed amino acid sequences or to amino acid sequences encoded by a nucleic acid molecule deposited by ATCC Accession No. 203091. A vector containing a nucleic acid encoding the polypeptide and an antibody or antibody fragment inhibiting an ability promoting the growth of endothelial cells through binding to the polypeptide are also available. Furthermore a method for identifying an agonist or antagonist of the polypeptide is provided. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates generally to the identification and isolation of novel DNA and the recombinant production of novel polypeptides.

Extracellular proteins play a particularly important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (e.g., mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) that are in turn taken by various cell receptors or membrane-bound proteins. Is interpreted. These secreted polypeptides or signal molecules usually pass through the cell secretory pathway to reach their site of action in the extracellular environment.
Secreted proteins have a variety of industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs currently available, such as thrombolytics, interferons, interleukins, erythropoietin, colony stimulating factor, and various other cytokines are secreted proteins. These receptors are also membrane proteins and have potential as therapeutic or diagnostic agents. Efforts have been made by both industry and academia to identify new native secreted proteins. Much effort has been devoted to screening mammalian recombinant DNA libraries to identify novel secretory protein coding sequences. Examples of screening methods and techniques are described in the literature [see, eg, Klein et al., Proc. Natl. Acad. Sci. 93; 7108-7113 (1996);

Membrane-bound proteins and receptors play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (e.g., mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones), which are then received by various cell receptors or membrane-bound proteins. Interpreted. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cell adhesions such as selectins and integrins. Contains molecules. For example, the transmission of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze the process, also act as growth factor receptors. Specific examples include fibroblast growth factor and nerve growth factor receptor.
Membrane-bound proteins and receptor molecules have a variety of industrial applications, including pharmaceutical and diagnostic agents. For example, receptor immunoadhesins can be used as therapeutic agents that block receptor-ligand interactions. Membrane-bound proteins can also be used to screen for peptide or small molecule inhibitors with potential for related receptor / ligand interactions.
Efforts have been made by both industry and academia to identify new native receptor proteins. Much effort has been devoted to screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins.

1. PRO281
A gene directed to testis enhanced gene transcript (TEGT) has recently been identified in humans (Walter et al., Genomics 20: 301-404 (1995)). Recent results have shown that TEGT protein is developmentally regulated in mammalian testis and has a nuclear targeting motif that localizes the protein to the nucleus (Walter et al., Mamm, Genome 5: 216-221 (1994 )). Thus, TEGT protein is thought to play an important role in testicular development. Therefore, there is great interest in identifying and characterizing novel polypeptides that have homology with TEGT proteins. We describe here the identification and characterization of a novel polypeptide having homology with the TEGT protein, designated herein as PRO281 polypeptide.

2. PRO276
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO276 polypeptide.
3. PRO189
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO189 polypeptide.

4). PRO190
Of particular interest are proteins with 7 transmembrane (7TM), more generally all multi-transmembrane spanning proteins. Among the multi-membrane spanning proteins are ion channels and transporters. Examples of transporters include the UPD-galactose transporter described in Ishida et al., J. Biochem., 120 (6): 1074-1078 (1996), and Eckhardt et al., PNAS, 93 (15): 7572-7576 ( 1996), a CMP-sialic acid transporter. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO190 polypeptide.
5). PRO341
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO341 polypeptide.

6). PRO180
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO180 polypeptide.
7). PRO194
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO194 polypeptide.

8). PRO203
Enzyme proteins play an important role in chemical reactions involved in food digestion, macromolecular biosynthesis, control of chemical energy utilization and release, and other processes necessary for life support. ATPases are a family of enzymes that play a variety of important roles, including energy transport of ions and molecules through cell membranes. Transport mechanisms using ATPase often involve the elimination of in vitro or endotoxins from the cellular environment, thereby protecting the cells from the toxicity of these compounds. Lu et al. Reported a detoxification mechanism in which glutathione S-transferase (GST) catalyzes the glutathioneization of plant toxins and that specific Mg2 ⁺ -ATPases are involved in the transport of glutathione S-complexes from the cytosol. ing. Proc. Natl. Acad. Sci. USA 94 (15): 8243-8248 (1997). This study and others have shown the importance of identifying novel proteins with sequence identity with ATPases and ATPases such as GST ATPase.
More generally and of interest are novel membrane-bound proteins, including those involved in the transport of ions and molecules across the membrane. Membrane-bound proteins and receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (e.g., mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) that are in turn taken by various cell receptors or membrane-bound proteins. Is interpreted. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cell adhesions such as selectins and integrins. Contains molecules. For example, the transmission of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Tyrosine kinases, proteins that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor.
In view of the important physiological roles played by ATPase and membrane-bound proteins, efforts are currently being made by both industry and academia to identify novel membrane-bound proteins and proteins that have sequence identity with ATPase. ing. We describe here the identification of a novel polypeptide having sequence identity to GST ATPase, designated herein as PRO203 polypeptide.

9. PRO290
Of particular interest are novel proteins and nucleic acids that have sequence identity with known proteins and nucleic acids. Proteins of interest known in the art include NTII-1, neuroproteins that promote regeneration, FAN, and beige. Beige or bg are mouse analogs associated with Chediak-Higashi syndrome (CHS), a rare autosomal responsive disease in which neutrophils, monocytes and lymphocytes contain large cytoplasmic particles. See Perou et al., J. Biol. Chem. 272 (47): 29790 (1997) and Barbosa et al., Nature 382: 262 (1996).
We describe here the identification of a novel polypeptide with sequence identity to NTII-1, FAN and beige, designated herein as PRO290 polypeptide.
10. PRO874
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO874 polypeptide.

11. PRO710
In Saccharomyces cerevisiae, when a cell becomes eligible for DNA replication, the chromatin structure of the DNA replication origin changes, and the G1-phase specific binding of the replication factor and the origin DNA enters S phase. (Aparicio et al., Cell 91: 59-69 (1997)). Indeed, initiation of DNA replication in Saccharomyces cerevisiae requires a protein product of the CDC45 gene that encodes a protein that remains at a relatively constant level throughout the cell cycle (Owens et al., Proc. Natl. Acad. Sci. USA). 94: 12521-12526 (1997)). The CDC45 protein is part of a pre-replication complex that can migrate with the DNA replication fork of yeast. Given the obvious importance of the CDC45 protein in DNA replication, the identification and characterization of novel polypeptides with homology to CDC45 is of great interest. Here we describe the identification and characterization of a novel polypeptide having homology to the CDC45 protein, designated herein as PRO710 polypeptide.
12 PRO1151
Complement proteins comprise a large group of serum proteins, some of which act in an enzymatic cascade to produce effector molecules involved in inflammation. Complement proteins are particularly important in the regulation of cellular behavior and function involved in inflammation. One of the complement proteins, C1q, has been shown to be involved in the recognition of antigen-antibody complexes on the microbial surface and in the classical pathway of complement (Shapiro et al., Curr. Biol. 8 (6): 335. -338 (1998)).
Given the physiological importance of inflammation and related mechanisms in vivo and the specific physiological activity of complement C1q protein, efforts to identify novel natural proteins with sequence similarity to complement proteins Is currently being made. We describe here the identity and characterization of a novel polypeptide having homology to the complement C1q protein, designated herein as PRO1151 polypeptide.

13. PRO1282
All proteins containing leucine-rich repeats are thought to be involved in protein-protein interactions. Leucine rich repeats are short sequence motifs present in many proteins and cell locations with diverse functions. The crystal structure of the ribonucleic acid inhibitor protein revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged to form parallel β-sheets with one side exposed to the solvent, and the protein acquires an unusual non-spherical shape. These two features have been shown to be responsible for the protein binding function of proteins containing leucine-rich repeats. See Kobe and Deisenhofer, Trends Biochem. Sci., 19 (10): 415-421 (Oct. 1994); Kobe and Deisenhofer, Curr. Opin, Struct. Biol., 5 (3): 409-416 (1995). I want to be.
Studies have been reported on leucine-rich proteoglycans that become tissue organizers that direct and direct collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stromal formation. Iozzo, RV, Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies showing the involvement of leucine-rich proteins in wound healing and tissue repair are in De La Salle, C. et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995) And reported mutations in the leucine-rich motif in the complex associated with the bleeding disorder Bernard-Soulier syndrome, Chlemetson, KJ, Thromb. Haemost. (Germany), 74 (1): 111-116 (July 1995) Reported that platelets have leucine-rich repeats, and La Jolla Cancer Research Foundation Ruoslahti, EI et al., WO 9110727-A, describes that decorin binding to transforming growth factor β is a treatment for cancer. Have been reported to be involved in wound healing and scarring. Useful in wound healing and concomitant therapies associated with regrowth of tissues such as connective tissue, skin and bone; by promoting body growth in humans and animals; and in stimulating other growth-related processes In some, the function associated with this group of proteins is insulin-like growth factor (IGF). The acid labile subunit (ALS) of IGF is also interesting in that it increases the half-life of IGF and is part of the in vivo IGF complex.
Other proteins reported to have leucine-rich repeats have been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for cancer diagnosis. SLIT protein. See Yale University, Artavanistsakonas, S. and Rothberg, JM, WO 9210518-A1. Of particular interest is LIG-1, a membrane glycoprotein that is specifically expressed in glial cells of the mouse brain and has leucine-rich repeats and immunoglobulin-like domains. Suzuki et al., J. Biol. Chem. (US), 271 (37): 22522 (1996). Other studies reporting biological functions of proteins with leucine-rich repeats include: Tayar, N. et al., Mol. Cell Endocrinol., (Ireland), 125 (1-2): 65-70 (Dec 1996) (gonadotropin receptor related); Miura, Y. et al., Nippon Rinsho (Japan), 54 (7): 1784-1789 (July 1996) (apoptosis related); Harris, PC et al., J. Am. Soc. Nephrol ., 6 (4): 1125-1133 (Oct. 1995) (related to kidney disease).
Leucine-rich repeat proteins are described in Kajava, J. Mol. Biol., 277 (3): 519-527 (1998), Nagasawa et al., Genomics, 44 (3): 273-279 (1997), Bengtsson, J. Biol. Chem., 270 (43): 25639-25644 (1995), Gaillard et al., Cell, 65 (7): 1127-1141 (1991) and Ohkuma and Yanagida, Cell, 64 (1): 149-157 (1991) Further described and incorporated herein by reference in its entirety.
For all of the above reasons, new members of the leucine rich repeat superfamily are interesting. At a more general level, all new proteins are interesting. We describe here the identification and characterization of a novel leucine-rich repeat-containing polypeptide, designated herein as PRO1282 polypeptide.

14 PRO358
Cloning of the Drosophila Toll gene, a maternal effect gene that plays a central role in establishing the embryonic dorsal-ventral pattern, has been reported by Hashimoto et al., Cell 52, 269-279 (1988). The Drosophila Toll gene encodes a complex membrane protein with an extra-cytoplasmic domain of 803 amino acids and a cytoplasmic domain of 269 amino acids. The extracytoplasmic domain has potential transmembrane segments and contains multiple copies of the leucine-rich segment, a structural motif found in many transmembrane proteins. Toll protein regulates the dorsal-ventral pattern in Drosophila embryos and activates the transcription factor Dorsal upon binding to its ligand Spatzle (Morisato and Anderson, Cell 76, 677-688 (1994)). In adult Drosophila, the Toll / Dorsal signaling pathway is involved in the antifungal immune response (Lenaitre et al., Cell 86, 973-983 (1996)).
Human homologues of the Drosophila Toll protein are described by Medzhitov et al., Nature 388, 394-397 (1997). Just like Drosophila Toll, this human Toll has an extracellular domain consisting of 21 tandem repeat leucine rich motifs (leucine rich region-LRR) separated by non-LRR regions, and human interleukin-1 (IL-1). ) A type I transmembrane protein with a cytoplasmic domain homologous to the cytoplasmic domain of the receptor. Constitutively active variants of human Toll transfected into human cell lines are NF-κB activation and NF-κB regulatory genes for inflammatory cytokines IL-1, IL-6 and IL-8 As well as the expression of the costimulatory molecule B7.1, which is required for the activation of native T cells. It has been suggested that Toll functions as a non-clonal receptor of the immune system in vertebrates, which can induce signals to activate both innate and adaptive immune responses in vertebrates. The human Toll gene reported by Medzhitov et al., Supra, is most strongly expressed in spleen and peripheral blood leukocytes (PBL), and the authors have shown that its expression in other tissues is due to the presence of macrophages and dendritic cells. It suggests that it can act as an early warning system for infection. The public Genbank database includes the following Toll sequences: Toll1 (DNAX # HSU88540-1 identical to the random sequence full length cDNA # HUMRSC786-1); Toll2 (DNAX # HSU88878-1); Toll3 (DNAX # HSU88879-1); And Toll4 (DNAX # HSU88880-1 which is identical to the DNA sequence reported by Medzhitov et al., Supra). A partial Toll sequence (Toll5) is available from Genbank as DNAX # HSU88881-1.
In addition, a human homologue of the Drosophila Toll protein named Toll-like receptors (huTLRs1-5) has recently been cloned and shown to mirror the tissue distribution structure of the Drosophila counterpart (Rock et al., Proc. Natl). Acad. Sci. USA 95,588-593 [1998]). Overexpression of certain human TLR constitutively active mutants (Toll protein homologs—Medzhitov et al., Supra; TLR4-Rock et al., Supra) is responsible for NF-κB activation and inflammatory cytokines and costimulatory molecules Leads to induction. Medzhitov et al., Supra.
We describe here the identity and characterization of a novel polypeptide having homology to Toll, herein designated as PRO385 polypeptide.

15. PRO1310
Of particular interest are proteins related to carboxypeptidases. Various carboxypeptidases are described in the literature, eg Krause et al., Immunol. Rev. 161: 119-127 (1998) and J. Endocrinol. 155 (2): 211-214 (1997). We describe here the identity and characterization of a novel polypeptide having homology to carboxypeptidase, designated herein as PRO1310 polypeptide.
16. PRO698
The extracellular mucosa matrix of the olfactory neuroepithelium is highly organized in the immediate vicinity of chemoreceptive cilia that contain olfactory transmitters. The main protein component of this extracellular matrix is olfactmedin, a glycoprotein expressed in the olfactory neuroepithelium, forming intermolecular disulfide bonds to produce macromolecules (Yokoe et al., Proc. Natl. Acad. Sci. USA 90: 4655-4659 (1993), Bal et al., Biochemistry 32: 1047-1053 (1993) and Snyder et al., Biochemistry 30: 9143-9153 (1991)). Olufactmedin has been suggested to affect the maintenance, growth or differentiation of chemoreceptive cilia on the apical dendrites of olfactory neurons. Given this important role, there is significant interest in identifying and characterizing novel polypeptides having homology to olfactomedin. We describe here the same and characterization of a novel polypeptide with homology to olfactomedin, designated herein as PRO698 polypeptide.

17. PRO732
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide having sequence identity to the Diff33 protein, designated herein as PRO732 polypeptide.
18. PRO1120
Enzyme proteins play an important role in chemical reactions involved in food digestion, macromolecular biosynthesis, control of chemical energy utilization and release, and other processes necessary for life support. Sulfatases are a family of secreted enzyme proteins that play a variety of important metabolic roles and are therefore of interest in research and industry (eg, Sleat et al., Biochem. J., 324 (Pt. 1): 33-39 (1997)). Certain sulfatase deletions have been implicated in various human diseases including Sanfilipo D syndrome (Litjens et al., Biochem. J., 327 (Pt 1): 899-94 (1997); Leipprandt et al., J. Inherit Metab. Dis. 18 (5): 647-648 (1995); and Freeman et al., Biochem. J., 282 (pt2): 605-614 (1992)). Here we describe the identification and characterization of a novel polypeptide having sequence identity to the sulfatase protein, designated herein as PRO1120 polypeptide.

19. PRO537
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO537 polypeptide.
20. PRO536
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO536 polypeptide.

21. PRO535
Isomerase proteins play an important physiological role in mammals. Many different types of isomerases have been identified and characterized, including, for example, protein disulfide isomerase and peptidyl-prolyl isomerase. Many immunophilin proteins, ie, proteins that provide receptors for immunosuppressive agents, exert peptidyl-prolyl isomerase activity that functions to catalyze the cis and trans isomerase conversion of peptides and protein substrates for immunophilin proteins. Was reported. As such, the identification and characterization of novel polypeptides having sequence identity to the peptidyl-prolyl isomerase protein is of great interest. Here we describe the identification and characterization of a novel polypeptide homologous to the putative peptidyl-prolyl isomerase protein, designated herein as the PRO535 polypeptide.
22. PRO718
Both industrial and academic efforts are currently being made to identify and characterize new natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO718 polypeptide.

23. PRO872
Enzyme proteins play an important role in chemical reactions involved in food digestion, macromolecular biosynthesis, control of chemical energy utilization and release, and other processes necessary for life support. Dehydrogenases and desaturases are a family of proteins that play a variety of important metabolic roles and are therefore of interest in research and industry (eg, Hable et al., Mol. Gen. Genet. 257 (2): 167-176. Schneider, C. et al., Prot. Expr. Purif. 10 (2): 175-179 (1997)). Here we describe the identification and characterization of a novel polypeptide having sequence identity to the dehydrogenase, designated herein as PRO872 polypeptide.
24. PRO1063
Collagen constitutes the most abundant protein of the extracellular matrix (ECM) in mammalian organisms. Collagen and other macromolecules of ECM are stored by resident cells and organized into a three-dimensional network. This ECM environment plays an essential role in cell-to-cell communication during the induction of cell migration and morphogenesis. Reorganization of ECM during remodeling occurs as a competitive multi-step process involving localized degradation of existing macromolecules, cytoskeletal rearrangement, cell transfer, and precipitation of new ECM components. Included in this reconstitution are enzymes such as collagenase and gelatinase that play an important role in the degradation of ECM. In view of the clearly important role played by the collagenase enzyme, the identification and characterization of novel polypeptides having homology to these proteins is of great interest. Here we describe the identification and characterization of a novel polypeptide having homology to the human type IV collagenase protein, designated herein as PRO1063 polypeptide.

25. PRO619
Immunoglobulins are proteins that function as both antibody molecules, receptors for antigens on the B cell membrane, and secreted products of plasma cells. Like all antibody molecules, immunoglobulins serve two main functions: they bind specifically to antigens and they participate in a limited number of biological effector functions. Thus, new members of the Ig superfamily are always of interest.
Of particular interest is a novel gene product related to the mu chain of immature B cells, Shirasawa et al., EMBO J., 12 (5): 1827-1834 (1993); Dul et al., Eur. J. Immunol. 26 (4): 906-913 (1996). In addition, the molecular components and assembly of the mu surrogate light chain complex in the pre-B cell line is of interest. Ohnishi and Takemori, J. Biol. Chem., 269 (45): 28347-28353 (1994); Bauer et al., Curr. Top. Microbiol., 137: 130-135 (1988). Of particular interest are novel nucleic acids and peptides that are related by sequence identity to VpreB1, VpreB2, and VpreB3. The assembly and manipulation of immunoglobulins can affect all industries related to antibodies and vaccines.
Here we describe the identification and characterization of a novel polypeptide having homology to the VpreB protein, designated herein as the PRO619 polypeptide.
26. PRO943
Fibroblast growth factor (FGF) protein exhibits a variety of activities and acts by binding to cell surface fibroblast growth factor receptors. Many fibroblast growth factor receptors have been identified and characterized, including fibroblast growth factor receptor 4, which has shown high affinity for both acidic and basic FGF (Ron et al., J. Biol. Chem. 268 : 5388-5394 (1994) and Stark et al., Development 113: 641-651 (1991)). Given the obvious importance of FGF family proteins and the cell surface receptors to which they bind, the identification of novel polypeptides having homology to the FGF receptor family is of great interest. Here we describe the identification and characterization of a novel polypeptide having homology to the fibroblast growth factor receptor 4 protein, designated herein as the PRO943 polypeptide.

27. PRO1188
The identification of nucleotide pyrophosphohydrolase is of interest due to the potential role that these secreted molecules play in calcium pyrophosphate dihydrate (CPPD) deposition disease, arthritis, and other joint diseases (Masuda et al., J. Biol. Rheumatol. (997) 24 (8): 1588-1594; and Terkeltaub et al., Arthritis Rheum (1998) 37 (6): 934-941). Here we describe the identification and characterization of a novel polypeptide homologous to the nucleotide pyrophosphohydrolase, designated herein as PRO1188 polypeptide.
28. PRO1133
Netrin is a molecule that leads to growing axons and is very similar in sequence and function in flies, nematodes and vertebrates. Furthermore, netrin receptors have been identified in all three animal groups and have been shown to have an important and conservative role in axon guidance. Netrin and their receptors are described in the literature, for example Varela-Echavarria and Guthrie, Genes Dev., 11 (5): 545-557 (1997); Guthrie, Curr. Biol., 7 (1): R6-R9 (1997). And Keynes and Cook, Neuron, 17 (6): 1031-1034 (1996). Due to their relationship with neurons, netrin and their related proteins are of interest. Of particular interest are molecules having sequence identity or similarity with netrin. Here we describe the identification and characterization of a novel polypeptide having homology to netrin, designated herein as PRO1133 polypeptide.

29. PRO784
Of interest are membrane-bound and receptor proteins involved in intracellular signaling, metabolism, transport and other pathways. For example, the endoplasmic reticulum and Golgi apparatus membrane-bound proteins play an important role in protein transport. The sec22 protein is an endoplasmic reticulum membrane-bound protein that is involved in the basement membrane transport reaction where the secreted product is transported from its synthesis site to its final destination. The role of sec22 in the transport pathway has been reported by many researchers (Tang et al., Biochem Biophys Res Commun 243 (3): 885-891 (1998); Hay et al., J. Biol. Chem. 271 (10) : 5671-5679 (1996); and Newman et al., Mol. Cell. Biol. 10 (7): 3405-3414 (1990)). Here we describe the identification and characterization of a novel polypeptide with homology to sec22, designated herein as the PRO784 polypeptide.
30. PRO783
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO783 polypeptide.

31. PRO820
Immunoglobulin molecules play a role in many important mammalian physiological processes. The structure of immunoglobulins has been extensively studied, and it is well known that native immunoglobulins have distinct domains, one of which is the constant domain or Fc region of an immunoglobulin molecule. The Fc domain of an immunoglobulin is not directly involved in antigen recognition and binding, but is not complexed with its corresponding antigen, or the complexed immunoglobulin is circulating in the serum or on the cell surface Mediates the ability to bind to the receptor. The ability of an immunoglobulin Fc domain to bind to an Fc receptor molecule results in a variety of important activities including, for example, monitoring immune responses against unwanted foreign particles. Thus, molecules related to Fc receptors are of interest. Fc receptors are further described in Tominaga et al., Biochem. Biophys. Res. Commun., 168 (2): 683-689 (1990); Zhang et al., Immuno., 39 (6): 423-427 (1994). Yes. Here we describe the identification and characterization of a novel polypeptide having homology to the Fc receptor, designated herein as PRO820 polypeptide.
32. PRO1080
Protein folding and assembly of protein complexes within small components of eukaryotic cells is catalyzed by different members of the Hsp70 protein family. The chaperone function of the Hsp70 protein in these events is regulated by members of the DnaJ-like protein family, which occurs through direct interactions of various Hsp70 and Dnaj-like protein pairs that specifically match each other. The functional diversity of Dnaj-like proteins using specific examples of Dnaj-Hsp70 and polypeptide interactions in the yeast protein biosynthetic pathway is described by Cyr et al., Trends Biochem. Sci., 19 (4): 176-181 ( (1994). The Dnaj protein and its inclusion in the binding of the secreted precursor polypeptide to the translocon subcomplex and polypeptide translocation in the yeast endoplasmic reticulum are described in Lyman and Schekman, Cell 88 (1): 85-96 (1997) and Lyman and Shekman. , Experientia 52 (12): 1042-1049 (1996), respectively. Thus, DnaJ protein is of interest, as are proteins related to DnaJ, particularly those having sequence identity to DnaJ protein. Here we describe the identification and characterization of a novel polypeptide having homology to the DnaJ protein, designated herein as PRO1080 polypeptide.

33. PRO1079
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1079 polypeptide.
34. PRO793
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO793 polypeptide.

35. PRO1016
Enzyme proteins play an important role in chemical reactions involved in food digestion, macromolecular biosynthesis, control of chemical energy utilization and release, and other processes necessary for life support. An acyltransferase is an enzyme that acylates a site. Acyl-glycerol-phosphate acyltransferase can act on lysophosphatidic acid as a substrate. Lysophosphatidic acid is converted to phosphatidic acid and thus plays a role in the formation of phosphatidylethanolamine found in the membrane. See Brown et al., Plant Mol. Biol., 26 (1): 211-223 (1994). Thus, acyltransferases play an important role in the biosynthesis of molecules that require acylation. Here we describe the identification and characterization of a novel polypeptide having homology to the acyltransferase protein, designated herein as PRO1016 polypeptide.
36. PRO1013
Both industrial and academic efforts are currently being made to identify and characterize new natural proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel proteins. Here we describe the identification and characterization of a novel polypeptide, designated herein as the PRO1013 polypeptide.

37. PRO937
The glypican family of heparin sulfate proteoglycans is the major surface proteoglycan of the developing nervous system. Members of the glypican family are thought to play a role in regulating cell cycle progression while transforming proliferating neuronal precursors into differentiated neurons. Lander et al., Perspect Dev. Neurobiol 3 (4): 347-358 (1996). Glypican family proteoglycans play other important roles in neurodevelopment (Lander et al., Supra), and in other tissues as glypican family members are also found in developing kidneys (Watanabe et al., J. Cell Biol. 130 (5): 1207-1218 (1995)). Therefore, the identification of novel members of the glypican family of proteins is of interest in research and industry.
Described herein is an identified characterization of a novel polypeptide having sequence identity to a glypican family protein, designated herein as a PRO937 polypeptide.
38. PRO842
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO842 polypeptide.

39. PRO839
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO839 polypeptide.
40. PRO1180
A methyltransferase enzyme catalyzes the transfer of a methyl group from a donor molecule to an acceptor molecule. Methyltransferase enzymes play a pivotal role in many different biological processes including, for example, the electron transport chain at the prokaryotic plasma membrane and the inner mitochondrial membrane of eukaryotic cells (Barkovich et al., J. Biol Chem. 272: 9182-9188 (1997), Dibrov et al., J. Biol. Chem. 272: 9175-9181 (1997), Lee et al., J. Bacteriol., 179: 1748-1754 (1997), and Marbiois et al. , Arch. Biochem. Biophys. 313: 83-88 (1994)). Both methyltransferase enzymes have been shown to be essential for the biosynthesis of ubiquinone (coenzyme Q) and menaquinone (vitamin K2) required for the isoprenoid non-component of the respiratory electron transport chain. Given the obvious importance of the methyltransferase enzyme, the identification of novel homologues of methyltransferase is of great interest. Here we describe the identification and characterization of a novel polypeptide having homology to the methyltransferase enzyme, designated herein as PRO1180 polypeptide.

41. PRO1134
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1134 polypeptide.
42. PRO830
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO830 polypeptide.

43. PRO1115
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO1115 polypeptide.
44. PRO1277
Both industrial and academic efforts have been made to identify and characterize new natural proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptors and other proteins. Of interest is the identification of proteins that play a role in various human diseases and disorders. For example, identification of ear proteins and the functions they play in hearing leads to an understanding of the causes of hearing impairment and hearing loss. Coch-B2 is one such protein and was found to be specifically expressed in the inner ear (cochlea). It has been identified and the possible role in auditory injury has been studied (Robertson et al., Genomics (1994) 23 (1): 52-50; Robertson et al., Genomics (1997) 46 (3): 345-354). Here we describe the identification and characterization of a novel polypeptide having sequence identity with Coch-B2, designated herein as PRO1277 polypeptide.

45. PRO1135
Glycosylation is an important mechanism for the regulation of protein physicochemical and biological properties in a step- and tissue-specific manner. One of the important enzymes involved in glycosylation in Saccharomyces cerevisiae is alpha 1,2-mannosidase, an enzyme that converts Man9GlcNAc2 to Man8GlcNAc2 during the formation of N-linked oligosaccharides. The Saccharomyces cerevisiae alpha 1,2-mannosidase enzyme is a member of the class I alpha 1,2-mannosidase conserved from yeast to mammals. Given the important role played by alpha 1,2-mannosidase in glycosylation and physicochemical activities regulated by glycosylation, the identification of novel polypeptides with homology to one or more mannosidases is highly Interesting. Here we describe the identification and characterization of a novel polypeptide having homology to the alpha 1,2-mannosidase protein, designated herein as PRO1135 polypeptide.
46. PRO1114
Interferons (INFs) comprise a large family of secreted proteins that occur in vertebrates. Although they were initially named for their antiviral activity, increasing evidence supports an important role for INFs in cell growth and differentiation (Jaramillo et al., Cancer Investigation 13 (3): 327-338 (1995)). INFs are negative growth factors that have the ability to inhibit the growth of a wide range of cells with normal and transformed phenotypes. INF treatment has been shown to be effective in the treatment of human cachexia such as Kaposi's sarcoma, chronic myelogenous leukemia, non-Hodgkin's lymphoma, and hairy cell leukemia, and infectious diseases such as hepatitis B ( Gamliel et al., Scanning Microscopy 2 (1): 485-492 (1988), Einhorn et al., Med. Oncol. & Tumor Pharmacother. 10: 25-29 (1993), Ringenberg et al., Missouri Medicine 85 (1): 21-26 (1988), Saraco et al., Journal of Gastroenterology and hepatology 10: 668-673 (1995), Gonzalez-Mateos et al., Hepato-Gastroenterology 42: 893-899 and Malaguarnera et al., Pharmacotherapy 17 (5): 998-1005 (1997) ).
Interferons can be classified into two main groups based on their primary sequence. Type I interferons, IFN-α and IFN-β are encoded by a single IFN-β gene that appears to have originated from a common ancestral gene with a superfamily of intronless genes consisting of the IFN-α gene family. Type I interferons can be produced by most cell types. Type II IFN or IFN-γ is restricted to lymphocytes (T cells and natural killer cells) and is stimulated in vivo by non-specific T cell activators or specific antigens.
Although both Type I and Type II IFNs create similar antiviral and antiproliferative effects, they act on distinct cell surface receptors and binding is generally species specific (Langer et al., Immunol. Today 9: 393 -400 (1988)). Both IFN-α and IFN-β bind competitively to the same high affinity type I receptor, while IFN-γ binds to another type II receptor. Although it is clear that the effects of IFN proteins are mediated through binding to cell surface interferon receptors, the presence and number of IFN receptors on the cell surface generally does not reflect the sensitivity of cells to IFN. Thus, the identification and characterization of novel interferon receptor proteins is extremely interesting.
We describe here the identification and characterization of a novel interferon receptor polypeptide, designated herein as the “PRO1114 interferon receptor” polypeptide. Accordingly, the PRO1114 polypeptide of the present invention represents a novel cell surface interferon receptor.

47. PRO828
Glutathione peroxidases are interesting because they play an important role in protecting against annular arterial disease, atherosclerosis, platelet hyperaggregation and the risk of synthesis of proaggregates and proinflammatory components. Glutathione peroxidase is involved in the reduction of hydrogen peroxide and lipid peroxide and in turn regulates the activity of the cyclooxygenase and lipooxygenase pathways. This ultimately affects the production of eicosanoids and regulates the equilibrium between platelet aggregation promotion and aggregation inhibition phases. These and other activities and functions of glutathione peroxidase are described in Ursini et al., Biomed. Envion. Sci 19 (2-3); Vitoux et al., Ann. Biol. Clin (Paris) 54 (5): 181-187 (1996); And Mirault et al., Ann NY Acad. Sci. 738: 104-115 (1994).
Here we describe the identification and characterization of a novel polypeptide having sequence identity with glutathione peroxidase, designated herein as PRO828 polypeptide.
48. PRO1009
Long chain acyl-CoA synthase converts free fatty acids to acyl-CoA esters. Interesting features have been reported for this synthase. In particular, it has been reported that two boys with Alport syndrome, elliptical erythrocytosis and mental retardation have a large deletion in which long-chain acyl-CoA synthase 4 is localized. That is, the absence of this enzyme is thought to play a role in mental retardation or other symptoms associated with Alport syndrome in the family. Piccini et al., Genomics, 47 (39: 350-358 (1998). Furthermore, triacin C, an inhibitor of acylcoenzyme A synthase, was reported to inhibit superoxide production and degranulation by human neutrophils. Thus, it has been suggested that there is a role for acyl-CoA in the regulation or subsequent steps of O ₂ production and degranulation activation with G protein, Korchak et al., J. Biol. Chem., 269 (48). 30281-30287 (1994) Long chain acyl-CoA synthases are also discussed in reports describing ultra long chain acyl-CoA synthases Uchiyama et al., J. Biol. Chem 271 (48): 30360 ( 1994) Therefore, long-chain acyl-CoA synthases, particularly novel polypeptides having sequence identity therewith are of interest.
We describe here the identification of a novel polypeptide having sequence identity to the long chain acyl-CoA synthase, designated herein as the PRO1009 polypeptide.

49. PRO1007
Glycosylphosphatidylinositol (GPI) -anchored proteoglycans are generally known to be localized on the cell surface and thus involved in the regulation of cellular responses to many growth factors, cell adhesion molecules and extracellular matrix components. Metastasis-related GPI anchor protein (MAGPIAP) is one of these cell surface proteins and has been found to be involved in metastasis. Metastasis is a form of cancer in which transformed or malignant cells migrate and spread the cancer from one site to another. Therefore, the identification of polypeptides related to metastasis and MAGPIAP is of interest.
We describe here the identification of a novel polypeptide having sequence identity to MAGPIAP, designated herein as PRO1007 polypeptide.
50. PRO1056
Mammalian cell membranes perform very important functions regarding the structural integrity and activity of various cells and tissues. Of particular interest in membrane physiology is the study of transmembrane ion channels that act to directly control various physiological, pharmacological and cellular processes. Numerous ion channels have been identified, including calcium (Ca), sodium (Na), chloride (Cl) and potassium (K) channels, each analyzed in detail, and the physiology of vertebrate and insect cells Its role in the process has been determined. These roles include such things as maintaining ionic homeostasis and intracellular signaling. Given the obvious importance of ion channels, there is considerable interest in identifying and characterizing novel polypeptides that have homology to a position or multiple ion channels. We describe here the identification and characterization of a novel polypeptide having homology to a chloride channel protein, designated herein as PRO1056 polypeptide.

51. PRO826
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO826 polypeptide.
52. PRO819
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO819 polypeptide.

53. PRO1006
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1006 polypeptide.
54. PRO1112
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1112 polypeptide.

55. PRO1074
Many membrane-bound enzyme proteins play an important role in chemical reactions involved in metabolism, macromolecular biosynthesis, control of chemical energy utilization and release, and other processes necessary for life support. Galactosyltransferases are a family of enzymes that play a variety of important metabolic roles and are therefore the subject of research and industrial interest. A number of references have been published regarding the identification of galactosyltransferases and their role in cell development, maintenance and dysfunction.
Here we describe the identification and characterization of a novel polypeptide homologous to galactosyltransferase, designated herein as PRO1074 polypeptide.
56. PRO1005
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1005 polypeptide.

57. PRO1073
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1073 polypeptide.
58. PRO1152
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1152 polypeptide.

59. PRO1136
PDZ domain-containing proteins help cell-cell binding and localization of membrane protein receptors and ion channels (Daniels et al., Nat. Struct. Biol. 5: 317-325 (1998) and Ullmer et al., FEBS Lett. 424: 63 -68 (1998). The PDZ domain interacts with the C-terminal residue of certain target membrane proteins. Based on their binding specificity and sequence homology, PDZ domains are divided into two classes, class I and class II, and the identification of novel polypeptides with homology to these proteins is of significant interest. is there. Here we describe the identification and characterization of a novel polypeptide having homology to a PDZ domain-containing protein, designated herein as PRO1136 polypeptide.
60. PRO813
Surface active proteins play a vital role in the mammalian lung system. One mammalian protein that has been studied and well characterized is pulmonary surfactant related protein C. For example, Qanbar et al., Am. J. Physiol. 271: L572-L580 (1996). The effect of palmitoylation of pulmonary surface activity-related protein C on the surface activity of phospholipid mixtures was studied. In particular, the authors argued that palmitoylation of pulmonary surface activity-related protein C greatly affects lipid re-diffusion and film stability and is therefore critical to surface activity function. Given the important role played by surface-active proteins in mammalian organisms, the identification of novel polypeptides having homology to one or more surface-active proteins is of great interest. Here we describe the identification and characterization of a novel polypeptide having homology to a pulmonary surfactant related protein, designated herein as PRO813 polypeptide.

61. PRO809
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO809 polypeptide.
62. PRO791
Of particular interest are novel proteins that have sequence identity with known proteins and nucleic acids. For example, novel proteins that have some degree of sequence identity with the major histocompatibility complex (MHC) are of interest. The MHC complex is a region of multiple loci that plays a major role in determining whether the transplanted tissue is self-acceptable (histocompatibility) or rejected as foreign (tissue incompatibility). Furthermore, MHC plays a central role in the progression of both humoral and cell-mediated immune responses. There are class I, II and III MHC antigens, all known in the art. Class I antigens are glycoproteins expressed on the surface of almost all nucleated cells and display altered autologous peptide antigens necessary for Tc cell activation. The assembly of MHC class I antigens is further described in Kvist and Levy, Semin. Immunol., 5 (2): 105-116 (1993) and Maffei et al., Hum Immunol., 54 (2): 91-103 (1997). Has been.
We describe here the identification of novel polypeptides having sequence identity with various MHC-I antigens, designated herein as PRO791 polypeptides.

63. PRO1004
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1004 polypeptide.
64. PRO1111
Protein-protein interactions include those associated with receptors and antigen complexes and signal transduction mechanisms. As is well known for the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions are more easily manipulated to modulate specific outcomes of protein-protein interactions. be able to. Thus, the mechanisms underlying protein-protein interactions are of interest to the scientific and medical communities.
All proteins containing leucine-rich repeats are thought to be involved in protein-protein interactions. Leucine rich repeats are short sequence motifs present in many proteins and cell locations with diverse functions. The crystal structure of the ribonucleic acid inhibitor protein revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged to form parallel β-sheets with one side exposed to the solvent, and the protein acquires an unusual non-spherical shape. These two features have been shown to be responsible for the protein binding function of proteins containing leucine-rich repeats. See Kobe and Deisenhofer, Trends Biochem. Sci., 19 (10): 415-421 (Oct. 1994).
Studies have been reported on leucine-rich proteoglycans that become tissue organizers that direct and direct collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stromal formation. Iozzo, RV, Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies showing the involvement of leucine-rich proteins in wound healing and tissue repair are in De La Salle, C. et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995). And reported mutations in the leucine-rich motif in the complex associated with the bleeding disorder Bernard-Soulier syndrome, Chlemetson, KJ, Thromb. Haemost. (Germany), 74 (1): 111-116 (July 1995) Report that platelets have leucine-rich repeats, and WO9110727-A by La Jolla Cancer Research Foundation Ruoslahti, EI et al. States that decorin binding to transforming growth factor β is a cancer treatment, wound healing And have been reported to be involved in scarring. Useful in wound healing and concomitant therapies associated with regrowth of tissues such as connective tissue, skin and bone; by promoting body growth in humans and animals; and in stimulating other growth-related processes In some, the function associated with this group of proteins is insulin-like growth factor (IGF). The acid labile subunit (ALS) of IGF is also interesting in that it increases the half-life of IGF and is part of the in vivo IGF complex.
Other proteins reported to have leucine-rich repeats have been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for cancer diagnosis. SLIT protein. See Artavanistsakonas, S. of Yale University and WO9210518-A1 of Rothberg, JM. Also of interest is LIG-1, a membrane glycoprotein that is specifically expressed in glial cells of the mouse brain and has leucine-rich repeats and immunoglobulin-like domains. Suzuki et al., J. Biol. Chem. (US), 271 (37): 22522 (1996). Other studies reporting biological functions of proteins with leucine-rich repeats include: Tayar, N. et al., Mol. Cell Endocrinol., (Ireland), 125 (1-2): 65-70 (Dec 1996) (gonadotropin receptor related); Miura, Y. et al., Nippon Rinsho (Japan), 54 (7): 1784-1789 (July 1996) (apoptosis related); Harris, PC et al., J. Am. Soc. Nephrol ., 6 (4): 1125-1133 (Oct. 1995) (related to kidney disease).
Here we describe the identification and characterization of a novel polypeptide homologous to LIG, designated herein as the PRO1111 polypeptide.

65. PRO1344
Factor C is a protein that is intimately involved in the clotting cascade of various organisms. The clotting cascade includes a number of different mediator proteins, including factor C, all of which are essential for the correct functioning of this cascade. Abnormal clotting cascade functions lead to a variety of significant abnormalities, and thus the activity of clotting cascade proteins is of particular interest. Thus, efforts are currently being made to identify novel polypeptides having homology with one or more coagulation cascade proteins.
Here we describe the identification and characterization of a novel polypeptide having homology to the Factor C protein, designated herein as PRO1344 polypeptide.
66. PRO1109
Sugar chains on glycoproteins are important not only for protein conformation, transport and stability, but also for cell-cell and cell-matrix interactions. β-1,4-galactosyltransferase is an enzyme involved in the production of sugar chains on proteins, and β-1,4-galactosyltransferase converts galactose to terminal N-acetyl in a complex N-glycan in the Golgi apparatus. It acts to move to glucosaminoglycans (Asano et al., EMBO J. 16: 1850-1857 (1997)). Furthermore, it was suggested that β-1,4-galactosyltransferase is directly involved through cell-cell interactions during pregnancy and a subpopulation of this enzyme distributed on the cell surface early in embryogenesis. In particular, Lu et al., Development 124: 4121-4131 (1997) and Larson et al., Biol. Reprod. 57: 442-453 (1997), reported that β-1,4-galactosyltransferase was not used in sperm from various mammalian species. It was expressed on the surface, suggesting an important role in pregnancy. In view of the above, novel polypeptides having sequence identity with β-1,4-galactosyltransferase are of interest.
Here we describe the identification and characterization of a novel polypeptide with homology to β-1,4-galactosyltransferase, designated herein as PRO1109 polypeptide.

67. PRO1383
The nmb gene is a novel gene that is differentially expressed in metastatic human melanoma cell lines and shows significant homology to the precursor of a melanocyte-specific protein called pMEL17 (Weterman et al., Int. J. Cancer 60 : 73-81 (1995)). Due to the interest in identifying tumor-specific cell surface polypeptide markers, novel polypeptides with homology to nmb are of considerable interest. Here we describe the identification and characterization of a novel polypeptide homologous to the nmb protein, designated herein as the PRO1383 polypeptide.
68. PRO1003
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1003 polypeptide.

69. PRO1108
Lysophosphatidylate acyltransferase (LPAAT) is an enzyme that converts lysophosphatidic acid (LPA) to phosphatidic acid (PA) in lipid metabolism. LPA is a phospholipid that acts as an intermediate in membrane phospholipid metabolism. Various LPAAT enzymes have been identified in various species (eg, Aguado et al., J. Biol. Chem. 273: 4096-4105 (1998), Stamp et al., Biochem. J. 326: 455-461 (1997), Eberhart et al., J. Biol. Chem. 272: 20299-20305 (1997) and West et al., DNA Cell Biol. 16: 691-701 (1997)). Given the obvious importance of LPAAT in various applications including cell membrane maintenance, there is significant interest in identifying and characterizing novel polypeptides having homology to LPAAT. Here we describe the identification and characterization of a novel polypeptide having homology to LPAAT, designated herein as PRO1108 polypeptide.
70. PRO1137
A specific class of secreted polypeptides of research and industrial interest are ribosyltransferases. Braren et al. Describe the use of EST databases for the identification and cloning of novel ribosyltransferase gene family members (Adv. Exp. Med. Biol. 419: 163-168 (1997)). Ribosyltransferases are known for post-translational modification of proteins (Saxty et al., J. Leukoc. Biol., 63 (1): 15-21 (1998)) and for the assembly and chemotaxis of filamentous actin in polymorphonuclear neutrophil leukocytes. It has been identified to play a role in various metabolic functions including mediation (Kefakas et al., Adv. Exp. Med. Biol. 419: 241-244 (1997)).
Described herein is the identification and characterization of a novel polypeptide having homology to ribosyltransferase, designated herein as PRO1137 polypeptide.

71. PRO1138
Both industrial and academic efforts are currently being made to identify and characterize new natural receptor proteins. Many of these efforts have concentrated on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. Of particular interest is the identification of membrane-bound proteins found in hematopoietic cells, as they play an important role in combating infection and repairing damaged tissues and other activities of hematopoietic cells. For example, the CD84 leukocyte antigen has recently been identified as a new member of the Ig superfamily (de la Fuente et al., Blood, 90 (6): 2398-2405 (1997)).
Described herein is the identification and characterization of a novel polypeptide having homology to the CD84 leukocyte antigen, designated herein as PRO1138 polypeptide.
72. PRO1054
Proteins of the major urinary protein complex (MUP), a member of the lipocalin family, act on binding to volatile pheromones and interact with the sensory epithelium of the olfactory nose. Thus, proteins in the MUP family are strongly associated with the access process between mammals of different sex. Many different members of the MUP family have been identified and characterized and shown to have varying degrees of amino acid sequence homology (eg, Mucignat et al., Chem. Senses 23: 67-70 (1998), Ferrari Et al., FEBS Lett. 401: 73-77 (1997) and Bishop et al., EMBO J. 1: 615-620 (1982)). Given the physiological and biological importance of the MUP family of proteins, the identification and characterization of new members of this family is of considerable interest. Here we describe the identification and characterization of a novel polypeptide homologous to the MUP family of proteins, designated herein as the PRO1054 polypeptide.

73. PRO994
L6 cell surface antigens are highly expressed in lung, breast, colon, and ovarian cancer and are attracting attention as potential therapeutic targets for mouse monoclonal antibodies and their humanized counterparts (Marken et al., Proc. Natl. Acad. Sci. USA 89: 3503-3507 (1992)). The cDNA encoding this tumor-associated cell surface antigen was expressed in COS cells and was shown to encode a 202 amino acid polypeptide with three transmembrane domains. The L6 antigen has been shown to be associated with a number of cell surface proteins involved in the regulation of cell growth, including for example CD63 and CO-029, as well as proteins that are highly expressed in tumor cells. Thus, the identification of novel polypeptides having homology to the L6 tumor cell antigen as a potential target for cancer therapy is extremely interesting. Here we describe the identification and characterization of a novel polypeptide homologous to the L6 cell surface tumor cell associated antigen, designated herein as the PRO994 polypeptide.
74. PRO812
Steroid binding proteins play an important role in many physiological processes involving steroid function. In particular, one well-characterized steroid-binding protein-related polypeptide is component 1 of prostate-binding protein, component 1 of prostate-binding protein is a prostate-binding protein that is the major secreted glycoprotein of the mouse ventral prostate Specific subunit F (Peeters et al., Eur. J. Biochem. 123: 55-62 (1982) and Liao et al., J. Biochem. 257: 122-125 (1982)). The amino acid sequence of component 1 of prostate binding protein was identified and the sequence was very rich in glutamate and overall highly acidic. This protein plays an important role in the response of the prostate to steroid hormones. Here we describe the identification and characterization of a novel polypeptide having homology to prostate steroid binding protein c1, designated herein as PRO812 polypeptide.

75. PRO1069
Of particular interest is the identification of novel membrane-bound proteins involved in ionic conduction such as channel inhibitor (CHIF) and MAT-8, which have recently been reported (Wald et al., Am. J. Physiol. 272 (5 pt 2): F617-F623 (1997); Capurro et al., Am. J. Physiol. 271 (3 pt 1): C753-C762 (1996); Wald et al., Am. J. Physiol, 271 (2 pt 2 ): F322-F329 (1996); and Morrison et al., J. Biol. Chem. 270 (5): 2176-2182 (1995)).
Described herein is the identification and characterization of a novel polypeptide having homology to CHIF and MAT-8 polypeptides, designated herein as PRO1069 polypeptide.
76. PRO1129
Cytochrome P-450 is a superfamily of homoproteins that represent the major pathways of drug and chemical oxidation (Horsmans, Acta gastroenterol. Belg. 60: 2-10 (1997)). This superfamily is divided into families, subfamilies, and / or single enzymes. Recent reports have provided very detailed information on cytochrome P-450 isozymes, giving increased recognition of life-and-death interactions with commonly prescribed drugs such as cisapride and antihistamines (Michalets, Pharmacotherapy 18: 84-112 (1998) and Singer et al., J. Am. Acad. Dematol. 37: 765-771 (1997)). Given this information, the identification of novel members of cytochrome P-450 family proteins is of significant interest. Here we describe the identification and characterization of a novel polypeptide homologous to cytochrome P-450, designated herein as PRO1129 polypeptide.

77. PRO1068
Urotensin is a neurosecretory protein, smooth muscle contraction (Yano et al., Gen. Comp. Endocrinol. 96 (3); 412-413 (1994)), regulation of arterial blood pressure and heart rate (le Mevel et al., Am. J. Physiol. 271 (5 Pt 2): R1335-R1343 (1996)), and corticosteroid secretion (feuilloley et al., J. Steroid Biochem Mol. Biol. 48 (2-3): 287-292 (1994)) Interesting because of their potential role in various physiological processes.
Here we describe the identification and characterization of a novel polypeptide homologous to urotensin, designated herein as PRO1068 polypeptide.
78. PRO1066
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1066 polypeptide.

79. PRO1184
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1184 polypeptide.
80. PRO1360
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1360 polypeptide.
81. PRO1029
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1029 polypeptide.

82. PRO1139
Obesity is the most common nutritional disease, with recent epidemiological studies affecting approximately one-third of Americans over the age of 20. Kuczmarski et al., J. Am. Med. Assoc. 272, 205-11 (1994). Obesity causes a variety of serious health problems including cardiovascular disease, type II diabetes, hypertension, hyperglyceridemia, lipoprotein deficiency, and several cancer forms. Pi-Sunyer, FX, Anns. Int. Med. 119, 655-60 (1993); Colfitz, GA, Am. J. Clin. Nutr. 55, 503S-507S (1992). Single gene mutations (obesity or “ob” mutations) resulted in obesity and type II diabetes in mice. Friedman, Genomics 11, 1054-1062 (1991). Zhang et al., Nature 372, 425-431 (1994) recently reported the cloning and sequencing of the mouse ob gene and its human homologue, where the ob gene product regulates the size of body fat accumulation, a signal from adipose tissue. It is suggested that it functions as a part of the transmission pathway. A parallel binding experiment carried out more than 20 years ago shows that genetic obese mice (ob / ob mice) with two mutant copies of the ob gene do not produce satiety factors that regulate food intake, and diabetes (db / db) Mice were predicted to produce but not respond to satiety factors. Coleman and Hummal, Am. J. Physiol. 217, 1298-1304 (1969); Coleman, Diabetol. 9, 294-98 (1973). OB proteins are disclosed, for example, in US Pat. Nos. 5,532,336, 5,552,522, 5,552,523, 5,552,514, and 5,554,727. A recent report by three independent research teams showed that daily injections of recombinant OB gene inhibited food intake and decreased body weight and fat in ob / ob mice that were obese visually obese, although db / db (Pelleymounter et al., Science 269, 540-43 [1995]; Halaas et al., Science 269, 543-46 [1995]; Camfield et al., Science 269, 546-49 [1995]) , Suggesting that the ob protein is a satiety factor as proposed in early cross-circulation studies.
The receptor for OB protein (OB-R) is disclosed in Tartaglia et al., Cell 83, 1263-71 (1995). OB-R is a single membrane spanning receptor homologue of class I cytokine receptor family members (Tartaglia, supra; Bazan, Proc. Natl. Acad. Sci. USA 87, 6934-6938 [1990]). Two 5'-untranslated regions and several 3'-alternative splicing variants encoding BO-R with different length cytoplasmic domains have been described in mice, rats and humans (Chen et al. Cell 84, 491-495 [1996]; Chua et al., Science 271, 994-996 [1996]; Tartaglia et al., Supra; Wang et al., FEBS Lett. 392: 87-90 [1996]; Phillips et al., Nature Genet. 13 , 18-19 [1996]; Cioffi et al., Nature Med., 2: 585-589 [1996]). A human blood protein receptor that can be a receptor for the OB protein is described in PCT application publication WO 96/08510 issued on March 21, 1996.
Bailleul et al., Nucl acids Res. 25, 2752-2758 (1997) identified a human mRNA splicing variant of the OB-R gene, which identified a novel protein called leptin receptor gene-related protein (OB-RGRP). Potentially code. This protein does not show sequence identity with the leptin receptor itself. The authors found that the OB-RGRP gene shares its promoter and two exons with the OB-R gene, and in order to elicit a total physiological response to leptin in vivo, the cooperative expression of OB-R and OB-RGRP Suggested that is necessary.

83. PRO1309
Protein-protein interactions include receptor and antigen complexes and signal transduction mechanisms. As is well known for the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions are more easily manipulated to modulate specific outcomes of protein-protein interactions. be able to. Thus, the mechanisms underlying protein-protein interactions are of interest to the scientific and medical communities.
All proteins containing leucine-rich repeats are thought to be involved in protein-protein interactions. Leucine rich repeats are short sequence motifs present in many proteins and cell locations with diverse functions. The crystal structure of the ribonucleic acid inhibitor protein revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged to form parallel β-sheets with one side exposed to the solvent, and the protein acquires an unusual non-spherical shape. These two features have been shown to be responsible for the protein binding function of proteins containing leucine-rich repeats. See Kobe and Deisenhofer, Trends Biochem. Sci., 19 (10): 415-421 (Oct. 1994); Kobe and Deisenhofer, Curr. Opin. Struct. Biol., 5 (3): 409-416 (1995). I want to be.
Studies have been reported on leucine-rich proteoglycans that become tissue organizers that direct and direct collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stromal formation. Iozzo, RV, Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies showing the involvement of leucine-rich proteins in wound healing and tissue repair are in De La Salle, C. et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995). And reported mutations in the leucine-rich motif in the complex associated with the bleeding disorder Bernard-Soulier syndrome, Chlemetson, KJ, Thromb. Haemost. (Germany), 74 (1): 111-116 (July 1995) Report that platelets have leucine-rich repeats, and WO9110727-A by La Jolla Cancer Research Foundation Ruoslahti, EI et al. States that decorin binding to transforming growth factor β is a cancer treatment, wound healing And have been reported to be involved in scarring. Useful in wound healing and concomitant therapies associated with regrowth of tissues such as connective tissue, skin and bone; by promoting body growth in humans and animals; and in stimulating other growth-related processes In some, the function associated with this group of proteins is insulin-like growth factor (IGF). The acid labile subunit (ALS) of IGF is also interesting in that it increases the half-life of IGF and is part of the in vivo IGF complex.
Other proteins reported to have leucine-rich repeats have been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for cancer diagnosis. SLIT protein. See Artavanistsakonas, S. of Yale University and WO9210518-A1 of Rothberg, JM. Also of interest is LIG-1, a membrane glycoprotein that is specifically expressed in glial cells of the mouse brain and has leucine-rich repeats and immunoglobulin-like domains. Suzuki et al., J. Biol. Chem. (US), 271 (37): 22522 (1996). Other studies reporting biological functions of proteins with leucine-rich repeats include: Tayar, N. et al., Mol. Cell Endocrinol., (Ireland), 125 (1-2): 65-70 (Dec 1996) (gonadotropin receptor related); Miura, Y. et al., Nippon Rinsho (Japan), 54 (7): 1784-1789 (July 1996) (apoptosis related); Harris, PC et al., J. Am. Soc. Nephrol ., 6 (4): 1125-1133 (Oct. 1995) (related to kidney disease).
Therefore, both industrial and academic efforts have been made to identify novel proteins with leucine-rich repeats to better understand protein-protein interactions. Of particular interest are proteins that have leucine-rich repeats and have homology with proteins known to have leucine-rich repeats such as platelet glycoproteins V, SLIT and ALS. Much of the effort has focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins with leucine-rich repeats.

84. PRO1028
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1028 polypeptide.
85. PRO1027
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1027 polypeptide.

86. PRO1107
Of particular interest are novel proteins that have some degree of sequence identity with known proteins. Known proteins include PC-1, alkaline phosphodiesterase I and ecto-enzyme with nucleotide pyrophosphatase activity and are further described in Belli et al., Eur. J. Biochem., 228 (3): 669-676 (1995). Yes. Phosphodiesterases are also described in Fuss et al., J. Neurosci., 17 (23): 9095-9103 (1997) and Scott et al., Hepatology, 25 (4): 99-1002 (1997). Phosphodiesterase I has been described as a novel adhesin molecule and / or cytokine (associated with autotoxins) involved in oligodendritic cell function. Fuss above.
We describe here the identification of a novel polypeptide having homology with PC-1, designated herein as the PRO1107 polypeptide.
87. PRO1140
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1140 polypeptide.

88. PRO1106
Since mitochondria are the primary cause of energy production, proteins associated with mitochondria are of interest. Recently, as described in Weber et al., PNAS USA, 94 (16): 8509-8514 (1997), cDNA from a novel Ca ^++- dependent member of the mitochondrial solute carrier superfamily has been used in rabbit small intestine cDNA. Isolated from library. This transporter has been reported to have four elongation factor-hand motifs at the N-terminus and localize to the peroxisome, but fragments are also found in mitochondria. Thus, proteins with sequence identity with this transporter and other members of this and the mitochondrial solute carrier superfamily are of interest.
Here we describe the identification and characterization of a novel polypeptide homologous to the peroxisomal calcium-dependent solute carrier protein, designated herein as PRO1106 polypeptide.
89. PRO1291
Butyrophilin is a lactose protein that constitutes over 40% of the total protein bound to the fat globule membrane of mammalian milk. The expression of butyrophilin mRNA correlates with the onset of milk fat production at the end of pregnancy and has been shown to be maintained throughout the lactation phase. Butyrophilin has been identified in cattle, mice and humans (Taylor et al., Biochim. Biophys. Acta 1306: 1-4 (1996), Ishii et al., Biochim. Biophys. Acta 1245: 285-292 (1995), Mather et al., J. Dairy Sci. 76: 3832-3850 (1993) and Banghart et al., J. Biol. Chem. 273: 4171-4179 (1998)), which is a type I transmembrane protein incorporated into the globulin membrane. It suggests that butyrophilin may serve as a key scaffold for the assembly of xanthine dehydrogenase / oxidase and complexes with other proteins that function in the germination and release of milk fat globules from the apical surface during lactation (Banghart et al., Supra).
Since butyrophilin clearly has an important role in mammalian milk production, there is considerable interest in identifying novel butyrophilin homologues. We describe here the identification and characterization of a novel polypeptide having homology to butyrophilin, designated herein as PRO1291 polypeptide.

90. PRO1105
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1105 polypeptide.
91. PRO511
An interesting protein is RoBo-1, urokinase plasminose that is selectively expressed in bone and growth plate cartilage as described in Noel et al., J. Biol. Chem. 273 (7): 3878-3883 (1998). Includes those with sequence identity to novel members of the genactivator receptor / CD59 / Ly-6 / snake toxin family. RoBo-1 is thought to play a new role in bone growth and remodeling. Interesting proteins also include those that have sequence identity with phospholipase inhibitors.
Here we describe here the identification and characterization of a novel polypeptide having homology to the urokinase plasminogen activator receptor and phospholipase inhibitor, designated herein as the PRO511 polypeptide.

92. PRO1104
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1104 polypeptide.
93. PRO1100
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1100 polypeptide.

94. PRO836
Of interest are luminal proteins, or proteins specific for the endoplasmic reticulum (ER). Of particular interest are novel proteins that have sequence identity with known proteins. Known proteins include proteins such as SLS1. In Saccharomyces cerevisiae, SLS1 is reported to be an integral membrane protein of mitochondria involved in mitochondrial metabolism. Rouillard et al., Mol. Gen. Genet., 252 (6): 700-708 (1996). It has been reported that the SLS1 gene product (SLS1p) behaves as a ER luminal protein in the yeast, Yarrowia lipolytca. SPS1p acts in the preprotein translocation process and is thought to interact directly with translocation polypeptides to promote their translocation and / or assist in folding in the ER. Bosirame et al., J. Biol. Chem., 271 (20): 11668-11675 (1996).
Here we describe here the identification and characterization of a novel polypeptide having homology to SLS1, designated herein as the PRO836 polypeptide.
95. PRO1141
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1141 polypeptide.

96. PRO1132
Proteases are enzyme proteins that are involved in many very important biological processes in mammalian and non-mammalian organisms. Many different protease enzymes from a variety of different mammalian and non-mammalian organisms have been identified and characterized, including serine proteases that exhibit specific activity against a variety of serine-containing proteins. Mammalian protease enzymes play an important role in biological processes such as protein digestion, activation, inactivation, or modulation of peptide hormone activity, and modification of physical properties of proteins and enzymes.
Neuropsin is a novel serine protease whose mRNA is expressed in the central nervous system. Mouse neuropsin has been cloned and studies have shown that it is involved in hippocampal plasticity. Neuropsin has also been shown to be involved in extracellular matrix modification and cell migration. See generally Chen et al., Neurosci. 7 (2): 5088-5097 (1995) and Chen et al., J. Histochem., 46: 313-320 (1998).
Another serine protease of interest is the enamel matrix serine protease. Dental enamel maturation promotes organic matrix degradation. Inhibition experiments have shown that this degradation is related to serine-type proteases. Proteases associated with enamel maturation are, for example, Simmer et al., J. Dent. Res., 77 (2): 377-386, Overall and Limeback, Biochem J., 256 (3): 96-972 (1988) and moradian. -Oldak, Conect Tissue Res., 35 (1-4): 231-238 (1996).
Here we describe here the identification of a novel polypeptide having homology to a serine protease, designated herein as PRO1132 polypeptide.

97. PRO1346
The abbreviations “TIE” or “tie” stand for “tyrosine kinase-containing Ig and EGF homology domains” and are expressed almost exclusively in vascular endothelial cells and early hematopoietic cells, EGF-like domains, and generally It was created to represent a novel family of receptor tyrosine kinases characterized by the presence of extracellular folding units stabilized by intrachain disulfide bonds called “immunoglobulin (IG) -like” folding. Tyrosine kinase homologue cDNA fragments from human leukemia cells (tie) are described in Partanen et al., Proc. Natl. Acad. Sci. USA 87, 8913-8917 (1990). This human “TIE” receptor mRNA was detected in all human fetal and mouse embryonic tissues and was reported to be localized in the heart and vascular endothelial cells. Korhonen et al., Blood 80, 2548-2555 (1992); PCT application publication WO 93/14124 (issued July 22, 1993). The rat homologue of human TIE is called “TIE-1” and was identified by Maisonpierre et al., Oncogene 8, 1631-1637 (1993). Another TIE receptor termed “TIE-2” was first identified in the rat (Dumont et al., Oncogene 8, 1293-1301 (1993)) and the human homologue of TIE-2 termed “ork” is US Pat. No. 5,447,860 (Ziegler). The mouse homologue of TIE-2 was initially named “tek”. Cloning of the mouse TIE-2 receptor from the brain capillary cDNA library is described in PCT application publication WO 95/13387 (issued May 18, 1995). TIE-2 is a receptor tyrosine kinase that is expressed almost exclusively on the vascular endothelium. TIE-2 knockout mice die from defects in microangiogenesis. Therefore, TIE receptors are actively involved in angiogenesis and are thought to play a role in hematopoiesis. Indeed, recent results showing the ability of soluble TIE-2 receptor to inhibit tumor angiogenesis (Lin et al., J. Clin. Invest. 100 (8), 2072-2078 [1997]) indicate that TIE-2 is It was interpreted to show a role in pathological blood vessel growth. In other studies, TIE-2 expression was tested in adult and stationary phase tissues during angiogenesis. TIE2 expression was immunohistologically located on the neovascular endothelium in angiogenic rat tissues during thyroid follicular adenocarcinoma mutation and uterine development and wound healing. TIE-2 was also reported to be expressed in the full spectrum of stationary phase blood vessels (veins, arteries, and capillaries) in a wide range of adult tissues. Wong et al., Circ. Res. 81 (4), 567-574 (1997). TIE-2 was suggested to have two functions in adult angiogenesis and vascular maintenance.
Expression cloning of human TIE-2 ligand is described in PCT application publication WO96 / 11269 (issued April 18, 1996) and US Pat. No. 5,521,073 (issued May 28, 1996). The vector designated λgt10 encoding the TIE-2 ligand NL7d “htie-2 ligand 1” or “hTL1” was deposited with the ATCC under accession number 75928. Plasmids encoding other TIE-2 ligands designated “htie-2 2” or “hTL2” are available at ATCC under accession number 75928. This second ligand has been described as an antagonist of the TAI-2 receptor. The identification of secreted human and mouse ligands for the TIE-2 receptor is reported in Davis et al., Cell 87, 1161-1169 (1996). The human ligand named “Angiopoietin-1” reflecting its role in angiogenesis and potential effects during hematopoiesis is referred to as “htie-2 1” or “hTL-1” in WO96 / 11269. It is the same ligand as variously called ligands. Angiopoietin-1 later plays a role in angiogenesis and is distinguished from VEGF (Suri et al., Cell 87, 1171-1180 (1996)). Since TIE-2 is clearly up-regulated during the pathological angiogenesis necessary for tumor growth (Kaipainen et al., Cancer Res. 54, 6571-6577 (1994)), angiopoietin-1 is associated with tumor blood vessels. It was suggested to be more useful for specific targeting (Davis et al., Supra).
Here we describe the identification and characterization of a novel TIE ligand polypeptide, designated herein as PRO1346 polypeptide.

98. PRO1131
The low density lipoprotein (LDL) receptor plays a key role in cholesterol homeostasis that mediates cellular uptake of lipoprotein particles by virtue of its high affinity binding to its ligands, apolipoprotein (apo) B-100 and apoE. It is a membrane-bound protein. The ligand binding domain of the LDL receptor contains seven cysteine-rich repeats of about 40 amino acids, each repeat containing six cysteines that form three intra-repeat disulfide bonds. These unique structural features give the LDL receptor the ability to specifically interact with apoB-100 and apoE, thereby transporting these lipoproteins across the cell membrane, and their components Can be metabolized. Soluble fragments containing the extracellular domain of the LDL receptor have been shown to retain their ability to interact with specific lipoprotein ligands (Simmons et al., J. Biol. Chem. 272: 25531- 25536 (1997)). LDL receptors are described in Javitt, FASEB J., 9 (13): 1378-1381 (1995), van BErkel et al., Atherosclerosis, 118 Suppl: S43-S50 (1995) and Herz and Willnow, Ann. NY Acad. Sci., 737: 14-19 (1994). Thus, proteins having sequence identity with the LDL receptor are of interest.
Here we describe the identification and characterization of a novel polypeptide having homology to the LDL receptor, designated herein as PRO1131 polypeptide.
99. PRO1281
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1281 polypeptide.

100. PRO1064
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO1064 polypeptide.
101. PRO1379
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1379 polypeptide.

102. PRO844
Proteases are enzyme proteins that are involved in many very important biological processes in mammalian and non-mammalian organisms. Many different protease enzymes from a variety of different mammalian and non-mammalian organisms have been identified and characterized. Mammalian protease enzymes play an important role in biological processes such as protein digestion, activation, inactivation, or modulation of peptide hormone activity, and modification of physical properties of proteins and enzymes. Thus, proteases are interesting. Also of interest are protease inhibitors.
Of particular interest is a serine protease. In one study, it was reported that when injected with a serine protease inhibitor anti-leukocyte proteinase (aLP), it accumulates in the joints and extra-articular cartilage of normal rats. This physiological pathway of cartilage accumulation, loss of proteoglycan-deficient articular cartilage, is thought to provide maintenance of a local balance between proteinase function and inhibition. Burkhardt et al., J. Rheumatol., 24 (6): 1145-1154 (1997). Furthermore, aLP and other protease inhibitors have been reported to play a role in in vitro growth of hematopoietic cells by neutralizing proteinases produced by bone marrow accessory cells. Gosklink et al., J. Exp. Med., 184 (4): 1305-1312 (1996). Also interesting are aLP variants. An oxidation-resistant mutant of aLP has been reported to have a significant therapeutic effect in animal models with emphysema. Steffens et al., Agents Actions suppl., 42: 111-121 (1993). Thus, serine protease inhibitors are interesting.
Here we describe here the identification of a novel polypeptide having homology to a serine protease inhibitor, designated herein as a PRO844 polypeptide.

103. PRO848
Interesting membrane-bound proteins include channels such as ion channels. In addition, interesting membrane-bound proteins include enzymes, such as transferases, bound to intracellular vacuoles or organelles. For example, the peptide of interest is GalNAc alpha 2,6-sialyltransferase as described in Kurosawa et al., J. Biol. Chem., 269 (2): 1402-1409 (1994). This peptide is constructed for secretion and maintains its catalytic activity. The expressed enzyme showed activity that was directed to asiaromucin and asialofetin but not to the other glycoproteins tested. Since sialylation is an important function, such sialyltransferases and peptides related in sequence identity are of interest.
Here we describe here the identification of a novel polypeptide having homology to a sialyltransferase, designated herein as a PRO848 polypeptide.
104. PRO1097
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1097 polypeptide.

105. PRO1153
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO1153 polypeptide.
106. PRO1154
Aminopeptidase N causes enzymatic degradation of correctly administered peptide drugs. Thus, aminopeptidase N has been used in studies to develop and identify inhibitors to improve the effectiveness of peptide drugs by inhibiting their degradation. Aminopeptidases are also of interest for applications that generally degrade peptides. Thus, aminopeptidases, particularly novel aminopeptidases, are of interest. Aminopeptidase N and its inhibitors are described in Bernkop-Schnurch and Marschutz, Pharm. Res., 14 (2): 181-185 (1997); Lerche et al., Mam. Genome, 7 (9): 712-713 (1996); Papapertropoulos et al., Immunopharmacology, 32 (1-3): 153-156 (1996); Miyachi et al., J. Med. Chem., 41 (3): 263-265 (1998); and Olsen et al., Adv. Exp. Med Biol., 421: 47-57 (1997).
Here we describe here the identification of a novel polypeptide having homology to aminopeptidase N, designated herein as PRO1154 polypeptide.

107. PRO1181
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1181 polypeptide.
108. PRO1182
Conglutinin was originally described as a vertebrate lectin protein and has four distinct domains: (1) an N-terminal cysteine-rich domain, (2) a collagen-like domain, (3) a neck domain, and (4) a carbohydrate recognition domain ( It is a bovine serum protein belonging to the family of C-type lectins having CRD). Recent reports have demonstrated that bovine conglutinin can inhibit hemagglutination by influenza A virus due to its lectin properties (Eda et al., Biochem. J. 316: 43-48 (1996). )). In addition, it has been suggested that lectins such as conglutinin can function as immunoglobulin-independent defense molecules because they are complement-mediated mechanisms. Thus, conglutinin has been shown to be useful for purifying immune complexes in vitro and removing circulating immune complexes from patient plasma in vivo (Lim et al., Biochem. Biophys. Res. Commun. 218: 260-266 (1996)). We describe here the identification and characterization of a novel polypeptide having homology to the conglutinin protein, designated herein as the PRO1182 polypeptide.

109. PRO1155
Substance P and related proteins, neurokinin A and neurokinin B, have been reported as compounds that induce ileal contraction directly through action on muscle cell receptors and indirectly through neuronal receptors. This action leads to the release of acetylcholine which causes muscle contraction via muscarinic receptors. Neurokinin B was also found to be the most potent agonist of neuronal substance P receptor, and it was reported that neurokinin B can be inhibited by enkephalinamide. Laufer et al., PNAS USA 82 (21): 74444-7448 (1985). In addition, neurokinin B has been reported to provide neuroprotection and cognitive enhancement and is therefore considered useful for the treatment of neurodegenerative diseases including Alzheimer's disease. Wenk et al., Behav. Brain Res., 83 (1-2): 129-133 (1997). Tachykinins are also described in Chawla et al., J. Comp. Neurol., 384 (3): 429-442 (1997). Thus, tachykinins, particularly those related to neurokinin B, are interesting.
Here we describe here the identification of a novel polypeptide having homology to the neurokinin B protein, designated herein as the PRO1155 polypeptide.
110. PRO1156
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1156 polypeptide.

111. PRO1098
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1098 polypeptide.
112. PRO1127
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1127 polypeptide.

113. PRO1126
The extracellular mucosa matrix of the olfactory neuroepithelium is highly organized in the immediate vicinity of chemoreceptive cilia that contain olfactory transmitters. The main protein component of this extracellular matrix is olfactmedin, a glycoprotein expressed in the olfactory neuroepithelium, forming intermolecular disulfide bonds to produce macromolecules (Yokoe et al., Proc. Natl. Acad. Sci. USA 90: 4655-4659 (1993), Bal et al., Biochemistry 32: 1047-1053 (1993) and Snyder et al., Biochemistry 30: 9143-9153 (1991)). Olufactmedin has been suggested to affect the maintenance, growth or differentiation of chemoreceptive cilia on the apical dendrites of olfactory neurons. Given this important role, there is significant interest in identifying and characterizing novel polypeptides having homology to olfactomedin. We describe here the same and characterization of a novel polypeptide having homology to the olfactomedin protein, designated herein as PRO1126 polypeptide.
114. PRO1125
Of particular interest are proteins with multiple Trp-Asp (WD) repeats. The WD protein consists of highly conserved repeat units that terminate in WD. These are found in eukaryotes, not prokaryotes. They regulate cell functions such as cell division, cell fate determination, gene transcription, gene transcription, transmembrane signaling, mRNA modification and vesicle fusion. WD is described in Neer et al., Nature, 371 (6495): 297-300 (1994); Jiang and Struhl, Nature, 391 (6666): 493-496 (1998); and Desaliva et al., Genetics, 148 (2): 657. -667 (1998). So all the members of this superfamily are interesting.

115. PRO1186
Protein A from Dendroaspis polylepis (black mamba) venom contains 81 amino acids containing 10 half-cysteine residues. The venom is of interest for use in assays, on the one hand, as weapons and on the other hand in identifying agents that reverse or inhibit the effects of venom or similar poisons. Black mamba venom is described in Int. J. Biochem., 17 (6): 695-699 (1985) and Joubert and Strydom, Hoppe Seylers Z Physiol. Chem., 361 (12): 1787-1794 (1980). ).
Here we describe the identification of a novel polypeptide with homology to snake venom protein A, designated herein as PRO1186 polypeptide.
116. PRO1198
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1198 polypeptide.

117. PRO1158
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO1158 polypeptide.
118. PRO1159
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1159 polypeptide.

119. PRO1124
The ion channel is considered the final boundary, the entrance to the brain. The ion channels and the receptors that control these channels are responsible for the passage of ions or nerve pulses that are transmitted from cell to cell, and thus the ion channel is responsible for transmission. In addition to their important role in the brain, ion channels play an important role in the heart as well as blood pressure. Ion channels are also associated with other important body functions and conditions, as well as diseases such as cystic fibrosis. For all these reasons, ion channels such as sodium, potassium, and calcium channels, and their related proteins and receptors are of interest. For example, cystic fibrosis has been reported to result from deletion of chloride channel protein, a cystic fibrosis transmembrane transduction regulator. McGill et al., Dig. Dis. Sci., 41 (3) 540-542 (1996). Chloride ion channels are further described at least in Finn et al., PNAS USA, 90 (12): 5691-569 (1993) and Finn et al., Mol. Cell Biochem., 114 (1-2): 21-26 (1992). ing.
Also interesting are molecules related to adhesion molecules, since adhesion molecules are known to be involved in cell-cell signaling and interaction. More generally, all novel membrane bound proteins are of interest. Membrane-bound proteins and receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (e.g., mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) that are then received by various cell receptors or membrane-bound proteins. Is interpreted. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, channels, transporters, and selectins and integrins. Cell adhesion molecules such as For example, the transmission of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze the process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor.
Membrane-bound proteins include those bound to the outer and inner membranes and organelles. Membrane-bound proteins and receptor molecules have a variety of industrial applications, including those as pharmaceutical and diagnostic agents. For example, receptor immunoadhesins can be used as therapeutic agents that block receptor-ligand interactions. Membrane-bound proteins can also be used to screen for potential peptide or small molecule inhibitors of related receptor / ligand interactions.
Efforts have been made to identify new native receptor proteins by both industry and academic research institutions. Much effort has been devoted to screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. Provided herein are polypeptides having sequence identity to chloride channel protein and lung epithelial cell adhesion molecule-1 (ECAM-1) and nucleic acids encoding the same.

120. PRO1287
Fringe is a protein that inhibits serrate-mediated activation of Notch in the dorsal compartment of the adult primordium of Drosophila wings. Fleming et al., Development, 124 (15): 2973-81 (1997). Thus, fringe proteins are interesting both for their role in development as well as their ability to modulate serate, particularly serate's signaling ability. Also of interest are novel polypeptides that have a role in the development and / or regulation of serate-like molecules. Of particular interest are novel polypeptides having homology to fringes.
Here we describe here the identification of a novel polypeptide having homology to a fringe protein, designated herein as PRO1287 polypeptide.
121. PRO1312
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1312 polypeptide.

122. PRO1192
Myelin membrane-bound proteins are of interest because they can be involved in a variety of neurological diseases that are associated with incorrect myelination. Myelin is a cellular sheath and is an axonal process that forms from glial cells, surrounds axons, improves various electrochemical properties, and provides neuronal nutritional support. Myelin is formed from Schwann cells in the peripheral nervous system (PNS) and from oligodendritic cells in the central nervous system (CNS). Incorrect myelination in central and peripheral neurons occurs in many pathologies and leads to incorrect signaling in the nervous system. Of various demyelinating diseases, multiple sclerosis is most noted.
The dominant integral membrane proteins of amphibian, reptile, avian and mammalian CNS myelins are proteolipid proteins (PLP) and the major glycoproteins in P0, PNS myelin (Schlieess and Stoffel, Biol. Chem. Hoppe Seyler (1991 372 (9): 865-874). In view of the importance of myelin membrane-bound proteins, both industrial and academic efforts are currently being made to identify various myelin proteins (Stratmann and Jeserich, J. Neurochem (1995) 64 (6) : 2427-2436).
123. PRO1160
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1160 polypeptide.

124. PRO1187
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1187 polypeptide.
125. PRO1185
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as PRO1185 polypeptide.

126. PRO345
Human tetranectin is a 202 amino acid protein encoded by a gene that spans about 12 kbp of DNA (Berglund et al., FEBS Lett. 309: 15-19 (1992)). Tetranectin is expressed in various tissues and has been shown to function primarily as a plasminogen binding protein. Tetranectin is classified into a distinct group of C-type lectins, but can have a structure and function similar to collectin proteins (Nielsen et al., FEBS Lett. 412 (2): 388-396 (1997)). . Recent studies have reported that serum tetranectin variability can predict the presence of various types of cancer, including, for example, ovarian and colorectal cancer (Hogdall et al., Acta Oncol. 35: 63-69 (1996). Hogdall et al., Eur. J. Cancer 31A (6): 888-894 (1995) and Tuxen et al., Cancer Treat. Rev. 21 (3): 215-245 (1995)). Thus, there is significant interest in the identification and characterization of novel polypeptides that have structural and functional similarities to tetranectin proteins.
Here we describe here the identification of a novel polypeptide having homology to tetranectin, designated herein as the PRO345 polypeptide.
127. PRO1245
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1245 polypeptide.

128. PRO358
Serine protease inhibitors are of interest because they inhibit catabolism and may be involved in tissue regeneration. For example, a gene encoding a plasma protein associated with liver regeneration has been cloned and referred to as regeneration-related serpin-1 (RASP-1). New et al., Biochem. Biophys. Res. Commun., 223 (2) 404-412 (1996). Serine protease inhibitors are a contrast of interest, but of particular interest are those that have sequence identity with known serine protease inhibitors such as RASP-1.
Here we describe here the identification of a novel polypeptide having homology to RASP-1, designated herein as the PRO358 polypeptide.
129. PRO1195
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1195 polypeptide.

130. PRO1270
Carbohydrate recognition by lectins has been shown to play an important role in various aspects of eukaryotic physiology. Although there are a number of different animal and plant lectin families, the calcium-dependent, or C-type lectin has recently received the most attention. For example, the recognition of carbohydrate residues on endothelial cells or leukocytes by the selectin family of calcium-dependent lectins has been shown to be critical for the transport of leukocytes to sites of inflammation. Lasky, L., Ann. Rev. Biochem., 64, 113-139 (1995). Biophysical analysis of these adhesive interactions suggested that the lectin-carbohydrate bond generated in this case allows adhesion of leukocytes and endothelium under high shear conditions of the vasculature. Thus, rapid carbohydrate recognition by such lectins allows rapid acquisition of the necessary ligands in high blood flow and shear. The physiological use of C-type lectins in this case is also supported by the relatively low affinity of these interactions required for the leukocyte rolling phenomenon observed to occur at sites of acute inflammation. Mannose binding protein (Weis et al., Science 254, 1608-1615 [1991]; Weis et al., Nature 360 127-134 [1992]) and E-selectin (Graves et al., Nature 367 (6463), 532-538 [1994]) The crystal structure of is shown in various mutagenesis analyzes (Erbe et al., J. Cell. Biol. 119 (1), 215-227 [1992]; Drickamer, Nature 360, 183-186 [1992]; Iobst et al., J. Biol. Chem., 169 (22), 15505-15511 [1994]; Kogan et al., J. Biol. Chem / 270 (23), 14047-14055 [1995]), together with C-type lectins, generally clusters It is consistent with the assumption that it is related to the rapid recognition of formed carbohydrates. These data also suggested that C-type lectins carry out important physiological phenomena through rapid and relatively low affinity recognition of carbohydrates.
Given the obvious importance of lectin proteins in many biological processes, efforts are now being made to create new lectin proteins or proteins with sequence homology to lectin proteins. Here we describe the identification and characterization of a novel polypeptide homologous to the lectin protein, designated herein as PRO1270 polypeptide.

131. PRO1271
Both industrial and academic efforts are currently being made to identify and characterize new natural membrane-bound proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as PRO1271 polypeptide.
132. PRO1375
The proteins L1CAM, G6PD and P55 are each associated with various known disease states. Therefore, the gene positions of Fugu rubripes homologues of human disease genes L1CAM, G6PD and P55 were analyzed. This analysis led to the identification of putative protein 2 (PUT2), GENBANK position AF026198, registration AF026198 (see GENBANK submission data). Therefore, proteins with sequence identity to PUT2 and PUT2 are interesting.

133. PRO1385
Both industrial and academic efforts are currently being made to identify and characterize new natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide, designated herein as the PRO1385 polypeptide.
134. PRO1387
Myelin membrane-bound proteins are of interest because they can be involved in a variety of neurological diseases that are associated with incorrect myelination. Myelin is a cellular sheath and is an axonal process that forms from glial cells, surrounds axons, improves various electrochemical properties, and provides neuronal nutritional support. Myelin is formed from Schwann cells in the peripheral nervous system (PNS) and from oligodendritic cells in the central nervous system (CNS). Incorrect myelination in central and peripheral neurons occurs in many pathologies and leads to incorrect signaling in the nervous system. Of various demyelinating diseases, multiple sclerosis is most noted.
The dominant integral membrane proteins of amphibian, reptile, avian and mammalian CNS myelins are proteolipid proteins (PLP) and the major glycoproteins in P0, PNS myelin (Schlieess and Stoffel, Biol. Chem. Hoppe Seyler (1991 372 (9): 865-874). In view of the importance of myelin membrane-bound proteins, both industrial and academic efforts are currently being made to identify various myelin proteins (Stratmann and Jeserich, J. Neurochem (1995) 64 (6) : 2427-2436).
Here we describe the identification and characterization of a novel polypeptide having homology to the myelin protein, designated herein as the PRO1387 polypeptide.

135. PRO1384
One class of receptor proteins of interest is the NKG2 family type II transmembrane molecules expressed in natural killer cells. These proteins shown to be covalently linked to CD94 are involved in natural killer cell-mediated recognition of different HLA-allotypes (Plougastel, B. et al., Eur. J. Immunol. (1997) 27 (11) : 2835-2839), interacting with major histocompatibility complex (MHC) class I to inhibit or activate functional activity (Ho, EL. Et al., Proc. Natl. Acad. Sci. (1998) 95 (11): 6320-6325). It is therefore interesting to identify and characterize members of this family of receptor proteins (Houchins JP, et al., J. Exp. Med. (1991) 173 (4): 1017-1020).

1. PRO281
In the present application, a cDNA clone (DNA16422-1209) having homology with a nucleic acid encoding a testis promoting gene transcript (TEGT) protein encoding a novel polypeptide named “PRO281” has been identified.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO281 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO281 polypeptide having a sequence of about 1 or about 15 to about 345 amino acid residues in FIG. 2 (SEQ ID NO: 2), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other embodiments, the invention provides an isolated nucleic acid encoding a PRO281 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 80 or about 122 to about 1114 of FIG. 1 (SEQ ID NO: 1). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA16422-1209) of ATCC Deposit No. 209929, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 209929 human protein cDNA (DNA16422-1209).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 2 (SEQ ID NO: 2) or the sequence from about 15 to about 345. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO281 polypeptide having amino acid residue 1 of FIG. 2 (SEQ ID NO: 2) or a sequence of about 15 to about 345, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 10 nucleotides produced by isolating a test DNA molecule when having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule having
In a particular embodiment, the present invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO281 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 14 in FIG. 2 (SEQ ID NO: 2). The plurality of transmembrane domains are amino acid positions about 83 to about amino acid position 105, amino acid position about 126 to about amino acid position 146, amino acid position about 158 to about amino acid position 177 of the PRO281 amino acid sequence (FIG. 2, SEQ ID NO: 2), Temporarily identified as extending from amino acid position 197 to amino acid position 216, amino acid position 218 to amino acid position 238, amino acid position 245 to amino acid position 265, and amino acid position 271 to amino acid position 290.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 2 (SEQ ID NO: 2) or the amino acid sequence from about 15 to about 345 An isolated nucleic acid comprising a DNA molecule encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO281 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 1 (SEQ ID NO: 1) can be derived from the nucleotide sequence shown.
In another embodiment, the present invention provides an isolated PRO281 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO281 polypeptide, which in certain embodiments comprises residues 1 or about 15 to about 345 of FIG. 2 (SEQ ID NO: 2). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85, to amino acid residue 1 of FIG. 2 (SEQ ID NO: 2) or to the sequence comprised from about 15 to about 345. It relates to an isolated PRO281 polypeptide comprising an amino acid sequence having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 2 (SEQ ID NO: 2) or the amino acid sequence from about 15 to about 345. Relates to an isolated PRO281 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 2 (SEQ ID NO: 2) or the sequence of about 15 to about 345, or a fragment sufficient to bind to an anti-PRO281 antibody thereof, Related to isolated PRO281 polypeptide. Preferably, this PRO281 fragment retains the qualitative biological activity of a native PRO281 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO281 polypeptide having a sequence of about 1 or about 15 to about 345 amino acid residues of FIG. 2 (SEQ ID NO: 2). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO281 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO281 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO281 polypeptide by contacting the native PRO281 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO281 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

2. PRO276
In the present application, a cDNA clone (DNA16435-1208), named “PRO276”, encoding a novel polypeptide having two transmembrane domains was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO276 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO276 polypeptide having a sequence of about 1 to about 251 amino acid residues of FIG. 4 (SEQ ID NO: 6), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO276 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 180 to about 932 of FIG. 3 (SEQ ID NO: 5). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA16435-1208) of ATCC Deposit No. 209930, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 209930 human protein cDNA (DNA16435-1208).
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about 85%, to the sequence from about 1 to about 251 amino acid residues of FIG. 4 (SEQ ID NO: 6). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO276 polypeptide having a sequence of about 1 to about 251 amino acid residues of FIG. 4 (SEQ ID NO: 6), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably Relates to an isolated nucleic acid molecule having about 100 nucleotides.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO276 polypeptide as a variant whose solubility, ie, transmembrane domain has been deleted or inactivated, or It is complementary to such an encoding nucleic acid molecule. The transmembrane domain is at amino acids about 98-116 and 152-172.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 to about 251 of FIG. 4 (SEQ ID NO: 6), and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO276 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO276 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO276 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 251 of FIG. 4 (SEQ ID NO: 6). It is out.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 251 of FIG. 4 (SEQ ID NO: 6). More preferably, an isolated PRO276 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 1 to 251 of FIG. 4 (SEQ ID NO: 6). It relates to an isolated PRO276 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In a still further aspect, the invention provides an isolated sequence comprising amino acid residues 1 to about 251 of Figure 4 (SEQ ID NO: 6), or a fragment sufficient to bind to an anti-PRO276 antibody thereof. PRO276 polypeptide. Preferably, this PRO276 fragment retains the qualitative biological activity of a native PRO276 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO276 polypeptide having a sequence of about 1 to about 251 amino acid residues of FIG. Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO276 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO276 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO276 polypeptide by contacting the native PRO276 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO276 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

3. PRO189
In the present application, a cDNA clone (DNA21624-1391) encoding a novel polypeptide named “PRO189” was identified. The PRO189 polypeptide has a cytosolic fatty acid binding domain.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO189 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO189 polypeptide having a sequence of about 1 to about 367 amino acid residues of FIG. 6 (SEQ ID NO: 8), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO189 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 200 to about 1300 of the residue of FIG. 5 (SEQ ID NO: 7). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA21624-1391) of ATCC Deposit No. 209917, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 21624 human protein cDNA (DNA21624-1391).
In yet a further aspect, the present invention provides (a) at least 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 367 amino acid residues in FIG. 6 (SEQ ID NO: 8). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO189 polypeptide having a sequence of about 1 to about 367 amino acid residues of FIG. 6 (SEQ ID NO: 8), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) An isolated nucleic acid molecule produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity About.
In a further aspect, the invention relates to at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residue 1 to about 367 of FIG. It relates to an isolated nucleic acid molecule PRO189 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In another embodiment, the present invention provides an isolated PRO189 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO189 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 367 of FIG. 6 (SEQ ID NO: 8). It is out.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 367 of FIG. 6 (SEQ ID NO: 8). More preferably, an isolated PRO189 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 1 to 367 of FIG. 6 (SEQ ID NO: 8). Pertaining to an isolated nucleic acid molecule PRO189 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO189 polypeptide having a sequence from about 1 to about 367 amino acid residues of FIG. 6 (SEQ ID NO: 8); Or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the present invention relates to agonists and antagonists of the native PRO189 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO189 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO189 polypeptide by contacting the native PRO189 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO189 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

4). PRO190
Applicants have identified a cDNA encoding a novel polypeptide having seven transmembrane domains and having sequence identity with CMP-sialic acid and UDP-galactose transporters, and this polypeptide is referred to in this application as “ It was named “PRO190”.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO190 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO190 polypeptide having amino acid residues 1 to 424 of FIG. 9 (SEQ ID NO: 14) or is complementary to such an encoding nucleic acid sequence. And remain attached to it under at least moderate and in some cases highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited with the ATCC as DNA2334-1392 on June 2, 1998, containing the nucleic acid sequence encoding PRO190.
In other embodiments, the present invention provides PRO190 polypeptides. In particular, the invention provides isolated native sequence PRO190 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 424 of FIG. 9 (SEQ ID NO: 14). A further embodiment of the invention relates to an isolated PRO190 polypeptide excluding the transmembrane domain. In some cases, the PRO190 polypeptide may be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of a vector deposited with the ATCC as DNA23334-1392 on June 2, 1998.
In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleic acid sequence of SEQ ID NO: 15.

5). PRO341
A cDNA clone (DNA26288-1239) encoding a novel transmembrane polypeptide designated “PRO341” in the present application has been identified.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO341 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO341 polypeptide having a sequence of about 1 or about 18 to about 458 amino acid residues in FIG. 12 (SEQ ID NO: 20), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO341 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide from about 380 or about 431 to about 1753 of FIG. 11 (SEQ ID NO: 19). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by human protein cDNA (DNA26288-1239) of ATCC Deposit No. 209792, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209792 (DNA26288-1239).
In one aspect, (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to amino acid residue 1 or the sequence from about 18 to about 458 of FIG. 12 (SEQ ID NO: 20) A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO341 polypeptide having amino acid residue 1 of FIG. 12 (SEQ ID NO: 20) or a sequence of from about 18 to about 458, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 165 nucleotides produced by isolating a test DNA molecule when it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule having
In a particular embodiment, the present invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO341 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 17 in FIG. 12 (SEQ ID NO: 20). The transmembrane domain consists of amino acid position about 171 to about amino acid position 190, amino acid position about 220 to about amino acid position 239, amino acid position about 259 to about amino acid position 275 of the PRO341 amino acid sequence (FIG. 12, SEQ ID NO: 20) Temporarily identified as extending from about 286 to about amino acid position 305, from about amino acid position 316 to about amino acid position 335, from about amino acid position 353 to about amino acid position 378, and from about amino acid position 396 to about amino acid position 417.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 12 (SEQ ID NO: 20) or the amino acid sequence from about 18 to about 458. To an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA of (a) .
Other embodiments relate to fragments of the PRO341 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 11 (SEQ ID NO: 19).
In another embodiment, the invention provides an isolated PRO341 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO341 polypeptide, which in certain embodiments comprises residue 1 or about 18 to about 458 of FIG. 12 (SEQ ID NO: 20). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 18 to about 458 of FIG. 12 (SEQ ID NO: 20). It relates to an isolated PRO341 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 12 (SEQ ID NO: 20) or the amino acid sequence from about 18 to about 458. Relates to an isolated PRO341 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 12 (SEQ ID NO: 20) or the sequence of about 18 to about 458, or a fragment sufficient to bind to an anti-PRO341 antibody thereof, It relates to an isolated PRO341 polypeptide. Preferably, this PRO341 fragment retains the qualitative biological activity of a native PRO341 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO341 polypeptide having a sequence of about 1 or about 18 to about 458 amino acid residues of FIG. 12 (SEQ ID NO: 20). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleic acid sequence of SEQ ID NO: 21 (see FIG. 13), herein designated as DNA12920.

6). PRO180
In the present application, a cDNA clone (DNA26843-1389) was identified that encodes a novel polypeptide having multiple transmembrane domains and named “PRO180”.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO180 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO180 polypeptide having a sequence of about 1 to about 266 amino acid residues of FIG. 15 (SEQ ID NO: 23), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO180 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 121 to about 918 of FIG. 14 (SEQ ID NO: 22). Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA26843-1389) of ATCC Deposit No. 203099, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC deposit no. 203099 (DNA26843-1389).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 266 amino acid residues of FIG. 15 (SEQ ID NO: 23). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO180 polypeptide having a sequence of about 1 to about 266 amino acid residues of FIG. 15 (SEQ ID NO: 23), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably Relates to an isolated nucleic acid molecule having about 100 nucleotides.
In a particular aspect, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO180 polypeptide as a variant thereof, ie, a variant whose transmembrane domain has been deleted or inactivated, or It is complementary to such an encoding nucleic acid molecule. The transmembrane domain is shown in FIG. PRO180 is considered to have a type II transmembrane domain of about amino acids 13-33 of SEQ ID NO: 23.
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 to about 266 of FIG. 15 (SEQ ID NO: 23), and more Preferably, it relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of the DNA molecule of (a).
Another embodiment relates to fragments of the PRO180 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO180 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO180 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to about 266 of FIG. 15 (SEQ ID NO: 23). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 266 of FIG. 15 (SEQ ID NO: 23). More preferably, an isolated PRO180 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence from residue 1 to about 266 of FIG. 15 (SEQ ID NO: 23). Relates to an isolated PRO180 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residues 1 to about 266 of FIG. 15 (SEQ ID NO: 23), or a fragment sufficient to bind to an anti-PRO180 antibody thereof. PRO180 polypeptide. Preferably, this PRO180 fragment retains the qualitative biological activity of a native PRO180 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO180 polypeptide having a sequence of about 1 to about 266 amino acid residues of FIG. 15 (SEQ ID NO: 23); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO180 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO180 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO180 polypeptide by contacting the native PRO180 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO180 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.
In another embodiment, the present invention provides an expressed sequence tag (EST) (DNA12922) comprising the nucleic acid sequence of FIG. 16 (SEQ ID NO: 24).

7). PRO194
The Applicant has identified a cDNA clone encoding a novel transmembrane polypeptide and named this polypeptide “PRO194” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO194 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO194 polypeptide having amino acid residues 1-264 of FIG. 18 (SEQ ID NO: 28) or is complementary to such encoding nucleic acid sequence. Yes, and remains bound to it under at least moderate and sometimes highly stringent conditions. In other embodiments, the isolated nucleic acid has a PRO194 polypeptide having amino acid residues about 18-264 of FIG. 18 (SEQ ID NO: 28) or amino acids 1 or about 18-X of FIG. 18 (SEQ ID NO: 28). Wherein X comprises a nucleic acid encoding any of the amino acids 96-105 of FIG. 18 (SEQ ID NO: 28) or is complementary to such an encoding nucleic acid sequence, at least moderate, In some cases, it remains stably bound to it under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA26844-1394 vector deposited as ATCC 209926 on June 2, 1998, containing the nucleic acid sequence encoding PRO194.
In other embodiments, the present invention provides PRO194 polypeptides. In particular, the invention provides isolated native sequence PRO194 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1-264 of FIG. 18 (SEQ ID NO: 28). A further embodiment of the invention is a PRO194 polypeptide having amino acids about 18-264 of FIG. 18 (SEQ ID NO: 28) or amino acids 1 or about 18-X of FIG. 18 (SEQ ID NO: 28), wherein X is 18 (SEQ ID NO: 28) is an arbitrary amino acid of 96 to 105. In some cases, the PRO194 polypeptide can be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA26844-1394 vector deposited on June 2, 1998 as ATCC 209926.

8). PRO203
Applicants have identified a cDNA encoding a novel polypeptide having sequence identity with glutathione-S-transferase, and named this polypeptide “PRO203” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO203 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO203 polypeptide having amino acid residues 1 to 347 of FIG. 20 (SEQ ID NO: 30) or is complementary to such encoding nucleic acid sequence. Yes, and remains bound to it under at least moderate and in some cases highly stringent conditions. In other embodiments, the isolated nucleic acid is a PRO203 polypeptide having amino acid residues X-347 of FIG. 20 (SEQ ID NO: 30), wherein X is from 83-92 of FIG. 20 (SEQ ID NO: 30). Contains a nucleic acid encoding, or is complementary to such an encoding nucleic acid sequence and remains stably bound to it under at least moderate and in some cases highly stringent conditions . The isolated nucleic acid sequence may comprise a cDNA insert of the DNA30862-1396 vector deposited on June 2, 1998 as ATCC 209920 containing the nucleic acid sequence encoding PRO203.
In other embodiments, the present invention provides isolated PRO203 polypeptides. In particular, the invention provides isolated native sequence PRO203 polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 1 to 347 of FIG. 20 (SEQ ID NO: 30). A further embodiment of the invention is a PRO203 polypeptide having amino acids X to 347 of FIG. 20 (SEQ ID NO: 30), wherein X is any amino acid from 83 to 92 of FIG. 20 (SEQ ID NO: 30). About. In some cases, the PRO203 polypeptide may be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA30862-1396 vector deposited on June 2, 1998 as ATCC 20992.
In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleic acid sequence of FIG. 21 (SEQ ID NO: 31) and designated herein as DNA15618.

9. PRO290
In the present application, a cDNA clone (DNA35680-1212) encoding a polypeptide named “PRO290” was identified. PRO290 polypeptide has sequence identity with NTII-1, FAN and beige.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO290 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO290 polypeptide having a sequence of about 1 or about 1 to about 1003 amino acid residues of FIG. 23 (SEQ ID NO: 33), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO290 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 293 to about 3301 of FIG. 22 (SEQ ID NO: 32). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA35680-1212) of ATCC Deposit No. 209790, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209790 (DNA35680-1212).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 1003 amino acid residues in FIG. 23 (SEQ ID NO: 33). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO290 polypeptide having a sequence from about 1 to about 1003 amino acid residues of FIG. 23 (SEQ ID NO: 33), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) An isolated nucleic acid molecule produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity About.
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 to about 1003 of FIG. 23 (SEQ ID NO: 33), and more Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
In another embodiment, the invention provides an isolated PRO290 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO290 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 1003 of FIG. 23 (SEQ ID NO: 33). It is out.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 1003 of FIG. 23 (SEQ ID NO: 33). More preferably, an isolated PRO290 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 1 to 1003 of FIG. 23 (SEQ ID NO: 33). It relates to an isolated PRO290 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO290 polypeptide having a sequence of about 1 to about 1003 amino acid residues of FIG. 23 (SEQ ID NO: 33) Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO290 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO290 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO290 polypeptide by contacting the native PRO290 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO290 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

10. PRO874
Applicants have identified a cDNA encoding a novel multi-span transmembrane polypeptide, which was named “PRO874” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO874 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO874 polypeptide having amino acid residues 1 to 321 of FIG. 25 (SEQ ID NO: 36) or is complementary to such an encoding nucleic acid sequence. And remain attached to it under at least moderate and in some cases highly stringent conditions. In other embodiments, the isolated nucleic acid is a PRO874 polypeptide having amino acids about X to 321 of FIG. 25 (SEQ ID NO: 36), except that any of about 270 to about 279 of X FIG. 25 (SEQ ID NO: 36) Or is complementary to such an encoding nucleic acid sequence and remains stably bound to it under at least moderate and in some cases highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA40621-1440 vector deposited on June 2, 1998 as ATCC 209922, which contains the nucleic acid sequence encoding PRO874.
In other embodiments, the present invention provides isolated PRO874 polypeptides. In particular, the present invention provides isolated native sequence PRO874 polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 1 through 321 of FIG. 25 (SEQ ID NO: 36). A further embodiment of the invention is a PRO874 polypeptide having amino acids X to 321 of FIG. 25 (SEQ ID NO: 36), wherein X is any amino acid from 270 to 279 of FIG. 25 (SEQ ID NO: 36). , Regarding. In some cases, the PRO874 polypeptide may be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA40621-1440 vector deposited on June 2, 1998 as ATCC 209922.

11. PRO710
Applicants have identified a cDNA encoding a novel polypeptide having homology to the CDC45 protein and named this polypeptide “PRO710” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO710 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO710 polypeptide having amino acid residues 1 to 566 of FIG. 27 (SEQ ID NO: 41) or is complementary to such encoding nucleic acid sequence. And remain attached to it under at least moderate and in some cases highly stringent conditions. In other embodiments, the isolated nucleic acid has a PRO710 polypeptide having amino acid residues about 33-566 of FIG. 27 (SEQ ID NO: 41) or amino acids 1 or about 33-X of FIG. 27 (SEQ ID NO: 41). Wherein X comprises a nucleic acid encoding any of the amino acids 449-458 of FIG. 27 (SEQ ID NO: 41) or is complementary to such an encoding nucleic acid sequence, at least moderately, In some cases, it remains stably bound to it under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA44161-1434 vector deposited as ATCC 209907 on May 27, 1998, including the nucleic acid sequence encoding PRO710.
In other embodiments, the present invention provides isolated PRO710 polypeptides. In particular, the present invention provides isolated native sequence PRO710 polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 1 through 566 of FIG. 27 (SEQ ID NO: 41). A further embodiment of the invention is a PRO710 polypeptide having amino acids about 33-566 of FIG. 27 (SEQ ID NO: 41) or amino acids 1 or about 33-X of FIG. 27 (SEQ ID NO: 41), wherein X is 27 (SEQ ID NO: 41) is an arbitrary amino acid of 449 to 458.
In some cases, a PRO710 polypeptide may be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA44161-1434 vector deposited on May 27, 1998 as ATCC 209907.
In another embodiment, the present invention provides an expressed sequence tag (EST), comprising the nucleotide sequence of FIG. 28 (SEQ ID NO: 42), herein designated DNA38190.

12 PRO1151
In the present application, a cDNA clone (DNA44694-1500) having homology with a nucleic acid encoding C1q protein encoding a novel polypeptide named “PRO1151” was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1151 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1151 polypeptide having a sequence of about 1 or about 21 to about 259 amino acid residues of FIG. 30 (SEQ ID NO: 47), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1151 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide from about 272 or about 332 to about 1048 of FIG. 29 (SEQ ID NO: 46). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA44694-1500) of ATCC Deposit No. 203114, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203114 (DNA44694-1500).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 30 (SEQ ID NO: 47) or the sequence from about 21 to about 259. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1151 polypeptide having the sequence of amino acid residue 1 of FIG. 30 (SEQ ID NO: 47) or from about 21 to about 259, b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 10 nucleotides produced by isolating a test DNA molecule when having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule having
In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1151 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 20 in FIG. 30 (SEQ ID NO: 47).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 30 (SEQ ID NO: 47) or the amino acid sequence from about 21 to about 259. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1151 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 29 (SEQ ID NO: 46).
In another embodiment, the present invention provides an isolated PRO1151 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1151 polypeptide, which in certain embodiments comprises residue 1 or about 21 to about 259 of FIG. 30 (SEQ ID NO: 47). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 30 (SEQ ID NO: 47) or the sequence from about 21 to about 259. It relates to an isolated PRO1151 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 30 (SEQ ID NO: 47) or the amino acid sequence from about 21 to about 259. Relates to an isolated PRO1151 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 30 (SEQ ID NO: 47) or the sequence of about 21 to about 259, or a fragment sufficient to bind to an anti-PRO1151 antibody thereof, It relates to an isolated PRO1151 polypeptide. Preferably, this PRO1151 fragment retains the qualitative biological activity of a native PRO1151 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO1151 polypeptide having a sequence from about 1 or about 21 to about 259 amino acid residues of FIG. 30 (SEQ ID NO: 47). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1151 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1151 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1151 polypeptide by contacting the native PRO1151 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1151 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

13. PRO1282
A cDNA clone (DNA45495-1550) has been identified that has sequence identity with a leucine-rich repeat protein and encodes a novel polypeptide named “PRO1282” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1282 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1282 polypeptide having a sequence of about 24 to about 673 amino acid residues of FIG. 32 (SEQ ID NO: 52), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1282 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 189 to about 2138 of FIG. 31 (SEQ ID NO: 51). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA45495-1550) of ATCC Deposit No. 203156, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203156 (DNA45495-1550).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 24 to about 673 amino acid residues of FIG. 32 (SEQ ID NO: 52). An isolation comprising a DNA encoding a polypeptide having a sex, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA molecule of (a) Nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1282 polypeptide having a sequence from about 24 to about 673 amino acid residues of FIG. 32 (SEQ ID NO: 52); or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) Having at least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule.
In a particular embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1282 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide is tentatively identified as extending from about amino acid position 1 to about amino acid position 23 in FIG. 32 (SEQ ID NO: 52). A transmembrane domain extending from about amino acid position 579 to about amino acid position 599 of the PRO1282 amino acid sequence (FIG. 32, SEQ ID NO: 52) has been tentatively identified.
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 24 to about 673 of FIG. 32 (SEQ ID NO: 52), and more Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
Other embodiments relate to fragments of the PRO1282 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1282 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1282 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 24 to 673 of FIG. 32 (SEQ ID NO: 52). It is out.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 24 to about 673 of FIG. 32 (SEQ ID NO: 52). More preferably, an isolated PRO1282 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the present invention relates to at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residue 24 to about 673 of FIG. 32 (SEQ ID NO: 52). It relates to an isolated PRO1282 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residues 24 to about 673 of FIG. 32 (SEQ ID NO: 52), or a fragment sufficient to bind to an anti-PRO1282 antibody thereof. PRO1282 polypeptide. Preferably, this PRO1282 fragment retains the qualitative biological activity of a native PRO1282 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1282 polypeptide having a sequence of about amino acid residues from about 24 to about 673 of FIG. 32 (SEQ ID NO: 52); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1282 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1282 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1282 polypeptide by contacting the native PRO1282 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1282 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

14 PRO358
Applicants have identified a novel cDNA clone that encodes a novel human Toll polypeptide termed “PRO358” in this application.
In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO358 polypeptide having amino acids 20 to 575 of FIG. 34 (SEQ ID NO: 57), or (b) the complement of the DNA molecule of (a). Have at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to the strand DNA is included. Complementary DNA molecules preferably remain bound to such encoding nucleic acid sequences under at least moderate and possibly highly stringent conditions.
In a further embodiment, the isolated nucleic acid molecule has at least about 90% sequence identity, preferably 95, with a polynucleotide encoding a polypeptide having the sequence of amino acids 1 to 811 of FIG. 34 (SEQ ID NO: 57). Polynucleotides with% sequence identity.
In certain embodiments, the present invention provides DNA encoding a native or mutant PRO358 polypeptide that has or does not have an N-terminal signal sequence and that does or does not have a transmembrane region of each full-length sequence. An isolated nucleic acid molecule is provided. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a mature full-length native PRO358 polypeptide having amino acid residues 1-811 of FIG. 34 (SEQ ID NO: 57). Complementary. In another aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a native PRO358 polypeptide that does not have an N-terminal signal sequence, or is complementary to such an encoding nucleic acid sequence. In yet another embodiment, the invention relates to a nucleic acid encoding a form in which the transmembrane domain of the full-length native PRO358 protein is deleted or inactivated.
In another embodiment, the present invention provides an isolated nucleic acid molecule comprising a clone (DNA47361-1249) deposited on November 7, 1997 with ATCC No. 209431.
In certain embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85, with a polynucleotide encoding a polypeptide comprising the sequence of amino acids 20 to 811 of FIG. 34 (SEQ ID NO: 57). A polynucleotide comprising a polynucleotide having% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a vector comprising a complementary strand of such a polynucleotide To do. In a particular embodiment, the vector comprises DNA encoding a novel Toll homologue (PRO358) with or without an N-terminal signal sequence (amino acids about 1-19), or a transmembrane domain (amino acids about 576). -595) deletion or inactivation mutants, or the extracellular domain of the mature protein (amino acids about 20 to 595), or a protein comprising any of these sequences. Host cells comprising such vectors are also provided.
In other embodiments, the invention provides isolated PRO358 polypeptides. The invention further provides an isolated native sequence PRO358 polypeptide, or variant thereof. In particular, the present invention provides isolated native sequence PRO358 polypeptide, which in certain embodiments, from residues 20 to 575, or 20 to 811, or 1 of FIG. 34 (SEQ ID NO: 57). The amino acid sequence containing 811 is included.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO358 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO358 antibody.
In yet a further embodiment, the invention relates to screening assays for identifying agonists or antagonists of native PRO358 polypeptides.
In yet a further embodiment, the invention relates to a composition comprising a PRO358 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.
The invention further relates to a composition comprising an antibody that specifically binds to a PRO358 polypeptide, together with a pharmaceutically acceptable carrier.
The invention also relates to a method of treating septic shock comprising administering to a patient an effective amount of an antagonist of a PRO358 polypeptide. In certain embodiments, the antagonist is a blocking antibody that specifically binds to a native PRO358 polypeptide.

15. PRO1310
A cDNA clone (DNA47394-1572) has been identified that has sequence identity with carboxypeptidase X2 and encodes a novel polypeptide named “PRO1310” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1310 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1310 polypeptide having a sequence of about 26 to about 765 amino acid residues of FIG. 36 (SEQ ID NO: 62), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1310 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 401 to about 2593 of FIG. 35A-B (SEQ ID NO: 61). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA47394-1572) of ATCC Deposit No. 203109, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203109 (DNA47394-1572).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 26 to about 765 amino acid residues of FIG. 36 (SEQ ID NO: 62). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1310 polypeptide having a sequence of about 26 to about 765 amino acid residues of FIG. 36 (SEQ ID NO: 62), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably Relates to an isolated nucleic acid molecule having at least about 100 nucleotides. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 26 to about 765 of FIG. 36 (SEQ ID NO: 62). Preferably it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA of (a).
In other embodiments, the present invention provides an isolated PRO1310 polypeptide encoded by any of the above isolated nucleic acid sequences.
In a particular aspect, the invention provides an isolated native sequence PRO1310 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 26 to 765 of FIG. 36 (SEQ ID NO: 62). .
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 26 to about 765 of FIG. 36 (SEQ ID NO: 62). More preferably, an isolated PRO1310 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 26 to 765 of FIG. 36 (SEQ ID NO: 62). Pertaining to an isolated PRO1310 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention provides an isolated comprising a sequence from amino acid residue 26 to about 765 of FIG. 36 (SEQ ID NO: 62), or a fragment sufficient to bind to an anti-PRO1310 antibody thereof. PRO1310 polypeptide. Preferably, this PRO1310 fragment retains the qualitative biological activity of a native PRO1310 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule that (a) a DNA molecule encoding a PRO1310 polypeptide having a sequence of about 26 to about 765 amino acid residues of FIG. 36 (SEQ ID NO: 62). Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity to (a) or (b), preferably Have at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A polypeptide produced by culturing under conditions suitable for expression of the peptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1310 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1310 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1310 polypeptide by contacting the native PRO1310 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1310 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

16. PRO698
The Applicant has identified a cDNA clone encoding a novel polypeptide having homology to olfcatomedin and named this polypeptide “PRO698” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO698 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO698 polypeptide having amino acid residues 1 to 510 of FIG. 38 (SEQ ID NO: 67) or is complementary to such encoding nucleic acid sequence. And remain attached to it under at least moderate and in some cases highly stringent conditions. In other embodiments, the isolated nucleic acid molecule comprises DNA encoding a PRO698 polypeptide having amino acid residues 21 to 510 of FIG. 38 (SEQ ID NO: 67) or is complementary to such encoding nucleic acid sequence. And remain attached to it under at least moderate and in some cases highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48320-1433 vector deposited on May 27, 1998 as ATCC 209904, which contains the nucleic acid sequence encoding PRO698.
In other embodiments, the present invention provides isolated PRO698 polypeptides. In particular, the invention provides isolated native sequence PRO698 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 510 of FIG. 38 (SEQ ID NO: 67). A further embodiment of the invention is directed to a PRO698 polypeptide consisting of about amino acids 1 to 510 of FIG. 38 (SEQ ID NO: 67). In some cases, the PRO698 polypeptide may be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA48320-1433 vector deposited on May 27, 1998 as ATCC 209904.
In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleic acid sequence of SEQ ID NO: 15.

17. PRO732
The Applicant has identified a cDNA clone that encodes a novel polypeptide having homology to human placental protein Diff33 and named this polypeptide “PRO732” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO732 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO732 polypeptide having amino acid residues 1 to 453 of FIG. 41 (SEQ ID NO: 73) or is complementary to such encoding nucleic acid sequence. And remain attached to it under at least moderate and in some cases highly stringent conditions. In other embodiments, the isolated nucleic acid is a PRO732 polypeptide having amino acid residues about 29-453 of FIG. 41 (SEQ ID NO: 73) or amino acids 1 or about 29-X of FIG. 41 (SEQ ID NO: 73). Wherein X comprises DNA encoding any of amino acids 31-40 of FIG. 41 (SEQ ID NO: 73) or is complementary to such encoding nucleic acid sequence, at least moderate, In some cases, it remains stably bound to it under highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48320-1435 vector deposited on June 2, 1998 as ATCC 209924 containing the nucleic acid sequence encoding PRO732.
In other embodiments, the present invention provides isolated PRO732 polypeptides. In particular, the invention provides isolated native sequence PRO732 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 453 of FIG. 41 (SEQ ID NO: 73). A further embodiment of the invention is a PRO732 polypeptide having amino acids about 29-453 of FIG. 41 (SEQ ID NO: 73) or amino acids 1 or about 29-X of FIG. 41 (SEQ ID NO: 73), wherein X is 41 (SEQ ID NO: 73). In some cases, the PRO732 polypeptide may be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA48334-1435 vector deposited on June 2, 1998 as ATCC 209924.
In another embodiment, the invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 42 (SEQ ID NO: 74), herein designated as DNA20239.
In another embodiment, the invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 43 (SEQ ID NO: 75), herein designated as DNA38050.
In another embodiment, the invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 44 (SEQ ID NO: 76), herein designated as DNA40683.
In another embodiment, the present invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 45 (SEQ ID NO: 77), designated herein as DNA42580.

18. PRO1120
Applicants have identified a cDNA clone (DNA48606-1479) that has homology to sulfatase and encodes a novel polypeptide named “PRO1120” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1120 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1120 polypeptide having a sequence from about 18 to about 867 amino acid residues of FIG. 47 (SEQ ID NO: 84), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO1120 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residues 659 to about 3208 of FIGS. 46A-B (SEQ ID NO: 83). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA48606-1479) of ATCC Deposit No. 203040, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203040 (DNA48606-1479).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 18 to about 867 amino acid residues in FIG. 47 (SEQ ID NO: 84). An isolation comprising a DNA encoding a polypeptide having a sex, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA molecule of (a) Nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1120 polypeptide having a sequence of about 18 to about 867 amino acid residues of FIG. 47 (SEQ ID NO: 84), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably Relates to an isolated nucleic acid molecule having 100 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1120 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 17 in the sequence of FIG. 47 (SEQ ID NO: 84).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 18 to about 867 of FIG. 47 (SEQ ID NO: 84), and more Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
Another embodiment relates to fragments of the PRO1120 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1120 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1120 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 18 to 867 of FIG. 47 (SEQ ID NO: 84). It is out.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 18 to about 867 of FIG. 47 (SEQ ID NO: 84). More preferably, an isolated PRO1120 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 18 to 867 of FIG. 47 (SEQ ID NO: 84). It relates to an isolated PRO1120 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residues 18 to about 867 of FIG. 47 (SEQ ID NO: 84), or a fragment sufficient to bind to an anti-PRO1120 antibody thereof. PRO1120 polypeptide. Preferably, this PRO1120 fragment retains the qualitative biological activity of a native PRO1120 polypeptide.
In yet a further aspect, the present invention relates to (i) a test DNA molecule, (a) a DNA molecule that encodes a PRO1120 polypeptide having a sequence from about 18 to about 867 in FIG. 47 (SEQ ID NO: 84). Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity to (a) or (b), preferably Have at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A polypeptide produced by culturing under conditions suitable for expression of the peptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1120 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1120 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1120 polypeptide by contacting the native PRO1120 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1120 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

19. PRO537
A cDNA clone (DNA49141-1431) encoding a novel secreted polypeptide termed “PRO537” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO537 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO537 polypeptide having a sequence from about 1 or about 32 to about 115 amino acid residues in FIG. 49 (SEQ ID NO: 95), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO537 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of FIG. 48 (SEQ ID NO: 94) from about nucleotide 97 or from about 190 to about 441. Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA49141-1431) of ATCC Deposit No. 203003, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203003 (DNA49141-1431).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or about 32 to about 115 amino acid residues in FIG. 49 (SEQ ID NO: 95). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO537 polypeptide having amino acid residue 1 of FIG. 49 (SEQ ID NO: 95) or about 1 or about 32 to about 115; Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably Produced by isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, It relates to an isolated nucleic acid molecule having about 10 nucleotides.
In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO537 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 31 in FIG. 49 (SEQ ID NO: 95).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 49 (SEQ ID NO: 95) or the amino acid sequence from about 32 to about 115. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO537 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, It can be derived from the nucleotide sequence shown in 48 (SEQ ID NO: 94).
In other embodiments, the invention provides an isolated PRO537 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO537 polypeptide, which in certain embodiments comprises residues 1 or about 32 to about 115 of FIG. 49 (SEQ ID NO: 95). Contains the amino acid sequence.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 49 (SEQ ID NO: 95) or the sequence from about 32 to about 115. It relates to an isolated PRO537 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 49 (SEQ ID NO: 95) or the amino acid sequence from about 32 to about 115. Relates to an isolated PRO537 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 49 (SEQ ID NO: 95) or the sequence of about 32 to about 115, or a fragment sufficient to bind to an anti-PRO537 antibody thereof, Related to isolated PRO537 polypeptide. Preferably, this PRO537 fragment retains the qualitative biological activity of a native PRO537 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule that encodes a PRO537 polypeptide having a sequence from about 1 or about 32 to about 115 amino acid residues of (a) Figure 49 (SEQ ID NO: 95). Or (b) a complementary strand of the DNA molecule of (a) is hybridized under stringent conditions so that the test DNA molecule is at least about 80% identical to (a) or (b) (Ii) a host comprising a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A polypeptide produced by culturing cells under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.

20. PRO536
A cDNA clone (DNA49142-1430) encoding a novel secreted polypeptide termed “PRO536” in the present application was identified.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO536 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO536 polypeptide having a sequence of about 1 or about 26 to about 313 of amino acid residues in FIG. 51 (SEQ ID NO: 97), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO536 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of about 48 or about 123 to about 986 of FIG. 50 (SEQ ID NO: 96). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA49142-1430) of ATCC Deposit No. 203002, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA49142-1430) at ATCC Deposit No. 203002.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence of about 1 or about 26 to about 313 of FIG. 51 (SEQ ID NO: 97), preferably at least about 85% A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO536 polypeptide having the amino acid residue 1 of FIG. 51 (SEQ ID NO: 97) or the sequence of about 1 or about 26 to about 313; Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably Produced by isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, It relates to an isolated nucleic acid molecule having about 10 nucleotides.
In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO536 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 25 in the sequence of FIG. 51 (SEQ ID NO: 97).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 51 (SEQ ID NO: 97) or the amino acid sequence from about 26 to about 313 An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO536 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long, 50 (SEQ ID NO: 96).
In another embodiment, the invention provides an isolated PRO536 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO536 polypeptide, which in certain embodiments comprises residue 1 or about 26 to about 313 of FIG. 51 (SEQ ID NO: 97). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 51 (SEQ ID NO: 97) or the sequence from about 26 to about 313. It relates to an isolated PRO536 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 51 (SEQ ID NO: 97) or the amino acid sequence from about 26 to about 313. Relates to an isolated PRO536 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of Figure 51 (SEQ ID NO: 97) or the sequence of about 26 to about 313, or a fragment sufficient to bind to an anti-PRO536 antibody thereof, Related to isolated PRO536 polypeptide. Preferably, this PRO536 fragment retains the qualitative biological activity of a native PRO536 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule that encodes a PRO536 polypeptide having the sequence from (a) amino acid residue about 1 or about 26 to about 313 of FIG. 51 (SEQ ID NO: 97). Or (b) a complementary strand of the DNA molecule of (a) is hybridized under stringent conditions so that the test DNA molecule is at least about 80% identical to (a) or (b) (Ii) a host comprising a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A polypeptide produced by culturing cells under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.

21. PRO535
A cDNA clone (DNA49143-1429) was identified that had homology to a nucleic acid encoding a putative peptidyl-prolyl isomerase encoding a novel polypeptide named “PRO535” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO536 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO535 polypeptide having a sequence of about 1 or about 26 to about 201 of amino acid residues in FIG. 53 (SEQ ID NO: 99), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO535 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide from about 78 or about 153 to about 680 of FIG. 52 (SEQ ID NO: 98). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA49143-1429) of ATCC Deposit No. 203031, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA49143-1429) of ATCC Deposit Number 203013.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or about 26 to about 201 amino acid residues in FIG. 53 (SEQ ID NO: 99). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO535 polypeptide having the sequence of amino acid residue 1 or about 26 to about 201 of FIG. 53 (SEQ ID NO: 99), or ( b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 10 nucleotides produced by isolating a test DNA molecule when having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule having
In a particular embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO535 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. A signal peptide extending from about amino acid position 1 to about amino acid position 25 of the PRO535 amino acid sequence (FIG. 53, SEQ ID NO: 99) has been tentatively identified. Multiple transmembrane domains have been tentatively identified as extending from about amino acid position 55 to about amino acid position 155 of the PRO535 amino acid sequence (FIG. 53, SEQ ID NO: 99).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 53 (SEQ ID NO: 99) or the amino acid sequence from about 26 to about 201. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO535 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 52 (SEQ ID NO: 98).
In another embodiment, the present invention provides an isolated PRO535 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO535 polypeptide, which in certain embodiments comprises residue 1 or about 26 to about 201 in FIG. 53 (SEQ ID NO: 99). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 53 (SEQ ID NO: 99) or the sequence from about 26 to about 201. It relates to an isolated PRO535 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 53 (SEQ ID NO: 99) or the amino acid sequence from about 26 to about 201. Relates to an isolated PRO535 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 53 (SEQ ID NO: 99) or the sequence of about 26 to about 201, or a fragment sufficient to bind to an anti-PRO535 antibody thereof, Related to isolated PRO535 polypeptide. Preferably, this PRO537 fragment retains the qualitative biological activity of a native PRO535 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule that encodes a PRO535 polypeptide having the sequence from (a) amino acid residue about 1 or about 26 to about 201 of FIG. 53 (SEQ ID NO: 99) Or (b) a complementary strand of the DNA molecule of (a) is hybridized under stringent conditions so that the test DNA molecule is at least about 80% identical to (a) or (b) (Ii) a host comprising a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A polypeptide produced by culturing cells under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the present invention relates to agonists and antagonists of the native PRO535 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO535 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO535 polypeptide by contacting the native PRO535 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO535 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.
In another embodiment, the present invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 54 (SEQ ID NO: 100), designated herein as DNA30861.
In another embodiment, the present invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 55 (SEQ ID NO: 101), herein designated DNA36351.

22. PRO718
Applicants have identified a cDNA clone encoding a novel tetraspan membrane polypeptide, which is designated “PRO718” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO718 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO718 polypeptide having amino acid residues 1 to 157 of FIG. 57 (SEQ ID NO: 103) or is complementary to such an encoding nucleic acid sequence. Yes, and remains bound to it under at least moderate and sometimes highly stringent conditions. In other embodiments, the isolated nucleic acid is a PRO718 polypeptide having amino acid residues X to 157 of FIG. 57 (SEQ ID NO: 103), wherein X is from 143 to 152 of FIG. 57 (SEQ ID NO: 103). Contains a nucleic acid encoding, or is complementary to such an encoding nucleic acid sequence and remains stably bound to it under at least moderate and in some cases highly stringent conditions . The isolated nucleic acid sequence may comprise the cDNA insert of the DNA49647-1398 vector deposited as ATCC 209919 on June 2, 1998, including the nucleic acid sequence encoding PRO718.
In other embodiments, the present invention provides isolated PRO718 polypeptides. In particular, the invention provides isolated native sequence PRO718 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 157 of FIG. 57 (SEQ ID NO: 103). A further embodiment of the invention is an isolated PRO718 polypeptide having amino acids X to 157 of FIG. 57 (SEQ ID NO: 103), wherein X is any of 143 to 152 of FIG. 57 (SEQ ID NO: 103) Related to being an amino acid. In some cases, a PRO718 polypeptide can be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA49647-1398 vector deposited on June 2, 1998 as ATCC 209919.
In another embodiment, the invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 58 (SEQ ID NO: 104), herein designated as DNA15386.
In another embodiment, the present invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 59 (SEQ ID NO: 105), herein designated DNA16630.
In another embodiment, the invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 60 (SEQ ID NO: 106), herein designated DNA16829.
In another embodiment, the present invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 61 (SEQ ID NO: 107), designated herein as DNA28357.
In another embodiment, the invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 62 (SEQ ID NO: 108), designated herein as DNA43512.

23. PRO872
Applicants have identified a cDNA, DNA49819-1439, which encodes a novel polypeptide having homology to dehydrogenase and named this polypeptide “PRO872” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO872 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO872 polypeptide having a sequence of about 1 or about 19 to about 610 amino acid residues of FIG. 64 (SEQ ID NO: 113), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO872 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid at residue 68 or residue 1834 of Figure 63 (SEQ ID NO: 112). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule that encodes the same mature polypeptide encoded by the human protein cDNA (DNA49819-1439) of ATCC deposit no. DNA comprising at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to isolated nucleic acid molecules. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209931 (DNA49819-1439).
In yet a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 or about 19 to about 610 amino acid residues of FIG. 64 (SEQ ID NO: 113). More preferably, an isolated nucleic acid molecule comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a particular embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO872 extracellular domain (ECD) with or without an N-terminal signal sequence and / or initiation methionine, and its solubility, A variant is provided (ie, the transmembrane domain has been deleted or inactivated) or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 18 of the PRO872 amino acid sequence (FIG. 64, SEQ ID NO: 113). A first transmembrane domain region has been tentatively identified as extending from about amino acid position 70 to about amino acid position 87 of the PRO872 amino acid sequence (Figure 64, SEQ ID NO: 113).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 64 (SEQ ID NO: 113) or the amino acid sequence from about 19 to about 610. It relates to an isolated nucleic acid molecule comprising a DNA molecule encoding a polypeptide with a score of positive, more preferably at least about 90% positive, most preferably at least about 95% positive.
Other embodiments relate to fragments of the PRO872 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO872 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO872 polypeptide, which in certain embodiments is an amino acid comprising residue 1 or about 19 to 610 of FIG. 64 (SEQ ID NO: 113). Contains an array.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to amino acid residue 1 or the sequence from about 19 to 610 of FIG. 64 (SEQ ID NO: 113). It relates to an isolated PRO872 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 64 (SEQ ID NO: 113) or the amino acid sequence of about 19 to 610. It relates to an isolated PRO872 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In another aspect, the invention provides amino acid residues 1 or about 19-X of FIG. 64 (SEQ ID NO: 113), wherein X is any amino acid residue of 66-75 of FIG. 64 (SEQ ID NO: 113). Amino acids having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity The PRO872 extracellular domain comprising the sequence.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 64 (SEQ ID NO: 113) or the sequence from about 19 to about 610, or a fragment sufficient to bind to an anti-PRO872 antibody thereof, Related to isolated PRO872 polypeptide. Preferably, this PRO872 fragment retains the qualitative biological activity of a native PRO872 polypeptide.
In another aspect, the invention relates to PRO872 polypeptide fragments that are long enough to provide an epitope from which antibodies can be produced.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO872 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO872 antibody.
In yet a further embodiment, the invention relates to a screening assay for identifying agonists or antagonists of native PRO872 polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO872 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

24. PRO1063
Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to human type IV collagenase, which polypeptide is named “PRO1063” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1063 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO1063 polypeptide having amino acid residues 1 to 301 of FIG. 66 (SEQ ID NO: 115) or is complementary to such encoding nucleic acid sequence. Yes, and remains bound to it under at least moderate and sometimes highly stringent conditions. In other embodiments, the isolated nucleic acid comprises DNA encoding a PRO1063 polypeptide having about 22-301 amino acid residues of FIG. 66 (SEQ ID NO: 115), or in such an encoding nucleic acid sequence. It is complementary and remains stably bound to it under at least moderate and in some cases highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA49820-1427 vector deposited on June 2, 1998 as ATCC 209932 containing the nucleic acid sequence encoding PRO1063.
In other embodiments, the present invention provides isolated PRO1063 polypeptides. In particular, the invention provides isolated native sequence PRO1063 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 301 of FIG. 66 (SEQ ID NO: 115). A further embodiment of the invention relates to an isolated PRO1063 polypeptide having amino acids about 22-301 of FIG. 66 (SEQ ID NO: 115). In some cases, the PRO1063 polypeptide may be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA49820-1427 vector deposited on June 2, 1998 as ATCC 209932.

25. PRO619
In the present application, a cDNA clone (DNA49821-1562) encoding a novel polypeptide named “PRO619” was identified. The PRO619 polypeptide has sequence identity with the VpreB gene, particularly the VpreB3 gene.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO619 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO619 polypeptide having a sequence from about 1 or 21 to about 123 amino acid residues of FIG. 68 (SEQ ID NO: 117), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). It comprises DNA with 95% sequence identity.
In another aspect, the invention provides an isolated PRO619 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of FIG. 67 (SEQ ID NO: 116) from about 81 or about 141 to about 449 of nucleic acid. Relates to nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA49821-1562) of ATCC Deposit No. 209981, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209981 (DNA49821-1562).
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or 21 to about 123 amino acid residues in FIG. 68 (SEQ ID NO: 117). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule that encodes a PRO619 polypeptide having the sequence of amino acid residue 1 or about 1 or 21 to about 123 of FIG. 68 (SEQ ID NO: 117); Or (b) hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least An isolation produced by isolating a test DNA molecule if it has about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Nucleic acid molecules.
In a particular embodiment, the present invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO619 polypeptide with or without an N-terminal signal sequence and / or initiation methionine in soluble form. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 20 in FIG. 68 (SEQ ID NO: 117).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 68 (SEQ ID NO: 117) or the amino acid sequence from about 21 to about 123. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO619 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, about 40 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, most preferably about 20 to It is about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO619 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO619 polypeptide, which in certain embodiments, comprises an amino acid sequence comprising residues 1 or 21 to 123 of FIG. 68 (SEQ ID NO: 117). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 or 21 to 123 of FIG. 68 (SEQ ID NO: 117). More preferably, an isolated PRO619 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 21 to 123 of FIG. 68 (SEQ ID NO: 117). It relates to an isolated PRO619 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO619 polypeptide having a sequence from about 1 or 21 to about 123 in FIG. 68 (SEQ ID NO: 117). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO619 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO619 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO619 polypeptide by contacting the native PRO619 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO281 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

26. PRO943
In the present application, a cDNA clone (DNA52192-1369) was identified which has homology to a nucleic acid encoding fibroblast growth factor receptor-4 encoding a novel polypeptide named “PRO943”.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO943 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO943 polypeptide having a sequence of about 1 or about 18 to about 504 amino acid residues in FIG. 70 (SEQ ID NO: 119), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other embodiments, the invention provides an isolated nucleic acid encoding a PRO943 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 150 or about 201 to about 1661 of FIG. 69 (SEQ ID NO: 118). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA52192-1369) of ATCC Deposit No. 203042, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203042 (DNA52192-1369).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 70 (SEQ ID NO: 119) or the sequence from about 18 to about 504. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO943 polypeptide having amino acid residue 1 of FIG. 70 (SEQ ID NO: 119) or a sequence of about 18 to about 504, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Of sequence identity, more preferably at least about 90%, and most preferably at least about 10 produced by isolating a test DNA molecule if it has at least about 95% sequence identity. It relates to an isolated nucleic acid molecule having nucleotides.
In a particular embodiment, the present invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO943 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 17 in FIG. 70 (SEQ ID NO: 119). A plurality of transmembrane domains extending from amino acid position 376 to amino acid position 396 have been tentatively identified.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 70 (SEQ ID NO: 119) or the amino acid sequence from about 18 to about 504. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO943 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 69 (SEQ ID NO: 118).
In other embodiments, the invention provides an isolated PRO943 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO943 polypeptide, which in certain embodiments comprises residue 1 or from about 18 to about 504 of FIG. 70 (SEQ ID NO: 119). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 70 (SEQ ID NO: 119) or the sequence from about 18 to about 504. It relates to an isolated PRO943 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 70 (SEQ ID NO: 119) or the amino acid sequence from about 18 to about 504. Relates to an isolated PRO943 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 70 (SEQ ID NO: 119) or the sequence of about 18 to about 504, or a fragment sufficient to bind to an anti-PRO943 antibody thereof, Related to isolated PRO943 polypeptide. Preferably, this PRO943 fragment retains the qualitative biological activity of a native PRO943 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO943 polypeptide having a sequence of about 1 or about 18 to about 504 amino acid residues of FIG. 70 (SEQ ID NO: 119). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO943 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO943 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO943 polypeptide by contacting the native PRO943 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO943 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

27. PRO1188
A cDNA clone (DNA52598-1518) has been identified that is homologous to the nucleotide pyrophosphohydrase and encodes a novel polypeptide named "PRO1188" in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1188 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1188 polypeptide having a sequence of about 22 to about 1184 of amino acid residues of FIG. 72 (SEQ ID NO: 124), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1188 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 199 to about 3687 of FIG. 71 (SEQ ID NO: 123). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA52598-1518) of ATCC Deposit No. 203107, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203107 (DNA52598-1518).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 22 to about 1184 amino acid residues of FIG. 72 (SEQ ID NO: 124). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1188 polypeptide having a sequence of from about 22 to about 1184 amino acid residues contained in FIG. 72 (SEQ ID NO: 124), or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 Produced by isolating a test DNA molecule if it has% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to nucleic acid molecules.
In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1188 polypeptide, which may or may not have an N-terminal signal sequence and / or an initiation methionine. Complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 21 in FIG. 72 (SEQ ID NO: 124).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 22 to about 1184 of FIG. 72 (SEQ ID NO: 124) Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
In another embodiment, the invention provides an isolated PRO1188 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1188 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 22 through 1184 of FIG. 72 (SEQ ID NO: 124). It is out.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 22 to about 1184 of FIG. 72 (SEQ ID NO: 124). More preferably, an isolated PRO1188 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from 22 to 1184 of FIG. 72 (SEQ ID NO: 124). It relates to an isolated PRO1188 polypeptide comprising an amino acid sequence encoding a polypeptide with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1188 polypeptide having a sequence from about 22 to about 1184 amino acid residues of FIG. 72 (SEQ ID NO: 124); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1188 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1188 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1188 polypeptide by contacting the native PRO1188 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO281 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

28. PRO1133
A cDNA clone (DNA53913-1490) was identified that has homology to Netrin-1a and encodes a novel polypeptide named “PRO1133” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1133 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1133 polypeptide having a sequence of about 19 to about 438 of amino acid residues in FIG. 74 (SEQ ID NO: 129), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1133 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from residue 320 to about 1579 of FIG. 73 (SEQ ID NO: 128). Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA53913-1490) of ATCC Deposit No. 203162, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203162 (DNA53913-1490).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 19 to about 438 amino acid residues of FIG. 74 (SEQ ID NO: 129). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1133 polypeptide having a sequence of about 19 to about 438 amino acid residues contained in FIG. 74 (SEQ ID NO: 129), or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 Produced by isolating a test DNA molecule if it has% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to nucleic acid molecules. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 19 to about 438 of FIG. 74 (SEQ ID NO: 129). Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
Other embodiments relate to fragments of the PRO1133 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1133 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1133 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 19 to 438 of FIG. 74 (SEQ ID NO: 129). It is out.
In yet another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues 19 to about 438 of FIG. 74 (SEQ ID NO: 129), and more Preferably, it relates to an isolated PRO1133 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 19 to 438 of FIG. 74 (SEQ ID NO: 129), More preferably, it relates to an isolated PRO1133 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a still further aspect, the invention provides an isolated sequence comprising amino acid residue 19 to about 438 of FIG. 74 (SEQ ID NO: 129), or a fragment sufficient to bind to an anti-PRO1133 antibody thereof. PRO1133 polypeptide. Preferably, this PRO1133 fragment retains the qualitative biological activity of a native PRO1133 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1133 polypeptide having a sequence of about 19 to about 438 of amino acid residues of FIG. 74 (SEQ ID NO: 129); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1133 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1133 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1133 polypeptide by contacting the native PRO1133 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO281 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

29. PRO784
In the present application, a cDNA clone (DNA53978-1443) was identified that encodes a novel polypeptide termed “PRO784”.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO784 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO784 polypeptide having a sequence of about 16 to about 228 amino acid residues of FIG. 76 (SEQ ID NO: 135), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO784 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from residue 182 to about 820 of FIG. 75 (SEQ ID NO: 134). Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA53978-1443) of ATCC Deposit No. 209983, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209983 (DNA53978-1443).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about 16 to about 228 amino acid residues of FIG. 76 (SEQ ID NO: 135). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO784 polypeptide having a sequence of about 16 to about 228 amino acid residues contained in FIG. 76 (SEQ ID NO: 135), or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 50 nucleotides produced by isolating a test DNA molecule when having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to an isolated nucleic acid molecule, preferably having 100 nucleotides.
In a particular embodiment, the present invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO784 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 15 in FIG. 76 (SEQ ID NO: 135). A first transmembrane domain extending from about amino acid position 68 to about amino acid position 87 of the PRO784 amino acid sequence (Figure 76, SEQ ID NO: 135) has been tentatively identified.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 16 to about 228 of FIG. 76 (SEQ ID NO: 135). Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
Other embodiments relate to fragments of the PRO784 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO784 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO784 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 16 to 228 of FIG. 76 (SEQ ID NO: 135). It is out.
In yet another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 16 to about 228 of FIG. 76 (SEQ ID NO: 135), and more Preferably, it relates to an isolated PRO784 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In other embodiments, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence of residues 16 to 228 of FIG. 76 (SEQ ID NO: 135). It relates to an isolated PRO784 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 16 to about 228 of FIG. 76 (SEQ ID NO: 135), or a fragment sufficient to bind to an anti-PRO784 antibody thereof. PRO784 polypeptide. Preferably, this PRO784 fragment retains the qualitative biological activity of a native PRO784 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO784 polypeptide having a sequence of about 16 to about 228 amino acid residues of FIG. 76 (SEQ ID NO: 135); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO784 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO784 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO784 polypeptide by contacting the native PRO784 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO784 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

30. PRO783
Applicants have identified a cDNA clone encoding a novel multi-span transmembrane polypeptide and named this polypeptide “PRO783” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO783 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO783 polypeptide having amino acid residues 1 to 489 of Figure 79 (SEQ ID NO: 138) or is complementary to such an encoding nucleic acid sequence. Yes, and remains bound to it under at least moderate and sometimes highly stringent conditions. In other embodiments, the isolated nucleic acid is a PRO783 polypeptide having amino acids 1-X of FIG. 79 (SEQ ID NO: 138), wherein X is any of 19-28 of FIG. 79 (SEQ ID NO: 138). DNA comprising an amino acid, or is complementary to such an encoding nucleic acid sequence and remains stably bound to it under at least moderate and in some cases highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA53996-1442 vector deposited on June 2, 1998 as ATCC 209921 containing the nucleic acid sequence encoding PRO783.
In other embodiments, the present invention provides isolated PRO783 polypeptides. In particular, the invention provides isolated native sequence PRO783 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 489 of FIG. 79 (SEQ ID NO: 138). A further embodiment of the invention is a PRO783 polypeptide having amino acids 1 to about X of FIG. 79 (SEQ ID NO: 138), wherein X is any amino acid 19 to 28 of FIG. 79 (SEQ ID NO: 138). , Concerning. In some cases, the PRO783 polypeptide may be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA53996-1442 vector deposited on June 2, 1998 as ATCC 209921.
In another embodiment, the invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of Figure 80 (SEQ ID NO: 139), designated DNA45201.
In another embodiment, the present invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 81 (SEQ ID NO: 140), designated herein as DNA14575.

31. PRO820
In the present application, a cDNA clone (DNA56041-1416) was identified that has sequence identity with the immunoglobulin γ Fc receptor encoding a novel polypeptide named “PRO820”.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO820 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO820 polypeptide having a sequence of about 1 or 16 to about 124 amino acid residues of FIG. 83 (SEQ ID NO: 146), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity. The term “or” as used herein to refer to an amino acid or nucleic acid refers to two alternative embodiments provided herein, namely 1-24 or 16-124 of other embodiments. I mean.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO820 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 115 or 160 to about 486 of FIG. 82 (SEQ ID NO: 145). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56041-1416) of ATCC Deposit No. 203021, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203021 (DNA56041-1416).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or 16 to about 124 amino acid residues in FIG. 83 (SEQ ID NO: 146). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO820 polypeptide having a sequence of about 1 or 16 to about 124 amino acid residues contained in FIG. 83 (SEQ ID NO: 146); Or (b) hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least An isolated produced by isolating a test DNA molecule if it has about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Nucleic acid molecules.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 16 to about 124 in FIG. 83 (SEQ ID NO: 146). A DNA molecule encoding a polypeptide with a score of at least about 90% positive, more preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) About.
In other embodiments, the invention provides an isolated PRO820 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO820 polypeptide, which in certain embodiments, comprises an amino acid sequence comprising residues 1 or 16 to 124 of Figure 83 (SEQ ID NO: 146). Is included.
In yet another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 1 or 16 to about 124 of FIG. 83 (SEQ ID NO: 146). More preferably, an isolated PRO820 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 16 to 124 of FIG. 83 (SEQ ID NO: 146). It relates to an isolated PRO820 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA encoding a PRO820 polypeptide having a sequence of from about 1 or 16 to about 124 amino acid residues of FIG. A molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a), wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO820 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO820 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO820 polypeptide by contacting the native PRO820 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO281 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

32. PRO1080
A cDNA clone (DNA56047-1456) was identified that encodes a novel polypeptide named “PRO1080” in this application. The PRO1080 polypeptide has sequence identity with the DnaJ protein.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1080 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule that encodes a PRO1080 polypeptide having a sequence of about 1 or 23 to about 358 of amino acid residues in FIG. 85 (SEQ ID NO: 148), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). It comprises DNA with 95% sequence identity. The term “or” as used herein to refer to an amino acid or nucleic acid refers to two alternative embodiments provided herein, namely 1-358 or other embodiments 23-358. I mean.
In another aspect, the invention provides an isolated nucleic acid molecule encoding a PRO1080 polypeptide comprising DNA that hybridizes from residue 159 or 225 of Figure 84 (SEQ ID NO: 147) to the complementary strand of about 1232 nucleic acid. About. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA56047-1456) of ATCC Deposit No. 209948, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209948 (DNA56047-1456).
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity with the sequence from about 1 or 23 to about 358 of FIG. 85 (SEQ ID NO: 148), preferably at least about 85%. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1080 polypeptide having a sequence of about 1 or 23 to about 358 of amino acid residues contained in FIG. 85 (SEQ ID NO: 148); Or (b) hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least An isolated produced by isolating a test DNA molecule if it has about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Nucleic acid molecules.
In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1080 polypeptide, which may or may not have an N-terminal signal sequence and / or an initiation methionine. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 22 in FIG. 85 (SEQ ID NO: 148).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 16 to about 358 of FIG. 85 (SEQ ID NO: 148). A DNA molecule encoding a polypeptide with a score of at least about 90% positive, more preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) About.
In other embodiments, the invention provides an isolated PRO1080 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1080 polypeptide, which in certain embodiments, comprises an amino acid sequence comprising residues 1 or 23 to 358 of FIG. 85 (SEQ ID NO: 148). Is included.
In yet another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 1 or 23 to about 358 of FIG. 85 (SEQ ID NO: 148). More preferably, an isolated PRO1080 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 23 to 358 of FIG. 85 (SEQ ID NO: 148). It relates to an isolated PRO1080 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA encoding a PRO1080 polypeptide having a sequence from about 1 or 23 to about 358 of amino acid residue of FIG. 85 (SEQ ID NO: 148). A molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a), wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1080 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1080 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1080 polypeptide by contacting the native PRO1080 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO281 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.
In another embodiment, the present invention provides an expressed sequence tag (EST), herein designated as DNA36527, comprising the nucleic acid sequence of FIG. 86 (SEQ ID NO: 149).

33. PRO1079
A cDNA clone (DNA56050-1455) was identified that encodes a novel polypeptide named “PRO1079” in the present application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1079 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1079 polypeptide having a sequence of about 30 to about 226 amino acid residues of FIG. 88 (SEQ ID NO: 151), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1079 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 270 to about 860 of FIG. 87 (SEQ ID NO: 150). Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56050-1455) of ATCC Deposit No. 203011, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA56050-1455) at ATCC Deposit No. 203011.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 30 to about 226 amino acid residues of FIG. 88 (SEQ ID NO: 151). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1079 polypeptide having a sequence of about 30 to about 226 amino acid residues contained in FIG. 88 (SEQ ID NO: 151), or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 50 nucleotides produced by isolating a test DNA molecule when having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to an isolated nucleic acid molecule, preferably having 100 nucleotides.
In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1079 polypeptide, which may or may not have an N-terminal signal sequence and / or an initiation methionine. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 29 in FIG. 88 (SEQ ID NO: 151).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 30 to about 226 of FIG. 88 (SEQ ID NO: 151), and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Another embodiment relates to fragments of the PRO1079 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1079 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1079 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 30 to 226 of FIG. 88 (SEQ ID NO: 151). It is out.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably, with the sequence from amino acid residue 30 to about 226 of FIG. 88 (SEQ ID NO: 151). Relates to an isolated PRO1079 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 30 to 226 of FIG. 88 (SEQ ID NO: 151). Pertains to an isolated PRO1079 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residues 30 to about 226 of Figure 88 (SEQ ID NO: 151), or a fragment sufficient to bind to an anti-PRO1079 antibody thereof. Related PRO1079 polypeptides. Preferably, this PRO1079 fragment retains the qualitative biological activity of a native PRO1079 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1079 polypeptide having a sequence of about 30 to about 226 amino acid residues of FIG. 88 (SEQ ID NO: 151); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

34. PRO793
In the present application, a cDNA clone (DNA56110-1437) encoding a novel polypeptide named “PRO793” has been identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO793 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO793 polypeptide having a sequence of about 1 to about 138 of amino acid residues in FIG. 90 (SEQ ID NO: 153), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention provides an isolated nucleic acid molecule encoding a PRO793 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 2 nucleotide 77 to about 490 of FIG. 89 (SEQ ID NO: 152). About. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56110-1437) of ATCC Deposit No. 203113, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203113 (DNA56110-1437).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 138 amino acid residues in FIG. 90 (SEQ ID NO: 153). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO793 polypeptide having a sequence of about 1 to about 138 amino acid residues contained in FIG. 90 (SEQ ID NO: 153), or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 10 nucleotides produced by isolating a test DNA molecule when having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule having
In a particular embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO793 polypeptide with or without an initiating methionine, and its soluble, ie transmembrane domain, has been deleted or inactivated. Variants are provided, or are complementary to such encoding nucleic acid molecules. PRO793 amino acid sequence (FIG. 90, SEQ ID NO: 153) from about amino acid position 12 to about amino acid position 30; A transmembrane domain extending to position 109 has been tentatively identified.
In other embodiments, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 to about 138 of FIG. 90 (SEQ ID NO: 153), and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO793 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 89 (SEQ ID NO: 152).
In another embodiment, the present invention provides an isolated PRO793 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO793 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 138 of FIG. 90 (SEQ ID NO: 153). It is out.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably, with the sequence of amino acid residues 1 to about 138 of FIG. 90 (SEQ ID NO: 153). Relates to an isolated PRO793 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 1 to 138 of FIG. 90 (SEQ ID NO: 153). Pertains to an isolated PRO793 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residues 1 to about 138 of Figure 90 (SEQ ID NO: 153), or a fragment sufficient to bind to an anti-PRO793 antibody thereof. Related PRO793 polypeptides. Preferably, this PRO793 fragment retains the qualitative biological activity of a native PRO793 polypeptide.
In yet a further aspect, the invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO793 polypeptide having a sequence of about 1 to about 138 amino acid residues of FIG. 90 (SEQ ID NO: 153); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In another embodiment, the present invention provides an expressed sequence tag (EST), comprising the nucleic acid sequence of FIG. 91 (SEQ ID NO: 154), designated herein as DNA50177.

35. PRO1016
A cDNA clone (DNA56113-1378) was identified that encodes a novel polypeptide termed “PRO1016” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1016 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1016 polypeptide having a sequence from about 1 or 19 to about 378 of amino acid residues in FIG. 93 (SEQ ID NO: 156), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity. The term “or” as used herein to refer to an amino acid or nucleic acid refers to two alternative embodiments provided herein, namely 1-378 or 19-378 of another embodiment. I mean.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1016 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue about 168 or 222 of FIG. 92 (SEQ ID NO: 155) to about 1301. Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56113-1378) of ATCC Deposit No. 203049, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203049 (DNA56113-1378).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence from about 1 or 19 to about 378 of FIG. 93 (SEQ ID NO: 156), preferably at least about 85%. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1016 polypeptide having a sequence of about 1 or 19 to about 378 amino acid residues contained in FIG. 93 (SEQ ID NO: 156); Or (b) hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least An isolation produced by isolating a test DNA molecule if it has about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Nucleic acid molecules.
In a particular embodiment, the present invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1016 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 18 in FIG. 93 (SEQ ID NO: 156). A transmembrane domain extending from about amino acid position 332 to about amino acid position 352 of the PRO1016 amino acid sequence (Figure 93, SEQ ID NO: 156) has been tentatively identified.
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 19 to about 378 of FIG. 93 (SEQ ID NO: 156). A DNA molecule encoding a polypeptide with a score of at least about 90% positive, more preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) About.
In other embodiments, the invention provides an isolated PRO1016 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1016 polypeptide, which in certain embodiments, comprises an amino acid sequence comprising residues 1 or 19 to 378 of Figure 93 (SEQ ID NO: 156). Is included.
In yet another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 1 or 19 to about 378 of FIG. 93 (SEQ ID NO: 156). More preferably, an isolated PRO1016 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 19 to 378 of FIG. 93 (SEQ ID NO: 156). It relates to an isolated PRO1016 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA encoding a PRO1016 polypeptide having a sequence from about 1 or 19 to about 378 of amino acid residue of FIG. 93 (SEQ ID NO: 156). A molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a), wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1016 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1016 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1016 polypeptide by contacting the native PRO1016 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO189 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

36. PRO1013
Applicants have identified a cDNA clone encoding a novel polypeptide having sequence identity with P120, and in this application named this polypeptide “PRO1013”.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1013 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO1013 polypeptide having amino acid residues 1 to 409 of FIG. 95 (SEQ ID NO: 158), or is complementary to its encoding nucleic acid sequence. Yes, and remains stably bound under at least moderate and sometimes highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on June 2, 1998 as ATCC56410-1414 containing the nucleotide sequence encoding PRO1013.
In other embodiments, the invention provides isolated PRO1013 polypeptides. In particular, the invention provides isolated native sequence PRO1013 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 409 of FIG. 95 (SEQ ID NO: 158). In some cases, the PRO1013 polypeptide may or may be obtained by expression of a polypeptide encoded by the cDNA insert of the vector deposited with the ATCC on June 2, 1998 as DNA56410-1414.

37. PRO937
The Applicant has identified a cDNA clone that encodes a novel polypeptide having homology to the glypican family proteins and named this polypeptide “PRO937” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO937 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO937 polypeptide having amino acid residues 1 to 556 of Figure 97 (SEQ ID NO: 160), or is complementary to the encoding nucleic acid sequence. Yes, and remains stably bound under at least moderate and sometimes highly stringent conditions. In other embodiments, the isolated nucleic acid comprises DNA encoding a PRO937 polypeptide having about amino acid residues 23 to 556 of FIG. 97 (SEQ ID NO: 160), or is complementary to the encoding nucleic acid sequence. Yes, and remains stably bound under at least moderate and sometimes highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA56436-1448 vector deposited on May 27, 1998 as ATCC 209902 containing the nucleotide sequence encoding PRO937.
In other embodiments, the present invention provides isolated PRO937 polypeptides. In particular, the invention provides isolated native sequence PRO937 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 556 of FIG. 97 (SEQ ID NO: 160). A further embodiment of the invention relates to a PRO937 polypeptide comprising about amino acids 23 to 556 of FIG. 97 (SEQ ID NO: 160). In some cases, the PRO937 polypeptide may or may be obtained by expression of a polypeptide encoded by the cDNA insert of the DNA56436-1448 vector deposited on May 27, 1998 as ATCC 209902.

38. PRO842
A cDNA clone (DNA56855-1447) was identified that encodes a novel secreted polypeptide termed “PRO842” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO842 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO842 polypeptide having a sequence of about 23 to about 119 amino acid residues of FIG. 99 (SEQ ID NO: 165), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO842 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 219 to about 509 of Figure 98 (SEQ ID NO: 164). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56855-1447) of ATCC Deposit No. 203004, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203004 human protein cDNA (DNA56855-1447).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 23 to about 119 amino acid residues in FIG. 99 (SEQ ID NO: 165). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO842 polypeptide having a sequence of from about 23 to about 119 amino acid residues of FIG. 99 (SEQ ID NO: 165); Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides, preferably produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to an isolated nucleic acid molecule having at least about 100 nucleotides.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO842 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie, deleted or Inactivated transmembrane domain variants are provided, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 22 in Figure 99 (SEQ ID NO: 165).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 23 to about 119 of FIG. 99 (SEQ ID NO: 165), More preferably, it relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO842 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO842 polypeptide encoded by any of the isolated nucleic acid sequences defined above.
In certain aspects, the invention provides isolated native sequence PRO842 polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 23 to 119 of FIG. 99 (SEQ ID NO: 165). It is out.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 23 to about 119 of FIG. 99 (SEQ ID NO: 165). More preferably, an isolated PRO842 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence of residues 23 to 119 of FIG. 99 (SEQ ID NO: 165). It relates to an isolated PRO842 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 23 to about 119 of Figure 99 (SEQ ID NO: 165), or a fragment sufficient to bind to an anti-PRO842 antibody thereof. PRO842 polypeptide. Preferably, this PRO842 fragment retains the qualitative biological activity of a native PRO842 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO842 polypeptide having a sequence of about amino acid residues from about 23 to about 119 of FIG. 99 (SEQ ID NO: 165); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

39. PRO839
A cDNA clone (DNA56859-1445) was identified that encodes a novel polypeptide named “PRO839” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO839 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO839 polypeptide having a sequence of about 24 to about 87 amino acid residues of FIG. 101 (SEQ ID NO: 167), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO839 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of Figure 100 (SEQ ID NO: 166) residues about 71 to about 262. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56859-1445) of ATCC Deposit No. 20319, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203019 human protein cDNA (DNA56859-1445).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, to the sequence from about 24 to about 87 amino acid residues in FIG. 101 (SEQ ID NO: 167). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a single strand comprising the complementary strand of the DNA of (a) Relates to released nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO839 polypeptide having a sequence of about 24 to about 87 amino acid residues of FIG. 101 (SEQ ID NO: 167), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, Preferably it relates to an isolated nucleic acid molecule having at least 100 nucleotides.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO839 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and soluble, ie, deleted or Inactivated transmembrane domain variants are provided or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 23 in the sequence of FIG. 101 (SEQ ID NO: 167).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 24 to about 87 of FIG. 101 (SEQ ID NO: 167), More preferably, it relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO839 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO839 polypeptide encoded by any isolated nucleic acid sequence as defined above.
In certain aspects, the invention provides isolated native sequence PRO839 polypeptide, which in certain embodiments, includes an amino acid sequence comprising residues 24 through 87 of FIG. 101 (SEQ ID NO: 167). It is out.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 24 to about 87 in FIG. 101 (SEQ ID NO: 167). More preferably, an isolated PRO839 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence of residues 24 to 87 of FIG. 101 (SEQ ID NO: 167). It relates to an isolated PRO839 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residues 24 to about 87 of Figure 101 (SEQ ID NO: 167), or a fragment thereof sufficient to bind to an anti-PRO839 antibody. PRO839 polypeptide. Preferably, this PRO839 fragment retains the qualitative biological activity of a native PRO839 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO839 polypeptide having a sequence of about 24 to about 87 amino acid residues of FIG. 101 (SEQ ID NO: 167); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably If it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

40. PRO1180
The Applicant has identified a cDNA clone (DNA56860-1510) that is homologous to a nucleic acid encoding a methyltransferase enzyme that encodes a novel polypeptide, designated “PRO1180” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1180 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1180 polypeptide having a sequence of about 1 or about 24 to about 277 of amino acid residues in FIG. 103 (SEQ ID NO: 169), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other embodiments, the invention provides an isolated nucleic acid molecule encoding a PRO1180 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid 78 of FIG. 102 (SEQ ID NO: 168) or from about 147 to about 908. About. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) at least about 80% sequence identity to a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56860-1510) at ATCC deposit no. Relates to an isolated nucleic acid molecule comprising DNA having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209952 (DNA56860-1510).
In yet a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with amino acid residue 1 of FIG. 103 (SEQ ID NO: 169) or the sequence from about 24 to about 277. More preferably, an isolated nucleic acid molecule comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1180 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 23 of the sequence of FIG. 103 (SEQ ID NO: 169).
In other embodiments, the invention provides at least about 80% positive, preferably at least about 85% when compared to the amino acid sequence contained in residue 1 of FIG. 103 (SEQ ID NO: 169) or from about 24 to about 277. It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score.
Other embodiments relate to fragments of the PRO1180 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1180 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1180 polypeptide, which in one embodiment, includes amino acid sequence comprising residue 1 or about 24 to about 277 of FIG. 103 (SEQ ID NO: 169). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 103 (SEQ ID NO: 169) or the sequence from about 24 to about 277. It relates to an isolated PRO1180 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to residue 1 of FIG. 103 (SEQ ID NO: 169) or the amino acid sequence from about 24 to about 277, more Preferably, it relates to an isolated PRO1180 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 103 (SEQ ID NO: 169) or a sequence from about 24 to about 277, or a fragment sufficient to bind to an anti-PRO1180 antibody. It relates to an isolated PRO1180 polypeptide. Preferably, this PRO1180 fragment retains the qualitative biological activity of a native PRO1180 polypeptide.
In another aspect, the invention relates to a fragment of a PRO1180 polypeptide that is long enough to provide an epitope from which antibodies can be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1180 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1180 antibody.
In a further embodiment, the invention relates to a screening method for identifying agonists or antagonists of native PRO1180 polypeptides.
In yet a further embodiment, the invention relates to a composition comprising a PRO1180 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

41. PRO1134
A cDNA clone (DNA56865-1491) encoding a novel secreted polypeptide, designated “PRO1134” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1134 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1134 polypeptide having a sequence of about 1 or about 24 to about 371 amino acid residues of FIG. 105 (SEQ ID NO: 171), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO1134 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide from about 153 or about 222 to about 1265 of FIG. 104 (SEQ ID NO: 170). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56865-1491) of ATCC Deposit No. 203022, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203022 human protein cDNA (DNA56865-1491).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 105 (SEQ ID NO: 171) or the sequence from about 24 to about 371. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule that encodes a PRO1134 polypeptide having the sequence of amino acid residue 1 or about 24 to about 371 of FIG. 105 (SEQ ID NO: 171); b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 10 nucleotides produced by isolating a test DNA molecule when it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule having
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1134 polypeptide with or without an N-terminal signal sequence and / or initiating methionine, or such code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 23 in the sequence of FIG. 105 (SEQ ID NO: 171).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 80% positive when compared to amino acid sequence contained in residue 1 or from about 24 to about 371 of FIG. 105 (SEQ ID NO: 171) An isolated DNA comprising a polypeptide encoding a polypeptide having a score of about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Relates to nucleic acid molecules.
Other embodiments relate to fragments of the PRO1134 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 104 (SEQ ID NO: 170).
In another embodiment, the present invention provides an isolated PRO1134 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1134 polypeptide, which in one embodiment, includes amino acid sequence comprising residue 1 or from about 24 to about 371 of FIG. 105 (SEQ ID NO: 171). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to amino acid residue 1 or the sequence from about 24 to 371 of FIG. 105 (SEQ ID NO: 171). It relates to an isolated PRO1134 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 105 (SEQ ID NO: 171) or the amino acid sequence from about 24 to about 371. Relates to an isolated PRO1134 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of Figure 105 (SEQ ID NO: 171) or a sequence from about 24 to about 371, or a fragment sufficient to bind to an anti-PRO1134 antibody thereof. Relates to an isolated PRO1134 polypeptide. Preferably, this PRO1134 fragment retains the qualitative biological activity of a native PRO1134 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1134 polypeptide having a sequence of about 1 or about 24 to about 371 amino acid residues of FIG. 105 (SEQ ID NO: 171). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In another embodiment, the present invention provides an expressed sequence tag (EST) designated herein as DNA52353 comprising the nucleotide sequence of SEQ ID NO: 172 (see FIG. 106).
In another embodiment, the present invention provides an expressed sequence tag (EST) designated herein as DNA55725 comprising the nucleotide sequence of SEQ ID NO: 173 (see FIG. 107).

42. PRO830
A cDNA clone (DNA56866-1342) encoding a novel secreted polypeptide, designated “PRO830” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO830 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO830 polypeptide having a sequence of about 1 or about 34 to about 87 amino acid residues of FIG. 109 (SEQ ID NO: 175), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO830 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of FIG. 108 (SEQ ID NO: 174) from about nucleotide 154 or from about 253 to about 414. Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56866-1342) of ATCC Deposit No. 203023, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit number 203023 human protein cDNA (DNA56866-1342).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 109 (SEQ ID NO: 175) or the sequence from about 34 to about 87. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO830 polypeptide having the sequence of amino acid residue 1 or about 34 to about 87 of FIG. 109 (SEQ ID NO: 175), or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 10 nucleotides produced by isolating a test DNA molecule when it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule having
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO830 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 33 of the sequence of FIG. 109 (SEQ ID NO: 175).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence contained in residue 1 or from about 34 to about 87 in FIG. 109 (SEQ ID NO: 175). An isolated DNA comprising a polypeptide encoding a polypeptide having a score of about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Relates to nucleic acid molecules.
Other embodiments relate to fragments of the PRO830 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 108 (SEQ ID NO: 174).
In other embodiments, the invention provides an isolated PRO830 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO830 polypeptide, which in one embodiment, includes amino acid sequence comprising residue 1 or from about 34 to about 87 in FIG. 109 (SEQ ID NO: 175). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to amino acid residue 1 or the sequence from about 34 to 87 in FIG. 109 (SEQ ID NO: 175). It relates to an isolated PRO830 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, when compared to residue 1 of FIG. 109 (SEQ ID NO: 175) or the amino acid sequence from about 34 to about 87. Preferably, it relates to an isolated PRO830 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of Figure 109 (SEQ ID NO: 175) or the sequence from about 34 to about 87, or a fragment sufficient to bind to an anti-PRO830 antibody thereof. Relates to an isolated PRO830 polypeptide. Preferably, this PRO830 fragment retains the qualitative biological activity of a native PRO830 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO830 polypeptide having a sequence of about 1 or about 34 to about 87 amino acid residues of FIG. 109 (SEQ ID NO: 175). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.

43. PRO1115
A cDNA clone (DNA56868-1478) was identified that encodes a novel transmembrane polypeptide, designated “PRO1115” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1115 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1115 polypeptide having a sequence from about 21 to about 445 of FIG. 111 (SEQ ID NO: 177), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1115 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 249 to about 1523 of FIG. 110 (SEQ ID NO: 176). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56868-1478) of ATCC Deposit No. 203024, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203024 human protein cDNA (DNA56868-1478).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 21 to about 445 amino acid residues of FIG. 111 (SEQ ID NO: 177) A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule that encodes a PRO1115 polypeptide having a sequence of about 21 to about 445 amino acid residues of FIG. Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably Relates to an isolated nucleic acid molecule having at least about 100 nucleotides.
In certain aspects, the invention provides a PRO1115 polypeptide that has or does not have an N-terminal signal sequence and / or an initiation methionine and has one or more of its transmembrane domains deleted or inactivated. An isolated nucleic acid molecule comprising the encoding DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to amino acid position 20 in FIG. 111 (SEQ ID NO: 177). The transmembrane domain has been tentatively identified as extending from amino acid positions about 35-54, 75-97, 126-146, 185-204, 333-350 and 352-371 of the PRO115 amino acid sequence (FIG. 111, SEQ ID NO: 177).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85, when compared to the amino acid sequence comprised between residues 21 to about 445 of FIG. 111 (SEQ ID NO: 177). An isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) About.
Other embodiments relate to fragments of the PRO1115 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1115 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO1115 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 21 to 445 of Figure 111 (SEQ ID NO: 177). It is out.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, relative to the sequence from amino acid residue 21 to about 445 of FIG. 111 (SEQ ID NO: 177). More preferably, an isolated PRO1115 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence from about 21 to about 445 of FIG. 111 (SEQ ID NO: 177). It relates to an isolated PRO1115 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residue 21 to about 445 of Figure 111 (SEQ ID NO: 177), or a fragment sufficient to bind to an anti-PRO1115 antibody thereof. Related to the PRO1115 polypeptide. Preferably, this PRO1115 fragment retains the qualitative biological activity of a native PRO1115 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1115 polypeptide having a sequence of about 21 to about 445 amino acid residues of FIG. Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

44. PRO1277
A cDNA clone (DNA56869-1545) was identified that encodes a novel polypeptide having homology to Coch-5B2, designated “PRO1277” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1277 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1277 polypeptide having a sequence of about 27 to about 678 of amino acid residues in FIG. 113 (SEQ ID NO: 179), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1277 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 266 to about 2221 of FIG. 112 (SEQ ID NO: 178). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA56869-1545) of ATCC Deposit No. 203161, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203161 human protein cDNA (DNA56869-1545).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 27 to about 678 of FIG. 113 (SEQ ID NO: 179). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1277 polypeptide having a sequence from about 27 to about 678 of FIG. 113 (SEQ ID NO: 179), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably Relates to an isolated nucleic acid molecule having at least about 100 nucleotides. In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1277 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and soluble, or transmembrane domains thereof. Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 26 in FIG. 113 (SEQ ID NO: 179). The transmembrane domain has been tentatively identified as extending from about amino acid position 181 to about 200 amino acid position (FIG. 113, SEQ ID NO: 179) of the PRO1277 amino acid sequence.
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85%, when compared to the amino acid sequence encompassed from residue 27 to about 678 of FIG. 113 (SEQ ID NO: 179). To an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA of (a) .
Other embodiments relate to fragments of the PRO1277 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1277 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1277 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 27 to 678 of FIG. 113 (SEQ ID NO: 179). .
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 27 to about 678 of FIG. 113 (SEQ ID NO: 179). More preferably, an isolated PRO1277 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence of residues 27 to 678 of FIG. 113 (SEQ ID NO: 179). It relates to an isolated PRO1277 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residues 27 to about 678 of Figure 113 (SEQ ID NO: 179), or a fragment sufficient to bind to an anti-PRO1277 antibody thereof. Related PRO1277 polypeptides. Preferably, this PRO1277 fragment retains the qualitative biological activity of a native PRO1277 polypeptide.
In yet a further aspect, the invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1277 polypeptide having a sequence of about amino acid residues 27 to about 678 of FIG. 113 (SEQ ID NO: 179); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1277 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1277 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1277 polypeptide by contacting the native PRO1277 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1277 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

45. PRO1135
Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to α1,2-mannosidase and named this polypeptide “PRO1135” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1135 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO1135 polypeptide having amino acid residues 1 to 541 of Figure 115 (SEQ ID NO: 181), or is complementary to its encoding nucleic acid sequence. Yes, and at least moderate, and in some cases remain stably bound under high stringency conditions. In other embodiments, the isolated nucleic acid comprises DNA encoding a PRO1135 polypeptide having about 22 to 541 amino acid residues in FIG. 115 (SEQ ID NO: 181), or is complementary to the encoding nucleic acid sequence. Yes, and at least moderate, and in some cases remain stably bound under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA56870-1492 vector deposited on June 2, 1998 as ATCC 209925 containing the nucleotide sequence encoding PRO1135.
In a further embodiment, the invention provides an isolated PRO1135 polypeptide. In particular, the invention provides isolated native sequence PRO1135 polypeptide, which in one embodiment, includes an amino acid sequence having residues 1 to 541 of FIG. 115 (SEQ ID NO: 181). Another embodiment of the invention relates to a PRO1135 polypeptide having about amino acids 22 to 541 of Figure 115 (SEQ ID NO: 181). Optionally, the PRO1135 polypeptide can be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA56870-1492 vector deposited on June 2, 1998 as ATCC 209925.

46. PRO1114
A cDNA clone (DNA57033-1403) encoding a novel interferon receptor polypeptide, designated “PRO1114 interferon receptor” in this application was identified.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1114 interferon receptor polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1114 interferon receptor polypeptide having a sequence of about 1 or about 30 to about 311 amino acid residues of FIG. 117 (SEQ ID NO: 183), or (B) at least about 80% sequence identity to the complementary strand of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably Comprises DNA having at least about 95% sequence identity.
In other embodiments, the present invention provides an isolated encoding for a PRO1114 interferon receptor polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide from about 250 or about 337 to about 1182 of FIG. 116 (SEQ ID NO: 182). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA57033-1403) of ATCC Deposit No. 209905, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 209905 human protein cDNA (DNA57033-1403).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 of FIG. 117 (SEQ ID NO: 183) or the sequence of about 30 to about 311. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1114 interferon receptor polypeptide having the sequence of amino acid residue 1 of FIG. 117 (SEQ ID NO: 183) or from about 30 to about 311; Or (b) hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least Produced by isolating a test DNA molecule if it has about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, It relates to an isolated nucleic acid molecule having nucleotides.
In a particular aspect, the present invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1114 interferon receptor polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie membrane A variant in which the penetrating domain has been deleted or inactivated is provided, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 29 in FIG. 117 (SEQ ID NO: 183). A transmembrane domain has been tentatively identified as extending from about amino acid position 230 to about amino acid position 255 (FIG. 117, SEQ ID NO: 183) of the PRO1114 interferon receptor amino acid sequence.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 80% positive when compared to amino acid sequence contained in residue 1 or from about 30 to about 311 of FIG. 117 (SEQ ID NO: 183). An isolated DNA comprising a polypeptide encoding a polypeptide having a score of about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Relates to nucleic acid molecules.
Other embodiments relate to fragments of the PRO1114 interferon receptor polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 116 (SEQ ID NO: 182).
In another embodiment, the invention provides an isolated PRO1114 interferon receptor polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1114 interferon receptor polypeptide, which in one embodiment comprises residue 1 or from about 30 to about 311 of FIG. 117 (SEQ ID NO: 183). Contains the amino acid sequence.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 or the sequence from about 30 to 311 of FIG. 117 (SEQ ID NO: 183). It relates to an isolated PRO1114 interferon receptor polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to residue 1 of FIG. 117 (SEQ ID NO: 183) or the amino acid sequence from about 30 to about 311 Preferably it relates to an isolated PRO1114 interferon receptor polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention includes amino acid residue 1 of FIG. 117 (SEQ ID NO: 183) or the sequence of about 30 to about 311 or a fragment sufficient to bind to an anti-PRO1114 interferon receptor antibody. For an isolated PRO1114 interferon receptor polypeptide. Preferably, the PRO1114 interferon receptor fragment retains the qualitative biological activity of a native PRO1114 interferon receptor polypeptide.
In yet a further aspect, the invention provides (i) a test DNA molecule comprising: (a) a PRO1114 interferon receptor polypeptide having a sequence of about 1 or about 30 to about 311 amino acid residues of FIG. 117 (SEQ ID NO: 183). At least about 80% of the sequence of the test DNA molecule relative to (a) or (b), which is hybridized under stringent conditions with the encoding DNA molecule or the complementary strand of the DNA molecule of (b) (a) If it has identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) comprises a test DNA molecule Produced by culturing host cells under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium To provide a Ripepuchido.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1114 interferon receptor polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1114 interferon receptor antibody.
In a further embodiment, the present invention provides an agonist or antagonist of a native PRO1114 interferon receptor polypeptide by contacting the native PRO1114 interferon receptor polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. The present invention relates to an identification method.
In yet a further embodiment, the invention relates to a composition comprising a PRO1114 interferon receptor polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.
In another embodiment, the present invention provides an expressed sequence tag (EST) designated herein as DNA48466 comprising the nucleotide sequence of SEQ ID NO: 184 (see FIG. 118).

47. PRO828
Applicants have identified a cDNA clone encoding a novel polypeptide with homology to glutathione peroxidase, designated “PRO828” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO828 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO828 polypeptide having amino acid residues 1 to 187 of FIG. 120 (SEQ ID NO: 189), or is complementary to its encoding nucleic acid sequence. Yes, and at least moderate and in some cases remain stably bound under high stringency conditions. In other embodiments, the isolated nucleic acid comprises DNA encoding a PRO828 polypeptide having about 22 to 187 amino acid residues of FIG. 120 (SEQ ID NO: 189), or is complementary to the encoding nucleic acid sequence. Yes, and at least moderate and in some cases remain stably bound under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA57037-1444 vector deposited on May 27, 1998 as ATCC 209903 containing the nucleotide sequence encoding PRO828.
In a further embodiment, the present invention provides an isolated PRO828 polypeptide. In particular, the invention provides isolated native sequence PRO828 polypeptide, which in one embodiment, includes an amino acid sequence having residues 1 to 187 of FIG. 120 (SEQ ID NO: 189). Another embodiment of the invention relates to a PRO828 polypeptide having about amino acids 22 to 187 of Figure 120 (SEQ ID NO: 189). Optionally, the PRO828 polypeptide can be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the DNA57037-1444 vector deposited on May 27, 1998 as ATCC 209903.

48. PRO1009
Sequence identity with long chain acyl-CoA synthase homologue, long chain acyl-CoA synthase and long chain acyl-CoA synthase ligase encoding a novel polypeptide, named “PRO1009” in this application A cDNA clone (DNA57129-1413) was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1009 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1009 polypeptide having a sequence of about 1 or about 23 to about 615 amino acid residues of FIG. 122 (SEQ ID NO: 194), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity. The phrase “or” as used herein to refer to an amino acid or nucleic acid means two alternative alternative embodiments provided herein, ie 1-615 or 23-615.
In another aspect, the invention provides an isolated PRO1009 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 41 or about 107 to about 1885 of FIG. 121 (SEQ ID NO: 193). Relates to nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA57129-1413) of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 2099777 human protein cDNA (DNA57129-1413).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence of about 1 or about 23 to about 615 of FIG. 122 (SEQ ID NO: 194), preferably at least about 85%. A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1009 polypeptide having amino acid residue 1 of FIG. 122 (SEQ ID NO: 194) or a sequence of about 23 to about 615, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 Isolated, produced by isolating a test DNA molecule if it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to nucleic acid molecules.
In a particular aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1009 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 22 in FIG. 122 (SEQ ID NO: 194). The transmembrane domain has been tentatively identified as extending from amino acid positions about 140-161, 213-229, and 312-334 (FIG. 122, SEQ ID NO: 194) of the PRO1009 amino acid sequence.
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about about 80% when compared to the amino acid sequence contained in residues 1 or 23 to about 615 of FIG. 122 (SEQ ID NO: 194). An isolated nucleic acid comprising a DNA encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Concerning molecules.
In another embodiment, the present invention provides an isolated PRO1009 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1009 polypeptide, which in one embodiment, comprises amino acid sequence comprising residue 1 or about 23 to about 615 of FIG. 122 (SEQ ID NO: 194). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 or 23 to 615 of FIG. 122 (SEQ ID NO: 194). More preferably, an isolated PRO1009 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence from residue 1 or 23 to about 615 of FIG. 122 (SEQ ID NO: 194). Relates to an isolated PRO1009 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises the sequence of amino acid residues 1 or 23 to about 615 of Figure 122 (SEQ ID NO: 194), or a fragment sufficient to bind to an anti-PRO1009 antibody thereof, Related to isolated PRO1009 polypeptide. Preferably, this PRO1009 fragment retains the qualitative biological activity of a native PRO1009 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1009 polypeptide having a sequence of about 1 or about 23 to about 615 amino acid residues of FIG. 122 (SEQ ID NO: 194). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1009 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1009 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1009 polypeptide by contacting the native PRO1009 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1009 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.
In another embodiment, the present invention provides an expressed sequence tag (EST) designated herein as DNA50853 comprising the nucleotide sequence of FIG. 123 (SEQ ID NO: 195).

49. PRO1007
Applicants have identified a cDNA clone encoding a novel polypeptide having sequence identity with MAGPIAP and named this polypeptide “PRO1007” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1007 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO1007 polypeptide having amino acid residues 1 to 346 of FIG. 125 (SEQ ID NO: 197), or is complementary to the encoding nucleic acid sequence. Yes, and at least moderate, and in some cases remain stably bound under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on June 9, 1998 with the ATCC as DNA57690-1374, which contains the nucleotide sequence encoding PRO1007.
In another embodiment, the invention provides isolated PRO1007 polypeptide. In particular, the present invention provides isolated native sequence PRO1007 polypeptide, which in one embodiment, includes an amino acid sequence having residues 1 to 346 of FIG. 125 (SEQ ID NO: 197). In another embodiment of the invention, the invention relates to an isolated extracellular domain of a PRO1007 polypeptide. Optionally, the PRO1007 polypeptide can be obtained or obtained by expression of a polypeptide encoded by the cDNA insert of the vector deposited with the ATCC on June 9, 1998 as DNA57690-1374.

50. PRO1056
A cDNA clone (DNA57693-1424) was identified that was homologous to a nucleic acid encoding a chloride channel protein encoding a novel polypeptide, designated “PRO1056” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1056 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1056 polypeptide having a sequence of about 1 or about 19 to about 120 amino acid residues of FIG. 127 (SEQ ID NO: 199), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1056 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide about 56 or about 110 to about 415 of FIG. 126 (SEQ ID NO: 198). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA57693-1424) of ATCC Deposit No. 203008, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203008 human protein cDNA (DNA57693-1424).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 of FIG. 127 (SEQ ID NO: 199) or the sequence of about 19 to about 120. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1056 polypeptide having amino acid residue 1 of FIG. 127 (SEQ ID NO: 199) or a sequence of about 19 to about 120, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, and at least 10 nucleotides produced by isolating the test DNA molecule It has an isolated nucleic acid molecule.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1056 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 18 in FIG. 127 (SEQ ID NO: 199). The transmembrane domain has been tentatively identified as extending from about amino acid position 39 to about amino acid position 58 (FIG. 127, SEQ ID NO: 199) of the PRO1056 amino acid sequence.
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about about 80% when compared to amino acid sequence contained in residue 1 or about 19 to about 120 of FIG. 127 (SEQ ID NO: 199). An isolated DNA molecule that encodes a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Relates to nucleic acid molecules.
Other embodiments relate to fragments of the PRO1056 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 126 (SEQ ID NO: 198).
In another embodiment, the invention provides an isolated PRO1056 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO1056 polypeptide, which in one embodiment, includes amino acid sequence comprising residue 1 or about 19 to about 120 of FIG. 127 (SEQ ID NO: 199). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 127 (SEQ ID NO: 199) or the sequence from about 19 to about 120. It relates to an isolated PRO1056 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 127 (SEQ ID NO: 199) or the amino acid sequence from about 19 to about 120. Relates to an isolated PRO1056 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 127 (SEQ ID NO: 199) or a sequence from about 19 to about 120, or a fragment sufficient to bind to an anti-PRO1056 antibody thereof. Relates to an isolated PRO1056 polypeptide. Preferably, this PRO1056 fragment retains the qualitative biological activity of a native PRO1056 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1056 polypeptide having a sequence of about 1 or about 19 to about 120 amino acid residues of FIG. 127 (SEQ ID NO: 199). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1056 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1056 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1056 polypeptide by contacting the native PRO1056 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1056 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

51. PRO826
A cDNA clone (DNA57694-1341) encoding a novel secreted polypeptide, designated “PRO826” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO826 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule that encodes a PRO826 polypeptide having a sequence of about 1 or about 23 to about 99 amino acid residues of FIG. 129 (SEQ ID NO: 201), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO826 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of FIG. 128 (SEQ ID NO: 200) from about nucleotide 13 or from about 79 to about 309. Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA57694-1341) of ATCC Deposit No. 20317, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203017 human protein cDNA (DNA57694-1341).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 129 (SEQ ID NO: 201) or the sequence from about 23 to about 99. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO826 polypeptide having the sequence of amino acid residue 1 or about 23 to about 99 of FIG. 129 (SEQ ID NO: 201), or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, and at least 10 nucleotides produced by isolating the test DNA molecule It has an isolated nucleic acid molecule.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO826 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 22 in FIG. 129 (SEQ ID NO: 201).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about about 80% when compared to residue 1 of Figure 129 (SEQ ID NO: 201) or an amino acid sequence comprised from about 23 to about 99. An isolated DNA molecule encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Relates to nucleic acid molecules.
Other embodiments relate to fragments of the PRO826 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, It can be derived from the nucleotide sequence shown in 128 (SEQ ID NO: 200).
In another embodiment, the invention provides an isolated PRO826 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO826 polypeptide, which in one embodiment, comprises amino acid sequence comprising residue 1 or about 23 to about 99 of FIG. 129 (SEQ ID NO: 201). Is included.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 129 (SEQ ID NO: 201) or the sequence from about 23 to about 99. It relates to an isolated PRO826 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 or the amino acid sequence from about 23 to about 99 in FIG. 129 (SEQ ID NO: 201). Relates to an isolated PRO826 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 129 (SEQ ID NO: 201) or a sequence of about 23 to about 99, or a fragment sufficient to bind to an anti-PRO826 antibody thereof. Relates to an isolated PRO826 polypeptide. Preferably, this PRO826 fragment retains the qualitative biological activity of a native PRO826 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO826 polypeptide having a sequence of about 1 or about 23 to about 99 amino acid residues of FIG. 129 (SEQ ID NO: 201). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.

52. PRO819
Applicants have identified a cDNA clone (DNA57695-1340) encoding a novel secreted polypeptide, designated “PRO819” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO819 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule that encodes a PRO819 polypeptide having a sequence of about 1 or about 25 to about 52 amino acid residues of FIG. 131 (SEQ ID NO: 203), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO819 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide about 46 or about 118 to about 201 of FIG. 130 (SEQ ID NO: 202). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA57695-1340) of ATCC Deposit No. 203006, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203006 human protein cDNA (DNA57695-1340).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 131 (SEQ ID NO: 203) or the sequence from about 25 to about 52 DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO819 polypeptide having the sequence of amino acid residue 1 or about 25 to about 52 of FIG. 131 (SEQ ID NO: 203); b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, and at least 10 nucleotides produced by isolating the test DNA molecule It has an isolated nucleic acid molecule.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO819 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 24 in the sequence of FIG. 131 (SEQ ID NO: 203).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence contained in residue 1 or from about 25 to about 52 of FIG. 131 (SEQ ID NO: 203) An isolated DNA comprising a DNA encoding a polypeptide having a score of about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Relates to nucleic acid molecules.
Other embodiments relate to fragments of the PRO819 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 130 (SEQ ID NO: 202).
In another embodiment, the present invention provides an isolated PRO819 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO819 polypeptide, which in one embodiment, includes amino acid sequence comprising residue 1 or about 25 to about 52 of FIG. 131 (SEQ ID NO: 203). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 25 to about 52 in FIG. 131 (SEQ ID NO: 203). It relates to an isolated PRO819 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, when compared to residue 1 or the amino acid sequence from about 25 to about 52 in FIG. 131 (SEQ ID NO: 203). Preferably, it relates to an isolated PRO819 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 131 (SEQ ID NO: 203) or the sequence of about 25 to about 52, or a fragment sufficient to bind to an anti-PRO819 antibody. Related to isolated PRO819 polypeptide. Preferably, this PRO819 fragment retains the qualitative biological activity of a native PRO819 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO819 polypeptide having a sequence of about 1 or about 25 to about 52 amino acid residues of FIG. 131 (SEQ ID NO: 203). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.

53. PRO1006
A cDNA clone (DNA57699-1412) has been identified that has sequence identity with the wild protein, believed to be a tyrosine protein kinase encoding a novel polypeptide, designated “PRO1006” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1006 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1006 polypeptide having a sequence of about 1 or about 24 to about 392 of amino acid residues in FIG. 133 (SEQ ID NO: 205), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity. As used herein, the phrase “or” means an amino acid or a nucleic acid, and two alternative alternative embodiments provided herein, eg, 1-392, or 24-392 in other embodiments. Means.
In another aspect, the invention provides an isolated PRO1006 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 28 or about 97 to about 1203 of FIG. 132 (SEQ ID NO: 204). Relates to nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA57699-1412) of ATCC Deposit No. 203020, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203020 human protein cDNA (DNA57699-1412).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence of about 1 or about 24 to about 392 of FIG. 133 (SEQ ID NO: 205), preferably at least about 85%. A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1006 polypeptide having a sequence of about 1 or about 24 to about 392 of amino acid residue of FIG. 133 (SEQ ID NO: 205); or (B) hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about An isolated, produced by isolating a test DNA molecule if it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Nucleic acid molecules.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 80% when compared to the amino acid sequence contained in residue 1 or from about 24 to about 392 of FIG. 133 (SEQ ID NO: 205). An isolated DNA molecule that encodes a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Relates to nucleic acid molecules.
In another embodiment, the present invention provides an isolated PRO1006 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1006 polypeptide, which in one embodiment, comprises amino acid sequence comprising residues 1 or about 24 to about 392 of FIG. 133 (SEQ ID NO: 205). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 133 (SEQ ID NO: 205) or the sequence from about 24 to about 392. It relates to an isolated PRO1006 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 133 (SEQ ID NO: 205) or the amino acid sequence from about 24 to about 392. Relates to an isolated PRO1006 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1006 polypeptide having a sequence of about 1 or about 24 to about 392 of amino acid residue of FIG. 133 (SEQ ID NO: 205). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1006 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1006 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1006 polypeptide by contacting the native PRO1006 polypeptide with a candidate molecule and monitoring biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1006 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

54. PRO1112
The Applicant has identified a cDNA clone encoding a novel polypeptide having a multi-membrane spanning domain and having some sequence identity with the Mycobacterium tuberculosis peptide, a peptide found in the Dayhoff database named “MTY20B11_13” And the novel polypeptide was named “PRO1112” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1112 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule that encodes a PRO1112 polypeptide having the sequence of amino acid residue 1 or about 14 to about 262 of FIG. 135 (SEQ ID NO: 207), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). It comprises DNA with 95% sequence identity.
In another aspect, the invention provides an isolated encoding a PRO1112 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 20 or about 59 to about 809 of FIG. 134 (SEQ ID NO: 206). Relates to nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention relates to (a) at least about 80% of the DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA deposited at ATCC on June 9, 1998 with DNA57702-1476. An isolated nucleic acid comprising DNA having sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Concerning molecules. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA deposited at ATCC on June 9, 1998 with DNA57702-1476.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 of FIG. 135 (SEQ ID NO: 207) or the sequence of about 14 to about 262. It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a particular aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1112 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 13 in FIG. 135 (SEQ ID NO: 207). The transmembrane domain has been tentatively identified as extending from amino acid positions about 58-76, 99-113, 141-159 and 203-222 in FIG. 135 (SEQ ID NO: 207).
In other embodiments, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to residue 1 of Figure 135 (SEQ ID NO: 207) or the amino acid sequence from about 14 to about 262, and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive.
Other embodiments relate to fragments of the PRO1112 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 60 to about 100 nucleotides in length.
In another embodiment, the present invention provides an isolated PRO1112 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1112 polypeptide, which in one embodiment, includes amino acid sequence comprising residue 1 or about 14 to about 262 of Figure 135 (SEQ ID NO: 207). Is included.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 135 (SEQ ID NO: 207) or the sequence from about 14 to about 262. It relates to an isolated PRO1112 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 135 (SEQ ID NO: 207) or the amino acid sequence from about 14 to about 262. Relates to an isolated PRO1112 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of Figure 135 (SEQ ID NO: 207) or the sequence of about 14 to about 262, or a fragment sufficient to bind to an anti-PRO1112 antibody thereof. Relates to an isolated PRO1112 polypeptide. Preferably, this PRO1112 fragment retains the qualitative biological activity of a native PRO1112 polypeptide.
In another aspect, the invention relates to a fragment of PRO1112 that is long enough to provide an epitope from which antibodies can be produced.

55. PRO1074
The Applicant has identified a cDNA clone, DNA57704-1452, encoding a novel polypeptide having homology to galactosyltransferase and named this polypeptide “PRO1074” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1074 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1074 polypeptide having the sequence from amino acid residue 1 to about 331 of FIG. 137 (SEQ ID NO: 209), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated PRO1074 polypeptide comprising DNA that hybridizes to a complementary strand of a nucleic acid sequence having residues from about 322 to about 1314 of FIG. 136 (SEQ ID NO: 208). Relates to nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA57704-1452) of ATCC Deposit No. 209953, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises a DNA molecule that encodes the same mature polypeptide encoded by the human protein cDNA (DNA57704-1452) at ATCC Deposit Number 209953.
In yet a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues 1 to about 331 of FIG. 137 (SEQ ID NO: 209), more preferably Relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding PRO1074 extracellular domain (ECD) with or without an initiating methionine, and soluble variants thereof (ie, lacking a transmembrane domain). Inactivated or inactivated) or complementary to such an encoding nucleic acid molecule. In the PRO 1074 amino acid sequence (FIG. 137, SEQ ID NO: 209), a type II transmembrane domain region has been experimentally identified as extending from about amino acid position 20 to about 39.
In other embodiments, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence from residue 1 to about 331 of FIG. 137 (SEQ ID NO: 209). It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of about 90% positive, most preferably at least about 95% positive.
Another embodiment relates to fragments of the PRO1074 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1074 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1074 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to about 331 of FIG. 137 (SEQ ID NO: 209). Yes.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 to 331 of FIG. 137 (SEQ ID NO: 209); More preferably, it relates to an isolated PRO1074 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the present invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residue 1 to about 331 of FIG. 137 (SEQ ID NO: 209). It relates to an isolated PRO1074 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In another embodiment, the present invention relates to a sequence from amino acid residue X of FIG. 2 (SEQ ID NO: 3) to about 331 (where X is amino acid residue 35 of FIG. 137 (SEQ ID NO: 209)). Any one to 44), at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence. PRO1074 extracellular domain comprising an amino acid sequence having identity.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residues 1 to about 331 of Figure 137 (SEQ ID NO: 209), or a fragment sufficient to bind to an anti-PRO1074 antibody thereof. Related PRO1074 polypeptides. Preferably, this PRO1074 fragment retains the qualitative biological activity of a native PRO1074 polypeptide.
In another aspect, the invention relates to a fragment of PRO1074 that is long enough to provide an epitope from which an antibody can be produced.
In yet another embodiment, the invention relates to agonists and antagonists of PRO1074 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1074 antibody.
In a further embodiment, the present invention relates to selection of methods for identifying agonists or antagonists of native PRO1074 polypeptides.
In yet a further embodiment, the invention relates to a composition comprising a PRO1074 polypeptide identified above with a pharmaceutically acceptable carrier.

56. PRO1005
A cDNA clone (DNA57708-1411) encoding a novel polypeptide, designated “PRO1005” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1005 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1005 polypeptide having a sequence of about 21 to about 185 amino acid residues of FIG. 139 (SEQ ID NO: 211), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1005 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 90 to about 584 of FIG. 138 (SEQ ID NO: 210). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA57708-1411) of ATCC Deposit No. 203021, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit number 203021 human protein cDNA (DNA57708-1411).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, to the sequence from about 21 to about 185 amino acid residues in FIG. 139 (SEQ ID NO: 211). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1005 polypeptide having a sequence of about 21 to about 185 amino acid residues of FIG. 139 (SEQ ID NO: 211), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least 50 nucleotides, preferably by isolation of a test DNA molecule when having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably It relates to an isolated nucleic acid molecule having at least 100 nucleotides.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1005 polypeptide with or without an N-terminal signal sequence, or complementary to such an encoding nucleic acid molecule. Is. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 20 in FIG. 139 (SEQ ID NO: 211).
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 21 to about 185 of FIG. 139 (SEQ ID NO: 211) Preferably it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA of (a).
Other embodiments relate to fragments of the PRO1005 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1005 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1005 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 21 to about 185 of FIG. 139 (SEQ ID NO: 211). Yes.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 21 to about 185 of FIG. 139 (SEQ ID NO: 211). More preferably, an isolated PRO1005 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 21 to 185 of FIG. 139 (SEQ ID NO: 211). Pertaining to an isolated PRO1005 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residue 21 to about 185 of FIG. 139 (SEQ ID NO: 211), or a fragment sufficient to bind to an anti-PRO1005 antibody thereof. Related PRO1005 polypeptide. Preferably, this PRO1005 fragment retains the qualitative biological activity of a native PRO1005 polypeptide.
In yet a further aspect, the invention provides: (i) a test DNA molecule, (a) a DNA molecule encoding a PRO1005 polypeptide having a sequence of about 21 to about 185 amino acid residues of FIG. 139 (SEQ ID NO: 211); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

57. PRO1073
A cDNA clone (DNA57710-1451) encoding a novel polypeptide, designated “PRO1073” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1073 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule that encodes a PRO1073 polypeptide having a sequence of about 32 to about 299 amino acid residues in FIG. 141 (SEQ ID NO: 213), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1073 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid at about 438 or about 12241 of FIG. 140 (SEQ ID NO: 212). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by human protein cDNA (DNA57710-1451) of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA57710-1451) at ATCC Deposit Number 203048.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, to the sequence from about 32 to about 299 amino acid residues of FIG. 141 (SEQ ID NO: 213). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1073 polypeptide having a sequence of from about 32 to about 299 amino acid residues of FIG. 141 (SEQ ID NO: 213), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least 50 nucleotides, preferably by isolation of a test DNA molecule when having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably It relates to an isolated nucleic acid molecule having at least 100 nucleotides.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1073 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 31 in the sequence of FIG. 141 (SEQ ID NO: 213).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 32 to about 299 of FIG. 141 (SEQ ID NO: 213), More preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA of (a).
Another embodiment relates to fragments of the PRO1073 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1073 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1073 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 32 to 299 of FIG. 141 (SEQ ID NO: 213). .
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 32 to about 299 of FIG. 141 (SEQ ID NO: 213). More preferably, an isolated PRO1073 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the present invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residues 32 to 299 of FIG. 141 (SEQ ID NO: 213). It relates to an isolated PRO1073 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising from about amino acid residue 32 to about 299 of FIG. 141 (SEQ ID NO: 213), or a fragment sufficient to bind to an anti-PRO1073 antibody thereof. Related PRO1073 polypeptides. Preferably, this PRO1073 fragment retains the qualitative biological activity of a native PRO1073 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1073 polypeptide having a sequence of about amino acid residues 32 to about 299 of FIG. 141 (SEQ ID NO: 213); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

58. PRO1152
A cDNA clone (DNA57711-1501) encoding a novel transmembrane polypeptide, designated “PRO1152” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1152 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1152 polypeptide having a sequence from about 1 or about 29 to about 479 amino acid residues in FIG. 144 (SEQ ID NO: 216), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO1152 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 58 or about 142 to about 1494 of FIG. 143 (SEQ ID NO: 215). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA57711-1501) of ATCC Deposit No. 20347, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA57711-1501) of ATCC Deposit No. 20347.
In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about about 80% to the sequence of amino acid residue 1 or about 29 to about 479 of FIG. 144 (SEQ ID NO: 216). DNA encoding a polypeptide having 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complementation of DNA of (a) It relates to an isolated nucleic acid molecule comprising a strand.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1152 polypeptide having the sequence of amino acid residue 1 of FIG. 144 (SEQ ID NO: 216) or from about 29 to about 479, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity produced at least about 300 nucleotides produced by isolating the test DNA molecule. It has an isolated nucleic acid molecule.
In a particular aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1152 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 28 in FIG. 144 (SEQ ID NO: 216). The various transmembrane domains are amino acids from about 133 to about 155, from about 168 to about 187, from about 299 to about 247 of the PRO1152 amino acid sequence (Figure 144, SEQ ID NO: 216). Tentatively identified as extending from amino acid position 264 to amino acid position 285, amino acid position 309 to amino acid position 330, amino acid position 371 to amino acid position 390, and amino acid position 441 to amino acid position 464. .
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 80% when compared to the amino acid sequence contained in residue 1 or from about 29 to about 479 of FIG. 144 (SEQ ID NO: 216). An isolated nucleic acid comprising a DNA encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1152 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 143 (SEQ ID NO: 215).
In other embodiments, the invention provides an isolated PRO1152 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1152 polypeptide, which in one embodiment, includes amino acid sequence comprising residue 1 or about 29 to about 479 of FIG. 144 (SEQ ID NO: 216). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 144 (SEQ ID NO: 216) or the sequence from about 29 to about 479. It relates to an isolated PRO1152 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to residue 1 of FIG. 144 (SEQ ID NO: 216) or the amino acid sequence from about 29 to about 479, and more. Preferably, it relates to an isolated PRO1152 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 144 (SEQ ID NO: 216) or the sequence of about 29 to about 479, or a fragment sufficient to bind to an anti-PRO1152 antibody thereof. Relates to an isolated PRO1152 polypeptide. Preferably, this PRO1152 fragment retains the qualitative biological activity of a native PRO1152 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO1152 polypeptide having the sequence of about 1 or about 29 to about 479 of FIG. 144 (SEQ ID NO: 216). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In another embodiment, the present invention provides a nucleic acid molecule herein designated DNA55807 comprising the nucleotide sequence of SEQ ID NO: 217 (see FIG. 145).

59. PRO1136
A cDNA clone (DNA57827-1493) having homology to a nucleic acid encoding a PDZ domain-containing protein encoding a novel polypeptide, designated “PRO1136” in the present application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1136 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1136 polypeptide having a sequence of about 1 or about 16 to about 632 of amino acid residues in FIG. 147 (SEQ ID NO: 219), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1136 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide about 216 or about 261 to about 2111 of FIG. 146 (SEQ ID NO: 218). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA57827-1493) of ATCC Deposit No. 203045, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203045 (DNA57827-1493).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about about 80% to the sequence of amino acid residue 1 or about 16 to about 632 of FIG. 147 (SEQ ID NO: 219). DNA encoding a polypeptide having 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complementation of DNA of (a) It relates to an isolated nucleic acid molecule comprising a strand.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1136 polypeptide having amino acid residue 1 of FIG. 147 (SEQ ID NO: 219) or a sequence of about 16 to about 632, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, and at least 10 nucleotides produced by isolating the test DNA molecule It has an isolated nucleic acid molecule.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1136 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 15 in FIG. 147 (SEQ ID NO: 219).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 80% when compared to amino acid sequence contained in residue 1 or from about 16 to about 632 of FIG. 147 (SEQ ID NO: 219). An isolated nucleic acid comprising a DNA encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1136 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 146 (SEQ ID NO: 218).
In another embodiment, the invention provides an isolated PRO1136 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO1136 polypeptide, which in one embodiment, comprises amino acid sequence comprising residue 1 or about 16 to about 632 of FIG. 147 (SEQ ID NO: 219). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 147 (SEQ ID NO: 219) or the sequence from about 16 to about 632 It relates to an isolated PRO1136 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, when compared to residue 1 of FIG. 147 (SEQ ID NO: 219) or the amino acid sequence from about 16 to about 632 Preferably, it relates to an isolated PRO1136 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 147 (SEQ ID NO: 219) or the sequence of about 16 to about 632, or a fragment sufficient to bind to an anti-PRO1136 antibody thereof. Relates to an isolated PRO1136 polypeptide. Preferably, this PRO1136 fragment retains the qualitative biological activity of a native PRO1136 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1136 polypeptide having a sequence of about 1 or about 16 to about 632 of amino acid residues of FIG. 147 (SEQ ID NO: 219). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet other embodiments, the invention relates to agonists and antagonists of native PRO1136 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1136 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1136 polypeptide by contacting the native PRO1136 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1136 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

60. PRO813
Applicants have identified a cDNA clone (DNA57834-1339), homologous to alveolar surfactant binding protein C, which is named “PRO813” in this application and encodes a novel secreted polypeptide.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO813 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO813 polypeptide having a sequence of about 1 or about 27 to about 176 amino acid residues in FIG. 149 (SEQ ID NO: 221), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO813 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide about 109 or about 187 to about 636 of FIG. 148 (SEQ ID NO: 220). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) at least about 80% sequence identity to a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA57834-1339) at ATCC deposit no. Relates to an isolated nucleic acid molecule comprising DNA having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA57834-1339) at ATCC Deposit Number 209954.
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about about 80% to the amino acid residue 1 or about 27 to about 176 sequence of FIG. 149 (SEQ ID NO: 221). It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO813 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 26 in FIG. 149 (SEQ ID NO: 221).
In other embodiments, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence contained in residue 1 or from about 27 to about 176 of FIG. 149 (SEQ ID NO: 221). More preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive.
Other embodiments relate to fragments of the PRO813 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO813 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO813 polypeptide, which in one embodiment, comprises amino acid sequence comprising residue 1 or from about 27 to about 176 of FIG. 149 (SEQ ID NO: 221). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 149 (SEQ ID NO: 221) or the sequence from about 27 to about 176. It relates to an isolated PRO813 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, when compared to residue 1 of FIG. 149 (SEQ ID NO: 221) or the amino acid sequence from about 27 to about 176, and more. Preferably, it relates to an isolated PRO813 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 149 (SEQ ID NO: 221) or the sequence of about 27 to about 176, or a fragment sufficient to bind to an anti-PRO813 antibody thereof. Relates to an isolated PRO813 polypeptide. Preferably, this PRO813 fragment retains the qualitative biological activity of a native PRO813 polypeptide.
In another aspect, the invention relates to a fragment of PRO813 that is long enough to provide an epitope from which an antibody can be produced.
In yet other embodiments, the invention relates to agonists and antagonists of native PRO813 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO813 antibody.
In a further embodiment, the present invention relates to screening methods for identifying agonists or antagonists of native PRO813 polypeptides.
In yet a further embodiment, the invention relates to a composition comprising a PRO813 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

61. PRO809
A cDNA clone (DNA57883-1338) was identified that was sequence-identical to a heparan sulfate proteoglycan encoding a novel polypeptide, designated “PRO809” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO809 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO809 polypeptide having a sequence from about 1 or 19 to about 265 amino acid residues in FIG. 151 (SEQ ID NO: 223), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about DNA comprising 95% sequence identity. As used herein, the phrase “or” means an amino acid or nucleic acid, and two alternative alternative embodiments provided herein, eg, 1-265, or 19-265 in other embodiments. Means.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO809 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 63 or 117 to about 867 of FIG. 150 (SEQ ID NO: 222). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA57836-1338) of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203025 human protein cDNA (DNA57883-1338).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about about 80% to the sequence from about 1 or 19 to about 265 amino acid residues in FIG. 151 (SEQ ID NO: 223). DNA encoding a polypeptide having 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complementation of DNA of (a) It relates to an isolated nucleic acid molecule comprising a strand.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO809 polypeptide having a sequence from about 1 or 19 to about 265 amino acid residues of FIG. 151 (SEQ ID NO: 223); b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 An isolated nucleic acid produced by isolating a test DNA molecule when it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Concerning molecules.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85 when compared to the amino acid sequence contained in residues 151 or 19 to about 265 of FIG. 151 (SEQ ID NO: 223). An isolated nucleic acid comprising a DNA molecule encoding a polypeptide with a score of% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a) Concerning molecules.
In another embodiment, the invention provides an isolated PRO809 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO809 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 19 to 265 of FIG. 151 (SEQ ID NO: 223). It is out.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 19 to about 265 of FIG. 151 (SEQ ID NO: 223). It relates to an isolated PRO809 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 1 or 19 to 265 of FIG. 151 (SEQ ID NO: 223). It relates to an isolated PRO809 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention relates to (i) a test DNA molecule, (a) a DNA encoding a PRO809 polypeptide having a sequence from about 1 or 19 to about 265 amino acid residues of FIG. 151 (SEQ ID NO: 223). A molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); If preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO809 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO809 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO809 polypeptide by contacting the native PRO809 polypeptide with a candidate molecule and monitoring biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO809 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

62. PRO791
A cDNA clone (DNA57838-1337) has been identified that has sequence identity with the MHC class I antigen encoding a novel polypeptide, designated “PRO791” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO791 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO791 polypeptide having a sequence of about 1 or 26 to about 246 of amino acid residues in FIG. 153 (SEQ ID NO: 225), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). It comprises DNA with 95% sequence identity. The term “or” as used herein to refer to amino acids or nucleic acids refers to two alternative embodiments provided herein, namely 1-246, or 26-246 of other embodiments. .
In another aspect, the invention provides an isolated nucleic acid encoding a PRO791 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 9 or 84 to about 746 of FIG. 152 (SEQ ID NO: 224). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by human protein cDNA (DNA57838-1337) of ATCC Deposit No. 203014, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203014 human protein cDNA (DNA57838-1337).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85, to the sequence from amino acid residue 1 or 26 to about 246 of FIG. 153 (SEQ ID NO: 225). DNA encoding a polypeptide having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO791 polypeptide having a sequence from amino acid residue 1 or 26 to about 246 of FIG. 153 (SEQ ID NO: 225); or (b ) Hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85% An isolated nucleic acid molecule produced by isolating a test DNA molecule when it has a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity About.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 26 to about 246 of FIG. 153 (SEQ ID NO: 225) More preferably, a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA of (a) .
In another embodiment, the present invention provides an isolated PRO791 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO791 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 26 to 246 of FIG. 153 (SEQ ID NO: 225). Yes.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 26 to about 246 of FIG. 153 (SEQ ID NO: 225). It relates to an isolated PRO791 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 1 or 26 to 246 of FIG. 153 (SEQ ID NO: 225). It relates to an isolated PRO791 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention relates to (i) a test DNA molecule, (a) a DNA encoding a PRO791 polypeptide having a sequence from about 1 or 26 to about 246 of amino acid residue of FIG. 153 (SEQ ID NO: 225) A molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); If preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO791 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO791 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO791 polypeptide by contacting the native PRO791 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO791 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

63. PRO1004
A cDNA clone (DNA57844-1410) encoding a novel polypeptide, designated “PRO1004” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1004 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1004 polypeptide having a sequence of about 25 to about 115 amino acid residues in FIG. 155 (SEQ ID NO: 227), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1004 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 191 to about 463 of FIG. 154 (SEQ ID NO: 226). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA57844-1410) of ATCC Deposit No. 203010, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203010 human protein cDNA (DNA57844-1410).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, to the sequence from about 25 to about 115 amino acid residues in FIG. 155 (SEQ ID NO: 227). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1004 polypeptide having a sequence of about 25 to about 115 amino acid residues of FIG. 155 (SEQ ID NO: 227), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least 50 nucleotides, preferably by isolation of a test DNA molecule when having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably It relates to an isolated nucleic acid molecule having at least 100 nucleotides.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1004 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 24 in FIG. 155 (SEQ ID NO: 227).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 25 to about 115 in FIG. 155 (SEQ ID NO: 227), and more Preferably it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA of (a).
Other embodiments relate to fragments of the PRO1004 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1004 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the present invention provides an isolated native sequence PRO1004 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 25 to 115 of FIG. 155 (SEQ ID NO: 227).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 25 to about 115 in FIG. 155 (SEQ ID NO: 227). More preferably, an isolated PRO1004 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence of residues 25 to 115 of FIG. 155 (SEQ ID NO: 227). It relates to an isolated PRO1004 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residues 25 to about 115 of FIG. 155 (SEQ ID NO: 227), or a fragment sufficient to bind to an anti-PRO1004 antibody thereof. Related to the PRO1004 polypeptide. Preferably, this PRO1004 fragment retains the qualitative biological activity of a native PRO1004 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1004 polypeptide having a sequence of about 25 to about 115 amino acid residues of FIG. 155 (SEQ ID NO: 227); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is polypeptide And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

64. PRO1111
A cDNA clone (DNA58721-1475) encoding a novel polypeptide having sequence identity with LIG, designated “PRO1111” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1111 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1111 polypeptide having a sequence of about 1 to about 653 amino acid residues in FIG. 157 (SEQ ID NO: 229), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1111 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 57 to about 2015 of FIG. 156 (SEQ ID NO: 228). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA58721-1475) of ATCC Deposit No. 203110, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203110 (DNA58721-1475).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, to the sequence from about 1 to about 653 amino acid residues of FIG. 157 (SEQ ID NO: 229). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1111 polypeptide having a sequence of about 1 to about 653 amino acid residues of FIG. 157 (SEQ ID NO: 229), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity; Preferably, it relates to an isolated nucleic acid molecule having at least about 100 nucleotides. In certain aspects, the invention provides isolated nucleic acid molecules comprising DNA encoding a PRO1111 polypeptide as a soluble form, ie, a mutant in which the transmembrane domain has been deleted or inactivated, or as such Complementary to a non-coding nucleic acid molecule. The transmembrane domain has been tentatively identified as extending from amino acid positions about 21-40 (type II) and 528-548 (FIG. 157, SEQ ID NO: 229) of the PRO1111 amino acid sequence.
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 to about 653 of FIG. 157 (SEQ ID NO: 229), and more Preferably it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA of (a).
Other embodiments relate to fragments of the PRO1111 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1111 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1111 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to 653 of FIG. 157 (SEQ ID NO: 229).
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 653 of FIG. 157 (SEQ ID NO: 229). More preferably, an isolated PRO1111 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention relates to at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence of residues 1 to 653 of FIG. 157 (SEQ ID NO: 229). It relates to an isolated PRO1111 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residue 1 to about 653 of FIG. 157 (SEQ ID NO: 229), or a fragment sufficient to bind to an anti-PRO1111 antibody thereof. Related PRO1111 polypeptides. Preferably, this PRO1111 fragment retains the qualitative biological activity of a native PRO1111 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1111 polypeptide having a sequence from about 1 to about 653 amino acid residues of FIG. 157 (SEQ ID NO: 229); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1111 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1111 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1111 polypeptide by contacting the native PRO1111 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1111 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

65. PRO1344
A cDNA clone (DNA58723-1588) has been identified that is homologous to a nucleic acid encoding factor C encoding a novel polypeptide, designated “PRO1344” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1344 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1344 polypeptide having a sequence of about 1 or about 24 to about 720 of amino acid residues in FIG. 159 (SEQ ID NO: 231), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1344 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide about 26 or about 95 to about 2185 of FIG. 158 (SEQ ID NO: 230). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA58723-1588) of ATCC Deposit No. 203133, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203133 human protein cDNA (DNA58723-1588).
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about about 80% to amino acid residue 1 in FIG. 159 (SEQ ID NO: 231) or the sequence from about 24 to about 720. DNA encoding a polypeptide having 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complementation of DNA of (a) It relates to an isolated nucleic acid molecule comprising a strand.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1344 polypeptide having amino acid residue 1 of FIG. 159 (SEQ ID NO: 231) or a sequence of about 24 to about 720, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, and at least 10 nucleotides produced by isolating the test DNA molecule It has an isolated nucleic acid molecule.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1344 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 23 in the sequence of FIG. 159 (SEQ ID NO: 231).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 159 (SEQ ID NO: 231) or the amino acid sequence from about 24 to about 720. To an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA of (a) .
Other embodiments relate to fragments of the PRO1344 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 158 (SEQ ID NO: 230) can be derived from the nucleotide sequence.
In another embodiment, the present invention provides an isolated PRO1344 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO1344 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 24 to about 720 of FIG. 159 (SEQ ID NO: 231). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 159 (SEQ ID NO: 231) or the sequence from about 24 to about 720. It relates to an isolated PRO1344 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to residue 1 of FIG. 159 (SEQ ID NO: 231) or the amino acid sequence from about 24 to about 720, and more. Preferably, it relates to an isolated PRO1344 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 159 (SEQ ID NO: 231) or the sequence of about 24 to about 720, or a fragment sufficient to bind to an anti-PRO1344 antibody thereof. Relates to an isolated PRO1344 polypeptide. Preferably, this PRO1344 fragment retains the qualitative biological activity of a native PRO1344 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO1344 polypeptide having the sequence of about 1 or about 24 to about 720 of amino acid residues of FIG. 159 (SEQ ID NO: 231). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1344 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1344 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1344 polypeptide by contacting the native PRO1344 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1344 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

66. PRO1109
A cDNA clone (DNA58737-1473) has been identified that is homologous to a nucleic acid encoding β-1,4-galactosyltransferase, encoding a novel polypeptide, designated “PRO1109” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1109 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1109 polypeptide having a sequence of about 1 or about 28 to about 344 of amino acid residues in FIG. 161 (SEQ ID NO: 236), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other embodiments, the invention provides an isolated nucleic acid encoding a PRO1109 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of FIG. 160 (SEQ ID NO: 235) from about nucleotide 119 or from about 200 to about 1150. Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA58737-1473) of ATCC deposit no. 203136, or (b) the complementary strand of the nucleic acid molecule of (a). DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203136 human protein cDNA (DNA58737-1473).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about about 80% to the sequence of amino acid residue 1 or about 28 to about 344 of FIG. 161 (SEQ ID NO: 236). DNA encoding a polypeptide having 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complementation of DNA of (a) It relates to an isolated nucleic acid molecule comprising a strand.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1109 polypeptide having amino acid residue 1 of FIG. 161 (SEQ ID NO: 236) or a sequence of from about 28 to about 344, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, and at least 10 nucleotides produced by isolating the test DNA molecule It has an isolated nucleic acid molecule.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1109 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 27 in FIG. 161 (SEQ ID NO: 236).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 161 (SEQ ID NO: 236) or the amino acid sequence from about 28 to about 344. A DNA molecule encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA of (a) About.
Other embodiments relate to fragments of the PRO1109 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, It can be derived from the nucleotide sequence shown in 160 (SEQ ID NO: 235).
In another embodiment, the present invention provides an isolated PRO1109 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1109 polypeptide, which in one embodiment, includes amino acid sequence comprising residue 1 or from about 28 to about 344 of FIG. 161 (SEQ ID NO: 236). Is included.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 161 (SEQ ID NO: 236) or the sequence from about 28 to about 344. It relates to an isolated PRO1109 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to residue 1 of FIG. 161 (SEQ ID NO: 236) or the amino acid sequence from about 28 to about 344, and more. Preferably, it relates to an isolated PRO1109 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 161 (SEQ ID NO: 236) or the sequence from about 28 to about 344, or a fragment sufficient to bind to an anti-PRO1109 antibody thereof. Relates to the isolated PRO1109 polypeptide. Preferably, this PRO1109 fragment retains the qualitative biological activity of a native PRO1109 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO1109 polypeptide having the sequence from about 1 or about 28 to about 344 of amino acid residue of FIG. 161 (SEQ ID NO: 236). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1109 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1109 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1109 polypeptide by contacting the native PRO1109 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1109 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

67. PRO1383
A cDNA clone (DNA58743-1609) having homology to a nucleic acid encoding human melanoma cell-expressed protein nmb encoding a novel polypeptide, named “PRO1383” in this application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1383 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1383 polypeptide having a sequence of about 1 or about 25 to about 423 amino acid residues of FIG. 163 (SEQ ID NO: 241), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other embodiments, the invention provides an isolated nucleic acid encoding a PRO1383 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of FIG. 162 (SEQ ID NO: 240) from about nucleotide 122 or from about 194 to about 1390. Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA58743-1609) of ATCC Deposit No. 203154, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203154 (DNA58743-1609).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 80%, to amino acid residue 1 of FIG. 163 (SEQ ID NO: 241) or from about 25 to about 423. DNA encoding a polypeptide having 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complementation of DNA of (a) It relates to an isolated nucleic acid molecule comprising a strand.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1383 polypeptide having amino acid residue 1 of FIG. 163 (SEQ ID NO: 241) or a sequence of about 25 to about 423, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, and at least 10 nucleotides produced by isolating the test DNA molecule It has an isolated nucleic acid molecule.
In a particular aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1383 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 24 in FIG. 163 (SEQ ID NO: 241). The transmembrane domain has been tentatively identified as extending from about amino acid position 339 to about amino acid position 362 of the PRO1383 amino acid sequence (FIG. 163, SEQ ID NO: 241).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 163 (SEQ ID NO: 241) or the amino acid sequence from about 25 to about 423. A DNA molecule encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA of (a) About.
Other embodiments relate to fragments of the PRO1383 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 162 (SEQ ID NO: 240).
In another embodiment, the invention provides an isolated PRO1383 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1383 polypeptide, which in one embodiment, comprises amino acid sequence comprising residue 1 or about 25 to about 423 of FIG. 163 (SEQ ID NO: 241). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 163 (SEQ ID NO: 241) or the sequence from about 25 to about 423. It relates to an isolated PRO1383 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to residue 1 of FIG. 163 (SEQ ID NO: 241) or the amino acid sequence from about 25 to about 423, and more. Preferably it relates to an isolated PRO1383 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 163 (SEQ ID NO: 241) or the sequence of about 25 to about 423, or a fragment sufficient to bind to an anti-PRO1383 antibody thereof. Relates to an isolated PRO1383 polypeptide. Preferably, this PRO1383 fragment retains the qualitative biological activity of a native PRO1383 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO1383 polypeptide having a sequence of about 1 or about 25 to about 423 amino acid residues of FIG. 163 (SEQ ID NO: 241). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1383 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1383 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1383 polypeptide by contacting the native PRO1383 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1383 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

68. PRO1003
Applicant has identified a DNA clone, DNA58846-1409, encoding a novel secreted polypeptide, designated “PRO1003” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1003 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1003 polypeptide having the sequence of amino acid residue 1 or about 25 to about 84 in FIG. 165 (SEQ ID NO: 246), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). It comprises DNA with 95% sequence identity.
In other aspects, the invention provides an isolated PRO1003 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 41 or about 113 to about 292 of FIG. 164 (SEQ ID NO: 245). Relates to nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule that encodes the same mature polypeptide encoded by human protein cDNA (DNA58846-1409) of ATCC Deposit No. 209957 deposited on June 9, 1998, DNA comprising at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209957 (DNA58846-1409).
In yet a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 25 to about 84 in FIG. 165 (SEQ ID NO: 246). It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In other embodiments, the invention provides at least about 80% positive, preferably at least about 90% positive when compared to the amino acid sequence contained in residue 1 or from about 25 to about 84 in FIG. 165 (SEQ ID NO: 246). Most preferably relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a positive score of at least about 95%.
Other embodiments relate to fragments of the PRO1003 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1003 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1003 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 25 to about 84 in FIG. 165 (SEQ ID NO: 246). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 25 to about 84 in FIG. 165 (SEQ ID NO: 246). It relates to an isolated PRO1003 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, when compared to residue 1 of FIG. 165 (SEQ ID NO: 246) or the amino acid sequence from about 25 to about 84, more Preferably it relates to an isolated PRO1003 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises amino acid residue 1 of FIG. 165 (SEQ ID NO: 246) or the sequence from about 25 to about 84, or a fragment sufficient to bind to an anti-PRO1003 antibody thereof. Relates to an isolated PRO1003 polypeptide. Preferably, this PRO1003 fragment retains the qualitative biological activity of a native PRO1003 polypeptide.
In another aspect, the invention relates to a fragment of PRO1003 that is long enough to provide an epitope from which antibodies can be produced.

69. PRO1108
Applicants have identified a cDNA clone (DNA58848-1472), homologous to a nucleic acid encoding an LPAAT protein encoding a novel secreted polypeptide, designated “PRO1108” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1108 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1108 polypeptide having a sequence of about 1 to about 456 amino acid residues in FIG. 167 (SEQ ID NO: 248), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the sequence identity of
In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1108 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from nucleotide 77 to nucleotide 1444 of FIG. 166 (SEQ ID NO: 247). Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 80% sequence identity to a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209955 (DNA58848-1472). Relates to an isolated nucleic acid molecule comprising DNA having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 209955 human protein cDNA (DNA58848-1472).
In yet a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 456 of FIG. 167 (SEQ ID NO: 248). More preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1108 polypeptide with or without an initiating methionine, and its soluble, ie transmembrane domain, has been deleted or inactivated. Variants are provided, or are complementary to such encoding nucleic acid molecules. The transmembrane domain consists of amino acid position 22 to amino acid position 42, amino acid position 156 to amino acid position 176, amino acid position 180 to amino acid position 199 and amino acid position of the PRO1108 amino acid sequence (FIG. 167, SEQ ID NO: 248). It has been tentatively identified as a type II domain extending from about 369 to about amino acid position 388.
In other embodiments, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence from residue 1 to about 456 of FIG. 167 (SEQ ID NO: 248). It relates to an isolated nucleic acid molecule comprising a DNA molecule encoding a polypeptide with a score of about 90% positive, most preferably at least about 95% positive.
Other embodiments relate to fragments of the PRO1108 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1108 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1108 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to about 456 of FIG. 167 (SEQ ID NO: 248). .
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 456 of FIG. 167 (SEQ ID NO: 248). More preferably, an isolated PRO1108 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention relates to at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence from residue 1 to about 456 of FIG. 167 (SEQ ID NO: 248). It relates to an isolated PRO1108 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated sequence comprising amino acid residues 1 to about 456 of FIG. 167 (SEQ ID NO: 248), or a fragment sufficient to bind to an anti-PRO1108 antibody thereof. Related to the PRO1108 polypeptide. Preferably, this PRO1108 fragment retains the qualitative biological activity of a native PRO1108 polypeptide.
In another aspect, the invention relates to a fragment of PRO1108 that is long enough to provide an epitope from which antibodies can be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1108 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1108 antibody.
In a further embodiment, the present invention relates to screening methods for identifying agonists or antagonists of native PRO1108 polypeptides.
In yet a further embodiment, the invention relates to a composition comprising a PRO1108 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

70. PRO1137
Applicants have identified a cDNA clone, DNA58849-1494, which encodes a novel polypeptide having homology to ribosyltransferase, which was named “PRO1137” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1137 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule that encodes a PRO1137 polypeptide having amino acid residue 1 of FIG. 169 (SEQ ID NO: 250) or a sequence of about 15 to about 240, or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In another aspect, the invention provides an isolated PRO1137 polypeptide comprising DNA that hybridizes to a complementary strand of nucleic acid having residues from about 77 or about 119 to about 796 of FIG. 168 (SEQ ID NO: 249). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC deposit no. ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising DNA having about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209958 (DNA58849-1494).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 169 (SEQ ID NO: 250) or the sequence from about 15 to about 240. It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain embodiments, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1137 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or of such encoding DNA molecule. Provide complementary strand. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 14 in FIG. 169 (SEQ ID NO: 250).
In other aspects, the invention provides (a) at least about 80% positive, preferably at least about 80% when compared to the amino acid sequence contained in residue 1 or from about 15 to about 240 of FIG. 169 (SEQ ID NO: 250). It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of 90% positive, most preferably at least about 95% positive.
Other embodiments relate to fragments of the PRO1137 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1137 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1137 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 15 to about 240 of FIG. 169 (SEQ ID NO: 250). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to amino acid residue 1 or the sequence from about 15 to 240 of FIG. 169 (SEQ ID NO: 250). It relates to an isolated PRO1137 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to residue 1 of FIG. 169 (SEQ ID NO: 250) or an amino acid sequence comprised from about 15 to about 240, More preferably, it relates to an isolated PRO1137 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 169 (SEQ ID NO: 250) or a sequence of about 15 to about 240, or a fragment sufficient to bind to an anti-PRO1137 antibody thereof, It relates to an isolated PRO1137 polypeptide. Preferably, this PRO1137 fragment retains the qualitative biological activity of a native PRO1137 polypeptide.
In another aspect, the invention relates to a fragment of PRO1137 that is long enough to provide an epitope from which antibodies can be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1137 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1137 antibody.
In a further embodiment, the present invention relates to screening methods for identifying agonists or antagonists of native PRO1137 polypeptides.
In yet a further embodiment, the invention relates to a composition comprising a PRO1137 polypeptide as described above in combination with a pharmaceutically acceptable carrier.

71. PRO1138
The Applicant has identified a cDNA clone, DNA58850-1495, encoding a novel polypeptide having homology to the CD84 leukocyte antigen, which was named “PRO1138” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1138 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1138 polypeptide having amino acid residue 1 of FIG. 171 (SEQ ID NO: 253) or a sequence of from about 23 to about 335, or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). It comprises DNA with 95% sequence identity.
In other aspects, the invention encodes a PRO1138 polypeptide comprising DNA that hybridizes to the complementary strand of a nucleic acid contained in the sequence having residues from about 38 or about 104 to about 1042 in FIG. 170 (SEQ ID NO: 252). To an isolated nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides: (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA58850-1495) deposited on June 9, 1998, ATCC deposit no. ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising DNA having about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 209956 human protein cDNA (DNA58850-1495).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 171 (SEQ ID NO: 253) or the sequence from about 23 to about 335. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a particular embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1138 extracellular domain (ECD) with or without an N-terminal signal sequence and / or initiation methionine, and soluble variants thereof Providing a body (ie, the transmembrane domain has been deleted or inactivated) or complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 22 in FIG. 171 (SEQ ID NO: 253). The transmembrane domain region has been tentatively identified as extending from about amino acid position 224 to about amino acid position 250 of the PRO1138 amino acid sequence (FIG. 171; SEQ ID NO: 253).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about about 80% when compared to residue 1 of FIG. 171 (SEQ ID NO: 253) or the amino acid sequence contained from about 23 to about 335. It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of 90% positive, most preferably at least about 95% positive.
Other embodiments relate to fragments of the PRO1138 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1138 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO1138 polypeptide, which in certain embodiments comprises residue 1 or about 23 to about 335 of FIG. 171 (SEQ ID NO: 253). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 or the sequence from about 23 to 335 of FIG. 171 (SEQ ID NO: 253). It relates to an isolated PRO1138 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence contained in residue 1 or from about 23 to about 335 of FIG. 171 (SEQ ID NO: 253), More preferably, it relates to an isolated PRO1138 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In another aspect, the invention provides amino acid residues 1 or about 23 to X of FIG. 171 (SEQ ID NO: 253), where X is amino acid residues 219 to 228 of FIG. 171 (SEQ ID NO: 253). At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. PRO1138 extracellular domain comprising an amino acid sequence having sex.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 171 (SEQ ID NO: 253) or the sequence of about 23 to about 335, or a fragment sufficient to bind to an anti-PRO1138 antibody thereof. Related to isolated PRO1138 polypeptide. Preferably, this PRO1138 fragment retains the qualitative biological activity of a native PRO1138 polypeptide.
In another aspect, the invention relates to a fragment of PRO1138 that is long enough to provide an epitope from which antibodies can be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1138 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1138 antibody.
In a further embodiment, the invention relates to a screening method for identifying agonists or antagonists of a native PRO1138 polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1138 polypeptide as described above in combination with a pharmaceutically acceptable carrier.
In another embodiment, the present invention provides DNA49140 comprising the nucleotide sequence of Figure 172 (SEQ ID NO: 254) and the nucleotide sequence designated herein.

72. PRO1054
Applicants have identified a cDNA clone (DNA58853-1423), homologous to a nucleic acid encoding major urinary proteins (MUPS), encoding a novel polypeptide, designated “PRO1054” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1054 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1054 polypeptide having a sequence of about 1 or about 19 to about 180 amino acid residues in FIG. 174 (SEQ ID NO: 256), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other embodiments, the invention provides an isolated nucleic acid encoding a PRO1054 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 46 or about 100 to about 585 of FIG. 173 (SEQ ID NO: 255). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA58853-1423) of ATCC Deposit No. 203016, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203016 human protein cDNA (DNA58853-1423).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 174 (SEQ ID NO: 256) or the sequence from about 19 to about 180. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1054 polypeptide having amino acid residue 1 of FIG. 174 (SEQ ID NO: 256) or a sequence of about 19 to about 180, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 At least about 10 nucleotides produced by isolating a test DNA molecule when it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule having
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1054 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 18 in FIG. 174 (SEQ ID NO: 256).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about about 80% when compared to amino acid sequence contained in residue 1 or from about 19 to about 180 in FIG. 174 (SEQ ID NO: 256). An isolated DNA molecule that encodes a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of the DNA molecule of (a) Nucleic acid molecules.
Other embodiments relate to fragments of the PRO1054 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 173 (SEQ ID NO: 255).
In another embodiment, the present invention provides an isolated PRO1054 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1054 polypeptide, which in certain embodiments, includes residue 1 or about 19 to about 180 of FIG. 174 (SEQ ID NO: 256). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to amino acid residue 1 or the sequence from about 19 to 180 in FIG. 174 (SEQ ID NO: 256). It relates to an isolated PRO1054 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 174 (SEQ ID NO: 256) or the amino acid sequence from about 19 to about 180. Relates to an isolated PRO1054 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 174 (SEQ ID NO: 256) or the sequence from about 19 to about 180, or a fragment sufficient to bind to an anti-PRO1054 antibody thereof, Related to isolated PRO1054 polypeptide. Preferably, this PRO1054 fragment retains the qualitative biological activity of a native PRO1054 polypeptide.
In a still further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1054 polypeptide having a sequence of about 1 or about 19 to about 180 amino acid residues of FIG. 174 (SEQ ID NO: 256). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the present invention relates to agonists and antagonists of the native PRO1054 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1054 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1054 polypeptide by contacting the native PRO1054 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1054 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

73. PRO994
Applicants have identified a cDNA clone (DNA58855-1422) homologous to a nucleic acid encoding tumor-associated antigen L6, which encodes a novel polypeptide named “PRO994” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO994 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule that encodes a PRO994 polypeptide having a sequence of about 1 to about 229 amino acid residues in FIG. 176 (SEQ ID NO: 258), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO994 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 31 to about 717 of FIG. 175 (SEQ ID NO: 257). Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA58855-1422) of ATCC Deposit No. 203018, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203018 human protein cDNA (DNA58855-1422).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 1 to about 229 of FIG. 176 (SEQ ID NO: 258). More preferably comprises DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO994 polypeptide having a sequence from amino acid residue 1 to about 229 of FIG. 176 (SEQ ID NO: 258); or (b) ( a) hybridizing with the complementary strand of the DNA molecule of a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85% sequence to (a) or (b) A single molecule having at least about 10 nucleotides produced by isolating a test DNA molecule when having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Relates to released nucleic acid molecules.
In a particular embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO994 polypeptide with or without an initiating methionine, and soluble, ie transmembrane domain deletion or inactivation variants thereof Or is complementary to such an encoding nucleic acid molecule. The plurality of transmembrane domains is from amino acid position about 10 to about amino acid position 31, amino acid position about 50 to about amino acid position 72, amino acid position about 87 to about amino acid position about PRO994 amino acid sequence (FIG. 176, SEQ ID NO: 258), And from amino acid position about 191 to about amino acid position 213.
In other embodiments, the invention provides: (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or about 229 of FIG. 176 (SEQ ID NO: 258); More preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) .
Other embodiments relate to fragments of the PRO994 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 175 (SEQ ID NO: 257) can be derived from the nucleotide sequence.
In another embodiment, the present invention provides an isolated PRO1054 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO994 polypeptide, which in certain embodiments, comprises an amino acid sequence comprising from 1 to about 229 of FIG. 176 (SEQ ID NO: 258). Is included.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 or 229 of FIG. 176 (SEQ ID NO: 258). More preferably, an isolated PRO994 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence from residue 1 to about 229 of FIG. 176 (SEQ ID NO: 258). It relates to an isolated PRO994 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 1 to about 229 of Figure 176 (SEQ ID NO: 258), or a fragment sufficient to bind to an anti-PRO994 antibody thereof. Related to the PRO994 polypeptide. Preferably, this PRO994 fragment retains the qualitative biological activity of a native PRO994 polypeptide.
In yet a further aspect, the present invention relates to (i) a test DNA molecule, (a) a DNA molecule that encodes a PRO994 polypeptide having a sequence from about 1 to about 229 amino acid residues in FIG. 176 (SEQ ID NO: 258). Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably Have at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A polypeptide produced by culturing under conditions suitable for expression of the peptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO994 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO994 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO994 polypeptide by contacting the native PRO994 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO994 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

74. PRO812
Applicants have identified a cDNA clone (DNA59205-1421) homologous to a nucleic acid encoding prostate steroid binding protein c1, which encodes a novel polypeptide named “PRO812” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO812 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO812 polypeptide having a sequence of about 1 or about 16 to about 83 amino acid residues of FIG. 178 (SEQ ID NO: 260), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO812 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 55 or about 100 to about 303 of FIG. 177 (SEQ ID NO: 259). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59205-1421) of ATCC Deposit No. 203309, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203309 (DNA59205-1421).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 178 (SEQ ID NO: 260) or the sequence from about 16 to about 83. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO812 polypeptide having the sequence of amino acid residue 1 of FIG. 178 (SEQ ID NO: 260) or from about 16 to about 83, or ( b) hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably Produced by isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, It relates to an isolated nucleic acid molecule having about 10 nucleotides.
In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO812 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 15 in FIG. 178 (SEQ ID NO: 260).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 178 (SEQ ID NO: 260) or the amino acid sequence from about 16 to about 83. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO812 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 177 (SEQ ID NO: 259).
In other embodiments, the invention provides an isolated PRO812 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the present invention provides an isolated native sequence PRO812 polypeptide, which in certain embodiments comprises residue 1 or about 16 to about 83 of FIG. 178 (SEQ ID NO: 260). Contains the amino acid sequence.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 or the sequence from about 16 to 83 of FIG. 178 (SEQ ID NO: 260). It relates to an isolated PRO812 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 178 (SEQ ID NO: 260) or the amino acid sequence from about 16 to about 83. Relates to an isolated PRO812 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 178 (SEQ ID NO: 260) or the sequence of about 16 to about 83, or a fragment sufficient to bind to an anti-PRO812 antibody thereof, Related to isolated PRO812 polypeptide. Preferably, this PRO812 fragment retains the qualitative biological activity of a native PRO812 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO812 polypeptide having a sequence of about 1 or about 16 to about 83 amino acid residues of FIG. 178 (SEQ ID NO: 260). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO812 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO812 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO812 polypeptide by contacting the native PRO812 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO812 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

75. PRO1069
The Applicant has identified a DNA clone, DNA59211-1450, which encodes a novel polypeptide having homology to CHIF and named it “PRO1069” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1069 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1069 polypeptide having a sequence of about 1 or about 17 to about 89 amino acid residues in FIG. 180 (SEQ ID NO: 262), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other aspects, the invention provides an isolated PRO1069 polypeptide comprising DNA that hybridizes to the complementary strand of a nucleic acid having residues about 197 or about 245 to about 463 of FIG. 179 (SEQ ID NO: 261). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59211-1450) of ATCC Deposit No. 209960, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 209960 human protein cDNA (DNA59211-1450).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 180 (SEQ ID NO: 262) or the sequence from about 17 to about 89. It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1069 extracellular domain (ECD) with or without an N-terminal signal sequence and / or initiation methionine, and soluble variants thereof Body (ie, one in which the transmembrane domain has been deleted or inactivated) or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 in FIG. 180 (SEQ ID NO: 262) to about amino acid position 16. The transmembrane domain region has been tentatively identified as extending from about amino acid position 36 to about amino acid position 59 of the PRO1069 amino acid sequence (Figure 180, SEQ ID NO: 262).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 90% when compared to residue 1 of Figure 180 (SEQ ID NO: 262) or the amino acid sequence from about 17 to about 89. It relates to an isolated nucleic acid molecule comprising a DNA molecule encoding a polypeptide with a positive, most preferably at least about 95% positive score.
Other embodiments relate to fragments of the PRO1069 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1069 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1069 polypeptide, which in certain embodiments, includes residue 1 or about 17 to about 89 of FIG. 180 (SEQ ID NO: 262). Contains the amino acid sequence.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to amino acid residue 1 or the sequence from about 17 to 89 in FIG. 180 (SEQ ID NO: 262). It relates to an isolated PRO1069 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 180 (SEQ ID NO: 262) or the amino acid sequence from about 17 to about 89. Relates to an isolated PRO1069 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In another aspect, the invention provides amino acid residue 1 of FIG. 180 (SEQ ID NO: 262) or a sequence of about 17 to X (where X is amino acid residues 32 to 41 of FIG. 180 (SEQ ID NO: 262)). At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. PRO1069 extracellular domain comprising an amino acid sequence having sex.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 180 (SEQ ID NO: 262) or the sequence of about 17 to about 89, or a fragment sufficient to bind to an anti-PRO1069 antibody thereof. It relates to an isolated PRO1069 polypeptide. Preferably, this PRO1069 fragment retains the qualitative biological activity of a native PRO1069 polypeptide.
In another aspect, the invention relates to fragments of PRO1069 polypeptide that are long enough to provide an epitope from which antibodies can be produced.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1069 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1069 antibody.
In a further embodiment, the present invention relates to screening methods for identifying agonists or antagonists of native PRO1069 polypeptides.
In yet a further embodiment, the invention relates to a composition comprising a PRO1069 polypeptide as described above in combination with a pharmaceutically acceptable carrier.

76. PRO1129
Applicants have identified a cDNA clone (DNA59213-1487) homologous to a nucleic acid encoding a cytochrome P-450 family member encoding a novel polypeptide, designated “PRO1129” in the present application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1129 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1129 polypeptide having a sequence of about 1 to about 524 amino acid residues in FIG. 182 (SEQ ID NO: 264), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1129 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of about 42 or about 1613 nucleotides of FIG. 181 (SEQ ID NO: 263). Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention provides (a) at least about 80% sequence identity to a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59213-1487) at ATCC Deposit No. 209959, preferably Relates to an isolated nucleic acid molecule comprising DNA having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209959 (DNA59213-1487).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 1 to about 524 of FIG. 182 (SEQ ID NO: 264). More preferably comprises DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1129 polypeptide with or without an initiating methionine, and its soluble, ie transmembrane domain, has been deleted or inactivated. Variants are provided, or are complementary to such encoding nucleic acid molecules. A type II transmembrane domain has been tentatively identified as extending from about amino acid position 13 to about amino acid position 32, and from about amino acid position 77 to about amino acid position 102 in the PRO1129 amino acid sequence (FIG. 182, SEQ ID NO: 264).
In other embodiments, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 to about 524 of FIG. 182 (SEQ ID NO: 264), and more Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive.
Other embodiments relate to fragments of the PRO1129 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1129 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1129 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to about 524 of FIG. 182 (SEQ ID NO: 264). .
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 524 of FIG. 182 (SEQ ID NO: 264). More preferably, an isolated PRO1129 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residue 1 to about 524 of FIG. 182 (SEQ ID NO: 264). It relates to an isolated PRO1129 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residues 1 to about 524 of Figure 182 (SEQ ID NO: 264), or a fragment sufficient to bind to an anti-PRO1129 antibody thereof. PRO1129 polypeptide. Preferably, this PRO1129 fragment retains the qualitative biological activity of a native PRO1129 polypeptide.
In another aspect, the invention relates to a fragment of a PRO1129 polypeptide that is long enough to provide an epitope from which an antibody can be produced.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1129 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1129 antibody.
In a further embodiment, the present invention relates to a screening method for identifying agonists or antagonists of a native PRO1129 polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1129 polypeptide as described above in combination with a pharmaceutically acceptable carrier.

77. PRO1068
A cDNA clone (DNA59214-1449) was identified that encodes a novel polypeptide having homology to urotensin, designated “PRO1068” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1068 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1068 polypeptide having a sequence of about 21 to about 124 amino acid residues of FIG. 184 (SEQ ID NO: 266), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO281 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid at residue about 102 or about 413 of FIG. 183 (SEQ ID NO: 265). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59214-1449) of ATCC Deposit No. 203046, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203046 (DNA59214-1449).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 21 to about 124 amino acid residues in FIG. 184 (SEQ ID NO: 266). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1068 polypeptide having a sequence of about 21 to about 124 amino acid residues of FIG. 184 (SEQ ID NO: 266), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, preferably Relates to an isolated nucleic acid molecule having at least about 100 nucleotides.
In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1068 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 20 in FIG. 184 (SEQ ID NO: 266).
In other embodiments, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 21 to about 124 in FIG. 184 (SEQ ID NO: 266). Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
Other embodiments relate to fragments of the PRO1068 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1068 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1068 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 21 or 124 of FIG. 184 (SEQ ID NO: 266). It is out.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 21 to about 124 in FIG. 184 (SEQ ID NO: 266). More preferably, an isolated PRO1068 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the present invention relates to at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residue 21 to about 124 of FIG. 184 (SEQ ID NO: 266). It relates to an isolated PRO1068 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 21 to about 124 of FIG. 184 (SEQ ID NO: 266), or a fragment sufficient to bind to an anti-PRO1068 antibody thereof. PRO1068 polypeptide. Preferably, this PRO1068 fragment retains the qualitative biological activity of a native PRO1068 polypeptide.
In yet a further aspect, the invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1068 polypeptide having a sequence of about 21 to about 124 amino acid residues of FIG. Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1068 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1068 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1068 polypeptide by contacting the native PRO1068 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1068 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

78. PRO1066
The Applicant has identified a cDNA clone (DNA59215-1425) encoding a novel secreted polypeptide, designated “PRO1066” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1066 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1066 polypeptide having a sequence from about 1 or about 24 to about 117 amino acid residues in FIG. 186 (SEQ ID NO: 268), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other embodiments, the invention provides an isolated nucleic acid encoding a PRO1066 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide from about 176 or about 245 to about 527 of FIG. 185 (SEQ ID NO: 267). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about 80% sequence identity to a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59215-1425) at ATCC deposit no. Relates to an isolated nucleic acid molecule comprising DNA having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA59215-1425) at ATCC Deposit Number 209961.
In yet a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with amino acid residue 1 or the sequence from about 24 to about 117 in FIG. 186 (SEQ ID NO: 268). More preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1066 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 23 in FIG. 186 (SEQ ID NO: 268).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 186 (SEQ ID NO: 268) or the amino acid sequence from about 24 to about 117. It relates to a DNA molecule encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score.
Other embodiments relate to fragments of the PRO1066 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1066 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1066 polypeptide, which in certain embodiments, includes residue 1 or from about 24 to about 117 of FIG. 186 (SEQ ID NO: 268). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 24 to about 117 in FIG. 186 (SEQ ID NO: 268). It relates to an isolated PRO1066 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 186 (SEQ ID NO: 268) or the amino acid sequence from about 24 to about 117. Relates to an isolated PRO1066 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 186 (SEQ ID NO: 268) or the sequence from about 24 to about 117, or a fragment sufficient to bind to an anti-PRO1066 antibody thereof. Related to isolated PRO1066 polypeptide. Preferably, this PRO1066 fragment retains the qualitative biological activity of a native PRO1066 polypeptide.
In another aspect, the invention relates to a fragment of PRO1066 polypeptide that is long enough to provide an epitope from which an antibody can be produced.

79. PRO1184
The Applicant has identified a cDNA clone (DNA59220-1514) encoding a novel secreted polypeptide, designated “PRO1184” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1184 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1184 polypeptide having a sequence of about 1 or about 39 to about 142 amino acid residues in FIG. 188 (SEQ ID NO: 270), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule that encodes a PRO1184 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from SEQ ID NO: 269 from about residue 106 or from about 220 to about 531. In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1184 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of SEQ ID NO: 269. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about 85, to a DNA molecule encoding the same mature polypeptide encoded by human protein DNA59220-1514 with ATCC deposit number. It relates to an isolated nucleic acid molecule comprising DNA having% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit number human protein DNA59220-1514.
In yet a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with amino acid residue 1 of SEQ ID NO: 270 or the sequence of about 39 to about 142, preferably at least about 85%, more preferably It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1184 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie, transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 38 of SEQ ID NO: 270.
In another aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to residue 1 of SEQ ID NO: 270 or the amino acid sequence of about 39 to about 142. It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of 90% positive, most preferably at least about 95% positive.
Other embodiments relate to fragments of the PRO1184 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the present invention provides an isolated PRO1184 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the present invention provides isolated native sequence PRO1184 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or about 39 to about 142 of SEQ ID NO: 270.
In other aspects, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to amino acid residue 1 of SEQ ID NO: 270 or the sequence of about 39 to about 142, More preferably, it relates to an isolated PRO1184 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to amino acid sequence from residue 1 of SEQ ID NO: 270 or from about 39 to about 142. Pertains to an isolated PRO1184 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises an amino acid residue 1 of SEQ ID NO: 270 or a sequence of about 39 to about 142, or a fragment sufficient to bind to an anti-PRO1184 antibody thereof. Relates to the PRO1184 polypeptide. Preferably, this PRO1184 fragment retains the qualitative biological activity of a native PRO1184 polypeptide.
In another aspect, the invention relates to a fragment of a PRO1184 polypeptide that is long enough to provide an epitope from which an antibody can be produced.

80. PRO1360
A cDNA clone (DNA59488-1603) was identified that encodes a novel polypeptide named “PRO1360” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1360 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1360 polypeptide having a sequence of about 30 to about 285 amino acid residues of FIG. 190 (SEQ ID NO: 272), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1360 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 140 to about 908 of FIG. 189 (SEQ ID NO: 271). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59488-1603) of ATCC Deposit No. 203157, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid relates to an isolated nucleic acid molecule comprising DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203157 (DNA59488-1603).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 30 to about 285 amino acid residues of FIG. 190 (SEQ ID NO: 272). An isolation comprising a DNA encoding a polypeptide having a sex, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA molecule of (a) Nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1360 polypeptide having a sequence of about 30 to about 285 amino acid residues of FIG. 190 (SEQ ID NO: 272), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about At least about 50, produced by isolating a test DNA molecule if it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule having nucleotides.
In other embodiments, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 30 to about 285 of FIG. 190 (SEQ ID NO: 272). Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
Other embodiments relate to fragments of the PRO1360 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1360 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1360 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 30 to about 285 of Figure 190 (SEQ ID NO: 272). .
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 30 to about 285 of FIG. 190 (SEQ ID NO: 272). More preferably, an isolated PRO1360 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention relates to at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residue 30 to about 285 of FIG. 190 (SEQ ID NO: 272). It relates to an isolated PRO1360 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 30 to about 285 of Figure 190 (SEQ ID NO: 272), or a fragment sufficient to bind to an anti-PRO1360 antibody thereof. PRO1360 polypeptide. Preferably, this PRO1360 fragment retains the qualitative biological activity of a native PRO1360 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1360 polypeptide having a sequence from about 30 to about 285 of FIG. Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1360 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1360 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1360 polypeptide by contacting the native PRO1360 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1360 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

81. PRO1029
A cDNA clone (DNA59493-1420) encoding a novel secreted polypeptide, designated “PRO1029” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1029 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1029 polypeptide having a sequence of about 1 or about 20 to about 86 amino acid residues in FIG. 192 (SEQ ID NO: 274), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other embodiments, the invention provides an isolated nucleic acid encoding a PRO1029 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 39 or about 96 to about 296 of FIG. 191 (SEQ ID NO: 274). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by human protein cDNA (DNA59493-1420) of ATCC Deposit No. 203050, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203050 (DNA59493-1420).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 192 (SEQ ID NO: 274) or the sequence from about 20 to about 86. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1029 polypeptide having amino acid residue 1 of FIG. 192 (SEQ ID NO: 274) or a sequence of about 20 to about 86, or ( b) hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably Produced by isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, It relates to an isolated nucleic acid molecule having about 10 nucleotides.
In a particular aspect, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1029 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 14 in FIG. 192 (SEQ ID NO: 274).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 192 (SEQ ID NO: 274) or the amino acid sequence from about 20 to about 86. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1029 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, It can be derived from the nucleotide sequence shown in 191 (SEQ ID NO: 273).
In another embodiment, the invention provides an isolated PRO109 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1029 polypeptide, which in certain embodiments, includes residue 1 or about 20 to about 86 of FIG. 192 (SEQ ID NO: 274). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 20 to about 86 in FIG. 192 (SEQ ID NO: 274). It relates to an isolated PRO1029 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 or the amino acid sequence from about 20 to about 86 in FIG. 192 (SEQ ID NO: 274). Relates to an isolated PRO1029 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 192 (SEQ ID NO: 274) or the sequence of about 20 to about 86, or a fragment sufficient to bind to an anti-PRO1029 antibody thereof, It relates to an isolated PRO1029 polypeptide. Preferably, this PRO1029 fragment retains the qualitative biological activity of a native PRO1029 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1029 polypeptide having a sequence of about 1 or about 20 to about 86 amino acid residues of FIG. 192 (SEQ ID NO: 274). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.

82. PRO1139
The Applicant has identified a cDNA clone (DNA59497-1496) encoding a novel human protein originally named PRO1139.
In one embodiment, the invention provides (a) a DNA molecule encoding a PRO1139 polypeptide having a sequence of about 29 to about 131 amino acid residues in FIG. 194 (SEQ ID NO: 276), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of Provided is an isolated nucleic acid molecule comprising DNA having sequence identity.
In another embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA that hybridizes to the complementary strand of the polynucleotide sequence from about 80 to about 391 of FIG. 193 (SEQ ID NO: 275). Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further embodiment, the invention provides (a) at least about 80% sequence identity to a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59497-1496) of ATCC Deposit No. 209941; Preferably, it relates to an isolated nucleic acid molecule comprising DNA having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209941 (DNA59497-1496).
In a still further aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues about 29 to about 131 of FIG. 194 (SEQ ID NO: 276), and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain embodiments, the present invention has or does not have an N-terminal signal sequence and / or an initiating methionine and also from FIG. 194, SEQ ID NO: 276 amino acid position about 33 to amino acid position about 52; Including DNA encoding a native or mutant PRO1139 polypeptide with or without a transmembrane region identified as extending from 71 to about amino acid position 89; and from about amino acid position about 98 to about amino acid position 120, respectively. An isolated nucleic acid molecule is provided. In one aspect, the isolated nucleic acid comprises DNA encoding a mature full-length native PRO1139 polypeptide having amino acid residues 1 to 131 of FIG. 194, SEQ ID NO: 276, or such encoding nucleic acid. Complementary to the sequence.
In other embodiments, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence from about 29 to about 131 of FIG. 194 (SEQ ID NO: 276). Relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive.
In another embodiment, the invention provides isolated PRO1139 polypeptide. In particular, the invention provides isolated native sequence PRO1139 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 29 to 131 of FIG. 194 (SEQ ID NO: 276). The present invention also provides PRO1139 polypeptide variants encoded by any of the isolated nucleic acid molecules described above. Certain variants include, but are not limited to, the full-length native sequence PRO1139 that lacks the N-terminal signal sequence and / or has at least one transmembrane domain deleted or inactivated. Deletion (cut) variants are included. The variant specifically deletes or inactivates one or more of the transmembrane regions between amino acid residues 33-52, 71-8, and 98-120, and further includes an N-terminal signal sequence (amino acid residues 1-28). ) And / or a mutant of the full length mature polypeptide of FIG. 194 (SEQ ID NO: 276) lacking the initiation methionine.
In a further embodiment, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence from about 29 to about 131 of FIG. 194 (SEQ ID NO: 276). It relates to an isolated PRO1139 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising from about 29 to about 131 amino acid residues of FIG. 194 (SEQ ID NO: 276), or a fragment sufficient to bind to an anti-PRO1139 antibody thereof. Related PRO1139 polypeptides. Preferably, this PRO1139 fragment retains the qualitative biological activity of a native PRO1139 polypeptide.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1139 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1139 antibody.
In a further embodiment, the present invention relates to a screening method for identifying agonists or antagonists of a native PRO1139 polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1139 polypeptide (including variants), or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.
The invention also relates to a method of treating obesity comprising administering to a patient an effective amount of a PRO1139 polypeptide. In certain embodiments, the antagonist is a blocking antibody that specifically binds to a native PRO1130 polypeptide.

83. PRO1309
A cDNA clone (DNA59588-1571) was identified that encodes a novel polypeptide with a leucine-rich repeat named “PRO1309” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1309 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1309 polypeptide having a sequence of about 35 to about 522 of amino acid residues in FIG. 196 (SEQ ID NO: 278), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1309 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid at residue about 822 or about 2285 of FIG. 195 (SEQ ID NO: 277). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59588-1571) of ATCC Deposit No. 203106, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203106 (DNA59588-1571).
In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 35 to about 522 of FIG. 196 (SEQ ID NO: 278). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1309 polypeptide having a sequence from about 35 to about 522 of amino acid residue of FIG. 196 (SEQ ID NO: 278), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about At least about 50, produced by isolating a test DNA molecule if it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule having nucleotides.
In a particular embodiment, the present invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1309 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 34 in FIG. 196 (SEQ ID NO: 278). The transmembrane domain has been tentatively identified as extending from about amino acid position 428 to about 450 amino acid position of the PRO1309 amino acid sequence (FIG. 196, SEQ ID NO: 278).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from about 35 to about 522 of FIG. 196 (SEQ ID NO: 278), More preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) .
Another embodiment relates to fragments of the PRO1309 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1309 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1309 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 35 to 522 of FIG. 196 (SEQ ID NO: 278). It is out.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from about 35 to about 522 of amino acid residue in FIG. 196 (SEQ ID NO: 278). More preferably, an isolated PRO1309 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 35 to 522 of FIG. 196 (SEQ ID NO: 278). Pertaining to an isolated PRO1309 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 35 to about 522 of FIG. 196 (SEQ ID NO: 278), or a fragment sufficient to bind to an anti-PRO1309 antibody thereof. PRO1309 polypeptide. Preferably, this PRO1309 fragment retains the qualitative biological activity of a native PRO1309 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule that encodes a PRO1309 polypeptide having a sequence of about 35 to about 522 of amino acid residues of FIG. Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1309 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1309 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1309 polypeptide by contacting the native PRO1309 polypeptide with a candidate molecule and monitoring biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1309 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

84. PRO1028
Applicants have identified a cDNA clone encoding a novel secreted polypeptide, where the polypeptide was named “PRO1028” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule encoding a PRO1028 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO1028 polypeptide having amino acid residues 1 to 197 of Figure 198 (SEQ ID NO: 281) or is complementary to such an encoding nucleic acid sequence. And remain stably bound to it under at least moderate and in some cases highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited with the ATCC as DNA59603-1419 on June 9, 1998, containing the nucleic acid sequence encoding PRO1028.
In another embodiment, the present invention provides a PRO1028 polypeptide. In particular, the invention provides isolated native sequence PRO1028 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 197 of FIG. 198 (SEQ ID NO: 281). In some cases, the PRO1028 polypeptide may or may be obtained by expression of a polypeptide encoded by the cDNA insert of a vector deposited with the ATCC as DNA59603-1419 on June 9, 1998.

85. PRO1027
A cDNA clone (DNA59605-1418) having a type II fibronectin collagen binding domain encoding a novel polypeptide named “PRO1027” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1027 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1027 polypeptide having a sequence of about 1 or about 34 to about 77 amino acid residues in Figure 200 (SEQ ID NO: 283), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity. As used herein to refer to an amino acid or nucleic acid, the term “or” refers to two alternative embodiments provided individually, namely 1-77, or another embodiment of 34-77. It is.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1027 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide about 31 or about 130 to about 261 of FIG. 199 (SEQ ID NO: 282). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59605-1418) of ATCC Deposit No. 203005, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203005 (DNA59605-1418).
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in Figure 200 (SEQ ID NO: 283) or the sequence from about 34 to about 77 DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule that encodes a PRO1027 polypeptide having the sequence of amino acid residue 1 or about 34 to about 77 of FIG. 200 (SEQ ID NO: 283); b) hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably A single molecule produced by isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Relates to released nucleic acid molecules.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 200 (SEQ ID NO: 283) or the amino acid sequence from about 34 to about 77. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
In other embodiments, the invention provides an isolated PRO1027 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the present invention provides an isolated native sequence PRO1027 polypeptide, which in certain embodiments, includes residues 1 or about 34 to about 77 of FIG. 200 (SEQ ID NO: 283). Contains the amino acid sequence.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 200 (SEQ ID NO: 283) or the sequence from about 34 to about 77. It relates to an isolated PRO1027 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of Figure 200 (SEQ ID NO: 283) or the amino acid sequence from about 34 to about 77. Relates to an isolated PRO1027 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO1027 polypeptide having a sequence of about 1 or about 34 to about 77 amino acid residues of FIG. 200 (SEQ ID NO: 283). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1027 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1027 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1027 polypeptide by contacting the native PRO1027 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1027 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

86. PRO1107
Applicants have identified a cDNA clone that encodes a novel polypeptide having sequence identity with PC-1 and named this polypeptide “PRO1107” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule encoding a PRO1107 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO1107 polypeptide having amino acid residues 1 to 477 of Figure 202 (SEQ ID NO: 285) or is complementary to such an encoding nucleic acid sequence. And remain stably bound to it under at least moderate and in some cases highly stringent conditions. In other embodiments, the isolated nucleic acid molecule has about amino acid residues 23 to 477 of FIG. 202 (SEQ ID NO: 285) or about 1 or 23 to 428 ± 5 of amino acid residues of FIG. 202 (SEQ ID NO: 285). It contains DNA encoding the PRO1107 polypeptide or is complementary to such an encoding nucleic acid sequence and remains stably bound to it under at least moderate and in some cases highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited with the ATCC as DNA59606-1471 on June 9, 1998, which contains the nucleotide sequence encoding PRO1107.
In another embodiment, the present invention provides a PRO1107 polypeptide. In particular, the invention provides isolated native sequence PRO1107 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 477 of FIG. 202 (SEQ ID NO: 285). A further embodiment of the invention relates to a PRO1107 polypeptide comprising amino acids about 23 to 477 of FIG. 202 (SEQ ID NO: 285) or amino acids 1 or 23 to 428 ± 5 of FIG. 202 (SEQ ID NO: 285). In some cases, PRO1107 polypeptide can be obtained or obtained by expressing a polypeptide encoded by the cDNA insert of the DNA59606-1471 vector deposited on June 9, 1998.

87. PRO1140
Applicants have identified a cDNA clone, DNA59607-1497, encoding a novel multi-span transmembrane polypeptide and named this polypeptide “PRO1140” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1140 polypeptide.
In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1140 polypeptide having the sequence from amino acid residue 1 to about 255 of FIG. 204 (SEQ ID NO: 287), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid molecule encoding a PRO1140 polypeptide comprising DNA that hybridizes to the complementary strand of a nucleic acid having residues from about 210 to about 974 of Figure 203 (SEQ ID NO: 286). About. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59607-1497) of ATCC Deposit No. 209946, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209946 (DNA5907-1497).
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 1 to about 255 of FIG. 204 (SEQ ID NO: 287). More preferably relates to DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1140 extracellular domain (ECD) with or without an initiating methionine, and soluble variants thereof (ie, lacking a transmembrane domain). Inactivated or inactivated) or complementary to such an encoding nucleic acid molecule. In the PRO1140 amino acid sequence shown in FIG. 204 (SEQ ID NO: 287), the transmembrane domain region is identified experimentally as extending from amino acid position about 101 to about 118, from about 141 to about 161, and from about 172 to about 191. doing.
In other embodiments, the invention provides at least about 80% positive, preferably at least about 90% positive, most preferably at least at least when compared to the amino acid sequence from residue 1 to about 255 of FIG. 204 (SEQ ID NO: 287). It relates to a DNA molecule encoding a polypeptide with a score of about 95% positive.
Other embodiments relate to fragments of the PRO1140 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1140 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1140 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to about 255 of Figure 204 (SEQ ID NO: 287). Contains.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 255 in FIG. 204 (SEQ ID NO: 287). More preferably, an isolated PRO1140 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention relates to at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residue 1 to about 255 in FIG. 204 (SEQ ID NO: 287). It relates to an isolated PRO1140 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In another aspect, the invention provides a sequence of amino acid residues 1 to X of FIG. 204 (SEQ ID NO: 287), wherein X is any of amino acid residues 96 to 105 of FIG. 204 (SEQ ID NO: 287) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. The PRO1140 extracellular domain comprising the amino acid sequence.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 1 to about 255 of FIG. 204 (SEQ ID NO: 287), or a fragment sufficient to bind to an anti-PRO1140 antibody thereof. PRO1140 polypeptide. Preferably, this PRO1140 fragment retains the qualitative biological activity of a native PRO1140 polypeptide.
In other aspects, the invention also relates to fragments of a PRO1140 polypeptide that are of sufficient length to provide an epitope from which antibodies can be produced.

88. PRO1106
Applicants have identified a cDNA encoding a novel polypeptide having sequence identity with a peroxisomal calcium-dependent solute carrier, and this polypeptide was named “PRO1106” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule encoding a PRO1106 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO1106 polypeptide having amino acid residues 1 to 469 of FIG. 206 (SEQ ID NO: 289) or is complementary to such encoding nucleic acid sequence. And remain stably bound to it under at least moderate and in some cases highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA59609-1470 vector deposited with the ATCC on June 9, 1998, including the nucleotide sequence encoding PRO1106.
In other embodiments, the present invention provides PRO1106 polypeptides. In particular, the invention provides isolated native sequence PRO1106 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 469 of FIG. 206 (SEQ ID NO: 289). In some cases, PRO1106 polypeptide may be obtained or obtained by expression of a polypeptide encoded by a cDNA insert of the DNA59609-1470 vector deposited with the ATCC on June 9, 1998.

89. PRO1291
A cDNA clone (DNA59610-1556) having homology to a nucleic acid encoding butyrophilin was identified that encodes a novel polypeptide named “PRO1291” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1291 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1291 polypeptide having a sequence of about 1 or about 29 to about 282 amino acid residues in FIG. 208 (SEQ ID NO: 291), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO1291 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of FIG. 207 (SEQ ID NO: 290) from about nucleotide 61 or from about 145 to about 906. Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59610-1556) of ATCC Deposit No. 209990, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA59610-1556) at ATCC Deposit Number 209990.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 208 (SEQ ID NO: 291) or the sequence from about 29 to about 282. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1291 polypeptide having amino acid residue 1 of FIG. 208 (SEQ ID NO: 291) or a sequence of about 29 to about 282, or ( b) hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably Produced by isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, It relates to an isolated nucleic acid molecule having about 10 nucleotides.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1291 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 28 in FIG. 208 (SEQ ID NO: 291). A transmembrane domain has been tentatively identified as extending from about amino acid position 258 to about amino acid position 281 of the PRO1291 amino acid sequence (Figure 208, SEQ ID NO: 291).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 208 (SEQ ID NO: 291) or the amino acid sequence from about 29 to about 282. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1291 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, It can be derived from the nucleotide sequence shown in 207 (SEQ ID NO: 290).
In another embodiment, the invention provides an isolated PRO1291 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1291 polypeptide, which in certain embodiments comprises residue 1 or about 29 to about 282 of FIG. 208 (SEQ ID NO: 291). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 208 (SEQ ID NO: 291) or the sequence from about 29 to about 282. It relates to an isolated PRO1291 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 208 (SEQ ID NO: 291) or the amino acid sequence from about 29 to about 282. Relates to an isolated PRO1291 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of Figure 208 (SEQ ID NO: 291) or the sequence of about 29 to about 282, or a fragment sufficient to bind to an anti-PRO1291 antibody thereof. Related to isolated PRO1291 polypeptide. Preferably, this PRO1291 fragment retains the qualitative biological activity of a native PRO1291 polypeptide.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1291 polypeptide having a sequence of about 1 or about 29 to about 282 amino acid residues of FIG. 208 (SEQ ID NO: 291). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1291 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1291 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1291 polypeptide by contacting the native PRO1291 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1291 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

90. PRO1105
The Applicant has identified a cDNA encoding a novel polypeptide having two transmembrane domains and named this polypeptide “PRO1105” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule that encodes a PRO1105 polypeptide. In one aspect, the isolated nucleic acid molecule comprises DNA encoding a PRO1105 polypeptide having amino acid residues 1 to 180 of FIG. 210 (SEQ ID NO: 293) or is complementary to such encoding nucleic acid sequence. And remain stably bound to it under at least moderate and in some cases highly stringent conditions. In other embodiments, the isolated nucleic acid molecule comprises DNA encoding a PRO1105 polypeptide having about 20 to 180 amino acid residues of FIG. 210 (SEQ ID NO: 293), or in such an encoding nucleic acid sequence. It is complementary and remains stably bound to it under at least moderate and sometimes highly stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA59612-1466 vector deposited with the ATCC on June 9, 1998, including the nucleotide sequence encoding PRO1105.
In other embodiments, the invention provides PRO1105 polypeptides. In particular, the invention provides isolated native sequence PRO1105 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 180 of FIG. 210 (SEQ ID NO: 293). A further embodiment of the invention relates to a PRO1105 polypeptide comprising amino acids about 1 to 179 and 100 to about 144 of FIG. 210 (SEQ ID NO: 293). In some cases, the PRO1105 polypeptide can be obtained or obtained by expressing a polypeptide encoded by the cDNA insert of the DNA59612-1466 vector deposited with the ATCC on June 9, 1998.

91. PRO511
A cDNA clone (DNA59613-1417) was identified in the present application, which was named “PRO1026” and had sequence identity with RoBo-1 and a phospholipase inhibitor, encoding a novel polypeptide.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1026 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1026 polypeptide having a sequence of about 1 or about 26 to about 237 of amino acid residues in FIG. 212 (SEQ ID NO: 295), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity. As used herein to refer to an amino acid or nucleic acid, the term “or” refers to two alternative embodiments provided individually, namely 1-237, or another embodiment 26-237. It is.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1026 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about nucleotide 233 or about 308 to about 943 of FIG. 212 (SEQ ID NO: 295). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59613-1417) of ATCC Deposit No. 203007, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203007 (DNA59613-1417).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 212 (SEQ ID NO: 295) or the sequence from about 26 to about 237. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1026 polypeptide having the sequence of amino acid residue 1 or about 26 to about 237 of FIG. 212 (SEQ ID NO: 295); b) hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably A single molecule produced by isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Relates to released nucleic acid molecules.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 212 (SEQ ID NO: 295) or the amino acid sequence from about 26 to about 237. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
In another embodiment, the invention provides an isolated PRO1026 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1026 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 26 to about 237 of FIG. 212 (SEQ ID NO: 295). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 26 to about 237 in FIG. 212 (SEQ ID NO: 295). It relates to an isolated PRO1026 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 212 (SEQ ID NO: 295) or the amino acid sequence from about 26 to about 237. Relates to an isolated PRO1026 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention encodes (i) a test DNA molecule (a) a PRO1026 polypeptide having the sequence of about 1 or about 26 to about 237 of amino acid residue of FIG. 212 (SEQ ID NO: 295). A DNA molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, and the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1026 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1026 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1026 polypeptide by contacting the native PRO1026 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1026 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

92. PRO1104
A cDNA clone (DNA59616-1465) encoding a novel polypeptide named “PRO1104” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1104 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1104 polypeptide having a sequence of about 1 or about 23 to about 341 of amino acid residues in FIG. 214 (SEQ ID NO: 297), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity. As used herein to refer to an amino acid or nucleic acid, the term “or” refers to two alternative embodiments provided individually, namely 1-341, or other embodiments 23-341. It is.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1104 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about nucleotide 109 or about 175 to about 1131 of FIG. 213 (SEQ ID NO: 296). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59616-1465) of ATCC Deposit No. 209991, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209991 (DNA59616-1465).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 of FIG. 214 (SEQ ID NO: 297) or the sequence of about 23 to about 341. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1104 polypeptide having amino acid residue 1 of FIG. 214 (SEQ ID NO: 297) or a sequence of from about 23 to about 341, or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 Isolated, produced by isolating a test DNA molecule if it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to nucleic acid molecules.
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 214 (SEQ ID NO: 297) or the amino acid sequence from about 23 to about 341. An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
In another embodiment, the present invention provides an isolated PRO1104 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1104 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 or about 23 to about 341 of FIG. 214 (SEQ ID NO: 297). Contains.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 214 (SEQ ID NO: 297) or the sequence from about 23 to about 341. It relates to an isolated PRO1104 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 214 (SEQ ID NO: 297) or the amino acid sequence from about 23 to about 341. Relates to an isolated PRO1104 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO1104 polypeptide having a sequence of about 1 or about 23 to about 341 of amino acid residues in FIG. 214 (SEQ ID NO: 297). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.

93. PRO1100
A cDNA clone (DNA59619-1464) was identified that encodes a novel polypeptide having multiple transmembrane domains, designated “PRO1100” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1100 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1100 polypeptide having a sequence of about 1 or 21 to about 320 amino acid residues of FIG. 216 (SEQ ID NO: 299), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity. As used herein, the term “or” with respect to amino acids or nucleic acids refers to two alternative embodiments, namely 1-320, or another embodiment 21-320.
In another aspect, the invention provides an isolated encoding a PRO1100 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 33 or 93 to about 992 of FIG. 215 (SEQ ID NO: 298). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59619-1464) of ATCC Deposit No. 203041, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203041 (DNA59619-1464).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence from about 1 or 21 to about 320 amino acid residues in FIG. 216 (SEQ ID NO: 299), preferably at least about 85%. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a single strand comprising the complementary strand of the DNA of (a) Relates to isolated nucleic acid molecules.
In a further aspect, the invention provides (a) a DNA molecule encoding a PRO1100 polypeptide having a sequence of about 1 or 21 to about 320 amino acid residues of FIG. 216 (SEQ ID NO: 299), or (b) (a) The test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of which the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence. Relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule if it has identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity .
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1100 polypeptide that does not have an N-terminal signal sequence and / or initiation methionine, and lacks its solubility, ie, the transmembrane domain. Alternatively, an inactivated variant is provided or is complementary to such an encoding nucleic acid molecule.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 21 to about 320 in FIG. 216 (SEQ ID NO: 299). More preferably, an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or a complementary strand of the DNA of (a).
In another embodiment, the invention provides an isolated PRO1100 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1100 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 21 to 320 of FIG. 216 (SEQ ID NO: 299). Yes.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 21 to about 320 in FIG. 216 (SEQ ID NO: 299). It relates to an isolated PRO1100 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 21 to 320 of FIG. 216 (SEQ ID NO: 299). It relates to an isolated PRO1100 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1100 polypeptide having a sequence of about 1 or 21 to about 320 amino acid residues of FIG. 216 (SEQ ID NO: 299), or (B) hybridizing the test DNA molecule under stringent conditions with the complementary strand of the DNA molecule of (a); the test DNA molecule has at least about 80% sequence identity to (a) or (b); (Ii) under conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. (Iii) culturing a host cell comprising the test DNA molecule and (iii) recovering the polypeptide from the cell culture to provide a polypeptide to be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1100 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1100 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1100 polypeptide by contacting the native PRO1100 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1100 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

94. PRO836
A cDNA clone (DNA59620-1463) having a certain sequence identity with SLS1 encoding a novel polypeptide named “PRO836” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO836 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO836 polypeptide having a sequence from about 1 or 30 to about 461 amino acid residues in FIG. 218 (SEQ ID NO: 301), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity. As used herein, the term “or” with respect to amino acids or nucleic acids refers to two alternative embodiments provided herein, namely 1-461, and another embodiment, 30-461.
In another aspect, the invention provides an isolated encoding a PRO836 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from residue 65 or 152 to about 1447 of FIG. 217 (SEQ ID NO: 300). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59620-1463) of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 209989 human protein cDNA (DNA59620-1463).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or 30 to about 461 amino acid residues in FIG. 218 (SEQ ID NO: 301). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a single strand comprising the complementary strand of the DNA of (a) Relates to isolated nucleic acid molecules.
In a further aspect, the present invention provides (a) a DNA molecule encoding a PRO836 polypeptide having a sequence from about 1 or 30 to about 461 amino acid residues in FIG. 218 (SEQ ID NO: 301), or (b) (a) The test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of which the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence. Relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule if it has identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity .
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 30 to about 461 of FIG. 218 (SEQ ID NO: 301). An isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a score of at least about 90% positive, more preferably at least about 95% positive, or (b) a complementary strand of the DNA of (a) About.
In other embodiments, the present invention provides an isolated PRO836 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the present invention provides isolated native sequence PRO836 polypeptide, which in one embodiment comprises amino acid sequence comprising residue 1 or about 30 to 461 of FIG. 218 (SEQ ID NO: 301). It is out.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 30 to about 461 of FIG. 218 (SEQ ID NO: 301). It relates to an isolated PRO836 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 30 to 461 of FIG. 218 (SEQ ID NO: 301). It relates to an isolated PRO836 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO836 polypeptide having a sequence of about 1 or 30 to about 461 amino acid residues of FIG. 218 (SEQ ID NO: 301), or (B) hybridizing a test DNA molecule under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); (Ii) under conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. (Iii) culturing a host cell comprising the test DNA molecule and (iii) recovering the polypeptide from the cell culture to provide a polypeptide to be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO836 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO836 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO836 polypeptide by contacting the native PRO836 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO836 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

95. PRO1141
A cDNA clone (DNA59625-1498) was identified that encodes a novel transmembrane polypeptide termed “PRO1141” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1141 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1141 polypeptide having a sequence of about 1 or about 20 to about 247 amino acid residues in FIG. 220 (SEQ ID NO: 303), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). It comprises DNA with 95% sequence identity.
In another aspect, the invention provides an isolation encoding a PRO1141 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 204 or about 261 to about 944 of FIG. 219 (SEQ ID NO: 302). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by ATCC Deposit No. 209992 protein cDNA (DNA59625-1498) or (b) the complementary strand of the DNA molecule of (a). A DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209992 (DNA59625-1498).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or about 20 to about 247 amino acid residues in FIG. 220 (SEQ ID NO: 303). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides (a) a DNA molecule encoding a PRO1141 polypeptide having amino acid residue 1 of FIG. 220 (SEQ ID NO: 303) or a sequence of about 20 to about 247, or (b) (a) The test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of which the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence. Having at least about 10 nucleotides produced by isolating the test DNA molecule if it has identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1141 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide is tentatively identified as extending from about amino acid position 1 to about amino acid position 19 in FIG. 220 (SEQ ID NO: 303). The transmembrane domain consists of amino acid position about 38 to amino acid position 57, amino acid position about 67 to amino acid position 83, amino acid position about 117 to amino acid position about 139 and amino acid position of the PRO1141 amino acid sequence (FIG. 220, SEQ ID NO: 303). Temporarily identified as extending from about 153 to about amino acid position 170.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 220 (SEQ ID NO: 303) or the amino acid sequence from about 20 to about 247. It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or a complementary strand of the DNA of (a).
Other embodiments relate to fragments of the PRO1141 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 219 (SEQ ID NO: 302).
In other embodiments, the invention provides an isolated PRO1141 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1141 polypeptide, which in one embodiment comprises a residue 1 of Figure 220 (SEQ ID NO: 303) or an amino acid sequence comprising about 20 to about 247. Contains.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 220 (SEQ ID NO: 303) or the sequence from about 20 to about 247. It relates to an isolated PRO1141 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 220 (SEQ ID NO: 303) or the amino acid sequence from about 20 to about 247. Relates to an isolated PRO1141 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention includes amino acid residue 1 of FIG. 220 (SEQ ID NO: 303) or a sequence contained from about 20 to about 247, or a fragment sufficient to bind to an anti-PRO1141 antibody thereof. Relates to an isolated PRO1141 polypeptide. Preferably, this PRO1141 fragment retains the qualitative biological activity of a native PRO1141 polypeptide.
In yet a further aspect, the present invention provides (i) (a) a DNA molecule encoding a PRO1141 polypeptide having a sequence of about 1 or about 20 to about 247 amino acid residues of FIG. 220 (SEQ ID NO: 303), Or (b) the test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A host cell comprising a test DNA molecule is cultured below, and (iii) recovering the polypeptide from the cell culture provides a polypeptide to be produced.
In another embodiment, the invention provides an expressed sequence tag (EST) designated herein as DNA33128 comprising the nucleotide sequence of SEQ ID NO: 304 (see FIG. 221).
In another embodiment, the present invention provides an expressed sequence tag (EST) designated herein as DNA34256 comprising the nucleotide sequence of SEQ ID NO: 305 (see FIG. 222).
In another embodiment, the present invention provides an expressed sequence tag (EST) designated herein as DNA47941 comprising the nucleotide sequence of SEQ ID NO: 306 (see FIG. 223).
In another embodiment, the present invention provides an expressed sequence tag (EST) designated herein as DNA54389 comprising the nucleotide sequence of SEQ ID NO: 307 (see FIG. 224).

96. PRO1132
A cDNA clone (DNA59767-1489) was identified that encodes a novel polypeptide having sequence identity with the serine protease and trypsinogen designated “PRO1132” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1132 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1132 polypeptide having a sequence of about 23 to about 293 of amino acid residues of FIG. 226 (SEQ ID NO: 309), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention provides an isolated nucleic acid molecule encoding a PRO1132 polypeptide comprising DNA that hybridizes to a complementary strand of nucleic acid contained at about nucleotide 420 or about 1232 of FIG. 225 (SEQ ID NO: 308). About. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59767-1489) of ATCC Deposit No. 203108, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203108 (DNA59767-1489).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 23 to about 293 amino acid residues of FIG. 226 (SEQ ID NO: 309). An isolation comprising a DNA encoding a polypeptide having a sex, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA molecule of (a) Nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1132 polypeptide having a sequence of about 23 to about 293 amino acid residues of FIG. 226 (SEQ ID NO: 309), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about At least about 50, produced by isolating a test DNA molecule if it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule having nucleotides, preferably at least about 100 nucleotides.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to the amino acid sequence contained in residues about 23 to about 293 of FIG. 226 (SEQ ID NO: 309) An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1132 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1132 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides an isolated native sequence PRO1132 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues about 23 to about 293 of FIG. 226 (SEQ ID NO: 309). Yes.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of about amino acid residues 23 to about 293 of FIG. 226 (SEQ ID NO: 309). More preferably, an isolated PRO1132 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence contained in residues about 23 to about 293 of FIG. 226 (SEQ ID NO: 309). Relates to an isolated PRO1132 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises an isolated sequence comprising from about 23 to about 293 amino acid residues of FIG. 226 (SEQ ID NO: 309), or a fragment sufficient to bind to an anti-PRO1132 antibody thereof. Related to the PRO1132 polypeptide. Preferably, this PRO1132 fragment retains the qualitative biological activity of a native PRO1132 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1132 polypeptide having a sequence of about amino acid residues 23 to about 293 of FIG. 226 (SEQ ID NO: 309); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1132 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1132 antibody.
In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1132 polypeptide by contacting the native PRO1132 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1132 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

97. PRO1346
A cDNA clone (DNA59776-1600) was identified that encodes a novel polypeptide having homology to a known TIE ligand, designated “PRO1346” (or NL7) in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding an NL7 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding an NL7 polypeptide having a sequence of about 51 to about 461 amino acid residues of FIG. 228 (SEQ ID NO: 314), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention provides DNA that hybridizes to the complementary strand of nucleic acid from nucleotides 1-3 (ATG) to 1381-1383 (CGC before the TAG stop codon) of FIG. 227 (SEQ ID NO: 313). Relates to an isolated nucleic acid molecule encoding an NL7 polypeptide comprising Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59776-1600) of ATCC Deposit No. 203128, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203128 (DNA59776-1600).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 51 to about 461 amino acid residues in FIG. 228 (SEQ ID NO: 314). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding an NL7 polypeptide having a sequence of about 51 to about 461 amino acid residues of FIG. 228 (SEQ ID NO: 314), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about At least about 1000 produced by isolating a test DNA molecule when it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule having nucleotides.
In a particular embodiment, the invention relates to an isolated nucleic acid molecule comprising DNA encoding an NL7 polypeptide with or without an initiating methionine, or a soluble form thereof, ie transmembrane domain deletion or inactivation A variant is provided or is complementary to such an encoding nucleic acid molecule. The transmembrane domain has been tentatively identified as extending from about amino acid position 31 to about amino acid position 50 of the NL7 amino acid sequence (FIG. 228, SEQ ID NO: 314).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85%, when compared to the amino acid sequence contained in residues about 51 to about 461 of FIG. 228 (SEQ ID NO: 314). An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
In a further aspect, the invention relates to an isolated nucleic acid molecule of at least about 200 bases long that encodes a fragment of a native NL7 polypeptide.
In other embodiments, the present invention provides an isolated NL7 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the present invention provides an isolated native sequence NL7 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues from about 51 to about 461 of FIG. 228 (SEQ ID NO: 314). Yes.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from about 51 to about 461 amino acid residues of FIG. 228 (SEQ ID NO: 314). More preferably, an isolated NL7 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence from about 51 to about 461 residues of FIG. 228 (SEQ ID NO: 314). It relates to an isolated NL7 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising from about 51 to about 461 amino acid residues of FIG. 228 (SEQ ID NO: 314), or a fragment sufficient to bind to an anti-NL7 antibody thereof. Related NL7 polypeptides. Preferably, this NL7 fragment retains the qualitative biological activity of a native NL7 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding an NL7 polypeptide having a sequence from about 51 to about 461 amino acid residues of FIG. 228 (SEQ ID NO: 314); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of natural NL7 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-NL7 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a natural NL7 polypeptide by contacting the natural NL7 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising an NL7 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

98. PRO1131
A cDNA clone (DNA59777-1480) was identified that encodes a novel polypeptide having sequence identity with the LDL receptor designated “PRO1131” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1131 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule that encodes a PRO1131 polypeptide having a sequence from about 1 to about 280 amino acid residues in FIG. 230 (SEQ ID NO: 319), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1131 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residues 144 to 983 of FIG. 229 (SEQ ID NO: 318). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59777-1480) of ATCC Deposit No. 203111, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203111 (DNA59777-1480).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 280 of amino acid residues in FIG. 230 (SEQ ID NO: 319). An isolation comprising a DNA encoding a polypeptide having a sex, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA molecule of (a) Nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1131 polypeptide having a sequence of about 1 to about 280 amino acid residues of FIG. 230 (SEQ ID NO: 319); or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity; Preferably, it relates to an isolated nucleic acid molecule having at least about 100 nucleotides.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1131 polypeptide as a soluble, ie, mutant in which the transmembrane domain has been deleted or inactivated. Complementary to a non-coding nucleic acid molecule. The transmembrane domain has been tentatively identified as extending at about amino acid positions 49-74 of Figure 230, SEQ ID NO: 319.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to an amino acid sequence comprised between about 1 to about 280 of FIG. 230 (SEQ ID NO: 319). An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1131 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1131 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1131 polypeptide, which in certain embodiments, comprises an amino acid sequence comprising residues 1 to about 280 of FIG. 230 (SEQ ID NO: 319). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from about 1 to about 280 amino acid residues of FIG. 230 (SEQ ID NO: 319). More preferably, an isolated PRO1131 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence contained in residues 1 to about 280 of FIG. 230 (SEQ ID NO: 319). It relates to an isolated PRO1131 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises an isolated sequence comprising from about 1 to about 280 of amino acid residue of Figure 230 (SEQ ID NO: 319), or a fragment sufficient to bind to an anti-PRO1131 antibody thereof. Related PRO1131 polypeptides. Preferably, this PRO1131 fragment retains the qualitative biological activity of a native PRO1131 polypeptide.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1131 polypeptide having a sequence of about 1 to about 280 amino acid residues of FIG. 230 (SEQ ID NO: 319); Or (b) hybridized with the complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1131 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1131 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1131 polypeptide by contacting the native PRO1131 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1131 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.
In another embodiment, the present invention provides DNA43546 comprising the nucleotide sequence of FIG. 231 (SEQ ID NO: 320) and the expressed sequence tag (EST) designated herein.

99. PRO1281
A cDNA clone (DNA59820-1549) encoding a novel secreted polypeptide named “PRO1281” in the present application has been identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1281 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1281 polypeptide having a sequence of about 16 to about 775 amino acid residues of FIG. 233 (SEQ ID NO: 326), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1281 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 273 to about 2552 of FIG. 232 (SEQ ID NO: 325). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59820-1549) of ATCC Deposit No. 203129, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203129 human protein cDNA (DNA59820-1549).
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 16 to about 775 amino acid residues of FIG. 233 (SEQ ID NO: 326). An isolation comprising a DNA encoding a polypeptide having a sex, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA molecule of (a) Nucleic acid molecules.
In a further aspect, the present invention provides a test DNA molecule comprising: (a) a DNA molecule that encodes a PRO1281 polypeptide having a sequence of about 16 to about 775 of FIG. 233 (SEQ ID NO: 326), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity; Preferably, it relates to an isolated nucleic acid molecule having at least about 100 nucleotides.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1281 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie, transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 15 in FIG. 233 (SEQ ID NO: 326).
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 16 to about 775 of FIG. 233 (SEQ ID NO: 326). Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
Other embodiments relate to fragments of the PRO1281 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1281 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1281 polypeptide, which in certain embodiments, comprises an amino acid sequence comprising residues 16 to about 775 of FIG. 233 (SEQ ID NO: 326). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 16 to about 775 of FIG. 233 (SEQ ID NO: 326). More preferably, an isolated PRO1281 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the present invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about at least when compared to the amino acid sequence from residue 16 to about 775 of FIG. 233 (SEQ ID NO: 326). It relates to an isolated PRO1281 polypeptide comprising an amino acid sequence with a score of 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 16 to about 775 of FIG. 233 (SEQ ID NO: 326), or a fragment sufficient to bind to an anti-PRO1281 antibody thereof. PRO1281 polypeptide. Preferably, this PRO1281 fragment retains the qualitative biological activity of a native PRO1281 polypeptide.
In yet a further aspect, the invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1281 polypeptide having a sequence of about 16 to about 775 amino acid residues of FIG. 233 (SEQ ID NO: 326); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

100. PRO1064
A cDNA clone (DNA59827-1426) was identified that encodes a novel transmembrane polypeptide designated “PRO1064” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1064 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1064 polypeptide having a sequence of about 1 or about 25 to about 153 amino acid residues in FIG. 235 (SEQ ID NO: 334), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1064 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid of about 532 or about 604 to about 990 of FIG. 234 (SEQ ID NO: 333). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59827-1426) of ATCC Deposit No. 203099, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA (DNA59827-1426) of ATCC Deposit No. 203089.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or about 25 to about 153 amino acid residues in FIG. 235 (SEQ ID NO: 334). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule comprising
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1064 polypeptide having a sequence of about 1 or about 25 to about 153 amino acid residues of FIG. 235 (SEQ ID NO: 334); or (B) hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about At least about 10 produced by isolating a test DNA molecule when it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule having nucleotides.
In a particular aspect, the present invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1064 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Provides a deleted or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 24 in FIG. 235 (SEQ ID NO: 334). The transmembrane domain has been tentatively identified as extending from about amino acid position 89 to about amino acid position 110 of the PRO1064 amino acid sequence (FIG. 235, SEQ ID NO: 334).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 235 (SEQ ID NO: 334) or the amino acid sequence from about 25 to about 153 An isolated nucleic acid comprising a DNA molecule encoding a polypeptide having a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA molecule of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1064 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 234 (SEQ ID NO: 333) can be derived from the nucleotide sequence shown.
In other embodiments, the invention provides an isolated PRO1064 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1064 polypeptide, which in certain embodiments, includes residue 1 or from about 25 to about 153 of FIG. 235 (SEQ ID NO: 334). Contains the amino acid sequence.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 235 (SEQ ID NO: 334) or the sequence from about 25 to about 153. It relates to an isolated PRO1064 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 235 (SEQ ID NO: 334) or the amino acid sequence from about 25 to about 153. Relates to an isolated PRO1064 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention comprises amino acid residue 1 of FIG. 235 (SEQ ID NO: 334) or the sequence of about 25 to about 153, or a fragment sufficient to bind to an anti-PRO1064 antibody thereof, Related to isolated PRO1064 polypeptide. Preferably, this PRO1064 fragment retains the qualitative biological activity of a native PRO1064 polypeptide.
In yet a further aspect, the present invention encodes (i) a test DNA molecule (a) a PRO1064 polypeptide having a sequence of about 1 or about 25 to about 153 amino acid residues of FIG. 235 (SEQ ID NO: 334). A DNA molecule, or (b) hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) a host cell comprising a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Is produced under conditions suitable for expression of the polypeptide, and (iii) a polypeptide produced by recovering the polypeptide from the cell culture medium is provided.
In another embodiment, the present invention provides an expressed sequence tag (EST) designated herein as DNA45288 comprising the nucleotide sequence of SEQ ID NO: 335 (see FIG. 236).

101. PRO1379
A cDNA clone (DNA59828-1608) was identified that encodes a novel secreted polypeptide termed “PRO1379” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1379 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1379 polypeptide having a sequence of about 18 to about 574 of FIG. 238 (SEQ ID NO: 340), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the following sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1379 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid contained at residues 61 to 1731 of FIG. 237 (SEQ ID NO: 339). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59828-1608) of ATCC Deposit No. 203158, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203158 (DNA59828-1608).
In yet a further aspect, the present invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 18 to about 574 of FIG. 238 (SEQ ID NO: 340) An isolation comprising a DNA encoding a polypeptide having a sex, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA molecule of (a) Nucleic acid molecules.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1379 polypeptide having a sequence of about 18 to about 574 of FIG. 238 (SEQ ID NO: 340), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) At least about 50 nucleotides produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity; Preferably, it relates to an isolated nucleic acid molecule having at least about 100 nucleotides.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1379 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 17 in FIG. 238 (SEQ ID NO: 340).
In other embodiments, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 18 to about 574 of FIG. 238 (SEQ ID NO: 340), and more Preferably, it relates to a DNA molecule encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a).
Other embodiments relate to fragments of the PRO1379 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1379 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1379 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 18 to 574 of FIG. 238 (SEQ ID NO: 340).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 18 to about 574 of FIG. 238 (SEQ ID NO: 340). More preferably, an isolated PRO1379 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 18 to 574 of FIG. 238 (SEQ ID NO: 340). It relates to an isolated PRO1379 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides an isolated sequence comprising amino acid residues 18 to about 574 of FIG. 238 (SEQ ID NO: 340), or a fragment sufficient to bind to an anti-PRO1379 antibody thereof. PRO1379 polypeptide. Preferably, this PRO1379 fragment retains the qualitative biological activity of a native PRO1379 polypeptide.
In yet a further aspect, the invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1379 polypeptide having a sequence of about 18 to about 574 of amino acid residues of FIG. 238 (SEQ ID NO: 340); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

102. PRO844
A cDNA clone (DNA59838-1462) has been identified that encodes a novel polypeptide named "PRO844" in this application and has sequence identity with a protease inhibitor.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO844 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO844 polypeptide having a sequence from about 1 or about 20 to about 111 amino acid residues in FIG. 240 (SEQ ID NO: 345), or (b ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about the complementary strand of the DNA molecule of (a) DNA comprising about 95% sequence identity. As used herein, the term “or” with respect to amino acids or nucleic acids means two alternative embodiments provided herein, namely 1-111 or another embodiment 20-111.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO844 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 5 or 62 to about 337 of FIG. 239 (SEQ ID NO: 344). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59838-1462) of ATCC Deposit No. 209976, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209976 (DNA59838-1462).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or 20 to about 111 amino acid residues in FIG. 240 (SEQ ID NO: 345). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO844 polypeptide having a sequence of about 1 or 20 to about 111 amino acid residues of FIG. 240 (SEQ ID NO: 345); or ( b) hybridizing with the complementary strand of the DNA molecule of (a) under moderate stringency conditions, wherein the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably Isolation produced by isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Nucleic acid molecules.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 20 to about 111 in FIG. 240 (SEQ ID NO: 345). A DNA molecule encoding a polypeptide with a score of at least about 90% positive, more preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) About.
In another embodiment, the invention provides an isolated PRO844 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO844 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 20 to 111 of Figure 240 (SEQ ID NO: 345). Yes.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 20 to about 111 in FIG. 240 (SEQ ID NO: 345). It relates to an isolated PRO844 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 20 to 111 of FIG. 240 (SEQ ID NO: 345). It relates to an isolated PRO844 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention relates to (i) a test DNA molecule, (a) a DNA encoding a PRO844 polypeptide having a sequence from about 1 or 20 to about 111 amino acid residues in FIG. 240 (SEQ ID NO: 345). A molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); If preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO844 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO844 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO844 polypeptide by contacting the native PRO844 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO844 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

103. PRO848
A cDNA clone (DNA59839-1461) was identified that has sequence identity with a sialytransferase encoding a novel polypeptide named “PRO848” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO848 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO848 polypeptide having a sequence from about 1 or 36 to about 600 amino acid residues in FIG. 242 (SEQ ID NO: 347), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about DNA comprising 95% sequence identity. The term “or” as used herein to refer to an amino acid or nucleic acid as used herein refers to two alternative embodiments provided herein, namely 1-600 or another embodiment. 36-600.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO848 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 1 or 251 to about 1945 of FIG. 241 (SEQ ID NO: 346). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by ATCC Deposit No. 209988 human protein cDNA (DNA59839-1461), or (b) a complementary strand of the DNA molecule of (a). In contrast, DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule comprising. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209988 (DNA59839-1461).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence from about 1 or 36 to about 600 amino acid residues in FIG. 242 (SEQ ID NO: 347), preferably at least about 85%. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or comprising the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO848 polypeptide having a sequence from about 1 or 36 to about 600 amino acid residues of FIG. 242 (SEQ ID NO: 347); b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 An isolated nucleic acid produced by isolating a test DNA molecule when it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Concerning molecules.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 36 to about 600 in FIG. 242 (SEQ ID NO: 347). A DNA molecule encoding a polypeptide with a score of at least about 90% positive, more preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) About.
In another embodiment, the invention provides an isolated PRO848 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO848 polypeptide, which in certain embodiments, comprises an amino acid sequence comprising residues 1 or 36 to 600 of FIG. 242 (SEQ ID NO: 347). Is included.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 36 to about 600 in FIG. 242 (SEQ ID NO: 347). It relates to an isolated PRO848 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence from residue 1 or 36 to 600 of FIG. 242 (SEQ ID NO: 347). It relates to an isolated PRO848 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention relates to (i) a test DNA molecule comprising: (a) a DNA encoding a PRO848 polypeptide having a sequence from about 1 or 36 to about 600 amino acid residues in FIG. 242 (SEQ ID NO: 347). A molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); If preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of the native PRO848 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO848 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO848 polypeptide by contacting the native PRO848 polypeptide with a candidate molecule and monitoring biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO848 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

104. PRO1097
Applicants have identified a cDNA clone (DNA59841-1460) encoding a novel secreted polypeptide having domains from the glycoprotease family protein and the acyltransferase ChoActase / COT / CPT family therein, and the polypeptide It was named “PRO1097” in the application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1097 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1097 polypeptide having a sequence from about 1 or 21 to about 91 amino acid residues in FIG. 244 (SEQ ID NO: 349), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about DNA comprising 95% sequence identity. The term “or” as used herein to refer to an amino acid or nucleic acid refers to two alternative embodiments provided herein, namely 1-91 or another embodiment 21-91.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1097 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 3 or 63 to about 275 of FIG. 243 (SEQ ID NO: 348). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59841-1460) of ATCC Deposit No. 203044, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203044 (DNA59841-1460).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or 21 to about 91 amino acid residues in FIG. 244 (SEQ ID NO: 349). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) the complementary strand of the DNA molecule of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1097 polypeptide having a sequence from about 1 or 21 to about 91 in FIG. 244 (SEQ ID NO: 349); or ( b) hybridizing under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85 An isolated nucleic acid produced by isolating a test DNA molecule when it has a% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Concerning molecules.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1097 polypeptide, which may or may not have an N-terminal signal sequence and / or an initiation methionine. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 20 in FIG. 244 (SEQ ID NO: 349).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 21 to about 91 in FIG. 244 (SEQ ID NO: 349). A DNA molecule encoding a polypeptide with a score of at least about 90% positive, more preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) About.
In other embodiments, the invention provides an isolated PRO1097 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1097 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 or 21 to 91 of FIG. 244 (SEQ ID NO: 349). Yes.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, to the sequence from amino acid residue 1 or 21 to about 91 in FIG. 244 (SEQ ID NO: 349). It relates to an isolated PRO1097 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 21 to 91 of FIG. 244 (SEQ ID NO: 349). It relates to an isolated PRO1097 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention relates to (i) a test DNA molecule, (a) a DNA encoding a PRO1097 polypeptide having a sequence of about 1 or 21 to about 91 amino acid residues of FIG. 244 (SEQ ID NO: 349). A molecule, or (b) hybridized with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); If preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) a host cell containing the test DNA molecule is A polypeptide produced by culturing under conditions suitable for expression of the polypeptide and (iii) recovering the polypeptide from the cell culture medium is provided.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1097 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1097 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1097 polypeptide by contacting the native PRO1097 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1097 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

105. PRO1153
A very proline rich cDNA clone (DNA59842-1502) with two transmembrane domains was identified that encodes a novel polypeptide named “PRO1153” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1153 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1153 polypeptide having a sequence of about 1 to about 197 of amino acid residues in FIG. 246 (SEQ ID NO: 351), or (b) (a ) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. DNA having the same sequence identity.
In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1153 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 92 to about 682 of FIG. 245 (SEQ ID NO: 350). . Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by human protein cDNA (DNA59842-1502) of ATCC Deposit No. 209982, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209982 (DNA59842-1502).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 197 of amino acid residues in FIG. 246 (SEQ ID NO: 351). A DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA molecule of (a) An isolated nucleic acid molecule.
In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1153 polypeptide having a sequence of about 1 to about 197 of amino acid residues in FIG. 246 (SEQ ID NO: 351), or (b) Hybridizing with the complementary strand of the DNA molecule of (a) under stringent conditions so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85%, relative to (a) or (b) Relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule if it has sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity .
In certain aspects, the invention provides isolated nucleic acid molecules comprising DNA encoding a PRO1153 polypeptide, and variants in which the soluble, ie, transmembrane domain has been deleted or inactivated, or Complementary to a non-coding nucleic acid molecule. The transmembrane domain has been tentatively identified as extending to amino acid positions about 10-28 and 85-110 of the PRO1153 amino acid sequence (FIG. 246, SEQ ID NO: 351).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence contained in residues 1 to about 197 of FIG. 246 (SEQ ID NO: 351). A DNA molecule encoding a polypeptide with a score of at least about 90% positive, more preferably at least about 95% positive, or (b) an isolated nucleic acid molecule comprising the complementary strand of the DNA molecule of (a) About.
In another embodiment, the present invention provides an isolated PRO1153 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1153 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to 197 of FIG. 246 (SEQ ID NO: 351).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 197 of FIG. 246 (SEQ ID NO: 351). More preferably, an isolated PRO1153 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 1 to 197 of FIG. 246 (SEQ ID NO: 351). Pertaining to an isolated PRO1153 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the present invention provides (i) a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1153 polypeptide having a sequence of about 1 to about 197 of amino acid residues of FIG. 246 (SEQ ID NO: 351); Or (b) hybridizing with a complementary strand of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably When having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, And (iii) providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

106. PRO1154
A cDNA clone (DNA59846-1503) encoding a novel aminopeptidase designated “PRO1154” in this application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1154 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1154 polypeptide having a sequence from about 1 or 35 to about 941 amino acid residues in FIG. 248 (SEQ ID NO: 353), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity.
In another aspect, the invention provides an isolated encoding a PRO1154 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 86 or 188 to about 2908 of FIG. 247 (SEQ ID NO: 352). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC deposit no.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence from about 1 or 35 to about 941 in FIG. 248 (SEQ ID NO: 353), preferably at least about 85%. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a single strand comprising the complementary strand of the DNA of (a) Relates to released nucleic acid molecules.
In a further aspect, the invention provides (a) a DNA molecule encoding a PRO1154 polypeptide having a sequence from about 1 or 35 to about 941 amino acid residues in FIG. 248 (SEQ ID NO: 353), or (b) (a) The test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of which the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence. Relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule if it has identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity .
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 35 to about 941 in FIG. 248 (SEQ ID NO: 353). An isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a score of at least about 90% positive, more preferably at least about 95% positive, or (b) a complementary strand of the DNA of (a) About.
In another aspect, the invention relates to an isolated nucleic acid molecule consisting essentially of DNA encoding a polypeptide having amino acid 1 or 35 to about 73 of SEQ ID NO: 353.
In other embodiments, the invention provides an isolated PRO1154 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the present invention provides isolated native sequence PRO1154 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 35 to 941 of FIG. 248 (SEQ ID NO: 353). Yes.
In certain aspects, the invention provides a polypeptide having amino acid 1 or 35 to about 73 of SEQ ID NO: 353.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 35 to about 941 in FIG. 248 (SEQ ID NO: 353). It relates to an isolated PRO1154 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 35 to 941 of FIG. 248 (SEQ ID NO: 353). It relates to an isolated PRO1154 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention includes amino acid residue 1 or 35 to about 941 of FIG. 248 (SEQ ID NO: 353), or a fragment thereof sufficient to provide a binding site for anti-PRO1154 antibody. For an isolated PRO1154 polypeptide. Preferably, the PRO1154 fragment retains the qualitative biological activity of a native PRO1154 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1154 polypeptide having a sequence of about 1 or 35 to about 941 amino acid residues of FIG. 248 (SEQ ID NO: 353), or (B) hybridizing a test DNA molecule under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); (Ii) under conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. (Iii) culturing a host cell comprising the test DNA molecule and (iii) recovering the polypeptide from the cell culture to provide a polypeptide to be produced.
In yet another embodiment, the present invention relates to agonists and antagonists of the native PRO1154 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1154 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1154 polypeptide by contacting the native PRO1154 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1154 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

107. PRO1181
A cDNA clone (DNA59847-1511) was identified that encodes a novel secreted polypeptide named “PRO1181” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1181 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1181 polypeptide having a sequence of about 1 or about 16 to about 437 amino acid residues in FIG. 250 (SEQ ID NO: 355), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 90%, to the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In other embodiments, the invention provides an isolated encoding for a PRO1181 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about nucleotide 17 or about 62 to about 1327 of FIG. 249 (SEQ ID NO: 354). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59847-1511) of ATCC Deposit No. 203098, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit number 203098 human protein cDNA (DNA59847-1511).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 250 (SEQ ID NO: 355) or the sequence from about 16 to about 437. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a DNA molecule encoding a PRO1181 polypeptide having at least 10 nucleotides and having (a) amino acid residue 1 of FIG. 250 (SEQ ID NO: 355) or a sequence of about 16 to about 437. Or (b) hybridizing the test DNA molecule under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule has at least about 80% sequence identity to (a) or (b); Produced by isolating a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Isolated nucleic acid molecules.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1181 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such encoding nucleic acid molecule. That are complementary to The signal peptide was experimentally identified as extending from about amino acid residue 1 to about amino acid position 15 of the sequence of FIG. 250 (SEQ ID NO: 355). The transmembrane domain is at amino acid positions 243-260 in FIG.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 250 (SEQ ID NO: 355) or the amino acid sequence from about 16 to about 437. An isolated nucleic acid comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1181 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long, 249 (SEQ ID NO: 354) can be extracted from the nucleotide sequence shown in FIG.
In other embodiments, the invention provides an isolated PRO1181 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the present invention provides isolated native sequence PRO1181 polypeptide, which in one embodiment, comprises residue 1 of FIG. 250 (SEQ ID NO: 355) or an amino acid sequence comprising from about 16 to about 437. Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 250 (SEQ ID NO: 355) or the sequence from about 16 to about 437. It relates to an isolated PRO1181 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 in Figure 250 (SEQ ID NO: 355) or the amino acid sequence from about 16 to about 437. Relates to an isolated PRO1181 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides amino acid residue 1 of FIG. 250 (SEQ ID NO: 355) or a sequence from about 16 to about 437, or a fragment thereof sufficient to provide a binding site for an anti-PRO1181 antibody. An isolated PRO1181 polypeptide comprising. Preferably, the PRO1181 fragment retains the qualitative biological activity of a native PRO1181 polypeptide.
In yet a further aspect, the invention provides (i) (a) a PRO1181 polypeptide having a sequence of about 1 or about 16 to about 437 amino acid residues of FIG. 250 (SEQ ID NO: 355), or (b) ( The test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule of a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about (Ii) a test DNA molecule under conditions suitable for expression of a polypeptide if it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. And (iii) recovering the polypeptide from the cell culture to provide the produced polypeptide.

108. PRO1182
A cDNA clone (DNA59848-1512) was identified that was homologous to a nucleic acid encoding conglutinin encoding a novel secreted polypeptide, named “PRO1182” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1182 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1182 polypeptide having a sequence of about 1 or about 26 to about 271 amino acid residues in FIG. 252 (SEQ ID NO: 357), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In other embodiments, the invention provides an isolated encoding a PRO1182 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 67 or about 142 to about 879 of FIG. 251 (SEQ ID NO: 356). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59848-1512) of ATCC Deposit No. 203088, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203088 human protein cDNA (DNA59848-1512).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 252 (SEQ ID NO: 357) or the sequence from about 26 to about 271. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention relates to a DNA molecule encoding a PRO1182 polypeptide having at least 10 nucleotides and having (a) amino acid residue 1 of FIG. 252 (SEQ ID NO: 357) or a sequence of about 26 to about 271. Or (b) hybridizing the test DNA molecule under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule has at least about 80% sequence identity to (a) or (b); Produced by isolating a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Isolated nucleic acid molecules.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1182 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such encoding nucleic acid molecule. That are complementary to The signal peptide was experimentally identified as extending from about amino acid residue 1 to about amino acid position 25 of the sequence of FIG. 252 (SEQ ID NO: 357).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 252 (SEQ ID NO: 357) or the amino acid sequence from about 26 to about 271 An isolated nucleic acid comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1182 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 251 (SEQ ID NO: 356).
In another embodiment, the present invention provides an isolated PRO1182 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the present invention provides isolated native sequence PRO1182 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 26 to about 271 of FIG. 252 (SEQ ID NO: 357). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 252 (SEQ ID NO: 357) or the sequence from about 26 to about 271. It relates to an isolated PRO1182 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 252 (SEQ ID NO: 357) or the amino acid sequence from about 26 to about 271. Relates to an isolated PRO1182 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides amino acid residue 1 of FIG. 252 (SEQ ID NO: 357) or a sequence from about 26 to about 271 or a fragment thereof sufficient to provide a binding site for an anti-PRO1182 antibody. An isolated PRO1182 polypeptide comprising. Preferably, the PRO1182 fragment retains the qualitative biological activity of a native PRO1182 polypeptide.
In yet a further aspect, the invention provides (i) (a) a PRO1182 polypeptide having a sequence of about 1 or about 26 to about 271 amino acid residues of FIG. 252 (SEQ ID NO: 357), or (b) ( The test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule of a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about (Ii) a test DNA molecule under conditions suitable for expression of a polypeptide if it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. And (iii) recovering the polypeptide from the cell culture to provide the produced polypeptide.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1182 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1182 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1182 polypeptide by contacting the native PRO1182 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1182 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

109. PRO1155
A cDNA clone (DNA59849-1504) having sequence identity with neurokinin B, encoding a novel secreted polypeptide, named “PRO1155” in this application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1155 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1155 polypeptide having a sequence from about 1 or 19 to about 135 amino acid residues in FIG. 254 (SEQ ID NO: 359), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity. The term “or” as used herein to refer to a nucleic acid or amino acid means providing another embodiment, ie, 1-135 or 19-135 of another embodiment.
In another aspect, the invention provides an isolation encoding a PRO1155 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from residue 158 or from about 212 to about 562 of FIG. 253 (SEQ ID NO: 358). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59849-1504) of ATCC Deposit No. 209986, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209986 (DNA59849-1504).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence from amino acid residue 1 or 19 to about 135 in FIG. 254 (SEQ ID NO: 359), preferably at least about 85% sequence. An isolation comprising a DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) Nucleic acid molecules.
In a further aspect, the invention provides (a) a DNA molecule encoding a PRO1155 polypeptide having a sequence of about 19 to about 135 amino acid residues of FIG. 254 (SEQ ID NO: 359), or (b) DNA of (a) The test DNA molecule is hybridized under stringent conditions with the complementary strand of the molecule so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85% sequence identity to (a) or (b) More preferably, it relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule if it has at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 19 to about 135 in FIG. 254 (SEQ ID NO: 359). An isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a score of at least about 90% positive, more preferably at least about 95% positive, or (b) a complementary strand of the DNA of (a) About.
In another embodiment, the present invention provides an isolated PRO1155 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the present invention provides an isolated native sequence PRO1155 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 19 to 135 of Figure 254 (SEQ ID NO: 359). Yes.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 19 to about 135 in FIG. 254 (SEQ ID NO: 359). It relates to an isolated PRO1155 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 19 to 135 of FIG. 254 (SEQ ID NO: 359). It relates to an isolated PRO1155 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides (i) (a) a PRO1155 polypeptide having a sequence of about 1 or 19 to about 135 amino acid residues of FIG. 254 (SEQ ID NO: 359), or (b) (a ) And the complementary strand of the DNA molecule under stringent conditions such that the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) the test DNA molecule under conditions suitable for polypeptide expression The produced host cell is cultured, and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet other embodiments, the invention relates to agonists and antagonists of native PRO1155 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1155 antibody.
In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1155 polypeptide by contacting the native PRO1155 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1155 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

110. PRO1156
A cDNA clone (DNA59853-1505) encoding a novel secreted polypeptide, designated “PRO1156” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1156 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1156 polypeptide having a sequence of from about 23 to about 159 amino acid residues of FIG. 256 (SEQ ID NO: 361), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO1156 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 281 to about 688 of Figure 255 (SEQ ID NO: 360). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59853-1505) of ATCC Deposit No. 209985, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209985 (DNA59853-1505).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 23 to about 159 of FIG. 256 (SEQ ID NO: 361). More preferably a DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a single strand comprising the complementary strand of the DNA of (a) Relates to isolated nucleic acid molecules.
In a further aspect, the present invention provides a PRO1156 polypeptide having a sequence of at least 50 nucleotides, preferably at least 100 nucleotides, and (a) amino acid residue 23 to about 159 of FIG. 256 (SEQ ID NO: 361). The test DNA molecule is hybridized under stringent conditions with the encoding DNA molecule or the complementary strand of the DNA molecule of (b) (a), wherein the DNA molecule is at least about 80% of (a) or (b) A test DNA molecule is isolated if it has sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity It relates to an isolated nucleic acid molecule produced by
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1156 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such encoding nucleic acid molecule. That are complementary to The signal peptide was experimentally identified as extending from amino acid residue 1 of the sequence of FIG. 256 (SEQ ID NO: 361) to about amino acid position 22.
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 23 to about 159 of FIG. 256 (SEQ ID NO: 361), and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
In another aspect, the invention relates to a hybridization probe comprising a fragment of the PRO784 coding sequence or its complementary sequence. The hybridization probe preferably has at least about 20 to about 80 nucleotides, more preferably about 20 to about 50 nucleotides.
In another embodiment, the present invention provides an isolated PRO1156 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1156 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 23 to 159 of FIG. 256 (SEQ ID NO: 361).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 23 to about 159 of FIG. 256 (SEQ ID NO: 361). More preferably, an isolated PRO1156 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 23 to 159 of FIG. 256 (SEQ ID NO: 361). Pertaining to an isolated PRO1156 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises the sequence from amino acid residue 23 to about 159 of Figure 256 (SEQ ID NO: 361), or a fragment thereof sufficient to provide a binding site for an anti-PRO1156 antibody. Relates to an isolated PRO1156 polypeptide. Preferably, the PRO1156 fragment retains the qualitative biological activity of a native PRO1156 polypeptide.
In yet a further aspect, the invention provides (i) (a) a PRO1156 polypeptide having a sequence of about 23 to about 159 amino acid residues of FIG. 256 (SEQ ID NO: 361), or (b) of (a) A test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule such that the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% When having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) comprising a test DNA molecule under conditions suitable for polypeptide expression. And (iii) recovering the polypeptide from the cell culture to provide the produced polypeptide.

111. PRO1098
A cDNA clone (DNA59854-1459) encoding a novel polypeptide, designated “PRO1098” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1098 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1098 polypeptide having a sequence of about 1 or 20 to about 78 amino acid residues of FIG. 258 (SEQ ID NO: 363), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity. As used herein to refer to an amino acid or nucleic acid, the term “or” refers to two alternative embodiments provided individually, namely 1-78, or another embodiment 20-78. It is.
In another aspect, the invention provides an isolated encoding a PRO1098 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from residue 58 or 115 to about 291 of Figure 257 (SEQ ID NO: 362). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA59854-1459) of ATCC Deposit No. 209974, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209974 (DNA59854-1459).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 or 20 to about 78 sequence of FIG. 258 (SEQ ID NO: 363). An isolation comprising a DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) Nucleic acid molecules.
In a further aspect, the invention provides: (a) a DNA molecule encoding a PRO1098 polypeptide having a sequence from amino acid residue 1 or 20 to about 78 of FIG. 258 (SEQ ID NO: 363); or (b) of (a) The test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule so that the DNA molecule is at least about 80% sequence identity, preferably at least about 85% sequence identity to (a) or (b) It relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule if it has a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 20 to about 78 of FIG. 258 (SEQ ID NO: 363). An isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a score of at least about 90% positive, more preferably at least about 95% positive, or (b) a complementary strand of the DNA of (a) About.
In another embodiment, the present invention provides an isolated PRO1098 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the invention provides isolated native sequence PRO1098 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 20 to 78 of FIG. 258 (SEQ ID NO: 363). Yes.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 20 to about 78 in FIG. 258 (SEQ ID NO: 363). It relates to an isolated PRO1098 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 20 to 78 of FIG. 258 (SEQ ID NO: 363). It relates to an isolated PRO1098 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides (i) (a) a PRO1098 polypeptide having a sequence of about 1 or 20 to about 78 amino acid residues of FIG. 258 (SEQ ID NO: 363), or (b) (a ) And the complementary strand of the DNA molecule under stringent conditions such that the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85 % Sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, (ii) the test DNA molecule under conditions suitable for polypeptide expression The produced host cell is cultured, and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.

112. PRO1127
A cDNA clone (DNA60283-1484) was identified that encodes a novel secreted protein named “PRO1127” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1127 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1127 polypeptide having a sequence of about 1 or 30 to about 67 amino acid residues in FIG. 260 (SEQ ID NO: 365), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity. As used herein, the term “or” with respect to amino acids or nucleic acids refers to two alternative embodiments, one embodiment of 1-67 and 30-67 embodiments.
In another aspect, the invention provides an isolated encoding a PRO1127 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 126 or 213 to about 326 of FIG. 259 (SEQ ID NO: 364). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA60283-1484) of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 204343 human protein cDNA (DNA60283-1484).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or 30 to about 67 amino acid residues in FIG. 260 (SEQ ID NO: 365). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a single strand comprising the complementary strand of the DNA of (a) Relates to isolated nucleic acid molecules.
In a further aspect, the invention provides (a) a DNA molecule encoding a PRO1127 polypeptide having a sequence of about 1 or 30 to about 67 amino acid residues of FIG. 260 (SEQ ID NO: 365), or (b) (a) The test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of which the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence. Relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule if it has identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity .
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1127 polypeptide that does not have an N-terminal signal sequence and / or an initiation methionine. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 29 in FIG. 260 (SEQ ID NO: 365).
In other embodiments, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 30 to about 67 of FIG. 260 (SEQ ID NO: 365). More preferably, an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or a complementary strand of the DNA of (a).
Other embodiments relate to fragments of the PRO1127 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1127 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the present invention provides isolated native sequence PRO1127 polypeptide, which in one embodiment comprises amino acid sequence comprising residue 1 or about 30 to 67 of Figure 260 (SEQ ID NO: 365). It is out.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, to the sequence from amino acid residue 1 or 30 to about 67 in FIG. 260 (SEQ ID NO: 365). It relates to an isolated PRO1127 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 30 to 67 of FIG. 260 (SEQ ID NO: 365). It relates to an isolated PRO1127 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1127 polypeptide having a sequence of about 1 or 30 to about 67 amino acid residues of FIG. 260 (SEQ ID NO: 365), or (B) hybridizing the test DNA molecule under stringent conditions with the complementary strand of the DNA molecule of (a); the test DNA molecule has at least about 80% sequence identity to (a) or (b); (Ii) under conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. And (iii) recovering the polypeptide from the cell culture to provide a polypeptide to be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1127 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1127 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1127 polypeptide by contacting the native PRO1127 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1127 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

113. PRO1126
A cDNA clone (DNA60615-1483) was identified that encodes a novel secreted protein named “PRO1126” in the present application and has homology to the nucleic acid encoding olfactomedin.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1126 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1126 polypeptide having a sequence of about 1 or about 26 to about 402 amino acid residues in FIG. 262 (SEQ ID NO: 367), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). It comprises DNA with 95% sequence identity.
In another aspect, the invention provides an isolated encoding a PRO1126 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about nucleotide 110 or about 185 to about 1315 of FIG. 261 (SEQ ID NO: 366). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60615-1483) of ATCC Deposit No. 209980, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit number 209980 human protein cDNA (DNA60615-1483).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% amino acid residue 1 in FIG. 262 (SEQ ID NO: 367) or the sequence from about 26 to about 402. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a single strand comprising the complementary strand of the DNA of (a) Relates to released nucleic acid molecules.
In a further aspect, the present invention provides a DNA molecule that encodes a PRO1126 polypeptide having at least 10 nucleotides and having (a) amino acid residue 1 of FIG. 262 (SEQ ID NO: 367) or the sequence of about 26 to about 402. Or (b) hybridizing the test DNA molecule under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule has at least about 80% sequence identity to (a) or (b); Produced by isolating a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Isolated nucleic acid molecules.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1126 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such encoding nucleic acid molecule. That are complementary to The signal peptide was experimentally identified as extending from about amino acid residue 1 to about amino acid position 25 of the sequence of FIG. 262 (SEQ ID NO: 367).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 262 (SEQ ID NO: 367) or the amino acid sequence from about 26 to about 402. It relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or a complementary strand of the DNA of (a).
Other embodiments relate to fragments of the PRO1126 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 261 (SEQ ID NO: 366).
In other embodiments, the invention provides an isolated PRO1126 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1126 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of FIG. 262 (SEQ ID NO: 367) or from about 26 to about 402. Contains.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 262 (SEQ ID NO: 367) or the sequence from about 26 to about 402. It relates to an isolated PRO1126 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 262 (SEQ ID NO: 367) or the amino acid sequence from about 26 to about 402. Relates to an isolated PRO1126 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides amino acid residue 1 of FIG. 262 (SEQ ID NO: 367) or a sequence from about 26 to about 402, or a fragment thereof sufficient to provide a binding site for an anti-PRO1126 antibody. An isolated PRO1126 polypeptide comprising. Preferably, the PRO1126 fragment retains the qualitative biological activity of a native PRO1126 polypeptide.
In yet a further aspect, the invention provides (i) (a) a PRO1126 polypeptide having a sequence of about 1 or about 26 to about 402 amino acid residues of FIG. 262 (SEQ ID NO: 367), or (b) ( a test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule of a) such that the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about (Ii) a test DNA molecule under conditions suitable for expression of a polypeptide if it has 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. And (iii) recovering the polypeptide from the cell culture to provide the produced polypeptide.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1126 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1126 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1126 polypeptide by contacting the native PRO1126 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1126 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

114. PRO1125
A cDNA clone (DNA60619-1482) with a β-transdacin family Trp-Asp (WD) conserved region encoding a novel secreted protein named “PRO1125” in this application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1125 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1125 polypeptide having a sequence from about 1 or 26 to about 447 of amino acid residues in FIG. 264 (SEQ ID NO: 369), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity. As used herein, “or” when referring to nucleic acids or amino acids refers to two alternative embodiments, namely 1-447 and 26-447.
In another aspect, the invention provides an isolated encoding a PRO1125 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 47 or 122 to about 1387 of FIG. 263 (SEQ ID NO: 368). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60619-1482) of ATCC Deposit No. 20993, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 209993 human protein cDNA (DNA60619-1482).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence from about 1 or 26 to about 447 of FIG. 264 (SEQ ID NO: 369), preferably at least about 85%. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a single strand comprising the complementary strand of the DNA of (a) Relates to isolated nucleic acid molecules.
In a further aspect, the present invention provides (a) a DNA molecule encoding a PRO1125 polypeptide having the sequence from about 1 or 26 to about 447 of amino acid residue of FIG. 264 (SEQ ID NO: 369), or (b) (a) The test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of which the DNA molecule is at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence. Relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule if it has identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity .
In a particular aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1125 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble or transmembrane domain Provides mutants that are deleted or inactivated, or that are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 25 in FIG. 264 (SEQ ID NO: 369).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 26 to about 447 of FIG. 264 (SEQ ID NO: 369). More preferably, an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or a complementary strand of the DNA of (a).
In another embodiment, the invention provides an isolated PRO1125 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the invention provides isolated native sequence PRO1125 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 26 to 447 of FIG. 264 (SEQ ID NO: 369). Yes.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 26 to about 447 of FIG. 264 (SEQ ID NO: 369). It relates to an isolated PRO1125 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention relates to at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 26 to 447 of FIG. 264 (SEQ ID NO: 369). It relates to an isolated PRO1125 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises the sequence from amino acid residue 26 to about 447 of FIG. 264 (SEQ ID NO: 369), or a fragment thereof sufficient to provide a binding site for an anti-PRO1125 antibody. Relates to an isolated PRO1125 polypeptide. Preferably, the PRO1125 fragment retains the qualitative biological activity of a native PRO1125 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1125 polypeptide having a sequence of about 26 to about 447 amino acid residues of FIG. 264 (SEQ ID NO: 369), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1125 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1125 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1125 polypeptide by contacting the native PRO1125 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

115. PRO1186
A cDNA clone (DNA60621-1516) was identified which has sequence identity with Venom Protein A and encodes a novel polypeptide named “PRO1186” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1186 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1186 polypeptide having a sequence of about 20 to about 105 amino acid residues of FIG. 266 (SEQ ID NO: 371), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1186 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 148 to about 405 of FIG. 265 (SEQ ID NO: 370). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60621-1516) of ATCC Deposit No. 203091, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by human protein cDNA (DNA60621-1516) at ATCC Deposit No. 203091.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 20 to about 105 amino acid residues of FIG. 266 (SEQ ID NO: 371). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the present invention has at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) has a sequence of about 20 to about 105 amino acid residues in FIG. 266 (SEQ ID NO: 371). A DNA molecule encoding a PRO1186 polypeptide, or (b) a test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least relative to (a) or (b) A test DNA molecule having about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to an isolated nucleic acid molecule produced by isolating.
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 20 to about 105 in FIG. 266 (SEQ ID NO: 371) Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1186 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1186 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1186 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 20 to 105 of FIG. 266 (SEQ ID NO: 371).
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 20 to about 105 in FIG. 266 (SEQ ID NO: 371). More preferably, an isolated PRO1186 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 20 to 105 of FIG. 266 (SEQ ID NO: 371). Pertaining to an isolated PRO1186 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises the sequence from amino acid residue 20 to about 105 of Figure 266 (SEQ ID NO: 371), or a fragment thereof sufficient to provide a binding site for an anti-PRO1186 antibody. Relates to an isolated PRO1186 polypeptide. Preferably, the PRO1186 fragment retains the qualitative biological activity of a native PRO1186 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1186 polypeptide having a sequence of about 20 to about 105 amino acid residues of FIG. 266 (SEQ ID NO: 371), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured, and (iii) recovering the polypeptide from the cell culture provides the polypeptide to be produced.
In yet other embodiments, the invention relates to agonists and antagonists of native PRO1186 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1186 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1186 polypeptide by contacting the native PRO1186 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1186 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

116. PRO1198
A cDNA clone (DNA60622-1525) encoding a novel secreted protein named “PRO1198” in this application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1198 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1198 polypeptide having a sequence of about 35 to about 229 amino acid residues of FIG. 268 (SEQ ID NO: 373), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1198 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 156 to about 740 of FIG. 268 (SEQ ID NO: 373). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60622-1525) of ATCC Deposit No. 203090, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203090 human protein cDNA (DNA60622-1525).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 35 to about 229 of FIG. 268 (SEQ ID NO: 373). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the invention provides PRO1198 having at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) the sequence from about 35 to about 229 amino acid residues of FIG. 268 (SEQ ID NO: 373). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolation.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1198 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 35 in FIG. 268 (SEQ ID NO: 373).
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 35 to about 229 in FIG. 268 (SEQ ID NO: 373). Preferably, it relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or a complementary strand of the DNA of (a).
Other embodiments relate to fragments of the PRO1198 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1198 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1198 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 35 to 229 of FIG. 268 (SEQ ID NO: 373).
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 35 to about 229 of FIG. 268 (SEQ ID NO: 373). More preferably, an isolated PRO1198 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 35 to 229 of FIG. 268 (SEQ ID NO: 373). Pertaining to an isolated PRO1198 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises the sequence from amino acid residue 35 to about 229 of FIG. 268 (SEQ ID NO: 373), or a fragment thereof sufficient to provide a binding site for anti-PRO1198 antibody. Relates to the isolated PRO1198 polypeptide. Preferably, the PRO1198 fragment retains the qualitative biological activity of a native PRO1198 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1198 polypeptide having a sequence of about 35 to about 229 amino acid residues of FIG. 268 (SEQ ID NO: 373), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.

117. PRO1158
A cDNA clone (DNA60625-1507) encoding a novel transmembrane polypeptide designated “PRO1158” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1158 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1158 polypeptide having a sequence of about 20 to about 123 amino acid residues of FIG. 270 (SEQ ID NO: 375), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In other embodiments, the invention provides an isolated nucleic acid encoding a PRO1158 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 220 to about 531 of FIG. 269 (SEQ ID NO: 374). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA60625-1507) of ATCC Deposit No. 209975, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 209975 (DNA60625-1507).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 20 to about 123 amino acid residues in FIG. 270 (SEQ ID NO: 375). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the invention comprises PRO1158 having at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) having a sequence from about 20 to about 123 amino acid residues in FIG. 270 (SEQ ID NO: 375). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolation.
In a particular aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1158 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Deletion or inactivation variants are provided or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 19 in FIG. 270 (SEQ ID NO: 375). The transmembrane domain has been tentatively identified as extending from about amino acid position 56 to about amino acid position 80 of the PRO1158 amino acid sequence (FIG. 270, SEQ ID NO: 375).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 20 to about 123 of FIG. 270 (SEQ ID NO: 375), and more Preferably, it relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or a complementary strand of the DNA of (a).
In another aspect, the invention relates to a hybridization probe comprising a fragment of the PRO1158 coding sequence, or a complementary sequence thereof. The hybridization probe preferably has at least about 20 to about 80 nucleotides, more preferably at least about 20 to about 50 nucleotides.
In another embodiment, the invention provides an isolated PRO1158 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1158 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 20 to 123 of FIG. 270 (SEQ ID NO: 375).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 20 to about 123 in FIG. 270 (SEQ ID NO: 375). More preferably, an isolated PRO1158 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 20 to 123 of FIG. 270 (SEQ ID NO: 375). It relates to an isolated PRO1158 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises the sequence from amino acid residue 20 to about 123 of Figure 270 (SEQ ID NO: 375), or a fragment thereof sufficient to provide a binding site for an anti-PRO1158 antibody. , Isolated PRO1158 polypeptide. Preferably, the PRO1158 fragment retains the qualitative biological activity of a native PRO1158 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1158 polypeptide having a sequence of about 20 to about 123 amino acid residues of FIG. 270 (SEQ ID NO: 375), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.

118. PRO1159
A cDNA clone (DNA60627-1508) encoding a novel secreted protein named “PRO1159” in this application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1159 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1159 polypeptide having a sequence of about 1 or about 16 to about 90 amino acid residues in FIG. 272 (SEQ ID NO: 377), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In another aspect, the invention provides an isolated PRO1159 polypeptide that comprises DNA that hybridizes to the complementary strand of nucleotides about 92 or about 137 to about 361 of FIG. 271 (SEQ ID NO: 376). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA60627-1508) of ATCC Deposit No. 203092, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203092 human protein cDNA (DNA60627-1508).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or about 16 to about 90 amino acid residues in FIG. 272 (SEQ ID NO: 377). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention provides at least 10 nucleotides and (a) a DNA encoding a PRO1159 polypeptide having a sequence of about 1 or about 16 to about 90 amino acid residues of FIG. 272 (SEQ ID NO: 377). The test DNA molecule is hybridized under stringent conditions with the molecule, or the complementary strand of the DNA molecule of (b) (a), and the DNA molecule is at least about 80% sequence identity to (a) or (b) Produced by isolating a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Related to isolated nucleic acid molecules.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1159 polypeptide with or without an N-terminal signal sequence and / or initiating methionine, or such code. Complementary to the activated nucleic acid molecule. The signal peptide was tentatively identified as extending from about amino acid position 1 to about amino acid position 15 in FIG. 272 (SEQ ID NO: 377).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 272 (SEQ ID NO: 377) or the amino acid sequence from about 16 to about 90 An isolated nucleic acid comprising a DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of the DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1159 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 271 (SEQ ID NO: 376).
In another embodiment, the present invention provides an isolated PRO1159 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the invention provides isolated native sequence PRO1159 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 16 to about 90 of FIG. 272 (SEQ ID NO: 377). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 16 to about 90 in FIG. 272 (SEQ ID NO: 377). It relates to an isolated PRO1159 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 or the amino acid sequence from about 16 to about 90 in FIG. 272 (SEQ ID NO: 377). Relates to an isolated PRO1159 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides amino acid residue 1 of FIG. 272 (SEQ ID NO: 377) or a sequence from about 16 to about 90, or a fragment thereof sufficient to provide a binding site for an anti-PRO1159 antibody. An isolated PRO1159 polypeptide comprising. Preferably, the PRO1159 fragment retains the qualitative biological activity of a native PRO1159 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1159 polypeptide having a sequence of about 1 or about 16 to about 90 amino acid residues of FIG. 272 (SEQ ID NO: 377), Or (b) a test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A host cell comprising a test DNA molecule is cultured below, and (iii) recovering the polypeptide from the cell culture provides a polypeptide to be produced.

119. PRO1124
A cDNA clone (DNA60629-1481) having sequence identity with a chloride ion channel protein and lung-endothelial cell adhesion molecule-1 (EAM-1) encoding a novel secreted protein named “PRO1124” in the present application Identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1124 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1124 polypeptide having a sequence of about 1 or 22 to about 919 of amino acid residues in FIG. 274 (SEQ ID NO: 379), or (b) ( a) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% to the complementary strand of the DNA molecule of a). % DNA with sequence identity. As used herein, “or”, ie 1 or 22 and 25 or 88, is used to describe two alternative embodiments. For example, the invention includes amino acids 1 to 919, and in other embodiments, amino acids 22 to 919, etc. are provided.
In another aspect, the invention provides an isolated encoding a PRO1124 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about 25 or 88 to about 2781 of FIG. 273 (SEQ ID NO: 378). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by human protein cDNA (DNA60629-1481) of ATCC Deposit No. 209799, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 2099779 human protein cDNA (DNA60629-1481).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity with the sequence from about 1 or 22 to about 919 of FIG. 274 (SEQ ID NO: 379), preferably at least about 85%. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1124 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain A deletion or inactivation variant is provided or is complementary to the encoding nucleic acid molecule. The cytoplasmic tail can also be excluded. The signal peptide has been experimentally identified as extending from amino acid position 1 to about amino acid position 21 in the sequence of FIG. 274 (SEQ ID NO: 379). The transmembrane domain has been experimentally identified as extending from amino acid position 284 to amino acid position 300 and from amino acid position 617 to amino acid position 633 of the amino acid sequence (FIG. 274, SEQ ID NO: 379).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 or 22 to about 919 of FIG. 274 (SEQ ID NO: 379). More preferably, an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or a complementary strand of the DNA of (a).
In other embodiments, the invention provides an isolated PRO1124 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the invention provides isolated native sequence PRO1124 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 22 to 919 of FIG. 274 (SEQ ID NO: 379). Yes.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence, relative to the sequence from amino acid residue 1 or 22 to about 919 of FIG. 274 (SEQ ID NO: 379). It relates to an isolated PRO1124 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least when compared to the amino acid sequence of residues 1 or 22 to 919 of FIG. 274 (SEQ ID NO: 379). It relates to an isolated PRO1124 polypeptide comprising an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1124 polypeptide having a sequence of about 1 or 22 to about 919 amino acid residues of FIG. 274 (SEQ ID NO: 379), or (B) hybridizing a test DNA molecule under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); (Ii) under conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. (Iii) culturing a host cell comprising the test DNA molecule and (iii) recovering the polypeptide from the cell culture to provide a polypeptide to be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1124 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1124 antibody.
In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1124 polypeptide by contacting the native PRO1124 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1124 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

120. PRO1287
A cDNA clone (DNA61755-1554) having homology to a nucleic acid encoding a fringe protein encoding a novel polypeptide named “PRO1287” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1287 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1287 polypeptide having a sequence of about 1 or about 28 to about 532 of amino acid residues in FIG. 276 (SEQ ID NO: 381), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In another aspect, the invention provides an isolated PRO1287 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about nucleotide 655 or about 736 to about 2250 of FIG. 275 (SEQ ID NO: 380). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA61755-1554) of ATCC Deposit No. 203112, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203112 human protein cDNA (DNA61755-1554).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with the sequence from about 1 or about 28 to about 532 amino acid residues in FIG. 276 (SEQ ID NO: 381). A DNA encoding a polypeptide having a sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complementary strand of the DNA of (a) It relates to an isolated nucleic acid molecule comprising.
In a further aspect, the present invention encodes a PRO1287 polypeptide having at least 100 nucleotides and having (a) the sequence of 1 or about 28 to about 532 amino acid residues of FIG. 276 (SEQ ID NO: 381). A DNA molecule or (b) a complementary strand of the DNA molecule of (a) is hybridized with the test DNA molecule under stringent conditions so that the DNA molecule is at least about 80% of the sequence relative to (a) or (b) By isolating the test DNA molecule if it has identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity Relates to the isolated nucleic acid molecule produced.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1287 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or an encoding nucleic acid thereof Complementary to the molecule. The signal peptide has been experimentally identified as extending from amino acid position 1 to about amino acid position 27 of the sequence of FIG. 276 (SEQ ID NO: 381).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 276 (SEQ ID NO: 381) or the amino acid sequence from about 28 to about 532 An isolated nucleic acid comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1287 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, 275 (SEQ ID NO: 380) can be taken from the nucleotide sequence shown.
In another embodiment, the present invention provides an isolated PRO1287 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the present invention provides isolated native sequence PRO1287 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 28 to about 532 of FIG. 276 (SEQ ID NO: 381). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 276 (SEQ ID NO: 381) or the sequence from about 28 to about 532. It relates to an isolated PRO1287 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 276 (SEQ ID NO: 381) or the amino acid sequence from about 28 to about 532 Relates to an isolated PRO1287 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides amino acid residue 1 of FIG. 276 (SEQ ID NO: 381) or a sequence from about 28 to about 532, or a fragment thereof sufficient to provide a binding site for an anti-PRO1287 antibody. An isolated PRO1287 polypeptide comprising. Preferably, the PRO1287 fragment retains the qualitative biological activity of a native PRO1287 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1287 polypeptide having a sequence of about 1 or about 28 to about 532 amino acid residues of FIG. 276 (SEQ ID NO: 381), Or (b) a test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A host cell comprising a test DNA molecule is cultured below, and (iii) recovering the polypeptide from the cell culture provides a polypeptide to be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1287 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1287 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1287 polypeptide by contacting the native PRO1287 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1287 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

121. PRO1312
A cDNA clone (DNA61883-1574) encoding a novel transmembrane polypeptide designated “PRO1312” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1312 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1312 polypeptide having a sequence of about 15 to about 212 amino acid residues of FIG. 278 (SEQ ID NO: 387), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1312 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 49 to about 642 of FIG. 277 (SEQ ID NO: 386). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC deposit no. 203132 (DNA61883-1574), or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203132 (DNA61883-1574).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 15 to about 212 amino acid residues in FIG. 278 (SEQ ID NO: 387). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the present invention comprises at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) a sequence of about 15 to about 212 amino acid residues of FIG. 278 (SEQ ID NO: 387). A DNA molecule that encodes a PRO1312 polypeptide, or (b) a complementary strand of the DNA molecule of (a) and a test DNA molecule that hybridizes under stringent conditions, and the DNA molecule is against (a) or (b) A test DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule that is produced by isolating the molecule.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1312 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie, transmembrane domain A deletion or inactivation variant is provided or is complementary to the encoding nucleic acid molecule. The signal peptide has been experimentally identified as extending from amino acid position 1 to about amino acid position 14 of the sequence of FIG. 278 (SEQ ID NO: 387). The transmembrane domain has been experimentally identified as extending from amino acid position 141 to about amino acid position 160 of the PRO1312 amino acid sequence (Figure 278, SEQ ID NO: 387).
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 15 to about 212 in FIG. 278 (SEQ ID NO: 387). Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1312 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the present invention provides an isolated PRO1312 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1312 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 15 to 212 of FIG. 278 (SEQ ID NO: 387).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 15 to about 212 in FIG. 278 (SEQ ID NO: 387). More preferably, an isolated PRO1312 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 15 to 212 of FIG. 278 (SEQ ID NO: 387). It relates to an isolated PRO1312 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention comprises the sequence of amino acid residues 15 to about 212 of FIG. 278 (SEQ ID NO: 387), or a fragment thereof sufficient to provide a binding site for an anti-PRO1312 antibody. Relates to an isolated PRO1312 polypeptide. Preferably, the PRO1312 fragment retains the qualitative biological activity of a native PRO1312 polypeptide.
In yet a further aspect, the present invention provides (i) (a) a DNA molecule encoding a PRO1312 polypeptide having a sequence of about 15 to about 212 amino acid residues of FIG. 278 (SEQ ID NO: 387), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.

122. PRO1192
A cDNA clone (DNA62814-1521) was identified that encodes a novel polypeptide having homology to the myelin P0 protein, designated “PRO1192” in this application.
In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1192 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1192 polypeptide having a sequence of about 22 to about 215 amino acid residues of FIG. 280 (SEQ ID NO: 389), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity. In another aspect, the invention provides an isolated nucleic acid encoding a PRO1192 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 184 to about 764 of FIG. 279 (SEQ ID NO: 388). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by human protein cDNA (DNA62814-1521) of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203093 human protein cDNA (DNA62814-1521).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 22 to about 215 amino acid residues of FIG. 280 (SEQ ID NO: 389). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the present invention has at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) PRO1192 having the sequence from about 22 to about 215 amino acid residues of FIG. 280 (SEQ ID NO: 389). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolation.
In a particular aspect, the invention relates to an isolated nucleic acid molecule comprising DNA encoding a PRO1192 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Deletion or inactivation variants are provided, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 21 in the sequence of FIG. 280 (SEQ ID NO: 389). The transmembrane domain has been tentatively identified as extending from about amino acid position 153 to about amino acid position 176 of the PRO 1192 amino acid sequence (FIG. 280, SEQ ID NO: 389).
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 22 to about 215 of FIG. 280 (SEQ ID NO: 389), and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1192 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1192 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1192 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 22 to 215 of FIG. 280 (SEQ ID NO: 389).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 22 to about 215 of FIG. 280 (SEQ ID NO: 389). More preferably, an isolated PRO1192 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 22 to 215 of FIG. 280 (SEQ ID NO: 389). Pertaining to an isolated PRO1192 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated PRO1192 polypeptide having a sequence of 22 to about 215 amino acid residues in FIG. 280 (SEQ ID NO: 389), or a binding site for an anti-PRO1192 antibody. About enough of that fragment. Preferably, the PRO1192 fragment retains the qualitative biological activity of a native PRO1192 polypeptide.
In yet a further aspect, the present invention provides (i) (a) a DNA molecule encoding a PRO1192 polypeptide having a sequence of about 22 to about 215 amino acid residues of FIG. 280 (SEQ ID NO: 389), or (b) A test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule of (a) such that the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least (Ii) a test DNA under conditions suitable for expression of a polypeptide if it has about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Culturing a host cell comprising the molecule and (iii) recovering the polypeptide from the cell culture provides a polypeptide to be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1192 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1192 antibody.
In a further embodiment, the invention relates to a method for identifying agonists or antagonists of a native PRO1192 polypeptide by contacting the native PRO1192 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1192 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

123. PRO1160
A cDNA clone (DNA62872-1509) encoding a novel secreted polypeptide named “PRO1160” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1160 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1160 polypeptide having a sequence of about 1 or about 20 to about 90 amino acid residues in FIG. 282 (SEQ ID NO: 394), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 90%, to the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In other embodiments, the invention provides an isolated encoding for a PRO1160 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about nucleotide 40 or about 97 to about 309 of FIG. 282 (SEQ ID NO: 394). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA62872-1509) of ATCC Deposit No. 203100, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203100 human protein cDNA (DNA62872-1509).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 282 (SEQ ID NO: 394) or the sequence from about 20 to about 90 DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the invention relates to a DNA encoding a PRO1160 polypeptide having at least about 100 nucleotides and having (a) amino acid residue 1 of FIG. 282 (SEQ ID NO: 394) or a sequence of about 20 to about 90 The test DNA molecule is hybridized under stringent conditions with the molecule, or the complementary strand of the DNA molecule of (b) (a), and the DNA molecule is at least about 80% sequence identity to (a) or (b) Produced by isolating a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Related to isolated nucleic acid molecules.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1160 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 19 of the sequence of FIG. 282 (SEQ ID NO: 394).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 282 (SEQ ID NO: 394) or the amino acid sequence from about 20 to about 90 An isolated nucleic acid comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1160 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long, It can be extracted from the nucleotide sequence shown in 281 (SEQ ID NO: 393).
In another embodiment, the present invention provides an isolated PRO1160 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the present invention provides isolated native sequence PRO1160 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 20 to about 90 of FIG. 282 (SEQ ID NO: 394). Contains.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 20 to about 90 in FIG. 282 (SEQ ID NO: 394). It relates to an isolated PRO1160 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 or the amino acid sequence from about 20 to about 90 in FIG. 282 (SEQ ID NO: 394). Relates to an isolated PRO1160 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention relates to an isolated PRO1160 polypeptide having a sequence of 1 or about 20 to about 90 amino acid residues of FIG. 282 (SEQ ID NO: 394), or a binding site for an anti-PRO1160 antibody About that fragment enough to provide. Preferably, the PRO1160 fragment retains the qualitative biological activity of a native PRO1160 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1160 polypeptide having a sequence of about 1 or about 20 to about 90 amino acid residues of FIG. 282 (SEQ ID NO: 394), or (B) hybridizing a test DNA molecule under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b); (Ii) under conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. (Iii) culturing a host cell comprising the test DNA molecule and (iii) recovering the polypeptide from the cell culture to provide a polypeptide to be produced.

124. PRO1187
A cDNA clone (DNA62876-1517), named “PRO1187” in the present application, encoding a novel polypeptide having sequence identity with endo-β-1,4-xylanase has been identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1187 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1187 polypeptide having a sequence of about 18 to about 120 amino acid residues of FIG. 284 (SEQ ID NO: 399), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1187 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 172 to about 480 of FIG. 283 (SEQ ID NO: 398). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203095 (DNA62876-1517), or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203095 human protein cDNA (DNA62876-1517).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 18 to about 120 amino acid residues in FIG. 284 (SEQ ID NO: 399). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the invention provides PRO1187 having at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) having a sequence of about 18 to about 120 amino acid residues of FIG. 284 (SEQ ID NO: 399). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolating.
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 18 to about 120 of FIG. 284 (SEQ ID NO: 399). Preferably, it relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or a complementary strand of the DNA of (a).
Other embodiments relate to fragments of the PRO1187 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1187 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1187 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 18 to 120 of FIG. 284 (SEQ ID NO: 399).
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 18 to about 120 in FIG. 284 (SEQ ID NO: 399). More preferably, an isolated PRO1187 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 18 to 120 of FIG. 284 (SEQ ID NO: 399). Pertaining to an isolated PRO1187 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated PRO1187 polypeptide having a sequence from amino acid residue 18 to about 120 of FIG. 284 (SEQ ID NO: 399), or a binding site for an anti-PRO1187 antibody. About that fragment enough. Preferably, the PRO1187 fragment retains the qualitative biological activity of a native PRO1187 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1187 polypeptide having a sequence of about 18 to about 120 amino acid residues of FIG. 284 (SEQ ID NO: 399), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1187 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1187 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1187 polypeptide by contacting the native PRO1187 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1187 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

125. PRO1185
In the present application, a cDNA clone (DNA62881-1515) was identified which was named “PRO1185” and encodes a novel polypeptide having sequence identity with the glucose suppression regulatory protein tupl.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1185 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1185 polypeptide having a sequence of about 22 to about 198 amino acid residues of FIG. 286 (SEQ ID NO: 401), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1185 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 67 to about 597 of FIG. 285 (SEQ ID NO: 400). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA62881-1515) of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203096 human protein cDNA (DNA62881-1515).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 22 to about 198 amino acid residues in FIG. 286 (SEQ ID NO: 401). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the present invention has at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) PRO1185 having a sequence of about 22 to about 198 amino acid residues of FIG. 286 (SEQ ID NO: 401). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolating.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 22 to about 198 of FIG. 286 (SEQ ID NO: 401) Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1185 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the invention provides an isolated PRO1185 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the invention provides isolated native sequence PRO1185 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 22 through 198 of FIG. 286 (SEQ ID NO: 401).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity, to the sequence from amino acid residue 22 to about 198 of FIG. 286 (SEQ ID NO: 401). More preferably, an isolated PRO1185 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 22 to 198 of FIG. 286 (SEQ ID NO: 401). Pertaining to an isolated PRO1185 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated PRO1185 polypeptide having the sequence of amino acid residue 22 to about 198 of FIG. 286 (SEQ ID NO: 401), or a binding site for an anti-PRO1185 antibody. Relating to its fragments enough. Preferably, the PRO1185 fragment retains the qualitative biological activity of a native PRO1185 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1185 polypeptide having a sequence of about 22 to about 198 amino acid residues of FIG. 286 (SEQ ID NO: 401), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1185 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1185 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1185 polypeptide by contacting the native PRO1185 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1185 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

126. PRO1345
A cDNA clone (DNA64852-1589) was identified that encodes a novel polypeptide having homology to a nucleic acid encoding tetranectin protein, designated “PRO1345” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1345 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1345 polypeptide having a sequence of about 1 or about 32 to about 206 of amino acid residues in FIG. 288 (SEQ ID NO: 403), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In other aspects, the invention provides an isolated encoding a PRO1345 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide about 7 or about 100 to about 624 of FIG. 287 (SEQ ID NO: 402). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA64852-1589) of ATCC Deposit No. 203127, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203127 (DNA64852-1589).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 of FIG. 288 (SEQ ID NO: 403) or the sequence from about 32 to about 206. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the invention encodes a PRO1345 polypeptide having at least about 100 nucleotides and having (a) from about 1 or about 32 to about 206 of the amino acid residue of FIG. 288 (SEQ ID NO: 403). A DNA molecule, or (b) a test DNA molecule is hybridized under stringent conditions with a complementary strand of the DNA molecule of (a) and the DNA molecule is at least about 80% identical to (a) or (b) By isolating a test DNA molecule if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule that is produced.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1345 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 or amino acid 10 to about amino acid position 31 in the sequence of FIG. 288 (SEQ ID NO: 403).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of FIG. 288 (SEQ ID NO: 403) or the amino acid sequence from about 32 to about 206. An isolated nucleic acid comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1345 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, It can be extracted from the nucleotide sequence shown in 287 (SEQ ID NO: 402).
In another embodiment, the present invention provides an isolated PRO1345 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the present invention provides an isolated native sequence PRO1345 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 32 to about 206 of FIG. 288 (SEQ ID NO: 403). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 or the sequence from about 32 to about 206 in FIG. 288 (SEQ ID NO: 403). It relates to an isolated PRO1345 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 288 (SEQ ID NO: 403) or the amino acid sequence from about 32 to about 206. Relates to an isolated PRO1345 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides a binding site for amino acid residue 1 of FIG. 288 (SEQ ID NO: 403) or an isolated PRO1345 polypeptide having a sequence of about 32 to about 206, or an anti-PRO1345 antibody. About enough of that fragment to provide. Preferably, the PRO1345 fragment retains the qualitative biological activity of a native PRO1345 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1345 polypeptide having a sequence of about 1 or about 32 to about 206 amino acid residues of FIG. 288 (SEQ ID NO: 403), Or (b) the test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A host cell comprising a test DNA molecule is cultured below, and (iii) recovering the polypeptide from the cell culture provides a polypeptide to be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1345 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1345 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1345 polypeptide by contacting the native PRO1345 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1345 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

127. PRO1245
A cDNA clone (DNA64888-1527) encoding a novel secreted polypeptide, designated “PRO1245” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1245 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1245 polypeptide having a sequence of about 19 to about 104 amino acid residues of FIG. 290 (SEQ ID NO: 408), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1245 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 133 to about 390 of FIG. 289 (SEQ ID NO: 407). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA64888-1245) of ATCC Deposit No. 203155, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203155 human protein cDNA (DNA64888-1245).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 19 to about 104 amino acid residues in FIG. 290 (SEQ ID NO: 408). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the invention provides PRO1245 having at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) the sequence from about 19 to about 104 amino acid residues of FIG. 290 (SEQ ID NO: 408). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolating.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1245 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 18 of the sequence of FIG. 290 (SEQ ID NO: 408).
In other embodiments, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 19 to about 104 in FIG. 290 (SEQ ID NO: 408). Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1245 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1245 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the invention provides isolated native sequence PRO1245 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 19 through 104 of FIG. 290 (SEQ ID NO: 408).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 19 to about 104 in FIG. 290 (SEQ ID NO: 408). More preferably, an isolated PRO1245 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 19 to 104 of FIG. 290 (SEQ ID NO: 408). Pertaining to an isolated PRO1245 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated PRO1245 polypeptide having a sequence from amino acid residue 19 to about 104 of FIG. 290 (SEQ ID NO: 408), or a binding site for an anti-PRO1245 antibody. Relating to its fragments enough. Preferably, the PRO1245 fragment retains the qualitative biological activity of a native PRO1245 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1245 polypeptide having a sequence of about 19 to about 104 amino acid residues of FIG. 290 (SEQ ID NO: 408), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.

128. PRO1358
A cDNA clone (DNA64890-1612) was identified that encodes a novel polypeptide having sequence identity with RASP-1 designated “PRO1358” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1358 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1358 polypeptide having a sequence of about 19 to about 444 amino acid residues in FIG. 292 (SEQ ID NO: 410), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In other aspects, the invention provides an isolated nucleic acid encoding a PRO1358 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 140 to about 1417 of FIG. 292 (SEQ ID NO: 410). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA64890-1612) of ATCC Deposit No. 203131, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203131 human protein cDNA (DNA64890-1612).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 19 to about 444 of amino acid residues in FIG. 292 (SEQ ID NO: 410). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the present invention comprises PRO1358 having at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) the sequence from about 19 to about 444 amino acid residues of FIG. 292 (SEQ ID NO: 410). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolation.
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 19 to about 444 of FIG. 292 (SEQ ID NO: 410) Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1358 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 80 nucleotides in length to about 120 nucleotides in length.
In another embodiment, the invention provides an isolated PRO1358 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the invention provides isolated native sequence PRO1358 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 19 to 444 of FIG. 292 (SEQ ID NO: 410).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 19 to about 444 of FIG. 292 (SEQ ID NO: 410). More preferably, an isolated PRO1358 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 19 to 444 of FIG. 292 (SEQ ID NO: 410). Pertaining to an isolated PRO1358 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention relates to an isolated PRO1358 polypeptide having the sequence from amino acid residue 19 to about 444 of FIG. 292 (SEQ ID NO: 410), or an anti-PRO1358 antibody specific thereto. It relates to fragments thereof sufficient to provide a binding site. Preferably, the PRO1358 fragment retains the qualitative biological activity of a native PRO1358 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1358 polypeptide having a sequence of about 19 to about 444 amino acid residues of FIG. 292 (SEQ ID NO: 410), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1358 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1358 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1358 polypeptide by contacting the native PRO1358 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1358 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

129. PRO1195
A cDNA clone (DNA65412-1523) was identified that encodes a novel polypeptide, named “PRO1195” in the present application, that has sequence identity with the mouse proline-rich acidic protein.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1195 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1195 polypeptide having a sequence from about 23 to about 151 amino acid residues in FIG. 294 (SEQ ID NO: 412), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity. In another aspect, the invention provides an isolated nucleic acid encoding a PRO1195 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 124 to about 510 of FIG. 293 (SEQ ID NO: 411). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA65412-1523) of ATCC Deposit No. 203094, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by human protein cDNA (DNA65412-1523) at ATCC Deposit No. 203094.
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 23 to about 151 amino acid residues in FIG. 294 (SEQ ID NO: 412). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the invention provides PRO1195 having at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) having the sequence from about 23 to about 151 amino acid residues of FIG. 294 (SEQ ID NO: 412). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolation.
In another aspect, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 23 to about 151 in FIG. 294 (SEQ ID NO: 412), and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1195 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In other embodiments, the present invention provides an isolated PRO1195 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1195 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 23 to 151 of FIG. 294 (SEQ ID NO: 412).
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 23 to about 151 in FIG. 294 (SEQ ID NO: 412). More preferably, an isolated PRO1195 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 23 to 151 of FIG. 294 (SEQ ID NO: 412). Pertaining to an isolated PRO1195 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1195 polypeptide having a sequence of about 23 to about 151 amino acid residues of FIG. 294 (SEQ ID NO: 412), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1195 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1195 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1195 polypeptide by contacting the native PRO1195 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1195 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

130. PRO1270
A cDNA clone (DNA66308-1537) has been identified which encodes a novel polypeptide and is homologous to a nucleic acid encoding a lectin protein, designated “PRO1270” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1270 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1270 polypeptide having a sequence of about 1 or about 17 to about 313 of amino acid residues in FIG. 296 (SEQ ID NO: 414), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In another aspect, the invention provides an isolated PRO1270 polypeptide that comprises DNA that hybridizes to the complementary strand of nucleotide from about nucleotide 103 or about 151 to about 1041 of FIG. 295 (SEQ ID NO: 413). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA66308-1537) of ATCC Deposit No. 203159, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203159 (DNA66308-1537).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 in FIG. 296 (SEQ ID NO: 414) or the sequence from about 17 to about 313. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the invention relates to a DNA encoding a PRO1270 polypeptide having at least 285 nucleotides and (a) having the sequence of about 1 or about 17 to about 313 of amino acid residues in FIG. 296 (SEQ ID NO: 414) The test DNA molecule is hybridized under stringent conditions with the molecule, or the complementary strand of the DNA molecule of (b) (a), and the DNA molecule is at least about 80% sequence identity to (a) or (b) Produced by isolating a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. Related to isolated nucleic acid molecules.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1270 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 16 of the sequence of FIG. 296 (SEQ ID NO: 414).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 296 (SEQ ID NO: 414) or the amino acid sequence from about 17 to about 313 An isolated nucleic acid comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1270 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, It can be extracted from the nucleotide sequence shown in 295 (SEQ ID NO: 413).
In other embodiments, the present invention provides an isolated PRO1270 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1270 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or about 17 to about 313 of FIG. 296 (SEQ ID NO: 414). Contains.
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 in FIG. 296 (SEQ ID NO: 414) or the sequence from about 17 to about 313. It relates to an isolated PRO1270 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 296 (SEQ ID NO: 414) or the amino acid sequence from about 17 to about 313. Relates to an isolated PRO1270 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides a binding site for amino acid residue 1 of FIG. 296 (SEQ ID NO: 414) or an isolated PRO1270 polypeptide having a sequence of about 17 to about 313, or an anti-PRO1270 antibody. About enough of that fragment to provide. Preferably, the PRO1270 fragment retains the qualitative biological activity of a native PRO1270 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1270 polypeptide having a sequence of about 1 or about 17 to about 313 amino acid residues of FIG. 296 (SEQ ID NO: 414), Or (b) the test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A host cell comprising a test DNA molecule is cultured below, and (iii) recovering the polypeptide from the cell culture provides a polypeptide to be produced.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1270 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1270 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1270 polypeptide by contacting the native PRO1270 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1270 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

131. PRO1271
A cDNA clone (DNA66309-1538) encoding a novel polypeptide with serine and threonine rich regions, designated “PRO1271” in this application, was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1271 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1271 polypeptide having a sequence of about 32 to about 208 amino acid residues of FIG. 298 (SEQ ID NO: 416), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1271 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 187 to about 717 of FIG. 297 (SEQ ID NO: 415). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA66309-1538) of ATCC Deposit No. 203235, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203235 (DNA66309-1538).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from amino acid residue 32 to about 208 in FIG. 298 (SEQ ID NO: 416). More preferably an isolated DNA comprising a polypeptide encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a) Relates to nucleic acid molecules.
In a further aspect, the invention comprises PRO1271 having at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) having a sequence of about 32 to about 208 amino acid residues of FIG. 298 (SEQ ID NO: 416). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolation.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1271 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain Deletion or inactivation variants are provided, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 31 in the sequence of FIG. 298 (SEQ ID NO: 416). The transmembrane domain has been tentatively identified as extending from about amino acid position 166 to about amino acid position 187 of the PRO1271 amino acid sequence (FIG. 298, SEQ ID NO: 416).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 32 to about 208 of FIG. 298 (SEQ ID NO: 416), and more Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1271 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1271 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1271 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 32 to 208 of FIG. 298 (SEQ ID NO: 416).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 32 to about 208 in FIG. 298 (SEQ ID NO: 416). More preferably, an isolated PRO1271 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 32 to 208 of FIG. 298 (SEQ ID NO: 416). Pertaining to an isolated PRO1271 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated PRO1271 polypeptide having a sequence from amino acid residue 32 to about 208 of FIG. 298 (SEQ ID NO: 416), or a binding site for an anti-PRO1271 antibody. About that fragment enough. Preferably, the PRO1271 fragment retains the qualitative biological activity of a native PRO1271 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1271 polypeptide having a sequence of about 32 to about 208 amino acid residues of FIG. 298 (SEQ ID NO: 416), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet other embodiments, the invention relates to agonists and antagonists of native PRO1271 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1271 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1271 polypeptide by contacting the native PRO1271 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1271 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

132. PRO1375
A cDNA clone (DNA67004-1614) was identified that encodes a novel polypeptide having sequence identity with PUT2, designated “PRO1375” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1375 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1375 polypeptide having a sequence of about 1 to about 198 amino acid residues in Figure 300 (SEQ ID NO: 418), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1375 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from residue 104 to about 697 of FIG. 299 (SEQ ID NO: 417). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA6704-1614) of ATCC Deposit No. 203115, or (b) the complementary strand of the DNA molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203115 human protein cDNA (DNA6704-1614).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 198 amino acid residues in Figure 300 (SEQ ID NO: 418). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the invention comprises PRO1375 having at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) having a sequence from about 1 to about 198 amino acid residues in Figure 300 (SEQ ID NO: 418). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolation.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1375 polypeptide, a soluble form thereof, ie, a transmembrane domain deletion or inactivation mutant, or such Complementary to the encoding nucleic acid molecule. Transmembrane domains have been tentatively identified as amino acid positions about 11-28 (type II) and 103-125 of SEQ ID NO: 418.
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 to about 198 of FIG. 300 (SEQ ID NO: 418). Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1375 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the invention provides an isolated PRO1375 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In certain aspects, the invention provides isolated native sequence PRO1375 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 198 of Figure 300 (SEQ ID NO: 418).
In other embodiments, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 198 of FIG. 300 (SEQ ID NO: 418). More preferably, an isolated PRO1375 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 1 to 198 of FIG. 300 (SEQ ID NO: 418). Pertaining to an isolated PRO1375 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated PRO1375 polypeptide having a sequence from amino acid residue 1 to about 198 of Figure 300 (SEQ ID NO: 418), or a binding site for an anti-PRO1375 antibody. About that fragment enough. Preferably, the PRO1375 fragment retains the qualitative biological activity of a native PRO1375 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1375 polypeptide having a sequence of about 1 to about 198 amino acid residues of Figure 300 (SEQ ID NO: 418), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet another embodiment, the invention relates to agonists and antagonists of native PRO1375 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1375 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1375 polypeptide by contacting the native PRO1375 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1375 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

133. PRO1385
A cDNA clone (DNA68869-1610) was identified that encodes a novel secreted polypeptide termed “PRO1385” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1385 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1385 polypeptide having a sequence of about 1 or about 29 to about 128 amino acid residues in FIG. 302 (SEQ ID NO: 420), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In another aspect, the invention provides an isolated encoding a PRO1385 polypeptide comprising DNA that hybridizes to the complementary strand of nucleotide about 26 or about 110 to about 409 of Figure 301 (SEQ ID NO: 419). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA68869-1610) of ATCC Deposit No. 203164, or (b) the complementary strand of the nucleic acid molecule of (a). DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC deposit no. 203164 human protein cDNA (DNA68869-1610).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 of FIG. 302 (SEQ ID NO: 420) or the sequence of about 29 to about 128. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention relates to a DNA molecule encoding a PRO1385 polypeptide having at least 245 nucleotides and having (a) amino acid residue 1 of Figure 302 (SEQ ID NO: 420) or a sequence of from about 29 to about 128. Or (b) hybridizing the test DNA molecule under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule has at least about 80% sequence identity to (a) or (b); Produced by isolating a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Isolated nucleic acid molecules.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1385 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, or such a code. Complementary to the activated nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 28 of the sequence of FIG. 302 (SEQ ID NO: 420).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 302 (SEQ ID NO: 420) or the amino acid sequence from about 29 to about 128. An isolated nucleic acid comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1385 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are from about 20 to about 80 nucleotides long, preferably from about 20 to about 60 nucleotides long, more preferably from about 20 to about 50 nucleotides long, most preferably from about 20 to about 40 nucleotides long, It can be extracted from the nucleotide sequence shown in 301 (SEQ ID NO: 419).
In another embodiment, the present invention provides an isolated PRO1385 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain aspects, the invention provides isolated native sequence PRO1385 polypeptide, which in one embodiment, comprises residue 1 of FIG. 302 (SEQ ID NO: 420) or an amino acid sequence comprising about 29 to about 128. Contains.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 302 (SEQ ID NO: 420) or the sequence from about 29 to about 128. It relates to an isolated PRO1385 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of FIG. 302 (SEQ ID NO: 420) or the amino acid sequence from about 29 to about 128. Relates to an isolated PRO1385 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides a binding site for amino acid residue 1 of FIG. 302 (SEQ ID NO: 420) or an isolated PRO1385 polypeptide having a sequence of about 29 to about 128, or an anti-PRO1385 antibody. About enough of that fragment to provide. Preferably, the PRO1385 fragment retains the qualitative biological activity of a native PRO1385 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1385 polypeptide having a sequence of about 1 or about 29 to about 128 amino acid residues of FIG. 302 (SEQ ID NO: 420); Or (b) the test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A host cell comprising a test DNA molecule is cultured below, and (iii) recovering the polypeptide from the cell culture provides a polypeptide to be produced.

134. PRO1387
A cDNA clone (DNA68872-1620) having homology to a nucleic acid encoding myelin encoding a novel secreted protein named “PRO1387” in the present application was identified.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1387 polypeptide.
In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1387 polypeptide having a sequence of about 1 or about 20 to about 394 amino acid residues in FIG. 304 (SEQ ID NO: 422), or (b) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about at least about the complementary strand of the DNA molecule of (a). DNA comprising 95% sequence identity.
In another aspect, the invention provides an isolated encoding a PRO1387 polypeptide comprising DNA that hybridizes to the complementary strand of nucleic acid from about nucleotide 85 or about 142 to about 1266 of FIG. 303 (SEQ ID NO: 421). Nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA68887-1620) of ATCC Deposit No. 203160, or (b) the complementary strand of the nucleic acid molecule of (a) DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by ATCC Deposit No. 203160 human protein cDNA (DNA68872-1620).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 of FIG. 304 (SEQ ID NO: 422) or the sequence from about 20 to about 394. DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) comprising the complementary strand of the DNA of (a) An isolated nucleic acid molecule comprising
In a further aspect, the present invention provides a DNA molecule encoding a PRO1387 polypeptide having at least 395 nucleotides and (a) amino acid residue 1 of Figure 304 (SEQ ID NO: 422) or the sequence of about 20 to about 394. Or (b) hybridizing the test DNA molecule under stringent conditions with the complementary strand of the DNA molecule of (a) so that the DNA molecule has at least about 80% sequence identity to (a) or (b); Produced by isolating a test DNA molecule, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Isolated nucleic acid molecules.
In certain aspects, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1387 polypeptide with or without an N-terminal signal sequence and / or initiation methionine, and its soluble, ie transmembrane domain, Deletions or inactivated variants are provided, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 19 in FIG. 304 (SEQ ID NO: 422). The transmembrane domain has been tentatively identified as extending from amino acid position 275 to about amino acid position 296 of the PRO1387 amino acid sequence (FIG. 304, SEQ ID NO: 422).
In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% when compared to residue 1 of Figure 304 (SEQ ID NO: 422) or the amino acid sequence from about 20 to about 394. An isolated nucleic acid comprising DNA encoding a polypeptide with a positive, more preferably at least about 90% positive, most preferably at least about 95% positive score, or (b) a complementary strand of DNA of (a) Concerning molecules.
Other embodiments relate to fragments of the PRO1387 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long, It can be extracted from the nucleotide sequence shown in 303 (SEQ ID NO: 421).
In another embodiment, the present invention provides an isolated PRO1387 polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In a particular aspect, the invention provides an isolated native sequence PRO1387 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 or about 20 to about 394 of Figure 304 (SEQ ID NO: 422). Contains.
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of FIG. 304 (SEQ ID NO: 422) or the sequence from about 20 to about 394. It relates to an isolated PRO1387 polypeptide comprising an amino acid sequence having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to residue 1 of Figure 304 (SEQ ID NO: 422) or the amino acid sequence from about 20 to about 394. Relates to an isolated PRO1387 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides a binding site for amino acid residue 1 of FIG. 304 (SEQ ID NO: 422) or an isolated PRO1387 polypeptide having a sequence of about 20 to about 394, or an anti-PRO1387 antibody. About enough of that fragment to provide. Preferably, the PRO1387 fragment retains the qualitative biological activity of a native PRO1387 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1387 polypeptide having a sequence of about 1 or about 20 to about 394 amino acid residues of FIG. 304 (SEQ ID NO: 422), Or (b) the test DNA molecule is hybridized under stringent conditions with the complementary strand of the DNA molecule of (a) so that the test DNA molecule has at least about 80% sequence identity to (a) or (b) (Ii) conditions suitable for expression of a polypeptide, preferably having at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. A host cell comprising a test DNA molecule is cultured below, and (iii) recovering the polypeptide from the cell culture provides a polypeptide to be produced.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1387 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1387 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1387 polypeptide by contacting the native PRO1387 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1387 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

135. PRO1384
A cDNA clone designated herein as “DNA71159” was identified that encodes a novel secreted protein having homology to the NKG2-D protein named “PRO1384” in this application.
In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1384 polypeptide.
In one aspect, the isolated nucleic acid comprises (a) a DNA molecule encoding a PRO1384 polypeptide having a sequence of about 1 to about 229 amino acid residues of FIG. 306 (SEQ ID NO: 424), or (b) (a) At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% relative to the complementary strand of It comprises DNA having sequence identity.
In another aspect, the invention provides an isolated nucleic acid encoding a PRO1384 polypeptide comprising DNA that hybridizes to the complementary strand of the nucleic acid from about 182 to about 868 of FIG. 305 (SEQ ID NO: 423). Concerning molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions.
In a further aspect, the present invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by human protein cDNA (DNA71159-1617) of ATCC deposit no. DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity An isolated nucleic acid molecule comprising In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203135 (DNA71159-1617).
In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 229 amino acid residues in FIG. 306 (SEQ ID NO: 424). Isolated, comprising a DNA encoding a polypeptide having a sex identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a complementary strand of the DNA of (a). Nucleic acid molecules.
In a further aspect, the present invention has at least about 50 nucleotides, preferably at least about 100 nucleotides, and (a) a PRO1384 having a sequence of about 1 to about 229 amino acid residues of FIG. 306 (SEQ ID NO: 424). A DNA molecule encoding a polypeptide, or (b) a test DNA molecule hybridized under stringent conditions with a complementary strand of the DNA molecule of (a), wherein the DNA molecule is at least about to (a) or (b) A test DNA molecule is tested if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule produced by isolation.
In certain aspects, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1384 polypeptide, wherein the transmembrane domain has been deleted or inactivated, or such encoding nucleic acid molecule Are complementary to each other. The transmembrane domain has been tentatively identified as extending from about amino acid position 32 to about amino acid position 57 of the PRO1384 amino acid sequence (FIG. 306, SEQ ID NO: 424).
In other embodiments, the present invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence from residue 1 to about 229 of FIG. 306 (SEQ ID NO: 424). Preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or (b) a complementary strand of DNA of (a).
Other embodiments relate to fragments of the PRO1384 polypeptide coding sequence that find use as hybridization probes. Such nucleic acid fragments are about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.
In another embodiment, the present invention provides an isolated PRO1384 polypeptide encoded by any of the isolated nucleic acid sequences described above.
In a particular aspect, the invention provides an isolated native sequence PRO1384 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to 229 of Figure 306 (SEQ ID NO: 424).
In another aspect, the invention provides at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 229 of FIG. 306 (SEQ ID NO: 424). More preferably, an isolated PRO1384 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 1 to 229 of FIG. 306 (SEQ ID NO: 424). Pertaining to an isolated PRO1384 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive.
In yet another aspect, the invention provides an isolated PRO1384 polypeptide having a sequence from amino acid residue 1 to about 229 of Figure 306 (SEQ ID NO: 424), or a binding site for an anti-PRO1384 antibody. Relating to its fragments enough. Preferably, the PRO1384 fragment retains the qualitative biological activity of a native PRO1384 polypeptide.
In yet a further aspect, the invention provides (i) (a) a DNA molecule encoding a PRO1384 polypeptide having a sequence of about 1 to about 229 amino acid residues of FIG. 306 (SEQ ID NO: 424), or (b ) Hybridizing the complementary strand of the DNA molecule of (a) with a test DNA molecule under stringent conditions, wherein the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably (Ii) tested under conditions suitable for expression of a polypeptide if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. A host cell comprising a DNA molecule is cultured and (iii) the polypeptide is recovered from the cell culture to provide the produced polypeptide.
In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1384 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1384 antibody.
In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1384 polypeptide by contacting the native PRO1384 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.
In yet a further embodiment, the invention relates to a composition comprising a PRO1384 polypeptide, or an agonist or antagonist as described above, together with a pharmaceutically acceptable carrier.

136. Further Embodiments In another embodiment of the invention, the present invention provides a vector comprising DNA encoding any of the above or below described polypeptides. Host cells comprising such vectors are also provided. By way of example, the host cell can be a CHO cell, E. coli, or yeast. Further provided is a method for producing any of the above or below described polypeptides, wherein the host cells are cultured under conditions suitable for expression of the desired polypeptide, and the desired polypeptide is obtained from the cell culture. Recovering.
In another embodiment, the invention provides a chimeric molecule comprising any of the above or below described polypeptides fused to a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include any of the above or below described polypeptides fused to an immunoglobulin Fc region or epitope tag sequence.
In other embodiments, the invention provides antibodies that specifically bind to any of the above or below described polypeptides. In some cases, the antibody is a monoclonal antibody, a humanized antibody, an antibody fragment or a single chain antibody.
In yet another embodiment, the present invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences, wherein these probes are taken from any of the nucleotide sequences described above or below. sell.
In another embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide.
In one aspect, an isolated nucleic acid molecule has (a) a full-length amino acid sequence disclosed herein, a full-length amino acid sequence lacking a signal peptide disclosed herein, or an extracellular domain of a transmembrane protein disclosed herein. At least about 80% sequence identity, preferably at least about 81% sequence identity, even more preferably, to a DNA molecule encoding a PRO polypeptide, or the complementary strand of a DNA molecule of (b) (a) At least about 82% sequence identity, even more preferably at least about 83% sequence identity, even more preferably at least about 84% sequence identity, even more preferably at least about 85% sequence identity, even more Preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more preferably At least about 88% sequence identity, even more preferably at least about 89% sequence identity, even more preferably at least about 90% acid sequence identity, even more preferably at least about 91% sequence identity; Even more preferably at least about 92% sequence identity, even more preferably at least about 93% sequence identity, even more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity. Even more preferably at least about 96% sequence identity, even more preferably at least about 97% sequence identity, even more preferably at least about 98% sequence identity, even more preferably at least about 99% sequence identity. It comprises a nucleotide sequence having sequence identity.
In other embodiments, the isolated nucleic acid molecule comprises (a) a coding sequence of a full-length PRO polypeptide cDNA disclosed herein, a coding sequence of a full-length PRO polypeptide cDNA that lacks a signal peptide disclosed herein, or a At least about 80% sequence identity, preferably at least about 81% sequence identity to the coding sequence of the extracellular domain of the disclosed transmembrane PRO polypeptide, or (b) the complementary strand of the DNA molecule of (a) Even more preferably at least about 82% sequence identity, even more preferably at least about 83% sequence identity, even more preferably at least about 84% sequence identity, even more preferably at least about 85% sequence identity. Sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence Identity, even more preferably at least about 88% sequence identity, even more preferably at least about 89% sequence identity, even more preferably at least about 90% acid sequence identity, even more preferably at least about 91 % Sequence identity, even more preferably at least about 92% sequence identity, even more preferably at least about 93% sequence identity, even more preferably at least about 94% sequence identity, even more preferably at least About 95% sequence identity, even more preferably at least about 96% sequence identity, even more preferably at least about 97% sequence identity, even more preferably at least about 98% sequence identity, even more preferred Comprises a nucleotide sequence having at least about 99% sequence identity.

In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATTC disclosed herein, or (b) of (a) At least about 80% sequence identity, preferably at least about 81% sequence identity, even more preferably at least about 82% sequence identity, even more preferably at least about 83%, relative to the complementary strand of the DNA molecule Sequence identity, even more preferably at least about 84% sequence identity, even more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about about 87% sequence identity, even more preferably at least about 88% sequence identity, even more preferably at least about 9% sequence identity, even more preferably at least about 90% acid sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92% sequence identity, even more preferred Is at least about 93% sequence identity, even more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, More preferably an isolation comprising a nucleotide sequence having at least about 97% sequence identity, even more preferably at least about 98% sequence identity, even more preferably at least about 99% sequence identity Nucleic acid molecules.
Another aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide in which the transmembrane domain is deleted or the transmembrane domain is inactivated, or Complementary to such coding nucleotide sequences, where the transmembrane domains of such polypeptides are disclosed herein. Accordingly, the soluble extracellular domains of the PRO polypeptides described herein are contemplated.
Other embodiments are PRO polypeptide coding sequences that find use, for example, to encode fragments of a PRO polypeptide that optionally encodes a polypeptide comprising a binding site as a hybridization probe or to an anti-PRO antibody. Related to fragments. Such nucleic acid fragments are usually at least about 20 nucleotides in length, preferably at least about 30 nucleotides in length, more preferably at least about 40 nucleotides in length, even more preferably at least about 50 nucleotides in length, even more Preferably at least about 60 nucleotides long, even more preferably at least about 70 nucleotides long, even more preferably at least about 80 nucleotides long, even more preferably at least about 90 nucleotides long, even more preferably At least about 100 nucleotides long, even more preferably at least about 110 nucleotides long, even more preferably at least about 120 nucleotides long, even more preferably at least about 130 nucleotides long, even more preferred At least about 140 nucleotides long, even more preferably at least about 150 nucleotides long, even more preferably at least about 160 nucleotides long, even more preferably at least about 170 nucleotides long, even more preferably at least about about 180 nucleotides long, even more preferably at least about 190 nucleotides long, even more preferably at least about 200 nucleotides long, even more preferably at least about 250 nucleotides long, even more preferably at least about 300 nucleotides long Nucleotide length, even more preferably at least about 350 nucleotide length, even more preferably at least about 400 nucleotide length, even more preferably at least about 450 nucleotide length, even more preferred Or at least about 500 nucleotides, even more preferably at least about 600 nucleotides, even more preferably at least about 700 nucleotides, even more preferably at least about 800 nucleotides, even more preferably At least about 900 nucleotides in length, even more preferably at least about 1000 nucleotides in length, where the term “about” means a reference nucleotide sequence length that is plus or minus 10% of its reference length To do. A novel fragment of a PRO polypeptide-encoding nucleotide sequence can be used to align a PRO polypeptide-encoding nucleotide sequence to other known nucleotide sequences using any of a number of well-known sequence alignment programs, which PRO polypeptide It is noted that this can be routinely determined by determining whether the coding nucleotide sequence fragment is novel. All such PRO polypeptide-encoding nucleotide sequences are contemplated herein. Also contemplated are PRO polypeptide fragments encoded by these nucleotide molecule fragments, preferably PRO polypeptide fragments comprising a binding site for an anti-PRO antibody.
In another embodiment, the invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In one aspect, the invention provides a PRO polypeptide having a full-length amino acid sequence disclosed herein, a full-length amino acid sequence lacking a signal peptide disclosed herein, or an extracellular domain of a transmembrane protein disclosed herein. At least about 80% sequence identity, preferably at least about 81% sequence identity, even more preferably at least about 82% sequence identity, even more preferably at least about 83% sequence identity, even more preferably At least about 84% sequence identity, even more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more Preferably at least about 88% sequence identity, even more preferably at least about 89% sequence identity. Even more preferably at least about 90% acid sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92% sequence identity, even more preferably at least about 93% Sequence identity, even more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, even more preferably at least about about It relates to an isolated PRO polypeptide comprising an amino acid sequence having 97% sequence identity, even more preferably at least about 98% sequence identity, even more preferably at least about 99% sequence identity.
In a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 81%, to an amino acid sequence encoded by any of the human protein cDNAs deposited with the ATTC disclosed herein. Sequence identity, even more preferably at least about 82% sequence identity, even more preferably at least about 83% sequence identity, even more preferably at least about 84% sequence identity, even more preferably at least about about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more preferably at least about 88% sequence identity, even more preferably At least about 89% sequence identity, even more preferably at least about 90% acid sequence identity, More preferably at least about 91% sequence identity, even more preferably at least about 92% sequence identity, even more preferably at least about 93% sequence identity, even more preferably at least about 94% sequence identity. Even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, even more preferably at least about 97% sequence identity, even more preferably at least about 98% sequence identity It relates to an isolated PRO polypeptide comprising an amino acid sequence having identity, more preferably at least about 99% sequence identity.
In a further aspect, the invention provides a full-length amino acid sequence disclosed herein, a full-length amino acid sequence lacking the signal peptide disclosed herein, or an amino acid sequence of a PRO polypeptide having an extracellular domain of a transmembrane protein disclosed herein. At least about 80% positive, preferably at least about 81% positive, more preferably at least about 82% positive, even more preferably at least about 83% positive, even more preferably at least about 84% Positive, even more preferably at least about 85% positive, even more preferably at least about 86% positive, even more preferably at least about 87% positive, even more preferably at least about 88% positive, even more preferred Little Both about 89% positive, even more preferably at least about 90% positive, even more preferably at least about 91% positive, even more preferably at least about 92% positive, even more preferably at least about 93% positive Even more preferably at least about 94% positive, even more preferably at least about 95% positive, even more preferably at least about 96% positive, even more preferably at least about 97% positive, even more preferably at least It relates to an isolated PRO polypeptide comprising an amino acid sequence that exhibits a positive score of about 98% positive, even more preferably at least about 99%.

In a particular aspect, the invention provides an isolated PRO polypeptide that does not have an N-terminal signal sequence and / or an initiation methionine, which is encoded by a nucleotide sequence that encodes such an amino acid sequence described above. Methods for producing it are also described herein, wherein these methods are used to cultivate a host cell comprising a vector containing a suitable encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide. Recovering the PRO polypeptide from the culture.
Another aspect of the invention provides an isolated PRO polypeptide in which the transmembrane domain is deleted or the transmembrane domain is inactivated. Methods for producing it are also described herein, wherein these methods are used to cultivate a host cell comprising a vector containing a suitable encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide. Recovering the PRO polypeptide from the culture.
In yet other embodiments, the invention relates to agonists and antagonists of the native PRO polypeptides identified herein. In a particular embodiment, the agonist or antagonist is an anti-PRO antibody or a small molecule.
In a further embodiment, the present invention relates to a method of identifying an agonist or antagonist of a PRO polypeptide, which comprises contacting the PRO polypeptide with a candidate molecule and monitoring biological activity mediated by said PRO polypeptide. including. Preferably, the PRO polypeptide is a native PRO polypeptide.
In yet a further embodiment, the invention relates to a composition of matter comprising a PRO polypeptide, or an agonist or antagonist of a PRO polypeptide described herein, or an anti-PRO antibody in combination with a carrier. In some cases, the carrier is a pharmaceutically acceptable carrier.
Another embodiment of the present invention provides a PRO polypeptide, or agonist or antagonist thereof, for the preparation of a medicament useful for the treatment of a condition responsive to the above-described PRO polypeptide, agonist or antagonist thereof or anti-PRO antibody Or the use of anti-PRO antibodies.

Detailed Description of Preferred Embodiments
I. Definitions As used herein, the terms “PRO polypeptide” and “PRO” refer to various polypeptides when immediately followed by a numerical sign, where the full sign (eg, PRO / number) Refers to the specific polypeptide sequence described. As used herein, “PRO / number polypeptide” and “PRO / number” include native sequence polypeptides and variants (as defined in more detail herein). The PRO polypeptides described herein may be isolated from a variety of sources, such as human tissue types or other sources, and may be prepared by recombinant or synthetic methods.
A “native sequence PRO polypeptide” includes a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide from nature. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. The term “native sequence PRO polypeptide” specifically includes naturally occurring truncated or secreted forms (eg, extracellular domain sequences), naturally occurring mutated forms (eg, alternatively spliced) of a particular PRO polypeptide. Form) and naturally occurring allelic variants of the polypeptide. In various embodiments of the invention, the native sequence PRO polypeptide disclosed herein is a mature or full-length native sequence polypeptide containing the full-length amino acid sequence shown in the associated figures. Start and stop codons are shown in the figure in bold typeface and underline. However, while the PRO polypeptide disclosed in the relevant figure is shown at amino acid position 1 in the figure to begin with a methionine residue, other polypeptides located either upstream or downstream of amino acid position 1 in the figure are shown. It is possible and possible that a methionine residue is used as the starting amino acid residue of a PRO polypeptide.

The PRO polypeptide “extracellular domain” or “ECD” means a form of a PRO polypeptide that is substantially free of transmembrane and cytoplasmic domains. Usually, PRO polypeptide ECD has less than 1% of their transmembrane and / or cytoplasmic domains, preferably less than 0.5% of such domains. It will be understood that any transmembrane domain identified for a PRO polypeptide of the invention is identified according to criteria routinely used in the art to identify that type of hydrophobic domain. . Although the exact boundaries of the transmembrane domain can vary, it is likely not to exceed about 5 amino acids from either end of the originally identified domain. Thus, the PRO polypeptide extracellular domain may optionally comprise no more than about 5 amino acids from either end of the transmembrane domain identified in the Examples or specifications and has a signal peptide for attachment. Such polypeptides without or with such nucleic acids and nucleic acids encoding them are contemplated in the present invention.
Appropriate positions for the “signal peptides” of the various PRO polypeptides disclosed herein are set forth herein and in the accompanying drawings. However, as noted, the C-terminal boundary of the signal peptide can vary, but is most likely less than about 5 amino acids on either side of the signal peptide C-terminal boundary as defined herein. High, the C-terminal boundary of a signal peptide can be identified according to criteria routinely used to identify such types of amino acid sequence components (eg, Nielsen et al., Prot. Eng. 10: 1-6). (1997) and von Heinje et al., Nucl. Acids. Res. 14: 4683-4690 (1986)). Furthermore, in some cases, it is also observed that cleavage of the signal peptide from the secreted polypeptide is not completely uniform, resulting in one or more secreted species. These mature polypeptides, and polynucleotides encoding them, which are cleaved within less than about 5 amino acids on either side of the C-terminal boundary of the signal peptide as defined herein, are contemplated in the present invention. The

  A “PRO polypeptide variant”, as defined above or below, is a full-length native sequence PRO polypeptide disclosed herein, a full-length native sequence PRO polypeptide sequence that lacks a signal peptide disclosed herein, a signal By an active PRO polypeptide having at least about 80% amino acid sequence identity with the extracellular domain of the PRO disclosed herein with or without the peptide or other fragments of the full-length PRO polypeptide disclosed herein. Such PRO polypeptide variants include, for example, PRO polypeptides in which one or more amino acid residues have been added or deleted at the N- or C-terminus of the full-length natural amino acid sequence. Typically, a PRO polypeptide variant is a full-length native amino acid sequence disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, or an extracellular domain of the PRO disclosed herein with or without a signal peptide. Or at least about 80% amino acid sequence identity, preferably at least about 81% amino acid sequence identity, more preferably at least about 82% amino acid sequence identity with other fragments of the full-length PRO polypeptide disclosed herein. More preferably at least about 83% amino acid sequence identity, more preferably at least about 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 86% amino acid sequence. Identity, more preferably at least about 87% amino acid sequence Identity, more preferably at least about 88% amino acid sequence identity, more preferably at least about 89% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, more preferably at least about 91%. Amino acid sequence identity, more preferably at least about 92% amino acid sequence identity, more preferably at least about 93% amino acid sequence identity, more preferably at least about 94% amino acid sequence identity, more preferably at least about 95 % Amino acid sequence identity, more preferably at least about 96% amino acid sequence identity, more preferably at least about 97% amino acid sequence identity, more preferably at least about 98% amino acid sequence identity, and more preferably Has at least about 99% amino acid sequence identity It is. Typically, a PRO variant polypeptide is at least about 10 amino acids long, more at least about 20 amino acids long, more at least about 30 amino acids long, more at least about 40 amino acids long, more at least about 50 amino acids long Long, more at least about 60 amino acids long, more at least about 70 amino acids long, more at least about 80 amino acids long, more at least about 90 amino acids long, more at least about 100 amino acids long, more It is at least about 150 amino acids long, more is at least about 200 amino acids long, more is at least about 300 amino acids long, or more.

  The “percent (%) amino acid sequence identity” identified herein for a PRO polypeptide as defined herein introduces gaps if necessary to align the sequences and obtain maximum percent sequence identity. And is defined as the percentage of amino acid residues in the candidate sequence that are identical to the amino acid residues of the PRO polypeptide, assuming that any conservative substitutions are not considered part of the sequence identity. Alignments for the purpose of determining percent amino acid sequence identity are publicly available such as various methods within the skill of the art, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software This can be achieved by using computer software. One skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximal alignment over the full length of the sequences being compared. However, for purposes herein,% amino acid sequence identity values can be obtained by using the sequence comparison program ALIGN-2, for which the complete source code for the ALIGN-2 program is provided in Table 1 below. Obtained. The ALIGN-2 sequence comparison computer program was created by Genentech, Inc., and the source code shown in Table 1 below was submitted to the US Copyright Office, Washington DC, 20559 along with the user documentation, with US copyright registration number TXU510087. Registered below. ALIGN-2 is preferably available from Genentech, South San Francisco, California, and may be compiled from the source code provided in Table 1 below. The ALIGN-2 program is compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

In situations where ALIGN-2 is used for amino acid sequence comparison,% amino acid sequence identity of a given amino acid sequence A with or against a given amino acid sequence B (or with a given amino acid sequence B, or In contrast, a given amino acid sequence A, which has or contains some% amino acid sequence identity), is calculated as follows:
100 times the fraction X / Y, where X is the number of amino acid residues with a score matched by A and B alignment of the sequence alignment program ALIGN-2, and Y is the total amino acid residue of B Is a number. It will be understood that if the length of amino acid sequence A is different from the length of amino acid sequence B, then the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A. As an example of calculating% amino acid sequence identity using this method, “PRO” represents the amino acid sequence of a hypothetical PRO polypeptide of interest, and “comparison protein” of interest is compared to the “comparison” protein of interest. And "X", "Y" and "Z" each represent a different hypothetical amino acid residue, and Tables 2 and 3 show the amino acid sequence "PRO" The calculation method of% amino acid sequence identity with respect to the amino acid sequence called "is shown.

  Unless otherwise noted, all% amino acid sequence identity values herein are obtained using the ALIGN-2 sequence comparison computer program as described above. However,% amino acid sequence identity values may be determined using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). In addition, most WU-BLAST-2 search parameters are set to initial values. Parameters that are not set to initial values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. For purposes herein,% amino acid sequence identity values are: (a) the amino acid sequence of the subject PRO polypeptide having a sequence derived from a native PRO polypeptide and the subject comparative amino acid sequence (ie, The number of identical identical amino acid residues determined by WU-BLAST-2 between the subject PRO polypeptide and the sequence that may be a PRO polypeptide variant to be compared) (b) Determined by the quotient divided by the total number of residues in the PRO polypeptide. For example, in the expression “polypeptide comprising amino acid sequence A having or having at least 80% amino acid sequence identity to amino acid sequence B”, amino acid sequence A is a comparative amino acid sequence of interest, Amino acid sequence B is the amino acid sequence of the target PRO polypeptide.

The% amino acid sequence identity may be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://ww.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search parameters, all of which are set to initial values, for example, unmask = possible, chain = all, predicted occurrence = 10, minimum low composite length = 15/5 Multipath e-value = 0.01, multipath constant = 25, final gap alignment dropoff = 25, and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is used for amino acid sequence comparison,% amino acid sequence identity of a given amino acid sequence A with or against a given amino acid sequence B (or with a given amino acid sequence B, or In contrast, a given amino acid sequence A, which has or contains some% amino acid sequence identity), is calculated as follows:
100 times the fraction X / Y, where X is the number of amino acid residues with a score matched by A and B alignment of the sequence alignment program NCBI-BLAST2, and Y is the total amino acid residue of B Is a number. It will be understood that if the length of amino acid sequence A is different from the length of amino acid sequence B, then the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A.

A “PRO variant polynucleotide” or “PRO variant nucleic acid sequence” is a nucleic acid molecule that encodes an active PRO polypeptide, as defined below, and a full-length native sequence PRO polypeptide sequence disclosed herein, A full-length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, an extracellular domain of the PRO polypeptide disclosed herein with or without a signal peptide, or any other fragment of the full-length PRO polypeptide sequence disclosed herein. Has at least 80% sequence identity with the encoding nucleic acid sequence. Typically, a PRO variant polypeptide nucleotide is a full-length native sequence PRO polypeptide sequence disclosed herein, a full-length native sequence PRO polypeptide sequence lacking a signal peptide disclosed herein, a PRO polypeptide disclosed herein with or without a signal peptide. At least about 80% nucleic acid sequence identity, preferably at least about 81% nucleic acid sequence identity with the nucleic acid sequence encoding the extracellular domain of the peptide, or any other fragment of the full-length PRO polypeptide disclosed herein, More preferably at least about 82% nucleic acid sequence identity, more preferably at least about 83% nucleic acid sequence identity, more preferably at least about 84% nucleic acid sequence identity, more preferably at least about 85% nucleic acid sequence identity. More preferably at least about 86% nucleic acid sequence identity, more preferred Is at least about 87% nucleic acid sequence identity, more preferably at least about 88% nucleic acid sequence identity, more preferably at least about 89% nucleic acid sequence identity, more preferably at least about 90% nucleic acid sequence identity; More preferably at least about 91% nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, more preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94% nucleic acid sequence identity. More preferably at least about 95% nucleic acid sequence identity, more preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably at least about 98% nucleic acid. It has sequence identity, and more preferably at least about 99% nucleic acid sequence identity. Variants do not contain the native nucleotide sequence.
Typically, a PRO variant polynucleotide is at least about 30 nucleotides in length, more is at least about 60 nucleotides in length, more is at least about 90 nucleotides in length, more is at least about 120 nucleotides in length, and more is at least about 150 nucleotides in length. Long, more at least about 180 nucleotides long, more at least about 210 nucleotides long, more at least about 240 nucleotides long, more at least about 270 nucleotides long, more at least about 300 nucleotides long, more It is at least about 450 nucleotides long, more is at least about 600 nucleotides long, more is at least about 900 nucleotides long, or more.

“Percent (%) nucleic acid sequence identity” relative to the PRO-encoding nucleic acid sequence identified herein introduces a gap if necessary to align the sequences and obtain maximum percent sequence identity, and Is defined as the percent of nucleotides in the candidate sequence that are identical. Alignments for the purpose of determining percent nucleic acid sequence identity can be obtained by various methods within the knowledge of those skilled in the art, such as publicly available computers such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. This can be achieved by using software. For purposes herein,% amino acid sequence identity values are obtained by using the sequence comparison program ALIGN-2, for which the complete source code for the ALIGN-2 program is provided in Table 1 below. . The ALIGN-2 sequence comparison computer program was created by Genentech, and the source code shown in Table 1 below is from the US Copyright Office,
Filed with user documentation in Washington DC, 20559 and registered under US copyright registration number TXU510087. ALIGN-2 is preferably available from Genentech, South San Francisco, California, and may be compiled from the source code provided in Table 1 below. The ALIGN-2 program is compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

In situations where ALIGN-2 is used for nucleic acid sequence comparisons, the given nucleic acid sequence C is in percent or identical to a given nucleic acid sequence D (or with a given amino acid sequence D, or In contrast, a given nucleic acid sequence C, which has or contains a certain percentage of nucleic acid sequence identity), is calculated as follows:
100 times the fraction W / Z, where W is the number of nucleic acid residues with a score matched by C and D alignment of the sequence alignment program ALIGN-2, and Z is the total nucleic acid residues of D Is a number.
It will be appreciated that if the length of nucleic acid sequence C is different from the length of amino acid sequence D, then the percent nucleic acid sequence identity of C to D is different from the percent nucleic acid sequence identity of D to C. As an example of calculating% nucleic acid sequence identity using this method, “PRO-DNA” represents a hypothetical PRO-encoding nucleic acid sequence of interest and “Comparative DNA” is a “PRO-DNA” nucleic acid molecule of interest. Represents the nucleic acid sequences being compared, and each of “N”, “L” and “V” represents a different hypothetical amino acid residue, and Tables 4 and 5 are referred to as “comparison DNA” 2 shows a method for calculating% nucleic acid sequence identity to a nucleic acid sequence referred to as “PRO-DNA”.

  Unless otherwise indicated, all% nucleic acid sequence identity values herein are obtained using the ALIGN-2 sequence comparison computer program as set forth in the immediately preceding paragraph. However,% nucleic acid sequence identity values may be determined using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). In addition, most WU-BLAST-2 search parameters are set to initial values. Parameters that are not set to initial values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When WU-BLAST-2 is used, the% nucleic acid sequence identity value is: (a) the nucleic acid sequence of the subject PRO polypeptide-encoding nucleic acid molecule having a sequence derived from a native sequence PRO polypeptide-encoding nucleic acid And a comparative nucleic acid sequence of interest (ie, a sequence that may be a PRO polypeptide variant to which the subject PRO polypeptide-encoding nucleic acid molecule is compared) determined by WU-BLAST-2 Determined by the quotient of the number of identical identical nucleic acid residues divided by (b) the total number of nucleotides of the subject PRO polypeptide-encoding nucleic acid molecule. For example, in the expression “polypeptide comprising nucleic acid sequence A having or having at least 80% nucleic acid sequence identity to nucleic acid sequence B”, nucleic acid sequence A is the target nucleic acid sequence, Nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest.

The% nucleic acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://www.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search parameters, all of which are set to initial values, for example, unmask = possible, chain = all, predicted occurrence = 10, minimum low composite length = 15/5 Multipath e-value = 0.01, multipath constant = 25, final gap alignment dropoff = 25, and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is used for nucleic acid sequence comparison, the% nucleic acid sequence identity of, or relative to, a given nucleic acid sequence C (or with a given nucleic acid sequence D, or In contrast, a given nucleic acid sequence C having or containing a certain percentage of nucleic acid sequence identity) may be calculated as follows:
100 times the fraction W / Z, where W is the number of nucleic acid residues with a score that is identical by the alignment of C and D of the sequence alignment program NCBI-BLAST2, and Z is the total number of nucleic acid residues of D Is a number. It will be appreciated that if the length of the nucleic acid sequence C is different from the length of the nucleic acid sequence D, then the% nucleic acid sequence identity of C to D is different from the% nucleic acid sequence identity of D to C.
In other embodiments, the PRO variant polypeptide nucleotide encodes an active PRO polypeptide and preferably hybridizes to the nucleotide sequence encoding the full-length PRO polypeptide disclosed herein under stringent hybridization and wash conditions. Nucleic acid molecule. The PRO variant polypeptide may be one encoded by a PRO variant polynucleotide.

The term “positive” refers to residues in the sequence comparison performed as described above that are not identical but have similar properties in the compared sequences (eg, conservative substitution results). As shown in Table 6 below. For purposes herein, positive% values are: (a) the amino acid sequence of the subject PRO polypeptide having a sequence derived from a native PRO polypeptide and the subject comparative amino acid sequence (ie, the PRO poly). (B) the number of amino acid residues that recorded a positive value in the BLOSUM62 matrix of WU-BLAST-2 (b) amino acid residues of the target PRO polypeptide Determined by the quotient divided by the total number of.
Unless otherwise noted,% positive values are calculated as described in the immediately preceding paragraph. Obtained using the WU-BLAST-2 computer program. However, amino acid sequence identity performed as described above for ALIGN-2 and NCBI-BLAST2 includes amino acid residues in sequences that have similar characteristics as well as identity. The amino acid residue that is positive for the target amino acid residue is the same as the target amino acid residue or is a preferred substitution of the target amino acid residue (defined in Table 6 below) Is.
In amino acid sequence comparison using ALIGN-2 or NCBI-BLAST2, a given amino acid sequence A is% positive with or against a given amino acid sequence B (or with a given amino acid sequence B; Or a given amino acid sequence A having or containing some% amino acid sequence identity) may be calculated as follows:
100 times the fraction X / Y, where X is the number of amino acid residues scored positive by the alignment of A and B of the sequence alignment program ALIGN-2 or NCBI-BLAST2, and Y is the number of B The total number of amino acid residues. It will be understood that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, then% positive for A for B is different from% positive for B for A.

"Isolated" when used to describe the various polypeptides disclosed herein means a polypeptide that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of the natural environment are substances that typically interfere with the diagnostic or therapeutic use of the polypeptide and include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by using a spinning cup sequenator, or (2) Coomassie blue or It is preferably purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using silver staining. Isolated polypeptide includes protein in situ within recombinant cells, since at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
An “isolated” PRO polypeptide-encoding nucleic acid is a nucleic acid molecule that has been identified and separated from at least one contaminating nucleic acid molecule normally associated with the natural source of the nucleic acid encoding the PRO polypeptide. An isolated PRO polypeptide-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature. Thus, an isolated PRO polypeptide-encoding nucleic acid molecule is distinguished from a PRO polypeptide-encoding nucleic acid molecule that is present in natural cells. However, an isolated PRO polypeptide-encoding nucleic acid molecule includes, for example, a PRO polypeptide nucleic acid molecule contained in a cell that normally expresses the PRO polypeptide at a chromosomal location different from that of natural cells. .

The expression “control sequence” refers to a DNA sequence necessary to express an operably linked coding sequence in a particular host organism. For example, suitable control sequences for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers.
A nucleic acid is “operably linked” when it is in a functional relationship with another nucleic acid sequence. For example, a presequence or secretory leader DNA is operably linked to the polypeptide DNA if expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is responsible for the transcription of the sequence. If it does, it is operably linked to the coding sequence; or the ribosome binding site is operably linked to the coding sequence if it is in a position that facilitates translation. In general, “operably linked” means that the bound DNA sequences are in close proximity and, in the case of a secretory leader, in close proximity and in the reading phase. However, enhancers do not necessarily have to be close together. Binding is achieved by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers are used according to conventional techniques.

The term “antibody” is used in the broadest sense, eg, a single anti-PRO polypeptide monoclonal antibody (including agonists, antagonists, and neutralizing antibodies), anti-PRO antibody compositions with multi-epitope specificity , Single chain anti-PRO antibodies, and fragments of anti-PRO antibodies (see below). The term “monoclonal antibody” as used herein is identical except for a substantially homogeneous population of antibodies, ie, naturally occurring mutations in which the individual antibodies that make up may be present in minor amounts. Refers to an antibody obtained from a population.
The “stringency” of a hybridization reaction is readily determined by those skilled in the art and is generally an empirical calculation that depends on probe length, wash temperature, and salt concentration. In general, the longer the probe, the higher the temperature for proper annealing, and the shorter the probe, the lower the temperature. Hybridization generally depends on the ability of denatured DNA to reanneal when the complementary strand is present in an environment close to but below its melting point. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures make the reaction conditions more stringent, while lower temperatures reduce the stringency. Furthermore, stringency is inversely proportional to salt concentration. For further details and explanation of the stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

As defined herein, “stringent conditions” or “highly stringent conditions” are: (1) 0.015 M sodium chloride / 0.0015 M citric acid at low ionic strength and high temperature, eg, 50 ° C., for washing. Using sodium / 0.1% sodium dodecyl sulfate; (2) denaturing agents such as formamide during hybridization, eg 50% (v / v) formamide and 0.1% bovine serum albumin / 0.1% ficoll / 0.1 at 42 ° C. % Polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5 and 750 mM sodium chloride, 75 mM sodium citrate; (3) 50% formamide at 42 ° C., 5 × SSC (0.75 M NaCl, 0.075 M Sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 × Solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate, washed in 0.2 × SSC (sodium chloride / sodium citrate) at 42 ° C. and 50% at 55 ° C. Identified by using a high stringency wash consisting of 0.1 × SSC containing formamide followed by EDTA at 55 ° C.
“Moderate stringency conditions” are identified as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) Including formation conditions (eg, temperature, ionic strength and% SDS) Moderate stringency conditions include 20% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7). .6) overnight incubation at 37 ° C. in a solution containing 5 × denhard solution, 10% dextran sulfate, and 20 mg / mL denatured sheared salmon sperm DNA, followed by washing the filter at 37-50 ° C. in 1 × SSC. One skilled in the art would adjust the temperature, ionic strength, etc. as needed to accommodate factors such as probe length. You will recognize that.

The term “epitope tag” as used herein refers to a PRO polypeptide fused to a “tag polypeptide”, or a chimeric polypeptide comprising their domain sequence. A tag polypeptide has a sufficient number of residues to provide an epitope from which the antibody can be produced, or an epitope that can be identified by several other reagents, but its length is the length of the target PRO polypeptide. Short enough not to inhibit the activity of the peptide. Also, the tag polypeptide is preferably fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually about 8 to about 50 amino acid residues (preferably about 10 to about 20 residues).
The term “immunoadhesin” as used herein refers to an antibody-like molecule that binds the binding specificity of a heterologous protein (“adhesin”) to an immunoglobulin constant domain. Structurally, an immunoadhesin comprises a fusion of an immunoglobulin constant domain sequence with the desired binding specificity and other than the antigen recognition and binding site of an antibody (ie, “heterologous”) and an immunoglobulin constant domain sequence. . The adhesin portion of an immunoadhesin molecule is typically a contiguous amino acid sequence that includes at least a receptor or ligand binding site. Immunoadhesin immunoglobulin constant domain sequences can be any IgG-1, IgG-2, IgG-3 or IgG-4 subtype, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM. It can be obtained from the immunoglobulins.

As used herein, “active” and “activity” means a form of PRO that retains the biological and / or immunological activity of a natural or naturally occurring PRO polypeptide, and “biological” By activity is meant a biological function (inhibitory or stimulatory) caused by a natural or naturally occurring PRO, excluding the ability to generate antibodies against the antigenic epitope of the natural or naturally occurring PRO. Thus, “immunological” activity means the ability to generate antibodies against an antigenic epitope of a natural or naturally occurring PRO.
The term “antagonist” is used in the broadest sense and refers to any molecule that prevents, inhibits, or neutralizes the biological activity of a native PRO polypeptide disclosed herein. Similarly, the term “agonist” is used in the broadest sense and refers to any molecule that mimics the biological activity of a native PRO polypeptide disclosed herein. Suitable agonist or antagonist molecules include in particular agonist or antagonist antibodies or antibody fragments, fragments of native PRO polypeptides or amino acid sequence variants, peptides, small organic molecules, and the like. A method for identifying an agonist or antagonist of a PRO polypeptide can include contacting the PRO polypeptide with a candidate antagonist or agonist and measuring a change in one or more biological activities normally associated with the PRO polypeptide.

“Treatment” as used herein refers to both curative treatment, prophylactic and preventative therapies, wherein the patient is prevented or reduced (reduced) in the targeted pathological condition or epilepsy. Those in need of treatment include those already suffering from the disease, as well as those susceptible to the disease or those in which the disease has been prevented.
“Chronic” administration means that the drug is administered in a continuous manner as opposed to an acute manner, and the initial therapeutic effect (activity) is maintained over a long period of time. An “intermittent” administration is a treatment that is not made continuously without interruption, but rather is essentially periodic.
“Mammals” for treatment subjects are classified as mammals, including humans, domestic and agricultural animals, zoos, sports, or pet animals, such as dogs, cats, cows, horses, sheep, pigs, rabbits, and the like. Means any animal. Preferably the mammal is a human.
Administration “in combination with” one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.

  As used herein, a “carrier” includes a pharmaceutically acceptable carrier, excipient, or stabilizer and is non-toxic to cells or mammals exposed to them at the dosages and concentrations used. . Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include phosphate, citrate, and other organic acid salt buffers; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; Eg serum albumin, gelatin or immunoglobulin; hydrophobic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextran; EDTA Chelating agents such as; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or non-ionic surfactants such as TWEEN (trade name), polyethylene glycol (PEG), and PLURONICS (product) Name).

“Antibody fragments” comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments are Fab, Fab ′, F (ab ′) ₂ , and Fv fragments; disbodies; linear antibodies (Zapata et al., Protein Eng. 8 (10): 1057-1062 [1995] ); Single chain antibody molecules; and multispecific antibodies formed from antibody fragments.
Papain digestion of antibodies produces two identical antibody-binding fragments called “Fab” fragments, each of which has a single antigen-binding site, the rest reflecting the ability to easily crystallize “Fc” It is named a fragment. Pepsin treatment yields an F (ab ′) ₂ fragment, which has two antigen binding sites and can cross-link antigen.
“Fv” is the minimum antibody fragment which contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy chain and one light chain variable region in tight, non-covalent association. In this arrangement, the three CDRs of each domain interact to determine the antigen binding site on the surface of the mer with V _H -V _L. Correctly, the six CDRs have antigen binding specificity for the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for the antigen) has a lower affinity than the entire binding site, but has the ability to recognize and bind to the antigen. .
The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Here, Fab′-SH represents Fab ′ in which the cysteine residue of the constant domain has a free thiol group. F (ab ′) ₂ antibody fragments are initially produced as pairs of Fab ′ fragments, with a hinge cysteine between them. Other chemical couplings of antibody fragments are also known.

“Light chains” of antibodies (immunoglobulins) from any vertebrate species are classified into one of two distinctly different types called kappa and lambda, based on the amino acid sequence of their constant domains.
Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be classified into different classes. There are five main classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, some of which are further classified into subclasses (isotypes) such as IgG1, IgG2, IgG3, IgG4, IgA and IgA2.
“Single-chain Fv” or “sFv” antibody fragments comprise antibody fragments comprising the V _H and V _L domains of antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the _VH and _VL domains, which allows sFV to form the desired structure for antigen binding. For a review of scFv, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (1994).
The term “diabodies” refers to small antibody fragments with two antigen binding sites, which fragments bind to the light chain variable domain (V _L ) within the same polypeptide chain (V _H -V _L ). Heavy chain variable domain (V _H ). By using a linker that is too short to pair between two domains of the same chain, the domain is forced to pair with the complementary domain of the other chain to produce two antigen binding sites. Diabodies are well described, for example, by EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).

An “isolated” antibody is one that has been identified and separated and / or recovered from a component of its natural environment. Contaminating components of the natural environment are substances that interfere with the use of the antibody in diagnosis or therapy, including enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the antibody is (1) more than 95% antibody as measured by the Lowry method, most preferably more than 99% by weight, (2) by using a spinning cup sequenator, Enough to obtain an N-terminal or internal amino acid sequence of at least 15 residues, or (3) homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or preferably silver staining Purified. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
The term “label” as used herein refers to a detectable compound or composition that is conjugated directly or indirectly to the antibody to produce a “labeled” antibody. The label may itself be detectable (eg, a radioactive label or a fluorescent label) or, in the case of an enzyme label, may catalyze chemical conversion of the detectable substrate compound or composition.
“Solid phase” means a non-aqueous matrix to which an antibody of the invention can be attached. Examples of solid phases contemplated herein include those formed, in part or in whole, from glass (eg, controlled pore glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone. In certain embodiments, depending on the content, the solid phase can constitute the well of an assay plate; in others it can be a purification column (eg, an affinity chromatography column). The term also encompasses a discontinuous solid phase of discrete particles, such as those described in US Pat. No. 4,275,149.
“Liposomes” are small vesicles composed of various types of lipids, phospholipids and / or surfactants, and are useful for transporting drugs (such as PRO polypeptides or antibodies thereof) to mammals. The components of the liposome are usually arranged in a bilayer format similar to the lipid arrangement of biological membranes.
“Small molecule” is defined herein as having a molecular weight of less than about 500 Daltons.

II. Compositions and Methods of the Invention Full-Length PRO Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode polypeptides referred to in this application as PRO polypeptides. In particular, cDNAs encoding various PRO polypeptides have been identified and isolated, as described in further detail in the Examples below. Note that proteins produced in separate rounds of expression are given different PRO numbers, but UNQ numbers are unique to all given DNA and encoded proteins and do not change. However, for simplicity, the proteins encoded by the full-length natural nucleic acid molecules disclosed herein, as well as further natural homologues and variants included in the PRO definition above, are herein referred to as their origin or form of preparation. Regardless, it is referred to as “PRO / number”.
As disclosed in the Examples below, various cDNA clones have been deposited with the ATCC. The exact nucleotide sequence of these clones can be readily determined by sequencing the deposited clones using routine methods in the art. The predicted amino acid sequence can be determined from the nucleotide sequence using routine skill. For the PRO polypeptides and encoding nucleic acids described herein, Applicants have identified what is believed to be the reading frame that best matches the currently available sequence information.

1. Full-Length PRO281 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO281 (UNQ244). In particular, a cDNA encoding a PRO281 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Using the WU-BLAST-2 sequence alignment program, it was found that the full-length native sequence PRO281 (shown in FIG. 2 and SEQ ID NO: 2) has some amino acid sequence identity with the rat TEGT protein. Thus, at present, PRO281 disclosed in this application is a newly identified TEGT homolog and is believed to have activity typical of that protein.
2. Full-Length PRO276 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO276 (UNQ243). In particular, a cDNA encoding a PRO276 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. To the best of our knowledge, the DNA16435-1208 sequence encodes a novel factor herein designated PRO276; it does not have sequence identity to any known protein using the WU-BLAST-2 sequence alignment program Became clear. The identification of the sequence identity found is listed in the examples below.

3. Full Length PRO189 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO189. In particular, Applicants have identified and isolated cDNA encoding a PRO189 polypeptide, as disclosed in further detail in the Examples below. Applicant's knowledge reveals that the DNA 21624-1391 nucleotide sequence encodes a novel factor; using the BLAST and FastA sequence alignment computer programs, it does not have sequence identity to any known protein. It was.
4). Full-Length PRO190 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO190. In particular, Applicants have identified and isolated cDNA encoding a PRO190 polypeptide, as disclosed in further detail in the Examples below. PRO190 encoding clones were isolated from a human retinal library. In Applicants' current knowledge, the DNA2334-1392 nucleotide sequence encodes a novel multi-transmembrane spanning protein; using the BLAST and FastA sequence alignment programs, certain with the CMP-sialic acid and UDP-galactose transporters There is a degree of sequence identity, indicating that PRO190 is related to the transporter and that PRO190 may be a novel transporter.

5). Full Length PRO341 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO341 (UNQ300). In particular, a cDNA encoding a PRO341 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
The DNA26288-1239 clone was isolated from a human placenta library. To the best of our knowledge, the DNA26288-1239 sequence encodes a novel factor, designated herein as PRO341; using the WU-BLAST-2 sequence alignment computer program, significant sequence identity to any known protein is demonstrated. It became clear that it did not have.
6). Full-Length PRO180 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO180 (UNQ154). In particular, a cDNA encoding a PRO180 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
The DNA26843-1389 clone was isolated from a human placenta library using an oligo formed from DNA12922 isolated from an amylase screen. To the best of our knowledge, the DNA26843-1389 sequence encodes a novel factor, designated herein as PRO180.

7). Full-Length PRO194 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO194. In particular, Applicants have identified and isolated cDNA encoding a PRO194 polypeptide, as disclosed in further detail in the Examples below. The PRO194 encoding clone was isolated from a human fetal lung library. Applicant's current knowledge is that the DNA26844-1394 nucleotide sequence encodes a novel factor; it may not have significant sequence identity to any known protein using the BLAST and FastA sequence alignment programs. It became clear.
8). Full-Length PRO203 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO203. In particular, Applicants have identified and isolated cDNA encoding a PRO203 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment programs, Applicants have found that PRO203 has sequence identity with GST ATPase. Thus, it is now believed that the PRO203 polypeptide disclosed in this application is a newly identified member of the ATPase family and has activity typical of GST ATPase.

9. Full-length PRO290 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO290. In particular, a cDNA encoding a PRO290 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Sequence identity was revealed: P_R99800, CC4H_HUMAN, YCS2_YEAST, CEF35G12_13, HSFAN_1, MMU52461_1, MMU70015_1, HSU67615_1, CET01H10_8 and CELT28F2_6.
Currently, PRO290 is believed to be an intracellular protein associated with one or more of the above proteins.
10. Full-Length PRO874 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO874. In particular, Applicants have identified and isolated cDNA encoding a PRO874 polypeptide, as disclosed in further detail in the Examples below.
The PRO874 encoding clone was isolated from a human fetal lung library. In the applicant's current knowledge, the DNA40621-1440 nucleotide sequence encodes a novel factor. However, using the BLAST and FastA sequence alignment computer programs, some degree of sequence identity was revealed to known proteins.

11. Full-Length PRO710 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO710. In particular, Applicants have identified and isolated cDNA encoding a PRO710 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that PRO710 has significant similarity to the CDC45 protein. Accordingly, it is now believed that the PRO710 polypeptide disclosed in this application is a newly identified CDC45 homolog.
12 Full-Length PRO1151 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1151. In particular, a cDNA encoding a PRO1151 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the native sequence PRO1151 (shown in FIG. 30 and SEQ ID NO: 47) has certain amino acid sequence identity with human 30 kD adipocyte complement-related precursor protein (ACR3 HUMAN) It was found to have Accordingly, it is now believed that PRO1151 disclosed in this application is a newly identified member of the complement protein family and has activity typical of that family.

13. Full-Length PRO1282 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1282. In particular, a cDNA encoding a PRO1282 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
To the best of our knowledge, the DNA45495-1550 sequence encodes a novel factor, designated herein as PRO1282. Using the WU-BLAST-2 sequence alignment computer program, some sequence identity was revealed between PRO1282 and other leucine-rich repeat proteins, as discussed in the Examples below, and leucine-rich repeat super It shows that a new member of the family has been identified.
14 Full Length PRO358 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO358. In particular, Applicants have identified and isolated cDNA encoding a novel human Toll polypeptide (PRO358), as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment analysis, Applicants have found that the coding sequence of PRO358 shows significant homology with the GenBank DNA sequences HSU_88540_1, HSU88878_1, HSU88879_1, HSU88880_1, HS88881_1, and HSU79260_1. However, with the exception of HSU79260_1, the proteins described have been identified as human toll-like receptors.
Thus, it is now believed that the PRO358 protein disclosed in this application is a newly identified human homologue of the Drosophila protein Toll and will play an important role in adaptive immunity. More specifically, PRO358 is involved in responses to inflammation, septic shock, and pathogens and is exacerbated by a variety of medical conditions that are exacerbated by immune responses such as diabetes, ALS, cancer, rheumatoid arthritis, and ulcers Can play a role. The role of PRO385 in detecting the presence of pathogenic pattern recognition receptors, conserved molecular structures on microorganisms, is further supported by the data disclosed in this application, and the known human Toll-like receptor, TLR2, is a direct receptor for LPS signaling. Indicates that it is a mediator.

15. Full Length PRO1310 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1310. In particular, a cDNA encoding a PRO1310 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1310 (shown in FIG. 36 and SEQ ID NO: 62) was found to have some amino acid sequence identity with carboxypeptidase X2. Thus, it is now believed that PRO1310 disclosed in this application is a newly identified member of the carboxypeptidase family and has carboxyl-terminal amino acid scavenging activity.
16. Full Length PRO698 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO698. In particular, Applicants have identified and isolated cDNA encoding a PRO698 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO698 polypeptide has significant similarity to the olfactomedin protein. Thus, it is now believed that PRO698 disclosed in this application is a newly identified olfactedin homolog.

17. Full-Length PRO732 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO732. In particular, Applicants have identified and isolated cDNA encoding a PRO732 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO732 polypeptide has significant similarity to the human placenta Diff33 protein. Thus, it is presently believed that the PRO732 polypeptide disclosed in this application is a newly identified Diff33 homolog.
18. Full-Length PRO1120 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1120. In particular, a cDNA encoding a PRO1120 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1120 (shown in FIG. 47 and SEQ ID NO: 84) is a known sulfatase referred to as CELK09C4_1 and GL6S_HUMAN in the Dayhoff (version 35.45 SwissProt 35) database, respectively. And some amino acid sequence identity. Accordingly, it is now believed that PRO1120 disclosed in this application is a newly identified sulfatase family member and has the typical activity of sulfatase.

19. Full-Length PRO537 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO537. In particular, a cDNA encoding a PRO537 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. The DNA49141-1431 clone was isolated from a human placenta library using a capture technique that selects for nucleotide sequences encoding secreted proteins. To the best of our knowledge, the DNA49141-1431 sequence encodes a novel factor herein designated PRO537; using the WU-BLAST-2 sequence alignment computer program, there is no significant sequence identity with any known protein. It became clear.
20. Full-Length PRO536 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO536. In particular, a cDNA encoding a PRO536 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. The DNA49142-1430 clone was isolated from a human infant brain library using a capture technique selected for the nucleotide sequence encoding the secreted protein. To the best of our knowledge, the DNA49142-1430 sequence encodes a novel factor herein designated PRO536; using the WU-BLAST-2 sequence alignment computer program, there is no significant sequence identity with any known protein. It became clear.

21. Full-Length PRO535 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO535. In particular, a cDNA encoding a PRO535 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO535 (shown in FIG. 53 and SEQ ID NO: 99) was found to have amino acid sequence identity with the putative peptidyl-prolyl isomerase protein. . Thus, PRO535 disclosed in this application is now a newly identified member of the isomerase protein family and is believed to have activity typical of these proteins.
22. Full-Length PRO718 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO718. In particular, Applicants have identified and isolated cDNA encoding a PRO718 polypeptide, as disclosed in further detail in the Examples below. PRO718-encoded clones were isolated from a human fetal lung library. Applicants' knowledge has revealed that the DNA49647-1398 nucleotide sequence encodes a novel factor; using the BLAST and FastA sequence alignment computer programs, there is no significant sequence identity with any known protein. .

23. Full-Length PRO872 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO872. In particular, Applicants have identified and isolated cDNA encoding a PRO872 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO872 polypeptide has sequence identity with the dehydrogenase. Accordingly, the PRO872 polypeptide disclosed in the present application is now a newly identified dehydrogenase family member and is believed to have dehydrogenase activity.
24. Full length PRO1063 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1063. In particular, Applicants have identified and isolated cDNA encoding a PRO1063 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1063 polypeptide has significant similarity to human type IV collagenase protein. Thus, it is now believed that the PRO1063 polypeptide disclosed in this application is a newly identified collagenase homolog.

25. Full-Length PRO619 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO619. In particular, a cDNA encoding a PRO619 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO619 (shown in FIG. 68 and SEQ ID NO: 117) was found to have some amino acid sequence identity with VpreB3. Therefore, PRO619 disclosed in this application is now a newly identified member of the IgG superfamily and has activities related to assembly and / or components of surrogate light chains associated with developing B cells. It is considered to be.
26. Full-Length PRO943 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO943. In particular, a cDNA encoding a PRO943 polypeptide, as disclosed in more detail in the examples below, has been identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO943 (shown in FIG. 70 and SEQ ID NO: 119) was found to have amino acid sequence identity with the fibroblast growth factor receptor-4 protein. It was. Thus, PRO943 disclosed in this application is now a newly identified member of the fibroblast growth factor receptor family and is believed to have activity typical of this family.

27. Full Length PRO1188 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1188. In particular, cDNA encoding PRO1188 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
As discussed in Example 1 below, using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1188 (shown in FIG. 72; SEQ ID NO: 124) is converted to nucleotide pyrophosphohydrolase (SSU83114_1) and It was found to have some amino acid sequence identity. Thus, PRO1188 disclosed in the present application is now a newly identified member of the nucleotide phosphohydrolase family and is believed to have activity typical of this protein family.
28. Full-length PRO1133 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1133. In particular, cDNA encoding PRO1133 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1133 (shown in FIG. 74 and SEQ ID NO: 129) may have some amino acid sequence identity with netrin 1a, Dayhoff registration AF002717_1. It was found. Thus, it is now believed that PRO1133 disclosed in this application shares at least one related mechanism with netrin.

29. Full-Length PRO784 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO784. In particular, a cDNA encoding a PRO784 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the BLAST and FastA sequence alignment computer programs, the full-length native sequence PRO784 (FIG. 76; shown in SEQ ID NO: 135) was found to have some amino acid sequence identity with the sec22 homolog. Thus, PRO784 disclosed in this application is now a newly identified member of the sec22 family and is believed to have vesicular transport activity typical of the sec22 family.
30. Full-Length PRO783 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO783. In particular, Applicants have identified and isolated cDNA encoding a PRO783 polypeptide, as disclosed in further detail in the Examples below. The PRO783-encoded clone was isolated from a human fetal kidney library. In Applicants' current knowledge, the DNA53996-1442 nucleotide sequence encodes a novel factor. Some sequence identity was found with known proteins using the BLAST and FastA sequence alignment computer programs.

31. Full-Length PRO820 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO820. In particular, Applicants have identified and isolated cDNA encoding a PRO820 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have determined that the various portions of PRO820 have sequence identity with low affinity immunoglobulin gamma Fc receptors, IgE high affinity Fc receptors and high affinity immunoglobulin epsilon receptors. Found to have. Thus, it is presently believed that the PRO820 polypeptides disclosed in this application are newly identified members of the Fc receptor family.
32. Full Length PRO1080 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1080. In particular, Applicants have identified and isolated cDNA encoding a PRO1080 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer program, Dayhoff database (version 35.45 swissProt 35), Applicants have determined that the PRO1080 polypeptide is referred to as “YRY1_CAEEL”, a 39.9 kd protein, referred to as “AF0127149_5” DnaJ homology. , DnaJ homologue 2 called “RNU95727_1” and Dna3 / Cpr3 called “AF011793_1” were found to have sequence identity. Thus, these results indicate that the PRO1080 polypeptide disclosed in this application is a newly identified member of the DnaJ-like protein family and is thus involved in protein biosynthesis.

33. Full Length PRO1079 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1079. In particular, cDNA encoding PRO1079 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
To the best of our knowledge, the DNA56050-1455 sequence encodes a novel factor herein designated PRO1079. However, using the WU-BLAST-2 sequence alignment computer program, it has been found to have some degree of sequence identity to known proteins.
34. Full-Length PRO793 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO793. In particular, a cDNA encoding a PRO793 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
The DNA56110-1437 clone was isolated from a human skin tumor library. To the best of our knowledge, the DNA56110-1437 sequence encodes a novel factor, designated herein as PRO793; does not have sequence identity to any known protein using the WU-BLAST-2 sequence alignment computer program It became clear.

35. Full-Length PRO1016 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1016. In particular, Applicants have identified and isolated cDNA encoding a PRO1016 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that PRO1016 polypeptides have sequence identity with acyltransferases. Accordingly, it is now believed that the PRO1016 polypeptide disclosed in this application is a newly identified member of the acyltransferase family and has the acylating ability typical of this family.
36. Full-Length PRO1013 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1013. In particular, Applicants have identified and isolated cDNA encoding a PRO1013 polypeptide, as disclosed in further detail in the Examples below. The PRO1013-encoded clone is from a human breast tumor tissue library. Thus, the PRO1013-encoding clone may encode a secretory factor associated with cancer. In the applicant's current knowledge, the DNA56410-1414 nucleotide sequence encodes a novel factor. PRO1013, which showed some sequence identity with KIAA0157 and P120 using the BLAST and FastA sequence alignment computer program, has at least one region in common with growth factors and cytokine receptors.

37. Full-Length PRO937 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO937. In particular, Applicants have identified and isolated cDNA encoding a PRO937 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO937 polypeptide has significant sequence identity with proteins of the glypican family. Thus, it is now believed that the PRO937 polypeptide disclosed in this application is a newly identified member of the glypican family and has properties typical of the glypican family.
38. Full Length PRO842 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO842. In particular, a cDNA encoding a PRO842 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
To the best of our knowledge, the DNA56855-1447 sequence encodes a novel factor herein designated PRO842. However, using the WU-BLAST-2 sequence alignment computer program, it has been found to have some degree of sequence identity to known proteins.

39. Full-Length PRO839 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO839. In particular, a cDNA encoding a PRO839 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
To the best of our knowledge, the DNA56859-1445 sequence encodes a novel factor herein designated PRO839. However, using the WU-BLAST-2 sequence alignment computer program, it has been found to have some degree of sequence identity to known proteins.
40. Full-Length PRO1180 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1180. In particular, Applicants have identified and isolated cDNA encoding a PRO1180 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1180 polypeptide has significant sequence identity with methyltransferase. Thus, it is now believed that the PRO1180 polypeptides disclosed in this application are newly identified members of the methyltransferase family and have activities typical of this family.

41. Full length PRO1134 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1134. In particular, cDNA encoding PRO1134 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
The DNA56865-1491 clone was isolated from a human fetal liver library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the DNA56865-1491 clone encodes a secreted factor. To the best of our knowledge, the DNA56865-1491 sequence encodes a novel factor herein designated PRO1134; it does not have sequence identity to any known protein using the WU-BLAST-2 sequence alignment computer program It became clear.
42. Full-Length PRO830 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO830. In particular, a cDNA encoding a PRO830 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
The DNA56866-1342 clone was isolated from a human fetal liver / spleen library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the DNA56866-1342 clone encodes a secreted factor. To the best of our knowledge, the DNA56866-1342 sequence encodes a novel factor, designated herein as PRO830; does not have sequence identity to any known protein using the WU-BLAST-2 sequence alignment computer program It became clear.

43. Full-Length PRO1115 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1115. In particular, cDNA encoding PRO1115 polypeptide, as disclosed in more detail in the examples below, has been identified and isolated.
As far as is known, the DNA56868-1478 sequence encodes a novel factor herein designated PRO1115. However, using the WU-BLAST-2 sequence alignment computer program, it has been found to have some degree of sequence identity to known proteins.
44. Full-Length PRO1277 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1277. In particular, cDNA encoding the PRO1277 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1277 (shown in FIG. 113 and SEQ ID NO: 179) is identical in amino acid sequence to the Coch-5B2 protein (referred to as “AF012252_1” in the Dayhoff database) It was found to have sex. Thus, PRO1277 disclosed in this application is currently a newly identified member of the Coch-5B2 protein family and is believed to have similar activity and properties as Coch-5B2.

45. Full Length PRO1135 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1135. In particular, Applicants have identified and isolated cDNA encoding a PRO1135 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1135 polypeptide has significant similarity to the alpha 1,2-mannosidase protein. Thus, it is now believed that the PRO1135 polypeptide disclosed in this application is a newly identified member of the mannosidase enzyme family and has activity typical of this family of proteins.
46. Full-Length PRO1114 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode polypeptides referred to in this application as PRO1114 interferon receptors. In particular, cDNA encoding a PRO1114 interferon receptor polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1114 (shown in FIG. 117 and SEQ ID NO: 183) was found to have sequence identity with other known interferon receptors. Thus, it is now believed that the PRO1114 interferon receptor has activity typical of interferon receptors.

47. Full-Length PRO828 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO828. In particular, Applicants have identified and isolated cDNA encoding a PRO828 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants found that the PRO828 polypeptide has sequence identity with glutathione peroxidase. Thus, the PRO828 polypeptide disclosed in the present application is now a newly identified member of the glutathione peroxidase family and is believed to have peroxidase activity and other activities typical of glutathione peroxidase.
48. Full-Length PRO1009 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in the present application as PRO1009. In particular, cDNA encoding PRO1009 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1009 (shown in FIG. 122 and SEQ ID NO: 194) is a long chain acyl-CoA synthetase homolog termed “F69893” and certain amino acid sequences. It was found to have identity. Accordingly, it is now believed that PRO1009 disclosed in this application is a newly identified member of the long chain acyl-CoA synthetase family and has activities associated with this family.

49. Full length PRO1007 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in the present application as PRO1007. In particular, Applicants have identified and isolated cDNA encoding a PRO1007 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants found that the PRO1007 polypeptide has sequence identity with MAGPIAP. Thus, the PRO1007 polypeptide disclosed in the present application is now a newly identified member of the MAGPIAP family and is believed to be associated with metastasis and / or cell signaling and / or cell replication.
50. Full-Length PRO1056 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1056. In particular, a cDNA encoding a PRO1056 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1056 (shown in FIG. 127 and SEQ ID NO: 199) was found to have amino acid sequence identity with the chloride channel protein. Thus, it is now believed that PRO1056 disclosed in this application is a newly identified chloride ion channel protein homolog.

51. Full-Length PRO826 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO826. In particular, cDNA encoding a PRO826 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
The DNA57694-1341 clone was isolated from a human fetal heart library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the DNA57694-1341 clone encodes a secreted factor. To the best of our knowledge, the DNA57694-1341 sequence encodes a novel factor, designated herein as PRO826; using the WU-BLAST-2 sequence alignment computer program, significant sequence identity to any known protein is demonstrated. It became clear that it did not have.
52. Full-Length PRO819 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO819. In particular, a cDNA encoding a PRO819 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
The DNA57669-1340 clone was isolated from a human fetal liver spleen library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the DNA57669-1340 clone encodes a secreted factor. To the best of our knowledge, the DNA57695-1340 sequence encodes a novel factor, designated herein as PRO819; using the WU-BLAST-2 sequence alignment computer program, we can obtain significant sequence identity to any known protein. It became clear that it did not have.

53. Full-Length PRO1006 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in the present application as PRO1006. In particular, Applicants have identified and isolated cDNA encoding a PRO1006 polypeptide, as disclosed in further detail in the Examples below. PRO1006-encoded clones were isolated from a human uterine library. Applicant's current knowledge is that the DNA57699-1412 nucleotide sequence encodes a novel factor; BLAST and FastA sequence alignment computer programs have been used to reveal some degree of sequence identity with putative tyrosine protein kinases. It was.
54. Full length PRO1112 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1112. In particular, cDNA encoding PRO1112 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated. Applicant's current knowledge is that the DNA57702-1476 nucleotide sequence encodes a novel factor, but using BLAST and FastA sequence alignment computer programs, some sequence identity to other known proteins has been found. It was issued.

55. Full-length PRO1074 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1074. In particular, cDNA encoding PRO1074 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1074 polypeptide has sequence identity with the glycosyltransferase. Accordingly, the PRO1074 polypeptide disclosed in the present application is now a newly identified member of the glycosyltransferase family and is believed to have glycosyltransferase activity.
56. Full-Length PRO1005 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1005. In particular, cDNA encoding PRO1005 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
To the best of our knowledge, the DNA57708-1411 sequence encodes a novel factor herein designated PRO1005. However, using the WU-BLAST-2 sequence alignment computer program, some degree of sequence identity was revealed to known proteins.

57. Full-Length PRO1073 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1073. In particular, cDNA encoding PRO1073 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
As far as is known, the DNA57710 sequence encodes a novel factor herein designated PRO1073. However, using the WU-BLAST-2 sequence alignment computer program, some degree of sequence identity was revealed to known proteins.
58. Full length PRO1152 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1152. In particular, a cDNA encoding a PRO1152 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
The DNA57711-1501 clone was isolated from a human infant brain library. To the best of our knowledge, the DNA57711-1501 sequence encodes a novel factor, designated herein as PRO1152, which uses the WU-BLAST-2 sequence alignment computer program to provide significant sequence identity to any known protein. It became clear that it did not have.

59. Full-Length PRO1136 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1136. In particular, a cDNA encoding a PRO1136 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1136 (shown in FIG. 147 and SEQ ID NO: 219) was found to have amino acid sequence identity with the PDZ domain-containing protein. Thus, at present, PRO1136 disclosed in this application is a newly identified member of the PDZ domain-containing protein family and is believed to have activity typical of this family.
60. Full Length PRO813 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO813. In particular, a cDNA encoding a PRO813 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO813 polypeptide has significant similarity to alveolar surfactant-related protein C. Therefore, it is now believed that the PRO813 polypeptide disclosed in this application is a newly identified alveolar surfactant-related protein C homolog.

61. Full-Length PRO809 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO809. In particular, a cDNA encoding a PRO809 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. In Applicants' current knowledge, the DNA57836-1338 nucleotide sequence encodes a novel factor.
62. Full-Length PRO791 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO791. In particular, a cDNA encoding a PRO791 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Applicant's current knowledge is that the DNA57838-1337 nucleotide sequence encodes a novel factor; however, BLAST and FastA sequence alignment computer programs are used to reveal some degree of sequence identity with the MHC-1 antigen. , PRO791 may be related to it in structure and function.

63. Full-Length PRO1004 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1004. In particular, cDNA encoding PRO1004 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
As far as is known, the DNA5784-1410 sequence encodes a novel factor, designated herein as PRO1004. However, using the WU-BLAST-2 sequence alignment computer program, some degree of sequence identity was revealed to known proteins.
64. Full-Length PRO1111 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1111. In particular, cDNA encoding PRO1111 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1111 (shown in FIG. 157 and SEQ ID NO: 229) was found to have some amino acid sequence identity with LIG. Accordingly, it is now believed that PRO1111 disclosed in this application is a newly identified member of this glycoprotein family.

65. Full Length PRO1344 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1344. In particular, a cDNA encoding a PRO1344 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1344 (shown in FIG. 159 and SEQ ID NO: 231) is identical in amino acid sequence to the Factor C protein of Carcinoscorpious rotundicauda. It was found to have sex. Therefore, PRO1344 disclosed in the present application is a newly identified factor C protein and is believed to have activity typical of that protein.
66. Full length PRO1109 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1109. In particular, cDNA encoding PRO1109 polypeptide, as disclosed in more detail in the examples below, has been identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1109 (shown in FIG. 161 and SEQ ID NO: 236) may have some amino acid sequence identity with human UPD-Gal: GlcNAc galactosyltransferase protein. It was found. Accordingly, PRO1109 disclosed in the present application is currently a newly identified β-galactosyltransferase enzyme and is believed to have activity typical of those enzymes.

67. Full-Length PRO1383 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1383. In particular, a cDNA encoding a PRO1383 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1383 (shown in FIG. 163 and SEQ ID NO: 241) has some amino acid sequence identity with the putative human transmembrane protein nmb precursor (NMB_HUMAN) It was found. Thus, it is now believed that PRO1383 disclosed in this application is a newly identified nmb homolog.
68. Full-Length PRO1003 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1003. In particular, Applicants have identified and isolated cDNA encoding a PRO1003 polypeptide, as disclosed in further detail in the Examples below. PRO1003-encoded clones were isolated from a human breast tumor tissue library. PRO1003-encoded clones were isolated using a capture technique that selects for nucleotide sequences encoding secreted proteins. Thus, the PRO1003 encoding clone may encode a secreted factor. Applicant's current knowledge is that the UNQ487 (DNA58846-1409) nucleotide sequence encodes a novel factor; using the BLAST and FastA sequence alignment computer programs, it is clear that there is no sequence identity with any known protein Became.

69. Full-Length PRO1108 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1108. In particular, cDNA encoding PRO1108 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1108 polypeptide has significant similarity to the LPAAT protein. Thus, it is now believed that PRO1108 disclosed in this application is a newly identified LPAAT homolog.
70. Full-Length PRO1137 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1137. In particular, a cDNA encoding a PRO1137 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that PRO1137 polypeptide has sequence identity with ribosyltransferase. Accordingly, the PRO1137 polypeptide disclosed in the present application is now a newly identified member of the ribosyltransferase family and is believed to have ribosyltransferase activity.

71. Full-Length PRO1138 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1138. In particular, a cDNA encoding a PRO1138 polypeptide, as disclosed in further detail in the examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1138 polypeptide has sequence identity with the CD84 leukocyte antigen. Thus, it is now believed that the PRO1138 polypeptide disclosed in this application is a newly identified member of the Ig superfamily and has activity typical of other members of the Ig superfamily.
72. Full Length PRO1054 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1054. In particular, cDNA encoding PRO1054 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1054 (shown in FIG. 174 and SEQ ID NO: 256) was found to have amino acid sequence identity with one or more major urine proteins. It was. Accordingly, it is now believed that PRO1054 disclosed in this application is a newly identified MUP family member and has activity typical of that family.

73. Full-Length PRO994 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO994. In particular, a cDNA encoding a PRO994 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO994 (shown in FIG. 176 and SEQ ID NO: 258) was found to have amino acid sequence identity with the tumor associated antigen L6. Accordingly, it is now believed that PRO994 disclosed in this application is a newly identified L6 antigen homolog.
74. Full-length PRO812 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO812. In particular, a cDNA encoding a PRO812 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO812 (shown in FIG. 178 and SEQ ID NO: 260) was found to have amino acid sequence identity with the prostate steroid-binding c1 protein. Thus, it is now believed that PRO812 disclosed in this application is a newly identified prostate steroid-binding c1 protein homolog.

75. Full Length PRO1069 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1069. In particular, cDNA encoding PRO1069 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1069 polypeptide has sequence identity with CHIF. Accordingly, the PRO1069 polypeptide disclosed in the present application is a newly identified CHIF polypeptide and is now considered to be involved in ionic conduction or regulation of ionic conduction.
76. Full Length PRO1129 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1129. In particular, a cDNA encoding a PRO1129 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1129 polypeptide has significant similarity to cytochrome P-450 family proteins. Thus, PRO1129 disclosed in the present application is now a newly identified member of the cytochrome P-450 family and is believed to have activity typical of that family.

77. Full-Length PRO1068 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1068. In particular, a cDNA encoding a PRO1068 polypeptide, as disclosed in more detail in the examples below, has been identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1068 was found to have amino acid sequence identity with urotensin. Therefore, PRO1068 disclosed in the present application is a newly identified member of the urotensin family and is believed to have activity typical of the urotensin family.
78. Full Length PRO1066 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1066. In particular, Applicants have identified and isolated cDNA encoding a PRO1066 polypeptide, as disclosed in further detail in the Examples below. PRO1066-encoded clones were isolated from a human pancreatic tumor tissue library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the PRO1066-encoding clone encodes a secreted factor. Applicants' current knowledge has revealed that the DNA59215-1425 nucleotide sequence encodes a novel factor; using the BLAST and FastA sequence alignment computer programs, it has been found that there is no sequence identity with any known protein. .

79. Full-Length PRO1184 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1184. In particular, Applicants have identified and isolated cDNA encoding a PRO1184 polypeptide, as disclosed in further detail in the Examples below. In the applicant's current knowledge, the DNA59220-1514 nucleotide sequence encodes a novel secreted factor.
80. Full Length PRO1360 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1360. In particular, a cDNA encoding a PRO1360 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
To the best of our knowledge, the DNA59488-1603 sequence encodes a novel factor herein designated PRO1360; using the WU-BLAST-2 sequence alignment computer program, there is significant sequence identity to any known protein. It became clear that there was no. As shown in the examples below, some sequence identity was seen.

81. Full-Length PRO1029 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1029. In particular, Applicants have identified and isolated cDNA encoding a PRO1029 polypeptide, as disclosed in further detail in the Examples below.
The DNA59493-1420 clone was isolated from a human fetal liver spleen library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the DNA59493-1420 clone encodes a secreted factor. As far as is known, the DNA59493-1420 sequence encodes a novel factor referred to herein as PRO1029; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein Became.
82. Full-Length PRO1139 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1139. In particular, a cDNA encoding a PRO1139 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants described the PRO1139 polypeptide originally identified in Bailleul et al., Nucleic Acids Res. 25, 2752-2758 (1997) (EMBL accession number: Y12670). It was found to show significant sequence homology with the OB receptor-related protein HSOBRGRP_1.

83. Full length PRO1309 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1309. In particular, cDNA encoding a PRO1309 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1309 (shown in FIG. 196 and SEQ ID NO: 278) has some amino acid sequence identity with the protein designated KIAA0416, given by the Dayhoff designation AB007876_1 It was found to have In addition, PRO1309 has leucine-rich repeats, so it is now believed that PRO1309 disclosed in this application is a newly identified leucine-rich repeat family member and involved in protein-protein interactions. .
84. Full-Length PRO1028 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1028. In particular, Applicants have identified and isolated cDNA encoding a PRO1028 polypeptide, as disclosed in further detail in the Examples below. In the applicant's current knowledge, the DNA59603-1419 nucleotide sequence encodes a novel factor. BLAST and FastA sequence alignment computer programs showed some degree of sequence identity with proteins such as those referred to as “A53050”.

85. Full-Length PRO1027 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1027. In particular, Applicants have identified and isolated cDNA encoding a PRO1027 polypeptide, as disclosed in further detail in the Examples below. PRO1027-encoded clones were isolated from a human cervical tissue library. In the applicant's current knowledge, the DNA59605-1418 nucleotide sequence encodes a novel factor.
86. Full-Length PRO1107 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1107. In particular, cDNA encoding PRO1107 polypeptide, as disclosed in more detail in the examples below, has been identified and isolated. Using the BLAST and FastA sequence alignment computer program, Applicants have found that the PRO1107 polypeptide has some similarity to PC-1 protein, human insulin receptor tyrosine kinase inhibitor, alkaline phosphidiesterase, and autotoxin I found. Accordingly, it is now believed that the PRO1107 polypeptide disclosed in this application is a newly identified member of the phosphodiesterase family.

87. Full-Length PRO1140 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1140. In particular, cDNA encoding PRO1140 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Some sequence identity with known proteins was found using BLAST and FastA sequence alignment computer programs.
88. Full-Length PRO1106 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1106. In particular, cDNA encoding PRO1106 polypeptide, as disclosed in more detail in the examples below, was identified and isolated. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the PRO1106 polypeptide has significant similarity to the peroxysomal calcium-dependent solute carrier. Thus, the PRO1106 polypeptide disclosed in this application is now a newly identified member of the mitochondrial carrier superfamily and is believed to have activity typical of this family.

89. Full Length PRO1291 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1291. In particular, cDNA encoding PRO1291 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1291 (shown in FIG. 208 and SEQ ID NO: 291) was found to have some amino acid sequence identity with the butyrophilin protein. Therefore, PRO1291 disclosed in the present application is a newly identified butyrophilin homologue and is believed to have activity typical of that protein.
90. Full-length PRO1105 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1105. In particular, Applicants have identified and isolated cDNA encoding a PRO1105 polypeptide, as disclosed in further detail in the Examples below. In Applicants' current knowledge, the DNA59612-1466 nucleotide sequence encodes a novel factor. However, there is some sequence identity with the peroxidase precursor referred to as “ATTS1623_1” in the Dayhoff database.

91. Full-Length PRO511 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO511. In particular, Applicants have identified and isolated cDNA encoding a PRO511 polypeptide, as disclosed in further detail in the Examples below. PRO511 encoding clones were isolated from a human colon tissue library. In the applicant's current knowledge, the DNA59613-1417 nucleotide sequence encodes a novel factor; using BLAST and FastA sequence alignment computer programs, the sequence identity with RoBo-1, a phospholipase inhibitor and a protein termed “SSC20F10_1” Sex is shown, indicating that PRO511 is associated with one or more of these proteins.
92. Full-length PRO1104 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1104. In particular, Applicants have identified and isolated cDNA encoding a PRO1104 polypeptide, as disclosed in further detail in the Examples below. Applicant's current knowledge is that the DNA59616-1465 nucleotide sequence encodes a novel factor; using the BLAST and FastA sequence alignment computer programs, or with proteins named “AB002107_1”, “AF022991_1” and “SP96_DICDI” Some degree of sequence identity was shown.

93. Full-Length PRO1100 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1100. In particular, Applicants have identified and isolated cDNA encoding a PRO1100 polypeptide, as disclosed in further detail in the Examples below. Applicant's current knowledge is that the DNA59619-1464 nucleotide sequence encodes a novel factor; BLAST and FastA sequence alignment computer programs have been used to reveal some sequence identity with known proteins. . There is some degree of sequence identity with the yeast hypothetical 42.5 KD protein (registration number: 140496) in the TSM1-ARE1 gene internal region, referred to as “YSCT4_YEAST”.
94. Full-Length PRO836 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO836. In particular, Applicants have identified and isolated cDNA encoding a PRO836 polypeptide, as disclosed in further detail in the Examples below. In the applicant's current knowledge, the DNA59620-1463 nucleotide sequence encodes a novel factor. Some sequence identity with SLS1 was shown using the BLAST and FastA sequence alignment computer programs.

95. Full Length PRO1141 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1141. In particular, Applicants have identified and isolated cDNA encoding a PRO1141 polypeptide, as disclosed in further detail in the Examples below.
The DNA59625-1498 clone was isolated from a human ileal tissue library. To the best of our knowledge, the DNA59625-1498 sequence encodes a novel factor referred to herein as PRO1141; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein Became.
96. Full Length PRO1132 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1132. In particular, a cDNA encoding a PRO1132 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, it was found that the full-length native sequence PRO1132 (shown in FIG. 226 and SEQ ID NO: 309) has some amino acid sequence identity with enamel matrix serine proteinase 1 and neuropsin. It was issued. Thus, PRO1132 disclosed in this application is now a newly identified serine protease family member and is believed to have activity typical of that family.

97. Full-length PRO1346 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide designated NL7 (UNQ701) in this application. In particular, cDNA encoding an NL7 polypeptide, as disclosed in further detail in the examples below, was identified and isolated.
Clone DNA59776-1600 has been deposited with ATCC as disclosed in the Examples below. The exact nucleotide sequence of this clone can be readily determined by sequencing the deposited clone using routine methods in the art. The predicted amino acid sequence can be determined from the nucleotide sequence using routine skill. For NL7 (PRO1346) here, Applicants have identified what is believed to be the reading frame that best matches the sequence information available at the time of filing.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence NL7 (shown in FIG. 228 and SEQ ID NO: 314) is expressed as Microbial Associated Glycoprotein 4 (MFA4_HUMAN); Ficolin-A-Mouse (AB007813_1); Human Lectin P35 (D63155S6_1); ficolin B-mouse (AF0063217_1); human tenascin-R (restricted) (HS518E13_1); rat janusin precursor (A45445); fibrinogen-related protein HFREP-1 precursor (JNO596); human tenacin precursor ( TENA HUMAN); human CDT6 (HSY16132_1); and angiopoietin-1-mouse (MMU83509_1) were found to have some amino acid sequence identity. Thus, at present, NL7 disclosed in this application is a novel TIE ligand homolog and plays a role in angiogenesis and / or vascular maintenance and / or wound healing and / or inflammation and / or tumor development and / or growth. It is thought to fulfill.
98. Full-Length PRO1131 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1131. In particular, cDNA encoding PRO1131 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1131 (shown in FIG. 230 and SEQ ID NO: 319) is converted into a lectin-like oxidized LDL.
It has been found to have some amino acid sequence identity with the receptor. Thus, it is presently believed that PRO1131 disclosed in this application has a mechanism similar to at least one LDL receptor.

99. Full-Length PRO1281 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1281. In particular, Applicants have identified and isolated cDNA encoding a PRO1281 polypeptide, as disclosed in further detail in the Examples below.
The DNA59820-1549 clone was isolated from a human fetal liver library using a capture technique that selects for nucleotide sequences encoding secreted proteins. As far as is known, the DNA59820-1549 sequence encodes a novel factor referred to herein as PRO1281. Using the WU-BLAST-2 sequence alignment computer program, some degree of sequence identity was found with known proteins, but was determined to be not significant.
100. Full-Length PRO1064 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1064. In particular, Applicants have identified and isolated cDNA encoding a PRO1064 polypeptide, as disclosed in further detail in the Examples below.
The DNA59827-1426 clone was isolated from a human fetal liver library. As far as is known, the DNA59827-1426 sequence encodes a novel factor, referred to herein as PRO1064; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein Became.

101. Full-Length PRO1379 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1379. In particular, Applicants have identified and isolated cDNA encoding a PRO1379 polypeptide, as disclosed in further detail in the Examples below.
The DNA59828 clone was isolated from a human fetal liver library. As far as is known, the PRO1379 polypeptide encoded thereby is a novel secretory factor. Using the WU-BLAST-2 sequence alignment computer program, sequence identity was found between PRO1379 and the yeast protein “YHY8_YEAST” (Dayhoff database; version 35/45 SwissProt 35), especially the C-terminus. Although sequence homology with other proteins was seen, it was determined not to be significant.
102. Full-Length PRO844 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO844. In particular, Applicants have identified and isolated cDNA encoding a PRO844 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants have found that PRO844 polypeptides have sequence identity with serine protease inhibitors. Thus, the PRO844 polypeptide disclosed in the present application is now a newly identified serine protease inhibitor and is believed to be capable of inhibiting serine proteases.

103. Full-Length PRO848 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO848. In particular, Applicants have identified and isolated cDNA encoding a PRO848 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that PRO848 polypeptides have sequence identity with sialyltransferases. Thus, the PRO848 polypeptides disclosed in the present application are now members of the newly identified sialyltransferase family and are believed to have sialylation capabilities typical of this family.
104. Full-Length PRO1097 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1097. In particular, Applicants have identified and isolated cDNA encoding a PRO1097 polypeptide, as disclosed in further detail in the Examples below. In the applicant's current knowledge, the DNA59841-1460 nucleotide sequence encodes a novel factor. Using the BLAST and FastA sequence alignment computer programs, some sequence identity with the proteins designated “CELK05G3_3”, “CRU26344_1”, “SPBC16C6_8”, “P_W13844” and “AF013403” was revealed.

105. Full length PRO1153 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1153. In particular, a cDNA encoding a PRO1153 polypeptide, as disclosed in more detail in the examples below, has been identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1153 (shown in FIG. 246 and SEQ ID NO: 351) has been converted to the HPBRII-7 protein and certain amino acids submitted to the EMBL data library in June 1992. It was found to have sequence identity. Therefore, it is now believed that PRO1153 disclosed in this application is related to HPBRII-7.
106. Full Length PRO1154 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1154. In particular, cDNA encoding PRO1154 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1154 (shown in FIG. 248 and SEQ ID NO: 353) was found to match the KIAA0525 protein designated AB011097. PRO1154 has a novel N-terminus of 73 amino acids. Therefore, PRO1154 is considered new. PRO1154 also has significant sequence identity with aminopeptidase N, insulin-regulated membrane aminopeptidase, throtropin releasing hormone degrading enzyme and placental leucine aminopeptidase. Therefore, PRO1154 is considered to be a novel aminopeptidase, or a peptide that degrades peptides.

107. Full-Length PRO1181 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1181. In particular, Applicants have identified and isolated cDNA encoding a PRO1181 polypeptide, as disclosed in further detail in the Examples below.
The DNA59847-1511 clone was isolated from human prostate tissue using a capture technique that selects for nucleotide sequences encoding secreted proteins. Thus, the DNA59847-1511 clone encodes a secreted factor. To the best of our knowledge, the DNA59847-1511 clone encodes a secreted factor; using the WU-BLAST-2 sequence alignment computer program, it was revealed that it was not sequence-identical with any known protein.
108. Full-Length PRO1182 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1182. In particular, a cDNA encoding a PRO1182 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1182 (shown in FIG. 252 and SEQ ID NO: 357) was found to have amino acid sequence identity with the conglutinin protein. Accordingly, it is now believed that PRO1182 disclosed in this application is a newly identified conglutinin homolog.

109. Full-Length PRO1155 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1155. In particular, cDNA encoding PRO1155 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1155 (shown in FIG. 254 and SEQ ID NO: 359) was found to have some amino acid sequence identity with neurokinin B. Thus, it is now believed that PRO1155 disclosed in this application is a newly identified member of the neurokinin family.
110. Full-length PRO1156 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1156. In particular, Applicants have identified and isolated cDNA encoding a PRO1156 polypeptide, as disclosed in further detail in the Examples below.
The DNA59853-1505 clone was isolated from an adult human heart library using a capture technique that selects the nucleotide sequence encoding the secreted protein. To the best of our knowledge, the DNA59853-1505 clone encodes a novel factor referred to herein as PRO1156. However, using the WU-BLAST-2 sequence alignment computer program, some sequence identity was revealed with known proteins.

111. Full Length PRO1098 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1098. In particular, Applicants have identified and isolated cDNA encoding a PRO1098 polypeptide, as disclosed in further detail in the Examples below. PRO1098-encoded clones were isolated from a human lung tissue library; the WU-BLAST-2 sequence alignment computer program was used to reveal no sequence identity with any known protein. Some degree of sequence identity was revealed with proteins such as “Env” polyprotein and methyltransferase.
112. Full-Length PRO1127 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1127. In particular, Applicants have identified and isolated cDNA encoding a PRO1127 polypeptide, as disclosed in further detail in the Examples below.
The DNA60283-1484 clone encodes a secreted factor. To the best of our knowledge, the DNA60283-1484 sequence encodes a novel factor referred to herein as PRO1127; the WU-BLAST-2 sequence alignment computer program is used to reveal minimal sequence identity with any known protein. became.

113. Full-Length PRO1126 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1126. In particular, cDNA encoding PRO1126 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1126 (shown in FIG. 262 and SEQ ID NO: 367) was found to have some amino acid sequence identity with the olfactmedin protein. Thus, at present, PRO1126 disclosed in this application is a newly identified olfactedin homolog and is believed to have activity typical of that protein.
114. Full Length PRO1125 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1125. In particular, cDNA encoding PRO1125 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1125 (shown in FIG. 264 and SEQ ID NO: 369) was found to have some amino acid sequence identity with the transcriptional repressor rco-1. It was. Accordingly, it is now believed that PRO1125 disclosed in this application is a newly identified member of the WD superfamily.

115. Full Length PRO1186 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1186. In particular, a cDNA encoding a PRO1186 polypeptide, as disclosed in more detail in the examples below, has been identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1186 (shown in FIG. 266 and SEQ ID NO: 371) may have amino acid sequence identity with venom protein A from Dendrospice polyrepsis venom. It was found. Thus, it is now believed that PRO1186 disclosed in this application is a newly identified venom protein A member and shares related mechanisms.
116. Full-Length PRO1198 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1198. In particular, Applicants have identified and isolated cDNA encoding a PRO1198 polypeptide, as disclosed in further detail in the Examples below.
To the best of our knowledge, the DNA60622-1525 sequence encodes a novel factor referred to herein as PRO1198. However, using the WU-BLAST-2 sequence alignment computer program, some sequence identity was revealed with known proteins.

117. Full Length PRO1158 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1158. In particular, Applicants have identified and isolated cDNA encoding a PRO1158 polypeptide, as disclosed in further detail in the Examples below.
The DNA60625-1507 clone was isolated from a human lung tumor tissue library. To the best of our knowledge, the DNA60625-1507 sequence encodes a novel factor referred to herein as PRO1158. However, the WU-BLAST-2 sequence alignment computer program was used to show some sequence identity with known proteins.
118. Full-Length PRO1159 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1159. In particular, Applicants have identified and isolated cDNA encoding a PRO1159 polypeptide, as disclosed in further detail in the Examples below.
The DNA60627-1508 clone was isolated from a human peripheral blood granulocyte tissue library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the DNA60627-1508 clone encodes a secreted factor. As far as is known, the DNA60627-1508 sequence encodes a novel factor, referred to herein as PRO1159; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein It became.

119. Full-Length PRO1124 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1124. In particular, cDNA encoding PRO1124 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1124 (shown in FIG. 274 and SEQ ID NO: 377) has amino acid sequence identity with the epithelial chloride channel protein from bos taurus Was found. PRO1124 also has sequence identity with ECAM-1. Thus, it is now believed that PRO1124 disclosed in the present application is a newly identified cell membrane protein involved in cell transmission via either ion channels or cell adhesion molecules.
120. Full Length PRO1287 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1287. In particular, cDNA encoding PRO1287 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1287 (shown in FIG. 276 and SEQ ID NO: 381) has amino acid sequence identity with the radical fringe protein (GGU82088_1) from Gallus. It was found. Thus, PRO1287 disclosed in this application is a newly identified fringe protein homologue and is believed to have activity typical of fringe proteins.

121. Full Length PRO1312 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1312. In particular, Applicants have identified and isolated cDNA encoding a PRO1312 polypeptide, as disclosed in further detail in the Examples below.
A WU-BLAST-2 sequence alignment computer program was used to reveal some degree of sequence identity with known proteins, but was determined not to be significant. Thus, to the best of our knowledge, the DNA61883-1574 sequence encodes a novel transmembrane protein referred to herein as PRO1312.
122. Full length PRO1192 polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1192. In particular, a cDNA encoding a PRO1192 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1192 (shown in FIG. 280 and SEQ ID NO: 389) was found to have amino acid sequence identity with the mass P0-like glycoprotein (GEN12838IP1). It was. Thus, it is now believed that PRO1192 disclosed in this application is a newly identified member of the myelin P0 glycoprotein family.

123. Full-Length PRO1160 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1160. In particular, Applicants have identified and isolated cDNA encoding a PRO1160 polypeptide, as disclosed in further detail in the Examples below.
The DNA62872-1509 clone was isolated from a human milk tissue library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the DNA62872-1509 clone encodes a secreted factor. To the best of our knowledge, the DNA 62872-1509 sequence encodes a novel factor, referred to herein as PRO1160; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein It became.
124. Full-Length PRO1187 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1187. In particular, Applicants have identified and isolated cDNA encoding a PRO1187 polypeptide, as disclosed in further detail in the Examples below.
To the best of our knowledge, the DNA62887-1517 sequence encodes a novel factor, referred to herein as PRO1187; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein It became.

125. Full Length PRO1185 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1185. In particular, Applicants have identified and isolated cDNA encoding a PRO1185 polypeptide, as disclosed in further detail in the Examples below.
To the best of our knowledge, the DNA62881-1515 sequence encodes a novel factor, referred to herein as PRO1185; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein It became.
126. Full Length PRO1345 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1345. In particular, a cDNA encoding a PRO1345 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1345 (shown in FIG. 288 and SEQ ID NO: 403) has amino acid sequence identity with the Bostaurus C-type lectin homologue protein (BTU22298_1) Was found. Thus, PRO1345 disclosed in the present application is now a newly identified member of the C-type lectin protein family and is believed to have activity typical of the tetranectin protein family in particular.

127. Full-Length PRO1245 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1245. In particular, Applicants have identified and isolated cDNA encoding a PRO1245 polypeptide, as disclosed in further detail in the Examples below.
The DNA64888-1527 clone was identified using a method that selects for nucleotide sequences encoding secreted proteins. To the best of our knowledge, the DNA64888-1527 sequence encodes a novel factor referred to herein as PRO1245. A WU-BLAST-2 sequence alignment computer program was used to reveal some degree of sequence identity with known proteins; however, it was determined not to be significant.
128. Full Length PRO1358 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1358. In particular, a cDNA encoding a PRO1358 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1358 (shown in FIG. 292 and SEQ ID NO: 410) was found to have amino acid sequence identity with RASP-1. Therefore, PRO1358 disclosed in the present application is a member of the serpin family of newly identified serine protease inhibitors and has serpin protease inhibitory activity, protein catabolism inhibitory activity and / or associated with tissue regeneration. It is considered to be.

129. Full-Length PRO1195 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1195. In particular, a cDNA encoding a PRO1195 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1195 (shown in FIG. 294 and SEQ ID NO: 412) was proline phosphorus-rich acidic protein from mouse, locus MMU28486, 1995 by John W. Kasik. It was found to have amino acid sequence identity with MMU28486_1, referred to as registration of database GBTRANS: U28486, filed 6 June. Accordingly, it is now believed that PRO1195 disclosed in this application is a newly identified member of this protein family.
130. Full-Length PRO1270 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1270. In particular, cDNA encoding PRO1270 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1270 (shown in FIG. 296 and SEQ ID NO: 414) was found to have amino acid sequence identity with Xenopus lectin protein (XLU86699_1). It was. Therefore, PRO1270 disclosed in the present application is now a newly identified member of the lectin protein family and is believed to have activity typical of this family.

131. Full Length PRO1271 Polypeptide The present invention provides a newly identified and isolated nucleic acid sequence encoding a polypeptide referred to in this application as PRO1271. In particular, Applicants have identified and isolated cDNA encoding a PRO1271 polypeptide, as disclosed in further detail in the Examples below.
To the best of our knowledge, the DNA66309-1538 sequence encodes a novel factor referred to herein as PRO1271; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein (The results are described in the examples below).
132. Full-Length PRO1375 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1375. In particular, cDNA encoding PRO1375 polypeptide, as disclosed in further detail in the Examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1375 (shown in FIG. 300 and SEQ ID NO: 418) was found to have amino acid sequence identity with PUT2. Thus, it is presently believed that PRO1375 disclosed in this application has at least one associated mechanism of PUT2.

133. Full-Length PRO1385 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1385. In particular, Applicants have identified and isolated cDNA encoding a PRO1385 polypeptide, as disclosed in further detail in the Examples below.
The DNA68889-1610 clone was isolated from a human tissue library using a capture technique that selects for nucleotide sequences encoding secreted proteins. That is, the DNA68889-1610 clone encodes a secreted factor. To the best of our knowledge, the DNA68869-1610 sequence encodes a novel factor, referred to herein as PRO1385; using the WU-BLAST-2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein It became.
134. Full-Length PRO1387 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1387. In particular, cDNA encoding PRO1387 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1387 (shown in FIG. 304 and SEQ ID NO: 422) was found to have amino acid sequence identity with the myelin p0 protein precursor (MYP0_HETFR). It was. Thus, PRO1387 disclosed in the present application is now a newly identified member of the myelin protein family and is believed to have activity typical of that family.

135. Full-Length PRO1384 Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to in this application as PRO1384. In particular, cDNA encoding PRO1384 polypeptide, as disclosed in more detail in the examples below, was identified and isolated.
Using the WU-BLAST-2 sequence alignment computer program, the full-length native sequence PRO1384 (shown in FIG. 306 and SEQ ID NO: 424) exhibits amino acid sequence identity with NKG2-D (AF054819_1; Dayhoff database, version 35.45 SwissProt 35). It was found to have. Therefore, PRO1384 disclosed in the present application is a newly identified NKG2 family member and is believed to have MHC activation / inactivation activity typical of the NKG family.

B. PRO variants In addition to the full-length native sequence PRO polypeptides described herein, it is contemplated that PRO variants can also be prepared. PRO variants can be prepared by introducing appropriate nucleotide changes into the PRO polypeptide DNA or by synthesizing the desired PRO polypeptide. One skilled in the art will appreciate that amino acid changes such as changes in the number or position of glycosylation sites or changes in membrane anchoring properties can alter the post-translational process of the PRO polypeptide.
Mutations in the various domains of the native full-length sequence PRO or the PRO polypeptides described herein can be made using any techniques and guidelines for conservative and non-conservative mutations described, for example, in US Pat. No. 5,364,934. be able to. A mutation may be a substitution, deletion or insertion of one or more codons that encode a PRO polypeptide that results in a change in the amino acid sequence of the PRO polypeptide relative to the native sequence PRO. In some cases, the mutation is a substitution of at least one amino acid by any other amino acid in one or more domains of the PRO polypeptide. Guidance on which amino acid residues are inserted, substituted or deleted without adversely affecting the desired activity can be obtained by comparing the sequence of the PRO polypeptide with the sequence of a protein molecule of known homology. Is found by minimizing amino acid sequence changes made in the high region of. Amino acid substitutions can be the result of substitution of one amino acid with another amino acid having similar structural and / or chemical properties, eg, substitution of leucine with serine, ie, a conservative amino acid substitution. Insertions and deletions can optionally be in the range of 1 to 5 amino acids. Acceptable mutations are determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting mutants for activity in any of the in vitro assays described in the Examples below. Is done.

PRO polypeptide fragments are provided herein. Such fragments may be cleaved at the N-terminus or C-terminus, for example, or lack internal residues when compared to a full-length native protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the PRO polypeptide.
PRO fragments may be prepared by any of a number of conventional techniques. Desired peptide fragments may be chemically synthesized. An alternative method is enzymatic digestion, for example by treating the protein with an enzyme known to cleave the protein at a site determined by a particular amino acid residue, or by digesting the DNA with an appropriate restriction enzyme. Production of the PRO fragment by isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding the desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that determine the desired ends of the DNA fragments are used in PCR 5 ′ and 3 ′ primers. Preferably, the PRO polypeptide fragment shares at least one biological and / or immunological activity with the native PRO polypeptide disclosed herein.

In a particular embodiment, the conservative substitutions of interest are shown in Table 1, starting with the preferred substitution. If such a substitution results in a change in biological activity, a more substitutional change is introduced and the product screened, as named in Table 1 as an exemplary substitution or as further described in the amino acid classification below. Is done.
Table 1
Original residue Exemplary substitution Preferred substitution
Ala (A) val; Leu; ile val
Arg (R) lys; gln; asn lys
Asn (N) gln; his; lys; arg gln
Asp (D) glu glu
Cys (C) ser ser
Gln (Q) asn ans
Glu (E) asp asp
Gly (G) pro; ala ala
His (H) asn; gln; lys; arg arg
Ile (I) leu; val; met; ala; phe;
Norleucine leu
Leu (L) norleucine; ile; val;
met; ala; phe ile
Lys (K) arg; gln; asn arg
Met (M) leu; phe; ile leu
Phe (F) leu; val; ile; ala; tyr leu
Pro (P) ala ala
Ser (S) thr thr
Thr (T) ser ser
Trp (W) tyr; phe tyr
Tyr (Y) trp; phe; thr; ser phe
Val (V) ile; leu; met; phe;
ala; norleucine leu

Substitutional modification of the PRO polypeptide function and immunological identity can include (a) the structure of the polypeptide backbone of the substitution region, eg, a sheet or helical configuration, (b) the charge or hydrophobicity of the target site, or (c) This is achieved by selecting substituents that differ substantially in their effects while maintaining the bulk of the side chains. Naturally occurring residues can be grouped based on common side chain properties:
(1) Hydrophobicity: norleucine, met, ala, val, leu, ile;
(2) Neutral hydrophilicity: cys, ser, thr;
(3) Acidity: asp, glu;
(4) Basicity: asn, gln, his, lys, arg;
(5) Residues affecting chain orientation: gly, pro; and (6) Aromatics: trp, tyr, phe.
Non-conservative substitutions will require exchanging one member of these classes for another. Residues so substituted can also be introduced at conservative substitution sites, preferably at remaining (non-conserved) sites.
Mutations can be performed using oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis [Carter et al., Nucl. Acids Res., 13: 4331 (1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restricted selective mutagenesis [Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or other methods known in the art can be used, or other known techniques can be performed on the cloned DNA to generate PRO mutant DNA.
Scanning amino acid analysis can also be used to identify one or more amino acids along adjacent sequences. Preferred scanning amino acids are relatively small and neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is a typically preferred scanning amino acid in this group because it eliminates side chains beyond the beta carbon and is unlikely to change the backbone structure of the mutant. Alanine is also typically preferred because it is the most common amino acid. Furthermore, it is often found in both buried and exposed positions [Creighton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol. Biol., 150: 1 (1976)]. If alanine substitution does not result in a sufficient amount of mutants, isoteric amino acids can be used.

C. Modification of PRO Covalent modifications of PRO polypeptides are included within the scope of the present invention. One type of covalent modification is to react the amino acid residue targeted by the PRO polypeptide with an organic derivatization reagent that can react with a selected side chain or N- or C-terminal residue of the PRO polypeptide. . Derivatization with bifunctional reagents is useful, for example, to cross-link PRO to a surface for use in a water-insoluble support matrix or anti-PRO antibody purification method or vice versa. Commonly used crosslinking agents include, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester, such as 4-azidosalicylic acid, 3,3′-dithiobis (succinimidyl) Homobifunctional imidoesters including disuccinimidyl esters such as propionate), bifunctional maleimides such as bis-N-maleimide-1,8-octane, and methyl-3-[(p-azidophenyl)- Reagents such as dithio] propioimidate.
Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl, hydroxylation of proline and lysine, phosphorylation of the hydroxyl group of seryl or threonyl residues, lysine, arginine, and histidine side chains, respectively. Α-amino group methylation [TE Creighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco, pp. 79-86 (1983)], N-terminal amine acetylation, and optional C-terminus Includes amidation of carboxyl groups.

Another type of covalent modification of a PRO polypeptide included within the scope of the invention involves altering the native glycosylation pattern of the polypeptide. By “altering the native glycosylation pattern” is intended herein the deletion of one or more carbohydrate moieties found in the native sequence PRO (removal of existing glycosylation sites or chemical and / or enzymatic). By means of any deletion of glycosylation by means) and / or addition of one or more glycosylation sites not present in the native sequence PRO. In addition, this clause includes qualitative changes in glycosylation of natural proteins, including changes in the nature and properties of the various carbohydrate moieties present.
Addition of glycosylation sites to the PRO polypeptide may involve amino acid sequence alterations. This alteration may be made, for example, by addition or substitution of one or more serine or threonine residues to the native sequence PRO (O-linked glycosylation site). The PRO amino acid sequence is optionally altered through changes at the DNA level, particularly by mutating the DNA encoding the PRO polypeptide at a preselected base to produce a codon that is translated into the desired amino acid. Also good.

Another means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example in WO 87/05330 issued September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., Pp. 259-306 (1981). Has been described.
Removal of carbohydrate moieties present on the PRO polypeptide can be accomplished chemically or enzymatically, or by mutational substitution of codons encoding amino acid residues presented as targets for glucosylation. Chemical deglycosylation techniques are known in the art, for example, by Hakimuddin et al., Arch. Biochem. Biophys., 259: 52 (1987), and Edge et al., Anal. Biochem., 118: 131 (1981 ). Enzymatic cleavage of the carbohydrate moiety on the polypeptide is accomplished by using various endo and exoglycosidases as described in Thotakura et al., Meth. Enzymol. 138: 350 (1987).
Another type of covalent modification of the PRO of the present invention is described in US Pat. No. 4,640,835 to one of a variety of non-proteinaceous polymers of PRO polypeptides, such as polyethylene glycol, polypropylene glycol, or polyoxyalkylene. 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.

The PRO polypeptides of the present invention may also be modified by methods that form chimeric molecules comprising PRO polypeptides fused to other heterologous polypeptides or amino acid sequences.
In one embodiment, such a chimeric molecule comprises a fusion of a tag polypeptide and a PRO polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally located at the amino or carboxyl terminus of the PRO polypeptide. The presence of such an epitope tag form of a PRO polypeptide can be detected using an antibody against the tag polypeptide. Providing the epitope tag also allows the PRO polypeptide to be readily purified by affinity purification using an anti-tag antibody or other type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8: 2159 -2165 (1988)]; c-myc tag and 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)]; and herpes simplex virus sugars A protein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3 (6): 547-553 (1990)]. Other tag polypeptides include flag peptides [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; KT3 epitope peptides [Martin et al., Science, 255: 192-194 (1992)]; α-tubulin epitope peptides [Skinner et al., J. Biol. Chem., 266: 15163-15166 (1991)]; and T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87: 6393-6397 ( 1990)].
In an alternative embodiment, the chimeric molecule may comprise a PRO immunoglobulin or a fusion with a specific region of an immunoglobulin. For a bivalent form of a chimeric molecule (also referred to as “immunoadhesin”), such a fusion can be the Fc region of an IgG molecule. The Ig fusion preferably comprises a solubilized (transmembrane domain deleted or inactivated) form of the PRO polypeptide in place of at least one variable region within the Ig molecule. In particularly preferred embodiments, the immunoglobulin fusion comprises the hinge, CH2 and CH3, or hinge, CH1, CH2 and CH3 regions of an IgG molecule. For the production of immunoglobulin fusions, see US Pat. No. 5,428,130 issued June 27, 1995.

D. PRO Preparation The following description primarily relates to a method for producing PRO by culturing cells transformed or transfected with a vector containing PRO nucleic acid. Of course, it is believed that the PRO can be prepared using other methods well known in the art. For example, PRO sequences, or portions thereof, may be produced by direct peptide synthesis using solid phase techniques [eg, Stewart et al., Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco, CA (1969). Merrifield, J. Am. Chem. Soc., 85: 2149-2154 (1963)]. In vitro protein synthesis may be performed manually or automatically. Automated synthesis may be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. Various portions of the PRO may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO.

1. Isolation of PRO-encoding DNA PRO-encoding DNA can be obtained from a cDNA library prepared from tissues that carry PRO mRNA and are believed to express it at detectable levels. Accordingly, human PRODNA can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. The PRO-encoded gene can also be obtained from a genomic library or by a known synthesis method (for example, automated nucleic acid synthesis).
Libraries can be screened with probes (such as antibodies to PRO or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by that gene. Screening of cDNA or genomic libraries with selected probes is performed using standard procedures described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). be able to. Another method for isolating the gene encoding the desired PRO polypeptide is to use the PCR method [Sambrook et al., Supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995). ].

The following examples describe cDNA library screening techniques. The oligonucleotide sequence selected as the probe must be long enough and clear enough to minimize false positives. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Labeling methods are well known in the art and include the use of radiolabels such as ³² P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions including moderate stringency and high stringency are given by Sambrook et al., Supra.
Sequences identified in such library screening methods can be compared and aligned with well-known sequences deposited in public databases such as Genbank or personal sequence databases and made available to the public. Sequence identity (either at the amino acid or nucleic acid level) within a determined region or over the entire length of the molecule can be determined using methods known in the art and described herein. .
Nucleic acids having protein coding sequences use the deduced amino acid sequences disclosed herein for the first time and, if necessary, Sambrook et al. Obtained by screening selected cDNA or genomic libraries using conventional primer extension methods as described in.

2. Host Cell Selection and Transformation Host cells are transfected or transformed with the expression or cloning vectors described herein for PRO production, promoters derived, transformants selected, or the desired sequence encoded. In order to amplify the gene to be cultured, it is cultured in a conventional nutrient medium appropriately modified. Culture conditions such as medium, temperature, pH, etc. can be selected by those skilled in the art without undue experimentation. In general, principles, protocols, and practical techniques for maximizing cell culture productivity can be found in Mammalian Cell Biotechnology: a Practical Approach, edited by M. Butler (IRL Press, 1991) and Sambrook et al., Supra. it can.
How prokaryotic cell transfection and eukaryotic cell transfection, for example, CaCl _2, CaPO _4, liposome-mediated and electroporation are known to those skilled in the art. Depending on the host cell used, transformation is done using standard methods appropriate to that cell. Calcium treatment or electroporation with calcium chloride described in Sambrook et al., Supra, is generally used for prokaryotes. Infection with Agrobacterium tumefaciens has been reported in certain plant cells as described in Shaw et al., Gene, 23: 315 (1983) and WO 89/05859 published 29 June 1989. Used for transformation. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52: 456-457 (1978) is preferred. General aspects of mammalian cell host system transformations are described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van solingen et al., J. Bact., 130: 946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. USA, 76: 3829 (1979). Implemented according to the method. However, other methods of introducing DNA into cells, such as nuclear microinjection, electroporation, intact cells, or bacterial protoplast fusion using polycations such as polybrene, polyornithine, etc. can also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods in Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-352 (1988).

  Suitable host cells for cloning or expressing the DNA in the vectors described herein are prokaryotic, yeast, or higher eukaryotic cells. Suitable prokaryotes include, but are not limited to, eubacteria such as Gram negative or Gram positive organisms such as Enterobacteriaceae such as E. coli. Various E. coli strains are available to the public, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strains W3110 (ATCC 27,325) and K5772 (ATCC 53,635). Other preferred prokaryotic host cells are E. coli, such as E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, such as Salmonella typhimurium, Serratia, eg Serratia marcesans ( Serratia marcescans), and Shigella, and Neisseria gonorrhoeae, such as B. subtilis and B. licheniformis (for example, Bacillicenifol described in DD 266,710 issued April 12, 1989) Miss 41P), Pseudomonas, including Enterobacteriaceae such as Pseudomonas aeruginosa and Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is one particularly preferred host or parent host because it is a common host strain for the issuance of recombinant DNA production. Preferably, the host cell secretes a minimal amount of proteolytic enzyme. For example, strain W3110 may be modified to have a genetic mutation in a gene encoding a foreign protein in the cell, examples of such hosts include E. coli W3110 strain 1A2 with the complete genotype tonA; E. coli W3110 strain 9E4 with the complete genotype tonA ptr3; E. coli W3110 strain 27C7 (ATCC 55,244) with the complete genotype tonA prt3 phoA E15 (argF-lac) 169 degP ompTkan (ATCC 55,244); lac) 169 degP ompT rbs7ilvGkan E. coli W3110 strain 37D6; E. coli W3110 strain 40B4, 37D6 strain with non-kanamycin resistant degP deletion mutation; and U.S. Pat. , 946,783, and E. coli strains having the mutant periplasmic protease. Alternatively, in vitro methods of cloning such as PCR or other nucleic acid polymerase polymerase reactions are preferred.

  In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO polypeptide-encoding vectors. Saccharomyces cerevisia is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces prombe (Beach and Nurse, Nature, 290: 140 [1981]; EP 139,383 issued May 2, 1985); Kluveromyces hosts (US patent) No. 4,943,529; Fleer et al., Bio / Technology, 9: 968-975 (1991)), for example, K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al., J. Bacteriol. 737 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), Cedrosophila ( K. drosophilarum (ATCC 36,906; Van den Berg et al., Bio / Technology, 8: 135 (1990)), K. themotolerans and K. marxianus; Yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sheekrishna et al., J. Basic Microbiol, 28: 265-278 [1988]) Candida; Trichodel Malaysia (EP 244,234); Red-skinned mold (Case et al., Proc. Natl. Acad. Sci. USA, 76: 5259-5263 [1979]); Schwanniomyces, eg, Schwanniomyces Occidentalis (EP 394,538 issued October 31, 1990); and filamentous fungi such as Neurospora, Penicillium, Tolypocladium (WO 91/00357 issued January 10, 1991) And Koji fungi, such as pseudonogenic Koji fungi (Ballance et al., Biochem. Biophys. Res. Commun., 112: 284-289 [1983]; Tilburn et al., Gene, 26: 205-221 [1983]; Yelton et al., Proc. Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and black mold (Kelly and Hynes, EMBO J., 4: 475-479 [1985]). Preferred methylotropic yeasts here include, but are not limited to, Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotorula. Includes yeast that can grow on methanol selected from the genus. A list of specific species that are illustrative of this yeast classification is described in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).

  Suitable host cells for the expression of glycosylated PRO are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodospera Sf9, and plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More detailed examples include monkey kidney CV1 strain transformed with SV40 (COS-7, ATCC CRL 1651); human embryonic kidney strain (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77: 4216 (1980)); mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23: 243-251 (1980)) human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); and mouse breast tumor cells ( Including MMT 060562, ATTC CCL51). The selection of an appropriate host cell is within the common general knowledge of this field.

3. Selection and use of replicable vectors Nucleic acids encoding PRO (eg, cDNA or genomic DNA) are inserted into replicable vectors for cloning (amplification of DNA) or expression. Various vectors are publicly available. The vector can be, for example, in the form of a plasmid, cosmid, virus particle, or phage. The appropriate nucleic acid sequence is inserted into the vector by a variety of techniques. In general, DNA is inserted into an appropriate restriction endonuclease site using techniques well known in the art. Vector components generally include, but are not limited to, one or more signal sequences, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Standard ligation techniques known to those skilled in the art are used to generate suitable vectors containing one or more of these components.
PRO is not only produced directly by recombinant techniques, but also as a fusion peptide with a heterologous polypeptide that is a signal sequence or a mature protein or other polypeptide having a specific cleavage site at the N-terminus of the polypeptide. Is also produced. In general, the signal sequence is a component of the vector or a part of the PRO-encoding DNA that is inserted into the vector. The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or a thermostable enterotoxin II leader. For yeast secretion, signal sequences include yeast invertase leader, alpha factor leader (including Saccharomyces and Kluyveromyces alpha factor leaders, the latter being described in US Pat. No. 5,010,182). Or an acid phosphatase leader, a C. albicans glucoamylase leader (EP362179 issued April 4, 1990), or WO 90/13646 published on November 15, 1990. It can be a signal. In mammalian cell expression, mammalian signal sequences may be used for direct secretion of proteins such as signal sequences from the same or related species of secreted polypeptides as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for many bacteria, yeasts and viruses. The origin of replication derived from plasmid pBR322 is suitable for most gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and the various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are suckling. Useful for cloning vectors in animal cells.
Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. Typical selection genes are (a) conferring resistance to antibiotics or other toxins such as ampicillin, neomycin, methotrexate or tetracycline, (b) compensate for auxotrophic defects, or (c) the genetic code for eg Basili It encodes a protein that supplies important nutrients not available from complex media, such as D-alanine racemase.
Examples of markers that can be appropriately selected for mammalian cells are those that can identify cellular components that can take up a PRO-encoding nucleic acid, such as DHFR or thymidine kinase. Suitable host cells when using wild-type DHFR are DHFR activity prepared and grown as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77: 4216 (1980). It is a defective CHO cell line. A suitable selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (1979); Kingman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)]. The trp1 gene provides a selectable marker for a mutant strain of yeast lacking the ability to grow in tryptophan, such as, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].

Expression and cloning vectors usually contain a promoter that is operably linked to the PRO-encoding nucleic acid sequence and controls mRNA synthesis. Suitable promoters that are recognized by a variety of possible host cells are known. Suitable promoters for use in prokaryotic hosts include β-lactamase and lactose promoter systems [Cahng et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, tryptophan (trp ) Promoter system [Goeddel, Nucleic Acids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80: 21-25 (1983). )]including. Promoters used in bacterial systems also have a Shine Dalgarno (SD) sequence operably linked to the DNA encoding PRO.
Examples of suitable promoter sequences for use with yeast hosts include 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochemistry, 17: 4900 (1987)], eg, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, Glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, trioselate isomerase, phosphoglucose isomerase, and glucokinase are included.
Other yeast promoters are inducible promoters that have the additional effect that transcription is controlled by growth conditions, such as alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degrading enzymes related to nitrogen metabolism, metallothionein, glycerin There are promoter regions of aldehyde-3-phosphate dehydrogenase and the enzymes that govern the utilization of maltose and galactose. Vectors and promoters suitably used for expression in yeast are further described in EP 73,657.

PRO transcription from vectors in mammalian host cells is, for example, polyomavirus, infectious epithelioma virus (UK 2,211,504 published July 5, 1989), adenovirus (eg adenovirus 2), bovine papilloma virus, avian Promoters derived from the genomes of viruses such as sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40), heterologous mammalian promoters such as actin promoter or immunoglobulin promoter, and heat shock promoter Is controlled as long as such a promoter is compatible with the host cell system.
Transcription of the DNA encoding the desired PRO by higher eukaryotes can be enhanced by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to enhance its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the late SV40 enhancer (100-270 base pairs) of the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer and the adenovirus enhancer late of the origin of replication. Enhancers can be spliced into the vector at the 5 'or 3' position of the PRO coding sequence, but are preferably located 5 'from the promoter.
Expression vectors used for eukaryotic host cells (nucleated cells from yeast, fungi, insects, plants, animals, humans, or other multicellular organisms) are sequences required for transcription termination and mRNA stabilization. Including. Such sequences can be obtained from the normally 5 ', sometimes 3' untranslated region of eukaryotic or viral DNA or cDNA. These regions contain nucleotide segments that are transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO.
Other methods, vectors and host cells suitable for adapting to the synthesis of PRO in recombinant vertebrate cell culture are Gething et al., Nature, 293: 620-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.

4). Gene amplification / expression detection Gene amplification and / or expression is based on the sequences provided herein, using appropriately labeled probes, eg, conventional Southern blotting, Northern to quantify mRNA transcription Can be measured directly in a sample by blotting [Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization. it can. Alternatively, antibodies capable of recognizing specific double strands including DNA double strands, RNA duplexes and DNA-RNA hybrid duplexes or DNA-protein duplexes can also be used. The antibody can then be labeled and an assay can be performed, where the duplex is bound to the surface, so that the antibody bound to the duplex at the time of formation on the surface of the duplex is bound. The presence can be detected.
Alternatively, gene expression can be measured by immunological methods that directly quantify gene product expression, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids can be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is directed against the native sequence PRO polypeptide, or against a synthetic peptide based on the DNA sequence provided herein, or to an exogenous sequence fused to the PRODNA and encoding a specific antibody epitope. Can be prepared for.

5). Purification of polypeptides PRO forms can be recovered from culture media or lysates of host cells. If membrane-bound, it can be detached from the membrane using an appropriate wash solution (eg Triton-X100) or enzymatic cleavage. Cells used for PRO expression can be disrupted by various chemical or physical means such as freeze-thaw cycles, sonication, mechanical disruption, or cytolytic agents.
It may be desirable to purify PRO from recombinant cell proteins or polypeptides. An example of a suitable purification procedure is purified by the following procedure: fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or a cation exchange resin such as DEAE; chromatofocusing; PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A sepharose column to remove contaminants such as IgG; and metal chelation column to bind the epitope tag form of the PRO polypeptide. It is possible to use many protein purification methods known in the art and described, for example, in Deutcher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). it can. The purification process chosen depends, for example, on the production method used and in particular on the nature of the particular PRO produced.

E. PRO Applications Nucleic acid sequences encoding PRO (or their complementary strands) are widely used in the field of molecular biology, including use as hybridization probes, in chromosome and gene mapping, and in the production of antisense RNA and DNA. Has a use. PRO nucleic acids will also be useful in the preparation of PRO polypeptides by the recombinant techniques described herein.
The full-length native sequence PRO gene or a portion thereof may be isolated from the full-length PRO cDNA or other genes having the desired sequence identity to the PRO sequences disclosed herein (eg, naturally occurring variants of PRO or other species). Can be used as a hybridization probe for a cDNA library for the isolation of PRO. In some cases, the length of the probe is from about 20 to about 50 bases. Hybridization probes may be derived at least in part from novel regions of the full-length native nucleotide sequence, which regions include the promoter, enhancer component and intron of the native sequence PRO without undue experimentation. It can be derived from a sequence. For example, screening methods include isolating a coding region of a PRO polypeptide gene using a well-known DNA sequence to synthesize a selected probe of about 40 bases. Hybridization probes can be labeled with a variety of labels including radioactive nucleotides such as ³² P or ³⁵ S, or enzyme labels such as alkaline phosphatase attached to the probe via an avidin / biotin binding system. A labeled probe having a sequence complementary to the PRO polypeptide gene of the present invention screens a library of human cDNA, genomic DNA or mRNA and determines which members of the library hybridize to the probe. Can be used to do. Hybridization techniques are described in further detail in the examples below.

Any EST disclosed in this application can be used in the manner described herein, as well as a probe.
Other useful fragments of PRO nucleic acids include antisense or sense oligonucleotides comprising single stranded nucleic acid sequences (either RNA or DNA) that can bind to target PRO mRNA (sense) or PRODNA (antisense) sequences. A sense or sense oligonucleotide, according to the present invention, comprises a fragment of the coding region of PRODNA. Such a fragment generally comprises at least about 14 nucleotides, preferably from about 14 to 30 nucleotides. The possibility of controlling antisense or sense oligonucleotides based on a cDNA sequence encoding a given protein is described, for example, by Stein and Cohen (CancerRes. 48: 2659: 1988) and van der Krol et al. (BioTechniques 6: 958, 1988).
Binding of the antisense or sense oligonucleotide to the target nucleic acid sequence results in the formation of a duplex, which can be one of several methods including promoting duplex degradation, premature termination of transcription or translation, or Other methods block transcription or translation of the target sequence. Thus, antisense oligonucleotides are used to block the expression of PRO proteins. Antisense or sense oligonucleotides further include oligonucleotides having modified sugar-phosphodiester backbones (or other sugar linkages, such as those described in WO 91/06629), where such sugar linkages are resistant to endogenous nucleases. is there. Oligonucleotides with such resistant sugar linkages are stable in vivo (ie, able to withstand enzymatic degradation), but retain sequence specificity that allows them to bind to the target nucleotide sequence.
Other examples of sense or antisense oligonucleotides include organic moieties, such as those described in WO 90/10048, and other moieties that improve the affinity of the oligonucleotide for the target nucleic acid sequence, such as poly- ( L-lysine). Furthermore, an intercalating agent such as ellipticine, an alkylating agent or a metal product may be bound to the sense or antisense oligonucleotide to modify the binding specificity of the antisense or sense oligonucleotide to the target nucleotide sequence.
An antisense or sense oligonucleotide is a cell containing a target nucleic acid sequence, for example, by any gene conversion method including CaPO4-mediated DNA transfection, electroporation, or by using a gene conversion vector such as Epstein-Barr virus. To be introduced. In a preferred method, the antisense or sense oligonucleotide is inserted into a suitable retroviral vector. A cell containing the target nucleic acid sequence is contacted with the recombinant retroviral vector in vivo or ex vivo. Suitable retroviral vectors include, but are not limited to, those derived from the murine retrovirus M-MuLV, N2 (retrovirus derived from M-MuLV), or double named DCT5A, DCT5B and DCT5C. Contains a copy vector (see WO 90/13641).
Sense or antisense oligonucleotides may also be introduced into cells containing the target sequence by formation of a complex with a ligand binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, complex formation of the ligand binding molecule substantially reduces the ability of the ligand binding molecule to bind to its corresponding molecule or receptor or to prevent entry of a sense or antisense oligonucleotide or complex thereof into the cell. Does not interfere.
Alternatively, sense or antisense oligonucleotides may be introduced into cells containing the target nucleic acid sequence by formation of oligonucleotide-lipid complexes as described in WO 90/10448. The sense or antisense oligonucleotide-lipid complex is preferably degraded intracellularly by endogenous lipase.

In general, an antibody or sense RNA or DNA molecule is at least about base length, about base 5 length, about 10 base length, about 15 base length, about 20 base length, about 25 base length, about 30 base length, about 35 base length. About 40 base length, about 45 base length, about 50 base length, about 55 base length, about 60 base length, about 65 base length, about 70 base length, about 75 base length, about 80 base length, about 85 base length , About 90 bases, about 95 bases, about 100 bases, or more.
Probes can also be used in PCR techniques to create a pool of sequences for the identification of closely related PRO coding sequences.
The nucleic acid sequence encoding PRO can also be used to create a hybridization probe for mapping the gene encoding the PRO and for gene analysis of individuals with genetic disease. The nucleic acid sequences provided herein can be mapped to specific regions of chromosomes and chromosomes using well known techniques such as in situ hybridization, binding analysis to known chromosomal markers, and hybridization screening in libraries. .
If the PRO coding sequence encodes a protein that binds to another protein (eg, when PRO is a receptor), PRO can be used in an assay to identify its ligand. By such methods, inhibitors of receptor / ligand binding interactions can be identified. Proteins involved in such binding interactions can also be used to screen for peptides or small molecule inhibitors or agonists of binding interactions. Receptor PRO can also be used to isolate related ligands. Screening assays are designed for the discovery of lead compounds that resemble the biological activity of native PRO or its receptor. Such screening assays are also used for high-throughput screening of chemical libraries, making them particularly suitable for the identification of small molecule candidate drugs. Small molecules considered include synthetic organic or inorganic compounds. The assays are performed in a variety of formats including protein-protein binding assays, biological screening assays, immunoassays and cell-based assays that are well known and characterized in the art.

  Nucleic acids encoding PRO or any modified form thereof can also be used to produce transgenic or “knockout” animals, which are useful in the development and screening of therapeutically useful reagents. A transgenic animal (eg, a mouse or rat) is an animal having cells containing a transgene introduced into the animal or its ancestors before birth, eg, at the embryonic stage. A transgene is DNA that is integrated into the genome of a cell in which a transgenic animal develops. In one embodiment, the cDNA encoding the PRO can be used to clone the genomic DNA encoding the PRO by established techniques, and the genomic sequence has cells that express the DNA encoding the PRO. It can be used to produce transgenic animals. Methods for producing transgenic animals, particularly specific animals such as mice or rats, are routine in the art and are described, for example, in US Pat. Nos. 4,736,866 and 4,870,009. Typically, specific cells are targeted for the introduction of the PRO transgene with a tissue-specific enhancer. Transgenic animals containing a copy of a PRO-encoded transgene introduced into the germ line of the animal at the embryonic stage can be used to examine the effects of increased expression of DNA encoding PRO. Such animals can be used, for example, as tester animals for reagents that would confer protection against pathological conditions associated with their overexpression. In this aspect of the invention, if an animal is treated with a reagent and the incidence of the pathological condition is low compared to an untreated animal with the transgene, a therapeutic treatment for the pathological condition is indicated. .

  Alternatively, the non-human homologue of PRO is a defect that encodes PRO by homologous recombination between the modified genomic DNA encoding PRO introduced into an animal embryonic cell and the endogenous gene encoding PRO. Alternatively, it can be used to create PRO “knock-out” animals with altered genes. For example, a cDNA encoding PRO can be used to clone genomic DNA encoding PRO according to established techniques. A portion of the genomic DNA encoding PRO can be deleted or replaced with other genes such as a gene encoding a selectable marker used to monitor integration. Typically, the vector contains several kilobases of intact flanking DNA (both 5 ′ and 3 ′ ends) [eg, Thomas and Capecchi, Cell, 51: 503 (1987) for homologous recombination vectors. checking]. Vectors are introduced into embryonic stem cells (eg, by electroporation), and cells are selected in which the introduced DNA is recombined homologously with endogenous DNA [eg, Li et al., Cell, 69: 915 (1992 )reference]. The selected cells are then injected into the blastocyst of the animal (eg mouse or rat) to form an aggregate chimera [eg Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, ed. , Oxford, 1987), pp. 113-152]. The chimeric embryo is then transplanted into an appropriate pseudopregnant female nanny to create a “knock-out” animal over time. Offspring with DNA homologously recombined into embryonic cells are identified by standard techniques and can be used to breed animals that contain DNA in which all cells of the animal are homologously recombined . Knockout animals are characterized by their ability to defend against certain pathological conditions and the progression of those pathological conditions due to the absence of PRO polypeptides.

  Nucleic acids encoding PRO polypeptides can also be used for gene therapy. In gene therapy applications, genes are introduced to achieve in vivo synthesis of a therapeutically effective amount of a gene product, eg, to replace a defective gene. “Gene therapy” includes both conventional gene therapy in which a continuous effect is achieved by a single treatment and administration of a gene therapy drug including single or repeated administration of therapeutically effective DNA or mRNA. . Antisense RNA and DNA can be used as therapeutic agents to block in vivo expression of certain genes. It has already been shown that short antisense oligonucleotides can be transferred into cells that act as inhibitors, despite low intracellular concentrations due to restricted uptake by the cell membrane (Zamecnik et al., Proc. Natl Acad. Sci. USA 83: 4143-4146 [1986]). Oligonucleotides may be modified to facilitate uptake by replacing their negatively charged phosphodiester groups with uncharged groups.

  There are a variety of techniques for introducing nucleic acids into viable cells. These techniques vary depending on whether the nucleic acid is transferred to the cultured cells in vitro or in vivo in the intended host cell. Suitable methods for transferring nucleic acids into mammalian cells in vitro include liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, calcium phosphate precipitation, and the like. Currently preferred in vivo gene transfer techniques are transfection with viral (typically retroviral) vectors and viral coat protein-liposome mediated transfection (Dzau et al., Trends, in Biotechnology 11, 205-219). In some situations, it may be desirable to provide a source of nucleic acid with an agent that targets the target cell, such as a cell surface membrane protein or an antibody specific for the target cell, a ligand for a receptor on the target cell. When using liposomes, proteins that bind to cell surface membrane proteins with endocytosis, such as specific cell-type capsid proteins or fragments thereof, antibodies to proteins that undergo internalization in the cycle, intracellular localization Proteins that target and improve intracellular half-life are used to promote targeting and / or uptake. Receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol. Chem. 262, 4429-2232 (1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414 (1990). Has been. For a review of gene generation and gene therapy protocols, see Anderson et al., Science 256, 808-813 (1992).

The PRO polypeptides described herein may be used as molecular weight markers for protein electrophoresis purposes.
Nucleic acid molecules encoding the PRO polypeptides or fragments thereof described herein are useful for chromosome identification. In this regard, there is a need to identify new chromosomal markers, since chromosomal marking reagents based on actual sequences are hardly available. Each PRO nucleic acid molecule of the present invention can be used as a chromosomal marker.
The PRO polypeptides and nucleic acid molecules of the invention can also be used for tissue typing, and the PRO polypeptides of the invention have different expression in one tissue compared to the other. PRO nucleic acid molecules will find use for generating probes for PCR, Northern analysis, Southern analysis and Western analysis.
The PRO polypeptides described herein may be used as therapeutic agents. The PRO polypeptides of the invention are formulated according to known methods for preparing pharmaceutically useful compositions, whereby the PRO product is mixed with a pharmaceutically acceptable carrier medium. The therapeutic formulation is in the form of a lyophilized formulation or an aqueous solution by mixing any pharmaceutically acceptable carrier, excipient or stabilizer with an active ingredient having the desired degree of purification ( Remington's Pharmaceutical Sciences, 16th edition, A. Osol, Ed., [1980]), prepared and stored. Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations used and are buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid Agent; low molecular weight (less than 10 residues) polypeptide; protein such as serum albumin, gelatin or immunoglobulin; hydrophilic polymer such as polyvinylpyrrolidone; amino acid such as glycine, glutamine, asparagine, arginine or lysine; glucose, Monosaccharides such as mannose or dextrin, disaccharides or other carbohydrates, chelating agents such as EDTA, sugars such as mannitol or sorbitol, salt-forming counterions such as sodium; and / or TWEEN (trade name), PLURONICS (trade name) Or a nonionic surfactant such as polyethylene glycol (PEG).
The formulation used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filter membranes before or after lyophilization and reconstitution.
Here, the pharmaceutical composition of the present invention is generally placed in a container having a sterile access port, for example, an intravenous bag or a vial having a stopper pierceable by a hypodermic needle.
The route of administration is by well-known methods such as injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or intralesional route, local administration, or sustained release system.
The dosage of the pharmaceutical composition of the invention and the desired drug concentration will vary depending on the particular intended use. Determination of the appropriate dose or route of administration is within the skill of the ordinary physician. Animal experiments provide reliable guidance for determining effective doses for human therapy. Effective species interspecific scaling is described in Toxicokinetics and New Drug Development, Yacobi et al., Ed., Pergamon Press, New York 1989, pp. 42-96, Mordenti, J. and chappell, W. Can be carried out according to the principle described in.

When in vivo administration of a PRO polypeptide or agonist or antagonist thereof is used, the normal dosage is about 10 ng / kg to 100 mg / kg, preferably about 1 μg per day per mammal body weight, depending on the route of administration. / Kg / day to 10 mg / kg / day. Specific dosage and delivery method guidelines are given in the literature; see, eg, US Pat. Nos. 4,657,760, 5,206,344, or 5,225,212. It is anticipated that different formulations will be effective for different therapeutic compounds and different diseases, eg, administration targeting one organ or tissue will require delivery in a different manner than other organs or tissues Is done.
Where sustained release of the PRO polypeptide is desired in a formulation with release characteristics suitable for the treatment of any disease or condition that requires administration of the PRO polypeptide, microencapsulation of the PRO polypeptide is contemplated. Microencapsulation of recombinant proteins for sustained release has been successfully performed with human growth hormone (rhGH), interferon (rhIFN), interleukin-2, and MNrgp120. Johnson et al., Nat. Med., 2: 795-799 (1996); Yasuda, Biomed. Ther., 27: 1221-1223 (1993); Hora et al., Bio / Technology, 8: 755-758 (1990); Cleland , `` Design and Production of Single Immunization Vaccines Using Polyactide Polyglycolide Microsphere Systems '' Vaccine Design: The Subunit and Adjuvant Approach, edited by Powell and Newman, (Plenum Press: New York, 1995), p. 439-462; WO 97/03692, WO 96/40072, WO 96/07399; and US Pat. No. 5,564,010.

Sustained release formulations of these proteins have been developed using poly-lactic-coglycolic acid (PLGA) polymers based on their biocompatibility and a wide range of biodegradation properties. The degradation products of PLGA, lactic acid and glycolic acid, are cleared immediately in the human body. Furthermore, the degradability of the polymer can be adjusted from months to years depending on the molecular weight and composition. Lewis, “Controlled release of bioactive agents from lactide / glycolide polymer”: M. Chasin and R. Langer (eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41.
The invention also encompasses methods of screening compounds to identify those that are similar to PRO polypeptides (agonists) or that inhibit the effects of PRO polypeptides (antagonists). Screening assays for candidate antagonist drugs include compounds that bind to or complex with the PRO polypeptide encoded by the gene identified herein, or other compounds that inhibit the interaction of the encoded polypeptide with other cellular proteins Designed to identify Such screening assays include those applicable to high-throughput screening of chemical libraries that make it particularly suitable for the identification of small molecule drug candidates.
This assay is performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, known in the art.
All assays for antagonists require that they contact the candidate drug with the PRO polypeptide encoded by the nucleic acid identified here under conditions and for a time sufficient for these two components to interact. Is common.
In binding assays, the interaction is binding and the complex formed is isolated or detected in the reaction mixture. In a particular embodiment, the PRO polypeptide or candidate drug encoded by the gene identified herein is immobilized to a solid phase, such as a microtiter plate, by covalent or non-covalent bonding. Non-covalent binding is generally achieved by coating a solid surface with a solution of the polypeptide and drying. Alternatively, an immobilized antibody specific for the immobilized PRO polypeptide, such as a monoclonal antibody, can be used to anchor it to a solid surface. The assay is performed by adding a non-immobilized component, which may be labeled with a detectable label, to a coated surface containing an immobilized component, such as an anchoring component. When the reaction is completed, unreacted components are removed, for example, by washing, and the complex adhered to the solid surface is detected. If the first non-immobilized component has a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the initial non-immobilized component does not have a label, complex formation can be detected, for example, by a labeled antibody that specifically binds to the immobilized complex.

  If a candidate compound interacts but does not bind to a specific PRO polypeptide encoded by the gene identified herein, its interaction with the polypeptide is determined by well-known methods for detecting protein-protein interactions. Can be assayed. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through a gradient or chromatographic column. Furthermore, protein-protein interactions are described in Fields and co-workers [Fiels and Song, Nature (London) 340, 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA 88, 9578-9582. (1991)] by using the yeast-based gene system described in Chevray and Nathans [Proc. Natl. Acad. Sci. USA 89, 5789-5793 (1991)]. It can be monitored using the system. Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one that acts as a DNA binding domain and the other that functions as a transcriptional activation domain. The yeast expression system described in the previous literature (commonly referred to as the “2-hybrid system”) takes advantage of this property and uses two hybrid proteins while the target protein is the DNA binding domain of GAL4. On the other hand, the candidate activation protein is fused to the activation domain. Expression of the GAL1-lacZ reporter gene under the control of a GAL4-activated promoter depends on reconstitution of GAL4 activity through protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. A complete kit (MATCHMAKER®) for identifying protein-protein interactions between two specific proteins using the two-hybrid technology is commercially available from Clontech. This system can also be extended to the mapping of protein domains involved in a particular protein interaction as well as the identification of amino acid residues important for this interaction.

Compounds that inhibit the interaction of the gene encoding the PRO polypeptide identified herein with intracellular or extracellular components can be tested as follows: Usually the reaction mixture is the gene product and extracellular or intracellular. The ingredients are prepared to include the conditions and time that the two products interact and bind. In order to test the ability of a candidate compound to inhibit binding, the reaction is performed in the absence and presence of the test compound. In addition, a placebo may be added to the third reaction mixture to provide a positive control. The binding (complex formation) between the test compound and the intracellular or extracellular component present in the mixture is monitored as described above. Formation of the complex in the control reaction but not the reaction mixture containing the test compound indicates that the test compound inhibits the interaction between the test compound and its binding partner.
To assay for an antagonist, a PRO polypeptide may be added with a compound that is screened for a particular activity, and the ability of the compound to inhibit the activity of interest in the presence of the PRO polypeptide is that the compound is an antagonist of the PRO polypeptide. Indicates that there is. Alternatively, antagonists may be detected by binding potential antagonists with PRO polypeptides and membrane-bound PRO polypeptide receptors or recombinant receptors under conditions suitable for competitive inhibition assays. PRO polypeptides can be labeled, such as by radioactivity, and the number of PRO polypeptides bound to the receptor can be used to determine the effectiveness of a potential antagonist. The gene encoding the receptor can be identified by a number of methods known to those skilled in the art, such as ligand panning and FACS sorting. Coligan et al., Current Protocols in Immun., 1 (2): Chapter 5 (1991). Preferably, expression cloning is used, polyadenylated RNA is prepared from cells reactive to the PRO polypeptide, cDNA libraries generated from this RNA are distributed into pools, and COS cells or other non-PRO polypeptide reactive Used for cell transfection. Transfected cells grown on glass slides are exposed to labeled PRO polypeptide. PRO polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. After fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified, and subpools are prepared and retransfected using an interactive subpooling and rescreening process, resulting in the generation of a single clone encoding the putative receptor.
As an alternative method of receptor identification, the labeled PRO polypeptide can be photoaffinity bound to a cell membrane or extract preparation that expresses the receptor molecule. The cross-linked material is dissolved in PAGE and exposed to X-ray film. The labeled complex containing the receptor can be excited, separated into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing is used to design a set of degradable oligonucleotide probes that screen a cDNA library that identifies the gene encoding the putative receptor.

In other assays for antagonists, mammalian cells or membrane preparations that express the receptor are incubated with labeled PRO polypeptide in the presence of the candidate compound. The ability of the compound to promote or block this interaction is then measured.
More specific examples of potential antagonists include oligonucleotides that bind to fusions of immunoglobulins and PRO polypeptides, particularly but not limited to polypeptide- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-chains, -Idiotype antibodies, and chimeric or humanized forms of these antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Alternatively, a potential antagonist may be a closely related protein, eg, a variant form of a PRO polypeptide that recognizes but does not have an effect on the receptor and thus competitively inhibits the action of the PRO polypeptide.
Other potential PRO polypeptide antagonists are antisense RNA or DNA constructs prepared using antisense technology, for example, antisense RNA or DNA hybridizes to target mRNA and interferes with protein translation It acts to directly block the translation of mRNA. Antisense technology can be used to control gene expression through triple helix formation or antisense DNA or RNA, both of which are based on the binding of polypeptide nucleotides to DNA or RNA. For example, the 5 ′ coding portion of the polypeptide nucleotide sequence encoding the mature PRO polypeptide herein is used in the design of antisense RNA oligonucleotides of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to a region of the gene involved in transcription (Triple Helix-Lee et al., Nucl, Acid Res., 6: 3073 (1979); Cooney et al., Science, 241: 456 (1988); Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and production of PRO polypeptides. Antisense RNA oligonucleotides hybridize to mRNA in vivo and block translation of mRNA molecules into PRO polypeptides (Osense-Okano, Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression ( SRS Press: Boca Raton, FL, 1988)). The oligonucleotides described above can also be transported into cells to express antisense RNA or DNA in vivo to inhibit PRO polypeptide production. When antisense DNA is used, oligodeoxyribonucleotides derived from the translation initiation site, eg, between -10 and +10 positions of the target gene nucleotide sequence, are preferred.

Potential antagonists include small molecules that bind to the active site, receptor binding site, or growth factor or other relevant binding site of a PRO polypeptide, thereby blocking the normal biological activity of the PRO polypeptide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptide organic or inorganic compounds.
Ribozymes are enzymatic RNA molecules that can catalyze the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by nucleotide strand breaks. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details see, for example, Rossi, Current Protocols in Biology 4: 469-471 (1994) and PCT Publication No. WO 97/33551 (issued September 18, 1997).
Nucleic acid molecules in triple helix formation used for transcription inhibition are single-stranded and composed of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via Hoogstin base pairing rules, which generally requires a resizable extension of purines or pyrimidines on one strand of the duplex . For further details see, for example, PCT Publication No. WO 97/33551, supra.
These small molecules can be identified by any one or more of the screening assays discussed above and / or by any other screening technique well known to those skilled in the art.
PRO189 can be used in assays with nematode W01A6.1, phosphodiesterase, transporter and proteins that bind to fatty acids to determine the relative activity of PRO189 against these proteins. The results can be used as appropriate.

F. Anti-PRO Antibody The present invention further provides an anti-PRO antibody. Examples of antibodies include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies.
1. Polyclonal antibodies Anti-PRO antibodies include polyclonal antibodies. Methods for preparing polyclonal antibodies are known to those skilled in the art. Polyclonal antibodies in mammals can be generated by one or more injections of, for example, an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and / or adjuvant is injected into the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent can comprise a PRO polypeptide or a fusion protein thereof. It is useful to conjugate the immunizing agent to a protein that is known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants that can be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol will be selected by one skilled in the art without undue experimentation.

2. Monoclonal antibody Alternatively, the anti-PRO antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared using the hybridoma method as described in Kohler and Milstein, Nature, 256: 495 (1975). In hybridoma methods, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to generate antibodies that specifically bind to the immunizing agent or to generate lymphocytes that can be generated. Trigger. Lymphocytes can also be immunized in vitro.
The immunizing agent typically comprises a subject PRO polypeptide or a fusion protein thereof. Generally, peripheral blood lymphocytes ("PBL") are used when cells derived from humans are desired, or spleen cells or lymph node cells are used when non-human mammalian sources are desired. Subsequently, lymphocytes are fused with immortalized cell lines using an appropriate fusion agent such as polyethylene glycol to form hybridoma cells [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59- 103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells from rodents, cows and humans. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells are preferably cultured in a suitable medium containing one or more substances that inhibit the survival or growth of unfused, immortalized cells. For example, if the parent cell lacks the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the hybridoma medium typically contains hypoxatin, aminopetitin and thymidine ("HAT medium"). This substance prevents the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, support stable high levels of antibody expression by selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortalized cell line is the mouse myeloma line, which is available, for example, from the Salk Institute Cell Distribution Center in San Diego, California and the American Type Culture Collection in Rockville, Maryland. Human myeloma and mouse-human heteromyeloma cell lines for generating human monoclonal antibodies have also been disclosed [Kozbor, J. Immunol., 133: 3001 (1984), Brodeur et al., Monoclonal Antibody Production Techniques and Applications. , Marcel Dekker, Inc., New York, (1987) pp. 51-63].
The culture medium in which the hybridoma cells are cultured is then assayed for the presence of monoclonal antibodies against PRO. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is measured by an immunoprecipitation or in vitro binding assay such as radioimmunoassay (RIA) or enzyme-linked immunoassay (ELISA). Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can be measured, for example, by the Scatchard analysis method by Munson and Pollard, Anal. Biochem., 107: 220 (1980).

After the desired hybridoma cells are identified, the clones can be subcloned by a limiting dilution step and grown by standard methods [Goding, supra]. Suitable media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown as ascites in vivo in a mammal.
Monoclonal antibodies secreted by the subclone can be isolated from the culture medium or ascites fluid by conventional immunoglobulin purification methods such as protein A-Sepharose method, hydroxylapatite chromatography method, gel electrophoresis method, dialysis method or affinity chromatography. Separated or purified.
Monoclonal antibodies can also be made by recombinant DNA methods, such as those described in US Pat. No. 4,816,567. The DNA encoding the monoclonal antibody of the present invention can be easily obtained using a conventional method (for example, using an oligonucleotide probe capable of specifically binding to the gene encoding the heavy and light chains of the mouse antibody). Can be isolated and sequenced. The hybridoma cells of the present invention are a preferred source of such DNA. Once isolated, the DNA can be placed in an expression vector that is transfected into a host cell, such as a monkey COS cell, a Chinese hamster ovary (CHO) cell, or a myeloma cell that does not produce immunoglobulin protein. And monoclonal antibodies can be synthesized in recombinant host cells. DNA can also be replaced by, for example, the human heavy and light chain constant domain coding sequences in place of homologous mouse sequences [US Pat. No. 4,816,567; Morrison et al., Supra], or nonimmune to immunoglobulin coding sequences. Modification can be made by covalently linking part or all of the globulin polypeptide coding sequence. Such non-immunoglobulin polypeptides can be substituted for the constant domains of the antibodies of the invention, or can be substituted for the variable domains of one antigen binding site of the antibodies of the invention, producing chimeric bivalent antibodies.
The antibody may be a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chains and modified heavy chains. The heavy chain is generally cleaved at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted or deleted with other amino acid residues to prevent crosslinking.
In vitro methods are also suitable for preparing monovalent antibodies. Generation of fragments, particularly Fab fragments, by antibody digestion can be accomplished using conventional techniques known in the art.

3. Human and humanized antibodies The anti-PRO antibodies of the present invention further include humanized antibodies or human antibodies. Humanized forms of non-human (eg mouse) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg Fv, Fab, Fab ′, F (ab ′) ₂ or other antigen binding subsequences of antibodies). And contains the minimum sequence derived from non-human immunoglobulin. A humanized antibody is a CDR residue of a non-human species (donor antibody) in which the complementarity determining region (CDR) of the recipient has the desired specificity, affinity and ability, such as mouse, rat or rabbit. Human immunoglobulin (recipient antibody) substituted by In some examples, human immunoglobulin Fv framework residues are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, a humanized antibody has at least one, typically all or almost all CDR regions corresponding to those of non-human immunoglobulin and all or almost all FR regions of human immunoglobulin consensus sequences, typically Contains substantially all of the two variable domains. Humanized antibodies optimally comprise at least part of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-329 (1988); and Presta, Curr. Op Struct. Biol., 2: 593-596 (1992)].

Methods for humanizing non-human antibodies are well known in the art. Generally, one or more amino acid residues derived from non-human are introduced into a humanized antibody. These non-human amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain. Humanization basically involves winter and co-workers [Jones et al., Nature, 321: 522-525 (1986); Riechmann; Et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)] by replacing the rodent CDR or CDR sequence with the corresponding sequence of a human antibody. To be implemented. Thus, such “humanized” antibodies are chimeric antibodies (US Pat. No. 4,816,567) wherein substantially less than an intact human variable domain has been substituted with the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
Human antibodies also include phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1992); Marks et al., J. Mol. Biol., 222: 581 (1991)]. It can also be created using various known methods. Also, methods such as Cole et al. And Boerner et al. Can be used for the preparation of human monoclonal antibodies [Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. P. 77 (1985) and Boerner et al., J. Immunol. , 147 (1): 86-95 (1991)]. Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, eg, mice in which the endogenous immunoglobulin genes are partially or completely inactivated. Upon administration, human antibody production is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in US Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016 and the following scientific literature: Marks et al., Bio / Technology 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14 , 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

4). Bispecific antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized antibodies, that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for PRO and the other is for any other antigen, preferably a cell surface protein or receptor or receptor subunit.
Methods for making bispecific antibodies are well known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain / light chain pairs where the two heavy chains have different specificities [Milstein and Cuello, Nature, 305: 537-539 (1983)]. Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, only one of which has the correct bispecific structure. Purification of the correct molecule is usually achieved by an affinity chromatography step. Similar procedures are disclosed in WO 93/08829 published May 13, 1993 and Traunecker et al., EMBO J., 10: 3655-3656 (1991).
Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. Desirably, at least one fusion has a first heavy chain constant region (CH1) containing the site necessary for light chain binding. The DNA encoding the immunoglobulin heavy chain fusion and, if desired, the immunoglobulin light chain are inserted into separate expression vectors and cotransfected into a suitable host organism. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).

According to another method described in WO 96/27011, the interface between a pair of antibody molecules can be manipulated to maximize the proportion of heterodimers recovered from recombinant cell culture. A suitable interface includes at least a portion of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). A complementary “cavity” of the same or similar size as the large side chain is created at the interface of the second antibody molecule by replacing the large amino acid side chain with a small one (eg, alanine or threonine). This provides a mechanism to increase the yield of heterodimers over other unwanted end products such as homodimers.
Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg F (ab ′) ₂ bispecific antibodies). Techniques for producing bispecific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science, 229: 81 (1985) describes a procedure in which intact antibodies are proteolytically cleaved to produce F (ab ′) ₂ fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The produced Fab ′ fragment is then converted to a thionitrobenzoate (TNB) derivative. One of the Fab′-TNB derivatives is then reconverted to Fab′-thiol by reduction with mercaptoethylamine and mixed with an equimolar amount of other Fab′-TNB derivatives to form bispecific antibodies. The produced bispecific antibody can be used as a drug for selective immobilization of an enzyme.
Fab ′ fragments can be recovered directly from E. coli, which can be chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225 (1992) describes the preparation of _two fully humanized bispecific antibody F (ab ′) molecules. Each Fab ′ fragment is secreted separately from E. coli and undergoes directed chemical coupling in vitro to form bispecific antibodies. The bispecific antibody thus formed is capable of binding to normal human T cells and cells overexpressing ErbB2 receptor, and triggers cytolytic activity of human cytotoxic lymphocytes against human breast tumor targets. Become.

Various methods for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol. 148 (5): 1547-1553 (1992). Leucine zipper peptides from Fos and Jun proteins are linked to the Fab ′ portions of two different antibodies by gene fusion. Antibody homodimers are reduced at the hinge region to form monomers and then reoxidized to form antibody heterodimers. This method can also be used for the production of antibody homodimers. The “diabody” technique described by Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993) provided an alternative mechanism for generating bispecific antibody fragments. A fragment consists of a heavy chain variable domain (V _H ) joined to a light chain variable domain (V _L ) by a linker that is short enough to allow pairing between two domains on the same chain. Thus, the V _H and V _L domains of one fragment are forced to pair with the complementary V _L and V _H domains of another fragment to form two antigen binding sites. Other strategies for producing bispecific antibody fragments by the use of single chain Fv (sFv) dimers have also been reported. See Gruber et al., J. Immunol. 152: 5368 (1994).
More than bivalent antibodies are also contemplated. For example, trispecific antibodies can be prepared. Tutt et al. J. Immunol. 147: 60 (1991).
Exemplary bispecific antibodies can bind to two different epitopes of the PRO polypeptide provided herein. Alternatively, the anti-PRO polypeptide arm can be a trigger molecule on leukocytes such as a T cell receptor molecule (eg, CD2, CD3, CD28, or B7) so as to focus the cytoprotective mechanism on specific PRO polypeptide expressing cells. Alternatively, it can bind to an arm that binds to an Fc receptor for IgG (FcγR) such as FcγRI (CD64), FcγRII (CD32) and FcγRIII (CD16). Bispecific antibodies can also be used to localize cytotoxic agents to cells that express a particular PRO polypeptide. These antibodies have a PRO binding arm and an arm that binds to a cytotoxic or radiochelating agent such as EOTUBE, DPTA, DOTA, or TETA. Other bispecific antibodies of interest bind to the PRO polypeptide and further bind to tissue factor (TF).
5). Heteroconjugate antibodies Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies consist of two covalently bound antibodies. Such antibodies are used, for example, to target immune system cells to unwanted cells [US Pat. No. 4,676,980] and for the treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. Proposed. This antibody could be prepared in vitro using known methods in synthetic protein chemistry, including those related to crosslinkers. For example, immunotoxins can be made using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in US Pat. No. 4,6767,980.

6). Processing of Effector Function It is desirable to modify the antibody of the present invention for effector function, for example to improve the effectiveness of the antibody in treating cancer. For example, a cysteine residue may be introduced into the Fc region, thereby forming an interchain disulfide bond in this region. Allogeneic dimeric antibodies so generated can have improved internalization ability and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, BJ Immunol. 148: 2918-2922 (1992). Allogeneic dimeric antibodies with improved anti-tumor activity can also be prepared using heterobifunctional cross-linking as described in Wolff et al., Cancer research 53: 2560-2565 (1993). Alternatively, the antibody can be engineered to have two Fc regions, thereby improving complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3: 219-230 (1989).

7). Immunoconjugates The present invention also provides for chemotherapeutic agents, cytotoxic agents such as toxins (eg, enzymatically active toxins from bacteria, fungi, plants or animals, or fragments thereof), or radioisotopes (ie, radioconjugates). It also relates to an immune complex comprising a conjugated antibody.
Chemotherapeutic agents useful for the generation of such immune complexes have been described above. Enzyme-active toxins and fragments thereof that can be used include diphtheria A chain, non-binding active fragment of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain , Alpha-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana protein (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, crusin (curcin), crotin, sapaonaria oficinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, phenomycin, enomycin and trichothecene )including. A variety of radioactive nucleotides are available for the production of radioconjugated antibodies. Examples include ²¹² Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y, and ¹⁸⁶ Re.

The conjugates of antibodies and cytotoxic agents are various bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), imidoester bifunctionality. Derivatives (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azide compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium Using derivatives (such as bis- (p-diazoniumbenzoyl) -ethylenediamine), diisocyanates (such as triene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene) Can be created. For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to the antibody. See WO 94/11026.
In other embodiments, the antibody may be conjugated to a “receptor” (such as streptavidin) for use in tumor pre-targeting, and the antibody-receptor complex is administered to the patient, followed by a clarifier. Used to remove unbound complexes from the circulation, followed by administration of a “ligand” (eg, avidin) conjugated to a cytotoxic agent (eg, a radionucleotide, etc.).

8). Immunoliposomes The antibodies disclosed herein may also be prepared as immunoliposomes. Liposomes containing antibodies are described in Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); Prepared by methods known in the art, such as described in 4,485,045 and 4,544,545. Liposomes with improved circulation time are disclosed in US Pat. No. 5,013,556.
Particularly useful liposomes are generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through a filter of a predetermined size to produce liposomes having a desired diameter. Fab ′ fragments of antibodies of the invention can be conjugated to liposomes via a disulfide exchange reaction as described in Martin et al., J. Biol. Chem. 257: 286-288 (1982). A chemotherapeutic agent (such as doxorubicin) is optionally contained within the liposome. See Gabizon et al., J. National Cancer Inst. 81 (19) 1484 (1989).

9. Antibody Pharmaceutical Compositions Antibodies that specifically bind to the PRO polypeptides identified herein, as well as other molecules identified in the screening assays disclosed above, are useful for the treatment of various diseases. It can be administered in the form.
When the PRO polypeptide is intracellular and the whole antibody is used as an inhibitor, an internalizing antibody is preferred. However, lipofection or liposomes can also be used to introduce antibodies, or antibody fragments, into cells. Where antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules that retain the ability to bind to a target protein sequence can be designed based on the variable region sequence of the antibody. Such peptides can be synthesized chemically or can be produced by recombinant DNA techniques. See, for example, Marasco et al., Proc. Natl. Acad. Sci. USA 90, 7889-7893 (1993). The formulations herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively or in addition, the composition may comprise a cytotoxic agent, cytokine or growth inhibitor. These molecules are suitably present in combination in amounts that are effective for the purpose intended.
The active ingredient can also be used in colloidal drug delivery systems (eg, in microcapsules prepared by coacervation techniques or by interfacial polymerization, eg, hydroxymethylcellulose or gelatin-microcapsules and poly (methyl methacrylate) microcapsules, respectively. , Liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or microemulsions. These techniques are disclosed in Remington's Pharmaceutical Science, supra.
The formulation used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filtration membranes.
Sustained release formulations may be prepared. Suitable examples of sustained release formulations include a semi-permeable matrix of solid hydrophobic polymer containing antibodies, which matrix is in the form of a molded article, such as a film or microcapsule. Examples of sustained release matrices include polyester hydrogels (eg, poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polyactides (US Pat. No. 3,773,919), L-glutamic acid and γ-ethyl-L-glutamate. , Non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT (trade name) (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate), poly- (D) -3-hydroxy Contains butyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid can release molecules for over 100 days, certain hydrogels release proteins in a shorter time. When encapsulated antibodies remain in the body for a long time, they denature or aggregate upon exposure to moisture at 37 ° C, resulting in reduced biological activity and possible changes in immunogenicity. . Reasonable methods can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is found to be intermolecular S—S bond formation through thio-disulfide exchange, stabilization may include modification of sulfhydryl residues, lyophilization from acidic solutions, control of water content, appropriate Addition of various additives and the development of specific polymer matrix compositions.

G. Uses of anti-PRO antibodies The anti-PRO antibodies of the present invention have various utilities. For example, anti-PRO antibodies are used in PRO diagnostic assays, such as detecting its expression in specific cells, tissues, or serum. Competitive binding assays, direct or indirect sandwich assays, and immunoprecipitation assays performed in heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc. (1987) pp. 147-158] Various diagnostic assay techniques known in the art are used. Antibodies used in diagnostic assays are labeled with a detectable moiety. The detectable site must generate a detectable signal, either directly or indirectly. For example, the detectable moiety may be a radioisotope such as ³ H, ¹⁴ C, ³² P, ³⁵ S or ¹²⁵ I, a fluorescent or chemiluminescent compound such as fluorescein isothiocyanate, rhodamine or luciferin, or alkaline phosphatase, beta-galactosidase Or it may be an enzyme such as horseradish peroxidase. Any method known in the art can be used to conjugate the detectable site to the antibody, including Hunter et al. Nature, 144: 945 (1962); David et al., Biochemistry, 13: 1014 (1974); Et al., J. Immunol. Meth., 40: 219 (1981); and Nygren, J. Histochem. And Cytochem., 30: 407 (1982).
Anti-PRO antibodies are also useful for affinity purification of PRO from recombinant cell culture or natural sources. In this method, the antibody against PRO is immobilized on a suitable support such as Sephadex resin or filter paper using methods well known in the art. Next, after the immobilized antibody is brought into contact with a sample containing PRO to be purified, the support is supported with an appropriate solvent that removes substantially all substances in the sample other than PRO bound to the immobilized antibody. Wash. Finally, the support is washed with another suitable solvent that will release PRO from the antibody.
The following examples are provided for purposes of illustration only and are not intended to limit the scope of the invention in any way.
All patents and references cited herein are hereby incorporated by reference in their entirety.

All commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. The source of cells identified by the ATCC registration number throughout the following examples and specification is American Type Culture Collection, Manassas, VA.
Example 1: Extracellular domain homology screening to identify novel polypeptides and cDNAs encoding them
Extracellular domain (ECD) sequences from about 950 known secreted proteins from the Swiss-Prot public database (including secreted signal sequences, if necessary) were used to search the EST database. EST databases include public databases (eg, Dayhoff, GenBank) and proprietary databases (eg, LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequence with a 6-frame translation of the EST sequence. Comparisons that do not encode known proteins and have a Blast score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, WA) and consensus DNA sequences Built in.
Using this extracellular domain homology screen, consensus DNA sequences were constructed against other identified EST sequences using phrap. Furthermore, the resulting consensus DNA sequence is often extended using repeated cycles of BLAST or BLAST-2 and phrap (if not all) and the consensus sequence is as long as possible using the sources of EST sequences discussed above. Elongated.
Based on the consensus sequence obtained as described above, oligonucleotides are then synthesized, and a cDNA library containing the sequence of interest is identified by PCR, and a clone of the full-length coding sequence of the PRO polypeptide is isolated. Used for use as a probe. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products that are about 100-1000 bp long. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR with PCR primer pairs, such as Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
The cDNA library used for isolation of the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, approximately sized by gel electrophoresis, and an appropriate cloning vector (such as pRKB or pRK5D; pRK5B is a precursor of pRKD that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) and was cloned in a defined orientation at unique XhoI and NotI sites.

Example 2: Isolation of cDNA clones by amylase screening Preparation of oligo dT primed cDNA library mRNA was isolated from human tissues of interest using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA was used to generate oligo dT primed cDNA in vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). In this method, double-stranded cDNA was classified in size exceeding 1000 bp, and SalI / NotI binding cDNA was cloned into an XhoI / NotI digested vector. pRK5D was cloned into a vector with an sp6 transcription initiation site followed by an SfiI restriction enzyme site, followed by a XhiI / NotI cDNA cloning site.
2. Preparation of Random Primed cDNA Library A secondary cDNA library was created to favorably express the 5 ′ end of the primary cDNA clone. Sp6 RNA was generated from the primary library (described above) and this RNA was ligated into the vector pSST-AMY. Used to generate a randomly primed cDNA library using reagents and protocols from Life Technologies at 0 (Super Script Plasmid System referenced above). In this method, double-stranded cDNA was sized to 500-1000 bp, ligated to a NotI adapter with blunt ends, cut at the SfiI site, and cloned into an SfiI / NotI cut vector. pSST-AMY. 0 is a cloning vector having a yeast alcohol dehydrogenase promoter before the cDNA cloning site and a mouse amylase sequence (mature sequence without a secretion signal) after the cloning site followed by an alcohol dehydrogenase transcription termination region. That is, cDNA cloned into this vector fused in frame with an amylase sequence will lead to secretion of amylase from a suitably transfected yeast colony.

3. Transformation and detection DNA from the library described in the above two paragraphs was chilled on ice, to which electrocompetent DH10B bacteria (Life Technologies, 20 ml) were added. The bacteria and vector mixture was then electroporated as recommended by the manufacturer. Then SOC medium (Life Technplogies, 1 ml) was added and the mixture was incubated at 37 ° C. for 30 minutes. Transformants were then plated on 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37 ° C.). Positive colonies were discarded from the plates and DNA was isolated from bacterial pellets using standard methods such as CsCl-gradient. The purified DNA was then subjected to the following yeast protocol.
Yeast methods are divided into three categories: (1) transformation with yeast plasmid / cDNA binding vectors; (2) detection and isolation of yeast clones secreting amylase; and (3) direct from yeast colonies. PCR amplification and sequencing of the insert and DNA purification for further analysis.
The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotypes: MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, yeast mutants with incomplete post-translational pathways can be used. Such mutants have transpositional deficient alleles at sec71, sec72, and sec62, with truncated sec71 being most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that inhibit the normal manipulation of these genes, other proteins involved in this post-translational pathway (eg, SEC61p, SEC72p, SEC62p, SEC63p, TDJ1p, SSA1p − 4p) or complex formation of these proteins is also preferably used in combination with amylase-expressing yeast.
Transformation was performed based on the protocol outlined in Gietz et al., Nucl. Acid. Res., 20: 1425 (1992). The transformed cells were then seeded from agar into YEPD complex medium broth (100 ml) and grown overnight at 30 ° C. YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). The overnight medium is then diluted to approximately 2 × 10 ⁶ cells / ml (approximately OD ₆₀₀ = 0.1) in fresh YEPD broth (500 ml) and 1 × 10 ⁷ cells / ml (approximately OD ₆₀₀ = 0.4−0.5). ).
The cells are then harvested, transferred to a GS3 rotor bottle in a Sorval GS3 rotor for 5 minutes at 5,000 rpm, the supernatant is discarded and then prepared for transformation by resuspension in sterile water and in a 50 ml Falcon tube And centrifuged again at 3,500 rpm in a Beckman GS-6KR centrifuge. The supernatant is discarded and the cells are subsequently washed with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and resuspended in LiAc / TE (2.5 ml). Made cloudy.
Transformation occurred by mixing the prepared cells (100 μl) with fresh denatured single-stranded salmon sperm DNA (Lofstrand Labs, Gaitherburg, MD) and transforming DNA (1 μg vol. <10 μl) in a microtube. It was. The mixture was mixed briefly by vortexing, then 40% PEG / TE (600 μl, 40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM LiOOCCH ₃ , pH 7.5) was added. The mixture was gently agitated and incubated at 30 ° C. with agitation for 30 minutes. The cells were then heat shocked at 42 ° C. for 15 minutes, and the reaction vessel was centrifuged in a microtube at 12,000 rpm for 5-10 seconds and decanted and TE (500 μl, 10 mM Tris-HCl, 1 mM EDTA pH 7.5). Followed by centrifugation. Cells were then diluted in TE (1 ml) and aliquots (200 μl) were spread on selective media previously prepared in 150 mm growth plates (VWR).
Alternatively, transformation was performed in one large scale reaction rather than multiple small reactions, but the amount of reagent was scaled up accordingly.
The selective media used was synthetic complete dextrose agar lacking uracil prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994). SCD-Ura). Transformants were grown at 30 ° C. for 2-3 days.
Detection of colonies secreting amylase was performed by inclusion of red starch in the selective growth medium. Starch was coupled to a red dye (reactive Red-120, Sigma) according to the method described in Biely et al., Anal. Biochem., 172: 176-179 (1988). Bound starch was introduced into SCD-Ura agar plates at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM).
Positive colonies were picked and streaked on fresh selective medium (150 mm plate) to obtain a well-isolated and identifiable single colony. Well-isolated colonies positive for amylase secretion were detected by direct introduction of red clusters into buffered SCD-Ura agar. Positive colonies were determined by their ability to degrade starch and form visible wrinkles directly around positive colonies.

4). DNA Isolation by PCR Amplification When positive colonies were isolated, a portion was picked with a toothpick and diluted in sterile water (30 μl) in a 96 well plate. At this point, positive colonies are either frozen and stored for subsequent analysis or are immediately amplified. Aliquots of cells (5 μl), 0.5 μl Klentaq (Clontech, Palo Alto, Calif.); 4.0 μl 10 mM dNTP (Perkin Elmer-Cetus); 2.5 μl Kentaq buffer (Clontech); 0.25 μl forward oligo 1; Used as template for PCR reaction in 25 μl volume containing 0.25 μl reverse oligo 2; 12.5 μl distilled water. The sequence of forward oligonucleotide 1 is:
5'- TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT -3 '
(SEQ ID NO: 3).
The sequence of reverse oligonucleotide 2 is:
5'- CAGGAAACAGCTATGACCACCTGCACACCTGCAAATCCATT-3 '
(SEQ ID NO: 4).
PCR was then performed as follows:
a. Denaturation 92 ° C, 5 minutes b. Next 3 cycles Denaturation 92 ℃, 30 seconds
Annealing 59 ℃, 30 seconds
Elongation 72 ° C, 60 seconds c. Next 3 cycles Denaturation 92 ℃, 30 seconds
Annealing 57 ℃, 30 seconds
Elongation 72 ° C, 60 seconds d. Next 25 cycles Denaturation 92 ℃, 30 seconds
Annealing 55 ℃, 30 seconds
Elongation 72 ° C, 60 seconds e. Holding 4 ℃
Underlined regions are annealed to the ADH promoter region and amylase region, respectively, and in the absence of insert, the vector pSST-AMY. Amplify the 307 bp region from zero. Typically, the first 18 nucleotides at the 5 ′ end of these oligonucleotides contained the annealing site for the sequence primer. That is, the total product of the PCR reaction from the empty vector was 343 bp. However, the signal sequence fusion cDNA resulted in a fairly long nucleotide sequence.
Following PCR, an aliquot (5 μl) of the reaction was examined by agarose gel electrophoresis using a Tris-volley and -EDTA (TBE) buffer system in a 1% agarose gel as described in Sambrook et al., Supra. did. Clones that yielded a single strong PCR product greater than 400 bp were further analyzed by DNA sequence after purification on a 96 Qiaquick PCR clean column (Quagen Inc., Charsworth, Calif.).

Example 3 Isolation of cDNA Clones Using Signal Algorithm Analysis Various polypeptide-encoding nucleic acid sequences were developed using a proprietary sequence discovery algorithm developed by Genentech, Inc. (South San Francisco, Calif.). For example, identification by applying to ESTs and populations and assembled EST fragments from GenBank) and / or personal (LIFESEQ®, Incyte Pharmaceuticals, Inc., Palo Alto, Calif.) Databases. The signal sequence algorithm calculates a secretory signal score based on the letters of the DNA nucleotide surrounding the first, possibly second, methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotide following the first ATG must encode at least 35 unambiguous amino acids without a stop codon. If the first ATG has the required amino acid, the second is not tested. If none of the requirements were met, the candidate sequence was not scored. In order to determine whether an EST sequence contains a genuine signal sequence, a set of seven sensors (evaluation parameters) known to be associated with the secretory signal, the DNA surrounding the ATG codon and the corresponding amino acid sequence. Used to score. Through the use of this algorithm, a number of polypeptide-encoding nucleic acid sequences have been identified.

Example 4: Isolation of cDNA clones encoding human PRO281 To obtain cDNA clones encoding PRO281, the method described in Klein et al., Proc. Natl. Acad. Sci., 93: 7108-7113 (1996) Was used with the following modifications. Yeast transformation was performed with a limited amount of transforming DNA to reduce the number of multiple transformed yeast cells. Rather than transformation of E. coli following plasmid isolation from yeast as described above in Klein et al., PCR analysis was performed on single yeast colonies. The PCR primers used were duplicated to amplify a small portion of the insert and invertase gene (determining that the insert was in frame with the invertase) and to add a full sequence primer site.
The invertase library was transformed into yeast and positives were selected on sucrose plates. Positive clones were retested and PCR products were sequenced. One clone, PRO281, was identified as containing a single signal peptide coding sequence. Oligonucleotide primers and probes were designed using the nucleotide sequence of PRO281. A full-length plasmid library of cDNA from human umbilical vein epithelial tissue was titrated and approximately 100,000 cfu was seeded in 96-well round bottom plates in 192 pools of 500 cfu / pool. The plate was sealed and the pool was grown overnight at 37 ° C. with shaking (200 rpm). Agarose gel electrophoresis was performed and positive wells were identified by visualizing bands of the expected size. Individual positive clones were obtained by colony lift followed by hybridization with ³² P-labeled oligonucleotide. These clones were characterized by PCR, restriction digests, and Southern blot analysis.
The full-length clone was identified as containing a single open reading frame, having an apparent translation start site at nucleotide positions 80-82, and having a stop signal at nucleotide positions 1115-1117 (FIG. 1; SEQ ID NO: 1) ). The predicted polypeptide precursor is 345 amino acids long, has a calculated molecular weight of about 37,205 and an estimated pI of about 10.15. Analysis of full-length PRO281 shown in FIG. 2 (SEQ ID NO: 2) revealed the presence of: a signal peptide of about amino acid 1 to about amino acid 14, amino acid position about 83 to amino acid position about 105, amino acid position about 126 to about amino acid position 146, amino acid position about 158 to about amino acid position 177, amino acid position about 197 to about amino acid position 216, amino acid position about 218 to about amino acid position 238, amino acid position about 245 to about amino acid position 265, and amino acid position An amino acid sequence block having homology to a multiple transmembrane domain from about 271 to about 290 amino acid positions and a G-protein coupled receptor protein from about 115 to about 155 amino acids. Clone UNQ224 (DNA16422-1209) was deposited with ATCC on June 2, 1998 and is assigned ATCC deposit number 209929.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology among B64815, YBHL_ECOLI, EMEQUTR_1, AF064763_3, S53708, A69253, AF035413_12 and S63281 was revealed.

Example 5: Isolation of cDNA clones encoding human PRO276 To obtain cDNA clones encoding PRO276, the following modifications were made to the method described in Klein et al., PNAS, 93: 7108-7113 (1996). Using. Yeast transformation was performed with a limited amount of transforming DNA to reduce the number of multiple transformed yeast cells. Rather than transformation of E. coli following plasmid isolation from yeast as described above in Klein et al., PCR analysis was performed on single yeast colonies. The PCR primers used were duplicated to amplify a small portion of the insert and invertase gene (determining that the insert was in frame with the invertase) and to add a full sequence primer site.
The invertase library was transformed into yeast and positives were selected on sucrose plates. Positive clones were retested and PCR products were sequenced. One clone, PRO276, was identified as containing a single signal peptide coding sequence. Oligonucleotide primers and probes were designed using the nucleotide sequence of PRO276. A full-length plasmid library of cDNA from human umbilical vein epithelial tissue was titrated and approximately 100,000 cfu was seeded in 96-well round bottom plates in 192 pools of 500 cfu / pool. The plate was sealed and the pool was grown overnight at 37 ° C. with shaking (200 rpm). Agarose gel electrophoresis was performed and positive wells were identified by visualizing bands of the expected size. Individual positive clones were obtained by colony lift followed by hybridization with ³² P-labeled oligonucleotide. These clones were characterized by PCR, restriction digests, and Southern blot analysis.
The full-length clone was identified as containing a single open reading frame, having an apparent translation start site at nucleotide positions 180-182, and a stop signal at nucleotide positions 933-935 (FIG. 3; SEQ ID NO: 5). ). The predicted polypeptide precursor is 251 amino acids long, has a calculated molecular weight of about 28,801 and an estimated pI of about 9.58. The transmembrane domain is approximately at amino acids 98-116 and 152-172 shown in FIG. 4 (SEQ ID NO: 6). Clone DNA16435-1208 (UNQ243) has been deposited with ATCC and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Some sequence identity was revealed between S69696, GRHR_RAT, NPCBAABCD_3, AB013149_1, P_R85942 and AP000006_5.

Example 6 Isolation of cDNA Clones Encoding Human PRO189 A clone designated herein as DNA14187 was isolated from a human retinal tissue library as described in Example 2 above. The DNA14187 sequence is shown in FIG. 7 (SEQ ID NO: 9). Based on the DNA14187 sequence shown in FIG. 7 (SEQ ID NO: 9), 1) to identify a cDNA library containing the sequence of interest by PCR and 2) to isolate a clone of the full-length coding sequence of PRO189 Oligonucleotides were synthesized for use as Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products that are about 100-1000 bp long. The probe sequence is typically 40-55 bp long. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs, such as Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-TTGACCTATACAGAGATTCATC-3 '(SEQ ID NO: 10)
Reverse PCR primer 5'-CTAAGAACTTCCCTCAGGATTTT-3 '(SEQ ID NO: 11)
In addition, a synthetic oligonucleotide hybridization probe was made from the DNA14187 sequence having the following nucleic acid sequence:
Hybridization probe
5'-ATGAAGATCAATTTCAAGAAGCATGCACTTCTCCTCTTGC-3 '(SEQ ID NO: 12)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO189 gene using one of the probe oligonucleotide and PCR primer pair.
RNA for construction of the cDNA library was isolated from human retinal tissue (LIB94). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, Ca. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO189 and the derived protein sequence of PRO189.
The entire nucleic acid sequence of DNA21624-1391 is shown in FIG. 5 (SEQ ID NO: 7). Clone DNA21624-1391 contains a single open reading frame and ends with an apparent translation start site at nucleotide positions 200-202 and a stop codon at nucleotide positions 1301-1303 (FIG. 5). The predicted polypeptide precursor is 367 amino acids long (Figure 6). The full-length PRO189 protein shown in FIG. 6 has an estimated molecular weight of about 41,871 daltons and a pI of about 5.06. Clone DNA21624-1391 has been deposited with ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence and that the sequences provided herein are based on known sequencing techniques.
By analysis of the amino acid sequence of SEQ ID NO: 8, the predicted N-glycosylation sites are about amino acids 224-227, 246-249, and 285-288. The cytosolic fatty acid binding protein is amino acids 78-107 of SEQ ID NO: 8. Corresponding nucleotides can be routinely determined given the sequence provided herein.
Some degree of sequence identity was found for the nematode proteins, W01A6.1 and F35D11.11, respectively named CEW01A6_10 and CELF35D11_11 in the Dayhoff database. Some degree of sequence identity was also found for malaria and restin antigens named P_R05766 and AF01412_1 respectively in the Dayhoff database. Some sequence identity was also observed for the microtubule binding protein and myosin, referred to as AF041382_1 and S07537, respectively, in the Dayhoff database. There is also some degree of sequence identity to 1-phosphatidylinositol-4,5-bisphosphate called PIP1_RAT.

Example 7: Isolation of cDNA clone encoding human PRO190 A clone designated herein as DNA14232 was isolated from a human retinal tissue library as described in Example 2 above. The DNA14232 sequence is shown in FIG. 10 (SEQ ID NO: 15). Based on the DNA 14232 sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) to use as a probe to isolate a clone of the full-length coding sequence of PRO190. . Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products that are about 100-1000 bp long. The probe sequence is typically 40-55 bp long. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs, such as Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-CTATACCTACTGTAGCTTCT-3 '(SEQ ID NO: 16)
Reverse PCR primer 5'-TCAGAGAATTCCTTCCAGGA-3 '(SEQ ID NO: 17)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA14232 sequence having the following nucleic acid sequence:
Hybridization probe
5'-ACAGTGCTGTAGTCATCCTGTAATATGCTCCTTGTCAACA-3 '(SEQ ID NO: 18)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO190 gene using one of the probe oligonucleotide and PCR primer pair.
RNA for construction of the cDNA library was isolated from human retinal tissue (LIB94). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, Ca. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO190 [herein designated as DNA23334-1392] (SEQ ID NO: 13) and the derived protein sequence of PRO190.
The entire nucleic acid sequence of DNA23334-1392 is shown in FIG. 8 (SEQ ID NO: 13). Clone DNA23334-1392 contains a single open reading frame and terminates at an apparent translation start site at nucleotide positions 193-195 and a stop codon at nucleotide positions 1465-1467 (FIG. 8). The predicted polypeptide precursor is 424 amino acids long (Figure 9). The full-length PRO190 protein shown in FIG. 9 has an estimated molecular weight of about 48,500 daltons and a pI of about 8.65. Clone DNA2334-1392 has been deposited with ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence and that the sequences provided herein are based on known sequencing techniques.
By analysis of the amino acid sequence of SEQ ID NO: 14, the predicted transmembrane domain is approximately amino acids 16-36, 50-74, 147-168, 229-250, 271-293, 298-318 and 328-368 of SEQ ID NO: 14. It is. The N-glycosylation sites are approximately amino acids 128-131, 204-207, 218-221 and 274-377 of SEQ ID NO: 14. Corresponding nucleotides can be routinely determined given the sequence provided herein.
PRO190 has at least sequence identity with the Dayhoff sequence: CEZK896_2, JC5023, GMS1_SCHPO and S44668, referred to below.

Example 8 Isolation of cDNA Clones Encoding Human PRO341 A clone designated herein as DNA12920 was isolated from a human retinal tissue library as described in Example 2 above. The DNA12920 sequence is shown in FIG. 13 (SEQ ID NO: 21). The DNA12920 sequence is then compared to various EST databases, including public databases (eg, GenBank) and proprietary databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Identified. The comparison was performed using the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzymology 266: 460-480 (1996)]. Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) to generate consensus DNA sequences. It was constructed. The consensus sequence obtained therefrom is designated herein as DNA25314. Based on the DNA25314 sequence, oligonucleotide probes were then synthesized and used to screen a human placenta cDNA library to identify the DNA26288-1239 clone shown in FIG. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) and the cDNA size cut was less than 2800 bp.
A full-length clone is identified, which contains a single open reading frame, with an apparent translation start site at nucleotide positions 380-382, and a stop signal at nucleotide positions 1754-1756 (FIG. 11; SEQ ID NO: 19). The predicted polypeptide precursor is 458 amino acids long, has a calculated molecular weight of about 50,264 and an estimated pI of about 8.17. Analysis of the full-length PRO341 sequence shown in FIG. 12 (SEQ ID NO: 20) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 17, about amino acid 171 to about amino acid 190, about amino acid 220 to A transmembrane domain of about amino acid 239, about amino acid 259 to about amino acid 275, about amino acid 286 to about amino acid 305, about amino acid 316 to about amino acid 335, about amino acid 353 to about amino acid 378, and about amino acid 396 to about amino acid 417, and Potential N-glycosylation sites from about amino acid 145 to about amino acid 147 and from about amino acid 155 to about amino acid 158. Clone DNA26288-1239 was deposited with ATCC on April 21, 1998 and is assigned ATCC deposit number 209792.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 12 (SEQ ID NO: 20) revealed that the PRO341 amino acid sequence and the following Dayhoff sequences, S75696, H69788, Homology between D69852, A69888, B64918, F64752, LPU89276_1, G64962, S52977 and S44253 was revealed.

Example 9: Isolation of cDNA clones encoding human PRO180 A clone, designated herein as DNA12922, was isolated from a human retinal tissue library as described in Example 2 above. The DNA12922 sequence is shown in FIG. 16 (SEQ ID NO: 24). The DNA12922 sequence is then compared to various EST databases, including public databases (eg, GenBank) and proprietary databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Identified. The comparison was performed using the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzymology 266: 460-480 (1996)]. Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built.
Oligonucleotide probes were synthesized based on the consensus sequence obtained above. This probe had the following sequence:
5'-ACCTGTTAGAAATGTGGTGGTTTCAGCAAGGCCTCAGTTT (SEQ ID NO: 25)
This probe was used to screen a human placenta cDNA library prepared as described in paragraph 1 of Example 2. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) and the cDNA size cut was less than 2800 bp. Here, a clone designated as DNA26843-1389 was obtained.
The complete nucleotide sequence of DNA26843-1389 is shown in FIG. 14 (SEQ ID NO: 22). Clone DNA26843-1389 contains a single open reading frame, has an apparent translation start site at nucleotide positions 121-123, and ends with a stop codon at nucleotide positions 919-921 (FIG. 14). The predicted polypeptide precursor is 266 amino acids long (Figure 15). The full-length PRO180 protein shown in FIG. 15 has an estimated molecular weight of about 29,766 and a pI of about 8.39. Clone DNA26843-1389 has been deposited with ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence and that the sequences provided herein are based on known sequencing techniques.
By analysis of the amino acid sequence of SEQ ID NO: 23, the transmembrane domain is approximately amino acids 13-33 (type II), 54-73, 94-113, 160-180, and 122-141 of SEQ ID NO: 23. N-myristoylation sites are approximately amino acids 57-62, 95-100, 99-104, 124-129 and 183-188 of SEQ ID NO: 23. Corresponding nucleotides can be routinely determined given the sequence provided herein.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. The homology between CELW03A5_1 and PEU83861_2 (NADH dehydrogenase subunit 4L, mitochondrion) was revealed.

Example 10: Isolation of cDNA clones encoding human PRO194 Consensus DNA sequences were assembled against other ESTs using phrap as described in Example 1 above. This consensus sequence is herein designated DNA19464. Based on the DNA19464 sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the full-length coding sequence of PRO194. . PCR primers (forward and reverse) were synthesized based on the DNA19464 sequence. In addition, synthetic oligonucleotide hybridization probes were generated from the consensus DNA19464 sequence.
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO194 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal lung tissue (LIB25).
The DNA sequence of the clone isolated as described above gave the full length DNA sequence of PRO194 [herein designated as DNA26844-1394] (SEQ ID NO: 27) and the derived protein sequence of PRO194.
The entire nucleic acid sequence of DNA26844-1394 is shown in FIG. 17 (SEQ ID NO: 27). Clone DNA26844-1394 contains a single open reading frame, has an apparent translation start site at nucleotide positions 81-83, and ends with a stop codon at nucleotide positions 873-875 (FIG. 17). The predicted polypeptide precursor is 264 amino acids long (Figure 18). The full-length PRO194 protein shown in FIG. 18 has an estimated molecular weight of about 29,665 daltons and a pI of about 9.34. Analysis of the full-length PRO194 sequence shown in FIG. 18 (SEQ ID NO: 28) revealed the presence of various important polypeptide domains shown in FIG. Clone DNA26844-1394 was deposited with ATCC on June 2, 1998 and is assigned ATCC deposit number 209926.
Analysis of the amino acid sequence of the full-length PRO194 polypeptide suggested no significant homology with any known human protein. However, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed that the PRO194 amino acid sequence and the following Dayhoff sequences, HUMORFT_1, CET07F10_5, ATFCA9_12, F64934, YDJX_ECOLI, ATAF00065719F29G20.19, H70002, S76980, H64934 and S76385 Became clear.

Example 11: Isolation of cDNA clones encoding human PRO203 A clone designated herein as DNA15618 was isolated from a human fetal lung tissue library as described in Example 2 above. The DNA15618 sequence is shown in FIG. 21 (SEQ ID NO: 31). An oligonucleotide probe was made from the sequence of the DNA15618 molecule and used to screen a human fetal lung library (LIB26) prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) and the cDNA size cut was less than 2800 bp.
A full-length clone is identified, which contains a single open reading frame, has an apparent translation start site at nucleotide positions 159-161, and ends with a stop codon at nucleotide positions 1200-1202 (FIG. 19; SEQ ID NO: 29 ). The predicted polypeptide precursor is 347 amino acids long, has a calculated molecular weight of about 39,870 and an estimated pI of about 6.76. Analysis of the full-length PRO203 sequence shown in FIG. 20 (SEQ ID NO: 30) revealed the presence of: a Type II transmembrane domain from about amino acid 64 to about amino acid 87; about amino acid 147 to about amino acid 150, about Possible N-glycosylation sites from amino acid 155 to about amino acid 158, and from about amino acid 237 to about amino acid 240; sequence identity with heavy metal binding domain protein from about amino acid 23 to about amino acid 45; and from about amino acid 24 to about amino acid 34 Sequence identity with the D-isomer specific 2-hydroxy acid dehydrogenase. Clone DNA30862-1396 was deposited with ATCC on June 2, 1998 and is assigned ATCC deposit number 209920.
Analysis of the amino acid sequence of the full-length PRO203 polypeptide suggests that it has sequence homology with GST ATPase, indicating that PRO203 is a novel GCT ATPase. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed homology between the PRO203 amino acid sequence and the following Dayhoff sequences, AF008124_1, CFRCD1GEN_1, and P_R82566.

Example 12 Isolation of cDNA Clones Encoding Human PRO290 Searching the expression sequence tag (EST) database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.) For ESTs with homology to beige and FAN Identified. An oligonucleotide probe was then synthesized based on the identified EST sequence and used to screen a human fetal kidney cDNA library for the purpose of identifying a full-length cDNA clone. The oligonucleotide probe had the following sequence:
5'-TGACTGCACTACCCCGTGGCAAGCTGTTGAGCCAGCTCAGCTG-3 '(SEQ ID NO: 34)
RNA for construction of the cDNA library was isolated from human fetal kidney tissue. The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
The entire cDNA clone was identified and sequenced.
The entire nucleotide sequence of DNA35680-1212 is shown in FIG. 22 (SEQ ID NO: 32). Clone DNA35680-1212 contains a single open reading frame, has an apparent translation start site at nucleotide positions 293-295, and a stop codon at nucleotide positions 3302-3304 (FIG. 22; SEQ ID NO: 32). The predicted polypeptide precursor is 1003 amino acids long. Currently, the PRO290 polypeptide is believed to be related to FAN and / or beige. Clone DNA35680-1212 has been deposited with ATCC and is assigned ATCC deposit no. It is understood that the deposited clone contains the correct sequence and that the sequences provided herein are based on known sequencing techniques. The full-length PRO290 protein shown in FIG. 23 has an estimated molecular weight of about 112,013 daltons and a pI of about 6.4.

Example 13: Isolation of cDNA clone encoding human PRO874 A consensus DNA sequence designated herein as DNA36459 was identified using phrap as described in Example 1 above. Based on the DNA36459 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the PRO874 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-TCGTGCCCAGGGGCTGATGTGC-3 '(SEQ ID NO: 37)
Reverse PCR primer 5'-GTCTTTACCCAGCCCCGGGATGCG-3 '(SEQ ID NO: 38)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA36459 sequence having the following nucleic acid sequence:
Hybridization probe
5'-GGCCTAATCCAACGTTCTGTCTTCAATCTGCAAATCTATGGGGTCCTGGG-3 '(SEQ ID NO: 39)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO874 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal lung tissue (LIB25).
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO874 [herein designated as DNA40621-1440] (SEQ ID NO: 35) and the derived protein sequence of PRO874.

The entire nucleotide sequence of DNA40621-1440 is shown in FIG. 24 (SEQ ID NO: 35). Clone DNA40621-1440 contains a single open reading frame and ends with a stop codon at nucleotide positions 964-966 (FIG. 24). The predicted polypeptide encoded by DNA40621-1440 is 321 amino acids long (Figure 25). The PRO874 protein shown in FIG. 25 has an estimated molecular weight of about 36,194 daltons and a pI of about 9.85. Analysis of the full-length PRO874 sequence shown in FIG. 25 (SEQ ID NO: 36) revealed the presence of: a Type II transmembrane domain from about amino acid 57 to about amino acid 80; about amino acids 110-126, 215-231 And an additional transmembrane domain of 254-274; potential N-glycosylation sites of about amino acids 16-19, 27-30, and 289-292; sequence identity with a hypothetical YBR002c family protein of about amino acids 276-287 Sex; and sequence identity with the ammonium transporter protein of about amino acids 204-230. Clone DNA40621-1440 has been deposited with ATCC on June 2, 1998 and is assigned ATCC deposit number 209922.
Analysis of the amino acid sequence of the full-length PRO874 polypeptide suggested a novel multi-span transmembrane protein. However, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed homology between the PRO874 amino acid sequence and the following Dayhoff sequences: S67049, AF054839_1, S73437, S52460, and HIVU80570_1.

Example 14: Isolation of cDNA clones encoding human PRO710 A yeast screening assay was used to identify cDNAs encoding potential secreted proteins. Use of this yeast screening assay allowed the identification of a single cDNA whose sequence (designated herein as DNA38190) is shown in FIG. 28 (SEQ ID NO: 42). Based on the DNA38190 sequence shown in FIG. 28, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) to use as a probe to isolate a clone of the full-length coding sequence of PRO710. Nucleotides were synthesized. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs, such as Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-TTCCGCAAAGAGTTCTACGAGGTGG-3 '(SEQ ID NO: 43)
Reverse PCR primer 5'-ATTGACAACATTGACTGGCCTATGGG-3 '(SEQ ID NO: 44)
In addition, synthetic oligonucleotide hybridization probes were made from DNA38190 sequences having the following nucleic acid sequences:
Hybridization probe
5'-GTGGATGCTCTGTGTGCGTGCAAGATCCTTCAGGCCTTGTTCCAGTGTGA-3 '(SEQ ID NO: 45)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO710 gene using one of the probe oligonucleotide and PCR primer pair.
RNA for construction of the cDNA library was isolated from human fetal kidney tissue (LIB227). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
A full-length clone is identified, which contains a single open reading frame, has an apparent translation start site at nucleotide positions 67-69, and terminates with a stop codon found at nucleotide positions 1765-1767 (FIG. 26; SEQ ID NO: : 40). The predicted polypeptide precursor is 566 amino acids long, has a calculated molecular weight of about 65,555 and an estimated pI of about 5.44. Analysis of the full-length PRO710 sequence shown in FIG. 27 (SEQ ID NO: 41) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 32, a transmembrane domain from about amino acid 454 to about amino acid 476, Aminoacyl-transfer RNA synthetase class II signature sequence from about amino acid 6 to about amino acid 26, potential N-glycosylation from about amino acid 111 to about amino acid 114, from about amino acid 146 to about amino acid 149, and from about amino acid 292 to about amino acid 295 Site. Clone DNA44161-1434 has been deposited with ATCC on May 27, 1998 and is assigned ATCC deposit number 209907.
Analysis of the amino acid sequence of the full-length PRO710 polypeptide suggests that it has significant sequence homology with the CDC45 protein, indicating that PRO710 is a novel CDC45 homolog. More specifically, by analysis of the Dayhoff database (version 35.45 SwissProt 35), the PRO710 amino acid sequence and the following Dayhoff sequences, HSAJ3728_1, CEF34D10_1, S64939, UMU50276_1, TRHY_SHEEP, CELT14E8_1, RNA1_YEAST, LVU89340_1, HSU80736_1 and CE Sex became clear.

Example 15: Isolation of cDNA clones encoding human PRO1151 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. Based on the DNA40665 consensus sequence, oligonucleotides were synthesized for 1) identifying a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the PRO1151 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-CCAGACGCTGCTCTTCGAAAGGGTC-3 '(SEQ ID NO: 48)
Reverse PCR primer 5'-GGTCCCCGTAGGCCAGGTCCAGC-3 '(SEQ ID NO: 49)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA40665 sequence having the following nucleic acid sequence:
Hybridization probe
5'-CTACTTCTTCAGCCTCAATGTGCACAGCTGGAATTACAAGGAGACGTACG-3 '(SEQ ID NO: 50)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1151 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1151 (herein named DNA44694-1500 [FIG. 29; SEQ ID NO: 46]) and the derived protein sequence of PRO1151.
The entire nucleotide sequence of DNA44694-1500 is shown in FIG. 29 (SEQ ID NO: 46). Clone DNA44694-1500 contains a single open reading frame, has an apparent translation start site at nucleotide positions 272-274, and ends with a stop codon at nucleotide positions 1049-1051 (FIG. 29). The predicted polypeptide is 259 amino acids long (Figure 30). The PRO1151 protein shown in FIG. 30 has an estimated molecular weight of about 28,770 daltons and a pI of about 6.12. Analysis of the full-length PRO1151 sequence shown in FIG. 30 (SEQ ID NO: 47) revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20, a potential N − of about amino acid 72 to about amino acid 75. An amino acid sequence block having homology to a glycosylation site and a C1q domain containing protein from about amino acid 144 to about amino acid 178, about amino acid 78 to about amino acid 111 and about amino acid 84 to about amino acid 117. Clone UNQ581 (DNA44694-1500) was deposited with ATCC on August 11, 1998 and is assigned ATCC deposit number 203114.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Homology between HUMC1QB2_1, P_R99306, CA1F_HUMAN, JX0369, CA24_HUMAN, S32436, P_R28916 and CA54_HUMAN was revealed.

Example 16: Isolation of cDNA clones encoding human PRO1282 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. Based on the DNA33778 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the PRO1282 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-TCTTCAGCCGCTTGCGCAACCTC-3 '(SEQ ID NO: 53)
Reverse PCR primer 5'-TTGCTCACATCCAGCTCCTGCAGG-3 '(SEQ ID NO: 54)
In addition, a synthetic oligonucleotide hybridization probe was made from the DNA33778 sequence having the following nucleic acid sequence:
Hybridization probe
5'-TGGATGTTGTCCAGACAACCAGCTGGAGCTGTATCCGAGGC-3 '(SEQ ID NO: 55)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1282 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal liver.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1282 (here designated DNA45495-1550 [Figure 31; SEQ ID NO: 51]) and the derived protein sequence of PRO1282.
The entire coding sequence of PRO1282 is shown in FIG. 31 (SEQ ID NO: 51). Clone DNA45495-1550 contains a single open reading frame, has an apparent translation start site at nucleotide positions 120-122, and ends with a stop codon at nucleotide positions 2139-2141 (FIG. 51). The predicted polypeptide is 673 amino acids long. The signal peptide is about amino acids 1-23 of SEQ ID NO: 52; the transmembrane domain is about amino acids 579-599; the EGF-like domain cysteine pattern signature begins at about amino acid 430; and the leucine zipper pattern is about Start at amino acids 197 and 269, see FIG. Clone DNA45495-1550 has been deposited with ATCC and is assigned ATCC deposit no. 203156. The full-length PRO1282 protein shown in FIG. 32 has an estimated molecular weight of about 71,655 daltons and a pI of about 7.8.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 32 (SEQ ID NO: 52) revealed that the PRO1282 amino acid sequence and the following Dayhoff sequence (data from the database) Are incorporated by reference), homology between AB007876_1, RNPLGPV_1, MUSLRRP_1, ALS_PAPPA, AC004142_1, ALS_HUMAN, AB014462_1, DMTARTAN_1, HSCHON3_1 and S46224 was revealed.

Example 17: Isolation of cDNA clones encoding human PRO358 Using the method described in Example 1 above, a single EST sequence, herein designated INC3115949, was identified in the Incyte database. Based on the INC3115949EST sequence, a cDNA library containing the sequence of interest was identified by PCR and oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence of PRO358.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-TCCCACCAGGTATCATAAACTGAA-3 '(SEQ ID NO: 58)
Reverse PCR primer 5'-TTATAGACAATCTGTTCTCATCAGAGA-3 '(SEQ ID NO: 59)
A probe was also synthesized:
5'-AAAAAGCATACTTGGAATGGCCCAAGGATAGGTGTAAATG-3 '(SEQ ID NO: 60)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1282 gene using the probe oligonucleotide and one of the pair. RNA for construction of the cDNA library was isolated from human bone marrow (LIB256). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO358 (FIG. 33; SEQ ID NO: 56) and the derived protein sequence of PRO358 (FIG. 34, SEQ ID NO: 57).
The entire nucleotide sequence of the identified clone (DNA47361-1154) is shown in FIG. 33 (SEQ ID NO: 56). Clone DNA47361-1154 contains a single open reading frame and has an apparent translation start site (ATG start signal) at the nucleotide position underlined in FIG. The predicted polypeptide precursor is 811 amino acids long, has a putative signal sequence (amino acids 1-19), an extracellular domain (amino acids 20-575, containing leucine-rich repeats in the region at positions 55-575), putative membrane Penetrating domain (amino acids) 576-595). Clone DNA47361-1249 has been deposited with ATCC and is assigned ATCC deposit no.

Example 18: Isolation of cDNA clones encoding human PRO1310 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. This consensus sequence is herein designated DNA37164. Based on the DNA37164 consensus sequence, oligonucleotides were synthesized for 1) identifying a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the PRO1310 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-GTTCTCAATGAGCTACCCGTCCCC-3 '(SEQ ID NO: 63) and reverse PCR primer 5'-CGCGATGTAGTGGAACTCGGGCTC-3' (SEQ ID NO: 64)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA47394 sequence having the following nucleic acid sequence:
Hybridization probe:
5'-ATCCGCATAAACCCTCAGTCCTGGTTTGATAATGGGAGCATCTGCATGAG-3 '(SEQ ID NO: 65)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1310 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal liver.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1310 and the derived protein sequence of PRO1310.
The entire coding sequence of PRO1310 is shown in FIG. 35 (SEQ ID NO: 61). Clone DNA47394-1572 contains a single open reading frame with an apparent translation start site at nucleotide positions 326-328 and an apparent stop codon at nucleotide positions 2594-2596 (FIG. 61). The predicted polypeptide is 765 amino acids long. The signal peptide is about amino acids 1-25 of SEQ ID NO: 62. Clone DNA47394-1572 has been deposited with ATCC and is assigned ATCC deposit no. The full-length PRO1310 protein shown in FIG. 36 has an estimated molecular weight of about 85,898 daltons and a pI of about 6.87.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 36 (SEQ ID NO: 62) revealed that the PRO1310 amino acid sequence and the following Dayhoff sequence: AF017639_1, P_W36817, Sequence identity among JC5256, CBPH_HUMAN, MMU23184_1, CBPN_HUMAN, HSU83411_1, CEF01D4_7, RNU62897_1 and P_W11851 was revealed.

Example 19: Isolation of cDNA clones encoding human PRO698 A yeast screening assay was used to identify cDNAs encoding potential secreted proteins. Use of this yeast screening assay allowed identification of a single cDNA whose sequence (designated herein as DNA39906) is shown in FIG. 39 (SEQ ID NO: 68). Based on the DNA39906 sequence shown in FIG. 39, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) to use as a probe to isolate a clone of the full-length coding sequence of PRO698. Nucleotides were synthesized. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs, such as Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-AGCTGTGGTCATGGTGGTGTGGTG-3 '(SEQ ID NO: 69)
Reverse PCR primer 5'-CTACCTTGGCCATAGGTGATCCGC-3 '(SEQ ID NO: 70)
In addition, a synthetic oligonucleotide hybridization probe was made from the DNA39906 sequence having the following nucleic acid sequence:
Hybridization probe
5'-CATCAGCAAACCGTCTGTGGTTCAGCTCAACTGGAGAGGGTT-3 '(SEQ ID NO: 71)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO698 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human bone marrow tissue (LIB255). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
A full-length clone is identified, which contains a single open reading frame, has an apparent translation start site at nucleotide positions 14-16, and ends with a stop codon found at nucleotide positions 1544-1546 (FIG. 37; SEQ ID NO: : 66). The predicted polypeptide precursor is 510 amino acids long, has a calculated molecular weight of about 57,280 and an estimated pI of about 5.61. Analysis of the full-length PRO698 sequence shown in FIG. 38 (SEQ ID NO: 67) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 20, about amino acid 72 to about amino acid 75, about amino acid 136 to Potential N-glycosylation sites from about amino acid 139, from about amino acid 193 to about amino acid 196, from about amino acid 253 to about amino acid 256, from about amino acid 352 to about amino acid 355, and from about amino acid 411 to about amino acid 414, from about amino acid 20 to about Amino acid block homologous to legume lectin beta chain protein of amino acid 39 and amino acid block homologous to proteins of the HBGF / FEF family from about amino acid 338 to about amino acid 365. Clone DNA48320-1433 has been deposited with ATCC on May 27, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO698 polypeptide suggests that it has significant sequence homology with the olfactomedin protein, indicating that PRO698 is a novel olfactedin homolog. More specifically, the analysis of the Dayhoff database (version 35.45 SwissProt 35) shows that the PRO698 amino acid sequence and the following Dayhoff sequences, OLFM_RANCA, I73637, AB006686S3_1, RNU78105_1, RNU72487_1, P_R98225, CELC48E7_4, CEF11C3_3, significant between 42 and XLU257970_1 The homology was revealed.

Example 20: Isolation of cDNA clones encoding human PRO732 A yeast screening assay was used to identify cDNAs encoding potential secreted proteins. The use of this yeast screening assay allowed the identification of a single cDNA whose sequence (designated herein as DNA42580) is shown in FIG. 45 (SEQ ID NO: 77). The DNA 42580 sequence was then identified for homology as compared to various known EST sequences. EST databases used include public databases (eg, GenBank) and proprietary databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The search was performed as a comparison with 6-frame translation of the EST sequence using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built.
Using the above analysis, consensus DNA sequences were assembled against other EST sequences using phrap. Originally developed Genentech EST sequences were used for consensus assembly, where they were used as DNA 20239 (FIG. 42; SEQ ID NO: 74), DNA38050 (FIG. 43; SEQ ID NO: 75) and DNA40683 (FIG. 44; SEQ ID NO: 76). Named.
Based on the consen01 sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the full-length coding sequence of PRO732. . Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products that are about 100-1000 bp long. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs, such as Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-ATGTTTGTGTGGAAGTGCCCCG-3 '(SEQ ID NO: 78)
Forward PCR primer 5'-GTCAACATGCTCCTCTGC-3 '(SEQ ID NO: 79)
Reverse PCR primer 5'-AATCCATTGTGCACTGCAGCTCTAGG-3 '(SEQ ID NO: 80)
Reverse PCR primer 5'-GAGCATGCCACCACTGGACTGAC-3 '(SEQ ID NO: 81)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA44143 sequence having the following nucleic acid sequence:
Hybridization probe
5'-GCCGATGCTGTCCTAGTGGAAACAACTCCACTGTAACTAGATTGATCTATGCAC-3 '(SEQ ID NO: 82)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO732 gene using one of the probe oligonucleotide and PCR primer pair.
RNA for construction of the cDNA library was isolated from human fetal lung tissue (LIB26). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
A full-length clone is identified, which contains a single open reading frame, has an apparent translation start site at nucleotide positions 88-90, and ends with a stop codon found at nucleotide positions 1447-1449 (FIG. 40; SEQ ID NO: : 72). The predicted polypeptide precursor is 453 amino acids long, has a calculated molecular weight of about 50,419 and an estimated pI of about 5.78. Analysis of the full-length PRO732 sequence shown in FIG. 41 (SEQ ID NO: 73) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 28, about amino acid 37 to about amino acid 57, about amino acid 93 to About amino acid 109, about amino acid 126 to about amino acid 148, about amino acid 151 to about amino acid 172, about amino acid 197 to about amino acid 215, about amino acid 231 to about amino acid 245, about amino acid 260 to about amino acid 279, about amino acid 315 to about amino acid 333, a transmembrane domain of about amino acid 384 to about amino acid 403 and about amino acid 422 to about amino acid 447, about amino acid 33 to about amino acid 36, about amino acid 34 to about amino acid 37, about amino acid 179 to about amino acid 183, about amino acid 298 to About amino acid 301, about amino acid 337 A potential N-glycosylation site from about amino acid 340 and from about amino acid 406 to about amino acid 409, an amino acid block having homology to a MIP family of proteins from about amino acid 119 to about amino acid 149, and DNA from about amino acid 279 to about amino acid 286 / Amino acid block with homology to non-RNA specific endonuclease protein. Clone DNA48334-1435 has been deposited with ATCC on June 2, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO732 polypeptide suggests that it has significant sequence homology with the Diff33 protein, indicating that PRO732 is a novel Diff33 homolog. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed that there was a significant difference between the PRO732 amino acid sequence and the following Dayhoff sequences: HS179M20_2, MUSTETU_1, CER11H6_2, RATDRP_1, S51256, E69226, AE000869_1, JC4120, CYB_PARTE and P_R50619 The homology was revealed.

Example 21: Isolation of cDNA clones encoding human PRO1120 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. This consensus sequence is herein designated consen0352. Consen 0352 was then extended using repeated cycles of BLAST and phrap, and the consensus sequence was extended as much as possible using the source of EST sequences described above. Based on the extended consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) to use the oligonucleotide as a probe to isolate a clone of the PRO1120 coding sequence. Synthesized.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer: 5′-GAAGCCGGCTGTCTGAATC-3 ′ (SEQ ID NO: 85),
5′-GGCCAGCTATCTCCGCAG-3 ′ (SEQ ID NO: 86),
5′-AAGGGCCTGCAAGAGAAG-3 ′ (SEQ ID NO: 87),
5'-CACTGGGACAACTGTGGG-3 '(SEQ ID NO: 88),
5′-CAGAGGCAACGTGGAGAG-3 ′ (SEQ ID NO: 89), and
5'-AAGTATTGTCATACAGTGTTC-3 '(SEQ ID NO: 90);
Reverse PCR primer: 5′-TAGTACTTGGGCACGAGGTTGGAG-3 ′ (SEQ ID NO: 91), and
5'-TCATACCAACTGCTGGTCATTGGC-3 '(SEQ ID NO: 92);
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA34365 sequence having the following nucleic acid sequence:
Hybridization probe:
5'-CTCAAGCTGCTGGACACGGAGCGGCCGGTGAATCGGTTTCACTTG-3 '(SEQ ID NO: 93)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1120 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1120 (herein named DNA48606-1479 [Figure 46, SEQ ID NO: 83]) and the derived protein sequence of PRO1120.
The entire coding sequence of PRO1120 is shown in FIG. 46 (SEQ ID NO: 83). Clone DNA48606-1479 contains a single open reading frame with an apparent translation start site at nucleotide positions 608-610 and an apparent stop codon at nucleotide positions 3209-321. The predicted polypeptide is 867 amino acids long. The full-length PRO1120 protein shown in FIG. 47 has an estimated molecular weight of about 100,156 daltons and a pI of about 9.44. Additional features of the PRO1120 polypeptide are: a signal peptide of about amino acids 1-17; a sulfatase signature of about amino acids 86-98; about amino acids 87-106, 133-146, 216-229, 291-320, and 365-375 A region homologous to sulfatase; and about amino acids 65-68, 112-115, 132-135, 149-152, 171-174, 198-201, 241-245, 561-564, 608-611, 717-720,754 Includes potential N-glycosyl sites at -757 and 764-767.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Sequence identity between G65169, NCU89492_1, BCU44852_1, E64903, P_R51355, STS_HUMAN, GA6S_HUMAN, and IDS_MOUSE was revealed. Clone DNA48606-1479 was deposited with ATCC on July 1, 1998 and is assigned ATCC deposit number 203040.

Example 22: Isolation of cDNA clones encoding human PRO537 The use of the signal sequence algorithm described in Example 3 above allows the identification of an EST cluster sequence named Incyte EST cluster number 29605 from the Incyte database. It was. Then the EST cluster sequence, as compared to public databases (e. G., GenBank) and my own ESTDNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, An existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA48350.
In light of the observed sequence homology between the DNA48350 consensus sequence and the EST sequence contained in Merck EST clone number R63443, Merck EST clone number R63443 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 48 and is herein designated as DNA49141-1431.
Clone DNA49141-1431 contains a single open reading frame, has an apparent translation start site at nucleotide positions 97-99, and ends with a stop codon at nucleotide positions 442-444 (FIG. 48). The predicted polypeptide precursor is 115 amino acids long (Figure 49). The full-length PRO537 protein shown in FIG. 49 has an estimated molecular weight of about 13,183 and a pI of about 12.13. Analysis of the full-length PRO537 sequence shown in FIG. 49 (SEQ ID NO: 95) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 31; a potential N − of about amino acid 44 to about amino acid 47. An amino acid block having homology with a glycosylation site, a potential N-myristylation site of about amino acid 3 to about amino acid 8 and about amino acid 16 to about amino acid 21 and a multi-copper oxidase protein of about amino acid 97 to about amino acid 105. Clone DNA49141-1431 was deposited with ATCC on June 23, 1998 and is assigned ATCC deposit number 203003.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 49 (SEQ ID NO: 95) revealed that the PRO537 amino acid sequence and the following Dayhoff sequences: A54523, CELF22H10_2, Sequence identity among FKH2_MOUSE, OTX1_HUMAN, URB1_USTMA, KNOB_PLAFN, A32895_1, AF036332_1, HRG_HUMAN and HRP3_PLAFS was revealed.

Example 23: Isolation of cDNA clones encoding human PRO536 By use of the signal sequence algorithm described in Example 3 above, the ss. clu2437. It became possible to identify an EST cluster sequence named init. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA48351.
In light of the observed sequence homology between the DNA48351 consensus sequence and the EST sequence contained in Merck EST clone number H11129, Merck EST clone H11129 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 50 and is herein designated as DNA49142-1430.
Clone DNA49142-1430 contains a single open reading frame, has an apparent translation start site at nucleotide positions 48-50, and ends with a stop codon at nucleotide positions 987-989 (FIG. 50). The predicted polypeptide precursor is 313 amino acids long (Figure 51). The full-length PRO536 protein shown in FIG. 51 has an estimated molecular weight of about 34,189 and a pI of about 4.8. Analysis of the full-length PRO536 sequence shown in FIG. 51 (SEQ ID NO: 97) revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 25, a potential N − of about amino acid 45 to about amino acid 48. A glycosylation site and an amino acid block having homology with a sulfatase protein of about amino acids 16 to about 26 Clone DNA49142-1430 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Sequence identity between H64743, F5114_18, CEAM_ECOLI, GEN14267, H64965, TCU39815_1, PSBJ_ODOSI and P_R06980 was revealed.

Example 24: Isolation of cDNA clones encoding human PRO535 Here, ss. clu12694. It became possible to identify an EST cluster sequence named init. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA48352. Two independently developed Genentech EST sequences were used for assembly and are shown in FIGS.
In view of the observed sequence homology between the DNA48352 consensus sequence and the EST sequence contained in Merck EST clone number H886994, Merck EST clone H86994 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 52 and is herein designated as DNA49143-1429.
Clone DNA49143-1429 contains a single open reading frame, has an apparent translation start site at nucleotide positions 78-80, and ends with a stop codon at nucleotide positions 681-683 (FIG. 52). The predicted polypeptide precursor is 201 amino acids long (Figure 53). The full-length PRO535 protein shown in FIG. 53 has an estimated molecular weight of about 22,180 and a pI of about 9.68. Analysis of the full-length PRO535 sequence shown in FIG. 53 (SEQ ID NO: 99) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 25, a transmembrane domain from about amino acid 155 to about amino acid 174, Potential N-glycosylation site from about amino acid 196 to about amino acid 199, and FKBR-type peptidyl-prolyl cis-trans isomer of about amino acid 62 to about amino acid 77, about amino acid 87 to about amino acid 123, and about amino acid 128 to about amino acid 141 Signature array. Clone DNA49143-1429 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Sequence identity between P_R28980, S71238, FKB2_HUMAN, CELC05C8_1, S55383, S72485, CELC50F2_6 and S75144 was revealed.

Example 25: Isolation of cDNA clone encoding human PRO718 The cDNA sequence isolated by the amylase screening described in Example 2 above (human fetal lung library) is herein designated as DNA43512 (Figure 62; SEQ ID NO: : 108). The DNA43512 sequence is then compared to various expressed sequence tag (EST) databases, including public databases (eg, GenBank) and proprietary ESTDNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). , Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is herein designated DNA45625. A Genentech EST sequence developed independently was used for assembly and is shown in FIGS. 58-61.
Oligonucleotide probes were generated based on the DNA45626 sequence and used to screen a human fetal lung library (LIB25) prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) and the cDNA size cut was less than 2800 bp.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer: 5'-GGGTGGATGGTACTGCTGCATCC-3 '(SEQ ID NO: 109)
Reverse PCR primer: 5'-TGTTGTGCTGTGGGAAATCAGATGTG-3 '(SEQ ID NO: 110)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA45625 sequence having the following nucleic acid sequence:
Hybridization probe:
5'-GTGTCTGGAGGCTGTGGCCGTTTTGTTTTCTTGGGCTAAAATCGGG-3 '(SEQ ID NO: 111)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO718 gene using one of the probe oligonucleotide and PCR primer pair.
A full-length clone is identified, which contains a single open reading frame, has an apparent translation start site at nucleotide positions 36-38, and ends with a stop codon found at nucleotide positions 607-609 (FIG. 56; SEQ ID NO: 102). The predicted polypeptide is 157 amino acids long, has a calculated molecular weight of approximately 17,400 daltons and an estimated pI of approximately 5.78. Analysis of the PRO718 sequence shown in FIG. 57 (SEQ ID NO: 103) revealed the following: about amino acid 21 to about amino acid 40 type II transmembrane domain, and about amino acid 58 to about amino acid 78, about amino acid 95 -Another transmembrane domain of about amino acid 114 and about amino acid 127-about amino acid 147; a cell adhesion sequence of about amino acid 79-about amino acid 81; a potential N-glycosylation site of about amino acid 53-about amino acid 56. Clone DNA49647-1398 has been deposited with ATCC on June 2, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO718 polypeptide suggests that it does not have significant homology with any known protein. However, according to analysis of the Dayhoff database (version 35.45 SwissProt 35), there is a certain relationship between the PRO718 amino acid sequence and the following Dayhoff sequences: AF045606_1, AF039906_1, SPBC8D2? 2, S63441, F64728, COX1_TRYBB, F64375, E64173, RPYGJT_3, MTCY261_23 A degree of homology was revealed.

Example 26: Isolation of cDNA clones encoding human PRO872 The use of the signal sequence algorithm described in Example 3 above, from the Incyte database, where ss. clu120709. It became possible to identify an EST cluster sequence named init. Then cul120709. Init sequences are compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.) An existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA48254.
In light of the observed sequence homology between the DNA48254 consensus sequence and the EST sequence contained in Incyte EST clone number 3438068, the Incyte EST clone 3438068 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 63, which is the full-length DNA sequence of PRO872. Clone DNA49819-1439 has been deposited with ATCC on June 2, 1998 and is assigned ATCC deposit no.
The entire nucleotide sequence of DNA49819-1439 is shown in FIG. 63 (SEQ ID NO: 112). Clone DNA49819-1439 contains a single open reading frame, has an apparent translation start site at nucleotide positions 14-16, and ends with a stop codon at nucleotide positions 1844-1846 (FIG. 63). The predicted polypeptide precursor is 610 amino acids long (Figure 64). The full-length PRO872 protein shown in FIG. 64 has an estimated molecular weight of about 66,820 and a pI of about 8.65. Analysis of the full-length PRO872 sequence shown in FIG. 64 (SEQ ID NO: 113) revealed the presence of: a signal peptide from about amino acids 1 to about amino acids 18, about amino acids 70-87, 200-222 and 568- 588 putative transmembrane domains; sequence identity with the bacterial phytoene dehydrogenase protein of about amino acids 71-105; sequence identity with the chromosome condensation regulator (RCC1) signature 2 of about amino acids 201-111; about amino acids 214-235 A leucine zipper pattern of 221-242, 228-249 and 364-385; a potential N-glycosylation site of about amino acids 271-274; and a glycosaminoglycan binding site of about amino acids 75-78. Analysis of the amino acid sequence of the full-length PRO872 polypeptide using the Dayhoff database (version 35.45 SwissProt 35) revealed that the PRO872 amino acid sequence and the following Dayhoff sequences: PRCRTI_1, S5951, S74689, CELF37C4_3, CRTI_RHOCA, S76617, YNI2_ METTL, MTV014_MAN, APFB_H And homology with MMU70429_1 was revealed.

Example 27: Isolation of cDNA clones encoding human PRO1063 Here, ss. clul 19743. It has become possible to identify a single Incyte EST cluster sequence named init. The IncyteEST cluster sequence ss. clul 19743. Init sequences are compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.) An existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA48288.
In light of the observed sequence homology between the DNA48288 consensus sequence and the EST sequence contained in Incyte EST clone number 2787726, the Incyte EST clone 2793726 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 65 and is herein designated as DNA49820-1427.
The full-length clone shown in FIG. 65 contains a single open reading frame, has an apparent translation start site at nucleotide positions 90-92, and ends with a stop codon at nucleotide positions 993-995 (FIG. 65; sequence). Number: 114). The predicted polypeptide precursor is 301 amino acids long, has a calculated molecular weight of about 33,530 and an estimated pI of about 4.80. Analysis of the full-length PRO1063 sequence shown in FIG. 66 (SEQ ID NO: 115) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 21, about amino acid 195 to about amino acid 198, about amino acid 217 to Potential N-glycosylation site of about amino acid 220 and about amino acid 272 to about amino acid 275, glycosaminoglycan binding site of about amino acid 267 to about amino acid 270, microsomal C-terminal targeting of about amino acid 299 to about amino acid 301 A site, a type II fibronectin collagen binding domain homologous sequence from about amino acid 127 to about amino acid 168, and a fructose bisphosphate once-rase class II protein homologous sequence from about amino acid 101 to about amino acid 118. Clone DNA49820-1427 has been deposited with ATCC on June 2, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO1063 polypeptide suggested sequence homology with the human type IV collagenase protein. More specifically, by analysis of the Dayhoff database (version 35.45 SwissProt 35), the homology between PRO1063 amino acid sequence and the following Dayhoff sequences, S68303, CFU68533_1, P_P91139, RNU65656_1, PA2R_RABIT, MMU56734_1, FINC_XENLA, A48925, P_R92778 and FA12_HUMAN Sex became clear.

Example 28: Isolation of cDNA clones encoding human PRO619 Use of the signal sequence algorithm described in Example 3 above allows identification of an EST cluster sequence, herein designated 88434, from the Incyte database. It was. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built.
In light of the observed sequence homology between the consensus sequence and the EST sequence contained in Incyte's EST clone no. 16656694, the Incyte EST clone 16656694 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 67 and is herein designated DNA49821-1562.
The full-length clone shown in FIG. 67 contains a single open reading frame, has an apparent translation start site at nucleotide positions 81-83, and ends with a stop codon at nucleotide positions 450-452 (FIG. 67; SEQ ID NO: 116). The predicted polypeptide precursor (Figure 68; SEQ ID NO: 117) is 123 amino acids long and contains the predicted signal peptide at about amino acids 1-20. The PRO619 protein has a calculated molecular weight of about 13,710 and an estimated pI of about 5.19. Clone DNA49821-1562 was deposited with ATCC on June 16, 1998 and is assigned ATCC deposit number 209981.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 68 (SEQ ID NO: 117) revealed that the PRO619 amino acid sequence and the following Dayhoff sequences: Significant homology was found among HSU93494_1, HUMIGLAM5_1, D86999_2, HUMIGLYM1_1, HUMIGLYMKE_1, A29491 \ 1, A29498_1, and VPR2_MOUSE.

Example 29: Isolation of cDNA clones encoding human PRO943 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. This consensus sequence was then extended using repeated cycles of BLAST and phrap, and the consensus sequence was extended as much as possible using the source of EST sequences described above. The extended consensus sequence is designated herein as DNA36360. Based on the DNA36360 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the PRO943 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer: 5'-CGAGATGACGCCGAGCCCCC-3 '(SEQ ID NO: 120)
Reverse PCR primer: 5'-CGGTTCGACACGCGGCAGGTG-3 '(SEQ ID NO: 121)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA36360 sequence having the following nucleic acid sequence:
Hybridization probe:
5'-TGCTGCTCCTGCTGCCGCCGCTGCTGCTGGGGGCCTTCCCGCCGG-3 '(SEQ ID NO: 122)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO943 gene using one of the probe oligonucleotide and PCR primer pair. RNA for constructing the cDNA library was isolated from human fetal brain tissue.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO943 (here named DNA52192-1369 [Figure 69, SEQ ID NO: 118]) and the derived protein sequence of PRO943.
The entire coding sequence of PRO943 is shown in FIG. 69 (SEQ ID NO: 118). Clone DNA52192-1369 contains a single open reading frame, has an apparent translation start site at nucleotide positions 150-152, and ends with a stop codon at nucleotide positions 1662-1664 (FIG. 69). The predicted polypeptide is 504 amino acids long (Figure 70). The full-length PRO943 protein shown in FIG. 70 has an estimated molecular weight of about 54,537 daltons and a pI of about 10.04. Analysis of the full-length PRO943 sequence shown in FIG. 70 (SEQ ID NO: 119) revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 17; a transmembrane domain from about amino acid 376 to about amino acid 396 Tyrosine kinase phosphorylation site from about amino acid 212 to about amino acid 219 and from about amino acid 329 to about amino acid 336, from about amino acid 111 to about amino acid 114, from about amino acid 231 to about amino acid 234, from about amino acid 255 to about amino acid 258 and from about amino acid 293 A potential N-glycosylation site of ˜amino acid 296, and an immunoglobulin and MHC protein sequence homology block of about amino acid 219 to about amino acid 236. Clone DNA52192-1369 has been deposited with ATCC on July 1, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology among FGR1_XENLA, S38579, RATHBFGFRB_1, TVHU2F, FRG &quot; _MOUSE, CEK3_CHICK, P_R21080 and A27171_1 was revealed.

Example 30: Isolation of cDNA clones encoding human PRO1188 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. This consensus sequence is herein designated DNA45679. Based on the DNA45679 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the PRO1188 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer: 5'-CTGGTGCCTCAACAGGGAGCAG-3 '(SEQ ID NO: 125)
Reverse PCR primer: 5'-CCATTGTGCAGGTCAGGTCACAG-3 '(SEQ ID NO: 126)
Furthermore, a synthetic oligonucleotide hybridization probe was made from the DNA45679 sequence having the following nucleic acid sequence.
Hybridization probe:
5'-CTGGAGCAAGTGCTCAGCTGCCTGTGGTCAGACTGGGGTC-3 '(SEQ ID NO: 127)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1188 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1188 (herein named DNA52598-1518 [Figure 71, SEQ ID NO: 123]) and the derived protein sequence of PRO1188.
The entire coding sequence of PRO1188 is shown in FIG. 71 (SEQ ID NO: 123). Clone DNA52598-1518 contains a single open reading frame, has an apparent translation start site at nucleotide positions 136-138, and ends with a stop codon at nucleotide positions 3688-3690. The predicted polypeptide is 1184 amino acids long. The full-length PRO1188 protein shown in FIG. 72 has an estimated molecular weight of about 132,582 daltons and a pI of about 8.80. Further features include a signal peptide of about amino acids 1-31; an ATP / GTP binding site motif A (P-loop) of about amino acids 266-273; an aldehyde dehydrogenase cysteine active site of about amino acids 188-199; Growth factor and cytokine receptor family signature 2; and potential N- of about amino acids 129-132, 132-135, 346-349, 420-423, 550-553, 631-634, 1000-1003, and 1056-1059. Contains a glycosylation site.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology between CET21B6_4, CELT19D &quot; _1, and TSP1_MOUSE was revealed.
Clone DNA52598-1518 has been deposited with ATCC and is assigned ATCC deposit no.

Example 31: Isolation of cDNA clones encoding human PRO1133 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. This sequence was extended using repeated phrap cycles. The extended consensus sequence is designated herein as DNA38102. Based on the DNA38102 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the PRO1133 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer: 5′-TCGATTATGGACGAACATGGCAGC-3 ′ (SEQ ID NO: 130);
Forward PCR primer: 5'-TTCTGAGATCCCTCATCCTC-3 '(SEQ ID NO: 131); and reverse PCR primer: 5'-AGGTTCAGGGACAGCAAGTTTGGG-3' (SEQ ID NO: 132)
In addition, a synthetic oligonucleotide hybridization probe was made from the DNA38102 sequence having the following nucleic acid sequence:
Hybridization probe:
5'-TTTGCTGGACCTCGGCTACGGAATTGGCTTCCCTCTACGGACAGCTGGAT-3 '(SEQ ID NO: 133)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1133 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1133 and the derived protein sequence of PRO1133.
The entire coding sequence of PRO1133 is shown in FIG. 73 (SEQ ID NO: 128). Clone DNA53913-1490 contains a single open reading frame and has an apparent translation start site at nucleotide positions 266-268 of SEQ ID NO: 128 and an apparent stop codon at nucleotide positions 1580-1582. The predicted polypeptide is 438 amino acids long. The signal peptide is amino acids 1-18 of SEQ ID NO: 129. The EGF-like domain cysteine pattern signature starts at 315 and 385 of SEQ ID NO: 129 shown in FIG. Clone DNA53913-1490 has been deposited with ATCC and is assigned ATCC deposit no. The full-length PRO1133 protein shown in FIG. 74 has an estimated molecular weight of about 49,260 daltons and a pI of about 6.15.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 74 (SEQ ID NO: 129) revealed the PRO1133 amino acid sequence and Is incorporated here): AF002717_1, LMG1_HUMAN, B54665, UNC6_CAEEL, LML1_CAEEL, LMA5_MOUSE, MMU88353_1, LMA1_HUMAN, HSLN2C64_1 and AF005258_1 revealed some degree of homology.

Example 32: Isolation of cDNA clone encoding human PRO784 A human fetal cDNA library wherein the initial DNA sequence (SEQ ID NO: 136) designated herein as DNA44661 and shown in FIG. 77 is predominantly the 5 ′ end of the primary cDNA clone. Identified using yeast screening. The DNA44661 sequence can then be obtained from various public databases (eg, GenBank) and proprietary databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.) And the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzymology 266: 460-480 (1996)]. The ESTs were then clustered with the computer program “phrap” (Phil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The resulting consensus sequence is designated herein as “DNA45463”. Based on the DNA45463 consensus sequence, an oligonucleotide was synthesized for use as a probe to isolate a clone of the full-length coding sequence of PRO784 from a human fetal lung cDNA library.
The full-length DNA 53978-1433 clone shown in FIG. 75 contains a single open reading frame, has an apparent translation start site at nucleotide positions 37-39, and terminates with a stop codon found at nucleotide positions 821-823 (FIG. 75; SEQ ID NO: 134). The predicted polypeptide precursor (Figure 76; SEQ ID NO: 135) is 228 amino acids long. PRO78 has a calculated molecular weight of about 25,735 and an estimated pI of about 5.45. PRO784 has the following characteristics: a signal peptide from about amino acids 1 to about 15; a transmembrane domain from about amino acids 68 to about 87, about 183 to about 204; about amino acids 15-20, 51-56, 66-60, 163 N-myristoylation sites at 16, and 206-211; RNP-1 protein RNA binding region from about amino acid 108 to about 117.
Clone DNA53978-1443 has been deposited with ATCC on Jun. 16, 1998 and is assigned ATCC deposit no.
Based on BLAST and FastA sequence alignment analysis of the full-length sequence (using the ALIGN computer program), PRO784 showed amino acid sequence identity with the following proteins: RNU42209_1, MMU91538_1, CGU91742_1, CELF55A4_6, SC22_YEAST, and F48188.

Example 33: Isolation of cDNA clones encoding human PRO783 A yeast screening assay was used to identify cDNAs encoding potential secreted proteins. The use of this yeast screening assay allowed the identification of a single cDNA, designated herein as DNA45201 (Figure 80; SEQ ID NO: 139).
The DNA45201 sequence was then used to identify homology compared to the EST sequence. EST databases include public databases (eg, GenBank) and proprietary databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The resulting consensus sequence is herein labeled “consen01”. The originally developed Genentech EST sequence was used for consensus assembly and was herein designated as DNA14575 (FIG. 81; SEQ ID NO: 140).
Based on the consen01 sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the full-length coding sequence of PRO783. . To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs, such as Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5′-GACTGTATCTGAGCCCCAGACTGC-3 ′ (SEQ ID NO: 141),
Forward PCR primer 5'-TCAGCAATGAGGTGCTGCTC-3 '(SEQ ID NO: 142) and reverse PCR primer 5'-TGAGGAAGATGAGGGACAGGTTGG-3' (SEQ ID NO: 143)
Furthermore, a synthetic oligonucleotide hybridization probe was prepared from a DNAconsen01 sequence having the following nucleic acid sequence.
Hybridization probe
5'-TATGGAAGCACCTGACTACGAAGTGCTATCCGTGCGAGAACAGCTATTCC-3 '(SEQ ID NO: 144)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO783 gene using one of the probe oligonucleotide and PCR primer pair.
RNA for construction of the cDNA library was isolated from human fetal kidney tissue (LIB228). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO783 (herein named DNA53996-1442) [SEQ ID NO: 137]) and the derived protein sequence of PRO783.
The entire coding sequence of PRO783 is shown in Figure 78 (SEQ ID NO: 137). Clone DNA53996-1442 contains a single open reading frame, has an apparent translation start site at nucleotide positions 310-312, and ends with a stop codon at nucleotide positions 1777-1779 (FIG. 78). The predicted polypeptide is 489 amino acids long (Figure 79). The full-length PRO783 protein shown in FIG. 79 has an estimated molecular weight of about 55,219 daltons and a pI of about 8.47. Analysis of the full-length PRO783 sequence shown in Figure 79 (SEQ ID NO: 138) revealed the presence of the following: about amino acids 23-42, 67-89, 111-135, 154-176, 194-218, Transmembrane domains of 296-319, 348-370, 387-410 and 427-452; a leucine zipper pattern localized at about amino acids 263-283 and 399-420; potential tyrosine kinase phosphorylation at about amino acids 180-187 A potential N-glycosylation site of about amino acids 105-108 and 121-124; a cAMP and cGMP-dependent protein kinase phosphorylation site of about amino acids 288-291; and a bacterial rhodopsin retinal binding site protein of about amino acids 190-218 A region that has homology with.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed some degree of sequence identity between the PRO783 amino acid sequence and the following Dayhoff sequences: YNC2_CAEEL, D64048, ATAC002332_3F4P9.3, NY2R_SHEEP, and VSH_MUMPA.
Clone DNA53996-1442 has been deposited with ATCC on June 2, 1998 and is assigned ATCC deposit no.

Example 34: Isolation of cDNA clones encoding human PRO820 The expression sequence tag (EST) database (Merck / wsh.U) was searched to identify an EST designated EST number AA504080, Merck clone number 825136 (library) 312, human B cell tonsils). A homology search revealed that this EST showed sequence identity with the low affinity immunoglobulin gamma Fc receptor II. DNA sequence analysis gave the full-length DNA sequence of PRO820 and the derived protein sequence of PRO820.
The entire nucleotide sequence of DNA56041-1416 is shown in FIG. 82 (SEQ ID NO: 145). Clone DNA56041-1416 contains a single open reading frame, has an apparent translation start site at nucleotide positions 115-117, and ends with a stop codon at nucleotide positions 487-489 (FIG. 82). The predicted polypeptide is 124 amino acids long (Figure 83). The full-length PRO820 protein shown in FIG. 83 has an estimated molecular weight of about 14,080 daltons and a pI of about 7.48. Clone DNA56041-1416 has been deposited with ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence and that the sequences provided herein are based on known sequencing techniques.
Upon further analysis of the amino acid sequence of SEQ ID NO: 146, the predicted signal peptide is approximately amino acids 1-15 of SEQ ID NO: 146. The protein kinase C phosphorylation site is approximately amino acids 20-22 and 43-45 of SEQ ID NO: 146. The N-myristoylation site is approximately amino acids 89-94 of SEQ ID NO: 146. The immunoglobulin and major histocompatibility complex domain is approximately amino acids 83-90 of SEQ ID NO: 146. Corresponding nucleotides can be routinely determined given the sequence provided herein.

Example 35: Isolation of cDNA clones encoding human PRO1080 Consensus DNA sequences were generated using phrap relative to other EST sequences and extended using repeated cycles of BLAST and phrap as described in Example 1 above. The consensus sequence was extended as much as possible using a source of EST sequences as described. This consensus sequence is herein designated DNA52640. An EST originally developed by Genentech is used for consensus assembly, and is named DNA36527 (FIG. 86; SEQ ID NO: 149).
In light of the observed sequence homology between the DNA36527 consensus sequence and the EST sequence contained in Merck EST clone number 526423, Merck EST clone 526423 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 84, where the entire nucleotide sequence of DNA56047-1456 is shown in FIG. 84 (SEQ ID NO: 147). Clone DNA56047-1456 contains a single open reading frame and ends with an apparent translation start site at nucleotide positions 159-161 of SEQ ID NO: 147 (FIG. 84) and a stop codon at nucleotide positions 1233-1235. The predicted polypeptide precursor is 358 amino acids long (Figure 85). The full-length PRO1080 protein shown in FIG. 85 has an estimated molecular weight of about 40,514 daltons and a pI of about 6.08. Clone DNA56047-1456 has been deposited with ATCC on June 9, 1998. The deposited clone contains the actual nucleotide sequence, and it is understood that the sequence provided herein is based on known sequencing techniques.
FIG. 85 also shows the approximate positions of the signal peptide, cell adhesion site, Nt-Dnaj domain signature, region with sequence identity to the Nt-Dnaj domain protein, and N-glycosylation site. Nucleic acids and others corresponding to these amino acid sequences provided herein can be routinely determined from the information provided herein.

Example 36: Isolation of cDNA clones encoding human PRO1079 A consensus DNA sequence was generated using phrap against other EST sequences as described in Example 1 above and is herein designated DNA52714. Based on the information provided by the assembly, a clone of Merck EST number HO6898 was obtained and sequenced, thereby giving the nucleotide sequence of the clone designated herein as DNA56050-1455. The entire nucleotide sequence of DNA56050-1455 is shown in FIG. 87 (SEQ ID NO: 150). Clone DNA56050-1455 contains a single open reading frame, has an apparent translation start site at nucleotide positions 183-185, and ends with a stop codon at nucleotide positions 861-863 (FIG. 87). The predicted polypeptide is 226 amino acids long (Figure 88). The full-length PRO1079 protein shown in FIG. 88 has an estimated molecular weight of about 24,611 daltons and a pI of about 4.85. Analysis of the full-length PRO1079 sequence shown in Figure 88 (SEQ ID NO: 3) revealed the presence of the following features: a signal peptide of about amino acids 1-29; N- of about amino acids 10-15 and 51-56. Myristoylation site; homology to the photosystem IpsaG and psaK proteins of about amino acids 2-20; and homology to the prolyl endopeptidase protein of about amino acids 150-163.
Analysis of the amino acid sequence of the full-length PRO1079 polypeptide using the Dayhoff database (version 35.45 SwissProt 35) showed significant homology between the PRO1079 amino acid sequence and the following Dayhoff sequences: CEK10C3_4, MMU50734_1, D69503, AF51149_1, and VSMP_CVMS It was revealed.
Clone UNQ536 (DNA56050-1455) was deposited with ATCC on June 22, 1998 and is assigned ATCC deposit number 203011.

Example 37: Isolation of cDNA clones encoding human PRO793 A cDNA clone encoding native human PRO793 polypeptide (DNA56110-1437) was isolated from a yeast skin tumor cDNA library that predominantly represents the 5 'end of the primary cDNA clone. Identified using screening. The yeast screen used identified a single EST clone, designated herein as DNA50177 (Figure 91; SEQ ID NO: 154). The DNA50177 sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary ESTDNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). The existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA50972.
In light of the observed sequence homology between the DNA50972 consensus sequence and the EST sequence contained in Merck EST clone number N33874, Merck EST clone N33874 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 89 and is herein designated as DNA56110-1437.
The full-length DNA 56110-1437 clone shown in FIG. 89 contains a single open reading frame, has an apparent translation start site at nucleotide positions 77-79, and ends with a stop codon at nucleotide positions 491-493 (FIG. 89). . The predicted polypeptide precursor is 138 amino acids long (Figure 90). The PRO793 protein shown in FIG. 90 has an estimated molecular weight of about 15,426 and a pI of about 10.67. Analysis of the full-length PRO1180 sequence shown in FIG. 90 (SEQ ID NO: 153) revealed the presence of: about amino acid 12 to about amino acid 30, about amino acid 33 to about amino acid 52, about amino acid 69 to about amino acid 89 And a transmembrane domain from about amino acid 93 to about amino acid 109, a potential N-myristoylation site from about amino acid 11 to about amino acid 16, about amino acid 51 to about amino acid 56 and about amino acid 116 to about amino acid 121, and about amino acid 49 to An amino acid sequence block having homology with an aminoacyl transferase RNA synthetase class II protein of about amino acid 59. Clone DNA56110-1437 has been deposited with ATCC on August 11, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Some homology was revealed between MTEHGN9_2, E64030, H69784, D64995, CD53_MOUSE, GEN8006, AE001138_7 and COX2_STRPU.

Example 38: Isolation of cDNA clones encoding human PRO1016 Consensus DNA sequences were generated against other EST sequences using phrap as described in Example 1. This consensus sequence is herein designated DNA53502.
In light of the observed sequence homology between the DNA53502 consensus sequence and the EST sequence contained in Merck EST clone number 38680, Merck EST clone 38680 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The full length nucleotide sequence of DNA56113-1378 is shown in FIG. 92 (SEQ ID NO: 155). Clone DNA56113-1378 contains a single open reading frame, has an apparent translation start site at nucleotide positions 168-170, and ends with a stop codon at nucleotide positions 1302-1304 (FIG. 92). The predicted polypeptide precursor is 378 amino acids long (Figure 93). The full-length PRO1016 protein shown in FIG. 93 has an estimated molecular weight of about 44,021 daltons and a pI of about 9.07. Clone DNA56113-1378 has been deposited with ATCC. With regard to the sequence, it is understood that the deposited clone contains the actual nucleotide sequence and that the sequence provided herein is based on known sequence techniques.
Analysis of the amino acid sequence of the full-length PRO1016 polypeptide suggests that some have sequence identity with the acyltransferase, thereby indicating that PRO1016 is a novel acyltransferase.
Upon further analysis of the amino acid sequence of SEQ ID NO: 156, the predicted signal peptide is about amino acids 1-18 of SEQ ID NO: 156. The transmembrane domain is approximately amino acids 332-352 and 305-330 of SEQ ID NO: 156. The fructose-bisphosphate aldolase class II protein is about amino acids 73-90 of SEQ ID NO: 156. The extradiol ring-cleaved dioxygenase protein is about amino acids 252-275 of SEQ ID NO: 156. Corresponding nucleotides can be routinely determined from the sequences given herein.
Specific Dayhoff database notation names for sequences for which PRO1016 has sequence identity include: S52645, P_R59712, P_R99249, P_R59713, BNAGPATRF_1, CELT054_15 and CELZK40_1.

Example 39: Isolation of cDNA clones encoding human PRO1013 Consensus DNA sequences were generated against other EST sequences using phrap as described in Example 1. The consensus DNA sequence was then extended using repeated cycles of BLAST and phrap, and the consensus sequence was extended as much as possible using a source of EST sequences.
In light of the observed sequence homology between the consensus sequence and the EST sequence contained in Incyte EST clone no. 3107695, the Incyte EST clone 3107695 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 94 and is herein designated as DNA56410-1414.
The full-length nucleotide sequence of DNA56410-1414 is shown in FIG. 94 (SEQ ID NO: 157). Clone DNA56410-1414 contains a single open reading frame, has an apparent translation start site at nucleotide positions 17-19, and ends with a stop codon at nucleotide positions 1244-1246 (FIG. 94). The predicted polypeptide precursor is 409 amino acids long (Figure 95). The full-length PRO1013 protein shown in FIG. 95 has an estimated molecular weight of about 46,662 daltons and a pI of about 7.18. Clone DNA56410-1414 has been deposited with ATCC. With regard to the sequence, it is understood that the deposited clone contains the actual nucleotide sequence and that the sequence provided herein is based on known sequence techniques.
Upon further analysis of the amino acid sequence of SEQ ID NO: 158, the predicted signal peptide is about amino acids 1-19 of SEQ ID NO: 158. The N-glycosylation sites are about amino acids 75-78 and 322-325 of SEQ ID NO: 158. The N-myristoylation site is about amino acids 184-189 of SEQ ID NO: 158. The growth factor and cytokine receptor family domain is about amino acids 134-149 of SEQ ID NO: 158. Corresponding nucleotides can be routinely determined from the sequences given herein.
Blast analysis showed some sequence identity with other proteins. In particular, PRO1013 has a certain degree of sequence identity with the Dayhoff sequence referred to as at least D63877_1, MHU22019_1, AE000730_10, and AF019079_1.

Example 40: Isolation of cDNA clones encoding human PRO937 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. This consensus sequence is herein designated DNA49651. Based on the DNA49651 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the PRO937 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-CTCCGTGGTAAACCCCACAGCCC-3 '(SEQ ID NO: 161)
Reverse PCR primer 5'-TCACATCGATGGGATCCATGACCG-3 '(SEQ ID NO: 162)
Furthermore, a synthetic oligonucleotide hybridization probe was made from a DNA49651 sequence having the following nucleic acid sequence:
Hybridization probe
5'-GGTCTCGTGACTGTGAAGCCATGTTACAACTACTGCTCAAACATCATGAG-3 '(SEQ ID NO: 163)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO937 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal kidney tissue (LB227).
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO937 [herein designated as DNA56436-1448 (FIG. 29; SEQ ID NO: 159)] and the derived protein sequence of PRO937.
The entire nucleotide sequence of DNA56436-1448 is shown in FIG. 96 (SEQ ID NO: 159). Clone DNA56436-1448 contains a single open reading frame and has an apparent translation start site at nucleotide positions 499-501 and ends with a stop codon found at nucleotide positions 2167-2169 (FIG. 96, SEQ ID NO: 159). . The predicted polypeptide precursor is 556 amino acids long,
It has a calculated molecular weight of about 62,412 daltons and an estimated pI of about 6.62. Analysis of the full-length PRO937 sequence shown in FIG. 97 (SEQ ID NO: 160) revealed the presence of the following features: a signal peptide of about amino acids 1-22; an ATP / GTP binding site motif A of about amino acids 515-523 (P-loop); potential N-glycosylation site at about amino acids 514-517; and glypican homology at about amino acids 54-74, 106-156, 238-279, 309-345, 423-459 and 468-505. Part of.
Clone DNA56436-1448 has been deposited with ATCC on May 27, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of full-length PRO937 suggests that it has significant sequence similarity to the glypican protein, thereby indicating that PRO937 is a novel glypican protein. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed that the PRO937 amino acid sequence and the following Dayhoff sequences, GPCK_MOUSE, GPS2_RAT, GPC5_HUMAN, GPC3_HUMAN, P_R30168, CEC03H12_2, GEN13820, HS119E23_1 and HDAC_DROME 37, Significant homology was revealed.

Example 41: Isolation of cDNA clone encoding human PRO842 The use of the signal sequence algorithm described in Example 3 above allows the identification of an EST cluster sequence named Incyte EST cluster number 69572 from the Incyte database. It was. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is herein designated DNA54230.
In light of the observed sequence homology between the DNA54230 consensus sequence and the EST sequence contained in Merck EST clone number AA477092, Merck EST clone number AA477092 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 98 and is herein designated as DNA56855-1447.
The full-length clone shown in FIG. 98 contains a single open reading frame, has an apparent translation start site at nucleotide positions 153-155, and ends with a stop codon at nucleotide positions 510-512 (FIG. 98; SEQ ID NO: 164). The predicted polypeptide precursor is 119 amino acids long (Figure 99; SEQ ID NO: 165). PRO842 has a calculated molecular weight of about 13,819 daltons and an estimated pI of about 11.16. Other features of PRO842 are:
It contains an about amino acid 1-22 signal peptide, a protein kinase C phosphorylation site at about amino acid 39-41, and a potential N-glycosylation site at about amino acid 27-32 and about amino acid 46-51.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 99 (SEQ ID NO: 164) revealed that the PRO842 amino acid sequence and the following Dayhoff sequences: Some homology was revealed between RAT5HT2X_1, S81882_1, A60912, MCU60315_137MC137L, U93422_1, p_P91996, U93462_1, and ZN18_HUMAN.
Clone DNA56855-1447 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.

Example 42: Isolation of cDNA clone encoding human PRO839 EST cluster sequence named Incyte EST cluster number 24479 from Incyte's LIFESEQ® database by use of the signal sequence algorithm described in Example 3 above. Can be identified. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55709.
In light of the observed sequence homology between the DNA55709 consensus sequence and the EST sequence contained in Merck EST clone no. 754525, Merck EST clone 754525 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in Figure 100 and is herein designated as DNA56859-1445.
The full-length clone shown in FIG. 100 contains a single open reading frame, has an apparent translation start site at nucleotide positions 2-4, and ends with a stop codon at nucleotide positions 263-265 (FIG. 100; SEQ ID NO: 166). The predicted polypeptide precursor is 87 amino acids long (Figure 101; SEQ ID NO: 167). PRO839 has a calculated molecular weight of about 9,719 daltons and an estimated pI of about 4.67. Other features of PRO839 are a signal peptide of about amino acids 1-23, a protein kinase C phosphorylation site of about amino acids 37-40 and about amino acids 85-87, a potential casein kinase II phosphorylation site of about amino acids 37-40, Sequence identity with the ribonucleotide reductase large subunit protein of about amino acids 50-60, and sequence identity with the eukaryotic RNA binding region RNP-1 protein of about amino acids 70-79.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Some degree of homology was revealed among HS714385_1, S49783, BB19_RABIT, GVPH-HALME, AB003135_1, P_R85453, LUU27081_2, and TP2B_MOUSE.
Clone DNA56859-1445 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.

Example 43: Isolation of cDNA clone encoding human PRO1180 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single IncyteEST cluster sequence (Incyte cluster SEQ ID NO: 14732). This Incyte cluster SEQ ID NO: 14732 sequence is then converted into various expressed sequence tags (ESTs) including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Compared to the database, the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55711.
In light of the observed sequence homology between the DNA55711 consensus sequence and the EST sequence contained in Merck EST clone number T60981, Merck EST clone T60981 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 102 and is herein designated as DNA56860-1510.
The full-length clone shown in FIG. 102 contains a single open reading frame, has an apparent translation start site at nucleotide positions 78-80, and ends with a stop codon at nucleotide positions 909-911 (FIG. 102; SEQ ID NO: 168). ). The predicted polypeptide precursor is 277 amino acids long, has a calculated molecular weight of approximately 31,416 and an estimated pI of approximately 8.88. Analysis of the full-length PRO1180 sequence shown in FIG. 103 (SEQ ID NO: 169) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 23, a leucine zipper pattern sequence from about amino acid 10 to about amino acid 31 N-myristoylation site of about amino acid 64 to about amino acid 69, about amino acid 78 to about amino acid 83, about amino acid 80 to about amino acid 85, about amino acid 91 to about amino acid 96 and about amino acid 201 to about amino acid 206. Clone DNA56860-1510 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit no.
Amino acid analysis of the full-length PRO1180 polypeptide suggested sequence similarity with the methyltransferase family of proteins. More specifically, by analysis using the Dayhoff database (version 35.45 SwissProt 35), the PRO1180 amino acid sequence and the following Dayhoff sequences: MTC165_14, D69267, YH09_TEAST, BIOC_SERMA, ATAC00448415T1D16.16, SHGCPIR_18, SPBC3B9_4, AB009504_A, P_AB52 Some degree of homology was revealed between.

Example 44: Isolation of cDNA clone encoding human PRO1134 Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST cluster sequence named 7511 from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55725. Two independently developed EST sequences were used for assembly and are shown in FIG. 106 (SEQ ID NO: 172) and FIG. 107 (SEQ ID NO: 173).
In light of the observed sequence homology between the DNA55725 consensus sequence and the EST sequence contained in Merck EST clone number H94897, Merck EST clone H94897 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 106 and is herein designated as DNA56865-1491.
Clone DNA56865-1491 contains a single open reading frame, has an apparent translation start site at nucleotide positions 153-155, and ends with a stop codon at nucleotide positions 1266-1268 (FIG. 104). The predicted polypeptide precursor is 371 amino acids long (Figure 105). The full-length PRO1134 shown in FIG. 105 has an estimated molecular weight of about 41,935 daltons and a pI of about 9.58. Analysis of full-length PRO1134 revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 23, about amino acid 103 to about amino acid 106, about amino acid 249 to about amino acid 252, and about amino acid 257 to about amino acid 260. An amino acid block having homology to the N-glycosylation site of and the tyrosinase CuA binding region protein from about amino acid 280 to about amino acid 306. Clone DNA56865-1491 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology among S47847, C64146, GSPA_BACSU, P_W10564, RFAI_ECOLI, Y258_HAEIN, RFAJ_SALTY and P_R32985 was revealed.

Example 45: Isolation of cDNA clones encoding human PRO830 Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST cluster sequence designated 20251 from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55733.
In light of the observed sequence homology between the DNA55733 consensus sequence and the EST sequence contained in Merck EST clone number H78534, the Merck EST clone H78534 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 108 and is herein designated as DNA56866-1342.
Clone DNA56866-1342 contains a single open reading frame, has an apparent translation start site at nucleotide positions 154-156, and ends with a stop codon at nucleotide positions 415-417 (FIG. 108). The predicted polypeptide precursor is 87 amino acids long (Figure 109). The full-length PRO830 shown in FIG. 109 has an estimated molecular weight of about 9,272 daltons and a pI of about 9.19. Analysis of the full-length PRO830 shown in FIG. 109 (SEQ ID NO: 175) revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 33, about amino acid 2 to about amino acid 7 and about amino acid 8 to about amino acid 13 potential N-myristoylation sites and a protein homology block of the thioredoxin family from about amino acid 23 to about amino acid 39. Clone UNQ470 (DNA56866-1342) was deposited with the ATCC on June 22, 1998 and is assigned ATCC deposit number 203023.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology among SAPKSGENE_1, HPU31791_5, GGCNOT2_1, CPU91421_1, CHKESTPC09_1, PQ0769, U97553_79 and B60095 was revealed.

Example 46 Isolation of cDNA Clones Encoding Human PRO1115 EST cluster sequence designated Incyte EST cluster number 165008 from Incyte's LIFESEQ® database using the signal sequence algorithm described in Example 3 above. Can be identified. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55726.
In light of the observed sequence homology between the DNA55726 consensus sequence and the EST sequence contained in Merck EST clone number R75784, the Merck EST clone R75784 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 111 and is herein designated as DNA56868-1478.
The full-length clone shown in FIG. 110 contains a single open reading frame, has an apparent translation start site at nucleotide positions 189-191, and ends with a stop codon at nucleotide positions 1524-1526 (FIG. 110; SEQ ID NO: 176). The predicted polypeptide precursor is 445 amino acids long (Figure 111; SEQ ID NO: 177). PRO1115 has a calculated molecular weight of about 50,533 daltons and an estimated pI of about 8.26. Other features include a signal peptide of about amino acids 1-20, potential N-glycosylation sites of about amino acids 204-207, 295-298 and 313-316, and about amino acids 35-54, 75-97, 126-146. 185-204, 333-350 and 353-371.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 111 (SEQ ID NO: 177) revealed that the PRO1115 amino acid sequence and the following Dayhoff sequence: AF053947_79, S73698, Some sequence identity was revealed among CEC47A10_4, CCOMTNDS5G_1, HS4LMP2AC_1, LMP2_EBV, PA24_MOUSE, HCU33331_7, P-W05508, and AF002273_1.
Clone DNA56868-1478 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.

Example 47 Isolation of cDNA Clones Encoding Human PRO1277 Consensus DNA sequences were generated relative to other EST sequences using BLAST and the program “phrap” repetitive cycles as described in Example 1. One or more ESTs from the assembly were derived from diseased coronary artery tissue. The resulting consensus sequence is designated herein as “DNA49434”.
In light of the observed sequence homology between the DNA49434 consensus sequence and the EST sequence contained in Incyte EST clone no. 3042605, the Incyte EST clone 3042605 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 112 (SEQ ID NO: 178).
Clone DNA56869-1545 contains a single open reading frame, has an apparent translation start site at nucleotide positions 188-190, and ends with a stop codon at nucleotide positions 2222-2224 (FIG. 112). The predicted polypeptide precursor is 678 amino acids long (Figure 113). The full-length PRO1277 protein shown in FIG. 113 has an estimated molecular weight of about 73,930 daltons and a pI of about 9.48. Additional features include a signal peptide of about amino acids 1-26; a transmembrane domain of about amino acids 181-200; and potential N-glycosylation sites of about amino acids 390-393 and 520-523.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. The significant homology of was revealed. Homology was also found between the PRO1277 amino acid sequence and the following Dayhoff sequences: AF006740_1, CA36_HUMAN, HSU1_1, HUMCOL7A1X_1, CA17_HUMAN, MMZ78163_1, CAMA_CHICK, HSU69263_1, YNX3_CAEEL and MMRNAM3_1.
Clone DNA56869-1545 has been deposited with ATCC and is assigned ATCC deposit no. 203161.

Example 48: Isolation of cDNA clones encoding human PRO1135 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1 above. This consensus sequence is herein designated DNA52767. Based on the DNA52767 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the PRO1135 coding sequence. .
To screen several libraries for a source of full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs prepared based on the DNA52767 sequence. The positive library was then used to isolate a clone encoding the PRO1135 gene using the probe oligonucleotide and one of the pair. RNA for construction of the cDNA library was isolated from human coronary artery smooth muscle tissue (LIB309). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1135 [herein named DNA56870-1492 (SEQ ID NO: 180)] and the derived protein sequence of PRO1135.
The entire nucleotide sequence of DNA56870-1492 is shown in FIG. 114 (SEQ ID NO: 180). Clone DNA56870-1492 contains a single open reading frame and has an apparent translation start site at nucleotide positions 62-64 and ends with a stop codon found at nucleotide positions 1685-1687 (FIG. 114). The predicted polypeptide precursor is 541 amino acids long (Figure 115). The full-length PRO1135 sequence shown in FIG. 115 has an estimated molecular weight of about 60,335 daltons and a pI of about 5.26. Analysis of the full-length PRO1135 sequence shown in FIG. 115 (SEQ ID NO: 181) revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 21; about amino acid 53 to about amino acid 56, about amino acid 75 to A potential N-glycosylation site of about amino acid 78, about amino acid 252 to about amino acid 255 and about amino acid 413 to about amino acid 416, and an amino acid block having homology with the glycosyl hydrolase family 35 protein of about amino acid 399 to about amino acid 414. Clone DNA56870-1492 has been deposited with ATCC on June 2, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of full-length PRO1135 suggests that it has significant sequence similarity with the alpha 1,2-mannosidase protein, thereby indicating that PRO1135 is a novel glypican protein. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed that there was significant homology between the PRO1135 amino acid sequence and the following Dayhoff sequences: DMC86E4_5, D86967_1, SPAC23A1_4, YH04_YEAST, B54408, SSMAN9MAN_1, CEZC410_4, S61631 and MSU14190_1 Sex became clear.

Example 49: Isolation of cDNA clone encoding human PRO1114 The cDNA sequence isolated by the amylase screening described in Example 2 above (human fetal lung library) was analyzed using the WU-BLAST-2 sequence alignment computer program. Has been found to have some sequence identity with known interferon receptors. This cDNA sequence is designated herein as DNA48466 and is shown in FIG. 118 (SEQ ID NO: 184). Probes were generated from DNA48466 molecules based on sequence identity and used to screen a human breast cancer (LIB135) library prepared as described in paragraph 1 of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) and the cDNA size cut was less than 2800 bp.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer: 5'-AGGCTTCGCTGCGACTAGACCTC-3 '(SEQ ID NO: 185)
Reverse PCR primer: 5'-CCAGGTCGGGTAAGGATGGTTGAG-3 '(SEQ ID NO: 186)
Hybridization probe:
5'-TTTCTACGCATTGATTCCATGTTTGCTCACAGATGAAGTGGCCATTCTGC-3 '(SEQ ID NO: 187)
A full-length clone is identified, which contains a single open reading frame, with an apparent translation start site at nucleotide positions 250-252 and a stop signal at nucleotide positions 1183-1185 (FIG. 116; SEQ ID NO: 182). The predicted polypeptide precursor is 311 amino acids long, has a calculated molecular weight of about 35,076 daltons and an estimated pI of about 5.04. Analysis of the PRO1114 sequence shown in FIG. 117 (SEQ ID NO: 183) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 29, a transmembrane domain from about amino acid 230 to about amino acid 255, about amino acid 40 A potential N-glycosylation site of about amino acid 43 and about amino acid 134 to about amino acid 137, an amino acid sequence block homologous to a tissue factor protein of about amino acid 92 to about amino acid 119, and about amino acid 232 to about amino acid 262 Amino acid sequence block with homology to integrin alpha chain protein. Clone DNA570703-1403 has been deposited with ATCC on May 27, 1998 and is assigned ATCC deposit number 209905.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 117 (SEQ ID NO: 183) revealed a PRO1114 amino acid sequence and Significant homology between P_R71035, INGS_HUMAN, A26595_1, A26593_1, I56215 and TF_HUMAN was revealed.

Example 50: Isolation of cDNA clone encoding human PRO828 A consensus DNA sequence was generated using the method described in Example 1 above. This consensus sequence is herein designated DNA35717. Based on the DNA35717 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the PRO828 coding sequence. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer: 5'-GCAGGACTTCTACGACTTCAAGGC-3 '(SEQ ID NO: 190)
Reverse PCR primer: 5'-AGTCTGGGCCAGGTACTTGAAGGC-3 '(SEQ ID NO: 191)
In addition, a synthetic oligonucleotide hybridization probe was made from the DNA35717 sequence having the following nucleic acid sequence:
Hybridization probe:
5'-CAACATCCGGGGCAAACTGGTGTCGCTGGAGAAGTACCGCGGATCGGTGT-3 '(SEQ ID NO: 192)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO828 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal lung tissue (LIB25).
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO828 [herein named DNA57037-1444] (FIG. 188) and the derived protein sequence of PRO828.
The entire coding sequence of PRO828 is shown in Figure 119 (SEQ ID NO: 188). Clone DNA57037-1444 contains a single open reading frame, has an apparent translation start site at nucleotide positions 34-36, and ends with a stop codon at nucleotide positions 595-597 (FIG. 119). The predicted polypeptide precursor is 187 amino acids long (Figure 120). The full-length PRO828 protein shown in FIG. 120 has an estimated molecular weight of about 20,996 daltons and a pI of about 8.62. Analysis of the full-length PRO828 sequence shown in FIG. 120 (SEQ ID NO: 189) revealed the presence of: a signal peptide of about amino acids 1-21; and a glutathione peroxidase signature 2 of about amino acids 82-89. Sequence identity; sequence identity with glutathione peroxidase selenocysteine protein of about amino acids 35-60, 63-100, 107-134 and 138-159. Clone DNA57037-1444 has been deposited with ATCC on May 27, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO828 polypeptide suggests that it has significant sequence similarity to glutathione peroxidase, thereby indicating that PRO828 is a novel peroxidase enzyme. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) shows that the PRO828 amino acid sequence is identical to the following Dayhoff sequence: AF053311_1, CELT09A12_2, AC004151_3, BTUE_ECOLI, CER05H10_3, P_P80918, PWU88907_1, and P_W22308. It was revealed.

Example 51: Isolation of cDNA clone encoding human PRO1009 A cDNA clone (DNA57129-1413) encoding native human PRO1009, preferably the SK-Lu-1 adenocarcinoma cell line representing the 5 'end of the primary cDNA clone Identified in the cDNA library using yeast screening. First SEQ ID NO:
195 (FIG. 123) was identified, and it was extended by alignment to other EST sequences to form a consensus sequence, synthesizing an oligonucleotide probe based on the consensus sequence to screen a cDNA library resulting in a full-length DNA57129-1413 clone. used.
The full-length DNA57129-1413 clone shown in FIG. 121 contains a single open reading frame, has an apparent translation start site at nucleotide positions 41-43, and ends with a stop codon at nucleotide positions 1886-1888 (FIG. 121; SEQ ID NO: 193). The predicted polypeptide precursor is 615 amino acids long (Figure 122, SEQ ID NO: 194). FIG. 122 also shows the approximate location of the signal sequence, transmembrane domain, myristoylation site, glycosylation site, and AMP binding domain. PRO1009 has a calculated molecular weight of about 68,125 daltons and an estimated pI of about 7.82. Clone DNA57129-1413 has been deposited with ATCC and is assigned ATCC deposit no. It will be appreciated that the deposited clone has the actual correct sequence and the presentation here may contain minor amounts of normal sequence errors.
Based on WU-BLAST-2 sequence alignment analysis (using the ALIGN computer program) of the full-length sequence, PRO1009 has been shown to have sequence identity with at least the following proteins referred to below in the Dayhoff database: F69893, CEF28F8_2, BSY13917_7, BSY13917_7, D69187, D69649, XCRPEB_1, E649928, YDID_ECOLI, BNACSF8_1 and RPU75363_2.

Example 52: Isolation of cDNA clones encoding human PRO1007 Consensus DNA sequences were generated using phrap against other EST sequences as described in Example 1. This consensus sequence is herein designated DNA40671.
In light of the observed sequence homology between the DNA40671 consensus sequence and the EST sequence contained in Merck EST clone number T70513, the Merck EST clone T70513 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The complete nucleotide sequence of DNA57690-1374 is shown in FIG. 124 (SEQ ID NO: 196). Clone DNA57690-1374 contains a single open reading frame and ends with an apparent translation start site at nucleotide positions 16-18 and a stop codon at nucleotide positions 1054-1056 (FIG. 124). The predicted polypeptide precursor is 346 amino acids long (Figure 125). The full-length PRO1007 protein shown in FIG. 125 has an estimated molecular weight of about 35,917 daltons and a pI of about 8.17. Clone DNA57690-1374 has been deposited with ATCC on June 9, 1998. With regard to the sequence, it is understood that the deposited clone contains the actual nucleotide sequence and that the sequence provided herein is based on known sequence techniques. The representative drawings here show representative numbering.
Analysis of the amino acid sequence of the full-length PRO1007 polypeptide suggests that some have sequence identity with MAGPIAP, thereby indicating that PRO1007 is a new member of the family to which MAGPIAP belongs.
Upon further analysis of the amino acid sequence of SEQ ID NO: 197, the predicted signal peptide is approximately amino acids 1-30 of SEQ ID NO: 197. The transmembrane domain is approximately amino acids 325-346 of SEQ ID NO: 197. The N-glycosylation sites are approximately amino acids 118-121, 129-132, 136-166, 176-179, 183-186 and 227-130 of SEQ ID NO: 197. The Ly-6 / u-Par domain protein homology is approximately amino acids 17-36 and 209-222 of SEQ ID NO: 197. Corresponding nucleotides can be routinely determined given the sequence provided herein.

Example 53: Isolation of cDNA clones encoding human PRO1056 The use of the signal sequence algorithm described in Example 3 above allows the identification of an EST cluster sequence, herein designated 6425, from the Incyte database. It was. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55736.
In light of the observed sequence homology between the DNA557536 consensus sequence and the EST sequence contained in Merck EST clone number R88049, Merck EST clone number R88049 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 126 and is herein designated as DNA57693-1424.
Clone DNA57669-1424 contains a single open reading frame, has an apparent translation start site at nucleotide positions 56-58, and ends with a stop codon at nucleotide positions 416-418 (FIG. 126). The predicted polypeptide precursor is 120 amino acids long (Figure 127). The full-length PRO1056 protein shown in FIG. 127 has an estimated molecular weight of about 13,345 and a pI of about 5.18. Analysis of the full-length PRO1056 sequence shown in FIG. 127 (SEQ ID NO: 199) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 18, a transmembrane domain from about amino acid 39 to about amino acid 58, A potential N-glycosylation site from about amino acid 86 to about amino acid 89; a protein kinase C phosphorylation site from about amino acid 36 to about amino acid 38 and from about amino acid 58 to about amino acid 60; a tyrosine kinase phosphorus from about amino acid 25 to about amino acid 32 An amino acid block having homology to an oxidation site and a channel-forming colicin protein from about amino acid 24 to about amino acid 56. Clone DNA57693-1424 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit number 203008.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 127 (SEQ ID NO: 199) revealed a PRO1056 amino acid sequence and Significant homology between ATNG_HUMAN, A55571, ATNG_SHEEP, S31524, GEN13025, RIC_MOUSE, A48678 and A10871_1 was revealed.

Example 54: Isolation of cDNA clone encoding human PRO826 Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST cluster sequence designated 47283 from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56000.
In light of the observed sequence homology between the DNA56000 consensus sequence and the EST sequence contained in Merck EST clone number W69233, Merck EST clone number W69233 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 128 and is herein designated as DNA57694-1341.
Clone DNA57694-1341 contains a single open reading frame, has an apparent translation start site at nucleotide positions 13-15, and ends with a stop codon at nucleotide positions 310-312 (FIG. 128). The predicted polypeptide precursor is 99 amino acids long (Figure 129). The full-length PRO826 protein shown in FIG. 129 has an estimated molecular weight of about 11,050 and a pI of about 7.47. Analysis of the full-length PRO826 sequence shown in FIG. 129 (SEQ ID NO: 201) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 22, about amino acid 22 to about amino acid 27, and about amino acid 90 to An amino acid block having homology to a potential N-myristoylation site of about amino acid 95, a peroxidase of about amino acid 16 to about amino acid 48. Clone DNA57694-1341 was deposited with ATCC on June 22, 1998 and is assigned ATCC deposit number 203017.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology between CELF39F10_4 and HELT_HELHO was revealed.

Example 55: Isolation of cDNA clone encoding human PRO819 Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST cluster sequence named 49605 from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56015.
In light of the observed sequence homology between the DNA56015 consensus sequence and the EST sequence contained in Merck EST clone number H65785, Merck EST clone number H65785 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 130 and is herein designated as DNA5765-1340.
Clone DNA57695-1340 contains a single open reading frame, has an apparent translation start site at nucleotide positions 46-48, and ends with a stop codon at nucleotide positions 202-204 (FIG. 130). The predicted polypeptide precursor is 52 amino acids long (Figure 131). The full-length PRO819 protein shown in FIG. 131 has an estimated molecular weight of about 5,216 and a pI of about 4.67. Analysis of the full-length PRO819 sequence shown in FIG. 131 (SEQ ID NO: 203) revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 24, a potential N − of about amino acid 2 to about amino acid 7. A region having homology to a myristoylation site and an immunoglobulin light chain of about amino acid 5 to about amino acid 33. Clone DNA15695-1340 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit number 203006.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 131 (SEQ ID NO: 203) revealed that the PRO819 amino acid sequence and the following Dayhoff sequences: HSU03899_1, Significant homology was revealed among VG28_HSVSA, AF31522_1, PAD1_YEAST and AF045484_1.

Example 56: Isolation of cDNA clones encoding human PRO1006 The signal sequence algorithm described in Example 3 above was used to identify the first candidate sequence from Incyte cluster SEQ ID NO: 45748. This sequence was then compared with various public databases and the Incyte EST sequence to identify a consensus sequence referred to herein as DNA56036.
In light of the observed sequence homology between the DNA56036 consensus sequence and the EST sequence contained in Merck EST clone number 487737, Merck EST clone number 489737 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The entire nucleotide sequence of DNA57699-1412 is shown in FIG. 132 (SEQ ID NO: 204). Clone DNA57699-1412 contains a single open reading frame, has an apparent translation start site at nucleotide positions 28-30, and ends with a stop codon at nucleotide positions 1204-1206 (FIG. 132). The predicted polypeptide precursor is 392 amino acids long (Figure 133). The full-length PRO1006 protein shown in FIG. 133 has an estimated molecular weight of about 46,189 and a pI of about 9.04. Clone DNA57699-1412 has been deposited with ATCC. With regard to the sequence, it is understood that the deposited clone contains the actual nucleotide sequence and that the sequence provided herein is based on known sequence techniques.
Upon further analysis of the amino acid sequence of SEQ ID NO: 205, the predicted signal peptide is approximately amino acids 1-23 of SEQ ID NO: 205, and the N-glycosylation site is approximately amino acids 40-43, 53-56, 204 of SEQ ID NO: 205. -207 and 373-376. The N-myristoylation site is approximately amino acids 273-278 of SEQ ID NO: 205. Corresponding nucleotides can be routinely determined given the sequence provided herein.

Example 57: Isolation of cDNA clone encoding human PRO1112 The use of the signal sequence algorithm described in Example 3 above allowed identification of specific ESt cluster sequences. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56018.
In light of the observed sequence homology between the DNA56018 consensus sequence and the EST sequence contained in Merck EST clone number AA223546, Merck EST clone number AA223546 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 134 and is herein designated as DNA57702-1476.
The complete nucleotide sequence of DNA57702-1476 is shown in FIG. 134 (SEQ ID NO: 206). Clone DNA57702-1476 contains a single open reading frame, has an apparent translation start site at nucleotide positions 20-22 of SEQ ID NO: 206, and ends with a stop codon at nucleotide positions 806-808 (FIG. 134). The predicted polypeptide precursor is 262 amino acids long (Figure 135). The full-length PRO1112 protein shown in FIG. 135 has an estimated molecular weight of about 29,379 and a pI of about 8.93. FIG. 135 also shows the approximate location of the signal peptide and transmembrane domain. Clone DNA57702-1476 has been deposited with ATCC on June 9, 1998. The deposited clone contains the actual nucleotide sequence, and it is understood that the sequence provided herein is based on known sequencing techniques.
Amino acid analysis of the full-length PRO1112 polypeptide suggested some degree of homology with other proteins. More specifically, according to the analysis of the Dayhoff database (version 35.45 SwissProt 35), the PRO1112 amino acid sequence and at least the following Dayhoff sequence: MTY20B11_13 (microbial tuberculosis peptide), F64471, AE000690_6, XLU16364_1, E43259 (H + -transport ATP synthase) And a certain degree of sequence identity between PIGSLADRXE_1 (MHC class II histocompatibility antigen).

Example 58: Isolation of cDNA clone encoding human PRO1074 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single Incyte EST cluster sequence (Incyte cluster SEQ ID NO: 42586). This cluster sequence is then compared to various expressed sequence tag (EST) databases, including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56251.
In light of the observed sequence homology between the DNA56251 consensus sequence and the EST sequence contained in Merck EST clone number AA081912, Merck EST clone number AA081912 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 136 and is the full-length DNA sequence for PRO1074. Clone DNA57704-1452 was deposited with ATCC on June 9, 1998 and is assigned ATCC deposit number 209953.
The full length nucleotide sequence of DNA57704-1452 is shown in Figure 136 (SEQ ID NO: 208). Clone DNA57704-1452 contains a single open reading frame, has an apparent translation start site at nucleotide positions 322-324, and ends with a stop codon at nucleotide positions 1315-1317 (FIG. 136). The predicted polypeptide precursor is 331 amino acids long (Figure 137). The full-length PRO1074 protein shown in FIG. 137 has an estimated molecular weight of about 39,512 and a pI of about 8.03. Analysis of the full-length PRO1074 sequence shown in FIG. 137 (SEQ ID NO: 209) revealed the presence of the following features: a transmembrane domain of about amino acids 20-39; about amino 72-75, 154-157, 198- A potential N-glycosylation site at 201, 212-215 and 326-329, a glycosaminoglycan binding site at about amino acids 239-242, and a Ly-6 / u-PAR domain at about amino acids 23-36.
Amino acid analysis of the full-length PRO1074 polypeptide suggested significant sequence similarity to beta 1,3-galactosyltransferase, indicating that PRO1074 is a novel member of the galactosyltransferase family of proteins.
Some degree of homology with other proteins was suggested. Analysis of the full-length PRO1074 polypeptide using the Dayhoff database (version 35.45 SwissProt 35) revealed that the PRO1074 amino acid sequence and the following Dayhoff sequences: AF029792_1, P_R57433, DMU41449_1, AC000348_14, P_R47479, CET09F5_2, CEF14B6_4, CET15EC4_5, CET15EC4_5 The homology between them became clear.
Clone DNA57704-1452 was deposited with ATCC on June 9, 1998 and is assigned ATCC deposit number 209953.

Example 59: Isolation of cDNA clone encoding human PRO1005 The use of the signal sequence algorithm described in Example 3 above allows identification of the EST cluster sequence, Incyte cluster SEQ ID NO: 49243, from the LIFESEQ® database. It became. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56380.
In light of the observed sequence homology between the DNA56380 consensus sequence and the EST sequence contained in Merck EST clone number AA256657, Merck EST clone number AA256657 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 138 and is herein designated as DNA57708-1411.
The full-length clone shown in FIG. 138 contains a single open reading frame, has an apparent translation start site at nucleotide positions 30-32, and ends with a stop codon at nucleotide positions 585-587 (FIG. 138; SEQ ID NO: 210). The predicted polypeptide precursor is 185 amino acids long (Figure 139; SEQ ID NO: 211). The PRO1005 protein has a calculated molecular weight of about 20,331 and an estimated pI of about 5.85. Clone DNA57708-1411 was deposited with ATCC on June 23, 1998 and is assigned ATCC deposit number 203021.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Some degree of homology was revealed between CELD1007_14, A42239, DDU42597_1, CYAG_DICDI, S50452, MRKC_KLEPN, P-R41998, and XYNA_RUMFL.

Example 60: Isolation of cDNA clone encoding human PRO1073 The first DNA sequence, designated herein as DNA55938 and shown in Figure 142 (SEQ ID NO: 214), is human SK-, which predominantly represents the 5 'end of the primary cDNA clone. Identified using a yeast screen in a Lu-1 granuloma cell line cDNA library. DNA55938 is then obtained from ESTs from public databases (eg, GenBank) and proprietary ESTDNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.) And the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). ESTs were grouped under the program “phrap” (Phil Green, University of Washington, Seattle, Washington) to construct consensus DNA sequences. The consensus sequence obtained therefrom is designated herein as DNA56411.
In light of the observed sequence homology between the DNA56411 consensus sequence and the EST sequence contained in Merck EST clone number H86027, Merck EST clone H86027 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The full length DNA 57710-1451 clone shown in FIG. 140 contains a single open reading frame, has an apparent translation start site at nucleotide positions 345-347, and terminates with a stop codon found at nucleotide positions 1214-1244 (FIG. 140; SEQ ID NO: 212). The predicted polypeptide precursor is 299 amino acids long (Figure 141; SEQ ID NO: 213). PRO1073 has a calculated molecular weight of about 34,689 and an estimated pI of about 11.49. The PRO1173 sequence has the following additional features: a signal peptide of about amino acid 1031, sequence identity of the about amino acid to the bZIP transcription factor basic domain signature, a potential N-glycosylation site of about amino acids 2-5, and about amino acids. Sequence identity to 158-183 protamine P1 protein.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Some sequence identity was found between 10, S59043, ENXNUPR_1, B4328, SR55_DROME, S26650, SON_HUMAN, VIT2_CHICK, and XLC4SRPRT_1.
Clone DNA57710-1451 has been deposited with ATCC on June 1, 1998 and is assigned ATCC deposit no.

Example 61 Isolation of cDNA Clones Encoding Human PRO1152 A cDNA clone (DNA57711-1501) encoding a native human PRO1152 polypeptide was isolated from yeast in a human infant brain cDNA library that predominantly represents the 5 ′ end of the primary cDNA clone. Identified using screening. In particular, yeast screening was used to identify a cDNA designated herein as DNA55807 (SEQ ID NO: 217; see FIG. 145).
In view of the observed sequence homology between the DNA55807 sequence and the EST sequence contained in Merck EST clone number R56756, Merck EST clone R56756 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The full-length DNA 57711-1501 clone shown in FIG. 143 contains a single open reading frame, has an apparent translation start site at nucleotide positions 58-60, and ends with a stop codon at nucleotide positions 1495-1497 (FIG. 143). . The predicted polypeptide precursor is 479 amino acids long (Figure 144). The PRO1152 protein shown in FIG. 144 has an estimated molecular weight of about 53,602 and a pI of about 8.82. Analysis of the full-length PRO1152 sequence shown in FIG. 144 (SEQ ID NO: 216) revealed the presence of: a signal sequence from about amino acid 1 to about amino acid 28, about amino acid 133 to about amino acid 155, about amino acid 168 to A transmembrane domain of about amino acid 187, about amino acid 229 to about amino acid 247, about amino acid 264 to about amino acid 285, about amino acid 309 to about amino acid 330, about amino acid 371 to about amino acid 390 and about amino acid 441 to about amino acid 464, about amino acid An amino acid sequence block having homology with a potential N-glycosylation site of 34 to about amino acid 37 and about amino acid 387 to about amino acid 390, and a respiratory chain NADH dehydrogenase subunit of about amino acid 243 to about amino acid 287. Clone DNA57711-1501 has been deposited with ATCC on June 1, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology between SFCYTB_1, GEN12507, P_R11769, MTV025_109, C61168, S43171, P_P61689 and P_P61696 was revealed.

Example 62 Isolation of cDNA Clones Encoding Human PRO1136 Use of the signal sequence algorithm described in Example 3 above allows identification of an EST cluster sequence, herein designated 109142, from the Incyte database. It was. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56039.
In view of the observed sequence homology between the DNA56039 consensus sequence and the EST sequence contained in Merck EST clone number HSC1NF011, the Merck EST clone HSC1NF011 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 146 and is herein designated as DNA57827-1493.
Clone DNA57827-1493 contains a single open reading frame, has an apparent translation start site at nucleotide positions 216-218, and ends with a stop codon at nucleotide positions 211-2214 (FIG. 146). The predicted polypeptide precursor is 632 amino acids long (Figure 147). The full-length PRO1136 protein shown in FIG. 147 has an estimated molecular weight of about 69,643 and a pI of about 8.5. Analysis of the full-length PRO1136 sequence shown in FIG. 147 (SEQ ID NO: 219) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 15, about amino acid 108 to about amino acid 11, about amino acid 157 to Potential N-glycosylation sites from about amino acid 160, 289 to about amino acid 292, and from about amino acid 384 to about amino acid 387. Clone DNA57827-1493 has been deposited with ATCC on June 1, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology between HSMUPP1_1, AF060539_1, SP97_RAT, I38757 &lt; MMU93309_1, CEK01A6_4 and HSA224747_1 was revealed.

Example 63: Isolation of cDNA clone encoding human PRO813 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single IncyteEST cluster sequence (IncyteEST cluster SEQ ID NO: 45501). This EST cluster SEQ ID NO: 45501 is then used to generate various expressed sequence tag (EST) databases, including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Compared to the identified homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56400.
In light of the observed sequence homology between the DNA56400 consensus sequence and the EST sequence contained in Merck EST clone number T90592, Merck EST clone number T90592 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 148 and is herein designated as DNA57834-1339.
The full-length clone shown in FIG. 148 contains a single open reading frame, has an apparent translation start site at nucleotide positions 109-111, and ends with a stop codon at nucleotide positions 637-639 (FIG. 149; SEQ ID NO: 221). The predicted polypeptide precursor is 176 amino acids long, has a calculated molecular weight of about 19,616 and an estimated pI of about 7.11. Analysis of the full-length PRO813 sequence shown in FIG. 149 (SEQ ID NO: 221) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 26, about amino acid 48 to about amino acid 53, about amino acid 153 to Potential N-glycosylation sites from about amino acid 158, 156 to about amino acid 161 and from about amino acid 167 to about amino acid 172. Clone DNA57834-1339 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit no.
Amino acid analysis of the full-length PRO813 polypeptide suggested sequence identity with multiple surface-associated protein Cs. More specifically, according to the analysis of the Dayhoff database (version 35.45 SwissProt 35), a certain degree between the PRO813 amino acid sequence and the following Dayhoff sequences: PSPC_MUSVI, P_P92071, G02964, P_R65489 &lt; P_P82977, P_R84555, S55542, MUSIGHAJ_1 and PH1158 The homology of was revealed.

Example 64: Isolation of cDNA clones encoding human PRO809 Use of the signal sequence algorithm described in Example 3 above allowed the identification of a single Incyte EST cluster sequence. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56418.
In light of the observed sequence homology between the DNA56418 consensus sequence and the EST sequence contained in Merck EST clone number H74302, Merck EST clone number H74302 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 150 and is herein designated as DNA57836-13338.
The full-length nucleotide sequence of DNA57836-1338 is shown in FIG. 150 (SEQ ID NO: 222). Clone DNA578836-1338 contains a single open reading frame, has an apparent translation start site at nucleotide positions 63-65 of SEQ ID NO: 222, and ends with a stop codon at nucleotide positions 858-860 (FIG. 150). The predicted polypeptide precursor is 265 amino acids long (Figure 151). The full-length PRO809 protein shown in FIG. 151 has an estimated molecular weight of about 29,061 and a pI of about 9.18. FIG. 151 also shows the approximate location of the signal peptide and the N-glycosylation site. Corresponding nucleotides can be readily determined with reference to FIG. Clone DNA57836-13338 was deposited with the ATCC on June 23, 1998. With regard to the sequence, it is understood that the deposited clone contains the actual nucleotide sequence and that the sequence provided herein is based on known sequence techniques.
Amino acid sequence analysis of the full-length PRO809 polypeptide suggested some degree of sequence homology with heparin surface proteoglycans and endothelial cell adhesion factor-1. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed sequence identity between the PRO809 amino acid sequence and the following Dayhoff sequences: PGBM_MOUSE, D82082_1 and PW14158.

Example 65: Isolation of cDNA clone encoding human PRO791 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single IncyteEST cluster sequence. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56429.
In light of the observed sequence homology between the DNA56429 consensus sequence and the EST sequence contained in Merck EST clone number 36367, Merck EST clone number 36367 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in Figure 152 and is herein designated as DNA57838-1337.
The full length nucleotide sequence of DNA57838-1337 is shown in FIG. 152 (SEQ ID NO: 224). Clone DNA57878-1337 contains a single open reading frame, has an apparent translation start site at nucleotide positions 9-11 of SEQ ID NO: 224, and ends with a stop codon at nucleotide positions 747-749 (FIG. 152). The predicted polypeptide precursor is 246 amino acids long (Figure 153). The full-length PRO791 protein shown in FIG. 153 has an estimated molecular weight of about 27,368 and a pI of about 7.45. FIG. 153 also shows the approximate location of signal peptides, transmembrane domains and N-glycosylation sites and regions conserved in extracellular proteins. Corresponding nucleotides are one embodiment provided herein with reference to FIG. Clone DNA57883-1337 was deposited with the ATCC on June 23, 1998. With regard to the sequence, it is understood that the deposited clone contains the actual nucleotide sequence and that the sequence provided herein is based on known sequence techniques.
Amino acid sequence analysis of the full-length PRO791 polypeptide suggested that it has sequence similarity to the MHC-I antigen, indicating that PRO is related to the MHC-I antigen. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed some degree of sequence identity between the PRO791 amino acid sequence and the following Dayhoff sequences: AF034346_1, MMQ1K5_1 and HFE_HUMAN.

Example 66: Isolation of cDNA clone encoding human PRO1004 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single Incyte EST cluster sequence, Incyte cluster SEQ ID NO: 73681. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56516.
In light of the observed sequence homology between the DNA56516 consensus sequence and the EST sequence contained in Merck EST clone number H43837, Merck EST clone H43837 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The full-length clone shown in FIG. 154 contains a single open reading frame, has an apparent translation start site at nucleotide positions 119-121, and ends with a stop codon at nucleotide positions 464-466 (FIG. 154; SEQ ID NO: 226). ). The predicted polypeptide precursor is 115 amino acids long (Figure 155; SEQ ID NO: 227). The full-length PRO1004 protein shown in FIG. 155 has an estimated molecular weight of about 13,649 and a pI of about 9.58. Analysis of the full-length PRO1004 sequence shown in FIG. 155 (SEQ ID NO: 227) revealed the presence of the following features: a microsomal C-terminal targeting signal of about amino acids 113-115, a potential of about amino acids 71-74 A domain with sequence identity to the N-glycosylation site and the dihydrofolate reductase protein of about amino acids 22-48.
Analysis of the amino acid sequence of the full-length PRO1004 polypeptide using the Dayhoff database (version 35.45 SwissProt 35) shows homology between the PRO1004 amino acid sequence and the following Dayhoff sequences: CELR02D3_7, LECI_MOUSE, AF06691, SSZ97390_1, SSZ97395_1, and SSZ97400_1 Became clear.
Clone DNA57844-1410 was deposited with ATCC on June 23, 1998 and is assigned ATCC deposit number 203010.

Example 67 Isolation of cDNA Clones Encoding Human PRO1111 The expression sequence tag (EST) DNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.) Was searched for homology to insulin-like growth factor binding proteins. ESTs were identified.
RNA for construction of the cDNA library was isolated from human fetal brain. The cDNA library used to isolate the cDNA clone encoding PRO1111 was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
A human fetal brain cDNA library (prepared as described above) was synthesized from a synthetic oligonucleotide probe based on the IncyteEST sequence described above:
5'-CCACCACCTGGAGGTCCTGCAGTTGGGCAGGAACTCCATCCGGCAGATTG-3 '(SEQ ID NO: 251)
Were screened by hybridization.
The identified cDNA clone was sequenced in its entirety. The complete nucleotide sequence of PRO1111 is shown in FIG. 156 (SEQ ID NO: 228). Clone DNA58721-1475 contains a single open reading frame and has an apparent translation start site at nucleotide positions 57-59 and a stop codon at nucleotide positions 2006-2018 (FIG. 156; SEQ ID NO: 228). The predicted polypeptide precursor is 653 amino acids long (Figure 157). The transmembrane domains are positions 21-40 (type II) and 528-548. Clone DNA58721-1475 has been deposited with ATCC and is assigned ATCC deposit no. The full-length PRO1111 protein shown in FIG. 157 has an estimated molecular weight of about 72,717 daltons and a pI of about 6.99.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Some sequence identity was revealed among RNPLGPV_V, PGS2_HUMAN, AF038127_1, ALS_MOUSE, GPV_HUMAN, PGS2_BOVIN, ALS_PAPPA and I147020.

Example 68: Isolation of cDNA clones encoding human PRO1344 Consensus DNA sequences were generated against other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA33790. Based on the DNA33790 sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the full-length coding sequence of PRO1344. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-AGGTTCGTGATGGAGACAACCGCG-3 '(SEQ ID NO: 232)
Reverse PCR primer 5'-TGTCAAGGACGCACTGCCGTCATG-3 '(SEQ ID NO: 233)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA 33790 sequence having the following nucleic acid sequence:
Hybridization probe
5'-TGGCCAGATCATCAAGCGTGTCTGTGGCAACGAGCGGCCAGCTCCTATCC-3 '(SEQ ID NO: 234)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1344 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1344 (herein named DNA58723-1588) [FIG. 158, SEQ ID NO: 230] and the derived protein sequence of PRO1344.
The entire nucleic acid sequence of DNA58723-1588 is shown in FIG. 158 (SEQ ID NO: 230). Clone DNA58723-1588 contains a single open reading frame and ends with an apparent translation start site at nucleotide positions 26-28 and a stop codon at nucleotide positions 2186-2188 (FIG. 158). The predicted polypeptide precursor is 720 amino acids long (Figure 159). The full-length PRO1344 protein shown in FIG. 159 has an estimated molecular weight of about 80,199 daltons and a pI of about 7.77.
Analysis of the full-length PRO1344 sequence shown in FIG. 159 (SEQ ID NO: 231) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 23, an EGF-like domain cysteine from about amino acid 260 to about amino acid 271 Protein signature sequence, potential N-glycosylation of about amino acid 96 to about amino acid 99, about amino acid 279 to about amino acid 282, about amino acid 316 to about amino acid 319, about amino acid 451 to about amino acid 454 and about amino acid 614 to about amino acid 617 Site, a serine protease from about amino acid 489 to about amino acid 505, an amino acid sequence block homologous to the trypsin family, and a CUB domain protein profile sequence from about amino acid 150 to about amino acid 166. Clone DNA58723-1588 was deposited with ATCC on August 18, 1998 and is assigned ATCC deposit number 203133.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology between P_R74775, P_P90070, P_R09217, P_P70475, HSBMP16_1 and U50330_1 was revealed.

Example 69: Isolation of cDNA clones encoding human PRO1109 Consensus DNA sequences were generated against other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA52642. The consensus DNA sequence was obtained by extension using BLAST and phrap repetitive cycles of the consensus sequence obtained in advance using the EST sequence source as described above as much as possible. Based on the DNA52642 sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the full-length coding sequence of PRO1109. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-CCTTACCTCAGAGGCCAGAGCAAGC-3 '(SEQ ID NO: 237)
Reverse PCR primer 5'-GAGCTTCATCCGTTCTGCGTTCACC-3 '(SEQ ID NO: 238)
Furthermore, a synthetic oligonucleotide hybridization probe was made from a DNA52642 sequence having the following nucleic acid sequence.
Hybridization probe
5'-CAGGAATGTAAAGCTTTACAGAGGGTCGCCATCCTCGTTCCCCACC-3 '(SEQ ID NO: 239)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1109 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human SK-Lu-1 granuloma cell tissue (LIB247).
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1109 (herein named DNA58737-1473) [FIG. 160, SEQ ID NO: 235] and the derived protein sequence of PRO1109.
The entire nucleic acid sequence of DNA58737-1473 is shown in FIG. 160 (SEQ ID NO: 235). Clone DNA58737-1473 contains a single open reading frame, has an apparent translation start site at nucleotide positions 119-120, and ends with a stop codon at nucleotide positions 1151-1153 (FIG. 160). The predicted polypeptide precursor is 344 amino acids long (Figure 161). The full-length PRO1109 protein shown in FIG. 161 has an estimated molecular weight of about 40,041 daltons and a pI of about 9.34. Analysis of the full-length PRO1109 sequence shown in FIG. 161 (SEQ ID NO: 236) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 27, about amino acid 4 to about amino acid 7, about amino acid 220 to A potential N-glycosylation site of about amino acid 223 and about amino acid 335 to about amino acid 338, and an amino acid sequence block homologous to a xylose isomerase protein of about amino acid 191 to about amino acid 201. Clone DNA58737-1473 was deposited with ATCC on August 18, 1998 and is assigned ATCC deposit number 203136.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology was found among NALS_BOVIN, HSU10473_1, CEW02B12_11, YNJ4_CAEEL, AE000738_11, CET24D1_1, S48121 and CEGLY9_1.

Example 70: Isolation of cDNA clones encoding human PRO1383 Consensus DNA sequences were generated against other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA53961. Based on the DNA53996 sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the full-length coding sequence of PRO1383. .
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer 5'-CATTTCCTTACCCTGGACCCAGCTCC-3 '(SEQ ID NO: 242)
Reverse PCR primer 5'-GAAAGGCCCACAGCACATCTGGCAG-3 '(SEQ ID NO: 243)
In addition, a synthetic oligonucleotide hybridization probe was made from a DNA53961 sequence having the following nucleic acid sequence:
Hybridization probe
5'-CCACGACCCGAGCAACTTCCTCAAGACCGACTTGTTTCTCTACAGC-3 '(SEQ ID NO: 244)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1383 gene using one of the probe oligonucleotide and PCR primer pair. RNA for constructing the cDNA library was isolated from human fetal brain tissue.
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO1383 (herein named DNA58743-1609) [FIG. 162, SEQ ID NO: 240] and the derived protein sequence of PRO1383.
The entire nucleic acid sequence of DNA58743-1609 is shown in FIG. 162 (SEQ ID NO: 240). Clone DNA58743-1609 contains a single open reading frame, has an apparent translation start site at nucleotide positions 122-124, and ends with a stop codon at nucleotide positions 3911-1393 (FIG. 162). The predicted polypeptide precursor is 423 amino acids long (Figure 163). The full-length PRO1383 protein shown in FIG. 163 has an estimated molecular weight of about 46,989 daltons and a pI of about 6.77. Analysis of the full-length PRO1383 sequence shown in FIG. 163 (SEQ ID NO: 241) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 24, a transmembrane domain from about amino acid 339 to about amino acid 362, And about amino acid 34 to about amino acid 37, about amino acid 58 to about amino acid 61, about amino acid 142 to about amino acid 145, about amino acid 197 to about amino acid 200, about amino acid 300 to about amino acid 303, and about amino acid 364 to about amino acid 367 N. -Glycosylation site. Clone DNA58743-1609 has been deposited with ATCC on August 25, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology between P_W38335, P115_CHICK, P_W38164, A45993_1, MMU70209_1, D83704_1 and P_W39176 was revealed.

Example 71: Isolation of cDNA clones encoding human PRO1003 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single IncyteEST cluster sequence, herein designated 43055. This sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary ESTDNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). , Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated here as consen01.
In light of the observed sequence homology between the consensus sequence and the EST sequence contained in Incyte's EST clone no. 2849382, the Incyte EST clone 2849382 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The complete nucleotide sequence of DNA58846-1409 is shown in FIG. 164 (SEQ ID NO: 245). Clone DNA58846-1409 contains a single open reading frame, has an apparent translation start site at nucleotide positions 41-43, and ends with a stop codon at nucleotide positions 293-295 (FIG. 164). The predicted polypeptide precursor is 84 amino acids long (Figure 165). The full-length PRO1003 shown in FIG. 165 has an estimated molecular weight of about 9,408 and a pI of about 9.28. Analysis of the full-length PRO1003 sequence shown in FIG. 165 (SEQ ID NO: 246) shows the presence of a signal peptide from about amino acid 1 to about amino acid 24, a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 58 to about 61. Revealed. Analysis of the amino acid sequence of the full-length PRO1003 polypeptide using the Dayhoff database (version 35.45 SwissProt 35) showed that the PRO1003 amino acid sequence and the following Dayhoff sequences: AOPCZA363_3, SRTX_ATREN, A48298, MHVJHMS_1, VGL2_CVMJH, DHDHTC2_2, CORT_RAT, TALDH The homology with DVUFI_2 was revealed.

Example 72: Isolation of cDNA clones encoding human PRO1108 Consensus DNA sequences were generated against other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA53237.
In light of the observed sequence homology between the DNA53237 consensus sequence and the EST sequence contained in Incyte EST clone no. 2379881, the Incyte EST clone 2379881 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 166 and is herein designated as DNA58848-1472.
The entire nucleotide sequence of DNA58848-1472 is shown in FIG. 166 (SEQ ID NO: 247). Clone DNA58848-1472 contains a single open reading frame, has an apparent translation start site at nucleotide positions 77-79, and ends with a stop codon at nucleotide positions 1445-1447 (FIG. 166). The predicted polypeptide precursor is 456 amino acids long (Figure 167). The full-length PRO1108 protein shown in FIG. 167 has an estimated molecular weight of about 52,071 and a pI of about 9.46. Analysis of the full-length PRO1108 sequence shown in FIG. 167 (SEQ ID NO: 248) revealed the presence of: about amino acid 22 to about amino acid 42, about amino acid 156 to about amino acid 176, about amino acid 180 to about amino acid 199. And a potential N of about amino acid 369 to about amino acid 388 type II transmembrane domain, about amino acid 247 to about amino acid 250, about amino acid 327 to about amino acid 330, about amino acid 328 to about amino acid 331 and about amino acid 362 to about amino acid 365 -Glycosylation sites and amino acid blocks with homology to the ER lumen protein-bearing receptor protein from about amino acid 153 to about amino acid 190. Clone DNA58848-1472 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO1108 polypeptide suggested that it has significant sequence similarity with the LPAAT protein, thereby indicating that PRO1108 is a novel LPAAT homolog. More specifically, by analysis of the Dayhoff database (version 35.45 SwissProt 35), the PRO1108 amino acid sequence and the following Dayhoff sequences: AF01511_1, CER07E3_2, YL35_CAEEL, S73863, CEF59F4_4, P? W06422, MMU41736_1, MTV008_39, P_R99PT and Y67 The homology of was revealed.

Example 72: Isolation of cDNA clone encoding human PRO1137
The extracellular domain (ECD) sequences from about 950 known secreted proteins from the Swiss-Prot public protein database (including the secretory signal, if necessary) were used to search the expressed sequence tag (EST) database. EST databases include public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). The search was performed as a comparison of the ECD protein sequence to a 6-frame translation of the EST sequence using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Using this technique, Incyte EST number 3549449, also referred to herein as “DNA7108”, was identified as an ESt that does not encode a known protein and has a BLAST score of 70 or higher.
Consensus DNA sequences were constructed against the DNA 7108 sequence and other ESTs using BLAST and repeated cycles of the program “phrap” (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom is designated herein as DNA53952.
In light of the observed sequence homology between the DNA53995 consensus sequence and the EST sequence contained in Incyte EST clone no. 3663102, the Incyte EST clone 3663102 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The complete nucleotide sequence of DNA58849-1494 is shown in FIG. 168 (SEQ ID NO: 249). Clone DNA58888-1494 contains a single open reading frame, has an apparent translation start site at nucleotide positions 77-79, and ends with a stop codon at nucleotide positions 797-799 (FIG. 168). The predicted polypeptide precursor is 240 amino acids long (Figure 169). The full-length PRO1137 protein shown in FIG. 169 has an estimated molecular weight of about 26,064 and a pI of about 8.65. Analysis of the full-length PRO1137 sequence shown in FIG. 169 (SEQ ID NO: 250) revealed the presence of a signal peptide of about amino acids 1-14 and a potential N-glycosylation site of about amino acids 101-105.
Analysis of the amino acid sequence of the full-length PRO1137 polypeptide suggested that it has significant sequence similarity with ribosyltransferase, thereby indicating that PRO1137 is a novel member of the ribosyltransferase family of proteins. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) reveals homology between the PRO1137 amino acid sequence and the following Dayhoff sequences: MMART5_1, NARG_MOUSE, GEN1909, GEN13794, GEN14406, MMRNART62_1, and P_R41876 It was.

Example 74: Isolation of a cDNA clone encoding human PRO1138 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single IncyteEST sequence, herein designated 165212. This cluster sequence is then compared to various expressed sequence tag (EST) databases, including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA54224. This assembly included a uniquely developed Genentech EST, designated herein as DNA49140 (FIG. 172; SEQ ID NO: 254).
In light of the observed sequence homology between the DNA54224 consensus sequence and the EST sequence contained in Incyte EST clone no. 3836613, the IncyteEST clone 3836613 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 170 and is the full-length DNA sequence of PRO1138. Clone DNA58850-1495 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit no.
The complete nucleotide sequence of DNA58850-1495 is shown in FIG. 170 (SEQ ID NO: 252). Clone DNA58850-1495 contains a single open reading frame, has an apparent translation start site at nucleotide positions 38-40, and ends with a stop codon at nucleotide positions 1043-1045 (FIG. 170). The predicted polypeptide precursor is 335 amino acids long (Figure 171). The full length PRO1138 shown in FIG. 171 has an estimated molecular weight of about 37,421 daltons and a pI of about 6.36. Analysis of the full-length PRO1138 sequence shown in FIG. 171 (SEQ ID NO: 253) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 22, a transmembrane domain from about amino acid 224 to about 250; Leucine zipper pattern from 229 to about amino acid 250; potential glycosylation sites from about amino acids 98-101, 142-145, 148-151, 172-175, 176-179, 204-207, and 291-295.
Analysis of the amino acid sequence of full-length PRO1138 suggests significant sequence similarity to CD84, indicating that PRO1138 is a novel member of the Ig superfamily polypeptide. Analysis of the amino acid sequence of full-length PRO1138 polypeptide using the Dayhoff database (version 35.45 SwissProt 35) revealed that the PRO1138 amino acid sequence and the following Dayhoff sequences: HSU82988_1, HUMLY9_1, P_R97631, P_R97628, P_R97629, P_R97630, CD48_RAT, CD2_U939 Homology with HUMBGP_1 was revealed.
Clone DNA58850-1495 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit no.

Example 75: Isolation of cDNA clone encoding human PRO1054 Use of the signal sequence algorithm described in Example 3 above allowed identification of the EST cluster sequence, designated 66212, from the Incyte database. . This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55722.
In light of the observed sequence homology between the DNA55722 consensus sequence and the EST sequence contained in Incyte EST clone no. 319751, the Incyte EST clone 319751 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 173 and is herein designated as DNA58853-1423.
Clone DNA58853-1423 contains a single open reading frame, has an apparent translation start site at nucleotide positions 46-48, and ends with a stop codon at nucleotide positions 586-588 (FIG. 173). The predicted polypeptide precursor is 180 amino acids long (Figure 174). The full-length PRO1054 protein shown in FIG. 174 has an estimated molecular weight of about 20,638 daltons and a pI of about 5.0. Analysis of the full-length PRO1054 sequence shown in FIG. 174 (SEQ ID NO: 256) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 18, a leucine zipper pattern from about amino acid 155 to about amino acid 176; An amino acid block having homology with lipocalin protein of amino acid 27 to about amino acid 38 and about amino acid 110 to about amino acid 120. Clone DNA58853-1423 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 174 (SEQ ID NO: 256) revealed that the PRO1136 amino acid sequence and the following Dayhoff sequences: Significant homology was revealed among MUP2_MOUSE, MUP2_MOUSE, MUP8_MOUSE, MUP5_MOUSE, MUP4_MOUSE, S10124, MUPM_MOUSE, MUP_RAT and ECU70823_1.

Example 76: Isolation of cDNA clone encoding human PRO994 Use of the signal sequence algorithm described in Example 3 above allowed identification of the EST cluster sequence, designated here as 157555, from the Incyte database. . This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55728.
In light of the observed sequence homology between the DNA55728 consensus sequence and the EST sequence contained in Incyte EST clone no. 2860366, the Incyte EST clone 2860366 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 175 and is herein designated as DNA58855-1422.
Clone DNA58855-1422 contains a single open reading frame, has an apparent translation start site at nucleotide positions 31-33, and ends with a stop codon at nucleotide positions 718-720 (FIG. 175). The predicted polypeptide precursor is 229 amino acids long (Figure 176). The full-length PRO994 protein shown in FIG. 176 has an estimated molecular weight of about 25,109 daltons and a pI of about 6.83. Analysis of the full-length PRO994 sequence shown in FIG. 176 (SEQ ID NO: 258) revealed the presence of: about amino acid 10 to about amino acid 31, about amino acid 50 to about amino acid 72, about amino acid 87 to about amino acid 110, and 213 potential N-glycosyl from about amino acid 191 to about amino acid 213, about amino acid 80 to about amino acid 83, about amino acid 132 to about amino acid 135, about amino acid 148 to about amino acid 151 and about amino acid 163 to about amino acid 166 An amino acid block having homology with the TNFR / NGFR sebum-sign rich region protein of about 4 to about 11 amino acids. Clone DNA58855-1422 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.
Analysis of the Dayoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology between ILT4_HUMAN, JC6205, MMU57570_1, S40363, ETU56093_1, S42858, P_R66849 and P_R74751 was revealed.

Example 77: Isolation of cDNA clone encoding human PRO812 Use of the signal sequence algorithm described in Example 3 above allowed identification of the EST cluster sequence, designated 170079, from the Incyte database. . This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA55721.
In light of the observed sequence homology between the DNA55721 consensus sequence and the EST sequence contained in Incyte EST clone number 388964, the Incyte EST clone 388964 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 177 and is herein designated as DNA59205-1421.
Clone DNA59205-1421 contains a single open reading frame, has an apparent translation start site at nucleotide positions 55-57, and ends with a stop codon at nucleotide positions 304-306 (FIG. 177). The predicted polypeptide precursor is 83 amino acids long (Figure 178). The full-length PRO812 protein shown in FIG. 178 has an estimated molecular weight of about 9,201 daltons and a pI of about 9.3. Analysis of the full-length PRO812 sequence shown in FIG. 178 (SEQ ID NO: 260) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 15, cAMP- and cGMP- from about amino acid 73 to about amino acid 76 A dependent protein kinase phosphorylation site and a protein kinase C phosphorylation site from about amino acid 70 to about amino acid 72 and from about amino acid 76 to about amino acid 78; Clone DNA59205-1421 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no.
Analysis of the Dayoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology was revealed among PSC1_RAT, S68231, GEN13917, PSC2_RAT, CC10_HUMAN, UTER_RABIT, AF008595_1 and A56413.

Example 78: Isolation of cDNA clone encoding human PRO1069 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single IncyteEST sequence, designated herein as 100727. This sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary ESTDNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). , Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56001.
In light of the observed sequence homology between the DNA56001 consensus sequence and the EST sequence contained in Incyte EST clone no. 3533881, the Incyte EST clone 3533881 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 179, which is the full-length DNA sequence of PRO1069.
Clone DNA59211-1450 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit number 209960.
FIG. 179 (SEQ ID NO: 261) shows the entire nucleotide sequence of DNA59211-1450. Clone DNA59211-1450 contains a single open reading frame, has an apparent translation start site at nucleotide positions 197-199, and ends with a stop codon at nucleotide positions 464-466. The predicted polypeptide precursor is 89 amino acids long (Figure 180). The full-length PRO1069 protein shown in FIG. 180 has an estimated molecular weight of about 9,433 daltons and a pI of about 8.21. Analysis of the full-length PRO1069 sequence shown in FIG. 180 (SEQ ID NO: 262) revealed the presence of: a signal peptide from about amino acids 1 to about 16; a transmembrane domain from about amino acids 36 to about 59; -Potential N-myristoylation sites at 46, 45-50 and 84-89; and homology with the extracellular protein SCP / Tpx-1 / Ag5 / PR-1 / Sc7 from about amino acids 54 to about 66.
Analysis of the amino acid sequence of full-length PRO1069 suggests significant sequence similarity to CHIF, indicating that PRO1069 is a novel member of the CHIF family of polypeptides. Analysis of the amino acid sequence of the full-length PRO1069 polypeptide using the Dayhoff database (version 35.45 SwissProt 35) revealed that the PRO1069 amino acid sequence and the following Dayhoff sequences: CHIF_RAT, A55571, PLM_HUMAN, A40533, ATNG_BOVIN, RIC_MOUSE, PETD_SYNY3, VTB1_XENLA, ATB05_XENLA, Homology with S75086 was revealed.
Clone DNA59211-1450 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit number 209960.

Example 79: Isolation of cDNA clone encoding human PRO1129 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single IncyteEST cluster sequence, designated herein as 98833. This Incyte EST cluster SEQ ID NO: 98833 sequence is then converted into various expression sequence tags (ESTs) including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Compared to the database, the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56038.
In light of the observed sequence homology between the DNA56038 consensus sequence and the EST sequence contained in Incyte EST clone number 1335241, the Incyte EST clone 1335241 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 181 and is herein designated as DNA59213-1487.
The full-length clone shown in FIG. 181 contains a single open reading frame, has an apparent translation start site at nucleotide positions 42-44, and ends with a stop codon at nucleotide positions 1614-1616 (FIG. 181; SEQ ID NO: 263). ). The predicted polypeptide precursor is 524 amino acids long, has a calculated molecular weight of about 60,310 daltons and an estimated pI of about 7.46. Analysis of the full-length PRO1129 sequence shown in FIG. 182 (SEQ ID NO: 264) revealed the presence of: a Type II transmembrane domain of about amino acid 13 to about amino acid 32 and about amino acid 77 to about amino acid 102, about amino acid A cytochrome P-450 cysteine heme-iron ligand lipid nature sequence from 461 to about amino acid 470, and a potential N-glycosylation site from about amino acid 112 to about amino acid 115 and from about amino acid 168 to about amino acid 171. Clone DNA59213-1487 was deposited with ATCC on June 9, 1998 and is assigned ATCC deposit number 209959.
Analysis of the amino acid sequence of full-length PRO1129 suggested sequence similarity to cytochrome P-450 family proteins. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed some degree of homology between the PRO1129 amino acid sequence and the following Dayhoff sequences: AC004523_1, S45702, AF054821_1, and I53015.

Example 80 Isolation of cDNA Clones Encoding Human PRO1068 From the LIFESEQ database of EST cluster sequences, herein designated Incyte cluster number 14736, by use of the signal sequence algorithm described in Example 3 above. Can be identified. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56094.
In light of the observed sequence homology between the DNA56094 consensus sequence and the EST sequence contained in Incyte EST clone no. 004974, the Incyte EST clone 004974 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 183 and is herein designated as DNA59214-1449 (SEQ ID NO: 265).
The full-length clone shown in FIG. 183 contains a single open reading frame, has an apparent translation start site at nucleotide positions 42-44, and ends with a stop codon at nucleotide positions 414-416 (FIG. 183; SEQ ID NO: 265). The predicted polypeptide precursor is 124 amino acids long. PRO1068 has a calculated molecular weight of about 14,284 daltons and an estimated pI of about 8.14. As shown in FIG. 184, the PRO1068 polypeptide has the following additional features: a signal sequence of about amino acids 1-20, a urothecin II signature sequence of about amino acids 118-123, a cell adhesion sequence of about amino acids 64-66, about Potential cAMP- and cGMP-dependent protein kinase phosphorylation sites at amino acids 112-115.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. The homology between I50498 and P_R78445 was revealed.
Clone DNA59214-1449 has been deposited with ATCC on July 1, 1998 and is assigned ATCC deposit no.

Example 81: Isolation of cDNA clone encoding human PRO1066 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single Incyte EST cluster sequence, herein designated 79066. This Incyte EST cluster SEQ ID NO: 79066 sequence is then converted into various expression sequence tags (EST) including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Compared to the database, the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56121.
In light of the observed sequence homology between the DNA56121 consensus sequence and the EST sequence contained in Incyte EST clone no. 1515315, the Incyte EST clone 1515315 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 185 and is herein designated as DNA59215-1425.
The full-length clone shown in FIG. 185 contains a single open reading frame, has an apparent translation start site at nucleotide positions 176-178, and ends with a stop codon at nucleotide positions 527-529 (FIG. 185; SEQ ID NO: 267). ). The predicted polypeptide precursor is 117 amino acids long, has a calculated molecular weight of about 12,911 daltons and an estimated pI of about 5.46. Analysis of the full-length PRO1066 sequence shown in FIG. 186 (SEQ ID NO: 268) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 23, cAMP- and cGMP- from about amino acid 38 to about amino acid 41 Dependent protein kinase phosphorylation sites and potential N-myristoylation sites of about amino acids 5 to about amino acids 10, about amino acids 63 to about amino acids 68 and about amino acids 83 to about amino acids 88. Clone UNQ524 (DNA59215-1425) was deposited with the ATCC on June 9, 1998 and is assigned ATCC deposit number 209961.
Analysis of the amino acid sequence of full-length PRO1066 suggested that it did not have significant sequence identity with known proteins. However, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed some degree of homology between the PRO1066 amino acid sequence and the following Dayhoff sequences: MOTI_HUMAN, AF025667_1, MTCY19H9_8 and RABIGKCH_1.

Example 82 Isolation of cDNA Clones Encoding Human PRO1184 The use of the signal sequence algorithm described in Example 3 above for ESTs from the Incyte database allows the identification of a candidate sequence herein designated DNA56375. It was. This sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary ESTDNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). , Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56375.
In light of the observed sequence homology between the DNA56375 consensus sequence and the EST sequence contained in Incyte EST clone no. 1428374, the Incyte EST clone 1428374 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The full-length clone shown in FIG. 187 contains a single open reading frame, has an apparent translation start site at nucleotide positions 106-108, and ends with a stop codon found at nucleotide positions 532-534 (FIG. 187; SEQ ID NO: : 269). The predicted polypeptide precursor is 142 amino acids long, has a calculated molecular weight of approximately 15,690 daltons and an estimated pI of approximately 9.64. Analysis of the full-length PRO1184 sequence shown in FIG. 188 (SEQ ID NO: 270) revealed the presence of a signal peptide of about amino acids 1-38. Clone DNA59220-1514 was deposited with the ATCC on June 9, 1998. The deposited clone contains the actual nucleotide sequence, and it is understood that a representative was provided here.
Analysis of the amino acid sequence of the full-length PRO1184 polypeptide suggested that it had some sequence identity with a protein called TIM from Drosophila, referred to as “DVTIMS02_1” in the Dayhoff database (version 35.45 SwissProt 35). Other Dayhoff database (version 35.45 SwissProt 35) sequences with some degree of sequence identity with PRO1184 include WISI_SCHPO, F002186_1, ATAC00239124 and MSAIPRP_1.

Example 83 Isolation of cDNA Clones Encoding Human PRO1360 The use of the signal sequence algorithm described in Example 3 above allowed identification from the EST Incyte database named DNA10572. This EST sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA57314.
In light of the observed sequence homology between the DNA57314 consensus sequence and the EST sequence contained in Merck EST clone number AA406443, Merck EST clone AA406443 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 189 and is herein designated as DNA59488-1603.
The full-length clone shown in FIG. 189 contains a single open reading frame, has an apparent translation start site at nucleotide positions 54-56, and ends with a stop codon at nucleotide positions 909-911 (FIG. 189; SEQ ID NO: 271). The predicted polypeptide precursor is 285 amino acids long (Figure 190; SEQ ID NO: 272). PRO1360 has a calculated molecular weight of about 31,433 daltons and an estimated pI of about 7.32. Clone DNA59488-1603 was deposited with ATCC on August 25, 1998 and is assigned ATCC deposit number 203157.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 190 (SEQ ID NO: 272) revealed that the PRO1360 amino acid sequence and Sequence identity between AF000634_1, GFO_ZYMMO, YE1J_SCHPO, D86566_1, ZMGFO_1, S76976, PPSA_SYNY3, and CEF28B1_4 was revealed.

Example 84: Isolation of cDNA clone encoding human PRO1029 Use of the signal sequence algorithm described in Example 3 above allowed identification of the EST cluster sequence named 18763 from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA5784.
In light of the observed sequence homology between the DNA5784 consensus sequence and the EST sequence contained in Merck EST clone number T98880, Merck EST clone T98880 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 191, and is herein designated as DNA59493-1420.
Clone DNA59493-1420 contains a single open reading frame, has an apparent translation start site at nucleotide positions 39-41, and ends with a stop codon at nucleotide positions 297-299 (FIG. 191). The predicted polypeptide precursor is 86 amino acids long (Figure 192). The full-length PRO1029 protein has an estimated molecular weight of about 9,548 daltons and a pI of about 8.52. Analysis of the full-length PRO1029 sequence shown in FIG. 192 (SEQ ID NO: 274) revealed the presence of the following: signal sequence from about amino acid 1 to about amino acid 19, bacterial rhodopsin retina binding from about amino acid 50 to about amino acid 61 Amino acid block with homology to the site protein, a prenyl group binding site from about amino acid 83 to about amino acid 86, and a potential N-glycosylation site from about amino acid 45 to about amino acid 48. Clone DNA59493-1420 has been deposited with ATCC on July 1, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology between PSEIS2a-1, S17699 and P_R63635 was revealed.

Example 85: Isolation of cDNA clone encoding human PRO1139 Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST cluster sequence named 4461 from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA57312.
The DNA57312 consensus sequence contained a 172 nucleotide long public EST (T62095, Merck / University of Washington Public Database). This EST clone, now referred to as the putative protein coding sequence, was purchased from Merck and sequenced to provide the coding sequence for PRO1139 (FIG. 193). As already noted, the deduced amino acid sequence of DNA59497-1496 shows significant sequence identity with the deduced amino acid sequence of HSOBRGRP_1. The full-length protein (Figure 194) contains a putative signal peptide between amino acid residues 1 and 28, and three putative transmembrane domains (about amino acid residues 33-52, 71-89, 98-120).

Example 86 Isolation of cDNA Clones Encoding Human PRO1309 The expression sequence tag (EST) database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.) Was searched to identify ESTs that show homology to SLIT. .
RNA for constructing the cDNA library was isolated from human fetal brain tissue. The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD in the specified orientation). PRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) with unique Xol and NotI sites.
Synthetic oligonucleotide probes derived from the above IncyteEST sequence from a cDNA library (prepared as described above):
5'-TCCGTGCAGGGGGACGCCTTTCAGAAACTGCGCCGAGTTAAGGAAC-3 '(SEQ ID NO: 279)
Were screened by hybridization.
cDNA clones were isolated and sequenced. The complete nucleotide sequence of DNA59588-1571 is shown in FIG. 195 (SEQ ID NO: 277). Clone DNA5958-1571 contains a single open reading frame, has an apparent translation start site at nucleotide positions 720-722, and ends with a stop codon at nucleotide positions 2286-2288 (Figure 195; SEQ ID NO: 277). The predicted polypeptide precursor is 522 amino acids long. The signal peptide is approximately 1-34 of SEQ ID NO: 278 and the transmembrane domain is approximately 428-450. Clone DNA59588-1571 has been deposited with ATCC and is assigned ATCC deposit no. The full-length PRO1309 protein shown in FIG. 196 has an estimated molecular weight of about 58,614 daltons and a pI of about 7.42.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Sequence identity between MOUSE, ALS_RAT, P_R85889, LUM_CHICK, AB014462_1, PGS1_CANFA, CEM88_7, A58532 and GEN11209 was revealed.

Example 87: Isolation of cDNA clones encoding human PRO1028 Use of the signal sequence algorithm described in Example 3 above allowed identification of certain EST cluster sequences from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA59603.
In light of the observed sequence homology between the DNA59603 consensus sequence and the EST sequence contained in Incyte EST clone no. 1497725, Incyte EST clone no. 1497725 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 197 and is herein designated as DNA59603-1419.
The full-length nucleotide sequence of DNA59603-1419 is shown in FIG. 197 (SEQ ID NO: 280). Clone DNA59603-1419 contains a single open reading frame, has an apparent translation start site at nucleotide positions 21-23, and ends with a stop codon at nucleotide positions 612-614 (FIG. 197). The predicted polypeptide precursor is 197 amino acids long (Figure 198). The full-length PRO1028 protein shown in FIG. 198 has an estimated molecular weight of about 20,832 daltons and a pI of about 8.74. Clone DNA59603-1419 has been deposited with ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence and that the sequences provided herein are based on known sequencing techniques.
When the amino acid sequence of SEQ ID NO: 281 is analyzed, the predicted signal peptide is about amino acids 1-19 of SEQ ID NO: 281. The N-glycosylation site is about amino acids 35-38 of SEQ ID NO: 281. The C-type lectin domain is about amino acids 108-117 of SEQ ID NO: 281, indicating that PRO1028 is related to or is a lectin. Corresponding nucleotides can be routinely determined given the sequence provided herein.

Example 88: Isolation of cDNA clones encoding human PRO1027 Use of the signal sequence algorithm described in Example 3 above allowed identification of certain EST cluster sequences from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56399.
In light of the observed sequence homology between the DNA56399 consensus sequence and the EST sequence contained in Incyte EST clone no. 937605, Incyte EST clone no. 937605 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 199 and is herein designated as DNA59605-1418.
The full length nucleotide sequence of DNA59605-1418 is shown in FIG. 199 (SEQ ID NO: 280). Clone DNA59605-1418 contains a single open reading frame, has an apparent translation start site at nucleotide positions 31-33, and ends with a stop codon at nucleotide positions 262-264 (FIG. 199). The predicted polypeptide precursor is 77 amino acids long (Figure 200). The full-length PRO1027 protein shown in FIG. 200 has an estimated molecular weight of about 8,772 daltons and a pI of about 9.62. Clone DNA59605-1418 has been deposited with ATCC. With respect to the sequence, it is understood that the deposited clone contains the correct sequence and that the sequences provided herein are based on known sequencing techniques.
When the amino acid sequence of SEQ ID NO: 283 is analyzed, the predicted signal peptide is about amino acids 1-33 of SEQ ID NO: 283. The type II transmembrane domain is about amino acid 30 of SEQ ID NO: 283. Corresponding nucleotides can be routinely determined given the sequence provided herein. PRO1027 can be included in tissue formation or repair.
The following Dayhoff notation was found to have some sequence identity with PRO1027: SFT2_YEAST; ATM3E9_2; A69826; YM16_MARPO; E64896; U60193_2; MTLRAJ205_1; MCU60315_70;

Example 89: Isolation of cDNA clones encoding human PRO1107 Use of the signal sequence algorithm described in Example 3 above allowed identification of certain EST cluster sequences from the Incyte database. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56402.
In light of the observed sequence homology between the DNA56402 consensus sequence and the EST sequence contained in Incyte's EST clone no. 3203694, the Incyte EST clone 3203694 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 201 and is herein designated as DNA59606-1471.
The full-length nucleotide sequence of DNA59606-1471 is shown in FIG. 201 (SEQ ID NO: 284). Clone DNA59606-1471 contains a single open reading frame, has an apparent translation start site at nucleotide positions 244-246 of SEQ ID NO: 284, and ends with a stop codon at nucleotide positions 1675-1677 (FIG. 201). The predicted polypeptide precursor is 477 amino acids long (Figure 202). The PRO1107 protein shown in FIG. 202 has an estimated molecular weight of about 54,668 daltons and a pI of about 6.33. Clone DNA59606-1471 was deposited with ATCC on June 9, 1998. The deposited clone contains the actual sequence and it is understood that the sequences provided herein are based on known sequencing techniques.
Analysis of the amino acid sequence of the full-length PRO1107 polypeptide suggests significant sequence similarity to phosphodiesterase I / nucleotide pyrophosphatase, human insulin receptor tyrosine kinase in non-bitter, alkaline phosphodiesterase, and autotoxin, so that PRO1107 It indicates that it has at least one or all of the activities of the protein. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) reveals sequence identity between the PRO1107 amino acid sequence and at least one of the following Dayhoff sequences: AF005632_1, P_R79148, RNU78787_1, AF60218_4, A57080 and HUMATXT_1 became.

Example 90: Isolation of cDNA clones encoding human PRO1140 The use of the signal sequence algorithm described in Example 3 above allowed identification of a single IncyteEST cluster sequence, herein designated 135917. This sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary ESTDNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). , Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56416.
In light of the observed sequence homology between the DNA56416 consensus sequence and the EST sequence contained in Incyte EST clone no. 3345705, the Incyte EST clone 3345705 was obtained and its cDNA insert was sequenced. The sequence shown in FIG. 203 and designated herein as DNA59607-1497 is the full-length DNA sequence of PRO1140. Clone DNA59607-1497 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit number 209946.
The entire nucleotide sequence of DNA59607-1497 is shown in FIG. 203 (SEQ ID NO: 286). Clone DNA59607-1497 contains a single open reading frame, has an apparent translation start site at nucleotide positions 210-212, and ends with a stop codon at nucleotide positions 975-977 (FIG. 203). The predicted polypeptide precursor is 255 amino acids long (Figure 204). The full-length PRO 1140 shown in FIG. 204 has an estimated molecular weight of about 29,405 daltons and a pI of about 7.64. Analysis of the full-length PRO1140 sequence shown in FIG. 204 (SEQ ID NO: 287) revealed the presence of three transmembrane domains of about amino acids 101-118, 141-161, and 172-191.
Analysis of the full-length PRO1140 amino acid sequence using the Dayhoff database (version 35.45 SwissProt 35) reveals homology between the PRO1140 amino acid sequence and the following Dayhoff sequences: AF023602_1, AF000368_1, CIN3_RAT, AF003373_1, GEN13279, and AF003372_1 became.
Clone DNA59607-1497 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit number 209946.

Example 91: Isolation of cDNA clones encoding human PRO1106 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single Incyte EST sequence. This sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary ESTDNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). , Identified the existing homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56423.
In light of the observed sequence homology between the DNA56423 consensus sequence and the EST sequence contained in Incyte EST clone number 1711247, Incyte EST clone number 1711247 was obtained and its cDNA insert was sequenced. The sequence shown in FIG. 205 and designated herein as DNA59609-1470 is the full-length DNA sequence of PRO1106. Clone DNA59609-1470 has been deposited with ATCC on June 9, 1998 and is assigned ATCC deposit no.
The entire nucleotide sequence of DNA59609-1470 is shown in FIG. 205 (SEQ ID NO: 288). Clone DNA59609-1470 contains a single open reading frame, has an apparent translation start site at nucleotide positions 61-63 of SEQ ID NO: 288, and ends with a stop codon at nucleotide positions 1468-1470 (FIG. 205). The predicted polypeptide precursor is 469 amino acids long (Figure 206). The full length PRO 1106 shown in FIG. 206 has an estimated molecular weight of about 52,689 daltons and a pI of about 8.68. One skilled in the art will appreciate that a polypeptide or nucleic acid encoding it can be constructed to exclude one or more of all these domains. For example, the transmembrane domain and / or either the amino terminus or the carboxyl terminus can be excluded. Clone DNA59609-1470 was deposited with ATCC on June 9, 1998. The deposited clone contains the actual nucleic acid sequence, and it is understood that the sequence provided herein is based on known sequencing techniques.
Analysis of the amino acid sequence of the full-length PRO1106 polypeptide suggested significant sequence similarity with the peroxisomal Ca-dependent solute carrier, thereby indicating that PRO1106 is a novel transporter. More particularly, analysis of the Dayhoff database (version 35.45 SwissProt 35) revealed sequence identity between the PRO1106 amino acid sequence and at least one of the following Dayhoff sequences: AF004161_1, IG002N01_25, GDC_BOVIN and BT_MAIZE.

Example 92: Isolation of cDNA clone encoding human PRO1291 Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST cluster sequence, designated 120480, from the Incyte database. . This EST cluster sequence is then compared to various expressed sequence tag (EST) databases including public databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, Calif.). And the existing homology was identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Built. The consensus sequence obtained therefrom is designated herein as DNA56425.
In light of the observed sequence homology between the DNA56425 consensus sequence and the EST sequence contained in Incyte EST clone number 2798803, the Incyte EST clone 2798803 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 207 and is herein designated as DNA59610-1556.
Clone DNA59610-1556 contains a single open reading frame, has an apparent translation start site at nucleotide positions 61-63, and ends with a stop codon at nucleotide positions 907-909 (FIG. 207). The predicted polypeptide precursor is 282 amino acids long (Figure 208). The full-length PRO1291 protein shown in FIG. 208 has an estimated molecular weight of about 30,878 daltons and a pI of about 5.27. Analysis of the full-length PRO1291 sequence shown in FIG. 208 (SEQ ID NO: 291) revealed the presence of: a signal peptide from about amino acid 1 to about amino acid 28, a transmembrane domain from about amino acid 258 to about amino acid 281, about Amino acid 112 to about amino acid 115, about amino acid 160 to about amino acid 163, about amino acid 190 to about amino acid 193, about amino acid 196 to about amino acid 199, about amino acid 205 to about amino acid 208, about amino acid 216 to about amino acid 219 and about amino acid 220 ~ N-glycosylation site at about amino acid 223. Clone DNA59610-1556 has been deposited with ATCC on Jun. 16, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. Significant homology was revealed among AF33107_1, HSB73_1, HSU90142_1, GGCD80_1, P_W34452, MOG_MOUSE, B39371, and P_R71360.

Example 93 Isolation of cDNA Clones Encoding Human PRO1105 Use of the signal sequence algorithm described in Example 3 above allowed identification of EST cluster sequences from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(Lifeseq R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56430.
In light of the observed sequence homology between the DNA56430 sequence and the EST sequence contained within Incyte EST clone no. 1853047, Incyte EST clone no. 1853047 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 209 and is herein designated as DNA59612-1466.
The complete nucleotide sequence of DNA59612-1466 is shown in FIG. 209 (SEQ ID NO: 292). DNA59612-1466 contains a single open reading frame with an apparent translation start site at nucleotide positions 28-30 of SEQ ID NO: 292 (FIG. 209) and terminating at a stop codon at nucleotide positions 568-570 (FIG. 209). ). The predicted polypeptide precursor is 180 amino acids long (Figure 210). The full-length PRO1105 protein shown in FIG. 210 has an estimated molecular weight of about 20,040 daltons and a pI of about 8.35. Clone DNA59612-1466 was deposited with the ATCC on June 9, 1998. It will be appreciated that the deposited clone has the actual nucleic acid sequence and the sequence provided herein is based on known sequencing methods.
Analyzing FIG. 210, the signal sequence is at amino acids about 1-19 of SEQ ID NO: 293, and the transmembrane domain is shown at amino acids about 80-99 and 145-162 of SEQ ID NO: 293. It will be appreciated by those skilled in the art that polypeptides with all or any combination of these regions or individually selected will be produced. It is also understood that corresponding nucleic acids can be routinely identified and can be prepared based on the information provided herein.

Example 94: Isolation of cDNA clones encoding human PRO511 Use of the signal sequence algorithm described in Example 3 above allowed identification of EST cluster sequences from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(Lifeseq R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56434.
In light of the observed sequence homology between the DNA56434 sequence and the EST sequence contained within Incyte EST clone no. 1227491, Incyte EST clone no. 1227491 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 211 and is herein designated as DNA59613-1417.
The entire nucleotide sequence of DNA59613-1417 is shown in FIG. 211 (SEQ ID NO: 294). DNA59613-1417 contains a single open reading frame with an apparent translation start site at nucleotide positions 233-235 and ending with a stop codon at nucleotide positions 944-946 (FIG. 211). The predicted polypeptide precursor is 237 amino acids long (Figure 212). The full-length PRO511 protein shown in FIG. 212 has an estimated molecular weight of about 25,284 daltons and a pI of about 5.74. Clone DNA59613-1417 has been deposited with ATCC. With respect to sequences, it is understood that the deposited clone contains the correct sequence and that the sequences provided herein are based on known sequencing methods.
When the amino acid sequence of SEQ ID NO: 295 is analyzed, the signal sequence is presumably at amino acids about 1-25 of SEQ ID NO: 295. N-glycosylation sites are at amino acids about 45-48, 73-76, 107-110, 118-121, 132-135, 172-175, 175-178 and 185-188 of SEQ ID NO: 295. The arthropod defensin conserved region is at about amino acids 176-182 of SEQ ID NO: 295. The kringle domain begins at about amino acid 128 of SEQ ID NO: 295 and the ly-6 / u-PAR domain begins at about amino acid 6 of SEQ ID NO: 295. These amino acid sequences and the corresponding nucleotides of others can be routinely determined given the sequences provided herein.
Symbols appearing in the Dayhoff database where PRO511 has certain sequence identity are as follows: SSC20F10_1; SF041083; P_W26579; S44208; JC2394; PSTA_DICDI; A27020; S59310; RAG1_RABIT; and MUSBALBC1_1.

Example 95: Isolation of cDNA clones encoding human PRO1104 The use of the signal sequence algorithm described in Example 3 above allowed the identification of EST cluster sequences from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(Lifeseq R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56446.
In light of the observed sequence homology between the DNA56446 sequence and the EST sequence contained within Incyte EST clone no. 2837496, Incyte EST clone no. 2837496 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 213 and is herein designated as DNA59616-1465.
The entire nucleotide sequence of DNA59616-1465 is shown in FIG. 213 (SEQ ID NO: 296). DNA59616-1465 has an apparent translation start site at nucleotide positions 109-111 of SEQ ID NO: 296 (FIG. 213) and contains a single reading frame that terminates at a stop codon at nucleotide positions 1132-1134 (FIG. 213). ). The predicted polypeptide precursor is 341 amino acids long (Figure 214). The full-length PRO1104 protein shown in FIG. 214 has an estimated molecular weight of about 36,769 daltons and a pI of about 9.03. Clone DNA59616-1465 was deposited with ATCC on June 16, 1998. It will be appreciated that the deposited clone has the actual nucleic acid sequence and the sequence provided herein is based on known sequencing methods.
Upon analysis of FIG. 214, the signal sequence is at about amino acids 1-22 of SEQ ID NO: 297. N-myristoylation sites are at amino acids 41-46, 110-115, 133-138, 167-172 and 179-184 of SEQ ID NO: 297.

Example 96: Isolation of cDNA clones encoding human PRO1100 Use of the signal sequence algorithm described in Example 3 above allowed identification of EST cluster sequences from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(Lifeseq R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed.
In light of the observed sequence homology between the resulting consensus sequence and the EST sequence contained within Incyte EST clone number 2305379, Incyte EST clone 2305379 was purchased and the cDNA insert was obtained and sequenced. did. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 215 and is herein designated as DNA59619-1464.
The entire nucleotide sequence of DNA59619-1464 is shown in FIG. 215 (SEQ ID NO: 298). DNA59619-1464 contains a single open reading frame with an apparent translation start site at nucleotide positions 33-35 of SEQ ID NO: 298 (FIG. 215) and ending with a stop codon at nucleotide positions 993-995 (FIG. 216). ). The predicted polypeptide precursor is 320 amino acids long (Figure 216). The full-length PRO1100 protein shown in FIG. 216 has an estimated molecular weight of about 36,475 daltons and a pI of about 7.29. Clone DNA59619-1464 was deposited with the ATCC on July 1, 1998. It will be appreciated that the deposited clone has the actual nucleic acid sequence and the sequence provided herein is based on known sequencing methods.
When SEQ ID NO: 299 is analyzed, the approximate location of the signal peptide, transmembrane domain, N-glycosylation site, N-pyristoylation site, CUB domain and amiloride sensitive sodium channel domain is present. It is believed that PRO 1100 can function as a channel. The corresponding nucleic acids for these amino acids and others can be routinely determined given SEQ ID NO: 299.

Example 97: Isolation of cDNA clones encoding human PRO836 Use of the signal sequence algorithm described in Example 3 above allowed the identification of EST cluster sequences from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(Lifeseq R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56453.
In light of the observed sequence homology between the DNA56453 consensus sequence and the EST sequence contained within the Incyte EST clone 2610075, the Incyte EST clone 2610075 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 217 and is herein designated as DNA59620-1463.
The entire nucleotide sequence of DNA59620-1463 is shown in FIG. 217 (SEQ ID NO: 300). DNA59620-1463 contains a single open reading frame with an apparent translation start site at nucleotide positions 65-67 of SEQ ID NO: 300 (FIG. 217), ending with a stop codon at nucleotide positions 1448-1450 (FIG. 217). ). The predicted polypeptide precursor is 461 amino acids long (Figure 218). The full-length PRO836 protein shown in FIG. 218 has an estimated molecular weight of about 52,085 daltons and a pI of about 5.36. Analysis of the full-length PRO836 sequence shown in FIG. 218 (SEQ ID NO: 301) conserves the following: signal peptide, N-glycosylation site, N-myristoylation site, protein YJL126w / YLR351c / yhcX family The existence of a domain and a region having sequence identity with SLS1 is proved. Clone DNA59620-1463 was deposited with the ATCC on June 16, 1998. It will be appreciated that the deposited clone has the actual nucleic acid sequence and the sequence provided herein is based on known sequencing methods.
Analysis of the amino acid sequence of the full-length PRO839 polypeptide suggests that it has some sequence identity with SLS1, thus indicating that PRO836 is involved in ER protein translocation. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) demonstrated some homology between the PRO836 amino acid sequence and at least the following Dayhoff sequences, S58132, SPBC3B9_1, S66714, CRU40057_1 and IMA_CAEEL.

Example 98: Isolation of cDNA clones encoding human PRO1141 Use of the signal sequence algorithm described in Example 3 above allowed identification of EST cluster sequences from the Incyte database, designated 11873. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56518.
In light of the observed sequence homology between the DNA56518 consensus sequence and the EST sequence contained within the Incyte EST clone 2679995, the Incyte EST clone 2679995 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 219 and is herein designated as DNA59625-1498.
Clone DNA59625-1498 has an apparent translation start site at nucleotide positions 204-206 and contains a single reading frame ending with a stop codon at nucleotide positions 945-947 (FIG. 219). The predicted polypeptide precursor is 247 amino acids long (Figure 220). The full-length PRO1141 protein shown in FIG. 220 has an estimated molecular weight of about 26,840 daltons and a pI of about 8.19. Analysis of the full-length PRO1141 sequence shown in FIG. 220 (SEQ ID NO: 303) reveals that: a signal peptide from about amino acid 1 to about 19 amino acids and about 38 to about 57 amino acids, about 67 to about 83 amino acids, about amino acids The existence of a transmembrane domain from about 117 to about amino acid 139 and from about amino acid 153 to about 170 amino acid is demonstrated. Clone DNA59625-1498 has been deposited with ATCC on June 16, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , AB000506_1, LEU95008_1, MRU87980_15, YIGM_ECOLI, STU65700_1, GHU62778_1, CYST_SYNY3 and AF009567_1 were proved.

Example 99: Isolation of cDNA clones encoding human PRO1132 Consensus DNA sequences were constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated DNA35934. Based on the DNA35934 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) to use as a probe to isolate a clone of the full-length coding sequence for PRO1132, an oligonucleotide Was synthesized.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer: 5′-TCCTGTGACCACCCCTCTAACACC-3 ′ (SEQ ID NO: 310) and reverse PCR primer: 5′-CTGGAACATCTGCTGCCCAGATTC-3 ′ (SEQ ID NO: 311).
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
5'-GTCGGATGACAGCAGCAGCCGCATCATCAATGGATCCGACTGCGATATGC-3 '(SEQ ID NO: 312)
Created from a consensus sequence with
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1132 gene using one of the probe oligonucleotides and PCR primers. RNA for construction of the cDNA library was isolated from human fetal kidney.
DNA sequencing of the clones isolated as described above resulted in a full-length DNA sequence for PRO1132 and a derived protein sequence for PRO1132.
The complete nucleotide sequence of PRO1132 is shown in Figure 225 (SEQ ID NO: 308). Clone DNA59767-1489 has an apparent translation start site at nucleotide positions 354-356 and contains a single reading frame that terminates at the stop codon at nucleotide positions 1233-1235 (FIG. 225; SEQ ID NO: 308). The predicted polypeptide precursor is 293 amino acids long. The signal peptide is at about amino acids 1-22 of SEQ ID NO: 309 and the histidine active site is at about amino acids 104-109. Clone DNA59767-1489 (having the actual sequence rather than the representation based on the sequencing method provided herein) has been deposited with ATCC and is assigned ATCC deposit number 203108. The full-length PRO1132 protein shown in FIG. 226 has an estimated molecular weight of about 32,020 daltons and a pI of about 8.7.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , MMAE000663_6, AF013988_1, U66061_8, MMAE000665_2, MMAE00066415, MMAE00066414, MMAE000665_4 and MMAE00066412 were proved.

Example 100: Isolation of cDNA clone encoding human NL7 (PRO1346) A single EST sequence (# 1398422) was found in the LIFESEQ ^R database as described in Example 1 above. This EST sequence was renamed DNA45668. Based on the DNA45668 sequence, oligonucleotides can be used for 1) identifying a cDNA library containing the sequence of interest by PCR, and 2) for use as a probe to isolate a clone of the full-length coding sequence for NL7. Synthesized.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer: 5′-CACACGTCCAACCTCAATGGGCAG-3 ′ (SEQ ID NO: 315) and reverse PCR primer: 5′-GACCAGCAGGGCCAAGGACAAGG-3 ′ (SEQ ID NO: 316)
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe:
5'-GTTCTCTGAGATGAAGATCCGGCCGGTCCGGGAGTACCGCTTAG-3 '
(SEQ ID NO: 317)
From the consensus DNA45668 sequence.
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate clones encoding the NL7 gene using one of the probe oligonucleotides and PCR primers. RNA for construction of the cDNA library was isolated from a human fetal kidney library (LIB227).
DNA sequencing of the clones isolated as described above yielded the full-length DNA sequence for NL7 (here named DNA59776-1600 [Figure 227, SEQ ID NO: 313]) and the derived protein sequence for NL7 (PRO1346). It was.
The complete nucleotide sequence of NL7 (PRO1346) is shown in FIG. 227 (SEQ ID NO: 313). Clone DNA59776-1600 contains a single open reading frame with an apparent translation start site at nucleotide positions 1-3 and an apparent stop codon at nucleotide positions 1384-1386. The predicted polypeptide precursor is 461 amino acids long. The protein has an apparent type II transmembrane domain at about 31 to about 50 amino acid positions; starting from amino acid position 409, the fibrinogen β and γ chain C-terminal domain signatures, and amino acid positions about 140, 147, 154 and 161 Each starts with a leucine zipper pattern. Clone DNA59776-1600 has been deposited with ATCC and is assigned ATCC deposit no. The full length NL7 protein shown in FIG. 228 has an estimated molecular weight of about 50,744 daltons and a pI of about 6.38.
Based on the WU-BLAST2 sequence alignment analysis (using the WU-BLAST2 computer program) of the full-length sequence, NL7 is against human microfibril related glycoprotein (1 MFA4_HUMAN); known TIE-2 ligand and ligand homology It shows significant amino acid sequence identity to the body, ficolin, serum lectin and TGF-1-binding protein.

Example 101: Isolation of cDNA clone encoding human PRO1131 The cDNA sequence isolated in the amylase screen described in Example 2 above is herein designated DNA43546 (see FIG. 231; SEQ ID NO: 320). ). The DNA43546 sequence is then compared with various existing sequence tags (ESTs), including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ ^™ , Incyte Pharmaceuticals, Palo Alto, Calif.). Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA45627.
Based on the DNA45627 sequence, oligonucleotide probes were produced and used to screen the human library described in the first paragraph of Example 2 above. The cloning vector is pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science 253: 1278-1280 (1991)) and the cleaved cDNA size was less than 2800 bp .
PCR primers (forward and two reverse directions) were synthesized:
Forward PCR primer 5′-ATGCAGGCCAAGTACAGCAGCAC-3 ′ (SEQ ID NO: 321);
Reverse PCR primer 1 5′-CATGCTGACGACTTCCTGCAAGC-3 ′ (SEQ ID NO: 322); and reverse PCR primer 2 5′-CCACACAGTCTCTGCTTCTTGGG-3 ′ (SEQ ID NO: 323)
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe:
5'-ATGCTGGATGATGATGGGGACACCACCATGAGCCTGCATT-3 '(SEQ ID NO: 234)
From the DNA45627 sequence having
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1131 gene using one of the probe oligonucleotides and PCR primers.
A full-length clone was identified that contained a single open reading frame with an apparent translation start site at nucleotide positions 144-146 and a stop signal at nucleotide positions 984-986 (FIG. 229; SEQ ID NO: 318). The predicted polypeptide precursor is 280 amino acids long, has a calculated molecular weight of approximately 31,966 daltons and an estimated pI of approximately 6.26. The transmembrane domain is at about 49-74 of SEQ ID NO: 319, and the region having sequence identity with the LDL receptor is at about 50-265 of SEQ ID NO: 319. PRO1131 contains potential N-linked glycosylation sites at amino acid positions 95-98 and 169-172 of SEQ ID NO: 319. Clone DNA59777-1480 has been deposited with ATCC and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , I49115, RNU56863_1, LY4A_MOUSE, I55686, MMU56404_1, I49361, AF030313_1 and MMU09739_1 proved some sequence identity.

Example 102: Isolation of cDNA clones encoding human PRO1281 Consensus DNA sequences were constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated DNA35720. Based on the DNA35720 sequence, oligonucleotides are used for 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) to use as a probe to isolate a clone of the full-length coding sequence for PRO1281. Synthesized.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer:
5'-TGGAAGGCTGCCGCAACGACAATC-3 '(SEQ ID NO: 327);
5'-CTGATGTGGCCGATGTTCTG-3 '(SEQ ID NO: 328); and
5′-ATGGCTCAGTGTGCAGACAG-3 ′ (SEQ ID NO: 329).
Reverse PCR primer:
5'-GCATGCTGCTCCGTGAAGTAGTCC-3 '(SEQ ID NO: 330); and
5′-ATGCATGGGAAAGAAGGCCTGCCC-3 ′ (SEQ ID NO: 331).
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe:
5'-TGCACTGGTGACCACGAGGGGGTGCACTATAGCCATCTGGAGCTGAG-3 '(SEQ ID NO: 332)
From the DNA35720 sequence with
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1281 gene using one of the probe oligonucleotides and PCR primers. RNA for construction of the cDNA library was isolated from human fetal kidney.
DNA sequencing of the clones isolated as described above yielded the full-length DNA sequence for PRO1281 (herein named DNA59820-1549 [FIG. 232, SEQ ID NO: 325]) and the derived protein sequence for PRO1281.
The entire coding sequence of PRO1281 is shown in FIG. 232 (SEQ ID NO: 325). Clone DNA 59820-1549 contains a single reading frame with an apparent translation start site at nucleotide positions 228-230 and an apparent stop codon at nucleotide positions 2555-2555. The predicted polypeptide precursor is 775 amino acids long. The full-length PRO1281 protein shown in FIG. 233 has an estimated molecular weight of about 85,481 daltons and a pI of about 6.92. Additional features include a signal peptide of about amino acids 1-15; and potential N-glycosylation sites of amino acids 138-141 and 361-364.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , CEC38H2_3, CAC2_HAECO, B3A2_HUMAN, S22373, CEF38A3_2, CEC34F6_2, CEC34F6_3, and CELT22B11_3 were revealed.
Clone DNA59820-1549 has been deposited with ATCC and is assigned ATCC deposit no.

Example 103: Isolation of cDNA clones encoding human PRO1064 The cDNA sequence isolated in the amylase screen described in Example 2 above is significantly different from known human proteins by the WU-BLAST2 sequence alignment computer program. It was found that there was no sequence identity. This cDNA sequence is herein designated DNA45288. Then, identify the DNA45288 sequences, EST databases (e.g., GenBank) and corporate EST DNA database public ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) as compared to various EST databases including, homology EST sequences did. Comparisons were made using the computer program BLAST or BLAST2 [Altshul et al., Methods in Enzymology 266: 460-480 (1996)]. The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. This consensus sequence is herein designated DNA48609. An oligonucleotide probe was then synthesized based on the DNA48609 sequence and used to screen a human fetal kidney cDNA library, and the DNA59827-1426 clone shown in FIG. 234 was identified. The cloning vector is pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science 253: 1278-1280 (1991)) and the cleaved cDNA size was less than 2800 bp .
The oligonucleotide probes used are as follows:
Forward PCR primer 5'-CTGAGACCCTGCAGCACCATCTG-3 '(SEQ ID NO: 336)
Reverse PCR primer 5'-GGTGCTTCTTGAGCCCCACTTAGC-3 '(SEQ ID NO: 337)
In addition, the synthetic oligonucleotide hybridization probe is a nucleotide sequence hybridization probe
5'-AATCTAGCTTCTCCAGGACTGTGGTCGCCCCGTCCGCTGT-3 '(SEQ ID NO: 338)
Consensus DNA48609 sequence with
A full-length clone was identified that contained a single open reading frame with an apparent translation start site at nucleotide positions 532-534 and a stop signal at nucleotide positions 991-993 (FIG. 234, SEQ ID NO: 333). The predicted polypeptide precursor is 153 amino acids long, has a calculated molecular weight of approximately 17,317 daltons and an estimated pI of approximately 5.17. Analysis of the full-length PRO1064 sequence shown in FIG. 235 (SEQ ID NO: 334) reveals that: a signal peptide from about amino acid 1 to about 24 amino acids, a transmembrane domain from about amino acid 89 to about 110 amino acids, about 114 amino acids from about amino acids The existence of about 137 Myb DNA binding domain protein repeat protein homologous blocks is demonstrated. Clone DNA59827-1426 has been deposited with ATCC on Aug. 4, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , CELF42G8_4, MMU58888_1, GEN14270, TUB8_SOLTU, RCN_MOUSE, HUMRBSY79_1, SESENODA_1 and A21467_1 were proved.

Example 104: Isolation of cDNA clones encoding human PRO1379 Consensus DNA sequences were constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated DNA45232. Based on the DNA45232 consensus sequence, oligonucleotides for 1) identification of cDNA libraries containing sequences of interest by PCR and 2) use as probes to isolate clones of the full-length coding sequence for PRO1379 Was synthesized.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer: 5'-TGGACACCGTACCCTGGTATCTGC-3 '(SEQ ID NO: 341)
Reverse PCR primer: 5'-CCAACTCTGAGGAGAGCAAGTGGC-3 '(SEQ ID NO: 342)
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe
5'-TGTATGTGCACACCCTCACCATCACCTCCAAGGGCAAGGAGAAC-3 '(SEQ ID NO: 343)
From the DNA45232 sequence.
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate clones encoding the PRO1379 gene using one of the probe oligonucleotides and PCR primers. RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
By DNA sequencing of the clone isolated as described above, the full-length DNA sequence for PRO1379 designated herein as DNA59828-1608 and shown in FIG. 237 (SEQ ID NO: 339) and the derived protein sequence for PRO1379 (SEQ ID NO: 340) )was gotten.
The entire nucleotide sequence of PRO1379 is shown in FIG. 237 (SEQ ID NO: 339). Clone DNA59828-1608 contains a single reading frame with an apparent translation start site at nucleotide positions 10-12 and an apparent stop codon at nucleotide positions 1732-1734. The predicted polypeptide precursor is 574 amino acids long. The full-length PRO1379 protein shown in FIG. 238 has an estimated molecular weight of about 65,355 daltons and a pI of about 8.73. Additional features include a signal peptide of about amino acids 1-17 and potential N-glycosylation sites of amino acids about 160-163, 287-290, and 323-326.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , HP714394_1, and HIV18U45630_1 revealed some homology.
Clone DNA59828-1608 has been deposited with ATCC and is assigned ATCC deposit no.

Example 105: Isolation of cDNA clones encoding human PRO844. Searching the expressed sequence tag (EST) DNA database (LIFESEQ ^™ , Incyte Pharmaceuticals, Palo Alto, Calif.) To identify ESTs that showed sequence identity with LP. did. Based on the information and findings provided here, the clone for this EST, Incyte clone number 2657496 from the cancerous lung library, was further examined.
DNA sequencing of the insert for this clone resulted in a sequence containing the full-length DNA sequence for PRO844 (herein named DNA59838-1462; SEQ ID NO: 344) and a derived protein sequence for PRO844.
The complete nucleotide sequence of DNA59838-1462 is shown in Figure 239 (SEQ ID NO: 344). Clone DNA59838-1462 has a single open reading frame with an apparent translation start site at nucleotide positions 5-7 of SEQ ID NO: 344 (FIG. 239) and ending with a stop codon at nucleotide positions 338-340. The predicted polypeptide precursor is 111 amino acids long (Figure 240). The full-length PRO844 protein shown in FIG. 240 has an estimated molecular weight of about 12,050 daltons and a pI of about 5.45. Clone UNQ544DNA59838-1462 was deposited with the ATCC on June 16, 1998. It will be appreciated that the deposited clone has the actual nucleic acid sequence and the sequence provided herein is based on known sequencing methods.
Analysis of the amino acid sequence of full-length PRO844 suggests that it has significant sequence similarity to serine protease inhibitors, indicating that PRO844 can be a novel proteinase inhibitor. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt35) demonstrated significant homology between the PRO844 amino acid sequence and at least the following Dayhoff sequences, ALK1_HUMAN, P_P82403, P_P82402, ELAF_HUMAN and P_P60950.

Example 106: Isolation of cDNA clones encoding human PRO848 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA55999.
In light of the observed sequence homology between the DNA55999 consensus sequence and the EST sequence contained within Incyte EST clone no. 2768571, the Incyte EST clone 2768571 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 241, and is herein designated as DNA59839-1461.
The entire nucleotide sequence of DNA59839-1461 is shown in FIG. 241 (SEQ ID NO: 346). Clone DNA59839-1461 has a single open reading frame with an apparent translation start site at nucleotide positions 146-148 of SEQ ID NO: 346 (FIG. 241) and ending with a stop codon at nucleotide positions 1946-1948. The predicted polypeptide precursor is 600 amino acids long (Figure 242). The full-length PRO848 protein shown in FIG. 242 has an estimated molecular weight of approximately 68,536 daltons. Clone DNA59839-1461 was deposited with ATCC on June 16, 1998. It will be appreciated that the deposited clone has the actual nucleic acid sequence and the sequence provided herein is based on known sequencing methods.
Analysis of the amino acid sequence of the full-length PRO848 polypeptide suggests that it may be a novel sialyltransferase. More specifically, by analyzing the Dayhoff database (version 35.45 SwissProt35), the PRO848 amino acid sequence and at least the following Dayhoff sequence, P_R78619 (GalNAc-α-2,6-sialyltransferase), CAAG5_CHICK (α-n-acetylgalactosami) Sequence identity between HSU14550_1, CAG6_HUMAN and P_R63217 (human α-2,3-sialyltransferase).

Example 107: Isolation of cDNA clones encoding human PRO1097 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56006.
In light of the observed sequence homology between the DNA56006 consensus sequence and the EST sequence contained within Incyte EST clone no. 2408105, Incyte EST clone 2408105 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 243 and is herein designated as DNA59841-1460.
The entire nucleotide sequence of DNA59841-1460 is shown in FIG. 243 (SEQ ID NO: 348). Clone DNA59841-1460 has a single open reading frame with an apparent translation start site at nucleotide positions 3-5 of SEQ ID NO: 348 (FIG. 243) and ending with a stop codon at nucleotide positions 276-278. The predicted polypeptide precursor is 91 amino acids long (Figure 244). The full-length PRO1097 protein shown in FIG. 244 has an estimated molecular weight of about 10,542 daltons and a pI of about 10.04. Clone DNA59841-1460 was deposited with the ATCC on July 1, 1998. It will be appreciated that the deposited clone has the actual nucleic acid sequence and the sequence provided herein is based on known sequencing methods.
Upon analysis of FIG. 244, the signal peptide is at about amino acids 1-20 of SEQ ID NO: 349. The protein domain of the glycopretease family begins at about amino acid 56 of SEQ ID NO: 349, and the acyltransferase ChoActase / COT / CPT family peptide begins at about amino acid 49.

Example 108: Isolation of cDNA clones encoding human PRO1153 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56008.
In light of the observed sequence homology between the DNA56008 consensus sequence and the EST sequence contained within Incyte EST clone number 2472409, the Incyte EST clone 2472409 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 245 and is herein designated as DNA59842-1502.
The full-length clone shown in FIG. 245 contains a single reading frame with an apparent translation start site at nucleotide positions 92-94 and ending with a stop codon found at nucleotide positions 683-685 (FIG. 245; SEQ ID NO: 350). The predicted polypeptide precursor (FIG. 246, SEQ ID NO: 351) is 197 amino acids long. PRO1153 has a calculated molecular weight of about 21,540 daltons and an estimated pI of about 8.31. Clone DNA59842-1502 has been deposited with ATCC and is assigned ATCC deposit no. It will be appreciated that the correct actual sequence is in the deposited clone and is provided here based on current sequencing methods that may have some errors.
Based on the WU-BLAST2 sequence alignment analysis of the full-length sequence (using the ALIGN computer program), PRO1153 has the following Dayhoff designation: S57447; SOYHRGPC_1; S46965; P_P82971; VCPHEROPH_1; EXTN_TOBAC; MLCB2548_9; Show some amino acid sequence identity.

Example 109: Isolation of cDNA clones encoding human PRO1154 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56025.
In light of the observed sequence homology between the DNA56025 consensus sequence and the EST sequence contained within Incyte EST clone number 2169375, the Incyte EST clone 2169375 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 247 and is herein designated as DNA59846-1503.
The full-length clone shown in FIG. 247 has a single open reading frame with an apparent translation start site at nucleotide positions 86-88 and ending with a stop codon found at nucleotide positions 2909-2911 (FIG. 247; SEQ ID NO: 352). The predicted polypeptide precursor (FIG. 248, SEQ ID NO: 353) is 941 amino acids long. PRO1154 has a calculated molecular weight of about 107,144 daltons and an estimated pI of about 6.26. Clone DNA59846-1503 has been deposited with ATCC and is assigned ATCC deposit no.
Based on WU-BLAST2 sequence alignment analysis of the full-length sequence (using the ALIGN computer program), PRO1154 has at least the following Dayhoff designations: AB011097_1, AMPN_HUMAN, RNU76997_1, 159331, GEN14047, HSU62768_1, P_R51281, CRE07H10_1, SRE371 Shows sequence identity.

Example 110: Isolation of a cDNA clone encoding human PRO1181 Use of the signal sequence algorithm described in Example 3 above allows identification of a single EST cluster sequence from the Incyte database, herein designated 82468. Became. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56029.
In light of the observed sequence homology between the DNA56029 consensus sequence and the EST sequence contained within Incyte EST clone number 2186536, Incyte EST clone 2186536 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 249 and is herein designated as DNA59847-1511.
Clone DNA59847-1511 contains a single open reading frame with an apparent translation start site at nucleotide positions 17-19 and ending with a stop codon at nucleotide positions 1328-1330 (FIG. 249). The predicted polypeptide precursor is 437 amino acids long (Figure 250). The full-length PRO1181 protein shown in FIG. 250 has an estimated molecular weight of about 46,363 daltons and a pI of about 6.22. Analysis of the full-length PRO1181 sequence shown in FIG. 250 (SEQ ID NO: 355) revealed that the following: a signal peptide from about amino acid 1 to about 15 amino acids, about 46 to about 49 amino acids, about 189 to about 192 amino acids and about 192 amino acids An amino acid sequence block having homology with a potential N-glycosylation site from about 192 to about 382 amino acids and a Ly-6 / u-PAR domain protein from about 287 to about 300 amino acids and from about 98 to about 111 amino acids; The existence of is proved. Clone DNA59847-1511 was deposited with ATCC on August 4, 1998 and is assigned ATCC deposit number 203098.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , RNMAGPIAN_1, CELT13C2_2, LMSAP2GN_1, S61882, CEF35C5_12, DP87_DICDI, GIU47631_1 and P_R07092 were proved.

Example 111: Isolation of cDNA clones encoding human PRO1182 Use of the signal sequence algorithm described in Example 3 above allows identification of a single EST cluster sequence from the Incyte database, herein designated 146647. Became. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56033.
In light of the observed sequence homology between the DNA56033 consensus sequence and the EST sequence contained within Incyte EST clone no. 2595195, the Incyte EST clone 2595195 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 251 and is herein designated as DNA59848-1512.
Clone DNA59848-1512 has an apparent translation start site at nucleotide positions 67-69 and contains a single reading frame ending with a stop codon at nucleotide positions 880-882 (FIG. 251). The predicted polypeptide precursor is 271 amino acids long (Figure 252). The full-length PRO1182 protein shown in FIG. 252 has an estimated molecular weight of about 28,665 daltons and a pI of about 5.33. Analysis of the full-length PRO1182 sequence shown in FIG. 252 (SEQ ID NO: 357) shows homology with the following: a signal peptide from about amino acid 1 to about 25 amino acids, and a C-type lectin domain protein from about amino acid 247 to about 256 amino acids. The existence of an amino acid block having and an amino acid sequence block having homology with a C1q domain protein from about 44 amino acids to about 77 amino acids is demonstrated. Clone DNA59848-1512 was deposited with ATCC on August 4, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , CONG_BOVIN, P_W18780, P_R45005, P_R53257 and CELEGAP7_1 proved significant homology.

Example 112: Isolation of cDNA clones encoding human PRO1155 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56102.
In light of the observed sequence homology between the DNA56102 consensus sequence and the EST sequence contained within the Incyte EST clone number 2858870, the Incyte EST clone 2858870 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 253 and is herein designated as DNA59849-1504.
The full-length clone shown in FIG. 253 has a single open reading frame with an apparent translation start site at nucleotide positions 158-160 and ending with a stop codon at nucleotide positions 563-565 (FIG. 253; SEQ ID NO: 358). ). The predicted polypeptide precursor (Figure 254, SEQ ID NO: 359) is 135 amino acids long. PRO1155 protein has a calculated molecular weight of approximately 14,833 daltons and a pI of approximately 9.78. Clone DNA59849-1504 has been deposited with ATCC and is assigned ATCC deposit no. While actual clones have the correct sequence, it is understood that what is described here is only a representation that may be a minor risk of sequencing error.
Based on WU-BLAST2 sequence alignment analysis of the full-length sequence (using the ALIGN computer program), PRO1155 has the following Dayhoff indication: TKNK_BOVIN; PVB19X587_1; AF019049_1; P_W00948; S72864; P_W00949; I62742; AF038501_1; TKBL_HMAN; Amino acid sequence identity. Based on the information provided here, PRO1155 may play a role in providing neuroprotection and nootropic.

Example 113: Isolation of a cDNA clone encoding human PRO1156 The use of the signal sequence algorithm described in Example 3 above allows the identification of a single EST cluster sequence from the Incyte database, designated here as 138851 Became. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56261.
In light of the observed sequence homology between the DNA56261 consensus sequence and the EST sequence contained within Incyte EST clone number 3675191, the Incyte EST clone 3675191 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 255 and is herein designated as DNA59853-1505.
The full-length clone shown in FIG. 255 contains a single open reading frame with an apparent translation start site at nucleotide positions 212-214 and ending with a stop codon found at nucleotide positions 689-691 (FIG. 255; SEQ ID NO: : 360). The predicted polypeptide precursor (FIG. 256; SEQ ID NO: 361) is 159 amino acids long. PRO1156 has a calculated molecular weight of about 17,476 daltons, an estimated pI of about 9.15, a signal peptide sequence of about 1 to about 22 amino acids, and potential N-glycosylation sites of about 27-30 and 41-44 amino acids. Have.
Clone DNA59853-1505 has been deposited with ATCC on June 16, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method (using the ALIGN computer program) of the full-length sequence shown in FIG. 256 (SEQ ID NO: 361) Some homology was revealed between the following Dayhoff sequences: D45027_1, P_R79914, JC5309, KBF2_HUMAN, AF010144_1, GEN14351, S68681, P_R79915, ZMTAC_3, and HUMCPGO_1.

Example 114: Isolation of cDNA clones encoding human PRO1098 Use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56377.
In light of the observed sequence homology between the DNA56377 consensus sequence and the EST sequence contained within Incyte EST clone no. 3050917, the Incyte EST clone 3050917 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 257 and is herein designated as DNA59854-1459.
The complete nucleotide sequence of DNA59854-1459 is shown in FIG. 257 (SEQ ID NO: 362). Clone DNA59854-1459 has an apparent translation start site at nucleotide positions 58-60 of SEQ ID NO: 362 (Figure 257) and contains a single reading frame that terminates at a stop codon at nucleotide positions 292-294. The predicted polypeptide precursor is 78 amino acids long (Figure 258). The full-length PRO1098 protein shown in FIG. 258 has an estimated molecular weight of about 8,396 daltons and a pI of about 7.66. Clone DNA59854-1459 was deposited with ATCC on June 16, 1998. It will be appreciated that the deposited clone has the actual nucleic acid sequence and the sequence provided herein is based on known sequencing methods.
Upon analysis of FIG. 258, the signal sequence appears to be at amino acids about 1-19 of SEQ ID NO: 363, the N-glycosylation site appears to be at amino acids 37-40 of SEQ ID NO: 363, and the N-myristoylation site Appears to be at amino acids about 15-20, 19-24 and 60-65 of SEQ ID NO: 363.

Example 115: Isolation of cDNA clones encoding human PRO1127 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA57959.
In light of the observed sequence homology between the DNA57959 consensus sequence and the EST sequence contained within Merck EST clone number 685126, Merck EST clone 685126 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 259 and is herein designated as DNA60283-1484.
The full-length clone shown in FIG. 259 contains a single reading frame with an apparent translation start site at nucleotide positions 126-128 and ending with a stop codon found at nucleotide positions 327-329 (FIG. 259; SEQ ID NO: 364). The predicted polypeptide precursor (Figure 260, SEQ ID NO: 365) is 67 amino acids long, including the signal peptide of about 1-29 of SEQ ID NO: 365. PRO1127 has a calculated molecular weight of about 7,528 daltons and an estimated pI of about 4.95. Clone DNA60283-1484 was deposited with ATCC on July 1, 1998 and is assigned ATCC deposit no. It will be understood that while the deposited clone has the actual nucleic acid sequence, an indication is provided here that may have minor sequencing errors.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , HBA_HETPO, S39821, KR2_EBV, CET20D3_8, HCU37630_1, HS193B12_10, S40012 and TRITUBC_1 were revealed to some degree.

Example 116: Isolation of cDNA clones encoding human PRO1126 Use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56250.
In light of the observed sequence homology between the DNA56250 consensus sequence and the EST sequence contained within Incyte EST clone number 1437250, Incyte EST clone 1437250 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 261 and is herein designated as DNA60615-1483.
Clone DNA60615-1483 has a single open reading frame with an apparent translation start site at nucleotide positions 110-112 and ending with a stop codon at nucleotide positions 1316-1318 (FIG. 261). The predicted polypeptide precursor is 402 amino acids long (Figure 262). The full-length PRO1126 protein shown in FIG. 262 has an estimated molecular weight of about 45,921 daltons and a pI of about 8.60. Analysis of the full-length PRO1126 sequence shown in FIG. 262 (SEQ ID NO: 367) revealed that the following: a signal peptide from about amino acid 1 to about 25 amino acid and about 66 to about 69 amino acid, about 138 to about 141 amino acid and about 141 amino acid The existence of a potential N-glycosylation site from about 183 to about 186 amino acids is demonstrated. Clone DNA60615-1483 has been deposited with ATCC on June 16, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , MMUSMYOC3_1, HS454G6_1, P_R98225, RNU78105_1, RNU72487_1, AF035301_1, CEELC48E7_4 and CEF11C3_3 were proved.

Example 117: Isolation of cDNA clones encoding human PRO1125 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56540.
In light of the observed sequence homology between the DNA56540 consensus sequence and the EST sequence contained within Incyte EST clone number 1486114, the Incyte EST clone 1486114 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 263 and is herein designated as DNA60615-1482.
The full-length clone shown in FIG. 263 contains a single reading frame with an apparent translation start site at nucleotide positions 47-49 and ending with a stop codon found at nucleotide positions 1388-1390 (FIG. 263, SEQ ID NO: : 368). The predicted polypeptide precursor (Figure 264, SEQ ID NO: 369) is 447 amino acids long. PRO1125 has a calculated molecular weight of about 49,798 daltons and an estimated pI of about 9.78. Clone DNA60619-1482 has been deposited with ATCC and is assigned ATCC deposit no. It will be appreciated that the clone has an actual nucleic acid sequence and that the sequence provided herein is a representation based on current methods that may contain minor errors.
Based on the WU-BLAST2 sequence alignment analysis (using the ALIGN computer program) of the full-length sequence, PRO1125 has the following Dayhoff notation: RCO1_NEUCR; S58306; PKWA_THECU; S76086; P_R85881; HET1_PODAN; SPU92792_1; AP414_HU59317; Shows the sequence identity.

Example 118: Isolation of cDNA clones encoding human PRO1186 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag (EST) databases including, Existing homologues were identified. Homology searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56748.
In light of the observed sequence homology between the DNA56748 sequence and the EST sequence contained within Incyte's EST clone no. 3476679, Incyte's EST clone 3476792 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 265 and is herein designated as DNA60621-1516.
The full length clone shown in FIG. 265 contains a single open reading frame with an apparent translation start site at nucleotide positions 91-93 and ending with a stop codon found at nucleotide positions 406-408 (FIG. 265; SEQ ID NO: 370). The predicted polypeptide precursor (Figure 266; SEQ ID NO: 371) is 105 amino acids long. The signal peptide is at amino acids 1-19 of SEQ ID NO: 371. PRO1186 has a calculated molecular weight of about 11,715 daltons and an estimated pI of about 9.05. Clone DNA60621-1516 was deposited with ATCC on August 4, 1998 and is assigned ATCC deposit number 203091.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , AF034208_1, AF030433_1, A55035, COL_RABIT, CELB0507_9, S67826_1, S34665 and CRU73817_1 showed some sequence identity.

Example 119: Isolation of cDNA clone encoding human PRO1198 The first DNA sequence referred to herein as DNA52083 uses yeast screening in a human umbilical vein endothelial cell cDNA library that preferentially represents the 5 'end of the primary cDNA clone. Identified. DNA52083 can be obtained from public databases (eg GenBank) and corporate EST databases (LIFESEQ ^R , Incyte Pharmaceuticals, Palo Alto) using the computer program BLAST or BLAST2 [Altshul et al., Methods in Enzymology 266: 460-480 (1996)]. , CA). ESTs were assembled and consensus DNA sequences were constructed using the computer program “phrap” (Phil Green, University of Washington, Seattle, Washington). One or more ESTs were obtained from human breast skin tissue biopsy. This consensus sequence is herein designated DNA52780.
In light of the observed sequence homology between the DNA52780 consensus sequence and the EST sequence contained within Incyte's EST clone number 3852910, Incyte's EST clone 3852910 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 267 and is herein designated as DNA60622-1525.
The full-length DNA60622-1525 clone shown in FIG. 267 (SEQ ID NO: 372) has an apparent translation start site at nucleotide positions 54-56 and a single open reading frame terminated with a stop codon found at nucleotide positions 741-743. including. The predicted polypeptide precursor shown in FIG. 268 (SEQ ID NO: 373) is 229 amino acids long. PRO1198 has a calculated molecular weight of about 25,764 daltons and an estimated pI of about 9.17. There is a signal peptide at about amino acids 1-34. There is sequence identity with the glycosyl hydrolase family 31 protein from about amino acid 142 to about 175.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. 268 (SEQ ID NO: 373) revealed that the PRO1198 amino acid sequence and the following Dayhoff sequence: ATF6H11_6, UCRI_RAT , TOBSUP2NT_1, RCUERF3_1, AMU88186_1, P_W22485, S56579, AF040711_1, DPP4_PIG were revealed to some degree.
Clone DNA60622-1525 was deposited with ATCC on August 4, 1998 and is assigned ATCC deposit number 203090.

Example 120: Isolation of cDNA clones encoding human PRO1158 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA57248.
In light of the observed sequence homology between the DNA57248 consensus sequence and the EST sequence contained within Incyte EST clone no. 2640776, Incyte EST clone 2640776 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 269 and is herein designated as DNA60625-1507.
The full-length clone shown in FIG. 269 has a single open reading frame with an apparent translation start site at nucleotide positions 163 to 165 and ending with a stop codon found at nucleotide positions 532 to 534 (FIG. 269; SEQ ID NO: 374). The predicted polypeptide precursor (Figure 270; SEQ ID NO: 375) is 123 amino acids long. PRO1158 has a calculated molecular weight of about 13,113 daltons and an estimated pI of about 8.53. Additional features include a signal peptide sequence of about amino acids 1-19, a transmembrane domain of about amino acids 56-80, and a potential N-glycosylation site of about 36-39 amino acids. Clone DNA60625-1507 has been deposited with ATCC on June 16, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis of the full-length sequence shown in FIG. , P_R85151, PHS2_SOLTU, RNMHCIBAC_1, RNA1FMHC_1, I68771, RNRT1A10G_1, PTPA_HUMAN, HUMGACA_1, and CHKPTPA_1 were revealed.

Example 121: Isolation of cDNA clones encoding human PRO1159 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA57221.
In light of the observed sequence homology between the DNA57221 consensus sequence and the EST sequence contained within Incyte EST clone number 376776, Incyte EST clone 376776 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 271 and is herein designated as DNA60627-1508.
Clone DNA60627-1508 contains a single open reading frame with an apparent translation start site at nucleotide positions 92-94 and ending with a stop codon at nucleotide positions 362-364 (FIG. 271). The predicted polypeptide precursor is 90 amino acids long (Figure 272). The full-length PRO1159 protein shown in FIG. 272 has an estimated molecular weight of about 9,840 daltons and an estimated pI of about 10.13. Analysis of the full-length PRO1159 sequence shown in FIG. 272 (SEQ ID NO: 377) reveals that: a signal peptide from about amino acid 1 to about 15 amino acids and a potential N-glycosylation site from about 38 amino acids to about 41 amino acids. Existence is proved. Clone DNA60627-1508 has been deposited with ATCC on August 4, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , DSSCUTE_1, D89100_1, S28060, MEFA_XENLA, AF020798_12, G70065, E64423, JQ2005 revealed significant homology.

Example 122: Isolation of cDNA clones encoding human PRO1124 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56035.
In light of the observed sequence homology between the DNA56035 consensus sequence and the EST sequence contained within Incyte EST clone no. 2767646, Incyte EST clone 2767646 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 273 and is herein designated as DNA60629-1481.
The full-length clone shown in FIG. 273 has a single open reading frame with an apparent translation start site at nucleotide positions 25-27 and ending with a stop codon found at nucleotide positions 2782-2784 (FIG. 273; SEQ ID NO: : 378). The predicted polypeptide precursor (FIG. 274, SEQ ID NO: 379) is 919 amino acids long. PRO1124 has a calculated molecular weight of about 101,282 daltons and an estimated pI of about 5.37. Clone DNA60629-1481 has been deposited with ATCC and is assigned ATCC deposit no. While the deposited clone has the actual nucleic acid sequence, it is understood that only representations based on current sequencing methods that may contain the usual minor errors are provided here.
Based on WU-BLAST2 sequence alignment analysis of the full-length sequence, PRO1124 shows significant amino acid sequence identity to chloride channel protein and ECAM-1. In particular, the following Dayhoff designations were identified as having sequence identity with PRO1124: ECLC_BOVIN, AF001261_1, P_W06548, SSC6A10_1, AF004355_1, S76691, AF017642, BYU06866_2, CSA_DICDI and SAU47139_2.

Example 123 Identification Isolation expressed sequence tag cDNA Clones Encoding Human PRO1287 (EST) DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) was searched and an EST showing fringe protein homology did. Then, identify the EST cluster sequence, EST databases (e.g., GenBank) and EST database company public ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) as compared to various EST databases including, homology EST sequences did. Comparisons were made using the computer program BLAST or BLAST2 [Altshul et al., Methods in Enzymology 266: 460-480 (1996)]. The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. This consensus sequence is herein designated DNA40568.
Based on the DNA40568 consensus sequence, oligonucleotides for 1) identification of cDNA libraries containing sequences of interest by PCR and 2) use as probes to isolate clones of the full-length coding sequence for PRO1287 Was synthesized. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to yield PCR products that are approximately 100-1000 bp long. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification as described by Ausubel et al., Current Protocols in Molecular Biology, supra, with PCR primer pairs. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer 5'-CTCGGGGAAAGGGACTTGATGTTGG-3 '(SEQ ID NO: 382)
Reverse PCR primer 1 5'-GCGAAGGTGAGCCTCTATCTCGTGCC-3 '(SEQ ID NO: 383)
Reverse PCR primer 2 5′-CAGCCTACACGTATTGAGG-3 ′ (SEQ ID NO: 384)
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe
5'-CAGTCAGTACAATCCTGGCATAATATACGGCCACCATGATGCAGTCCC-3 '(SEQ ID NO: 385)
Consensus DNA40568 sequence with
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate clones encoding the PRO1287 gene using one of the probe oligonucleotides and PCR primers.
RNA for construction of the cDNA library was isolated from human bone marrow tissue. The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with oligo dT containing a NotI site, blunt-ended and bound to a SalI hemikinase adapter, cut with NotI, sized appropriately by gel electrophoresis, and appropriate at the unique XhoI and NotI sites. Cloned in a defined orientation in a cloning vector (eg, pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain an SfiI site; see Holmes et al., Science, 253: 1278-1280 (1991)).
DNA sequencing of the clones isolated as described above resulted in the full-length DNA sequence for PRO1287 (designated DNA61755-1554 [Figure 275, SEQ ID NO: 380]) and the derived protein sequence for PRO1287.
The entire nucleotide sequence of DNA61755-1554 is shown in FIG. 275 (SEQ ID NO: 380). The full-length clone contains a single open reading frame with an apparent translation start site at nucleotide positions 655-657 and a stop signal at nucleotide positions 2251-2253 (FIG. 275; SEQ ID NO: 380). The predicted polypeptide precursor is 532 amino acids long, has a calculated molecular weight of approximately 61,351 daltons and an estimated pI of approximately 8.77. Analysis of the full-length PRO1287 sequence shown in FIG. 276 (SEQ ID NO: 381) revealed that: a signal peptide from about amino acid 1 to about 27 amino acids and a potential of about 315 to about 318 amino acids and about 324 to about 327 amino acids The existence of a typical N-glycosylation site is demonstrated. Clone DNA61755-1554 has been deposited with ATCC on August 11, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 276 (SEQ ID NO: 381) revealed that the PRO1287 amino acid sequence and the following Dayhoff sequence: CET24D1_1, EZRI_BOVIN , GGU19889_1, CC3_YEAST, S74244, NALS_MOUSE, MOES_PIG, S28660, S44860 and YNA4_CAEEL were proved to be significant.

Example 124: Isolation of a cDNA clone encoding human PRO1312 DNA55773 was identified in a human fetal kidney cDNA library using a yeast screen that preferentially represents the 5 'end of the primary cDNA clone. Based on the DNA55773 sequence, oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence for PRO1312.
The full length DNA 61873-1574 clone shown in FIG. 277 (SEQ ID NO: 386) has a single open reading frame with an apparent translation start site at nucleotide positions 7-9 and ending with a stop codon found at nucleotide positions 643-645. including. The predicted polypeptide precursor is 212 amino acids long (Figure 278, SEQ ID NO: 387). PRO1312 has a calculated molecular weight of about 24,024 daltons and an estimated pI of about 6.26. Other features include a signal peptide of about amino acids 1-14, a transmembrane domain of about amino acids 141-160, and potential N-glycosylation sites of about amino acids 76-79 and 93-96.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , P_R96298, AF001406_1, PVU88874_1, P_R85151, AF041409_1, CELC50F2_7, C45875, and AB009510_21 were revealed to some degree.
Clone DNA61883-1574 has been deposited with ATCC and is assigned ATCC deposit no.

Example 125: Isolation of cDNA clones encoding human PRO1192 Consensus DNA sequences were constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated DNA35924. Based on the DNA35924 consensus sequence, oligonucleotides for 1) identification of cDNA libraries containing sequences of interest by PCR and 2) use as probes to isolate clones of the full-length coding sequence for PRO1192 Was synthesized.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer: 5'-CCGAGGCCATCTAGAGGCCAGAGC-3 '(SEQ ID NO: 390)
Reverse PCR primer: 5'-ACAGGCAGAGCCAATGGCCAGAGC-3 '(SEQ ID NO: 391)
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe
5'-GAGAGGACTGCGGGAGTTTGGGACCTTTGTGCAGACGTGCTCATG-3 '(SEQ ID NO: 392)
Consensus DNA35924 sequence with
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate clones encoding the PRO1192 gene using one of the probe oligonucleotides and PCR primers. RNA for construction of the cDNA library was isolated from human fetal liver and spleen tissue.
By DNA sequencing of the clone isolated as described above, the full-length DNA sequence for PRO1192 designated herein as DNA62814-1521 and shown in FIG. 279 (SEQ ID NO: 388) and the derived protein sequence for PRO1192 shown in FIG. (SEQ ID NO: 389) was obtained.
The entire coding sequence of PRO1192 is shown in FIG. 279 (SEQ ID NO: 388). Clone DNA62814-1521 contains a single open reading frame with an apparent translation start site at nucleotide positions 121-123 and an apparent stop codon at nucleotide positions 766-768. The predicted polypeptide precursor is 215 amino acids long. The predicted polypeptide precursor has the following characteristics: a signal peptide of about amino acids 1-21 in FIG. 280; a transmembrane domain of about amino acids 153-176; a potential N- of about 39-42 and 118-121 amino acids. Glycosylation site; and homology with the myelin P0 protein of amino acids about 27-68 and 99-128. The full-length PRO1192 protein shown in FIG. 280 has an estimated molecular weight of about 24,484 daltons and a pI of about 6.98.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , AF049498_1, GEN14531, P_W14146, HS46KDA_1, CINB_RAT, OX2G_RAT, D87018_1, and D86996_2 were revealed.
Clone DNA62814-1521 has been deposited with ATCC on August 4, 1998 and is assigned ATCC deposit no.

Example 126: Isolation of cDNA clones encoding human PRO1160 Consensus DNA sequences were constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated DNA40650. Based on the DNA40650 consensus sequence, oligonucleotides for 1) identification of cDNA libraries containing sequences of interest by PCR and 2) use as probes to isolate clones of the full-length coding sequence for PRO1160 Was synthesized.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer: 5'-GCTCCCTGATCTTCATGTCACCACC-3 '(SEQ ID NO: 395)
Reverse PCR primer: 5'-CAGGGACACACTCTACCATTCGGGAG-3 '(SEQ ID NO: 396)
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe
5'-CCATCTTTCTGGTCTCTGCCCAGAATCCGACAACAGCTGCTC-3 '(SEQ ID NO: 397)
Consensus DNA 40650 sequence with
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1160 gene using one of the probe oligonucleotides and PCR primers. RNA for construction of the cDNA library was isolated from human breast tissue.
DNA sequencing of the clones isolated as described above resulted in a full-length DNA sequence for PRO1160 (here designated as DNA62872-1509 [Figure 281; SEQ ID NO: 393]) and a derived protein sequence for PRO1160. .
The entire nucleotide sequence of DNA62872-1509 is shown in FIG. 281 (SEQ ID NO: 393). Clone DNA62872-1509 has an apparent translation start site at nucleotide positions 40-42 and contains a single open reading frame that terminates at a stop codon at nucleotide positions 310-312 (FIG. 281). The predicted polypeptide precursor is 90 amino acids long (Figure 282). The full-length PRO1160 protein shown in FIG. 282 has an estimated molecular weight of about 9,039 daltons and a pI of about 4.37. Analysis of the full-length PRO1160 sequence shown in FIG. 282 (SEQ ID NO: 394) shows the presence of the following: a signal peptide from about amino acid 1 to about amino acid 19 and a protein kinase C phosphorylation site from about amino acid 68 to about 70 amino acid. Proven. Clone DNA62872-1509 has been deposited with ATCC on August 4, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , I53641, S53363, HA34_BRELC, SP96_DICDI, S36326, SSU51197_10, MUC1_XENLA, TCU32448_1 and AF000409_1 were proved.

Example 127: Isolation of cDNA clone encoding human PRO1187 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA57726.
In light of the observed sequence homology between the DNA57726 consensus sequence and the EST sequence contained within Incyte EST clone number 358563, Incyte EST clone 358563 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 283 and is herein designated as DNA62876-1517.
The full-length clone shown in FIG. 283 has a single open reading frame with an apparent translation start site at nucleotide positions 121-123 and ending with a stop codon found at nucleotide positions 481-483 (FIG. 283; SEQ ID NO: : 398). The predicted polypeptide precursor (Figure 284, SEQ ID NO: 399) is 120 amino acids long. The signal peptide is at about amino acids 1-17 of SEQ ID NO: 399. PRO1187 has a calculated molecular weight of about 12,925 daltons and an estimated pI of about 9.46. Clone DNA62887-1517 has been deposited with ATCC on August 4, 1998 and is assigned ATCC deposit no. It will be appreciated that while the deposited clone has the actual nucleic acid sequence, the designations described herein may contain minor sequencing errors.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , AMPG_STRLI, HSBBOVHERL_2, LEEXTEN10_1, AF029958_1 and P_W04957 some degree of sequence identity (and therefore some degree of relationship) was revealed.

Example 128: Isolation of cDNA clones encoding human PRO1185 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA56426.
In light of the observed sequence homology between the DNA57726 consensus sequence and the EST sequence contained within Incyte EST clone number 3284411, the Incyte EST clone 3284411 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 285 and is herein designated as DNA62881-1515.
The full length DNA 62881-1515 clone shown in FIG. 285 contains a single reading frame with an apparent translation start site at nucleotide positions 4-6 and ending with a stop codon found at nucleotide positions 598-600 (FIG. 285). ; SEQ ID NO: 400). The predicted polypeptide precursor (Figure 286, SEQ ID NO: 401) is 198 amino acids long. The signal peptide is at about amino acids 1-21 of SEQ ID NO: 401. PRO1185 has a calculated molecular weight of about 22,105 Daltons and an estimated pI of about 7.73. Clone DNA62881-1515 has been deposited with ATCC and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , MAOM_SOLTU, SPPBPHU9_1, I41024, EPCPLCFAIL_1, HSPLEC_1, YKL4_CAEEL, A44643, TGU65922_1 were revealed to some extent.

Example 129: Isolation of cDNA clones encoding human PRO1345 Consensus DNA sequences were constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated DNA47364. Based on the DNA47364 consensus sequence, oligonucleotides for 1) identification of cDNA libraries containing sequences of interest by PCR and 2) use as probes to isolate clones of the full-length coding sequence for PRO1345 Was synthesized.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer: 5'-CCTGGTTATCCCCAGGAACTCCGAC-3 '(SEQ ID NO: 404)
Reverse PCR primer: 5'-CTCTTGCTGCTGCGACAGGCCTC-3 '(SEQ ID NO: 405)
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe
5'-CGCCCTCCAAGACTATGGTAAAAGGAGCCTGCCAGGTGTCAATGAC-3 '(SEQ ID NO: 406)
Consensus DNA47364 sequence with
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate clones encoding the PRO1345 gene using one of the probe oligonucleotides and PCR primers. RNA for construction of the cDNA library was isolated from human breast cancer tissue.
DNA sequencing of the clones isolated as described above resulted in a full-length DNA sequence for PRO1345 (designated herein as DNA64852-1589 [Figure 287, SEQ ID NO: 402]) and a derived protein sequence for PRO1345. .
The entire nucleotide sequence of DNA64852-1589 is shown in FIG. 287 (SEQ ID NO: 402). Clone DNA64852-1589 has a single open reading frame with an apparent translation start site at nucleotide positions 7-9 or 34-36 and ending with a stop codon at nucleotide positions 625-627 (FIG. 287). The predicted polypeptide precursor is 206 amino acids long (Figure 288). The full-length PRO1345 protein shown in FIG. 288 has an estimated molecular weight of about 23,190 daltons and a pI of about 9.40. Analysis of the full-length PRO1345 sequence shown in FIG. 288 (SEQ ID NO: 403) reveals that: The existence of a type lectin domain signature sequence is demonstrated. Clone DNA64852-1589 has been deposited with ATCC on August 18, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , TETN_HUMAN, MABA_RAT, S34198, P_W13144, MACMBPA_1, A46274, PSPD_RAT and P_R32188 proved significant homology.

Example 130: Isolation of a cDNA clone encoding human PRO1245 Use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56019.
In light of the observed sequence homology between the DNA56019 consensus sequence and the EST sequence contained within Incyte EST clone no. 1327836, Incyte EST clone 1327836 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 289 and is herein designated as DNA64888-1527.
The full-length clone shown in Figure 289 has a single reading frame with an apparent translation start site at nucleotide positions 79-81 and ending with a stop codon found at nucleotide positions 391-393 (Figure 289; SEQ ID NO: : 407). The predicted polypeptide precursor (FIG. 290, SEQ ID NO: 408) is 104 amino acids long and the signal peptide sequence is from about amino acid 1 to about amino acid 18. PRO1245 has a calculated molecular weight of about 10,100 daltons and an estimated pI of about 8.76.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , MTV044_4, AB011151_1, RLAJ2750_3, SNELIPTRA_1, S63624, C28391, A37907, and S14064 were revealed to some degree.
Clone DNA64888-1245 has been deposited with ATCC on August 25, 1998 and is assigned ATCC deposit no.

Example 131: Isolation of cDNA clones encoding human PRO1358 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed.
In light of the observed sequence homology between the consensus sequence and the EST sequence contained within Incyte EST clone no. 88718, Incyte EST clone 88718 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 291 and is herein designated as DNA64890-1612.
The full-length clone shown in FIG. 291 contains a single open reading frame with an apparent translation start site at nucleotide positions 86 to 88 and ending with a stop codon found at nucleotide positions 1418 to 1420 (FIG. 291; SEQ ID NO: : 409). The predicted polypeptide precursor (Figure 292, SEQ ID NO: 410) is 444 amino acids long. The signal peptide is at about amino acids 1-18 of SEQ ID NO: 410. PRO1358 has a calculated molecular weight of about 50,719 daltons and an estimated pI of about 8.82. Clone DNA64890-1612 was deposited with ATCC on August 18, 1998 and is assigned ATCC deposit number 203131.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , AB000546_1, A1AT_RAT, AB015164_1, P_P50021, COTR_CAVPO, and HAMHPP_1 were revealed. The variants described in the claims of this application exclude these sequences.

Example 132: Isolation of cDNA clones encoding human PRO1195 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA55716.
In light of the observed sequence homology between the DNA55716 consensus sequence and the EST sequence contained within Incyte EST clone number 3252980, the Incyte EST clone 3252980 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 293 and is herein designated as DNA65412-1523.
The full-length clone shown in FIG. 293 contains a single reading frame with an apparent translation start site at nucleotide positions 58-60 and ending with a stop codon found at nucleotide positions 511-513 (FIG. 293; SEQ ID NO: : 411). The predicted polypeptide precursor (Figure 294, SEQ ID NO: 412) is 151 amino acids long. The signal peptide is at about amino acids 1-22 of SEQ ID NO: 412. PRO1195 has a calculated molecular weight of about 17,277 daltons and an estimated pI of about 5.33. Clone DNA65412-1523 has been deposited with ATCC on August 4, 1998 and is assigned ATCC deposit no.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , P_W31186, CELK03C7_1, F69034, EF1A_METVA, AF024540_1, SSU90353_1, MRSP_STAAU and P_R97680 were revealed to some extent.

Example 133: Isolation of cDNA clones encoding human PRO1270 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA57951.
In light of the observed sequence homology between the DNA57951 consensus sequence and the EST sequence contained within Merck EST clone number 124878, Merck EST clone 124878 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 295 and is herein designated as DNA66308-1537.
Clone DNA66308-1537 contains a single open reading frame with an apparent translation start site at nucleotide positions 103-105 and ending with a stop codon at nucleotide positions 1042-1044 (FIG. 295). The predicted polypeptide precursor is 313 amino acids long (Figure 296). The full-length PRO1270 protein shown in FIG. 296 has an estimated molecular weight of about 34,978 daltons and a pI of about 5.71. Analysis of the full-length PRO1270 sequence shown in FIG. 296 (SEQ ID NO: 414) revealed that: a signal peptide from about amino acid 1 to about amino acid 16; a potential N-glycosylation site from about amino acid 163 to about 166 amino acid; The presence of glycosaminoglycan attachment sites from about amino acid 74 to about 77 amino acid and from about 289 amino acid to about 292 amino acid is demonstrated. Clone DNA66308-1537 was deposited with ATCC on August 25, 1998 and is assigned ATCC deposit number 203159.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using WU-BLAST2 sequence alignment analysis of the full-length sequence shown in FIG. 296 (SEQ ID NO: 414) revealed that the PRO1270 amino acid sequence and the following Dayhoff sequence: , FIBA_PARPA, FIBB_HUMAN, P_R47189, AF004326_1, DRTENASCN_1, AF004327_1, P_W01411 and FIBG_BOVIN were proved to be significant homology.

Example 134: Isolation of cDNA clone encoding human PRO1271 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is designated herein as DNA57955.
In light of the observed sequence homology between the DNA57955 consensus sequence and the EST sequence contained within Merck EST clone number AA625350, Merck EST clone AA625350 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 297 and is herein designated as DNA66309-1538.
Clone DNA66309-1538 contains a single open reading frame with an apparent translation start site at nucleotide positions 94-96 and ending with a stop codon at nucleotide positions 718-720 (FIG. 297). The predicted polypeptide precursor is 208 amino acids long (Figure 298). The full-length PRO1271 protein shown in FIG. 298 has an estimated molecular weight of about 21,531 daltons and a pI of about 8.99. Analysis of the full-length PRO1271 sequence shown in FIG. 298 (SEQ ID NO: 416) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 31 and a transmembrane domain from about amino acid 166 to about 187 amino acid . Clone DNA66309-1538 was deposited with ATCC on September 15, 1998 and is assigned ATCC deposit number 203235.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , AGA1_YEAST, BPU43599_1, YS8A_CAEEL, S67570, LSU54556_2, S70305, VGLX_HSVEB, and D88733_1 were proved.

Example 135: Isolation of cDNA clones encoding human PRO1375 Merck / Wash. U. A database was searched to identify the Merk EST. Then, Swiss-Prot public database this arrangement, public EST databases (e.g. GenBank, Merck / Wash. U.) and corporate EST database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and other sequences from the It was entered into a program that marshals it. The search was performed using the computer program BLAST or BLAST2 [Altshul et al., Methods in Enzymology 266: 460-480 (1996)] as a comparison of extracellular domain (ECD) protein sequence with 6-frame translation of the EST sequence. The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed.
A consensus DNA sequence was constructed against other EST sequences using phrap. This consensus sequence is designated herein as “DNA67003”.
A nucleic acid (SEQ ID NO: 417) was identified in a human pancreatic library based on the DNA67003 consensus sequence. Cloning DNA sequencing yielded a full-length DNA sequence for PRO1375 and a derived protein sequence for PRO1375.
The entire coding sequence of PRO1375 is shown in FIG. 299 (SEQ ID NO: 417). Clone DNA67004-1614 contains a single reading frame with an apparent translation start site at nucleotide positions 104-106 of SEQ ID NO: 417 and an apparent stop codon at nucleotide positions 698-700. The predicted polypeptide precursor is 198 amino acids long. The transmembrane domain is at amino acids about 11-28 (type II) and 103-125 of SEQ ID NO: 418. Clone DNA67004-1614 has been deposited with ATCC and is assigned ATCC deposit no. The full-length PRO1375 protein shown in FIG. 300 has an estimated molecular weight of about 22,531 daltons and a pI of about 8.47.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , S73465, Y011_MYCPN, S64538_1, P_P8150, MUVSHPO10_1, VSH_MUMPL and CVU59751_5 were revealed.

Example 136: Isolation of cDNA clones encoding human PRO1385 Use of the signal sequence algorithm described in Example 3 above allowed identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA57952.
In light of the observed sequence homology between the DNA57995 consensus sequence and the EST sequence contained within Incyte EST clone no. 3129630, Incyte EST clone 3129630 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 301 and is herein designated as DNA68889-1610.
Clone DNA68869-1610 has a single open reading frame with an apparent translation start site at nucleotide positions 26-28 and ending with a stop codon at nucleotide positions 410-412 (FIG. 301). The predicted polypeptide precursor is 128 amino acids long (Figure 302). The full-length PRO1385 protein shown in FIG. 302 has an estimated molecular weight of about 13,663 daltons and a pI of about 10.97. Analysis of the full-length PRO1385 sequence shown in FIG. 302 (SEQ ID NO: 420) shows that: a signal peptide from about amino acid 1 to about 28 amino acids, and about 82 to about 85 and about 91 to about 94 The existence of a glycosylaminoglycan attachment site is demonstrated. Clone DNA68869-1610 was deposited with ATCC on August 25, 1998 and is assigned ATCC deposit number 203164.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 302 (SEQ ID NO: 420) revealed that the PRO1385 amino acid sequence and the following Dayhoff sequences: , HXD9_HUMAN, CHKCMLF_1, HS5PP34_2, DMDRING_1, A37107_1, MMLUNGENE_1, PUM_DROME and DMU25117_1 proved low homology.

Example 137: Isolation of cDNA clones encoding human PRO1387 The use of the signal sequence algorithm described in Example 3 above allowed the identification of a single EST cluster sequence from the Incyte database. Then, the EST cluster sequence was compared public EST databases (e.g., GenBank) and corporate EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) different expressed sequence tags that contain a (EST), existing Homologues were identified. Homologue searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The comparisons that resulted in a BLAST score of 70 (or 90 in some cases) that did not encode a known protein were assembled and consensus DNA was run in the “phrap” program (Phil Green, University of Washington, Seattle, Washington). The sequence was constructed. The resulting consensus sequence is herein designated DNA56259.
In light of the observed sequence homology between the DNA56259 consensus sequence and the EST sequence contained within Incyte EST clone no. 3507924, Incyte EST clone 3507924 was purchased and the cDNA insert was obtained and sequenced. This insert was found to encode the full-length protein. The sequence of this cDNA insert is shown in FIG. 303 and is herein designated as DNA68872-1620.
Clone DNA68872-1620 contains a single open reading frame with an apparent translation start site at nucleotide positions 85-87 and ending with a stop codon at nucleotide positions 1267-1269 (FIG. 303). The predicted polypeptide precursor is 394 amino acids long (Figure 304). The full-length PRO1387 protein shown in FIG. 304 has an estimated molecular weight of about 44,339 daltons and a pI of about 7.10. Analysis of the full-length PRO1387 sequence shown in FIG. 304 (SEQ ID NO: 422) reveals that: a signal peptide from about amino acid 1 to about 19 amino acids, a transmembrane domain from about amino acid 275 to about 296 amino acids, about 76 amino acids from about amino acids About 79, potential N-glycosylation sites from about amino acid 231 to about 234, amino acid about 302 to about 305, amino acid about 307 to about 310 and amino acid about 376 to about 379, and about amino acid about 210 to amino acid The existence of an amino acid sequence block having homology with the myelin p0 protein of about 239 and about 92 to about 121 amino acids is demonstrated. Clone DNA68872-1620 was deposited with ATCC on August 25, 1998 and is assigned ATCC deposit number 203160.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. , HS46KDA_1, AF049498_1, MYO0_HUMAN, AF030454_1, A53268, SHPTCRA_1, P_W14146 and GEN12838 were proved.

Example 138: Isolation of cDNA clones encoding human PRO1384 Consensus DNA sequences were constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated DNA54192. Based on the DNA54192 consensus sequence, oligonucleotides for 1) identification of cDNA libraries containing sequences of interest by PCR and 2) use as probes to isolate clones of the full-length coding sequence for PRO1384 Was synthesized.
PCR primers (forward and reverse) were synthesized:
Forward PCR primer 5'-TGCAGCCCCTGTGACACAAACTGG-3 '(SEQ ID NO: 425)
Reverse PCR primer 5'-CTGAGATAACCGAGCCATCCTCCCAC-3 '(SEQ ID NO: 426)
In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence:
Hybridization probe
5'-GGAGATAGCTGCTATGGGTTCTTCAGGCACAACTTAACATGGGAAG-3 '(SEQ ID NO: 27)
From the DNA54192 sequence having
In order to screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO1384 gene using one of the probe oligonucleotides and PCR primers. RNA for construction of the cDNA library was isolated from human fetal liver.
DNA sequencing of the clone isolated as described above resulted in the full-length DNA sequence for PRO1384 (herein named DNA71159-1617 [Figure 305, SEQ ID NO: 423]) and the derived protein sequence for PRO1384. .
The entire coding sequence of PRO1384 is shown in FIG. 305 (SEQ ID NO: 423). Clone DNA71159-1617 contains a single reading frame with an apparent translation start site at nucleotide positions 182-184 and an apparent stop codon at nucleotide positions 869-871. The predicted polypeptide precursor is 229 amino acids long. The full-length PRO1384 protein shown in FIG. 306 has an estimated molecular weight of about 26,650 daltons and a pI of about 8.76. Additional features include a type II transmembrane domain of amino acids about 32-57 and potential N-glycosylation sites of amino acids about 68-71, 120-123, and 134-137.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. , AF009511_1, AB010710_1, GEN13595, HSAJ673_1, GEN13961, AB005900_1, LECH_CHICK, AF021349_1, and NK13_RAT were revealed.
Clone DNA71159-1617 has been deposited with ATCC and is assigned ATCC deposit no.

Example 139: Use of PRO as a hybridization probe The following method describes the use of a nucleic acid sequence encoding PRO as a hybridization probe.
The DNA containing the full-length or mature PRO coding sequence disclosed herein can be used for screening homologous DNAs (such as those encoding naturally occurring variants of PRO polypeptides) in human tissue cDNA libraries or human tissue genomic libraries. Used as a probe.
Hybridization and washing of the filter containing any library DNA was performed under the following high stringency conditions. Hybridization of the radiolabeled PRO-derived probe to the filter consisted of a solution of 50% formamide, 5x SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate. In, it was carried out at 42 ° C. for 20 hours. The filter was washed at 42 ° C. in an aqueous solution of 0.1 × SSC and 0.1% SDS.
The DNA having the desired sequence identity with the DNA encoding the full-length native sequence PRO can then be identified using standard methods known in the art.

Example 140: Expression of PRO in E. coli This example illustrates the preparation of the desired non-glycosylated form of PRO by recombinant expression in E. coli.
The DNA sequence encoding PRO was first amplified using selected PCR primers. The primer must have a restriction enzyme site corresponding to the restriction enzyme site of the selected expression vector. Various expression vectors are used. An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al., Gene, 2:95 (1977)), which contains genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzymes and dephosphorylated. The PCR amplified sequence is then ligated into a vector. The vector is preferably an antibiotic resistance gene, trp promoter, polyhis leader (including the first 6 STII codons, polyhis sequence, and enterokinase cleavage site), a specific PRO coding region, a lambda transcription termination region, and an argU gene including.
The ligation mixture is then used to transform selected E. coli using the method described in Sambrook et al., Supra. Transformants are identified by their ability to grow on LB plates and then antibiotic resistant clones are selected. Plasmid DNA is isolated and confirmed by restriction analysis and DNA sequence analysis.
Selected clones can be grown overnight in liquid media such as LB broth supplemented with antibiotics. The overnight medium is subsequently used for seeding the large-scale medium. The cells are then grown to optimal optical density, during which the expression promoter is activated.
After further incubation for several hours, the cells can be collected and centrifuged. Cell pellets obtained by centrifugation were solubilized using various reagents known in the art, and then the solubilized PRO protein was purified using metal chelation columns under tight protein binding conditions. .

PRO may be expressed in E. coli in poly-His tag form using the following procedure. DNA encoding PRO was first amplified using selected PCR primers. Primers provide restriction enzyme sites that correspond to the restriction enzyme sites of the selected expression vector, and efficient and reliable translation initiation, rapid purification with metal chelate columns, and proteolytic removal with enterokinase Includes other useful sequences. The PCR-amplified poly-His tag sequence was then ligated into an expression vector, which was used to transform an E. coli host based on strain 52 (W3110 fuhA (tonA) lon galE rpoHts (htpRts) cllpP (lacIq)). Transformants were initially treated with 3-5 O.D. with shaking at 30 ° C. in LB containing 50 mg / ml carbenicillin. D. Grow to 600. The medium was then CRAP medium (3.57 g (NH ₄ ) ₂ SO ₄ , 0.71 g sodium citrate 2H 2 O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g Shefield hycase SF in 500 mL water, and Diluted 100-100 times in 110 mM MPOS, pH 7.3, mixed with 0.55% (w / v) glucose and 7 mM MgSO ₄ ) and grown for about 20-30 hours with shaking at 30 ° C. . A sample was removed and expression was confirmed by SDS-PAGE, and the bulk medium was centrifuged to form a cell pellet. Cell pellets were frozen until purification and refolding.
E. coli paste from 0.5 to 1 L fermentation (6-10 g pellet) was resuspended in 10 volumes (w / v) in 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfate and sodium tetrathionate were added to final concentrations of 0.1 M and 0.02 M, respectively, and the solution was stirred at 4 ° C. overnight. This process resulted in a denatured protein with cysteine residues blocked by sulfite. The solution was concentrated in a Beckman Ultracentrifuge at 40,000 rpm for 30 minutes. The supernatant was diluted with 3-5 volumes of metal chelate column buffer (6M guanidine, 20 mM Tris, pH 7.4) and filtered through a 0.22 micron filter to clarify. The clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated with metal chelate column buffer. The column was washed with an addition buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. The protein concentration was estimated by its absorption at 280 nm using the extinction coefficient calculated based on its amino acid sequence.
Proteins by gradually diluting the sample in freshly prepared refolding buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA Was refolded. The refolding volume was chosen so that the final protein concentration was 50-100 microgram / ml. The refolding solution was stirred slowly at 4 ° C. for 12-36 hours. The refolding reaction was stopped by adding TFA at a collection concentration of 0.4% (pH of about 3). Prior to further purification of the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added at a final concentration of 2-10%. The refolded protein was chromatographed on a Poros R1 / H reverse phase column, eluting with a 0.1% TFA transfer buffer and a 10-80% acetonitrile gradient. Aliquots of fractions with A280 absorption were analyzed on SDS polyacrylamide gel and fractions containing homologous refolded proteins were pooled. In general, correctly refolded species of most proteins elute at the lowest concentration of acetonitrile because these species are the most compact and their hydrophobic inner surface is shielded from interaction with the reverse phase resin. Is done. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to removing the misfolded form of the protein from the desired form, the reverse phase process also removes endotoxin from the sample.
Fractions containing the desired folded PRO polypeptide were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. The protein was prepared to 20 mM Hepes, pH 6.8 containing 0.14 M sodium chloride and 4% mannitol by gel filtration and sterile filtration on G25 Superfine (Pharmacia) resin equilibrated with dialysis or preparation buffer.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.

Example 141: Expression of PRO polypeptides in mammalian cells This example illustrates the preparation of a glycosylated form of PRO by recombinant expression in mammalian cells.
PRK5 (see EP 307,247 issued on March 15, 1989) was used as an expression vector. In some cases, PRODNA is ligated to pRK5 with a selected restriction enzyme and PRODNA is inserted using a ligation method as described in Sambrook et al., Supra. The resulting vector is called pRK5-PRO.
In one embodiment, the selected host cell can be a 293 cell. Human 293 cells (ATCC CCL 1573) were grown and confluent in tissue culture plates in media such as DMEM supplemented with fetal bovine serum and optionally nourishing ingredients and / or antibiotics. About 10 μg of pRK5-PRO polypeptide DNA is mixed with about 1 μg of VA RNA gene-encoding DNA [Thimmappaya et al., Cell, 31: 543 (1982))] and 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227M CaCl ₂ Dissolved in. To this mixture, 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ was added dropwise and a precipitate formed at 25 ° C. for 10 minutes. The precipitate was suspended, added to 293 cells and allowed to settle at 37 ° C. for about 4 hours. The culture medium was aspirated and 2 ml of 20% glycerol in PBS was added for 30 seconds. The 293 cells were then washed with serum free medium, fresh medium was added and the cells were incubated for about 5 days.
Approximately 24 hours after transfection, the culture medium was removed and replaced with culture medium (only) or culture medium containing 200 μCi / ml ³⁵ S-cysteine and 200 μCi / ml ³⁵ S-methionine. After 12 hours of incubation, the conditioned medium was collected, concentrated with a spin filter and added to a 15% SDS gel. The treated gel was dried and exposed to the film for a selected time revealing the presence of PRO polypeptide. The medium containing the transformed cells was further incubated (in serum-free medium) and the medium was tested in the selected bioassay.
In an alternative technique, PRO is transiently introduced into 293 cells using the dextran sulfate method described in Somparyac et al., Proc. Natl. Acad. Sci., 12: 7575 (1981). 293 cells are grown to maximal density in a spinner flask and 700 μg pRK5-PRODNA is added. The cells were first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate was incubated on the cell pellet for 4 hours. Cells were treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and reintroduced into a spinner flask containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days, the conditioned medium was centrifuged and filtered to remove cells and cell debris. The sample containing the expressed PRO was then concentrated and purified by selected methods such as dialysis and / or column chromatography.
In other embodiments, PRO can be expressed in CHO cells. The pRK5-PRO can be transfected into CHO cells using known reagents such as CaPO ₄ or DEAE- dextran. As described above, the cell culture medium can be incubated and the culture medium can be replaced with culture medium (only) or a medium containing a radioactive label such as ³⁵ S-methionine. After identifying the presence of the PRO polypeptide, the culture medium may be replaced with serum-free medium. Preferably, the medium is incubated for about 6 days and then the conditioned medium is collected. The medium containing the expressed PRO can then be concentrated and purified for the selected method.
In addition, the epitope tag PRO may be expressed in the host CHO cell. PRO was subcloned from the pRK5 vector. The subclone insert can then be subjected to PCR and fused to a frame with a selected epitope tag, such as a poly-his tag in a baculovirus expression vector. The poly-his tagged PRO insert can then be subcloned into an SV40 derived vector containing a selectable marker such as DHFR for selection of stable clones. Finally, CHO cells were transfected with the SV40 derived vector (as described above). To confirm expression, labeling may be performed as described above. The culture medium containing the expressed poly-his tag PRO can then be concentrated and purified by selected methods such as Ni ²⁺ -chelate affinity chromatography.
Moreover, PRO may be expressed in CHO and / or COS cells by a transient expression method, and in CHO cells by another stable expression method.

Stable expression in CHO cells was performed using the following method. The protein is an IgG construct in which the coding sequence (eg, extracellular domain) in the solubilized and / or poly-His tag form of the corresponding protein is fused to a constant region sequence comprising the hinge, CH2, and CH2 domains of IgG1. (Immunoadhesin) or expressed as a poly-His tag form.
Following PCR amplification, the corresponding DNA was subcloned into a CHO expression vector using standard techniques as described in Ausubel et al., Current Protocols of Molecular Biology, Unit 3.26, John Wiley and Sons (1997). The CHO expression vector has restriction sites compatible with 5 ′ and 3 ′ of the DNA of interest and is constructed so that the cDNA can be conveniently shuttled. The vector was expressed in CHO cells as described in Lucas et al., Nucl. Acids res. 24: 9, 1774-1779 (1996) and used to express the cDNA of interest and the expression of dihydrofolate reductase (DHFR). The SV40 early promoter / enhancer is used for control. DHFR expression allows selection for stable maintenance of the plasmid following transfection.
Twelve micrograms of the desired plasmid DNA was introduced into approximately 10 million CHO cells of the commercially available transfection reagents Superfect® (Quiagen), Dosper® and Fugene® (Boehringer Mannheim). Cells were grown as described in Lucas et al. Approximately 3 × 10 ⁻⁷ cells were frozen in ampoules for further growth and production as described below.
An ampoule containing the plasmid DNA was placed in a water bath, thawed, and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mL of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated and the cells were suspended in 10 mL selective medium (0.2 μm filtered PS20, 5% 0.2 μm diafiltered fetal bovine serum added). Cells were then divided into 100 ml spinners containing 90 mL selection medium 1-2 days later, cells were transferred to a 250 mL spinner filled with 150 mL selection medium and incubated at 37 ° C. After a further 2-3 days, 250 mL, 500 mL and 2000 mL spinners were seeded at 3 × 10 ⁵ cells / mL. The cell medium was replaced with fresh medium by centrifugation and resuspended in production medium. Any suitable CHO medium may be used, but in practice the production medium described in US Pat. No. 5,122,469 issued June 16, 1992 was used. A 3 L production spinner was seeded at 1.2 × 10 ⁶ cells / mL. On day 0, cell number and pH were measured. On the first day, the spinner was sampled and sprayed with filtered air. On the second day, sample the spinner, change the temperature to 33 ° C, and add 500 g / L glucose and 30 mL of 0.6 mL of 10% antifoam (eg 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion) did. Throughout production, the pH was adjusted and maintained near 7.2. Cell medium was collected by centrifugation after 10 days or until viability was below 70% and filtered through a 0.22 μm filter. The filtrate was stored at 4 ° C. or immediately loaded onto a purification column.

For the poly-His tag construct, the protein was purified using a Ni-NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM. The conditioned medium was pumped at 4 ° C at a flow rate of 4-5 ml / min onto a 6 ml Ni-NTA column equilibrated with 20 mM Hepes, pH 7.4 buffer containing 0.3 M NaCl and 5 mM imidazole. After loading, the column was further washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted with 25 ml G25 Superfine (Pharmacia) in storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol and stored at −80 ° C.
Immunoadhesin (Fc-containing) constructs were purified from conditioned media as follows. The conditioned medium was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions into a tube containing 275 μl of 1M Tris buffer, pH 9. The highly purified protein was subsequently desalted in the storage buffer described above for the poly-His tag protein. Homogeneity was tested on SDS polyacrylamide gel and N-terminal amino acid sequence determined by Edman degradation.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.

Example 142: Expression of PRO in yeast The following method describes recombinant expression of PRO in yeast.
First, a yeast expression vector is produced for intracellular production or secretion of PRO from the ADH2 / GAPDH promoter. DNA encoding PRO and a promoter are inserted into appropriate restriction enzyme sites of the selected plasmid to direct intracellular expression of PRO. For selection of plasmids that encode DNA encoding PRO for secretion, DNA encoding the ADH2 / GAPDH promoter, native PRO signal peptide or other mammalian signal peptide, or yeast alpha factor secretion signal / leader sequence, for example, And (if necessary) can be cloned with a linker sequence for expression of PRO.
Yeast strains such as yeast strain AB110 can then be transformed with the above expression plasmid and cultured in the selected fermentation medium. Transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gel with Coomassie blue staining.
The recombinant PRO can then be isolated and purified by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using a selected cartridge filter. The concentrate containing PRO may be further purified using a selected column chromatography resin.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.

Example 143: Expression of PRO in baculovirus infected insect cells The following method describes recombinant expression of PRO in baculovirus infected insect cells.
The PRO-encoding sequence was fused upstream of an epitope tag contained in a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (such as the Fc region of IgG). Various plasmids can be used, including plasmids derived from commercially available plasmids such as pVL1393 (Navogen). Briefly, 5 'and 3' regions include PRO or a predetermined portion of a PRO coding sequence, such as a sequence encoding the extracellular domain of a transmembrane protein or a sequence encoding a mature protein when the protein is extracellular. Amplified by PCR with primers complementary to. The 5 ′ primer may include flanking (selected) restriction enzyme sites. The product is then digested with selected restriction enzymes and subcloned into an expression vector.
Recombinant baculovirus is obtained by co-transfecting the above plasmid and BaculoGold (trade name) viral DNA (Pharmingen) into Lipofectin (commercially available from GIBCO-BRL) in Spodoptera frugiperda (“Sf9”) cells (ATCC CRL 1711). Created by populating. After incubation at 28 ° C. for 4-5 days, the released virus was collected and used for further amplification. Viral infection and protein expression were performed as described in O'Reilley et al., Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford University Press (1994).
The expressed poly-his tag PRO is then purified, for example, by Ni ²⁺ -chelate affinity chromatography as follows. Extracts were prepared from virus-infected recombinant Sf9 cells as described in Rupert et al., Nature, 362: 175-179 (1993). Briefly, Sf9 cells were washed and sonicated buffer (25 mM Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M KCl) Resuspended in and sonicated twice on ice for 20 seconds. The sonicated product was clarified by centrifugation, and the supernatant was diluted 50-fold with a loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. A Ni ²⁺ -NTA agarose column (commercially available from Qiagen) was prepared with a total volume of 5 mL, washed with 25 mL water, and equilibrated with 25 mL loading buffer. The filtered cell extract was loaded onto the column at 0.5 mL per minute. The column was washed with loading buffer to A ₂₈₀ baseline where fraction collection began. The column was then washed with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0) that elutes nonspecifically bound protein. After reaching A ₂₈₀ baseline again, the column was developed with a 0 to 500 mM imidazole gradient in the secondary wash buffer. 1 mL fractions were collected and analyzed by SDS-PAGE and silver staining or Western blot with Ni ²⁺ -NTA conjugated to alkaline phosphatase (Qiagen). Fractions containing the eluted His ₁₀ -tagged PRO were pooled and dialyzed against loading buffer.
Alternatively, purification of IgG tag (or Fc tag) PRO can be performed using known chromatographic techniques including, for example, protein A or protein G column chromatography.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.

Example 144: Preparation of antibodies that bind to PRO This example illustrates the preparation of monoclonal antibodies that can specifically bind to PRO.
Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be used include purified PRO, fusion proteins comprising PRO, cells expressing recombinant PRO on the cell surface. The selection of the immunogen can be made without undue experimentation by one skilled in the art.
Mice such as Balb / c are immunized with PRO immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally at 1-100 micrograms. Alternatively, the immunogen may be emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the animal's hind footpad. Immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. Thereafter, for several weeks, the mice are boosted with additional immunization injections. Serum samples from retroorbital hemorrhage may be taken periodically from mice for testing in an ELISA assay for detection of anti-PRO antibodies.
After a suitable antibody titer has been detected, animals “positive” for antibodies can be given a final infusion of PRO intravenous injection. Three to four days later, the mice were sacrificed and the spleen was removed. The spleen cells were then (using 35% polyethylene glycol), P3X63AgU. Fused to 1st selected mouse myeloma cell line. Hybridoma cells were generated by fusion and then plated on 96-well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit the growth of unfused cells, myeloma hybrids, and spleen cell hybrids.
Hybridoma cells are screened by ELISA for reactivity to PRO. The determination of “positive” hybridoma cells that secrete monoclonal antibodies to PRO is within the common general knowledge.
Positive hybridoma cells are injected intraperitoneally into syngeneic Balb / c mice to produce ascites containing anti-PRO monoclonal antibodies. Alternatively, hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of monoclonal antibodies produced in ascites can be performed using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the affinity of antibody for protein A or protein G can also be used.

Example 145: Purification of PRO polypeptides using specific antibodies Natural or recombinant PRO polypeptides can be purified by various standard protein purification methods in the art. For example, pro-PRO polypeptide, mature polypeptide, or pre-PRO polypeptide is purified by immunoaffinity chromatography using an antibody specific for the PRO polypeptide of interest. In general, an immunoaffinity column is made by covalently coupling an anti-PRO polypeptide antibody to an activated chromatography resin.
Polyclonal immunoglobulins are prepared from immune sera either by precipitation with ammonium sulfate or purification with immobilized protein A (Pharmacia LKB Biotechnology, Piscataway, NJ). Similarly, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography with immobilized protein A. The partially purified immunoglobulin is covalently bound to a chromatographic resin such as CnBr-activated Sepharose (trade name) (Pharmacia LKB Biotechnology). The antibody is bound to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions.
Such immunoaffinity columns are utilized in the purification of PRO polypeptides by preparing fractions from cells containing solubilized forms of PRO polypeptides. This preparation is derived by solubilization of whole cells or cell component fractions obtained via addition of detergents or differential centrifugation by methods known in the art. Alternatively, solubilized PRO polypeptide comprising a signal sequence is secreted in an oily amount into the medium in which the cells grow.
The solubilized PRO polypeptide-containing preparation is passed through an immunoaffinity column and the column is washed under conditions that allow preferred adsorption of the PRO polypeptide (eg, a high ionic strength buffer in the presence of a detergent). The column is then eluted under conditions that degrade antibody / PRO polypeptide binding (eg, a low pH such as about 2-3, a high concentration of urea or a chaotrope such as thiocyanate ion), and the PRO polypeptide is recovered. .

Example 146: Drug Screening The present invention is particularly useful for screening compounds by using PRO polypeptides or binding fragments thereof in various drug screening techniques. The PRO polypeptide or fragment used in such a test may be free in solution, immobilized on a solid support, located on the cell surface, or localized within the cell. One method of drug screening utilizes eukaryotic or prokaryotic host cells that are stably transfected with recombinant nucleic acids expressing the PRO polypeptide or fragment. Agents are screened against such transfected cells in a competitive binding assay. Such cells can be used in standard binding assays in either viable or immobilized form. For example, complex formation may be measured between the PRO polypeptide or fragment and the reagent being tested. Alternatively, the reduction in complex formation between the PRO polypeptide and its target cells caused by the reagent being tested can be tested.
Thus, the present invention provides methods for screening for drugs or any other reagent that can affect a PRO polypeptide-related disease or disorder. These methods involve contacting the reagent with a PRO polypeptide or fragment and (I) for the presence of a complex between the reagent and the PRO polypeptide or fragment, or (ii) between the PRO polypeptide or fragment and the cell. Testing for the presence of a complex between. In these competitive binding assays, the PRO polypeptide or fragment is typically labeled. After appropriate incubation, free PRO polypeptide or fragments are separated from those in bound form, and the amount of free or uncomplexed label determines whether a particular reagent binds to the PRO polypeptide or PRO polypeptide / cell complex. It is a measure of the ability to inhibit
Other techniques for drug screening provide high-throughput screening for compounds with appropriate binding affinity for polypeptides and are described in detail in WO 84/03564 issued September 13, 1984. Has been. Briefly, a number of different small peptide test compounds are synthesized on a solid support such as plastic pins or some other surface. When applied to a PRO polypeptide, the peptide test compound reacts with the PRO polypeptide and is washed. Bound PRO polypeptide is detected by methods well known in the art. Purified PRO polypeptide can also be coated directly onto plates for use in the drug screening techniques described above. Furthermore, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
The present invention also contemplates competitive drug screening assays in which neutralizing antibodies capable of binding to the PRO polypeptide specifically compete with the test compound for the PRO polypeptide or fragment thereof. In this method, the antibody can be used to detect the presence of any peptide with one or more antigenic determinants in the PRO polypeptide.

Example 147: Rational Drug Design The purpose of rational drug design is the structure of a biologically active polypeptide of interest (eg, PRO polypeptide) or a small molecule with which they interact, such as an agonist, antagonist, or inhibitor Is to produce a similar analog. These examples can be used to create more active and stable forms of the PRO polypeptide or drugs that promote or inhibit the function of the PRO polypeptide in vivo (see Hodgson, Bio / Technology, 9: 19-21 (1991 )).
In one method, the three-dimensional structure of a PRO polypeptide, or PRO polypeptide-inhibitor complex, is determined by x-ray crystallography, by computer modeling, most typically by a combination of the two methods. In order to elucidate the structure of the molecule and determine the active site, both the shape and charge of the PRO polypeptide must be confirmed. Less often, useful information regarding the structure of the PRO polypeptide may be obtained by modeling based on the structure of homologous proteins. In both cases, relevant structural information is used in the design of similar PRO polypeptide-like molecules or the identification of inhibitors to go. Useful examples of rational drug design are molecules with improved activity or stability as shown in Braxton and Wells, Biochemistry, 31: 7796-7801 (1992), or Athauda et al., J. Biochem. , 113: 742-746 (1993), including molecules that act as inhibitors, agonists or antagonists of natural peptides.
It is also possible to isolate a target-specific antibody selected by the functional assay as described above and elucidate its crystal structure. This method in principle produces a pharmacore on which subsequent drug design can be based. By generating anti-idiotype antibodies (anti-ids) against functional pharmacologically active antibodies, protein crystallography can be bypassed. As a mirror image of the mirror image, the anti-ids binding site can be predicted to be an analog of the original receptor. The anti-id can then be used to identify and isolate the peptide from a bank of chemically or biologically produced peptides. The isolated peptide will function as a pharmacore.
In accordance with the present invention, sufficient amounts of PRO polypeptides are available to perform analytical experiments such as X-ray crystallography. Further, the PRO polypeptide amino acid sequence knowledge provided herein provides knowledge used in computer modeling techniques to replace or add to x-ray crystallography.

Example 148: Stimulation of cardiac neonatal hypertrophy (Assay 1)
This assay is designed to measure the ability of PRO polypeptides to stimulate neonatal heart hypertrophy. PRO polypeptides that test positive in this assay are expected to be available for therapeutic treatment of various heart failure disorders.
Myocytes were obtained from 1 day old Harlan Sprague Dawley rats. Cells (180 μl at 7.5 × 10 ⁴ / ml, serum <0.1%, freshly isolated) were added on day 1 to 96 well plates pre-coated with DMEM / F12 + 4% FCS. Test samples (20 μL / well) containing test PRO polypeptide or growth medium alone (negative control) were added directly to wells on day 1. PGF (20 μL / well) is then added to a final concentration of 10 ⁻⁶ M on the second day. Cells are then stained on day 4 and scored visually on day 5, where cells that do not increase in size (compared to the negative control) are scored 0.0, indicating a small to moderate increase in size. Cells shown (compared to the negative control) are scored 1.0 and cells that showed a larger increase in size (compared to the negative control) are scored 2.0. A positive result in this assay is a score of 1.0 or higher.
The following polypeptides were tested positive in this assay: PRO1312

Example 149: Stimulation of endothelial cell proliferation (Assay 8)
This assay is designed to determine whether a PRO polypeptide of the invention exhibits the ability to stimulate adrenocortical capillary endothelial cell (ACE) growth. Polypeptides tested positive in this assay include, for example, wound healing, and the like, and are expected to be useful in the therapeutic treatment of conditions and diseases where angiogenesis is beneficial (these PRO polypeptides). Like peptide agonists). PRO polypeptide antagonists tested positive in this assay are expected to be useful for therapeutic treatment of cancerous tumors.
Bovine adrenal cortex capillary endothelial (ACE) cells (from primary cultures, up to 12-14 passages) were plated at 500 cells / well per 100 microliters in 96 well plates. The assay medium includes low glucose DMEM, 10% calf serum, 2 mM glutamine, and 1 × penicillin / streptomycin / fungizone. Control wells include: (1) no ACE cells added; (2) ACE cells only; (3) ACE cells + VEGF (5 ng / ml); and (4) ACE cells + FGF (5 ng / ml). Control and test samples (100 microliter volume) were then added to the wells (1%, 0.1% and 0.01% dilutions, respectively). Cell culture medium was incubated at 37 ° C./5% CO ₂ for 6-7 days. After incubation, the medium in the wells was aspirated and the cells were washed 1x with PBS. The acid phosphatase reaction mixture (100 microliters, 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate) was then added to each well. After 2 hours incubation at 37 ° C., the reaction was stopped by the addition of 10 microliters 1N NaOH. The optical density (OD) was measured with a microtiter plate at 405 nm.
The activity of the PRO polypeptide was calculated as the fold increase in proliferation (acid phosphatase activity, measured at OD 405 nm) against (1) cell-only background and (2) maximal stimulation with VEGF. VEGF (3-10 ng / ml) and FGF (1-5 ng / ml) were used as criteria for activity against maximal stimulation. The results of the assay were considered “positive” when the observed stimulus was increased by ≧ 50% over background. The VEGF (5 ng / ml) control gave 1.24 times stimulation at 1% dilution; the FGB (5 ng / ml) control gave 1.46 times stimulation at 1% dilution.
The following test polypeptides were positive in this assay: PRO1154 and PRO1186.

Example 150: Ability of PRO polypeptides to inhibit proliferation of vascular endothelial growth factor (VEGF) stimulated endothelial cell growth (Assay 9)
The ability of various PRO polypeptides to inhibit the proliferation of endothelial cells stimulated by VEGF was tested. A positive polypeptide test in this assay is useful for inhibiting mammalian endothelial cells, and such effects are beneficial, such as inhibiting tumor growth.
In particular, bovine adrenal cortical capillary endothelial (ACE) cells (from primary medium up to 12-14 passages) were seeded in 96-well 100 microtiter plates at 500 cells / well. The assay medium contains low glucose DMEM, 10% bovine serum, 2 mM glutamine, 1 × penicillin / streptomycin / fungizone. Control wells include: (1) ACE cells not added; (2) ACE cells alone; (3) ACE cells plus 5 ng / ml FGF; (4) ACE cells plus 3 ng / ml VEGF; (5) ACE cells plus 3 ng / ml VEGF plus 1 ng / ml TGF-beta; and (6) ACE cells plus 3 ng / ml VEGF plus 5 ng / ml LIF. The test sample poly-his tagged PRO polypeptide (in 100 microtiter volume) was then added to the wells (diluted to 1%, 0.1% and 0.001%, respectively). Cells were incubated 6-7 days at 37 ° C. / 5% of CO _2. After incubation, the well medium was aspirated and the cells were washed with 1 × PBS. Acid phosphatase reaction mixture (100 microtiter, 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate) was added to each well. After 2 hours incubation at 37 ° C., the reaction was stopped by the addition of 10 microtiter 1N NaOH. Optical density (OD) was measured at 405 nm with a microplate reader.
PRO polypeptide activity was calculated as the percent inhibition (determined by measuring acid phosphatase activity at OD 405 nm) of VEGF (3 ng / ml) stimulated proliferation relative to unstimulated cells. TGF-β blocked VEGF-stimulated ACE cell proliferation by 70-90% and was used as an activity reference at 1 ng / ml. The results indicate the usefulness of PRO polypeptides in cancer therapy, particularly in inhibiting tumor angiogenesis. The numerical value (relative inhibition) calculates the percent inhibition of VEGF-stimulated proliferation by PRO polypeptide relative to unstimulated cells, and then TGF-β at a concentration of 1 ng / ml prevents VEGF-stimulated cell proliferation by 70-90%. It is determined by dividing the percent inhibition obtained with known percentages. The result is considered positive when the PRO polypeptide inhibits VEGF stimulation of endothelial cell growth by 30% or more (relative inhibition of 30% or more).
The following test polypeptide was positive in this assay: PRO812.

Example 151: Stimulatory activity in a mixed lymphocyte reaction (MLR) assay (Assay 24)
This example shows that certain peptides of the invention are active as stimulators of stimulated T-lymphocyte proliferation. Compounds that stimulate lymphocyte proliferation are useful therapeutically where an enhanced immune response is beneficial. The therapeutic agent takes the form of an antagonist of the polypeptide of the invention, for example, a mouse-human chimera, humanized or human antibody against the polypeptide.
The basic protocol for this assay is published in Current Protocols in Immunology, unit 3.12; published by JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W Strober, National Institutes of Health, John Wiley & Sons, Inc. Yes.
More specifically, in one variation of this assay, peripheral blood mononuclear cells (PBMC) are isolated from individual mammals, eg, human volunteers, by leucopheresis (a single donor is provided with a stimulator PBMC). And responder PBMC to other donors). If desired, after isolation, the cells are frozen in fetal calf serum and DMSO. Frozen cells are thawed overnight in assay medium (37 ° C., 5% CO ₂ ), then washed, assay medium (RPMI; 10% fetal calf serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES , 1% non-essential amino acids, 1% pyruvate) at 3 × 10 ⁶ cells / ml. The stimulator PBMC is prepared by exposing the cells to light (approximately 3000 rads).
This assay is a mixture:
Test sample diluted to 1% or 0.1% of 100: 1,
Stimulator cells exposed to 50: 1 light, and
50: 1 responder PBMC cells,
Prepared in a triple well. 100 microtiter cell culture medium or 100 microtiter CD4-IgG is used as a control. The wells are then incubated for 4 days at 37 ° C., 5% CO ₂ . On day 5, apply tritiated thymidine (1.0 mC / well; Amersham) to each well. After 6 hours, the cells are washed three times, and then label incorporation is evaluated.
In another variation of this assay, PBMC are isolated from the spleens of Balb / c and C57B6 mice. Cells are microscopically examined from freshly collected spleens in assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acids, 1% pyruvate) PMBCs are isolated by finely chopping them and overlaying these cells on Lympholyte M (Organon Teknika), centrifuged at 2000 rpm for 20 minutes, collected, and mononuclear cell layer in assay medium And resuspend the cells in assay medium to 1 × 10 ⁷ cells / ml. The assay is then performed as described above.
An increase relative to the control is considered positive, preferably an increase of 180% or more or equivalent to 180%. However, all values greater than the control indicate a stimulating effect for the test protein.
The following test polypeptides were positive in this assay: PRO826, PRO1068, PRO1184, PRO1346 and PRO1375.

Example 152: Retinal neuron survival (Assay 52)
This example shows that various PRO polypeptides have efficacy in promoting the survival of retinal neuronal cells, and therefore, retinal diseases or injuries involving the treatment of mammalian vision loss due to, for example, retinitis pigmentosa, AMD, etc. It is useful for the therapeutic treatment of
Day 7 SD rat fetuses (mixed population: glial and retinal neuronal types) were sacrificed by decapitation following CO ₂ anesthesia and eyes were removed under aseptic conditions. The neural retina was excised from the pigment epithelium and other ocular tissues were dissociated into single cell suspensions using 0.25% trypsin in PBS without Ca ²⁺ , Mg ²⁺ . The retina was incubated at 37 ° C. for 7-10 minutes, after which trypsin was inactivated by adding 1 ml of soybean trypsin inhibitor. Cells were seeded at 100,000 cells per well in 96-well plates in DMEM / F12 with or without N2 and specific test PRO polypeptide. For all experiments, cells were grown at 37 ° C. in a water saturated atmosphere of 5% CO ₂ . Cells were stained with calcein AM after 2-3 days in medium, then fixed with 4% paraformaldehyde and stained with DAPI for determination of total cell count. Total cells (fluorescence) were quantified at 20X objective magnification using a CCD camera and NIH image software for MacIntosh. The field of view of the well was chosen at random.
The effect of various concentrations of the PRO polypeptide was calculated by dividing the total number of calcein AM positive cells in 2-3 days in the medium by the total number of DAPI-labeled cells in the 2-3 days in the medium. Survival over 30% is considered positive.
The following PRO polypeptides were positive in this assay using polypeptide concentrations ranging from 0.01% -1.0%: PRO828, PRO826, PRO1068 and PRO1132.

Example 153: Survival of rod photoreceptor cells (Assay 56)
This assay acts to increase the survival / proliferation of rod photoreceptor cells of a given polypeptide of the present invention, and thus includes treatment of mammalian vision loss due to, for example, retinitis pigmentosa, AMD, etc. It is useful for therapeutic treatment of disease or injury.
Day 7 Sprague Dawley rat fetuses (mixed population: glial and retinal neuronal cell types) were sacrificed by decapitation following CO ₂ anesthesia and eyes were removed under aseptic conditions. The neural retina was excised from the pigment epithelium and other ocular tissues and then dissociated into single cell suspensions using 0.25% trypsin in PBS without Ca ²⁺ , Mg ²⁺ . The retina was incubated at 37 ° C. for 7-10 minutes, after which trypsin was inactivated by adding 1 ml of soybean trypsin inhibitor. Cells in DMEM / F12 supplemented with N _2, were plated at 100,000 cells per well in 96-well plates. For all experiments, cells were grown at 37 ° C. in a water saturated atmosphere of 5% CO ₂ . After 2-3 days in medium, cells were fixed with 4% paraformaldehyde and then stained with Cell Tracker Green CMFDA. Rho 4D2 (ascites or IgG1: 100), a monoclonal antibody against the visible dye rhodopsin, was used for detection of rod photoreceptors by indirect immunofluorescence. Results are calculated as% survival: total number of calcein-rhodopsin positive cells in 2-3 days in medium divided by total number of calcein-rhodopsin positive cells in 2-3 days in medium. Total cells (fluorescence) were quantified at 20X objective magnification using a CCD camera and NIH image software for MacIntosh. The field of view of the well was chosen at random.
The following test polypeptides were positive in this assay: PRO536, PRO943, PRO828, PRO826, PRO1068 and PRO1132.

Example 154: Induction of c-fos in endothelial cells (Assay 34)
This assay is designed to determine whether a PRO polypeptide exhibits the ability to induce c-fos in endothelial cells. PRO polypeptides tested positive in this assay are useful for therapeutic treatment of symptoms and diseases, such as angiogenesis, such as wound healing, and the like (such as agonists of these PRO polypeptides) It is useful for those containing. PRO polypeptides that test positive in this assay are expected to be useful for therapeutic treatment of cancerous tumors.
Growth medium (50% Ham F12w / oGHT: low glucose, and without glycine _{50% DMEM: NaHCO 3, 1} % glutamine, 10 mM of HEPES, 10 percent FBS, 10 ng / ml of bFGF) Human venous umbilical in Venous endothelial cells (HUVEC, Cell Systems) were plated in 96-well macrotiter plates at a cell density of 1 × 10 ⁴ cells / well. The day after plating, the growth medium is removed and the cells are removed with 100 μl / well test sample and control (positive control: growth medium; negative control: 10 mM HEPES, 140 mM NaCl, 4% (w / v) mannitol, pH 6 Cells were starved by treatment in .8). Cells were incubated for 30 minutes at 37 ° C. in 5% CO ₂ . The sample was removed and the first part of the bDNA kit protocol (Chiron Diagnostics, cat. # 6005-037) was followed. Here, each capitalized reagent / buffer below was available from the kit.
Briefly, the amount of TM Lysis Buffer and probe required for the test was calculated based on the information provided by the manufacturer. An appropriate amount of thawing probe was added to the TM lysis buffer. The Capture Hybridization Buffer was warmed to room temperature. bDNA strips were set up in a metal strip holder and 100 μl of capture hybridization buffer was added to each required b-DNA well and incubated for at least 30 minutes. The intracellular test plate was removed from the incubator and the medium was gently removed using a vacuum manifold. Lysis hybridization buffer with 100 μl of probe to each well of the microtiter plate was quickly pipetted into each b-DNA well. The plate was then incubated for 15 minutes at 55 ° C. Remove the plate from the incubator, place the plate on a vortex mixer equipped with a microtiter adapter head, and vortex for 1 minute at the # 2 setting. 80 μl of the lysate was removed, added to the bDNA well containing the capture hybridization buffer, and mixed by pipetting up and down. Plates were incubated at 53 ° C. for at least 16 hours.
The next day, the second part of the bDNA kit protocol was followed. That is, the plate was removed from the incubator, placed on the bench and allowed to cool for 10 minutes. The required volume of addition was calculated based on the information applied by the manufacturer. An amplifier working solution was prepared by making an amplifier concentrate (20 fm / μl) at a dilution of 1: 100 in AL hybridization buffer. The hybridization mixture was washed twice with Wash A. 50 μl of amplifier working solution was added to each well and the wells were incubated at 53 ° C. for 30 minutes. The plate was then removed from the incubator and cooled for 10 minutes. A labeled probe working solution was prepared by making a labeled concentrate (40 pmoles / μl) at a dilution of 1: 100 in AL hybridization buffer. After a 10 minute cooling period, the amplifier hybridization mixture was removed and the plate was washed twice with detergent A. 50 μl of labeled probe working solution was added to each well and the wells were incubated at 53 ° C. for 15 minutes. After 10 minutes of cooling, the substrate was warmed to room temperature. 3 μl of substrate enhancer was added to each mole of substrate required for the assay, the plate was cooled for 10 minutes, the labeled hybridization mixture was removed, and the plate was washed 2 times with Wash A and 3 times with Wash D. Substrate solution with 50 μl enhancer was added to each well. Plates were incubated at 37 ° C. for 30 minutes and RLU was read with an appropriate luminometer.
Replicates were averaged to determine the coefficient of variation. Measurement of activity in fold increments relative to negative control (HEPES buffer described above) values was indicated by chemiluminescence units (RLU). The results are shown in Table 9 below, and samples showing at least twice the negative control value were considered positive. Negative control = 1.00 RLU at 1.00% dilution. Positive control = 8.39 RLU at 1.00% dilution.
The following polypeptides were tested positive in this assay: PRO535, PRO826, PRO819, PRO1126, PRO1160 and PRO1387.

Example 155: Inhibitory activity assay in mixed lymphocyte reaction (MLR) (Assay 67)
This example demonstrates that one or more polypeptides of the invention are active as growth inhibitors of stimulated T lymphocytes. Compounds that inhibit lymphocyte proliferation are useful in treatments where suppression of the immune response is preferred.
The basic protocol for this assay is described in Current Protocols published by Immunology, unit 3.12; JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W Strober, National Institutes of Health, John Wiley & Sons, Inc. Yes.
In addition, in one variation of this assay, peripheral blood mononuclear cells (PBMC) are isolated from individual mammals, eg, human volunteers, by leucopheresis (one donor is provided with the stimulator PBMC, the other Donor will be provided with responder PBMC). If desired, after isolation, the cells are frozen in fetal calf serum and DMSO. Frozen cells are thawed overnight in assay medium (37 ° C., 5% CO ₂ ), then washed, assay medium (RPMI; 10% fetal calf serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES , 1% non-essential amino acids, 1% pyruvate) to 3 × 10 ⁶ cells / ml. The stimulant PBMC is prepared by exposing the cells to light (approximately 3000 rads).
This assay is a mixture:
Test sample diluted to 1% or 0.1% of 100: 1,
Stimulator cells exposed to 50: 1 light, and
50: 1 responder PBMC cells,
Prepared in a triple well. 100 microtiter cell culture medium or 100 microtiter CD4-IgG is used as a control. The wells are then incubated for 4 days at 37 ° C., 5% CO ₂ . On day 5, apply tritiated thymidine (1.0 mC / well; Amersham) to each well. After 6 hours, the cells are washed three times, and then label incorporation is evaluated.
In another variation of this assay, PBMC are isolated from the spleens of Balb / c and C57B6 mice. Cells were microscopically taken from spleens freshly recovered in assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acids, 1% pyruvate) PMBCs are isolated by chopping them fine for examination and overlaying these cells on Lympholyte M (Organon Teknika), centrifuged at 2000 rpm for 20 minutes, collected, and mononuclear cells in assay medium The layer is washed and the cells are resuspended in assay medium to 1 × 10 ⁷ cells / ml. The assay is then performed as described above.
Any reduction in the following controls is considered to be a positive result for the inhibitory compound, and a reduction of less than 80% is preferred. However, if any value is less than the control, it exhibits an inhibitory effect on the test protein.
The following test polypeptides were positive in this assay: PRO1114, PRO836, PRO1159, PRO1312, PRO1192, PRO1195 and PRO1387.

Example 156: Mouse Kidney Mesangial Cell Proliferation Assay (Assay 92)
This assay 37 works to induce certain peptides of the present invention to induce the proliferation of mammalian kidney mesangial cells and hence against Burger disease or Schönlein-Henoch purpura, celiac disease, herpes dermatitis or Crohn's disease. It is useful for the treatment of renal diseases associated with decreased mesangial cell function, such as other related renal disorders. This assay is performed as follows. On day 1, mouse kidney mesangial cells were plated on growth medium (3: 1 mix of Dulbecco's modified Eagle medium and Ham F12 medium, supplemented with 95% fetal calf serum, 5% 14 mM HEPES) on a 96-well plate. Grow overnight. On the second day, the PRO polypeptide is diluted in serum-free medium to two concentrations (1% and 5%) and added to the cells. The control sample is serum free medium. On the fourth day, 20 μl of Cell Titer 96 Aqueous one solution reagent (Progema) is added to each well and the photometric reaction is continued for 2 hours. Then, the absorbance was measured at 490 nm. A positive in this assay is anything that gives an absorbance reading at least 15% above that of the control sample.
The following test polypeptides were positive in this assay: PRO819, PRO813 and PRO1066.

Example 157: Pericyte c-Fos induction (Assay 93)
This assay not only serves to elicit the expression of c-fos in pericytes, but is useful as a diagnostic marker for certain types of pericyte-binding tumors. , To produce antagonists that are expected to be useful for therapeutic treatment of pericyte-binding tumors. In particular, on the first day, pericytes are obtained from VEC Technologies and all but 5 ml of medium is removed from the flask. On day 2, the pericytes are trypsinized, washed, spun and then seeded in a 96 well plate. On day 7, the medium was removed and pericytes were added in 100 μl of PRO polypeptide test sample and control (positive control = DEM + 5% serum +/− 500 ng / ml PDGF; negative control = protein 32). To process. Average replicates and determine SD / CV. Fold increase (buffer control) above the protein 32 value as indicated by the fluorescence luminescence unit (RLU) luminometer reading verse frequency is plotted on a histogram and is positive for the assay if the protein 32 value above is doubled. it is conceivable that. ASY matrix: growth medium = low glucose DMEM = 20% FBS + 1 × pen strep + 1 × fungizone. Assay medium = low glucose DMEM + 5% FBS.
The following test polypeptides were positive in this assay: PRO943 and 819.

Example 158: Detection of PRO polypeptide affecting glucose or FFA uptake by early rat adipocytes (Assay 94)
This assay is designed to determine whether a PRO polypeptide exhibits the ability to affect glucose or FFA uptake by adipocytes. PRO polypeptides that evaluate positive in this assay are expected to be useful for therapeutic treatment of diseases that are stimulation or inhibition of glucose uptake by adipocytes, including, for example, obesity, diabetes or high or hypoinsulinemia. The
In a 96 well format, the PRO polypeptide to be assayed is added to early rat adipocytes and incubated overnight. At 4 and 16 hours, samples for glycerol, glucose and FFA uptake assays are taken. After 16 hours of incubation, add insulin to the medium and incubate for 4 hours. At this time, a sample is taken and the uptake of glycerol, glucose and FFA is measured. Medium without insulin with PRO polypeptide is used as a positive reference control. If the PRO polypeptide being tested stimulates or inhibits glucose or FFA uptake, a result is recorded as positive if it is 1.5 times higher or 0.5 times lower than the insulin control.
The following PRO polypeptides were rated positive as stimulators of glucose and / or FAA uptake in this assay: PRO1114, PRO1007, PRO1066, PRO848, PRO1182, PRO1198, PRO1192, PRO1271, PRO1375 and PRO1387.
The following test PRO polypeptides were positive as inhibitors of glucose and / or FAA uptake in this assay: PRO1184, PRO1360, PRO1309, PRO1154, PRO1181, PRO1186, PRO1160 and PRO1384.

Example 159: Chondrocyte Redifferentiation Assay (Assay 110)
This assay demonstrates that certain peptides of the invention induce chondrocyte redifferentiation and are therefore expected to be useful in the treatment of various bone and / or cartilage tissue diseases such as, for example, sports injury and arthritis. Show. This assay is performed as follows. Porcine chondrocytes are isolated by overnight collagenase digestion from articular cartilage of 4-6 month old sows metacarpophalangeal joints. The isolated cells are then seeded at a rate of 25,000 cells / cm ² into Ham F-12 containing 10% FBS and 4 μg / ml gentamicin. The medium is changed every 3 days, and the cells are seeded into a 96-well plate at 5,000 cells / well in 100 μl of the same medium without serum and 100 μl of the test PRO polypeptide, 5 nM staurosporine ( Positive control) or medium alone (negative control) is added to a final volume of 200 μl / well. After 5 days of incubation, pictures of each well are taken to determine the stage of chondrocyte differentiation. If the chondrocyte redifferentiation resembled a positive control rather than a negative control, the assay gave a positive result.
The following test polypeptides were positive in this assay: PRO1282, PRO1310, PRO619, PRO943, PRO820, PRO1080, PRO1016, PRO1007, PRO1056, PRO791, PRO1111, PRO1184, PRO1360, PRO1309, PRO1107, PRO1107, PRO1131 PRO1181, PRO1186, PRO1159, PRO1312, PRO1192, and PRO1384.

Example 160: Chondrocyte proliferation assay (Assay 111)
This assay is designed to determine whether a PRO polypeptide of the invention exhibits the ability to inhibit chondrocyte proliferation in culture. Polypeptides tested positive in this assay are expected to be useful for therapeutic treatment of various bone and / or cartilage tissue diseases such as, for example, sports injuries and arthritis.
Porcine chondrocytes were isolated by overnight collagenase digestion from articular cartilage of 4-6 month old sows metacarpophalangeal joints. The isolated cells are then seeded at a rate of 25,000 cells / cm ² into Ham F-12 containing 10% FBS and 4 μg / ml gentamicin. The medium was changed every 3 days and the cells were replated every 5 days to 25,000 cells / cm ² . On day 12, cells are seeded into a 96-well plate of 100 μl of the same medium without serum at a rate of 5,000 cells / well, serum-free medium (negative control), staurosporine (final concentration 5 nM; positive control) ) Or test PRO polypeptide was added to a final volume of 200 μl / well. After 5 days at 37 ° C., 20 μl Alamar blue was added to each well and the plates were incubated for an additional 3 hours at 37 ° C. Then, the fluorescence of each well was measured (Ex: 530 nm; Em: 590 nm). To obtain the background, the fluorescence of the plate containing 200 μl of serum-free medium was measured. A positive result of this assay is obtained in cases where the fluorescence of the PRO polypeptide-treated sample is like that of the positive control than that of the negative control.
The following test polypeptides were positive in this assay: PRO1310, PRO844, PRO1312, PRO1192, and PRO1387.

Example 161: Induction of proliferation of pancreatic beta cell precursors (Assay 117)
This assay shows that certain peptides of the present invention induce proliferation of pancreatic β-cell precursors and are therefore expected to be useful in the treatment of various insulin deficiency conditions in mammals including diabetes. This assay was performed as follows. This assay uses primary cultures of mouse fetal pancreatic cells, where the primary measure is a change in the expression of a marker indicative of either β-cell precursors or mature β-cells. Marker expression is measured by real-time quantified PCR (RT-PCR): The marker to be evaluated is a transcription factor called Pdx1.
The pancreas was dissected from E14 embryos (CD1 mice). The pancreas was then digested with collagenase / dispase in F12 / DMEM at 37 ° C. for 40-60 minutes (collagenase / dispase, 1.37 mg / ml, Beringer Mannheim, # 1097113). The digest is then neutralized with an equal volume of 5% BSA and the cells are washed once with RPMI1640. On day 1, cells are seeded into 12-well tissue culture plates (20 μl / ml laminin in PBS, precoated with Boehringer Mannheim, # 124317). Distribute pancreatic cells from 1-2 embryos into one well. The medium for this primary culture is 14F / 1640. On the second day, media is removed and adherent cells are washed with RPMI / 1640. In addition to the protein to be tested, add 2 ml of minimal medium. On the fourth day, the medium is removed, RNA is prepared from the cells, and marker expression is analyzed by real time quantitative RT-PRC. A protein is considered active in this assay if the expression of the associated beta cell marker is increased compared to an untreated control.
14F / 1640 is RPMI1640 plus the following:
Group A1: 1000
Group B1: 1000 recombinant human insulin 10μg / ml
Aprotinin (50μg / ml) 1: 2000 (Boehringer Mannheim # 981532)
Bovine pituitary extract (BPE) 60μg / ml
Gentamicin 100ng / ml
Group A: (in 10 ml PBS)
Transferrin, 100mg (Sigma T2252)
Epidermal growth factor, 100 μg (BRL 100004)
10 μl of triiodothyronine, 5 × 10 ⁻⁶ M (Sigma T5516)
100 μl of ethanolamine, 10 ⁻¹ M (Sigma E0135)
100 μl of phosphoethanolamine, 10 ⁻¹ M (Sigma P0503)
4 μl of selenium, 10 ⁻¹ M (Aesar # 12574)
Group C: (10ml in 100% ethanol)
Hydrocortisone, 5 × 10 ⁻³ M 2 μl (Sigma # H0135)
Progesterone, 1x10 ^-3 M 100 µl (Sigma # P6149)
Forskolin, 20 mM, 500 μl (Calbiochem # 344270)
Minimum medium:
RPMI1640 plus transferrin (10 μg / ml), insulin (1 μg / ml), gentamicin (100 ng / ml), aprotinin (50 μg / ml) and BPE (15 μg / ml).
Limited medium:
RPMI1640 plus transferrin (10 μg / ml), insulin (1 μg / ml), gentamicin (100 ng / ml) and aprotinin (50 μg / ml)
The following test polypeptides were positive in this assay: PRO1310, PRO1188, PRO1131, and PRO1387.

Example 162: Detection of polypeptides affecting glucose or FFA uptake in skeletal muscle (Assay 106)
This assay is designed to determine whether a PRO polypeptide exhibits the ability to affect skeletal muscle glucose or FFA uptake. PRO polypeptides that evaluate positive in this assay are expected to be useful for therapeutic treatment of diseases that are stimulation or inhibition of glucose uptake by skeletal muscle, including, for example, diabetes or high or hypoinsulinemia.
In a 96 well format, the PRO polypeptide to be assayed is added to early rat differentiated skeletal muscle and incubated overnight. A fresh medium containing PRO polypeptide and +/− insulin is then added to the wells. The sample medium is then monitored to measure glucose or FFA uptake by skeletal muscle. Insulin stimulates glucose or FFA uptake by skeletal muscle, and medium containing insulin without PRO polypeptide is used as a positive reference control and scoring restriction. If the PRO polypeptide being tested stimulates or inhibits glucose or FFA uptake, a result is recorded as positive if it is 1.5 times higher or 0.5 times lower than the insulin control.
The following test PRO polypeptides were positive as stimulators or inhibitors of glucose and / or FAA uptake in this assay: PRO358, PRO1016, PRO1007, PRO826, PRO1066, PRO1029 and PRO1309.

Example 163: Induction of fetal hemoglobin in an erythroblast cell line (Assay 107)
This assay is useful for screening the ability of PRO polypeptides to induce the switch from adult hemoglobin to fetal hemoglobin in erythroblast cell lines. If the molecule tested in this assay is positive, it is expected to be useful for therapeutic treatment of a variety of mammalian hemoglobin-related diseases, such as various thalassemias. This assay is performed as follows. Erythroid cells are plated at 1000 cells / well in a 96-well format in standard growth medium. PRO polypeptide is added to the growth medium at a concentration of 0.2% or 2% and the cells are incubated at 37 ° C. for 5 days. As a positive control, cells are treated with 100 μM hemin and as a negative control, cells are not treated. After 5 days, cell lysates are prepared and analyzed for gamma globulin expression (fetal marker). Positive in this assay is that the gamma globulin level is at least twice that of the negative control.
The following test polypeptides were positive in this assay: PRO1114, PRO826, PRO1066, PRO844, PRO1192, and PRO1358.

Example 164: Induction of pancreatic beta cell precursor differentiation (assay 89)
This assay shows that certain peptides of the present invention induce differentiation of pancreatic β-cell precursors and are therefore expected to be useful in the treatment of various insulin deficiency conditions in mammals including diabetes. This assay was performed as follows. This assay uses primary cultures of mouse fetal pancreatic cells, where the primary measure is a change in the expression of a marker indicative of either β-cell precursors or mature β-cells. Marker expression is measured by real time quantified PCR (RTQ-PCR, real time quatitative PCR): the marker to be evaluated is insulin.
The pancreas is dissected from E14 embryos (CD1 mice). The pancreas is then digested with collagenase / dispase in F12 / DMEM at 37 ° C. for 40-60 minutes (collagenase / dispase, 1.37 mg / ml, Behringer Mannheim, # 1097113). The digest is then neutralized with an equal volume of 5% BSA and the cells are washed once with RPMI1640. On day 1, cells are seeded into 12-well tissue culture plates (20 μl / ml laminin in PBS, pre-coated with Boehringer Mannheim, # 124317). Distribute pancreatic cells from 1-2 embryos into one well. The medium for this primary culture is 14F / 1640. On the second day, media is removed and adherent cells are washed with RPMI / 1640. In addition to the protein to be tested, add 2 ml of minimal medium. On the fourth day, the medium is removed, RNA is prepared from the cells, and marker expression is analyzed by real time quantitative RT-PRC. A protein is considered active in this assay if the expression of the associated beta cell marker is increased compared to an untreated control.
14F / 1640 (Gibco) has the following RPMI1640:
Group A1: 1000
Group B1: 1000
Recombinant human insulin 10μg / ml
Aprotinin (50μg / ml) 1: 2000 (Boehringer Mannheim # 981532)
Bovine pituitary extract (BPE) 60μg / ml
Gentamicin 100 ng / ml
Group A: (in 10 ml PBS)
Transferrin, 100 mg (Sigma T2252)
Epidermal growth factor, 100 μg (BRL 100004)
Triiodothyronine, 5 × 10 ⁻⁶ M 10 μl (Sigma T5516)
100 μl of ethanolamine, 10 ⁻¹ M (Sigma E0135)
100 μl of phosphoethanolamine, 10 ⁻¹ M (Sigma P0503)
4 μl of selenium, 10 ⁻¹ M (Aesar # 12574)
Group C: (10 ml in 100% ethanol)
Hydrocortisone, 5 × 10 ⁻³ M 2 μl (Sigma # H0135)
100 μl of progesterone, 1 x 10 ^-3 M (Sigma # P6149)
Forskolin, 20 mM 500 μl (Calbiochem # 344270)
Minimum medium:
RPMI1640 plus transferrin (10 μg / ml), insulin (1 μg / ml), gentamicin (100 ng / ml), aprotinin (50 μg / ml) and BPE (15 μg / ml).
Limited medium:
RPMI1640 plus transferrin (10 μg / ml), insulin (1 μg / ml), gentamicin (100 ng / ml) and aprotinin (50 μg / ml).
The following test polypeptides were positive in this assay: PRO1188, PRO1132, PRO1131, and PRO1181.

Example 165: Skin Vascular Permeability Assay (Assay 64)
This assay shows that certain polypeptides of the invention stimulate the immune system and induce inflammation by inducing mononuclear cells, eosinophils and PMN infiltration at the site of mammalian injection. Compounds that stimulate the immune response are therapeutically useful when the immune response is beneficial. This skin vascular permeability assay is performed as follows. Anesthetized by intramuscular administration of ketamine (70-80 mg / kg) and 5 mg / kg xylazine to hairless guinea pigs of 350 g or more (IM). The purified polypeptide of the invention or the conditional test sample is injected intradermally into the dorsal skin of the test animal at 100 μl per injection site. There may be approximately 10-30, preferably 16-24, injection sites per animal. Then 1 μl of Evans Blue dye (1% buffered saline) is injected intracardiac. The spots at the injection site are then measured 1 and 6 hours after injection (mm diameter). The animals were sacrificed 6 hours after injection. Each skin injection site is biopsied and fixed with formalin. This skin is then conditioned for histopathological evaluation. Each site is evaluated for wet inflammatory cells on the skin. Sites of visible inflammatory cell wetting are scored as positive. Inflammatory cells can be neutrophils, eosinophils, mononuclear cells or lymphoid. At least the minimum perivascular wet material at the injection site is scored as positive, and the non-wet material at the injection site is scored as negative.
The following test PRO polypeptides were positive in this assay: PRO1007, PRO1358 and PRO1375.

Example 166: Induction of endothelial cell apoptosis (ELISA) (Assay 109)
The ability of the PRO polypeptide to induce apoptosis in endothelial cells was determined using the 96-well format in 0% serum medium supplemented with 100 ng / ml VEGF, 0.1% BSA, 1Xpenn / strep, and the umbilical vein of human veins. Tested in endothelial cells (HUVEC, Cell Systems). The 96-well plate used was manufactured by Falcon (number 3072). 96 well coatings were prepared by allowing gelatinization to occur for> 30 minutes with 100 μl of 0.2% gelatin in PBS solution. The gelatin mixture was all aspirated and then plated at a final concentration of 2 × 10 ⁴ cells / ml in 10% serum-containing medium—100 μl volume per well. Cells were grown for 24 hours before adding a test sample containing the PRO polypeptide of interest.
To all wells, 100 μl in 0% serum medium supplemented with 100 ng / ml VEGF, 0.1% BSA, 1 × penn / strep was added. Test samples containing PRO polypeptide were added in triplicate at dilutions of 1%, 0.33% and 0.11%. Wells without cells were used as blanks and cell-only wells were used as negative controls. As a positive control, a 50 μl 1: 3 serial dilution of 3 × stock staurosporine was used. Prior to ELISA, cells were incubated for 24-35 hours.
An ELISA was used to determine the level of apoptosis preparation solution according to the Boehringer manual [Boehringer, Cell Death Detection ELISA plus, catalog number 1920685]. Sample preparation: A 96-well plate was spun down (200 g) at 1 krpm for 10 minutes, the supernatant was removed by high speed inversion, and the plate was placed upside down on a paper towel to remove the remaining liquid. To each well, 100 μl of 1 × lysis buffer was added and incubated for 30 minutes at room temperature without shaking. Plates were spun down at 1 krpm for 10 minutes and 20 μl of lysate (cytoplasmic fraction) was transferred to streptavidin-coated MTP. 80 μl of immunoreagent mixture was added to 20 μl lysate in each well. MTP was covered with an adhesive foil and incubated for 2 hours at room temperature by placing it on an orbital shaker (200 rpm). After 2 hours, the supernatant was removed by aspiration and the wells were rinsed 3 times with 250 μl of 1 × incubation buffer per well (removed by aspiration). Substrate solution was added to each well (100 μl) and incubated on an orbital shaker at 250 rpm at room temperature until sufficient color development for photometric analysis (after about 10-20 minutes). A 96 well reader was used to read the plate at 405 nm with a reference wavelength of 492 nm. The level obtained for PIN32 (control buffer) was set to 100%. Samples with a level> 130% were considered positive for apoptosis induction.
The following test polypeptide was positive in this assay: PRO844.

Example 167: Guinea Pig Vascular Leakage (Assay 32)
This assay is for determining whether a PRO polypeptide of the invention exhibits the ability to induce vascular permeability. PRO polypeptides that evaluate positive in this assay are expected to be useful for therapeutic treatment of conditions that benefit from hypertrophic vascular permeability, including those that benefit from enlarged local immune system cell infiltration, for example. .
Anesthetized by intramuscular administration of ketamine (70-80 mg / kg) and 5 mg / kg xylazine to hairless guinea pigs of 350 g or more. A test sample containing a PRO302 polypeptide or physiological buffer without the test polypeptide is injected intradermally into the dorsal skin of the test animal at 100 μl per injection site. There were approximately 16-24 injection sites per animal. Then 1 ml of Evans Blue dye (1% in PBS) is injected intracardiac. The skin vascular permeability response to the compound (ie, spot at the injection site) is scored visually by measuring the diameter (mm) of the blue leakage from the injection site 1, 6, and 24 hours after administration of the test animals. . The blue diameter of the injection site is observed and recorded with the severity of vascular leakage. Spots with a diameter of at least 5 mm are considered positive in the assay when testing purified protein, indicating the ability to induce vascular leakage or permeability. Responses greater than 7 mm diameter are considered positive for conditioned media samples. 0.1 μg / 100 μl of human VEGF was used as a positive control and induced a 4-8 mm diameter response.
The following test PRO polypeptide was positive in this assay: PRO1155.

Example 168: Mouse Mesengial Cell Inhibition Assay (Assay 114)
This assay is designed to determine whether a PRO polypeptide of the invention exhibits the ability to inhibit the growth of mouse Mesengial cells in culture. Polypeptides tested positive in this assay include Mesengial, such as cystic nephrogenesis, polycystic kidney disease, or other renal diseases associated with abnormal growth of Mesengial cells, renal tumors, and the like It is expected to be useful for therapeutic treatment of conditions and diseases where inhibition of cell proliferation is beneficial.
On day 1, mouse Mesengial cells were plated on growth medium (3: 1 mix of Dulbecco's modified Eagle medium and Ham F12 medium, supplemented with 95% fetal bovine serum, 5% 14 mM HEPES) overnight. Grow. On day 2, the PRO polypeptide was diluted in serum-free medium to two different concentrations (1% and 0.1%) and added to the cells. The control sample is a growth medium without the addition of PRO polypeptide. After incubating the cells for 48 hours, 20 μl of Cell Titer 96 Aqueous one solution reagent (Progema) was added to each well and the photometric reaction was continued for 2 hours. The absorbance was measured at 490 nm. A positive in this assay is anything that gives an absorbance reading at least 10% above that of the control sample.
The following test polypeptides were positive in this assay: PRO1192, PRO1195.

Example 169: In vitro antiproliferative assay (Assay 161)
The anti-proliferative activity of various PRO polypeptides has been investigated by a national cancer study using a sulforhodamine B (SRB) dye binding assay essentially as described by Skehan et al., J. Natl. Cancer Inst. 82: 1107-1112 (1990). (NCI) experimental, disease-oriented in vitro anticancer drug discovery assay. The 60 tumor cell lines ("NCI panel") used in this assay, and their maintenance and in vitro culture conditions, are described in Monks et al., J. Natl. Cancer Inst. 83: 757-766 (1991). Yes. The purpose of this screening is to first assess the cytotoxicity and / or mitotic activity of the test compound against different types of tumors (Monks et al., Supra; Boyd, Cancer: Princ. Pract. Oncol. Update 3 (10): 1-12 [1989]).
Cells from approximately 60 human tumor cell lines were harvested with trypsin / EDTA (Gibco), washed once, resuspended in IMEM, and their survival was measured. The cell suspension was pipetted (100 μL volume) into another 96-well microtiter plate. The cell density of the 6 day incubation was smaller than the 2 day incubation and overgrowth was prevented. After seeding, preincubation was performed at 37 ° C. for 24 hours for stabilization. Two-fold dilutions of the desired test concentration were added to microtiter plate wells in a 100 μl aliquot at zero (1: 2 dilution). Test compounds were evaluated at 5 log dilutions (1000 to 100,000 times). Incubations were performed for 2 and 6 days in a 5% CO ₂ atmosphere and 100% humidity.
After incubation, the medium was removed and the cells were fixed with 0.1 ml of 10% trichloroacetic acid at 40 ° C. The plate is washed 5 times with deionized water, dried, stained with 0.1 ml of 0.4% sulforhodamine B dye (Sigma) dissolved in 1% acetic acid for 30 minutes, and washed 4 times with 1% acetic acid to unbound dye. The dyeing was extracted with 0.1 ml of 10 mM Tris base [Tris (hydroxymethyl) aminomethane], pH 10.5 for 5 minutes. Absorption (OD) of sulforhodamine B at 492 nm was measured using a computer-connected 96-well microtiter plate reader.
A test sample is considered positive when it exhibits at least 50% growth inhibition at one or more concentrations. The PRO polypeptides that showed positive in this assay are shown in Table 7 and the abbreviations are as follows:
NSCL = Non-small cell lung carcinoma CNS = Central nervous system

これらのアッセイの結果は、ポジティブと試験されるＲＰＯポリペプチドが、多くの異なる腫瘍細胞型の腫瘍性成長を抑制するのに役立ち、その治療に役立ちうることを示している。これらのＰＲＯポリペプチドに対する抗体は、これらの有用なポリペプチドの親和性精製に役立つ。これらのＰＲＯポリペプチドをコードする核酸は、これらのポリペプチドの組換え生産に役立つ。

The results of these assays indicate that RPO polypeptides that are tested positive can help to inhibit and treat neoplastic growth of many different tumor cell types. Antibodies against these PRO polypeptides are useful for affinity purification of these useful polypeptides. Nucleic acids encoding these PRO polypeptides are useful for recombinant production of these polypeptides.

Example 170: Tumor Gene Amplification This example shows that genes encoding various PRO polypeptides are amplified in the genome of certain human cancers. Amplification is accompanied by overexpression of the gene product, indicating that the PRO polypeptide is a useful target for therapeutic intervention in certain cancers such as colon, lung and other cancers. The therapeutic agent can take the form of an antagonist of the PRO polypeptide-encoding gene, eg, a mouse-human chimera, a humanized or human antibody against the PRO polypeptide.
The starting material for the screening is genomic DNA isolated from various cancers. DNA is accurate quantitatively, eg, fluorometrically. As a negative control, DNA was isolated from 10 normal healthy individuals and pooled and used as an assay control for gene copy in healthy individuals (not shown). 5 'nuclease assays (eg, TaqMan (trade name)) and real-time quantitative PCR (eg, ABI Prizm 7700 Sequence Detection System (trade name) (Perkin Elmer, Applied Biosystems Division, Foster City, CA)) Used to find genes that are potentially amplified in cancer. The results were used to determine if the PRO polypeptide was overexpressed in screened lung and colon cancer. Primary lung cancer was obtained from individual tumor types and stages, as shown in Table 8. A description of the abbreviations used to name the primary tumors in Table 8 and the primary tumors and cell lines referred to throughout this example are shown below.
TaqMan (trade name) results are reported in delta (Δ) CT units. One unit corresponds to about 2 times amplification for 1 PCR cycle or normal, 2 units corresponds to 4 times, 3 units corresponds to 8 times, and so on. Quantification was obtained using TaqMan (trade name) fluorescence derived from primers and the PRO polypeptide-encoding gene. Regions of the PRO polypeptide that appear to contain the most unique nucleic acid sequence and that do not have the most spliced introns, such as the 3′-untranslated region, are preferred for primer induction. The sequences for primers and probes (forward, reverse and probe) used for gene amplification analysis of PRO polypeptides were as follows:

PRO290 (DNA35680-1212):
35680.tm.p:
5'-CCACCAATGGCAGCCCCACCT -3 '(SEQ ID NO: 428)
35680.tm.f:
5'-GACTGCCCTCCCTGCCA-3 '(SEQ ID NO: 429)
35680.tm.r:
5'-CAAAAAGCCTGGAAGTCTTCAAAG-3 '(SEQ ID NO: 430)

PRO341 (DNA26288-1239):
26288.tm.f1:
5'-CAGCTGGACTGCAGGTGCTA-3 '(SEQ ID NO: 431)
26288.tm.r1:
5'-CAGTGAGCACAGCAAGTGTCCT-3 '(SEQ ID NO: 432)
26288.tm.p1:
5'-GGCCACCTCCTTGAGTCTTCAGTTCCCT-3 '(SEQ ID NO: 433)

PRO535 (DNA49143-1429):
49143.tm.f1:
5'-CAACTACTGGCTAAAGCTGGTGAA-3 '(SEQ ID NO: 434)
49143.tm.r1:
5'-CCTTTCTGTATAGGTGATACCCAATGA-3 '(SEQ ID NO: 435)
49143.tm.p1:
5'-TGGCCATCCCTACCAGAGGCAAAA-3 '(SEQ ID NO: 436)

PRO619 (DNA49821-1562):
49821.tm.f1:
5'-CTGAAGACGACGCGGATTACTA-3 '(SEQ ID NO: 437)
49821.tm.r1:
5'-GGCAGAAATGGGAGGCAGA-3 '(SEQ ID NO: 438)
49821.tm.p1:
5'-TGCTCTGTTGGCTACGGCTTTAGTCCCTAG-3 '(SEQ ID NO: 439)

PRO809 (DNA57836-1338):
57836.tm.f1:
5'-AGCAGCAGCCATGTAGAATGAA-3 '(SEQ ID NO: 440)
57836.tm.r1:
5'-AATACGAACAGTGCACGCTGAT-3 '(SEQ ID NO: 441)
57836.tm.p1:
5'-TCCAGAGAGCCAAGCACGGCAGA-3 '(SEQ ID NO: 442)

PRO830 (DNA56866-1342):
56866.tm.f1:
5'-TCTAGCCAGCTTGGCTCCAATA-3 '(SEQ ID NO: 443)
56866.tm.r1:
5'-CCTGGCTCTAGCACCAACTCATA-3 '(SEQ ID NO: 444)
56866.tm.p1:
5'-TCAGTGGCCCTAAGGAGATGGGCCT-3 '(SEQ ID NO: 445)

PRO848 (DNA59839-1461):
59839.tm.f1:
5'-CAGGATACAGTGGGAATCTTGAGA -3 '(SEQ ID NO: 446)
59839.tm.r1:
5'-CCTGAAGGGCTTGGAGCTTAGT-3 '(SEQ ID NO: 447)
59839.tm.p1:
5'-TCTTTGGCCATTTCCCATGGCTCA-3 '(SEQ ID NO: 448)

PRO943 (DNA52192-1369):
52192.tm.f1:
5'-CCCATGGCGAGGAGGAAT-3 '(SEQ ID NO: 449)
52192.tm.r1:
5'-TGCGTACGTGTGCCTTCAG-3 '(SEQ ID NO: 450)
52192.tm.p1:
5'-CAGCACCCCAGGCAGTCTGTGTGT-3 '(SEQ ID NO: 451)

PRO1005 (DNA57708-1411):
57708.tm.f1:
5'-AACGTGCTACACGACCAGTGTACT-3 '(SEQ ID NO: 452)
57708.tm.r1:
5'-CACAGCATATTCAGATGACTAAATCCA-3 '(SEQ ID NO: 453)
57708.tm.p1:
5'-TTGTTTAGTTCTCCACCGTGTCTCCACAGAA-3 '(SEQ ID NO: 454)

PRO1009 (DNA57129-1413):
57129.tm.f1:
5'-TGTCAGAATGCAACCTGGCTT-3 '(SEQ ID NO: 455)
57129.tm.r1:
5'-TGATGTGCCTGGCTCAGAAC-3 '(SEQ ID NO: 456)
57129.tm.p1:
5'-TGCACCTAGATGTCCCCAGCACCC-3 '(SEQ ID NO: 457)

PRO1097 (DNA59841-1460):
59841.tm.f1:
5'-AAGATGCGCCAGGCTTCTTA-3 '(SEQ ID NO: 458)
59841.tm.r1:
5'-CTCCTGTACGGTCTGCTCACTTAT-3 '(SEQ ID NO: 459)
59841.tm.p1:
5'-TGGCTGTCAGTCCAGTGTGCATGG-3 '(SEQ ID NO: 460)

PRO1107 (DNA59606-1471):
59606.tm.f1:
5'-GCATAGGGATAGATAAGATCCTGCTTTAT-3 '(SEQ ID NO: 461)
59606.tm.r1:
5'-CAAATTAAAGTACCCATCAGGAGAGAA-3 '(SEQ ID NO: 462)
59606.tm.p1:
5'-AAGTTGCTAAATATATACATTATCTGCGCCAAGTCCA-3 '(SEQ ID NO: 463)

PRO1111 (DNA58721-1475):
58721.tm.f2:
5'-GTGCTGCCCACAATTCATGA-3 '(SEQ ID NO: 464)
58721.tm.p2:
5'-GTCCTTGGTATGGGTCTGAATTATAT-3 '(SEQ ID NO: 465)
58721.tm.r2:
5'-ACTCTCTGCACCCCACAGTCACCACTATCTC-3 '(SEQ ID NO: 466)

PRO1153 (DNA59842-1502):
59842.tm.f1:
5'-CTGAGGAACCAGCCATGTCTCT-3 '(SEQ ID NO: 467)
59842.tm.r1:
5'-GACCAGATGCAGGTACAGGATGA-3 '(SEQ ID NO: 468)
59842.tm.p1:
5'-CTGCCCCTTCAGTGATGCCAACCTT-3 '(SEQ ID NO: 469)

PRO1182 (DNA59848-1512):
59848.tm.f1:
5'-GGGTGGAGGCTCACTGAGTAGA-3 '(SEQ ID NO: 470)
59848.tm.r1:
5'-CAATACAGGTAATGAAACTCTGCTTCTT-3 '(SEQ ID NO: 471)
59848.tm.p1:
5'-TCCTCTTAAGCATAGGCCATTTTCTCAGTTTAGACA-3 '(SEQ ID NO: 472)

PRO1184 (DNA59220-1514):
59220.tm.f1:
5'-GGTGGTCTTGCTTGGTCTCAC-3 '(SEQ ID NO: 473)
59220.tm.r1:
5'-CCGTCGTTCAGCAACATGAC-3 '(SEQ ID NO: 474)
59220.tm.p1.
5'-ACCGCCTACCGCTGTGCCCA-3 '(SEQ ID NO: 475)

PRO1187 (DNA62876-1517):
62876.tm.f1:
5'-CAGTAAAACCACAGGCTGGATTT-3 '(SEQ ID NO: 476)
62876.tm.r1:
5'-CCTGAGAGCAAGAAGGTTGAGAAT-3 '(SEQ ID NO: 477)
62876.tm.p1:
5'-TAGACAGGGACCATGGCCCGCA-3 '(SEQ ID NO: 478)

PRO1281 (DNA59820-1549):
59820.tm.f1:
5'-TGGGCTGTAGAAGAGTTGTTG-3 '(SEQ ID NO: 479)
59820.tm.r1:
5'-TCCACACTTGGCCAGTTTAT-3 '(SEQ ID NO: 480)
59820.tm.p1:
5'-CCCAACTTCTCCCTTTTGGACCCT-3 '(SEQ ID NO: 481)

PRO1112 (DNA57702-1476):
57702.tm.f1:
5'-GTCCCTTCACTGTTTAGAGCATGA-3 '(SEQ ID NO: 482)
57702.tm.r1:
5'-ACTCTCCCCCTCAACAGCCTCCTGAG-3 '(SEQ ID NO: 483)
57702.tm.p1:
5'-GTGGTCAGGGCAGACCTTT-3 '(SEQ ID NO: 484)

PRO1185 (DNA62881-1515):
62881.tm.f1:
5'-ACAGATCCAGGAGAGACTCCACA-3 '(SEQ ID NO: 485)
62881.tm.r1:
5'-AGCGGCGCTCCCAGCCTGAAT-3 '(SEQ ID NO: 486)
62881.tm.p1:
5'-CATGATTGGTCCTCAGTTCCATC-3 '(SEQ ID NO: 487)

PRO1245 (DNA64884-1527):
64884.tm.f1:
5'-ATAGAGGGCTCCCAGAAGTG -3 '(SEQ ID NO: 488)
64884.tm.p1:
5'-CAGGGCCTTCAGGGCCTTCAC-3 '(SEQ ID NO: 489)
64884.tm.r1:
5'-GCTCAGCCAAACACTGTCA-3 '(SEQ ID NO: 490)
64884.tm.f2:
5'-GGGGCCCTGACAGTGTT-3 '(SEQ ID NO: 491)
64884.tm.p2:
5'-CTGAGCCGAGACTGGAGCATCTACAC-3 '(SEQ ID NO: 492)
64884.tm.r2:
5'-GTGGGCAGCGTCTTGTC-3 '(SEQ ID NO: 493)

The 5 ′ nuclease assay reaction is a fluorescent PCR-based technique that uses the 5 ′ exonuclease activity of the Taq DNA polymerase enzyme for real-time amplification monitoring. Two oligonucleotide primers (forward [.f] and reverse [.r]) were used to generate amplicons typical of PCR reactions. A third oligonucleotide, or probe (.p), was designed to detect the nucleic acid sequence located between the two PCR primers. The probe is non-extensible by Taq DNA polymerase enzyme and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. When the two dyes are located close together on the probe, the laser-induced emission from the reporter dye is quenched by the quenching dye. During the amplification reaction, the probe is cleaved in a template dependent manner by the Taq DNA polymerase enzyme. The resulting probe fragment dissociates into solution and the signal from the released reporter dye is not subject to the quenching effect from the second fluorophore. One molecule of reporter dye is labeled for each newly synthesized molecule, and detection of the non-quenched reporter dye provides the basis for quantitative interpretation of the data.
The 5 ′ nuclease method is performed on a real-time quantitative PCR instrument such as ABI Prism 7700 ™ sequence detection. The system consists of a temperature cycler, laser, charge coupled device (CCD) camera and computer. The system amplifies the sample in 96-well on a temperature cycler. During amplification, the laser-induced fluorescence signal is collected in 96 wells with a fiber optic cable and detected with a CCD. The system includes software for device execution and data analysis.
5 ′ nuclease assay data is initially expressed in Ct or boundary cycles. This is defined as the cycle in which the reporter signal accumulates beyond the fluorescent background. When comparing cancer DNA results with normal human DNA results, the ΔCt value is used as a quantitative measure of the relative number of speciation copies of a particular target sequence in a nucleic acid sample.
Table 8 shows the T-stage and N-stage of various primary tumors used for screening of the PRO polypeptide compounds of the present invention.

DNA preparation:
DNA was prepared from cultured cell lines, primary tumors, and normal human blood. Isolation was performed using purification kits, buffer sets and proteases, all from Quiagen, according to manufacturer's instructions and below.
Cell culture lysis:
Cells were washed, trypsinized at a concentration of 7.5 × 10 ⁸ per chip, pelleted by centrifugation at 1000 rpm for 5 minutes at 4 ° C. and then washed with 1/2 volume PBS re-centrifuge. The pellet was washed 3 times and the suspended cells were collected and washed with 2 × PBS. The cells were then suspended in 10 mL PBS. Buffer C1 was equilibrated at 4 ° C. Quiagen protease # 19155 was diluted with 6.25 ml of cold ddH2O to a final concentration of 20 mg / ml and equilibrated at 4 ° C. 10 mL of G2 buffer was prepared by diluting Quiagen RNAse A stock (100 mg / ml) to a final concentration of 200 μg / ml.
Buffer C1 (10 mL, 4 ° C.) and ddH ₂ O (40 mL, 4 ° C.) were then added to the 10 mL cell suspension, mixed by inversion, and incubated on ice for 10 minutes. Cell nuclei were pelleted by centrifuging at 2500 rpm for 15 minutes at 4 ° C. in a Beckman swing bucket rotor. The supernatant was discarded, and the nuclei were suspended in ₂ mL of buffer C1 (4 ° C.) and 6 mL of ddH ₂ O while vortexing, and centrifuged at 2500 rpm for 15 minutes at 4 ° C. after 1 second. The nuclei were then resuspended in the remaining buffer using 200 μl per chip. Loose vortexing was applied while adding G2 buffer (10 ml) to the suspended nuclei. When buffer addition was complete, a strong vortex was applied for 30 seconds. Quiagen protease (200 μl prepared as above) was added and incubated at 50 ° C. for 60 minutes. Incubation and centrifugation were repeated until the lysate was clear (eg, incubated for an additional 30-60 minutes and pelleted at 3000 × g for 10 minutes at 4 ° C.).

Preparation and lysis of solid human tumor samples:
Tumor samples were weighed and placed in a 50 ml conical tube and kept on ice. Processing was limited to less than 250 mg tissue per preparation (1 chip / preparation). The protease solution was freshly prepared by diluting in 6.25 ml cold ddH ₂ O to a final concentration of 20 mg / ml and stored at 4 ° C. G2 buffer (20 ml) was prepared by diluting DNAseA to a final concentration of 200 mg / ml (from a 100 mg / ml stock). Tumor tissue was homogenized in 19 ml of G2 buffer for 60 seconds and kept at room temperature using a large polytron tip in a laminar flow T hood to avoid aerosol inhalation. Polytrons were clarified by spinning between samples with ₂ L each of ddH ₂ O for 2 × 30 seconds and then with G2 buffer (50 ml). If tissue was present on the generator chip, the device was disassembled and cleaned.
Quiagen protease (prepared for above, 1.0 ml) was added, then vortexed and incubated at 50 ° C. for 3 hours. Incubation and centrifugation were repeated until the lysate was clear (eg, incubated for an additional 30-60 minutes and pelleted at 3000 × g for 10 minutes at 4 ° C.).
Human blood preparation and lysis:
Blood was drawn from healthy volunteers using a standard infectious agent protocol and citrated to a 10 ml sample per chip. Quiagen protease was freshly prepared by dilution in 6.25 ml of cold ddH ₂ O to a final concentration of 20 mg / ml and stored at 4 ° C. G2 buffer (20 ml) was prepared by diluting DNAseA from a 100 mg / ml stock to a final concentration of 200 mg / ml. Blood (10 ml) was placed in a 50 ml conical tube, 10 ml C1 buffer and 30 ml ddH ₂ O (both equilibrated at 4 ° C.) were added, inverted and mixed and kept on ice for 10 minutes. The nuclei were pelleted with a Beckman swinging bucket rotor at 2500 rpm at 4 ° C. for 15 minutes and the supernatant discarded. While vortexing, the nuclei were suspended in ₂ ml C1 buffer (4 ° C.) and 6 ml ddH ₂ O (4 ° C.). Vortexing was repeated until the pellet was white. The nuclei were then suspended in the remaining buffer using a 200 μl tip. Vortex gently while adding G2 buffer (10 ml) to the suspension nuclei and then vortex vigorously for 30 seconds. Quiagen protease was added (200 μl) and incubated at 50 ° C. for 60 minutes. Incubation and centrifugation were repeated until the lysate was clear (eg, incubated for an additional 30-60 minutes and pelleted at 3000 × g for 10 minutes at 4 ° C.).

Purification of clarified lysate:
(1) Isolation of genomic DNA:
Genomic DNA was equilibrated with 10 ml QBT buffer (1 sample per maximum chip preparation). QF elution buffer was equilibrated at 50 ° C. The sample was vortexed for 30 seconds, then loaded onto the equilibration tip and drained by gravity. The chip was washed with 2x15 ml QC buffer. The DNA was eluted in a 30 ml silanized autoclave 30 ml Cortex tube with 15 ml QF buffer (50 ° C.). Isopropanol (10.5 ml) was added to each sample and the tube was covered with paraffin and mixed by inversion repeatedly until the DNA precipitated. Samples were pelleted by centrifugation for 10 minutes at 15,000 rpm at 4 ° C. in an SS-34 rotor. The pellet position was marked, the supernatant was discarded, and 10 ml of 70% ethanol (4 ° C.) was added. The sample was pelleted again by centrifugation at 10,000 rpm for 10 minutes at 4 ° C. in an SS-34 rotor. The pellet position was marked and the supernatant was discarded. The tubes were then placed on each side of the drying shelf and allowed to dry at 37 ° C. for 10 minutes, taking care to avoid over-drying.
After drying, the pellet was dissolved in 1.0 ml TE (pH 8.5) and placed at 50 ° C. for 1-2 hours. The sample was kept at 4 ° C. overnight to continue dissolution. The DNA solution was then transferred to a 1.5 ml tube equipped with a 26 gauge needle on a tuberculin syringe. The transition was repeated 5x to shear the DNA. The sample was then placed at 50 ° C. for 1-2 hours.

(2) Preparation for genomic DNA quantification and gene amplification assay:
The DNA level in each tube was quantified with a standard A ₂₆₀ , A ₂₈₀ spectrum at a 1:20 dilution (5 μl DNA + 95 μlddH ₂ O) using a 0.1 ml quartz cuvette on a Beckman DU640 spectrophotometer. The A ₂₆₀ / A ₂₈₀ ratio was in the range of 1.8-1.9. Each DNA sample was then diluted to about 200 ng / ml in TE (pH 8.5). If the initial material was at a high concentration (about 700 ng / μl), the material was left for several hours until resuspended at 50 ° C.
The diluted material (20-600 ng / ml) was then subjected to fluorescent DNA quantification with the manufacturer's instructions modified as follows. This was done by warming the Hoeffer DyNA Quant 200 fluorometer for about 15 minutes. Hoechst dye working solution (# H33258, 10 μl, prepared within 12 hours of use) was diluted in 100 ml 1 × TNE buffer. A 2 ml cuvette was filled with the fluorometer solution and placed on the machine, and the machine was zeroed. pGEM3Zf (+) (2 μl, lot # 360851026) was added to a 2 ml fluorometer solution and calibrated to 200 units. An additional 2 μl of pGEM3Zf (+) DNA was then tested and the reading was confirmed at 400 +/− 10 units. Each sample was then read at least three times. When 3 samples were found to be within 10% of each other, they were averaged and this value was used as the quantification value.
The concentration determined by fluorescence measurement was then used to dilute each sample in ddH ₂ O to 10 ng / μl. This was done on all template samples simultaneously for a single TaqMan plate assay and with enough material to perform a 500-1000 assay. Samples were tested in triplicate with Taqman (trade name) primers and probes and are on a single plate with normal human DNA for both B-actin and GAPDH and no template control. Although diluted samples were used, the CT value of normal human DNA subtracted from the test DNA was +/- 1 CT. Diluted, lot-qualified genomic DNA was stored at −80 ° C. in 1.0 ml aliquots. Aliquots subsequently inherited and used for amplification assays were stored at 4 ° C. Each 1 ml aliquot is sufficient for 8-9 plates or 64 tests.

Gene amplification assay:
The PRO polypeptide compounds of the invention are screened on the following primary tumors and the resulting ΔCt values of 1.0 or greater are reported in Table 9.

  Since the various DNA amplifications described above occur in various tumors, the various DNA amplifications appear to be associated with tumor formation and / or growth. As a result, antagonists (eg, antibodies) targeting these polypeptides are expected to be useful in cancer therapy.

Example 171: Identification of receptor / ligand interactions In this assay, various PRO polypeptides were tested for their ability to bind to a panel of potential receptor molecules to identify the receptor / ligand. Identification of a ligand for a known receptor, a receptor for a known ligand or a novel receptor / ligand pair includes, for example, labeling a bioactive molecule (binding to the ligand or receptor) to a receptor or a cell known to express the ligand, Use of a receptor or ligand as a reagent to detect the presence of a receptor or ligand in a composition that is suggested to contain the same, which may constitute a cell that the composition is suggested to express the ligand or receptor, receptor or ligand Regulation of immunity against or in response to cells expressing the organism, the acceptability of preparation of agonists, antagonists and / or antibodies to receptors or ligands that modulate the development of the organism or immune activity of cells expressing the receptor or ligand, and normal For engineers Help in a variety of display, including already apparent various other various display.
The assay is performed as follows. The PRO polypeptide of the present invention, suggested to be a receptor ligand, is expressed as a fusion protein (immunoadhesin) containing the Fc domain of human IgG. Receptor-ligand binding is the interaction of immunoadhesins with cells expressing candidate PRO polypeptide receptors (eg, Cos cells) and the clarification of bound immunoadhesins using fluorescent reagents and microscopic examination of Fc fusion domains. It is detected by visualizing. Cells expressing candidate receptors are generated by transient transfection as well as by transient transfection of a defined subset of a library of cDNA expression vectors encoding PRO polypeptides that can function as receptor molecules. The cells are then incubated for 1 hour in the presence of a PRO polypeptide immunoadhesin that is tested for possible receptor binding. The cells are then washed with paraformaldehyde and fixed. The cells are then incubated with a fluorescent conjugated antibody (eg, a FITC conjugated goat anti-human Fc antibody) to the Fc portion of the PRO polypeptide immunoadhesin. The cells are then washed again and examined with a microscope. Positive interactions are similar to the presence of fluorescent labels in cells transfected with a cDNA or receptor pool encoding a particular PRO polypeptide receptor, and with other cDNA or cDNA pools. Judged by the absence of similar fluorescent labels in the prepared cells. If it is determined that a defined pool of cDNA expression vectors is positive for interaction with a PRO polypeptide immunoadhesin, the individual cDNA species comprising the pool may interact with the PRO polypeptide immunoadhesin. The determination of a specific cDNA encoding a receptor that can act is tested individually (the pool is “degraded”).

In another embodiment of this assay, an epitope-tagged potential ligand PRO polypeptide (eg, 8 histidine “His” tag) is expressed as a fusion with the Fc domain of human IgG (immunoadhesin). It interacts with a panel of potential receptor PRO polypeptides. Following a 1 hour co-incubation with the epitope-tagged PRO polypeptide, each co-receptor is immunocoagulated with protein A beads and the beads are washed. Potential ligand interactions are determined by Western blot analysis of immune coagulation complexes with antibodies against the epitope tag. If an epitope-tagged protein band of the expected molecular weight is observed by Western blot analysis using the candidate receptor, but not observed by other members of the panel of potential receptors, the interaction is considered to exist. Is done.
Using these assays, the following receptor / ligand interactions were identified here:
(1) PRO943 binds to FHF1, PRO183 (FHF2), PRO184 (FHF3), and PRO185 (FHF4), and vice versa.
(2) PRO331 binds to PRO1133 and vice versa.
(3) PRO363 binds to PRO1387 and vice versa.
(4) PRO5723 binds to PRO1387 and vice versa.
(5) PRO1114 binds to PRO3301 and PRO9940 and vice versa.
(6) PRO9828 is shown to be a novel fibroblast growth factor receptor (FGFR) ligand in that it binds to the known FGF receptors FGFR1, FGFR2IIIC, FGFR3IIIC and FGFR4. Thus, PRO9828 and agonists can find use for activating biological activities normally activated by FGF molecules including, for example, cell growth and proliferation. PRO9828 antagonists may find use in inhibiting biological activity mediated through the FGF receptor.
(7) PRO1181 binds to PRO7170, PRO361, and PRO846.

Example 172: Tissue Expression Distribution Oligonucleotide probes were constructed from the PRO polypeptide-encoding nucleotide sequences shown in the accompanying figures in the use of quantitative PCR amplification reactions. Oligonucleotide probes were selected to give an amplified fragment of approximately 200-600 base pairs from the 3 ′ end of the template associated with a standard PCR reaction. Oligonucleotide probes are used in standard quantitative PCR amplification reactions with cDNA libraries isolated from different human adult and / or fetal tissue sources, and the PRO polypeptide-encoding nucleic acid in various tissues tested. Expression levels were analyzed by agarose gel electrophoresis to obtain a quantitative measurement. Knowledge of the expression pattern of a PRO polypeptide-encoding nucleic acid in a variety of different human tissue types is useful for tissue classification with or without other tissue-specific markers to determine primary tissue sources such as metastatic tumors Diagnostic markers are provided. These assays provide the following results:
DNA molecular tissue w / significant expression tissue w / o significant expression
DNA16422-1209 substantia nigra, dendrocyte, uterus hippocampus
DNA16435-1208 substantia nigra, dendrocyte, uterus hippocampus
DNA26843-1389 Dendrocyte, Heart, Uterus, Colon tumor Hippocampus, Substantia nigra, Cartilage
DNA26844-1394 HUVEC, Dendrocyte, Cartilage, Substantia nigra, Hippocampus, Uterus, Prostate
DNA40621-1440 prostate, uterus, colon tumor brain, heart, HUVEC, cartilage
DNA44161-1434 colon tumor, dendrocyte substantia nigra, hippocampus, prostate, uterus
DNA44694-1500 dendrocyte, hippocampus, prostate colon tumor, substantia nigra, heart
DNA48320-1433 Prostate, uterine colon tumor, brain, heart, cartilage
DNA49647-1398 Brain, heart, prostate, uterus cartilage
DNA53913-1490 Hippocampus Black matter, Dendrocyte
DNA53978-1443 Dendrocyte, Uterus, Prostate substantia nigra, Colon tumor
DNA53996-1442 Spleen, prostate, uterus, hippocampus nigra, heart
DNA56050-1455 Prostate, uterus, cartilage, hippocampus heart, colon tumor, dendrocyte
DNA56110-1437 Spleen, colon tumor, brain, prostate heart
DNA56410-1414 Uterus, Dendrocyte Hippocampus, Substantia nigra, Heart
DNA56436-1448 substantia nigra, prostate, hippocampal dendrocyte, heart, HUVEC
DNA56855-1447 prostate, uterus brain, cartilage, heart, colon tumor
DNA56860-1510 Colon tumor Prostate, uterus, dendrocyte
DNA56868-1478 Colon tumor, prostate uterus, brain, heart, cartilage
DNA56869-1545 prostate, uterus, cartilage brain, colon tumor, spleen, heart
DNA57699-1412 Dendrocyte, hippocampus, prostate substantia nigra, heart
DNA57704-1452 Brain, heart, spleen, uterus, prostate colon tumor
DNA57710-1451 Dendrocyte, hippocampus, spleen, uterine nigra, heart
DNA57711-1501 Dendrocyte, Hippocampus, Heart, Cartilage
DNA57827-1493 Colon tumor, hippocampus, prostate substantia nigra, dendrocyte, uterus
DNA58723-1588 Substantia nigra, Cartilage Uterus Hippocampus, Dendrocyte, HUVEC
DNA58743-1609 Brain, prostate, uterine colon tumor, heart, spleen, cartilage
DNA58846-1409 Hippocampus, dendrocyte nigra, uterus, prostate, colon tumor
DNA58849-1494 Prostate Brain, Uterus, Cartilage, Heart, Colon tumor
DNA58850-1495 Spleen, prostate, dendrocyte hippocampus, nigra, colon tumor
DNA59213-1487 Spleen, cartilage, prostate, nigral heart, hippocampus, dendrocyte
DNA59497-1496 Dendrocyte, prostate, uterus, heart cartilage, hippocampus, substantia nigra
DNA59605-1418 Dendrocyte, Prostate, Uterus Hippocampus, Substantia nigra, Colon tumor
DNA59609-1470 dendrocyte nigra, hippocampus, heart, prostate, uterus, spleen
DNA59612-1466 Prostate, Dendrocyte Hippocampus, Substantia nigra, Uterus, Colon tumor
DNA59616-1465 Dendrocyte, substantia nigra, colon tumor Hippocampus
DNA59619-1464 Dendrocyte, substantia nigra, colon tumor Hippocampus
DNA59625-1498 Brain, colon tumor, prostate, uterus THP-1 macrophage
DNA59827-1426 substantia nigra, prostate, uterus hippocampus, dendrocyte, heart
DNA59828-1608 Dendrocyte, substantia nigra, colon tumor Hippocampus
DNA59853-1505 Prostate Brain, Uterus, Spleen, Heart, Colon tumor
DNA59854-1459 Cartilage Prostate, brain, heart, colon tumor
DNA60283-1484 Dendrocyte, Spleen, Prostate, Uterus Hippocampus, Substantia nigra, Heart
DNA60619-1482 Dendrocyte, substantia nigra, colon tumor Hippocampus
DNA60625-1507 Cartilage Prostate, brain, heart, colon tumor
DNA60629-1481 Uterus, colon tumor, substantia nigra hippocampus, dendrocyte, spleen, prostate
DNA61755-1554 Dendrocyte, substantia nigra, colon tumor Hippocampus
DNA64852-1589 Prostate, uterus brain, heart, cartilage, colon tumor
DNA66308-1537 prostate, heart uterus brain, colon tumor, cartilage
DNA68869-1610 Spleen, prostate, heart, uterus, colon tumor, substantia nigra hippocampus, dendrocyte, prostate

Example 173: Isolation of cDNA clones encoding human PRO846 Consensus sequences are obtained for various EST sequences as described in Example 1 above, and the resulting consensus sequence is herein designated DNA39949 . Based on the DNA39949 consensus sequence, oligonucleotides were synthesized for 1) identifying a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO846 did.
Forward and reverse primers were synthesized:
Forward PCR primer 5'-CCCTGCAGTGCACCTACAGGGAAG-3 '(SEQ ID NO: 518)
Reverse PCR primer 5'-CTGTCTTCCCCTGCTTGGCTGTGG-3 '(SEQ ID NO: 519)
In addition, a synthetic oligonucleotide hybridization probe was generated from the consensus DNA39949 sequence having the following nucleic acid sequence:
Hybridization probe
5'-GGTGCAGGAAGGGTGGGATCCTCTTCTCTCGCTGCTCTGGCCACATC-3 '(SEQ ID NO: 520)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO846 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal kidney tissue (LIB227).
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO846 [here designated as UNQ422 (DNA44196-1353)] (SEQ ID NO: 215) and the derived protein sequence of PRO846.
The entire nucleic acid sequence of UNQ422 (DNA44196-1353) is shown in FIG. 329 (SEQ ID NO: 516). Clone UNQ422 (DNA44195-1353) contains a single open reading frame, has an apparent translation start site at nucleotide positions 25-27, and ends with a stop codon at nucleotide positions 1021-1023 (FIG. 329). The predicted polypeptide precursor is 332 amino acids long (Figure 330). The full-length PRO846 protein shown in FIG. 330 has an estimated molecular weight of about 36,143 daltons and a pI of about 5.89. The key regions of the amino acid sequence of PRO846 are, as shown in FIG. 330, sequences typical for signal peptides, transmembrane domains, N-glycosylation sites, fibrinogen beta and gamma chain C-terminal domains, and Ig-like V-type Contains sequences typical of domains. Clone UNQ422 (DNA44196-1353) has been deposited with ATCC and is assigned ATCC deposit no.

Example 174: Isolation of cDNA clones encoding human PRO363 Consensus sequences were obtained for various EST sequences as described in Example 1 above, and the resulting consensus sequence is herein designated DNA42828 . Based on the DNA42828 consensus sequence, oligonucleotides were synthesized for 1) identifying a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO363. did.
PCR primer pairs (forward and reverse) were synthesized:
Forward PCR primer (42828.f1) 5'-CCAGTGCACAGCAGGCAACGAAGC-3 '(SEQ ID NO: 521)
Reverse PCR primer (42828.r1) 5'-ACTAGGCTGTATGCCTGGGTGGGC-3 '(SEQ ID NO: 522)
In addition, synthetic oligonucleotide hybridization probes were generated from the consensus DNA42828 sequence having the following nucleic acid sequences:
Hybridization probe (42828.p1)
5'-GTATGTACAAAGCATCGGCATGGTTGCAGGAGCAGTGACAGGC-3 '(SEQ ID NO: 523)
To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pairs identified above. The positive library was then used to isolate a clone encoding the PRO363 gene using one of the probe oligonucleotide and PCR primer pair. RNA for construction of the cDNA library was isolated from human fetal kidney tissue (LIB227).
The DNA sequence of the clone isolated as described above gave the full-length DNA sequence of PRO363 [here designated as UNQ318 (DNA45419-1252)] (SEQ ID NO: 500) and the derived protein sequence of PRO363.
The entire nucleic acid sequence of UNQ318 (DNA45419-1252) is shown in FIG. 313 (SEQ ID NO: 500). Clone UNQ318 (DNA45419-1252) contains a single open reading frame, has an apparent translation start site at nucleotide positions 190-192, and ends with a stop codon at nucleotide positions 1309-1311 (FIG. 313). The predicted polypeptide precursor is 373 amino acids long (Figure 314). The full-length PRO363 protein shown in FIG. 314 has a molecular weight of about 41.281 and a pI of about 8.33. A transmembrane domain exists at amino acids 221 to 254 of the amino acid sequence shown in FIG. 314 (SEQ ID NO: 501). The PRO363 polypeptide also has at least two myelin PO protein domains at about amino acids 15-56 and about amino acids 87-116. Clone UNQ318 (DNA45419-1252) was deposited with the ATCC on February 5, 1998 and is assigned ATCC deposit number 209616.
Analysis of the amino acid sequence of the full-length PRO363 polypeptide suggests that it has significant sequence similarity with the cell surface protein HCAR, indicating that PRO363 can be a novel HCAR homolog. More specifically, the Dayhoff database (version 35.45 SwissProt 35) is significant between the PRO363 amino acid sequence and the following Dayhoff sequences: HS46KDA_1, HSU90716_1, MMCARH_1, MMCARHOM_1, MMU90715_1, A33_HUMAN, P_W14146, P_W14158, A42632, and B42632 Homology revealed.

Example 175: Isolation of cDNA clones encoding human PRO9828 were constructed for other nucleic acid sequences using the phrap consensus as described in Example 1 above. This consensus sequence is herein designated DNA139814. Based on the DNA139814 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate a clone of the full-length coding sequence of PRO9828. did. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to yield PCR products that are approximately 100-1000 bp long. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs according to Ausubel et al., Current Protocols in Molecular Biology, supra. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
PCR primers (forward and reverse) were synthesized:
5'-AATCTCAGCACCAGCCACTCAGAGCA-3 '(SEQ ID NO: 524)
5'-GTTAAAGAGGGTGCCCTTCCAGCGA -3 '(SEQ ID NO: 525)
5'-TATCCCAATGCCTCCCCACTGCTC -3 '(SEQ ID NO: 526)
5'-GATGAACTTGGCGAAGGGGCGGCA-3 '(SEQ ID NO: 527)

RNA for construction of the cDNA library was isolated from human fetal liver tissue. The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, California. The cDNA is primed with oligo dT containing a NotI site, bound to a SalI hemikinase adapter at the blunt end, cut with NotI, appropriately sized by gel electrophoresis, and an appropriate cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain an SfiI site; see Holmes et al., Science, 253: 1278-1280 (1991)), cloned in the specified orientation at unique XhoI and NotI sites.
By DNA sequencing of the clones isolated as described above, the full-length DNA sequence of the full-length PRO9828 polypeptide (herein referred to as DNA142238-2768 [Figure 323, SEQ ID NO: 510]) and the induction of the PRO9828 polypeptide A protein sequence was obtained.
The full-length clone identified above contains an apparent transcription start site at nucleotide positions 232-234, a stop signal at nucleotide positions 985-987 (FIG. 323, SEQ ID NO: 510). The predicted polypeptide precursor has a length of 251 amino acids, an estimated molecular weight of about 27954 daltons, and an estimated PI of about 9.22. Analysis of the full-length PRO9828 sequence shown in FIG. 324 (SEQ ID NO: 511) reveals the presence of various important polypeptide domains as shown in FIG. 324, where these important polypeptide domains The position to give is approximate as described above. The chromosomal map shows that the PRO9828-encoding nucleic acid is located on chromosome 12p13 in humans. Clone DNA142238-2768 has been deposited with ATCC on Oct. 5, 1999 and is assigned ATCC deposit no. 819-PTA.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using ALIGN-2 sequence alignment analysis of the full-length sequence shown in FIG. Sequence identity between FGF3_HUMAN, P_R70824, S54407, P_R80780, P_Y23761, P_W92312, OMFGF6_1 and P_R80871 was demonstrated.

Example 176: Isolation of cDNA Clones Encoding Human PRO7170 DNA108722-2743 is a proprietary sequence discovery algorithm developed by Genentech, Inc. (South San Francisco, Calif.) Using public (eg, GenBank) and / or private was identified by applying the ^{(LIFESEQ R Incyte Pharmaceuticals, Inc.,} Palo Alto, CA) ESTs and clustered and constructed EST fragments from the database. The signal sequence algorithm calculates a secretory signal score based on the nature of the DNA nucleotide surrounding the first, possibly second, methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotide following the first ATG must encode at least 35 unambiguous amino acids without a stop codon. If the first ATG has the required amino acid, the second is not tested. If none of the requirements were met, the candidate sequence was not scored. In order to determine whether an EST sequence contains a genuine signal sequence, a set of seven sensors (evaluation parameters) known to be associated with the secretory signal, the DNA surrounding the ATG codon and the corresponding amino acid sequence. Used to score. Through the use of this algorithm, a number of polypeptide-encoding nucleic acid sequences have been identified.
The use of the signal sequence algorithm described above allowed the identification of an EST cluster sequence, designated herein as CLU57836, from the LIFESEQ ^R database Incyte Pharmaceuticals, Palo Alto ,. This EST cluster sequence was compared to public databases (e. G., GenBank) and my own EST DNA database ^{(LIFESEQ R, Incyte Pharmaceuticals, Palo} Alto, CA) and various expression sequence tag containing (EST) database, there To identify the homology. Homologue searches were performed using the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). These comparisons, which do not encode known proteins and have a BLAST score of 70 (may be 90) or higher, are grouped and consensused by the program “phrap” (Phil Green, University of Washington, Seattle, Washington). A DNA sequence was constructed. The consensus sequence obtained therefrom is designated herein as DNA58756.

In view of the sequence homology found in the EST sequence encompassed by the DNA58756 sequence and no.2251462 from the Incyte (Incyte Pharmaceuticals, Palo Alto, CA Incyte) database, clone no.2251462 was purchased and its cDNA insert was obtained. Was determined. Here, it was found that the cDNA insert encodes a full-length protein. Here, it was found that the cDNA insert encodes a full-length protein. The sequence of this cDNA insert is shown in FIG. 325 and is herein designated as DNA108722-2743.
Clone DNA108722-2743 contains a single open reading frame, has an apparent translation start site at nucleotide positions 60-62, and ends with a stop codon at nucleotide positions 1505-1508 (FIG. 325). The predicted polypeptide precursor is 482 amino acids long (Figure 326). The full length PRO7170 protein shown in FIG. 326 has an estimated molecular weight of about 49060 and a pI of about 4.74. Analysis of the full-length PRO7170 sequence shown in FIG. 326 (SEQ ID NO: 513) demonstrates the existence of various important polypeptide domains as shown in FIG. 326 and is given to these important polypeptide domains. The approximate location is as described above. Clone DNA108722-2743 was deposited with ATCC on August 17, 1999 and was assigned ATCC deposit number 552-PTA.
Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in FIG. 326 (SEQ ID NO: 513) shows the PRO7170 amino acid sequence and the following Dayhoff sequence: P_Y12291, Sequence identity between I47141, D88733_1, DMC56G7_1, P_Y11606, HWP1_CANAL, HSMUC5BEX_1, HSU78550_1, HSU70136_1, and SGS3_DROME was revealed.

Example 177: Isolation of cDNA clones encoding human PRO361 Consensus DNA sequences were assembled against other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA40654. Based on the DNA40654 consensus sequence, oligonucleotides were synthesized for 1) identifying a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the PRO361 full-length coding sequence. .
Forward and reverse PCR primers were synthesized as follows:
Forward PCR primer 5'-AGGGAGGATTATCCTTGACCTTTGAAGACC-3 '(SEQ ID NO: 528)
Forward PCR primer 5′-GAAGCAAGTGCCCAGCTC-3 ′ (SEQ ID NO: 529)
Forward PCR primer 5'-CGGGTCCCTGCTCTTTGG-3 '(SEQ ID NO: 530)
Reverse PCR primer 5'-CACCGTAGCTGGGAGCGCACTCAC-3 '(SEQ ID NO: 531)
Reverse PCR primer 5'-AGTGTAAGTCAAGCTCCC-3 '(SEQ ID NO: 532)
In addition, a synthetic oligonucleotide hybridization probe having the following nucleotide sequence was generated from the consensus DNA40654 sequence.
Hybridization probe
5'-GCTTCCTGACACTAAGGCTGTCTGCTAGTCAGAATTGCCTCAAAAAGAG-3 '(SEQ ID NO: 427)
To screen several libraries for a source of full-length clones, DNA from the libraries was screened by PCR amplification of one of the PCR primer pairs identified above. The positive library was then used to isolate clones encoding the PRO361 gene using probe oligonucleotides. RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
DNA sequencing of the clones isolated as described above yielded the full-length DNA sequence of PRO361 [herein named DNA45410-1250] (SEQ ID NO: 514) and the derived protein sequence of PRO361.
The entire nucleotide sequence of DNA45410-1250 is shown in FIG. 327 (SEQ ID NO: 514). Clone DNA45410-1250 contains a single open reading frame, has an apparent translation start site at nucleotide positions 226-228, and ends with a stop codon at nucleotide positions 1519-1521 (FIG. 327). The predicted polypeptide precursor is 431 amino acids long (Figure 328). The full-length PRO361 protein shown in FIG. 328 has an estimated molecular weight of about 46,810 daltons and a pI of about 6.45. Also shown in FIG. 328 is a region of interest that includes a transmembrane domain (amino acids 380-409) and sequences typical for the arginase protein family (amino acids 3-14 and 39-57). Clone DNA45410-1250 has been deposited with ATCC and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO361 polypeptide suggests that the portion has significant homology with mucin and / or chitinase protein, indicating that PRO361 may be a novel mucin and / or chitinase protein. Show.

Example 178: Isolation of cDNA clones encoding human PRO183, PRO184, PRO185, PRO5723, PRO3301, or PRO9940 DNA molecule encoding human PRO183, PRO184, PRO185, PRO5723, PRO3301 or PRO9940 polypeptide shown in the accompanying drawings Was obtained through GenBank.

Deposits of materials The following materials were deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209, USA (ATCC):
Table 10
Material ATCC Deposit Number Deposit Date
DNA45410-1250 ATCC 209612 February 5, 1998
DNA108722-2743 ATCC 522-PTA August 17, 1999
DNA142238-2768 ATCC 819-PTA October 5, 1999
DNA40981-1234 ATCC 209439 7 November 1997
DNA45419-1252 ATCC 209616 February 5, 1998
DNA44196-1353 ATCC 209847 May 6, 1998
DNA16422-1209 ATCC 209929 June 2, 1998
DNA16435-1208 ATCC 209930 June 2, 1998
DNA21624-1391 ATCC 209917 June 2, 1998
DNA23334-1392 ATCC 209918 June 2, 1998
DNA26288-1239 ATCC 209792 Apr 21, 1998
DNA26843-1389 ATCC 203099 August 4, 1998
DNA26844-1394 ATCC 209926 June 2, 1998
DNA30862-1396 ATCC 209920 June 2, 1998
DNA35680-1212 ATCC 209790 Apr 21, 1998
DNA40621-1440 ATCC 209922 June 2, 1998
DNA44161-1434 ATCC 209907 May 27, 1998
DNA44694-1500 ATCC 203114 August 11, 1998
DNA45495-1550 ATCC 203156 25 August 1998
DNA47361-1154 ATCC 209431 7 November 1997
DNA47394-1572 ATCC 203109 August 11, 1998
DNA48320-1433 ATCC 209904 May 27, 1998
DNA48334-1435 ATCC 209924 June 2, 1998
DNA48606-1479 ATCC 203040 July 1, 1998
DNA49141-1431 ATCC 203003 June 23, 1998
DNA49142-1430 ATCC 203002 Jun 23, 1998
DNA49143-1429 ATCC 203013 23 June 1998
DNA49647-1398 ATCC 209919 June 2, 1998
DNA49819-1439 ATCC 209931 June 2, 1998
DNA49820-1427 ATCC 209932 June 2, 1998
DNA49821-1562 ATCC 209981 June 16, 1998
DNA52192-1369 ATCC 203042 July 1, 1998
DNA52598-1518 ATCC 203107 August 11, 1998
DNA53913-1490 ATCC 203162 25 August 1998
DNA53978-1443 ATCC 209983 June 16, 1998
DNA53996-1442 ATCC 209921 June 2, 1998
DNA56041-1416 ATCC 203012 Jun 23, 1998
DNA56047-1456 ATCC 209948 Jun 9, 1998
DNA56050-1455 ATCC 203011 Jun 23, 1998
DNA56110-1437 ATCC 203113 August 11, 1998
DNA56113-1378 ATCC 203049 July 1, 1998
DNA56410-1414 ATCC 209923 June 2, 1998
DNA56436-1448 ATCC 209902 May 27, 1998
DNA56855-1447 ATCC 203004 June 23, 1998
DNA56859-1445 ATCC 203019 Jun 23, 1998
DNA56860-1510 ATCC 209952 9 June 1998
DNA56865-1491 ATCC 203022 June 23, 1998
DNA56866-1342 ATCC 203023 June 23, 1998
DNA56868-1209 ATCC 203024 June 23, 1998
DNA56869-1545 ATCC 203161 25 August 1998
DNA56870-1492 ATCC 209925 June 2, 1998
DNA57033-1403 ATCC 209905 May 27, 1998
DNA57037-1444 ATCC 209903 May 27, 1998
DNA57129-1413 ATCC 209977 June 16, 1998
DNA57690-1374 ATCC 209950 Jun 9, 1998
DNA57693-1424 ATCC 203008 Jun 23, 1998
DNA57694-1341 ATCC 203017 Jun 23, 1998
DNA57695-1340 ATCC 203006 Jun 23, 1998
DNA57699-1412 ATCC 203020 June 23, 1998
DNA57702-1476 ATCC 209951 Jun 9, 1998
DNA57704-1452 ATCC 209953 9 June 1998
DNA57708-1411 ATCC 203021 Jun 23, 1998
DNA57710-1451 ATCC 203048 July 1, 1998
DNA57711-1501 ATCC 203047 July 1, 1998
DNA57827-1493 ATCC 203045 July 1, 1998
DNA57834-1339 ATCC 209954 9 June 1998
DNA57836-1338 ATCC 203025 Jun 23, 1998
DNA57838-1337 ATCC 203014 23 June 1998
DNA57844-1410 ATCC 203010 Jun 23, 1998
DNA58721-1475 ATCC 203110 August 11, 1998
DNA58723-1588 ATCC 203133 August 18, 1998
DNA58737-1473 ATCC 203136 August 18, 1998
DNA58743-1609 ATCC 203154 25 August 1998
DNA58846-1409 ATCC 209957 9 June 1998
DNA58848-1472 ATCC 209955 June 9, 1998
DNA58849-1494 ATCC 209958 Jun 9, 1998
DNA58850-1495 ATCC 209956 9 June 1998
DNA58853-1423 ATCC 203016 23 June 1998
DNA58855-1422 ATCC 203018 June 23, 1998
DNA59205-1421 ATCC 203009 Jun 23, 1998
DNA59211-1450 ATCC 209960 June 9, 1998
DNA59213-1487 ATCC 209959 9 June 1998
DNA59214-1449 ATCC 203046 July 1, 1998
DNA59215-1425 ATCC 209961 Jun 9, 1998
DNA59220-1514 ATCC 209962 Jun 9, 1998
DNA59488-1603 ATCC 203157 August 25, 1998
DNA59493-1420 ATCC 203050 July 1, 1998
DNA59497-1496 ATCC 209941 June 4, 1998
DNA59588-1571 ATCC 203106 August 11, 1998
DNA59603-1419 ATCC 209944 9 June 1998
DNA59605-1418 ATCC 203005 Jun 23, 1998
DNA59606-1471 ATCC 209945 9 June 1998
DNA59607-1497 ATCC 209957 Jun 9, 1998
DNA59609-1470 ATCC 209963 June 9, 1998
DNA59610-1559 ATCC 209990 June 16, 1998
DNA59612-1466 ATCC 209947 Jun 9, 1998
DNA59613-1417 ATCC 203007 Jun 23, 1998
DNA59616-1465 ATCC 209991 June 16, 1998
DNA59619-1464 ATCC 203041 July 1, 1998
DNA59620-1463 ATCC 209989 June 16, 1998
DNA59625-1498 ATCC 209992 June 17, 1998
DNA59767-1489 ATCC 203108 Aug 11, 1998
DNA59776-1600 ATCC 203128 August 18, 1998
DNA59777-1480 ATCC 203111 August 11, 1998
DNA59820-1549 ATCC 203129 August 18, 1998
DNA59827-1426 ATCC 203089 August 4, 1998
DNA59828-1608 ATCC 203158 August 25, 1998
DNA59838-1462 ATCC 209976 June 16, 1998
DNA59839-1461 ATCC 209988 June 16, 1998
DNA59841-1460 ATCC 203044 July 1, 1998
DNA59842-1502 ATCC 209982 June 16, 1998
DNA59846-1503 ATCC 209978 June 16, 1998
DNA59847-1511 ATCC 203098 August 4, 1998
DNA59848-1512 ATCC 203088 August 4, 1998
DNA59849-1504 ATCC 209986 June 16, 1998
DNA59853-1505 ATCC 209985 June 16, 1998
DNA59854-1459 ATCC 209974 June 16, 1998
DNA60283-1484 ATCC 203043 July 1, 1998
DNA60615-1483 ATCC 209980 June 16, 1998
DNA60619-1482 ATCC 209993 June 16, 1998
DNA60621-1516 ATCC 203091 Aug 4, 1998
DNA60622-1525 ATCC 203090 Aug 4, 1998
DNA60625-1507 ATCC 209975 June 16, 1998
DNA60627-1508 ATCC 203092 August 4, 1998
DNA60629-1481 ATCC 209979 June 16, 1998
DNA61755-1554 ATCC 203112 Aug 11, 1998
DNA61873-1574 ATCC 203132 August 18, 1998
DNA62814-1521 ATCC 203093 Aug 4, 1998
DNA62872-1509 ATCC 203100 August 4, 1998
DNA62876-1517 ATCC 203095 August 4, 1998
DNA62881-1515 ATCC 203096 August 4, 1998
DNA64852-1589 ATCC 203127 August 18, 1998
DNA64884-1527 ATCC 203155 August 25, 1998
DNA64890-1612 ATCC 203131 August 18, 1998
DNA65412-1523 ATCC 203094 Aug 4, 1998
DNA66308-1537 ATCC 203159 25 August 1998
DNA66309-1538 ATCC 203235 September 15, 1998
DNA67004-1614 ATCC 203115 August 11, 1998
DNA68869-1610 ATCC 203164 25 August 1998
DNA68872-1620 ATCC 203160 August 25, 1998
DNA71159-1617 ATCC 203135 August 18, 1998

This deposit was made in accordance with the provisions of the Budapest Treaty and its regulations (Budapest Treaty) on the international recognition of the deposit of microorganisms in the patent procedure. This assures that the viable culture of the deposit is maintained for 30 years from the date of deposit. Deposits may be obtained from the ATCC in accordance with the terms of the Budapest Treaty and in accordance with the agreement between Genentech and ATCC, regardless of which is the first issue of the relevant U.S. patent or any Ensures that the progeny of the deposited culture are made available permanently and unrestricted at the time of publication of the US or foreign patent application, and is subject to 35 USC 122 and the Patent Office Commissioner Regulation (specifically 37 CFR of reference number 886OG638). Guarantees that the offspring will be available to those who have been determined to have rights in accordance with (including Section 1.14).
The assignee of this application agrees that if the deposited culture dies or is lost or destroyed when cultured under appropriate conditions, the material will be immediately replaced with the same other upon notification. To do. The availability of deposited materials is not considered a license to practice the present invention in violation of rights granted under any governmental authority in accordance with patent law.
The above written description is considered to be sufficient to enable one skilled in the art to practice the invention. The deposited embodiments are intended as an illustration of certain aspects of the invention, and since any functionally equivalent product is within the scope of the invention, the deposited product will limit the scope of the invention. It is not limited. The deposit of material herein does not admit that the written description contained herein is insufficient to allow implementation of any aspect of the present invention, including its best mode, and that It is not to be construed as limiting the scope of the claims for the particular illustrations represented. Indeed, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

The nucleotide sequence of the native sequence PRO281 (UNQ244) cDNA (SEQ ID NO: 1) is shown. SEQ ID NO: 1 is a clone designated herein as “DNA16422-1209”. 2 shows an amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEQ ID NO: 1 shown in FIG. The nucleotide sequence of the native sequence PRO276 (UNQ243) cDNA (SEQ ID NO: 5) is shown. SEQ ID NO: 5 is a clone designated herein as “DNA16435-1208”. The amino acid sequence (SEQ ID NO: 6) derived from the coding sequence of SEQ ID NO: 5 shown in FIG. 3 is shown. The nucleotide sequence (SEQ ID NO: 7) of the native sequence PRO189 (UNQ163) cDNA is shown. SEQ ID NO: 7 is a clone designated herein as “DNA21642-1391”. FIG. 6 shows an amino acid sequence (SEQ ID NO: 8) derived from the coding sequence of SEQ ID NO: 7 shown in FIG. Here, the nucleotide sequence designated as DNA14187 (SEQ ID NO: 9) is shown. The nucleotide sequence (SEQ ID NO: 13) of the native sequence PRO190 (UNQ164) cDNA is shown. SEQ ID NO: 13 is a clone designated herein as “DNA23334-1392”. FIG. 9 shows an amino acid sequence (SEQ ID NO: 14) derived from the coding sequence of SEQ ID NO: 13 shown in FIG. Here, the nucleotide sequence designated as DNA14232 (SEQ ID NO: 15) is shown. The nucleotide sequence (SEQ ID NO: 19) of the native sequence PRO341 (UNQ300) cDNA is shown. SEQ ID NO: 19 is a clone designated herein as “DNA26288-1239”. This shows the amino acid sequence (SEQ ID NO: 20) derived from the coding sequence of SEQ ID NO: 19 shown in FIG. Here, the nucleotide sequence designated as DNA12920 (SEQ ID NO: 21) is shown. The nucleotide sequence (SEQ ID NO: 22) of the native sequence PRO180 (UNQ154) cDNA is shown. SEQ ID NO: 22 is a clone designated herein as “DNA26843-1389”. The amino acid sequence (SEQ ID NO: 23) derived from the coding sequence of SEQ ID NO: 22 shown in FIG. 14 is shown. Here, the nucleotide sequence designated as DNA12922 (SEQ ID NO: 24) is shown. The nucleotide sequence (SEQ ID NO: 27) of the native sequence PRO194 (UNQ168) cDNA is shown. SEQ ID NO: 27 is a clone designated herein as “DNA26844-1394”. The amino acid sequence (SEQ ID NO: 28) derived from the coding sequence of SEQ ID NO: 27 shown in FIG. The nucleotide sequence (SEQ ID NO: 29) of the native sequence PRO203 (UNQ177) cDNA is shown. SEQ ID NO: 29 is a clone designated herein as “DNA30862-1396”. The amino acid sequence (SEQ ID NO: 30) derived from the coding sequence of SEQ ID NO: 29 shown in FIG. Here, the nucleotide sequence designated as DNA15618 (SEQ ID NO: 31) is shown. The nucleotide sequence (SEQ ID NO: 32) of the native sequence PRO290 (UNQ253) cDNA is shown. SEQ ID NO: 32 is a clone designated herein as “DNA35680-1212”. The amino acid sequence (SEQ ID NO: 33) derived from the coding sequence of SEQ ID NO: 32 shown in FIG. The nucleotide sequence (SEQ ID NO: 35) of the native sequence PRO874 (UNQ441) cDNA is shown. SEQ ID NO: 35 is a clone designated herein as “DNA40621-1440”. FIG. 25 shows the amino acid sequence (SEQ ID NO: 36) derived from the coding sequence of SEQ ID NO: 35 shown in FIG. The nucleotide sequence (SEQ ID NO: 40) of the native sequence PRO710 (UNQ374) cDNA is shown. SEQ ID NO: 40 is a clone designated herein as “DNA44161-1434”. 27 shows the amino acid sequence (SEQ ID NO: 41) derived from the coding sequence of SEQ ID NO: 40 shown in FIG. Here, the nucleotide sequence designated as DNA38190 (SEQ ID NO: 42) is shown. The nucleotide sequence (SEQ ID NO: 46) of the native sequence PRO1151 (UNQ581) cDNA is shown. SEQ ID NO: 46 is a clone designated herein as “DNA44694-1500”. The amino acid sequence (SEQ ID NO: 47) derived from the coding sequence of SEQ ID NO: 46 shown in FIG. 29 is shown. The nucleotide sequence (SEQ ID NO: 51) of the native sequence PRO1282 (UNQ652) cDNA is shown. SEQ ID NO: 51 is a clone designated herein as “DNA45495-1550”. The amino acid sequence (sequence number: 52) derived from the coding sequence of sequence number: 51 shown in FIG. 31 is shown. The nucleotide sequence (SEQ ID NO: 56) of the native sequence PRO358 cDNA is shown. SEQ ID NO: 56 is a clone designated herein as “DNA47361-1154”. An amino acid sequence (SEQ ID NO: 57) derived from the coding sequence of SEQ ID NO: 56 shown in FIG. 33 is shown. The nucleotide sequence of the native sequence PRO1310 cDNA (SEQ ID NO: 61) is shown. SEQ ID NO: 61 is a clone designated herein as “DNA47394-1572”. It shows the amino acid sequence (SEQ ID NO: 62) derived from the coding sequence of SEQ ID NO: 61 shown in FIGS. 35A-B. The nucleotide sequence (SEQ ID NO: 66) of the native sequence PRO698 (UNQ362) cDNA is shown. SEQ ID NO: 66 is a clone designated herein as “DNA48320-1433”. An amino acid sequence (SEQ ID NO: 67) derived from the coding sequence of SEQ ID NO: 66 shown in FIG. 37 is shown. Here, the nucleotide sequence designated as DNA39906 (SEQ ID NO: 68) is shown. The nucleotide sequence (SEQ ID NO: 72) of the native sequence PRO732 (UNQ396) cDNA is shown. SEQ ID NO: 72 is a clone designated herein as “DNA48334-1435”. The amino acid sequence (SEQ ID NO: 73) derived from the coding sequence of SEQ ID NO: 72 shown in FIG. 40 is shown. Here, the nucleotide sequence designated as DNA20239 (SEQ ID NO: 74) is shown. Here, the nucleotide sequence designated as DNA38050 (SEQ ID NO: 75) is shown. Here, the nucleotide sequence designated as DNA40683 (SEQ ID NO: 76) is shown. Here, the nucleotide sequence designated as DNA42580 (SEQ ID NO: 77) is shown. The nucleotide sequence (SEQ ID NO: 83) of the native sequence PRO1120 (UNQ559) cDNA is shown. SEQ ID NO: 83 is a clone designated herein as “DNA48606-1479”. 46A shows the amino acid sequence (SEQ ID NO: 84) derived from the coding sequence of SEQ ID NO: 83 shown in FIGS. 46A-B. The nucleotide sequence (SEQ ID NO: 94) of the native sequence PRO537 (UNQ338) cDNA is shown. SEQ ID NO: 94 is a clone designated herein as “DNA49141-1431”. 48 shows the amino acid sequence (SEQ ID NO: 95) derived from the coding sequence of SEQ ID NO: 94 shown in FIG. The nucleotide sequence (SEQ ID NO: 96) of the native sequence PRO536 (UNQ337) cDNA is shown. SEQ ID NO: 96 is a clone designated herein as “DNA49142-1430”. An amino acid sequence (SEQ ID NO: 97) derived from the coding sequence of SEQ ID NO: 96 shown in FIG. 50 is shown. The nucleotide sequence (SEQ ID NO: 98) of the native sequence PRO535 (UNQ336) cDNA is shown. SEQ ID NO: 98 is a clone designated herein as “DNA49143-1429”. 52 shows the amino acid sequence (SEQ ID NO: 99) derived from the coding sequence of SEQ ID NO: 98 shown in FIG. Here, the nucleotide sequence designated as DNA30861 (SEQ ID NO: 100) is shown. Here, the nucleotide sequence designated as DNA36351 (SEQ ID NO: 101) is shown. The nucleotide sequence (SEQ ID NO: 102) of the native sequence PRO718 (UNQ386) cDNA is shown. SEQ ID NO: 102 is a clone designated herein as “DNA49647-1398”. The amino acid sequence (SEQ ID NO: 103) derived from the coding sequence of SEQ ID NO: 102 shown in FIG. 56 is shown. Here, the nucleotide sequence designated as DNA15386 (SEQ ID NO: 104) is shown. Here, the nucleotide sequence designated as DNA 16630 (SEQ ID NO: 105) is shown. Here, the nucleotide sequence designated as DNA16829 (SEQ ID NO: 106) is shown. Here, the nucleotide sequence designated as DNA28357 (SEQ ID NO: 107) is shown. Here, the nucleotide sequence designated as DNA43512 (SEQ ID NO: 108) is shown. The nucleotide sequence (SEQ ID NO: 112) of the native sequence PRO872 (UNQ439) cDNA is shown. SEQ ID NO: 112 is a clone designated herein as “DNA49819-1439”. An amino acid sequence (SEQ ID NO: 113) derived from the coding sequence of SEQ ID NO: 112 shown in FIG. 63 is shown. The nucleotide sequence (SEQ ID NO: 114) of the native sequence PRO1063 (UNQ128) cDNA is shown. SEQ ID NO: 114 is a clone designated herein as “DNA49820-1427”. An amino acid sequence (SEQ ID NO: 115) derived from the coding sequence of SEQ ID NO: 114 shown in FIG. 65 is shown. The nucleotide sequence (SEQ ID NO: 116) of the native sequence PRO619 (UNQ355) cDNA is shown. SEQ ID NO: 116 is a clone designated herein as “DNA49821-1562”. The amino acid sequence (SEQ ID NO: 117) derived from the coding sequence of SEQ ID NO: 116 shown in FIG. 67 is shown. The nucleotide sequence (SEQ ID NO: 118) of the native sequence PRO943 (UNQ480) cDNA is shown. SEQ ID NO: 118 is a clone designated herein as “DNA52192-1369”. The amino acid sequence (SEQ ID NO: 119) derived from the coding sequence of SEQ ID NO: 118 shown in FIG. 69 is shown. The nucleotide sequence (SEQ ID NO: 123) of the native sequence PRO1188 (UNQ602) cDNA is shown. SEQ ID NO: 123 is a clone designated herein as “DNA52598-1518”. An amino acid sequence (SEQ ID NO: 124) derived from the coding sequence of SEQ ID NO: 123 shown in FIG. 71 is shown. The nucleotide sequence (SEQ ID NO: 128) of the native sequence PRO1133 (UNQ571) cDNA is shown. SEQ ID NO: 128 is a clone designated herein as “DNA53913-1490”. The amino acid sequence (SEQ ID NO: 129) derived from the coding sequence of SEQ ID NO: 128 shown in FIG. 73 is shown. 1 shows the nucleotide sequence of the native sequence PRO784 (UNQ459) cDNA (SEQ ID NO: 134). SEQ ID NO: 134 is a clone designated herein as “DNA53978-1443”. 75 shows the amino acid sequence (SEQ ID NO: 135) derived from the coding sequence of SEQ ID NO: 134 shown in FIG. Here, the nucleotide sequence designated as DNA44661 (SEQ ID NO: 136) is shown. The nucleotide sequence (SEQ ID NO: 137) of the native sequence PRO783 (UNQ458) cDNA is shown. SEQ ID NO: 137 is a clone designated herein as “DNA53996-1442”. 78 shows the amino acid sequence (SEQ ID NO: 138) derived from the coding sequence of SEQ ID NO: 137 shown in FIG. Here, a nucleotide sequence designated as DNA45201 (SEQ ID NO: 139) is shown. Here, the nucleotide sequence designated as DNA14575 (SEQ ID NO: 140) is shown. The nucleotide sequence (SEQ ID NO: 145) of the native sequence PRO820 (UNQ503) cDNA is shown. SEQ ID NO: 145 is a clone designated herein as “DNA56041-1416”. The amino acid sequence (SEQ ID NO: 146) derived from the coding sequence of SEQ ID NO: 145 shown in FIG. 82 is shown. The nucleotide sequence (SEQ ID NO: 147) of the native sequence PRO1080 (UNQ537) cDNA is shown. SEQ ID NO: 147 is a clone designated herein as “DNA56047-1456”. The amino acid sequence (SEQ ID NO: 148) derived from the coding sequence of SEQ ID NO: 147 shown in FIG. 84 is shown. Here, the nucleotide sequence designated as DNA36527 (SEQ ID NO: 149) is shown. The nucleotide sequence (SEQ ID NO: 150) of the native sequence PRO1079 (UNQ536) cDNA is shown. SEQ ID NO: 150 is a clone designated herein as “DNA56050-1455”. This shows the amino acid sequence (SEQ ID NO: 151) derived from the coding sequence SEQ ID NO: 150 shown in FIG. The nucleotide sequence (SEQ ID NO: 152) of the native sequence PRO793 (UNQ432) cDNA is shown. SEQ ID NO: 152 is a clone designated herein as “DNA56110-1437”. This shows the amino acid sequence (SEQ ID NO: 153) derived from the coding sequence of SEQ ID NO: 152 shown in FIG. Here, the nucleotide sequence designated as DNA50177 (SEQ ID NO: 154) is shown. The nucleotide sequence (SEQ ID NO: 155) of the native sequence PRO1016 (UNQ499) cDNA is shown. SEQ ID NO: 155 is a clone designated herein as “DNA56113-1378”. The amino acid sequence (SEQ ID NO: 156) derived from the coding sequence of SEQ ID NO: 155 shown in FIG. 92 is shown. The nucleotide sequence (SEQ ID NO: 157) of the native sequence PRO1013 (UNQ496) cDNA is shown. SEQ ID NO: 157 is a clone designated herein as “DNA56410-1414”. 94 shows an amino acid sequence (SEQ ID NO: 158) derived from the coding sequence of SEQ ID NO: 157 shown in FIG. The nucleotide sequence (SEQ ID NO: 159) of the native sequence PRO937 (UNQ474) cDNA is shown. SEQ ID NO: 159 is a clone designated herein as “DNA56436-1448”. 96 shows the amino acid sequence (SEQ ID NO: 160) derived from the coding sequence of SEQ ID NO: 159 shown in FIG. The nucleotide sequence (SEQ ID NO: 164) of the native sequence PRO842 (UNQ473) cDNA is shown. SEQ ID NO: 164 is a clone designated herein as “DNA56855-1447”. The amino acid sequence (SEQ ID NO: 165) derived from the coding sequence of SEQ ID NO: 164 shown in FIG. 98 is shown. The nucleotide sequence of the native sequence PRO839 (UNQ472) cDNA (SEQ ID NO: 166) is shown. SEQ ID NO: 166 is a clone designated herein as “DNA56859-1445”. FIG. 100 shows an amino acid sequence (SEQ ID NO: 167) derived from the coding sequence of SEQ ID NO: 166 shown in FIG. The nucleotide sequence (SEQ ID NO: 168) of the native sequence PRO1180 (UNQ594) cDNA is shown. SEQ ID NO: 168 is a clone designated herein as “DNA56860-1510”. An amino acid sequence (SEQ ID NO: 169) derived from the coding sequence of SEQ ID NO: 168 shown in FIG. 1 shows the nucleotide sequence (SEQ ID NO: 170) of the native sequence PRO1134 (UNQ572) cDNA. SEQ ID NO: 170 is a clone designated herein as “DNA56865-1491”. An amino acid sequence (SEQ ID NO: 171) derived from the coding sequence of SEQ ID NO: 170 shown in FIG. 104 is shown. Here, the nucleotide sequence designated as DNA52352 (SEQ ID NO: 172) is shown. Here, the nucleotide sequence designated as DNA55725 (SEQ ID NO: 173) is shown. The nucleotide sequence (SEQ ID NO: 174) of the native sequence PRO830 (UNQ470) cDNA is shown. SEQ ID NO: 174 is a clone designated herein as “DNA56866-1342”. The amino acid sequence (SEQ ID NO: 175) derived from the coding sequence of SEQ ID NO: 174 shown in FIG. 108 is shown. The nucleotide sequence (SEQ ID NO: 176) of the native sequence PRO1115 (UNQ558) cDNA is shown. SEQ ID NO: 176 is a clone designated herein as “DNA56868-1478”. The amino acid sequence (SEQ ID NO: 177) derived from the coding sequence of SEQ ID NO: 176 shown in FIG. 110 is shown. The nucleotide sequence (SEQ ID NO: 178) of the native sequence PRO1277 (UNQ647) cDNA is shown. SEQ ID NO: 178 is a clone designated herein as “DNA56869-1545”. The amino acid sequence (SEQ ID NO: 179) derived from the coding sequence of SEQ ID NO: 178 shown in FIG. 112 is shown. The nucleotide sequence (SEQ ID NO: 180) of the native sequence PRO1135 (UNQ573) cDNA is shown. SEQ ID NO: 180 is a clone designated herein as “DNA56870-1492”. 114 shows the amino acid sequence (SEQ ID NO: 181) derived from the coding sequence of SEQ ID NO: 180 shown in FIG. The nucleotide sequence (SEQ ID NO: 182) of the native sequence PRO1114 (UNQ557) cDNA is shown. SEQ ID NO: 182 is a clone designated herein as “DNA57033-1403”. 116 shows an amino acid sequence (SEQ ID NO: 183) derived from the coding sequence of SEQ ID NO: 182 shown in FIG. Here, the nucleotide sequence designated as DNA48466 (SEQ ID NO: 184) is shown. The nucleotide sequence (SEQ ID NO: 188) of the native sequence PRO828 (UNQ469) cDNA is shown. SEQ ID NO: 188 is a clone designated herein as “DNA57037-1444”. 119 shows the amino acid sequence (SEQ ID NO: 189) derived from the coding sequence of SEQ ID NO: 188 shown in FIG. The nucleotide sequence (SEQ ID NO: 193) of the native sequence PRO1009 (UNQ493) cDNA is shown. SEQ ID NO: 193 is a clone designated herein as “DNA57129-1413”. The amino acid sequence (SEQ ID NO: 194) derived from the coding sequence of SEQ ID NO: 193 shown in FIG. 121 is shown. Here, the nucleotide sequence designated as DNA50853 (SEQ ID NO: 195) is shown. The nucleotide sequence (SEQ ID NO: 196) of the native sequence PRO1007 (UNQ491) cDNA is shown. SEQ ID NO: 196 is a clone designated herein as “DNA57690-1374”. The amino acid sequence (SEQ ID NO: 197) derived from the coding sequence of SEQ ID NO: 196 shown in FIG. 124 is shown. The nucleotide sequence (SEQ ID NO: 198) of the native sequence PRO1056 (UNQ521) cDNA is shown. SEQ ID NO: 198 is a clone designated herein as “DNA57693-1424”. The amino acid sequence (SEQ ID NO: 199) derived from the coding sequence of SEQ ID NO: 198 shown in FIG. 126 is shown. The nucleotide sequence of the native sequence PRO826 (UNQ467) cDNA (SEQ ID NO: 200) is shown. SEQ ID NO: 200 is a clone designated herein as “DNA57694-1341”. The amino acid sequence (SEQ ID NO: 201) derived from the coding sequence of SEQ ID NO: 200 shown in FIG. 128 is shown. The nucleotide sequence (SEQ ID NO: 202) of the native sequence PRO819 (UNQ466) cDNA is shown. SEQ ID NO: 202 is a clone designated herein as “DNA57669-1340”. The amino acid sequence (SEQ ID NO: 203) derived from the coding sequence of SEQ ID NO: 202 shown in FIG. 130 is shown. The nucleotide sequence (SEQ ID NO: 204) of the native sequence PRO1006 (UNQ490) cDNA is shown. SEQ ID NO: 204 is a clone designated herein as “DNA57699-1412”. The amino acid sequence (SEQ ID NO: 205) derived from the coding sequence of SEQ ID NO: 204 shown in FIG. 132 is shown. 1 shows the nucleotide sequence (SEQ ID NO: 206) of the native sequence PRO1112 (UNQ555) cDNA. SEQ ID NO: 206 is a clone designated herein as “DNA57702-1476”. The amino acid sequence (SEQ ID NO: 207) derived from the coding sequence of SEQ ID NO: 206 shown in FIG. 134 is shown. The nucleotide sequence (SEQ ID NO: 208) of the native sequence PRO1074 (UNQ531) cDNA is shown. SEQ ID NO: 208 is a clone designated herein as “DNA57704-1452”. The amino acid sequence (SEQ ID NO: 209) derived from the coding sequence of SEQ ID NO: 208 shown in FIG. 136 is shown. 1 shows the nucleotide sequence (SEQ ID NO: 210) of the native sequence PRO1005 (UNQ489) cDNA. SEQ ID NO: 210 is a clone designated herein as “DNA57708-1005”. The amino acid sequence (SEQ ID NO: 211) derived from the coding sequence of SEQ ID NO: 210 shown in FIG. 138 is shown. The nucleotide sequence (SEQ ID NO: 212) of the native sequence PRO1073 (UNQ530) cDNA is shown. SEQ ID NO: 212 is a clone designated herein as “DNA57710-1451”. The amino acid sequence (SEQ ID NO: 213) derived from the coding sequence of SEQ ID NO: 212 shown in FIG. 140 is shown. Here, the nucleotide sequence designated as DNA55938 (SEQ ID NO: 214) is shown. The nucleotide sequence (SEQ ID NO: 215) of the native sequence PRO1152 (UNQ582) cDNA is shown. SEQ ID NO: 215 is a clone designated herein as “DNA57711-1501”. The amino acid sequence (SEQ ID NO: 216) derived from the coding sequence of SEQ ID NO: 215 shown in FIG. 143 is shown. Here, the nucleotide sequence designated as DNA55807 (SEQ ID NO: 217) is shown. The nucleotide sequence (SEQ ID NO: 218) of the native sequence PRO1136 (UNQ574) cDNA is shown. SEQ ID NO: 218 is a clone designated herein as “DNA57827-1493”. The amino acid sequence (SEQ ID NO: 219) derived from the coding sequence of SEQ ID NO: 218 shown in FIG. 146 is shown. The nucleotide sequence (SEQ ID NO: 220) of the native sequence PRO813 (UNQ465) cDNA is shown. SEQ ID NO: 220 is a clone designated herein as “DNA57834-1339”. The amino acid sequence (SEQ ID NO: 221) derived from the coding sequence of SEQ ID NO: 220 shown in FIG. 148 is shown. The nucleotide sequence (SEQ ID NO: 222) of the native sequence PRO809 (UNQ464) cDNA is shown. SEQ ID NO: 222 is a clone designated herein as “DNA57836-1338”. The amino acid sequence (SEQ ID NO: 223) derived from the coding sequence of SEQ ID NO: 222 shown in FIG. 150 is shown. The nucleotide sequence (SEQ ID NO: 224) of the native sequence PRO791 (UNQ463) cDNA is shown. SEQ ID NO: 224 is a clone designated herein as “DNA57838-1337”. The amino acid sequence (SEQ ID NO: 225) derived from the coding sequence of SEQ ID NO: 224 shown in FIG. 152 is shown. The nucleotide sequence (SEQ ID NO: 226) of the native sequence PRO1004 (UNQ488) cDNA is shown. SEQ ID NO: 226 is a clone designated herein as “DNA57844-1410”. The amino acid sequence (SEQ ID NO: 227) derived from the coding sequence of SEQ ID NO: 226 shown in FIG. 154 is shown. The nucleotide sequence (SEQ ID NO: 228) of the native sequence PRO1111 (UNQ554) cDNA is shown. SEQ ID NO: 228 is a clone designated herein as “DNA58721-1475”. The amino acid sequence (SEQ ID NO: 229) derived from the coding sequence of SEQ ID NO: 228 shown in FIG. 156 is shown. The nucleotide sequence (SEQ ID NO: 230) of the native sequence PRO1344 (UNQ699) cDNA is shown. SEQ ID NO: 230 is a clone designated herein as “DNA58723-1588”. The amino acid sequence (SEQ ID NO: 231) derived from the coding sequence of SEQ ID NO: 230 shown in FIG. 158 is shown. The nucleotide sequence (SEQ ID NO: 235) of the native sequence PRO1109 (UNQ552) cDNA is shown. SEQ ID NO: 235 is a clone designated herein as “DNA58737-1473”. The amino acid sequence (SEQ ID NO: 236) derived from the coding sequence of SEQ ID NO: 235 shown in FIG. 160 is shown. The nucleotide sequence (SEQ ID NO: 240) of the native sequence PRO1383 (UNQ719) cDNA is shown. SEQ ID NO: 240 is a clone designated herein as “DNA58743-1609”. The amino acid sequence (SEQ ID NO: 241) derived from the coding sequence of SEQ ID NO: 240 shown in FIG. 162 is shown. The nucleotide sequence (SEQ ID NO: 245) of the native sequence PRO1003 (UNQ487) cDNA is shown. SEQ ID NO: 245 is a clone designated herein as “DNA58846-1409”. The amino acid sequence (SEQ ID NO: 246) derived from the coding sequence of SEQ ID NO: 245 shown in FIG. 164 is shown. The nucleotide sequence (SEQ ID NO: 247) of the native sequence PRO1108 (UNQ551) cDNA is shown. SEQ ID NO: 247 is a clone designated herein as “DNA58848-1472”. The amino acid sequence (SEQ ID NO: 248) derived from the coding sequence of SEQ ID NO: 247 shown in FIG. 166 is shown. The nucleotide sequence (SEQ ID NO: 249) of the native sequence PRO1137 (UNQ575) cDNA is shown. SEQ ID NO: 249 is a clone designated herein as “DNA58849-1494”. The amino acid sequence (SEQ ID NO: 250) derived from the coding sequence of SEQ ID NO: 249 shown in FIG. 168 is shown. The nucleotide sequence (SEQ ID NO: 252) of the native sequence PRO1138 (UNQ576) cDNA is shown. SEQ ID NO: 252 is a clone designated herein as “DNA58850-1495”. The amino acid sequence (SEQ ID NO: 253) derived from the coding sequence of SEQ ID NO: 252 shown in FIG. 170 is shown. Here, the nucleotide sequence designated as DNA49140 (SEQ ID NO: 254) is shown. 1 shows the nucleotide sequence (SEQ ID NO: 255) of the native sequence PRO1054 (UNQ519) cDNA. SEQ ID NO: 255 is a clone designated herein as “DNA58853-1423”. The amino acid sequence (SEQ ID NO: 256) derived from the coding sequence of SEQ ID NO: 255 shown in FIG. 173 is shown. The nucleotide sequence (SEQ ID NO: 257) of the native sequence PRO994 (UNQ518) cDNA is shown. SEQ ID NO: 257 is a clone designated herein as “DNA58855-1422”. The amino acid sequence (SEQ ID NO: 258) derived from the coding sequence of SEQ ID NO: 257 shown in FIG. 175 is shown. The nucleotide sequence (SEQ ID NO: 259) of the native sequence PRO812 (UNQ517) cDNA is shown. SEQ ID NO: 259 is a clone designated herein as “DNA59205-1421”. The amino acid sequence (SEQ ID NO: 260) derived from the coding sequence of SEQ ID NO: 259 shown in FIG. 177 is shown. The nucleotide sequence (SEQ ID NO: 261) of the native sequence PRO1069 (UNQ526) cDNA is shown. SEQ ID NO: 261 is a clone designated herein as “DNA59211-1450”. The amino acid sequence (SEQ ID NO: 262) derived from the coding sequence of SEQ ID NO: 261 shown in FIG. 179 is shown. The nucleotide sequence (SEQ ID NO: 263) of the native sequence PRO1129 (UNQ568) cDNA is shown. SEQ ID NO: 263 is a clone designated herein as “DNA59213-1487”. The amino acid sequence (SEQ ID NO: 264) derived from the coding sequence of SEQ ID NO: 263 shown in FIG. 181 is shown. The nucleotide sequence of the native sequence PRO1068 (UNQ525) cDNA (SEQ ID NO: 265) is shown. SEQ ID NO: 265 is a clone designated herein as “DNA59214-1449”. The amino acid sequence (SEQ ID NO: 266) derived from the coding sequence of SEQ ID NO: 265 shown in FIG. 183 is shown. The nucleotide sequence of the native sequence PRO1066 (UNQ524) cDNA (SEQ ID NO: 267) is shown. SEQ ID NO: 267 is a clone designated herein as “DNA59215-1425”. The amino acid sequence (SEQ ID NO: 268) derived from the coding sequence of SEQ ID NO: 267 shown in FIG. 185 is shown. The nucleotide sequence (SEQ ID NO: 269) of the native sequence PRO1184 (UNQ598) cDNA is shown. SEQ ID NO: 269 is a clone designated herein as “DNA59220-1514”. The amino acid sequence (SEQ ID NO: 270) derived from the coding sequence of SEQ ID NO: 269 shown in FIG. 187 is shown. The nucleotide sequence (SEQ ID NO: 271) of the native sequence PRO1360 (UNQ709) cDNA is shown. SEQ ID NO: 271 is a clone designated herein as “DNA59488-1603”. The amino acid sequence (SEQ ID NO: 272) derived from the coding sequence of SEQ ID NO: 271 shown in FIG. 189 is shown. The nucleotide sequence (SEQ ID NO: 273) of the native sequence PRO1029 (UNQ514) cDNA is shown. SEQ ID NO: 273 is a clone designated herein as “DNA59493-1420”. The amino acid sequence (SEQ ID NO: 274) derived from the coding sequence of SEQ ID NO: 273 shown in FIG. 191 is shown. The nucleotide sequence (SEQ ID NO: 275) of the native sequence PRO1139 (UNQ577) cDNA is shown. SEQ ID NO: 275 is a clone designated herein as “DNA59497-1496”. The amino acid sequence (SEQ ID NO: 276) derived from the coding sequence of SEQ ID NO: 275 shown in FIG. 193 is shown. The nucleotide sequence (SEQ ID NO: 277) of the native sequence PRO1309 (UNQ675) cDNA is shown. SEQ ID NO: 277 is a clone designated herein as “DNA59588-1571”. The amino acid sequence (SEQ ID NO: 278) derived from the coding sequence of SEQ ID NO: 277 shown in FIG. 195 is shown. The nucleotide sequence (SEQ ID NO: 280) of the native sequence PRO1028 (UNQ513) cDNA is shown. SEQ ID NO: 280 is a clone designated herein as “DNA59603-1419”. The amino acid sequence (SEQ ID NO: 281) derived from the coding sequence of SEQ ID NO: 280 shown in FIG. 197 is shown. The nucleotide sequence of the native sequence PRO1027 (UNQ512) cDNA (SEQ ID NO: 282) is shown. SEQ ID NO: 282 is a clone designated herein as “DNA59605-1418”. The amino acid sequence (SEQ ID NO: 283) derived from the coding sequence of SEQ ID NO: 282 shown in FIG. 199 is shown. The nucleotide sequence of the native sequence PRO1107 (UNQ550) cDNA (SEQ ID NO: 284) is shown. SEQ ID NO: 284 is a clone designated herein as “DNA59606-1471”. The amino acid sequence (SEQ ID NO: 285) derived from the coding sequence of SEQ ID NO: 284 shown in FIG. 201 is shown. The nucleotide sequence of the native sequence PRO1140 (UNQ578) cDNA (SEQ ID NO: 286) is shown. SEQ ID NO: 286 is a clone designated herein as “DNA59607-1497”. The amino acid sequence (SEQ ID NO: 287) derived from the coding sequence of SEQ ID NO: 286 shown in FIG. 203 is shown. The nucleotide sequence (SEQ ID NO: 288) of the native sequence PRO1106 (UNQ549) cDNA is shown. SEQ ID NO: 288 is a clone designated herein as “DNA59609-1470”. The amino acid sequence (SEQ ID NO: 289) derived from the coding sequence of SEQ ID NO: 288 shown in FIG. 205 is shown. The nucleotide sequence (SEQ ID NO: 290) of the native sequence PRO1291 (UNQ659) cDNA is shown. SEQ ID NO: 290 is a clone designated herein as “DNA59610-1556”. The amino acid sequence (SEQ ID NO: 291) derived from the coding sequence of SEQ ID NO: 290 shown in FIG. 207 is shown. The nucleotide sequence (SEQ ID NO: 292) of the native sequence PRO1105 (UNQ548) cDNA is shown. SEQ ID NO: 292 is a clone designated herein as “DNA59612-1466”. The amino acid sequence (SEQ ID NO: 293) derived from the coding sequence of SEQ ID NO: 292 shown in FIG. 209 is shown. The nucleotide sequence (SEQ ID NO: 294) of the native sequence PRO511 (UNQ511) cDNA is shown. SEQ ID NO: 294 is a clone designated herein as “DNA59613-1417”. The amino acid sequence (SEQ ID NO: 295) derived from the coding sequence of SEQ ID NO: 294 shown in FIG. 211 is shown. The nucleotide sequence (SEQ ID NO: 296) of the native sequence PRO1104 (UNQ547) cDNA is shown. SEQ ID NO: 296 is a clone designated herein as “DNA59616-1465”. The amino acid sequence (SEQ ID NO: 296) derived from the coding sequence of SEQ ID NO: 296 shown in FIG. The nucleotide sequence (SEQ ID NO: 298) of the native sequence PRO1100 (UNQ546) cDNA is shown. SEQ ID NO: 298 is a clone designated herein as “DNA59619-1464”. The amino acid sequence (SEQ ID NO: 299) derived from the coding sequence of SEQ ID NO: 298 shown in FIG. 215 is shown. 1 shows the nucleotide sequence (SEQ ID NO: 300) of the native sequence PRO836 (UNQ545) cDNA. SEQ ID NO: 300 is a clone designated herein as “DNA59620-1463”. The amino acid sequence (SEQ ID NO: 301) derived from the coding sequence of SEQ ID NO: 300 shown in FIG. 1 shows the nucleotide sequence (SEQ ID NO: 302) of the native sequence PRO1141 (UNQ579) cDNA. SEQ ID NO: 302 is a clone designated herein as “DNA59625-1498”. The amino acid sequence (SEQ ID NO: 303) derived from the coding sequence of SEQ ID NO: 302 shown in FIG. 219 is shown. Here, the nucleotide sequence designated as DNA33128 (SEQ ID NO: 304) is shown. Here, the nucleotide sequence designated as DNA34256 (SEQ ID NO: 305) is shown. Here, the nucleotide sequence designated as DNA47941 (SEQ ID NO: 306) is shown. Here, the nucleotide sequence designated as DNA54389 (SEQ ID NO: 307) is shown. The nucleotide sequence of the native sequence PRO1132 (UNQ570) cDNA (SEQ ID NO: 308) is shown. SEQ ID NO: 308 is a clone designated herein as “DNA59767-1489”. The amino acid sequence (SEQ ID NO: 309) derived from the coding sequence of SEQ ID NO: 308 shown in FIG. 225 is shown. The nucleotide sequence of the native sequence PRO1346 cDNA (SEQ ID NO: 313) is shown. SEQ ID NO: 313 is a clone designated herein as “DNA59776-1600”. The amino acid sequence (SEQ ID NO: 314) derived from the coding sequence of SEQ ID NO: 313 shown in FIG. 227 is shown. The nucleotide sequence (SEQ ID NO: 318) of the native sequence PRO1131 (UNQ569) cDNA is shown. SEQ ID NO: 318 is a clone designated herein as “DNA59777-1480”. The amino acid sequence (SEQ ID NO: 319) derived from the coding sequence of SEQ ID NO: 318 shown in FIG. 229 is shown. Here, the nucleotide sequence designated as DNA43546 (SEQ ID NO: 320) is shown. The nucleotide sequence (SEQ ID NO: 325) of the native sequence PRO1281 (UNQ651) cDNA is shown. SEQ ID NO: 325 is a clone designated herein as “DNA59820-1549”. The amino acid sequence (SEQ ID NO: 326) derived from the coding sequence of SEQ ID NO: 325 shown in FIG. The nucleotide sequence (SEQ ID NO: 333) of the native sequence PRO1064 (UNQ111) cDNA is shown. SEQ ID NO: 333 is a clone designated herein as “DNA59827-1426”. The amino acid sequence (SEQ ID NO: 334) derived from the coding sequence of SEQ ID NO: 333 shown in FIG. 234 is shown. Here, the nucleotide sequence designated as DNA45288 (SEQ ID NO: 335) is shown. The nucleotide sequence (SEQ ID NO: 339) of the native sequence PRO1379 (UNQ716) cDNA is shown. SEQ ID NO: 339 is a clone designated herein as “DNA59828-1608”. The amino acid sequence (SEQ ID NO: 340) derived from the coding sequence of SEQ ID NO: 339 shown in FIG. 237 is shown. The nucleotide sequence (SEQ ID NO: 344) of the native sequence PRO844 (UNQ544) cDNA is shown. SEQ ID NO: 344 is a clone designated herein as “DNA59838-1462”. The amino acid sequence (SEQ ID NO: 345) derived from the coding sequence of SEQ ID NO: 344 shown in FIG. 239 is shown. The nucleotide sequence (SEQ ID NO: 346) of the native sequence PRO848 (UNQ543) cDNA is shown. SEQ ID NO: 346 is a clone designated herein as “DNA59839-1461”. The amino acid sequence (SEQ ID NO: 347) derived from the coding sequence of SEQ ID NO: 346 shown in FIG. The nucleotide sequence (SEQ ID NO: 348) of the native sequence PRO1097 (UNQ542) cDNA is shown. SEQ ID NO: 348 is a clone designated herein as “DNA59841-1460”. The amino acid sequence (SEQ ID NO: 349) derived from the coding sequence of SEQ ID NO: 348 shown in FIG. 243 is shown. The nucleotide sequence (SEQ ID NO: 350) of the native sequence PRO1153 (UNQ583) cDNA is shown. SEQ ID NO: 350 is a clone designated herein as “DNA59842-1502”. The amino acid sequence (SEQ ID NO: 351) derived from the coding sequence of SEQ ID NO: 350 shown in FIG. 245 is shown. The nucleotide sequence (SEQ ID NO: 352) of the native sequence PRO1154 (UNQ584) cDNA is shown. SEQ ID NO: 352 is a clone designated herein as “DNA59846-1503”. The amino acid sequence (SEQ ID NO: 353) derived from the coding sequence of SEQ ID NO: 352 shown in FIG. 247 is shown. The nucleotide sequence (SEQ ID NO: 354) of the native sequence PRO1181 (UNQ595) cDNA is shown. SEQ ID NO: 354 is a clone designated herein as “DNA59847-1511”. The amino acid sequence (SEQ ID NO: 355) derived from the coding sequence of SEQ ID NO: 354 shown in FIG. 249 is shown. The nucleotide sequence (SEQ ID NO: 356) of the native sequence PRO1182 (UNQ596) cDNA is shown. SEQ ID NO: 356 is a clone designated herein as “DNA59848-1512”. The amino acid sequence (SEQ ID NO: 357) derived from the coding sequence of SEQ ID NO: 356 shown in FIG. The nucleotide sequence (SEQ ID NO: 358) of the native sequence PRO1155 (UNQ585) cDNA is shown. SEQ ID NO: 358 is a clone designated herein as “DNA59849-1504”. The amino acid sequence (SEQ ID NO: 359) derived from the coding sequence of SEQ ID NO: 358 shown in FIG. 253 is shown. 1 shows the nucleotide sequence (SEQ ID NO: 360) of the native sequence PRO1156 (UNQ586) cDNA. SEQ ID NO: 360 is a clone designated herein as “DNA59853-1505”. The amino acid sequence (SEQ ID NO: 361) derived from the coding sequence of SEQ ID NO: 360 shown in FIG. 255 is shown. The nucleotide sequence (SEQ ID NO: 362) of the native sequence PRO1098 (UNQ541) cDNA is shown. SEQ ID NO: 362 is a clone designated herein as “DNA59854-1459”. The amino acid sequence (SEQ ID NO: 363) derived from the coding sequence of SEQ ID NO: 362 shown in FIG. 257 is shown. The nucleotide sequence (SEQ ID NO: 364) of the native sequence PRO1127 (UNQ565) cDNA is shown. SEQ ID NO: 364 is a clone designated herein as “DNA60283-1484”. The amino acid sequence (SEQ ID NO: 365) derived from the coding sequence of SEQ ID NO: 364 shown in FIG. 259 is shown. The nucleotide sequence (SEQ ID NO: 366) of the native sequence PRO1126 (UNQ564) cDNA is shown. SEQ ID NO: 366 is a clone designated herein as “DNA60615-1483”. The amino acid sequence (SEQ ID NO: 367) derived from the coding sequence of SEQ ID NO: 366 shown in FIG. 261 is shown. The nucleotide sequence (SEQ ID NO: 368) of the native sequence PRO1125 (UNQ563) cDNA is shown. SEQ ID NO: 368 is a clone designated herein as “DNA60619-1482”. The amino acid sequence (SEQ ID NO: 369) derived from the coding sequence of SEQ ID NO: 368 shown in FIG. 263 is shown. The nucleotide sequence (SEQ ID NO: 370) of the native sequence PRO1186 (UNQ600) cDNA is shown. SEQ ID NO: 370 is a clone designated herein as “DNA60621-1516”. The amino acid sequence (SEQ ID NO: 371) derived from the coding sequence of SEQ ID NO: 370 shown in FIG. 265 is shown. The nucleotide sequence (SEQ ID NO: 372) of the native sequence PRO1198 (UNQ611) cDNA is shown. SEQ ID NO: 372 is a clone designated herein as “DNA60622-1525”. The amino acid sequence (SEQ ID NO: 373) derived from the coding sequence of SEQ ID NO: 372 shown in FIG. 267 is shown. The nucleotide sequence (SEQ ID NO: 374) of the native sequence PRO1158 (UNQ588) cDNA is shown. SEQ ID NO: 374 is a clone designated herein as “DNA60625-1507”. The amino acid sequence (SEQ ID NO: 375) derived from the coding sequence of SEQ ID NO: 374 shown in FIG. 269 is shown. The nucleotide sequence (SEQ ID NO: 376) of the native sequence PRO1159 (UNQ589) cDNA is shown. SEQ ID NO: 376 is a clone designated herein as “DNA60627-1508”. The amino acid sequence (SEQ ID NO: 377) derived from the coding sequence of SEQ ID NO: 376 shown in FIG. 271 is shown. The nucleotide sequence (SEQ ID NO: 378) of the native sequence PRO1124 (UNQ562) cDNA is shown. SEQ ID NO: 378 is a clone designated herein as “DNA60629-1481”. The amino acid sequence (SEQ ID NO: 379) derived from the coding sequence of SEQ ID NO: 378 shown in FIG. 273 is shown. The nucleotide sequence (SEQ ID NO: 380) of the native sequence PRO1287 (UNQ656) cDNA is shown. SEQ ID NO: 380 is a clone designated herein as “DNA61755-1554”. The amino acid sequence (SEQ ID NO: 381) derived from the coding sequence of SEQ ID NO: 380 shown in FIG. 275 is shown. The nucleotide sequence (SEQ ID NO: 386) of the native sequence PRO1312 (UNQ678) cDNA is shown. SEQ ID NO: 386 is a clone designated herein as “DNA61883-1574”. The amino acid sequence (SEQ ID NO: 387) derived from the coding sequence of SEQ ID NO: 386 shown in FIG. 277 is shown. 1 shows the nucleotide sequence (SEQ ID NO: 388) of the native sequence PRO1192 (UNQ606) cDNA. SEQ ID NO: 388 is a clone designated herein as “DNA62814-1521”. This shows the amino acid sequence (SEQ ID NO: 389) derived from the coding sequence of SEQ ID NO: 388 shown in FIG. The nucleotide sequence (SEQ ID NO: 393) of the native sequence PRO1160 (UNQ590) cDNA is shown. SEQ ID NO: 393 is a clone designated herein as “DNA62872-1509”. The amino acid sequence (SEQ ID NO: 394) derived from the coding sequence of SEQ ID NO: 393 shown in FIG. 281 is shown. The nucleotide sequence (SEQ ID NO: 398) of the native sequence PRO1187 (UNQ601) cDNA is shown. SEQ ID NO: 398 is a clone designated herein as “DNA62876-1517”. The amino acid sequence (SEQ ID NO: 399) derived from the coding sequence of SEQ ID NO: 398 shown in FIG. 283 is shown. 1 shows the nucleotide sequence (SEQ ID NO: 400) of the native sequence PRO1185 (UNQ599) cDNA. SEQ ID NO: 400 is a clone designated herein as “DNA62881-1515”. The amino acid sequence (SEQ ID NO: 401) derived from the coding sequence of SEQ ID NO: 400 shown in FIG. 285 is shown. 1 shows the nucleotide sequence (SEQ ID NO: 402) of the native sequence PRO1345 (UNQ700) cDNA. SEQ ID NO: 402 is a clone designated herein as “DNA64852-1589”. The amino acid sequence (SEQ ID NO: 403) derived from the coding sequence of SEQ ID NO: 402 shown in FIG. 287 is shown. The nucleotide sequence (SEQ ID NO: 407) of the native sequence PRO1245 (UNQ629) cDNA is shown. SEQ ID NO: 407 is a clone designated herein as “DNA64888-1527”. The amino acid sequence (SEQ ID NO: 408) derived from the coding sequence of SEQ ID NO: 407 shown in FIG. 289 is shown. The nucleotide sequence (SEQ ID NO: 409) of the native sequence PRO1358 (UNQ707) cDNA is shown. SEQ ID NO: 409 is a clone designated herein as “DNA64890-1612”. The amino acid sequence (SEQ ID NO: 410) derived from the coding sequence of SEQ ID NO: 409 shown in FIG. 291 is shown. The nucleotide sequence (SEQ ID NO: 411) of the native sequence PRO1195 (UNQ608) cDNA is shown. SEQ ID NO: 411 is a clone designated herein as “DNA65412-1523”. The amino acid sequence (SEQ ID NO: 412) derived from the coding sequence of SEQ ID NO: 411 shown in FIG. 293 is shown. The nucleotide sequence (SEQ ID NO: 413) of the native sequence PRO1270 (UNQ640) cDNA is shown. SEQ ID NO: 413 is a clone designated herein as “DNA66308-1537”. The amino acid sequence (SEQ ID NO: 414) derived from the coding sequence of SEQ ID NO: 413 shown in FIG. 295 is shown. The nucleotide sequence (SEQ ID NO: 415) of the native sequence PRO1271 (UNQ641) cDNA is shown. SEQ ID NO: 415 is a clone designated herein as “DNA66309-1538”. This shows the amino acid sequence (SEQ ID NO: 416) derived from the coding sequence SEQ ID NO: 415 shown in FIG. The nucleotide sequence (SEQ ID NO: 417) of the native sequence PRO1375 (UNQ712) cDNA is shown. SEQ ID NO: 417 is a clone designated herein as “DNA67004-1614”. The amino acid sequence (SEQ ID NO: 418) derived from the coding sequence of SEQ ID NO: 417 shown in FIG. 299 is shown. The nucleotide sequence (SEQ ID NO: 419) of the native sequence PRO1385 (UNQ720) cDNA is shown. SEQ ID NO: 419 is a clone designated herein as “DNA68889-1610”. The amino acid sequence (SEQ ID NO: 420) derived from the coding sequence of SEQ ID NO: 419 shown in FIG. 301 is shown. The nucleotide sequence (SEQ ID NO: 421) of the native sequence PRO1387 (UNQ722) cDNA is shown. SEQ ID NO: 421 is a clone designated herein as “DNA68872-1620”. The amino acid sequence (SEQ ID NO: 422) derived from the coding sequence of SEQ ID NO: 421 shown in FIG. 303 is shown. The nucleotide sequence (SEQ ID NO: 423) of the native sequence PRO1384 (UNQ721) cDNA is shown. SEQ ID NO: 423 is a clone designated herein as “DNA71159-1617”. The amino acid sequence (SEQ ID NO: 424) derived from the coding sequence of SEQ ID NO: 423 shown in FIG. 305 is shown. 1 shows the nucleotide sequence of the native sequence PRO183 cDNA (SEQ ID NO: 494). SEQ ID NO: 494 is a clone designated herein as “DNA28498”. The amino acid sequence (SEQ ID NO: 495) derived from the coding sequence of SEQ ID NO: 494 shown in FIG. 307 is shown. 1 shows the nucleotide sequence of the native sequence PRO184 cDNA (SEQ ID NO: 496). SEQ ID NO: 496 is a clone designated herein as “DNA28500”. The amino acid sequence (SEQ ID NO: 497) derived from the coding sequence of SEQ ID NO: 496 shown in FIG. 309 is shown. 1 shows the nucleotide sequence of the native sequence PRO185 cDNA (SEQ ID NO: 498). SEQ ID NO: 498 is a clone designated herein as “DNA28503”. The amino acid sequence (SEQ ID NO: 499) derived from the coding sequence of SEQ ID NO: 498 shown in FIG. 311 is shown. The nucleotide sequence of the native sequence PRO331 cDNA (SEQ ID NO: 500) is shown. SEQ ID NO: 500 is a clone designated herein as “DNA40981-1234”. The amino acid sequence (SEQ ID NO: 501) derived from the coding sequence of SEQ ID NO: 500 shown in FIG. 313 is shown. 1 shows the nucleotide sequence of the native sequence PRO363 cDNA (SEQ ID NO: 502). SEQ ID NO: 502 is a clone designated herein as “DNA45419-1252”. The amino acid sequence (SEQ ID NO: 503) derived from the coding sequence of SEQ ID NO: 502 shown in FIG. 315 is shown. 1 shows the nucleotide sequence of the native sequence PRO5723 cDNA (SEQ ID NO: 504). SEQ ID NO: 504 is a clone designated herein as “DNA82361”. The amino acid sequence (SEQ ID NO: 505) derived from the coding sequence of SEQ ID NO: 504 shown in FIG. 317 is shown. The nucleotide sequence (SEQ ID NO: 506) of the native sequence PRO3301 cDNA is shown. SEQ ID NO: 506 is a clone designated herein as “DNA88002”. The amino acid sequence (SEQ ID NO: 507) derived from the coding sequence of SEQ ID NO: 506 shown in FIG. 319 is shown. 1 shows the nucleotide sequence of the native sequence PRO9940 cDNA (SEQ ID NO: 508). SEQ ID NO: 508 is a clone designated herein as “DNA92282”. The amino acid sequence (SEQ ID NO: 509) derived from the coding sequence of SEQ ID NO: 508 shown in FIG. 321 is shown. The nucleotide sequence of the native sequence PRO9828 cDNA (SEQ ID NO: 510) is shown. SEQ ID NO: 510 is a clone designated herein as “DNA142238-2768”. The amino acid sequence (SEQ ID NO: 511) derived from the coding sequence of SEQ ID NO: 510 shown in FIG. 323 is shown. 1 shows the nucleotide sequence of the native sequence PRO7170 cDNA (SEQ ID NO: 512). SEQ ID NO: 512 is a clone designated herein as “DNA108722-2743”. The amino acid sequence (SEQ ID NO: 513) derived from the coding sequence of SEQ ID NO: 512 shown in FIG. 325 is shown. This shows the nucleotide sequence of the native sequence PRO361 cDNA (SEQ ID NO: 514). SEQ ID NO: 514 is a clone designated herein as “DNA45410-1250”. The amino acid sequence (SEQ ID NO: 515) derived from the coding sequence of SEQ ID NO: 514 shown in FIG. 327 is shown. 1 shows the nucleotide sequence of the native sequence PRO846 cDNA (SEQ ID NO: 516). SEQ ID NO: 516 is a clone designated herein as “DNA44196-1353”. The amino acid sequence (SEQ ID NO: 517) derived from the coding sequence of SEQ ID NO: 516 shown in FIG. 329 is shown.

Claims (118)

  Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: : 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 (SEQ ID NO: 36), Figure 27 (SEQ ID NO: 41), Figure 30 (SEQ ID NO: 47), Figure 32 (SEQ ID NO: 52), Figure 34 (SEQ ID NO: 57), Figure 36 (SEQ ID NO: 62), Figure 38 (SEQ ID NO: 67), Figure 41 (SEQ ID NO: 73), FIG. 47 (SEQ ID NO: 84), FIG. 49 (SEQ ID NO: 95), FIG. 51 (SEQ ID NO: 97), FIG. 53 (SEQ ID NO: 99), FIG. 57 (SEQ ID NO: 103), FIG. 64 (SEQ ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119), Figure 72 (SEQ ID NO: 124), Figure 74 (SEQ ID NO: 129) ), FIG. 76 (SEQ ID NO: 135), FIG. 79 (SEQ ID NO: 138), FIG. 83 (SEQ ID NO: 146), FIG. 85 (SEQ ID NO: 148), FIG. 88 (SEQ ID NO: 151), FIG. 90 ( (SEQ ID NO: 153), FIG. 93 (SEQ ID NO: 156), FIG. 95 (SEQ ID NO: 158), FIG. 97 (SEQ ID NO: 160), FIG. 99 (SEQ ID NO: 165), FIG. 101 (SEQ ID NO: 167) , Figure 103 Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181), Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (SEQ ID NO: : 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), FIG. 144 (SEQ ID NO: 216), FIG. 147 (SEQ ID NO: 219), FIG. 149 (SEQ ID NO: 221), FIG. 151 (SEQ ID NO: 223), FIG. 153 (SEQ ID NO: 225), FIG. 155 (SEQ ID NO: 227), FIG. 157 (SEQ ID NO: 229), FIG. 159 (SEQ ID NO: 231), FIG. 161 (SEQ ID NO: 236), FIG. 163 (SEQ ID NO: 241), FIG. 165 (SEQ ID NO: 246), FIG. 167 (SEQ ID NO: 248), FIG. 169 (SEQ ID NO: 250), FIG. 171 (SEQ ID NO: 253), FIG. 174 (SEQ ID NO: 256), FIG. 176 (SEQ ID NO: 258) ), Figure 178 (SEQ ID NO: 260), Figure 180 (SEQ ID NO: 262), Figure 182 (SEQ ID NO: 264), Figure 184 (Array) Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276), Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (SEQ ID NO: : 289), Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO: 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361) ), Figure 258 (SEQ ID NO: 363), Figure 260 (SEQ ID NO: 365), Figure 262 (SEQ ID NO: 367), Figure 264 (Array) Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 (SEQ ID NO: 379), Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: : 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422), Figure 306 (SEQ ID NO: 424), Figure 308 (SEQ ID NO: 495), Figure 310 (SEQ ID NO: 497), Figure 312 (SEQ ID NO: 499), Figure 314 (SEQ ID NO: 501), Figure 316 (SEQ ID NO: 503), Figure 318 (SEQ ID NO: 505), Figure 320 (SEQ ID NO: 507), Figure 322 (SEQ ID NO: 509), Figure 324 (SEQ ID NO: 511), Figure 326 (SEQ ID NO: 513), Figure 328 (SEQ ID NO: 515) and Figure 330 (SEQ ID NO: 517) An amino acid sequence selected from the group consisting of the amino acid sequences shown in An isolated nucleic acid having at least 80% sequence identity to a nucleotide sequence encoding a polypeptide comprising   Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 5), Figure 5 (SEQ ID NO: 7), Figure 8 (SEQ ID NO: 13), Figure 11 (SEQ ID NO: 19), Figure 14 (SEQ ID NO: 22), Figure 17 (SEQ ID NO: 27), Figure 19 (SEQ ID NO: 29), Figure 22 (SEQ ID NO: 32), Figure 24 (SEQ ID NO: 35), Figure 26 (SEQ ID NO: 40), Figure 29 (SEQ ID NO: 46), Figure 31 (SEQ ID NO: 51), Figure 33 (SEQ ID NO: 56), Figure 35 (SEQ ID NO: 61), Figure 37 (SEQ ID NO: 66), Figure 40 (SEQ ID NO: 72), FIG. 46 (SEQ ID NO: 83), FIG. 48 (SEQ ID NO: 94), FIG. 50 (SEQ ID NO: 96), FIG. 52 (SEQ ID NO: 98), FIG. 56 (SEQ ID NO: 102) ), FIG. 63 (SEQ ID NO: 112), FIG. 65 (SEQ ID NO: 114), FIG. 67 (SEQ ID NO: 116), FIG. 69 (SEQ ID NO: 118), FIG. 71 (SEQ ID NO: 123), FIG. 73 ( (SEQ ID NO: 128), FIG. 75 (SEQ ID NO: 134), FIG. 78 (SEQ ID NO: 137), FIG. 82 (SEQ ID NO: 145), FIG. 84 (SEQ ID NO: 147), FIG. 87 (SEQ ID NO: 150) Figure 89 (SEQ ID NO: 152), Figure 92 (SEQ ID NO: 155), Figure 94 (SEQ ID NO: 157), Figure 96 (SEQ ID NO: 159), Figure 98 (SEQ ID NO: 164), Figure 100 (SEQ ID NO: 166), FIG. 102 (SEQ ID NO: 168), FIG. 104 (SEQ ID NO: 170), FIG. 108 (SEQ ID NO: 174), FIG. 110 (SEQ ID NO: 176), FIG. 112 (SEQ ID NO: 178) ), FIG. 114 (SEQ ID NO: 180), FIG. 116 (SEQ ID NO: 182), FIG. 119 (SEQ ID NO: 188), FIG. 121 (SEQ ID NO: 193), FIG. 124 (SEQ ID NO: 196), FIG. 126 ( (SEQ ID NO: 198), FIG. 128 (SEQ ID NO: 200), FIG. 130 (SEQ ID NO: 202), FIG. 132 (SEQ ID NO: 204), FIG. 134 (SEQ ID NO: 206), FIG. 136 (SEQ ID NO: 208) Figure 138 (SEQ ID NO: 210), Figure 140 (SEQ ID NO: 212), Figure 143 (SEQ ID NO: 215), Figure 146 (SEQ ID NO: 218), Figure 148 (SEQ ID NO: 220), Figure 150 (Array) Fig. 152 (SEQ ID NO: 224), Fig. 154 (SEQ ID NO: 226), Fig. 156 (SEQ ID NO: 228), Fig. 158 (SEQ ID NO: 230), Fig. 160 (SEQ ID NO: 235), Figure 162 (SEQ ID NO: 240), Figure 164 (SEQ ID NO: 245), Figure 166 (SEQ ID NO: 247), Figure 168 (SEQ ID NO: 249), Figure 170 (SEQ ID NO: 252), Figure 173 (SEQ ID NO: : 255), Figure 175 (SEQ ID NO: 257), Figure 177 (SEQ ID NO: 259), Figure 179 (SEQ ID NO: 261), Figure 181 ( (SEQ ID NO: 263), FIG. 183 (SEQ ID NO: 265), FIG. 185 (SEQ ID NO: 267), FIG. 187 (SEQ ID NO: 269), FIG. 189 (SEQ ID NO: 271), FIG. 191 (SEQ ID NO: 273) , Figure 193 (SEQ ID NO: 275), Figure 195 (SEQ ID NO: 277), Figure 197 (SEQ ID NO: 280), Figure 199 (SEQ ID NO: 282), Figure 201 (SEQ ID NO: 284), Figure 203 (Array) Figure 207 (SEQ ID NO: 290), Figure 209 (SEQ ID NO: 292), Figure 211 (SEQ ID NO: 294), Figure 213 (SEQ ID NO: 296), Figure 215 (SEQ ID NO: 298), Figure 217 (SEQ ID NO: 300), Figure 219 (SEQ ID NO: 302), Figure 225 (SEQ ID NO: 308), Figure 227 (SEQ ID NO: 313), Figure 229 (SEQ ID NO: : 318), Figure 232 (SEQ ID NO: 325), Figure 234 (SEQ ID NO: 333), Figure 237 (SEQ ID NO: 339), Figure 239 (SEQ ID NO: 344), Figure 241 (SEQ ID NO: 346), Figure 243 (SEQ ID NO: 348), Figure 245 (SEQ ID NO: 350), Figure 247 (SEQ ID NO: 352), Figure 249 (SEQ ID NO: 354), Figure 251 (SEQ ID NO: 356), Figure 253 (SEQ ID NO :: 358), Figure 255 (SEQ ID NO: 360), Figure 257 (SEQ ID NO: 362), Figure 259 (SEQ ID NO: 364), Figure 261 ( (Column number: 366), Figure 263 (SEQ ID NO: 368), Figure 265 (SEQ ID NO: 370), Figure 267 (SEQ ID NO: 372), Figure 269 (SEQ ID NO: 374), Figure 271 (SEQ ID NO: 376) , Figure 273 (SEQ ID NO: 378), Figure 275 (SEQ ID NO: 380), Figure 277 (SEQ ID NO: 386), Figure 279 (SEQ ID NO: 388), Figure 281 (SEQ ID NO: 393), Figure 283 (Array) Figure 285 (SEQ ID NO: 400), Figure 287 (SEQ ID NO: 402), Figure 289 (SEQ ID NO: 407), Figure 291 (SEQ ID NO: 409), Figure 293 (SEQ ID NO: 411), Figure 295 (SEQ ID NO: 413), Figure 297 (SEQ ID NO: 415), Figure 299 (SEQ ID NO: 417), Figure 301 (SEQ ID NO: 419), Figure 303 (SEQ ID NO: 421), Figure 305 (SEQ ID NO: : 423), Figure 307 (SEQ ID NO: 494), Figure 309 (SEQ ID NO: 496), Figure 311 (SEQ ID NO: 498), Figure 313 (SEQ ID NO: 500), Figure 315 (SEQ ID NO: 502), Figure 317 (SEQ ID NO: 504), Figure 319 (SEQ ID NO: 506), Figure 321 (SEQ ID NO: 508), Figure 323 (SEQ ID NO: 510), Figure 325 (SEQ ID NO: 512), Figure 327 (SEQ ID NO: 514) and FIG. 329 (SEQ ID NO: 516) selected from the group consisting of the sequences shown in FIG. 2. The nucleic acid sequence of claim 1 comprising a nucleotide sequence.   Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 5), Figure 5 (SEQ ID NO: 7), Figure 8 (SEQ ID NO: 13), Figure 11 (SEQ ID NO: 19), Figure 14 (SEQ ID NO: 22), Figure 17 (SEQ ID NO: 27), Figure 19 (SEQ ID NO: 29), Figure 22 (SEQ ID NO: 32), Figure 24 (SEQ ID NO: 35), Figure 26 (SEQ ID NO: 40), Figure 29 (SEQ ID NO: 46), Figure 31 (SEQ ID NO: 51), Figure 33 (SEQ ID NO: 56), Figure 35 (SEQ ID NO: 61), Figure 37 (SEQ ID NO: 66), Figure 40 (SEQ ID NO: 72), FIG. 46 (SEQ ID NO: 83), FIG. 48 (SEQ ID NO: 94), FIG. 50 (SEQ ID NO: 96), FIG. 52 (SEQ ID NO: 98), FIG. 56 (SEQ ID NO: 102) ), FIG. 63 (SEQ ID NO: 112), FIG. 65 (SEQ ID NO: 114), FIG. 67 (SEQ ID NO: 116), FIG. 69 (SEQ ID NO: 118), FIG. 71 (SEQ ID NO: 123), FIG. 73 ( (SEQ ID NO: 128), FIG. 75 (SEQ ID NO: 134), FIG. 78 (SEQ ID NO: 137), FIG. 82 (SEQ ID NO: 145), FIG. 84 (SEQ ID NO: 147), FIG. 87 (SEQ ID NO: 150) Figure 89 (SEQ ID NO: 152), Figure 92 (SEQ ID NO: 155), Figure 94 (SEQ ID NO: 157), Figure 96 (SEQ ID NO: 159), Figure 98 (SEQ ID NO: 164), Figure 100 (SEQ ID NO: 166), FIG. 102 (SEQ ID NO: 168), FIG. 104 (SEQ ID NO: 170), FIG. 108 (SEQ ID NO: 174), FIG. 110 (SEQ ID NO: 176), FIG. 112 (SEQ ID NO: 178) ), FIG. 114 (SEQ ID NO: 180), FIG. 116 (SEQ ID NO: 182), FIG. 119 (SEQ ID NO: 188), FIG. 121 (SEQ ID NO: 193), FIG. 124 (SEQ ID NO: 196), FIG. 126 ( (SEQ ID NO: 198), FIG. 128 (SEQ ID NO: 200), FIG. 130 (SEQ ID NO: 202), FIG. 132 (SEQ ID NO: 204), FIG. 134 (SEQ ID NO: 206), FIG. 136 (SEQ ID NO: 208) Figure 138 (SEQ ID NO: 210), Figure 140 (SEQ ID NO: 212), Figure 143 (SEQ ID NO: 215), Figure 146 (SEQ ID NO: 218), Figure 148 (SEQ ID NO: 220), Figure 150 (Array) Fig. 152 (SEQ ID NO: 224), Fig. 154 (SEQ ID NO: 226), Fig. 156 (SEQ ID NO: 228), Fig. 158 (SEQ ID NO: 230), Fig. 160 (SEQ ID NO: 235), Figure 162 (SEQ ID NO: 240), Figure 164 (SEQ ID NO: 245), Figure 166 (SEQ ID NO: 247), Figure 168 (SEQ ID NO: 249), Figure 170 (SEQ ID NO: 252), Figure 173 (SEQ ID NO: : 255), Figure 175 (SEQ ID NO: 257), Figure 177 (SEQ ID NO: 259), Figure 179 (SEQ ID NO: 261), Figure 181 ( (SEQ ID NO: 263), FIG. 183 (SEQ ID NO: 265), FIG. 185 (SEQ ID NO: 267), FIG. 187 (SEQ ID NO: 269), FIG. 189 (SEQ ID NO: 271), FIG. 191 (SEQ ID NO: 273) , Figure 193 (SEQ ID NO: 275), Figure 195 (SEQ ID NO: 277), Figure 197 (SEQ ID NO: 280), Figure 199 (SEQ ID NO: 282), Figure 201 (SEQ ID NO: 284), Figure 203 (Array) Figure 207 (SEQ ID NO: 290), Figure 209 (SEQ ID NO: 292), Figure 211 (SEQ ID NO: 294), Figure 213 (SEQ ID NO: 296), Figure 215 (SEQ ID NO: 298), Figure 217 (SEQ ID NO: 300), Figure 219 (SEQ ID NO: 302), Figure 225 (SEQ ID NO: 308), Figure 227 (SEQ ID NO: 313), Figure 229 (SEQ ID NO: : 318), Figure 232 (SEQ ID NO: 325), Figure 234 (SEQ ID NO: 333), Figure 237 (SEQ ID NO: 339), Figure 239 (SEQ ID NO: 344), Figure 241 (SEQ ID NO: 346), Figure 243 (SEQ ID NO: 348), Figure 245 (SEQ ID NO: 350), Figure 247 (SEQ ID NO: 352), Figure 249 (SEQ ID NO: 354), Figure 251 (SEQ ID NO: 356), Figure 253 (SEQ ID NO :: 358), Figure 255 (SEQ ID NO: 360), Figure 257 (SEQ ID NO: 362), Figure 259 (SEQ ID NO: 364), Figure 261 ( (Column number: 366), Figure 263 (SEQ ID NO: 368), Figure 265 (SEQ ID NO: 370), Figure 267 (SEQ ID NO: 372), Figure 269 (SEQ ID NO: 374), Figure 271 (SEQ ID NO: 376) , Figure 273 (SEQ ID NO: 378), Figure 275 (SEQ ID NO: 380), Figure 277 (SEQ ID NO: 386), Figure 279 (SEQ ID NO: 388), Figure 281 (SEQ ID NO: 393), Figure 283 (Array) Figure 285 (SEQ ID NO: 400), Figure 287 (SEQ ID NO: 402), Figure 289 (SEQ ID NO: 407), Figure 291 (SEQ ID NO: 409), Figure 293 (SEQ ID NO: 411), Figure 295 (SEQ ID NO: 413), Figure 297 (SEQ ID NO: 415), Figure 299 (SEQ ID NO: 417), Figure 301 (SEQ ID NO: 419), Figure 303 (SEQ ID NO: 421), Figure 305 (SEQ ID NO: : 423), Figure 307 (SEQ ID NO: 494), Figure 309 (SEQ ID NO: 496), Figure 311 (SEQ ID NO: 498), Figure 313 (SEQ ID NO: 500), Figure 315 (SEQ ID NO: 502), Figure 317 (SEQ ID NO: 504), Figure 319 (SEQ ID NO: 506), Figure 321 (SEQ ID NO: 508), Figure 323 (SEQ ID NO: 510), Figure 325 (SEQ ID NO: 512), Figure 327 (SEQ ID NO: 514) and the full-length coding sequence of the sequence shown in FIG. 329 (SEQ ID NO: 516) The nucleic acid sequence of claim 1 comprising a nucleotide sequence selected from.   An isolated nucleic acid comprising the full-length coding sequence of DNA deposited under any ATCC accession number shown in Table 10.   A vector comprising the nucleic acid of claim 1.   6. The vector of claim 5 operably linked to a control sequence recognized by a host cell transformed with the vector.   A host cell comprising the vector of claim 5.   8. The host cell of claim 7, wherein the cell is a CHO cell.   8. The host cell of claim 7, wherein the cell is E. coli.   8. The host cell of claim 7, wherein the cell is a yeast cell.   A method for producing a PRO polypeptide, comprising culturing the host cell of claim 7 under conditions suitable for expression of the PRO polypeptide, and recovering the PRO polypeptide from the cell culture.   Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: : 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 (SEQ ID NO: 36), Figure 27 (SEQ ID NO: 41), Figure 30 (SEQ ID NO: 47), Figure 32 (SEQ ID NO: 52), Figure 34 (SEQ ID NO: 57), Figure 36 (SEQ ID NO: 62), Figure 38 (SEQ ID NO: 67), Figure 41 (SEQ ID NO: 73), FIG. 47 (SEQ ID NO: 84), FIG. 49 (SEQ ID NO: 95), FIG. 51 (SEQ ID NO: 97), FIG. 53 (SEQ ID NO: 99), FIG. 57 (SEQ ID NO: 103), FIG. 64 (SEQ ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119), Figure 72 (SEQ ID NO: 124), Figure 74 (SEQ ID NO: 129) ), FIG. 76 (SEQ ID NO: 135), FIG. 79 (SEQ ID NO: 138), FIG. 83 (SEQ ID NO: 146), FIG. 85 (SEQ ID NO: 148), FIG. 88 (SEQ ID NO: 151), FIG. 90 ( (SEQ ID NO: 153), FIG. 93 (SEQ ID NO: 156), FIG. 95 (SEQ ID NO: 158), FIG. 97 (SEQ ID NO: 160), FIG. 99 (SEQ ID NO: 165), FIG. 101 (SEQ ID NO: 167) , Figure 103 Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181), Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (SEQ ID NO: : 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), FIG. 144 (SEQ ID NO: 216), FIG. 147 (SEQ ID NO: 219), FIG. 149 (SEQ ID NO: 221), FIG. 151 (SEQ ID NO: 223), FIG. 153 (SEQ ID NO: 225), FIG. 155 (SEQ ID NO: 227), FIG. 157 (SEQ ID NO: 229), FIG. 159 (SEQ ID NO: 231), FIG. 161 (SEQ ID NO: 236), FIG. 163 (SEQ ID NO: 241), FIG. 165 (SEQ ID NO: 246), FIG. 167 (SEQ ID NO: 248), FIG. 169 (SEQ ID NO: 250), FIG. 171 (SEQ ID NO: 253), FIG. 174 (SEQ ID NO: 256), FIG. 176 (SEQ ID NO: 258) ), Figure 178 (SEQ ID NO: 260), Figure 180 (SEQ ID NO: 262), Figure 182 (SEQ ID NO: 264), Figure 184 (Array) Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276), Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (SEQ ID NO: : 289), Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO: 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361) ), Figure 258 (SEQ ID NO: 363), Figure 260 (SEQ ID NO: 365), Figure 262 (SEQ ID NO: 367), Figure 264 (Array) Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 (SEQ ID NO: 379), Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: : 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422), Figure 306 (SEQ ID NO: 424), Figure 308 (SEQ ID NO: 495), Figure 310 (SEQ ID NO: 497), Figure 312 (SEQ ID NO: 499), Figure 314 (SEQ ID NO: 501), Figure 316 (SEQ ID NO: 503), Figure 318 (SEQ ID NO: 505), Figure 320 (SEQ ID NO: 507), Figure 322 (SEQ ID NO: 509), Figure 324 (SEQ ID NO: 511), Figure 326 (SEQ ID NO: 513), Figure 328 (SEQ ID NO: 515) and Figure 330 (SEQ ID NO: 517) Amino acid sequence selected from the group consisting of the amino acid sequences shown in In contrast, an isolated PRO polypeptide having at least 80% sequence identity.   An isolated PRO polypeptide having at least 80% sequence identity to the amino acid sequence encoded by the nucleic acid molecule deposited with any ATCC accession number set forth in Table 10.   A chimeric molecule comprising the polypeptide of claim 12 fused to a heterologous amino acid sequence.   The chimeric molecule according to claim 14, wherein the heterologous amino acid sequence is an epitope tag sequence.   The chimeric molecule according to claim 14, wherein the heterologous amino acid sequence is an Fc region of an immunoglobulin.   An antibody that specifically binds to the PRO polypeptide of claim 12.   The antibody according to claim 17, wherein the antibody is a monoclonal antibody.   The antibody of claim 17, wherein the antibody is a humanized antibody.   The antibody according to claim 17, wherein the antibody is an antibody fragment.   Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 5), Figure 5 (SEQ ID NO: 7), Figure 8 (SEQ ID NO: 13), Figure 11 (SEQ ID NO: 19), Figure 14 (SEQ ID NO: : 22), Figure 17 (SEQ ID NO: 27), Figure 19 (SEQ ID NO: 29), Figure 22 (SEQ ID NO: 32), Figure 24 (SEQ ID NO: 35), Figure 26 (SEQ ID NO: 40), Figure 29 (SEQ ID NO: 46), Figure 31 (SEQ ID NO: 51), Figure 33 (SEQ ID NO: 56), Figure 35 (SEQ ID NO: 61), Figure 37 (SEQ ID NO: 66), Figure 40 (SEQ ID NO: 72), FIG. 46 (SEQ ID NO: 83), FIG. 48 (SEQ ID NO: 94), FIG. 50 (SEQ ID NO: 96), FIG. 52 (SEQ ID NO: 98), FIG. 56 (SEQ ID NO: 102), FIG. 63 (SEQ ID NO: 112), FIG. 65 (SEQ ID NO: 114), FIG. 67 (SEQ ID NO: 116), FIG. 69 (SEQ ID NO: 118), FIG. 71 (SEQ ID NO: 123), FIG. 73 (SEQ ID NO: 128) ), FIG. 75 (SEQ ID NO: 134), FIG. 78 (SEQ ID NO: 137), FIG. 82 (SEQ ID NO: 145), FIG. 84 (SEQ ID NO: 147), FIG. 87 (SEQ ID NO: 150), FIG. 89 ( (SEQ ID NO: 152), FIG. 92 (SEQ ID NO: 155), FIG. 94 (SEQ ID NO: 157), FIG. 96 (SEQ ID NO: 159), FIG. 98 (SEQ ID NO: 164), FIG. 100 (SEQ ID NO: 166) , Fig. 102 Figure 104 (SEQ ID NO: 170), Figure 108 (SEQ ID NO: 174), Figure 110 (SEQ ID NO: 176), Figure 112 (SEQ ID NO: 178), Figure 114 (SEQ ID NO: 180), Figure 116 (SEQ ID NO: 182), Figure 119 (SEQ ID NO: 188), Figure 121 (SEQ ID NO: 193), Figure 124 (SEQ ID NO: 196), Figure 126 (SEQ ID NO: 198), Figure 128 (SEQ ID NO: : 200), Figure 130 (SEQ ID NO: 202), Figure 132 (SEQ ID NO: 204), Figure 134 (SEQ ID NO: 206), Figure 136 (SEQ ID NO: 208), Figure 138 (SEQ ID NO: 210), Figure 140 (SEQ ID NO: 212), Figure 143 (SEQ ID NO: 215), Figure 146 (SEQ ID NO: 218), Figure 148 (SEQ ID NO: 220), Figure 150 (SEQ ID NO: 222), Figure 152 (SEQ ID NO: 224), FIG. 154 (SEQ ID NO: 226), FIG. 156 (SEQ ID NO: 228), FIG. 158 (SEQ ID NO: 230), FIG. 160 (SEQ ID NO: 235), FIG. 162 (SEQ ID NO: 240), FIG. 164 (SEQ ID NO: 245), Figure 166 (SEQ ID NO: 247), Figure 168 (SEQ ID NO: 249), Figure 170 (SEQ ID NO: 252), Figure 173 (SEQ ID NO: 255), Figure 175 (SEQ ID NO: 257) ), Figure 177 (SEQ ID NO: 259), Figure 179 (SEQ ID NO: 261), Figure 181 (SEQ ID NO: 263), Figure 183 (Array) Figure 185 (SEQ ID NO: 267), Figure 187 (SEQ ID NO: 269), Figure 189 (SEQ ID NO: 271), Figure 191 (SEQ ID NO: 273), Figure 193 (SEQ ID NO: 275), Figure 195 (SEQ ID NO: 277), Figure 197 (SEQ ID NO: 280), Figure 199 (SEQ ID NO: 282), Figure 201 (SEQ ID NO: 284), Figure 203 (SEQ ID NO: 286), Figure 205 (SEQ ID NO: : 288), Figure 207 (SEQ ID NO: 290), Figure 209 (SEQ ID NO: 292), Figure 211 (SEQ ID NO: 294), Figure 213 (SEQ ID NO: 296), Figure 215 (SEQ ID NO: 298), Figure 217 (SEQ ID NO: 300), Figure 219 (SEQ ID NO: 302), Figure 225 (SEQ ID NO: 308), Figure 227 (SEQ ID NO: 313), Figure 229 (SEQ ID NO: 318), Figure 232 (SEQ ID NO :: 325), Fig. 234 (SEQ ID NO: 333), Fig. 237 (SEQ ID NO: 339), Fig. 239 (SEQ ID NO: 344), Fig. 241 (SEQ ID NO: 346), Fig. 243 (SEQ ID NO: 348), Fig. 245 (SEQ ID NO: 350), Figure 247 (SEQ ID NO: 352), Figure 249 (SEQ ID NO: 354), Figure 251 (SEQ ID NO: 356), Figure 253 (SEQ ID NO: 358), Figure 255 (SEQ ID NO: 360) ), Figure 257 (SEQ ID NO: 362), Figure 259 (SEQ ID NO: 364), Figure 261 (SEQ ID NO: 366), Figure 263 (Array) No.368), Figure 265 (SEQ ID NO: 370), Figure 267 (SEQ ID NO: 372), Figure 269 (SEQ ID NO: 374), Figure 271 (SEQ ID NO: 376), Figure 273 (SEQ ID NO: 378), Figure 275 (SEQ ID NO: 380), Figure 277 (SEQ ID NO: 386), Figure 279 (SEQ ID NO: 388), Figure 281 (SEQ ID NO: 393), Figure 283 (SEQ ID NO: 398), Figure 285 (SEQ ID NO: : 400), Figure 287 (SEQ ID NO: 402), Figure 289 (SEQ ID NO: 407), Figure 291 (SEQ ID NO: 409), Figure 293 (SEQ ID NO: 411), Figure 295 (SEQ ID NO: 413), Figure 297 (SEQ ID NO: 415), Figure 299 (SEQ ID NO: 417), Figure 301 (SEQ ID NO: 419), Figure 303 (SEQ ID NO: 421), Figure 305 (SEQ ID NO: 423), Figure 307 (SEQ ID NO: 494), Figure 309 (SEQ ID NO: 496), Figure 311 (SEQ ID NO: 498), Figure 313 (SEQ ID NO: 500), Figure 315 (SEQ ID NO: 502), Figure 317 (SEQ ID NO: 504), Figure 319 (SEQ ID NO: 506), Figure 321 (SEQ ID NO: 508), Figure 323 (SEQ ID NO: 510), Figure 325 (SEQ ID NO: 512), Figure 327 (SEQ ID NO: 514) and Figure 329 (SEQ ID NO: 516) A nucleotide sequence selected from the group consisting of: An isolated nucleic acid molecule having at least 80% sequence identity to the nucleic acid sequence.   Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 5), Figure 5 (SEQ ID NO: 7), Figure 8 (SEQ ID NO: 13), Figure 11 (SEQ ID NO: 19), Figure 14 (SEQ ID NO: : 22), Figure 17 (SEQ ID NO: 27), Figure 19 (SEQ ID NO: 29), Figure 22 (SEQ ID NO: 32), Figure 24 (SEQ ID NO: 35), Figure 26 (SEQ ID NO: 40), Figure 29 (SEQ ID NO: 46), Figure 31 (SEQ ID NO: 51), Figure 33 (SEQ ID NO: 56), Figure 35 (SEQ ID NO: 61), Figure 37 (SEQ ID NO: 66), Figure 40 (SEQ ID NO: 72), FIG. 46 (SEQ ID NO: 83), FIG. 48 (SEQ ID NO: 94), FIG. 50 (SEQ ID NO: 96), FIG. 52 (SEQ ID NO: 98), FIG. 56 (SEQ ID NO: 102), FIG. 63 (SEQ ID NO: 112), FIG. 65 (SEQ ID NO: 114), FIG. 67 (SEQ ID NO: 116), FIG. 69 (SEQ ID NO: 118), FIG. 71 (SEQ ID NO: 123), FIG. 73 (SEQ ID NO: 128) ), FIG. 75 (SEQ ID NO: 134), FIG. 78 (SEQ ID NO: 137), FIG. 82 (SEQ ID NO: 145), FIG. 84 (SEQ ID NO: 147), FIG. 87 (SEQ ID NO: 150), FIG. 89 ( (SEQ ID NO: 152), FIG. 92 (SEQ ID NO: 155), FIG. 94 (SEQ ID NO: 157), FIG. 96 (SEQ ID NO: 159), FIG. 98 (SEQ ID NO: 164), FIG. 100 (SEQ ID NO: 166) , Fig. 102 Figure 104 (SEQ ID NO: 170), Figure 108 (SEQ ID NO: 174), Figure 110 (SEQ ID NO: 176), Figure 112 (SEQ ID NO: 178), Figure 114 (SEQ ID NO: 180), Figure 116 (SEQ ID NO: 182), Figure 119 (SEQ ID NO: 188), Figure 121 (SEQ ID NO: 193), Figure 124 (SEQ ID NO: 196), Figure 126 (SEQ ID NO: 198), Figure 128 (SEQ ID NO: : 200), Figure 130 (SEQ ID NO: 202), Figure 132 (SEQ ID NO: 204), Figure 134 (SEQ ID NO: 206), Figure 136 (SEQ ID NO: 208), Figure 138 (SEQ ID NO: 210), Figure 140 (SEQ ID NO: 212), Figure 143 (SEQ ID NO: 215), Figure 146 (SEQ ID NO: 218), Figure 148 (SEQ ID NO: 220), Figure 150 (SEQ ID NO: 222), Figure 152 (SEQ ID NO: 224), FIG. 154 (SEQ ID NO: 226), FIG. 156 (SEQ ID NO: 228), FIG. 158 (SEQ ID NO: 230), FIG. 160 (SEQ ID NO: 235), FIG. 162 (SEQ ID NO: 240), FIG. 164 (SEQ ID NO: 245), Figure 166 (SEQ ID NO: 247), Figure 168 (SEQ ID NO: 249), Figure 170 (SEQ ID NO: 252), Figure 173 (SEQ ID NO: 255), Figure 175 (SEQ ID NO: 257) ), Figure 177 (SEQ ID NO: 259), Figure 179 (SEQ ID NO: 261), Figure 181 (SEQ ID NO: 263), Figure 183 (Array) Figure 185 (SEQ ID NO: 267), Figure 187 (SEQ ID NO: 269), Figure 189 (SEQ ID NO: 271), Figure 191 (SEQ ID NO: 273), Figure 193 (SEQ ID NO: 275), Figure 195 (SEQ ID NO: 277), Figure 197 (SEQ ID NO: 280), Figure 199 (SEQ ID NO: 282), Figure 201 (SEQ ID NO: 284), Figure 203 (SEQ ID NO: 286), Figure 205 (SEQ ID NO: : 288), Figure 207 (SEQ ID NO: 290), Figure 209 (SEQ ID NO: 292), Figure 211 (SEQ ID NO: 294), Figure 213 (SEQ ID NO: 296), Figure 215 (SEQ ID NO: 298), Figure 217 (SEQ ID NO: 300), Figure 219 (SEQ ID NO: 302), Figure 225 (SEQ ID NO: 308), Figure 227 (SEQ ID NO: 313), Figure 229 (SEQ ID NO: 318), Figure 232 (SEQ ID NO :: 325), Fig. 234 (SEQ ID NO: 333), Fig. 237 (SEQ ID NO: 339), Fig. 239 (SEQ ID NO: 344), Fig. 241 (SEQ ID NO: 346), Fig. 243 (SEQ ID NO: 348), Fig. 245 (SEQ ID NO: 350), Figure 247 (SEQ ID NO: 352), Figure 249 (SEQ ID NO: 354), Figure 251 (SEQ ID NO: 356), Figure 253 (SEQ ID NO: 358), Figure 255 (SEQ ID NO: 360) ), Figure 257 (SEQ ID NO: 362), Figure 259 (SEQ ID NO: 364), Figure 261 (SEQ ID NO: 366), Figure 263 (Array) No.368), Figure 265 (SEQ ID NO: 370), Figure 267 (SEQ ID NO: 372), Figure 269 (SEQ ID NO: 374), Figure 271 (SEQ ID NO: 376), Figure 273 (SEQ ID NO: 378), Figure 275 (SEQ ID NO: 380), Figure 277 (SEQ ID NO: 386), Figure 279 (SEQ ID NO: 388), Figure 281 (SEQ ID NO: 393), Figure 283 (SEQ ID NO: 398), Figure 285 (SEQ ID NO: : 400), Figure 287 (SEQ ID NO: 402), Figure 289 (SEQ ID NO: 407), Figure 291 (SEQ ID NO: 409), Figure 293 (SEQ ID NO: 411), Figure 295 (SEQ ID NO: 413), Figure 297 (SEQ ID NO: 415), Figure 299 (SEQ ID NO: 417), Figure 301 (SEQ ID NO: 419), Figure 303 (SEQ ID NO: 421), Figure 305 (SEQ ID NO: 423), Figure 307 (SEQ ID NO :: 494), Figure 309 (SEQ ID NO: 496), Figure 311 (SEQ ID NO: 498), Figure 313 (SEQ ID NO: 500), Figure 315 (SEQ ID NO: 502), Figure 317 (SEQ ID NO: 504), Figure 319 (SEQ ID NO: 506), Figure 321 (SEQ ID NO: 508), Figure 323 (SEQ ID NO: 510), Figure 325 (SEQ ID NO: 512), Figure 327 (SEQ ID NO: 514) and Figure 329 (SEQ ID NO: 516) ) Is a full-length code of a nucleotide sequence selected from the group consisting of An isolated nucleic acid molecule having at least 80% sequence identity to a coding sequence.   The extracellular domain of an isolated PRO polypeptide.   An isolated PRO polypeptide lacking an associated signal peptide.   An isolated polypeptide having at least about 80% amino acid sequence identity to the extracellular domain of the PRO polypeptide.   An isolated polypeptide having at least about 80% amino acid sequence identity to a PRO polypeptide lacking an associated signal peptide. (a) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: 23), FIG. 18 (SEQ ID NO: 28), FIG. 20 (SEQ ID NO: 30), FIG. 23 (SEQ ID NO: 33), FIG. 25 (SEQ ID NO: 36), FIG. 27 (SEQ ID NO: 41) ), Figure 30 (SEQ ID NO: 47), Figure 32 (SEQ ID NO: 52), Figure 34 (SEQ ID NO: 57), Figure 36 (SEQ ID NO: 62), Figure 38 (SEQ ID NO: 67), Figure 41 ( (SEQ ID NO: 73), FIG. 47 (SEQ ID NO: 84), FIG. 49 (SEQ ID NO: 95), FIG. 51 (SEQ ID NO: 97), FIG. 53 (SEQ ID NO: 99), FIG. 57 (SEQ ID NO: 103) Fig. 64 (SEQ ID NO: 113), Fig. 66 (SEQ ID NO: 115), Fig. 68 (SEQ ID NO: 117), Fig. 70 (SEQ ID NO: 119), Fig. 72 (SEQ ID NO: 124), Fig. 74 (sequence) Fig. 76 (SEQ ID NO: 135), Fig. 79 (SEQ ID NO: 138), Fig. 83 (SEQ ID NO: 146), Fig. 85 (SEQ ID NO: 148), Fig. 88 (SEQ ID NO: 151), Figure 90 (SEQ ID NO: 153), Figure 93 (SEQ ID NO: 156), Figure 95 (SEQ ID NO: 158), Figure 97 (SEQ ID NO: 160), Figure 99 (SEQ ID NO: 165), Figure 101 (SEQ ID NO: : 167), Figure 103 ( (Column number: 169), Figure 105 (SEQ ID NO: 171), Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181) , Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (Array) Number: 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), Figure 144 (SEQ ID NO: 216), Figure 147 (SEQ ID NO: 219), Figure 149 (SEQ ID NO: 221), Figure 151 (SEQ ID NO: 223), Figure 153 (SEQ ID NO: : 225), Figure 155 (SEQ ID NO: 227), Figure 157 (SEQ ID NO: 229), Figure 159 (SEQ ID NO: 231), Figure 161 (SEQ ID NO: 236), Figure 163 (SEQ ID NO: 241), Figure 165 (SEQ ID NO: 246), Figure 167 (SEQ ID NO: 248), Figure 169 (SEQ ID NO: 250), Figure 171 (SEQ ID NO: 253), Figure 174 (SEQ ID NO: 256), Figure 176 (SEQ ID NO: 258), Figure 178 (SEQ ID NO: 260), Figure 180 (SEQ ID NO: 262), Figure 182 (SEQ ID NO: 264), Figure 184 ( (Column number: 266), Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276) , Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (Array) Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO: 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: : 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361), Fig. 258 (SEQ ID NO: 363), Fig. 260 (SEQ ID NO: 365), Fig. 262 (SEQ ID NO: 367), Fig. 264 (Arrangement) (Column number: 369), Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 (SEQ ID NO: 379) , Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (Array) Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422), Figure 306 (SEQ ID NO: 424), Figure 308 (SEQ ID NO: : 495), Figure 310 (SEQ ID NO: 497), Figure 312 (SEQ ID NO: 499), Figure 314 (SEQ ID NO: 501), Figure 316 (SEQ ID NO: 503), Figure 318 (SEQ ID NO: 505), Figure 320 (SEQ ID NO: 507), Figure 322 (SEQ ID NO: 509), Figure 324 (SEQ ID NO: 511), Figure 326 (SEQ ID NO: 513), Figure 328 (SEQ ID NO: 515) or Figure 330 (SEQ ID NO: 517) and lacks its associated signal peptide. Nucleotide sequence;
(b) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 (SEQ ID NO: 36), Figure 27 (SEQ ID NO: 41) ), Fig. 30 (SEQ ID NO: 47), Fig. 32 (SEQ ID NO: 52), Fig. 34 (SEQ ID NO: 57), Fig. 36 (SEQ ID NO: 62), Fig. 38 (SEQ ID NO: 67), Fig. 41 ( (SEQ ID NO: 73), FIG. 47 (SEQ ID NO: 84), FIG. 49 (SEQ ID NO: 95), FIG. 51 (SEQ ID NO: 97), FIG. 53 (SEQ ID NO: 99), FIG. 57 (SEQ ID NO: 103) Figure 64 (SEQ ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119), Figure 72 (SEQ ID NO: 124), Figure 74 (Array) Fig. 76 (SEQ ID NO: 135), Fig. 79 (SEQ ID NO: 138), Fig. 83 (SEQ ID NO: 146), Fig. 85 (SEQ ID NO: 148), Fig. 88 (SEQ ID NO: 151), Figure 90 (SEQ ID NO: 153), Figure 93 (SEQ ID NO: 156), Figure 95 (SEQ ID NO: 158), Figure 97 (SEQ ID NO: 160), Figure 99 (SEQ ID NO: 165), Figure 101 (SEQ ID NO: : 167), Figure 103 ( (Column number: 169), Figure 105 (SEQ ID NO: 171), Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181) , Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (Array) Number: 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), Figure 144 (SEQ ID NO: 216), Figure 147 (SEQ ID NO: 219), Figure 149 (SEQ ID NO: 221), Figure 151 (SEQ ID NO: 223), Figure 153 (SEQ ID NO: : 225), Figure 155 (SEQ ID NO: 227), Figure 157 (SEQ ID NO: 229), Figure 159 (SEQ ID NO: 231), Figure 161 (SEQ ID NO: 236), Figure 163 (SEQ ID NO: 241), Figure 165 (SEQ ID NO: 246), Figure 167 (SEQ ID NO: 248), Figure 169 (SEQ ID NO: 250), Figure 171 (SEQ ID NO: 253), Figure 174 (SEQ ID NO: 256), Figure 176 (SEQ ID NO: 258), Fig. 178 (SEQ ID NO: 260), Fig. 180 (SEQ ID NO: 262), Fig. 182 (SEQ ID NO: 264), Fig. 184 (Arrangement) (Column number: 266), Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276) , Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (Array) Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO: 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: : 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361), Fig. 258 (SEQ ID NO: 363), Fig. 260 (SEQ ID NO: 365), Fig. 262 (SEQ ID NO: 367), Fig. 264 (Arrangement) Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 (SEQ ID NO: 379), Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: : 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422), Figure 306 (SEQ ID NO: 424), Figure 308 (SEQ ID NO: 495), Figure 310 (SEQ ID NO: 497), Figure 312 (SEQ ID NO: 499), Figure 314 (SEQ ID NO: 501), Figure 316 (SEQ ID NO: 503), Figure 318 (SEQ ID NO: 505), Figure 320 (SEQ ID NO: 507), Figure 322 (SEQ ID NO: 509), Figure 324 (SEQ ID NO: 511), Figure 326 (SEQ ID NO: 513), Figure 328 (SEQ ID NO: 515) or Figure 330 (SEQ ID NO: 517) ) Which encodes the extracellular domain of the polypeptide shown in FIG. Nucleotide sequence with a peptide; or
(c) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 (SEQ ID NO: 36), Figure 27 (SEQ ID NO: 41) ), Fig. 30 (SEQ ID NO: 47), Fig. 32 (SEQ ID NO: 52), Fig. 34 (SEQ ID NO: 57), Fig. 36 (SEQ ID NO: 62), Fig. 38 (SEQ ID NO: 67), Fig. 41 ( (SEQ ID NO: 73), FIG. 47 (SEQ ID NO: 84), FIG. 49 (SEQ ID NO: 95), FIG. 51 (SEQ ID NO: 97), FIG. 53 (SEQ ID NO: 99), FIG. 57 (SEQ ID NO: 103) Figure 64 (SEQ ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119), Figure 72 (SEQ ID NO: 124), Figure 74 (Array) Fig. 76 (SEQ ID NO: 135), Fig. 79 (SEQ ID NO: 138), Fig. 83 (SEQ ID NO: 146), Fig. 85 (SEQ ID NO: 148), Fig. 88 (SEQ ID NO: 151), Figure 90 (SEQ ID NO: 153), Figure 93 (SEQ ID NO: 156), Figure 95 (SEQ ID NO: 158), Figure 97 (SEQ ID NO: 160), Figure 99 (SEQ ID NO: 165), Figure 101 (SEQ ID NO: : 167), Figure 103 ( (Column number: 169), Figure 105 (SEQ ID NO: 171), Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181) , Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (Array) Number: 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), Figure 144 (SEQ ID NO: 216), Figure 147 (SEQ ID NO: 219), Figure 149 (SEQ ID NO: 221), Figure 151 (SEQ ID NO: 223), Figure 153 (SEQ ID NO: : 225), Figure 155 (SEQ ID NO: 227), Figure 157 (SEQ ID NO: 229), Figure 159 (SEQ ID NO: 231), Figure 161 (SEQ ID NO: 236), Figure 163 (SEQ ID NO: 241), Figure 165 (SEQ ID NO: 246), Figure 167 (SEQ ID NO: 248), Figure 169 (SEQ ID NO: 250), Figure 171 (SEQ ID NO: 253), Figure 174 (SEQ ID NO: 256), Figure 176 (SEQ ID NO: 258), Fig. 178 (SEQ ID NO: 260), Fig. 180 (SEQ ID NO: 262), Fig. 182 (SEQ ID NO: 264), Fig. 184 (Arrangement) (Column number: 266), Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276) , Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (Array) Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO: 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: : 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361), Fig. 258 (SEQ ID NO: 363), Fig. 260 (SEQ ID NO: 365), Fig. 262 (SEQ ID NO: 367), Fig. 264 (Arrangement) Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 (SEQ ID NO: 379), Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: : 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422), Figure 306 (SEQ ID NO: 424), Figure 308 (SEQ ID NO: 495), Figure 310 (SEQ ID NO: 497), Figure 312 (SEQ ID NO: 499), Figure 314 (SEQ ID NO: 501), Figure 316 (SEQ ID NO: 503), Figure 318 (SEQ ID NO: 505), Figure 320 (SEQ ID NO: 507), Figure 322 (SEQ ID NO: 509), Figure 324 (SEQ ID NO: 511), Figure 326 (SEQ ID NO: 513), Figure 328 (SEQ ID NO: 515) or Figure 330 (SEQ ID NO: 517) ) Which encodes the extracellular domain of the polypeptide shown in FIG. Nucleotide sequence lacking a peptide;
An isolated nucleic acid having at least 80% nucleic acid sequence identity to. Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: : 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 (SEQ ID NO: 36), Figure 27 (SEQ ID NO: 41), Figure 30 (SEQ ID NO: 47), Figure 32 (SEQ ID NO: 52), Figure 34 (SEQ ID NO: 57), Figure 36 (SEQ ID NO: 62), Figure 38 (SEQ ID NO: 67), Figure 41 (SEQ ID NO: 73), FIG. 47 (SEQ ID NO: 84), FIG. 49 (SEQ ID NO: 95), FIG. 51 (SEQ ID NO: 97), FIG. 53 (SEQ ID NO: 99), FIG. 57 (SEQ ID NO: 103), FIG. 64 (SEQ ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119), Figure 72 (SEQ ID NO: 124), Figure 74 (SEQ ID NO: 129) ), FIG. 76 (SEQ ID NO: 135), FIG. 79 (SEQ ID NO: 138), FIG. 83 (SEQ ID NO: 146), FIG. 85 (SEQ ID NO: 148), FIG. 88 (SEQ ID NO: 151), FIG. 90 ( (SEQ ID NO: 153), FIG. 93 (SEQ ID NO: 156), FIG. 95 (SEQ ID NO: 158), FIG. 97 (SEQ ID NO: 160), FIG. 99 (SEQ ID NO: 165), FIG. 101 (SEQ ID NO: 167) , Figure 103 Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181), Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (SEQ ID NO: : 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), FIG. 144 (SEQ ID NO: 216), FIG. 147 (SEQ ID NO: 219), FIG. 149 (SEQ ID NO: 221), FIG. 151 (SEQ ID NO: 223), FIG. 153 (SEQ ID NO: 225), FIG. 155 (SEQ ID NO: 227), FIG. 157 (SEQ ID NO: 229), FIG. 159 (SEQ ID NO: 231), FIG. 161 (SEQ ID NO: 236), FIG. 163 (SEQ ID NO: 241), FIG. 165 (SEQ ID NO: 246), FIG. 167 (SEQ ID NO: 248), FIG. 169 (SEQ ID NO: 250), FIG. 171 (SEQ ID NO: 253), FIG. 174 (SEQ ID NO: 256), FIG. 176 (SEQ ID NO: 258) ), Figure 178 (SEQ ID NO: 260), Figure 180 (SEQ ID NO: 262), Figure 182 (SEQ ID NO: 264), Figure 184 (Array) Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276), Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (SEQ ID NO: : 289), Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO: 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361) ), Figure 258 (SEQ ID NO: 363), Figure 260 (SEQ ID NO: 365), Figure 262 (SEQ ID NO: 367), Figure 264 (Array) Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 (SEQ ID NO: 379), Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: : 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422), Figure 306 (SEQ ID NO: 424), Figure 308 (SEQ ID NO: 495), Figure 310 (SEQ ID NO: 497), Figure 312 (SEQ ID NO: 499), Figure 314 (SEQ ID NO: 501), Figure 316 (SEQ ID NO: 503), Figure 318 (SEQ ID NO: 505), Figure 320 (SEQ ID NO: 507), Figure 322 (SEQ ID NO: 509), Figure 324 (SEQ ID NO: 511), Figure 326 (SEQ ID NO: 513), Figure 328 (SEQ ID NO: 515) or Figure 330 (SEQ ID NO: 517) ) And lacks its associated signal peptide;
(b) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 (SEQ ID NO: 36), Figure 27 (SEQ ID NO: 41) ), Fig. 30 (SEQ ID NO: 47), Fig. 32 (SEQ ID NO: 52), Fig. 34 (SEQ ID NO: 57), Fig. 36 (SEQ ID NO: 62), Fig. 38 (SEQ ID NO: 67), Fig. 41 ( (SEQ ID NO: 73), FIG. 47 (SEQ ID NO: 84), FIG. 49 (SEQ ID NO: 95), FIG. 51 (SEQ ID NO: 97), FIG. 53 (SEQ ID NO: 99), FIG. 57 (SEQ ID NO: 103) Figure 64 (SEQ ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119), Figure 72 (SEQ ID NO: 124), Figure 74 (Array) Fig. 76 (SEQ ID NO: 135), Fig. 79 (SEQ ID NO: 138), Fig. 83 (SEQ ID NO: 146), Fig. 85 (SEQ ID NO: 148), Fig. 88 (SEQ ID NO: 151), Figure 90 (SEQ ID NO: 153), Figure 93 (SEQ ID NO: 156), Figure 95 (SEQ ID NO: 158), Figure 97 (SEQ ID NO: 160), Figure 99 (SEQ ID NO: 165), Figure 101 (SEQ ID NO: : 167), Figure 103 ( (Column number: 169), Figure 105 (SEQ ID NO: 171), Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181) , Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (Array) Number: 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), Figure 144 (SEQ ID NO: 216), Figure 147 (SEQ ID NO: 219), Figure 149 (SEQ ID NO: 221), Figure 151 (SEQ ID NO: 223), Figure 153 (SEQ ID NO: : 225), Figure 155 (SEQ ID NO: 227), Figure 157 (SEQ ID NO: 229), Figure 159 (SEQ ID NO: 231), Figure 161 (SEQ ID NO: 236), Figure 163 (SEQ ID NO: 241), Figure 165 (SEQ ID NO: 246), Figure 167 (SEQ ID NO: 248), Figure 169 (SEQ ID NO: 250), Figure 171 (SEQ ID NO: 253), Figure 174 (SEQ ID NO: 256), Figure 176 (SEQ ID NO: 258), Fig. 178 (SEQ ID NO: 260), Fig. 180 (SEQ ID NO: 262), Fig. 182 (SEQ ID NO: 264), Fig. 184 (Arrangement) (Column number: 266), Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276) , Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (Array) Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO: 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: : 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361), Fig. 258 (SEQ ID NO: 363), Fig. 260 (SEQ ID NO: 365), Fig. 262 (SEQ ID NO: 367), Fig. 264 (Arrangement) Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 (SEQ ID NO: 379), Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: : 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422), Figure 306 (SEQ ID NO: 424), Figure 308 (SEQ ID NO: 495), Figure 310 (SEQ ID NO: 497), Figure 312 (SEQ ID NO: 499), Figure 314 (SEQ ID NO: 501), Figure 316 (SEQ ID NO: 503), Figure 318 (SEQ ID NO: 505), Figure 320 (SEQ ID NO: 507), Figure 322 (SEQ ID NO: 509), Figure 324 (SEQ ID NO: 511), Figure 326 (SEQ ID NO: 513), Figure 328 (SEQ ID NO: 515) or Figure 330 (SEQ ID NO: 517) Of the polypeptide with its associated signal peptide Domain; or
(c) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 6), Figure 6 (SEQ ID NO: 8), Figure 9 (SEQ ID NO: 14), Figure 12 (SEQ ID NO: 20), Figure 15 (SEQ ID NO: 23), Figure 18 (SEQ ID NO: 28), Figure 20 (SEQ ID NO: 30), Figure 23 (SEQ ID NO: 33), Figure 25 (SEQ ID NO: 36), Figure 27 (SEQ ID NO: 41) ), Fig. 30 (SEQ ID NO: 47), Fig. 32 (SEQ ID NO: 52), Fig. 34 (SEQ ID NO: 57), Fig. 36 (SEQ ID NO: 62), Fig. 38 (SEQ ID NO: 67), Fig. 41 ( (SEQ ID NO: 73), FIG. 47 (SEQ ID NO: 84), FIG. 49 (SEQ ID NO: 95), FIG. 51 (SEQ ID NO: 97), FIG. 53 (SEQ ID NO: 99), FIG. 57 (SEQ ID NO: 103) Figure 64 (SEQ ID NO: 113), Figure 66 (SEQ ID NO: 115), Figure 68 (SEQ ID NO: 117), Figure 70 (SEQ ID NO: 119), Figure 72 (SEQ ID NO: 124), Figure 74 (Array) Fig. 76 (SEQ ID NO: 135), Fig. 79 (SEQ ID NO: 138), Fig. 83 (SEQ ID NO: 146), Fig. 85 (SEQ ID NO: 148), Fig. 88 (SEQ ID NO: 151), Figure 90 (SEQ ID NO: 153), Figure 93 (SEQ ID NO: 156), Figure 95 (SEQ ID NO: 158), Figure 97 (SEQ ID NO: 160), Figure 99 (SEQ ID NO: 165), Figure 101 (SEQ ID NO: : 167), Figure 103 ( (Column number: 169), Figure 105 (SEQ ID NO: 171), Figure 109 (SEQ ID NO: 175), Figure 111 (SEQ ID NO: 177), Figure 113 (SEQ ID NO: 179), Figure 115 (SEQ ID NO: 181) , Figure 117 (SEQ ID NO: 183), Figure 120 (SEQ ID NO: 189), Figure 122 (SEQ ID NO: 194), Figure 125 (SEQ ID NO: 197), Figure 127 (SEQ ID NO: 199), Figure 129 (Array) Number: 201), Figure 131 (SEQ ID NO: 203), Figure 133 (SEQ ID NO: 205), Figure 135 (SEQ ID NO: 207), Figure 137 (SEQ ID NO: 209), Figure 139 (SEQ ID NO: 211), Figure 141 (SEQ ID NO: 213), Figure 144 (SEQ ID NO: 216), Figure 147 (SEQ ID NO: 219), Figure 149 (SEQ ID NO: 221), Figure 151 (SEQ ID NO: 223), Figure 153 (SEQ ID NO: : 225), Figure 155 (SEQ ID NO: 227), Figure 157 (SEQ ID NO: 229), Figure 159 (SEQ ID NO: 231), Figure 161 (SEQ ID NO: 236), Figure 163 (SEQ ID NO: 241), Figure 165 (SEQ ID NO: 246), Figure 167 (SEQ ID NO: 248), Figure 169 (SEQ ID NO: 250), Figure 171 (SEQ ID NO: 253), Figure 174 (SEQ ID NO: 256), Figure 176 (SEQ ID NO: 258), Fig. 178 (SEQ ID NO: 260), Fig. 180 (SEQ ID NO: 262), Fig. 182 (SEQ ID NO: 264), Fig. 184 (Arrangement) (Column number: 266), Figure 186 (SEQ ID NO: 268), Figure 188 (SEQ ID NO: 270), Figure 190 (SEQ ID NO: 272), Figure 192 (SEQ ID NO: 274), Figure 194 (SEQ ID NO: 276) , Figure 196 (SEQ ID NO: 278), Figure 198 (SEQ ID NO: 281), Figure 200 (SEQ ID NO: 283), Figure 202 (SEQ ID NO: 285), Figure 204 (SEQ ID NO: 287), Figure 206 (Array) Figure 208 (SEQ ID NO: 291), Figure 210 (SEQ ID NO: 293), Figure 212 (SEQ ID NO: 295), Figure 214 (SEQ ID NO: 297), Figure 216 (SEQ ID NO: 299), Figure 218 (SEQ ID NO: 301), Figure 220 (SEQ ID NO: 303), Figure 226 (SEQ ID NO: 309), Figure 228 (SEQ ID NO: 314), Figure 230 (SEQ ID NO: 319), Figure 233 (SEQ ID NO: : 326), Figure 235 (SEQ ID NO: 334), Figure 238 (SEQ ID NO: 340), Figure 240 (SEQ ID NO: 345), Figure 242 (SEQ ID NO: 347), Figure 244 (SEQ ID NO: 349), Figure 246 (SEQ ID NO: 351), Figure 248 (SEQ ID NO: 353), Figure 250 (SEQ ID NO: 355), Figure 252 (SEQ ID NO: 357), Figure 254 (SEQ ID NO: 359), Figure 256 (SEQ ID NO: 361), Fig. 258 (SEQ ID NO: 363), Fig. 260 (SEQ ID NO: 365), Fig. 262 (SEQ ID NO: 367), Fig. 264 (Arrangement) Figure 266 (SEQ ID NO: 371), Figure 268 (SEQ ID NO: 373), Figure 270 (SEQ ID NO: 375), Figure 272 (SEQ ID NO: 377), Figure 274 (SEQ ID NO: 379), Figure 276 (SEQ ID NO: 381), Figure 278 (SEQ ID NO: 387), Figure 280 (SEQ ID NO: 389), Figure 282 (SEQ ID NO: 394), Figure 284 (SEQ ID NO: 399), Figure 286 (SEQ ID NO: : 401), Figure 288 (SEQ ID NO: 403), Figure 290 (SEQ ID NO: 408), Figure 292 (SEQ ID NO: 410), Figure 294 (SEQ ID NO: 412), Figure 296 (SEQ ID NO: 414), Figure 298 (SEQ ID NO: 416), Figure 300 (SEQ ID NO: 418), Figure 302 (SEQ ID NO: 420), Figure 304 (SEQ ID NO: 422), Figure 306 (SEQ ID NO: 424), Figure 308 (SEQ ID NO: 495), Figure 310 (SEQ ID NO: 497), Figure 312 (SEQ ID NO: 499), Figure 314 (SEQ ID NO: 501), Figure 316 (SEQ ID NO: 503), Figure 318 (SEQ ID NO: 505), Figure 320 (SEQ ID NO: 507), Figure 322 (SEQ ID NO: 509), Figure 324 (SEQ ID NO: 511), Figure 326 (SEQ ID NO: 513), Figure 328 (SEQ ID NO: 515) or Figure 330 (SEQ ID NO: 517) The extracellular of a polypeptide lacking its associated signal peptide domain;
An isolated polypeptide having at least 80% amino acid sequence identity to.   In a method for detecting a PRO943 polypeptide from a sample suspected of containing a PRO943 polypeptide, the sample is contacted with a PRO183, PRO184 or PRO185 polypeptide, and the PRO943 / PRO183, PRO184 or PRO185 polypeptide conjugate in the sample is contacted. Measuring the formation, wherein the formation of the conjugate indicates the presence of a PRO943 polypeptide in the sample.   30. The method of claim 29, wherein the sample comprises cells suspected of expressing the PRO943 polypeptide.   30. The method of claim 29, wherein the PRO183, PRO184 or PRO185 polypeptide is labeled with a detectable label.   30. The method of claim 29, wherein the PRO183, PRO184, or PRO185 polypeptide is attached to a solid support.   In a method for detecting PRO183, PRO184, or PRO185 polypeptide from a sample presumed to contain PRO183, PRO184, or PRO185 polypeptide, the sample is contacted with PRO943 polypeptide, and PRO943 / PRO183, PRO184, or PRO185 polypeptide in the sample is contacted. Measuring the formation of peptide conjugates, wherein said conjugate formation indicates the presence of PRO183, PRO184 or PRO185 polypeptide in said sample.   34. The method of claim 33, wherein the sample comprises cells suspected of expressing the PRO183, PRO184, or PRO185 polypeptide.   34. The method of claim 33, wherein the PRO943 polypeptide is labeled with a detectable label.   34. The method of claim 33, wherein the PRO943 polypeptide is attached to a solid support.   A method for detecting a PRO331 polypeptide from a sample suspected of containing a PRO331 polypeptide comprising contacting the sample with a PRO1133 polypeptide and measuring the formation of a PRO331 / PRO1133 polypeptide conjugate in the sample. The method wherein the formation of the conjugate indicates the presence of PRO331 polypeptide in the sample.   38. The method of claim 37, wherein the sample comprises cells suspected of expressing the PRO331 polypeptide.   38. The method of claim 37, wherein the PRO1133 polypeptide is labeled with a detectable label.   38. The method of claim 37, wherein the PRO1133 polypeptide is attached to a solid support.   A method of detecting a PRO1133 polypeptide from a sample suspected of containing a PRO1133 polypeptide, comprising contacting the sample with a PRO331 polypeptide and measuring the formation of a PRO331 / PRO1133 polypeptide conjugate in the sample. The method wherein the formation of the conjugate indicates the presence of PRO1133 polypeptide in the sample.   42. The method of claim 41, wherein the sample comprises cells suspected of expressing the PRO1133 polypeptide.   42. The method of claim 41, wherein the PRO331 polypeptide is labeled with a detectable label. 42. The method of claim 41, wherein the PRO331 polypeptide is attached to a solid support.   In a method of detecting PRO363 or PRO5723 polypeptide from a sample suspected of containing PRO363 or PRO5723 polypeptide, the sample is contacted with PRO1387 polypeptide to form a PRO363 or PRO5723 / PRO1387 polypeptide conjugate in the sample. Measuring, wherein said conjugate formation indicates the presence of PRO363 or PRO5723 polypeptide in said sample.   46. The method of claim 45, wherein the sample comprises cells suspected of expressing the PRO363 or PRO5723 polypeptide.   46. The method of claim 45, wherein the PRO1387 polypeptide is labeled with a detectable label.   46. The method of claim 45, wherein the PRO1387 polypeptide is attached to a solid support.   In a method for detecting a PRO1387 polypeptide from a sample suspected of containing a PRO1387 polypeptide, the sample is contacted with a PRO363 or PRO5723 polypeptide, and the formation of a PRO363 or PRO5723 / PRO1387 polypeptide conjugate in the sample is measured. Wherein the formation of said conjugate indicates the presence of PRO1387 polypeptide in said sample.   50. The method of claim 49, wherein the sample comprises cells suspected of expressing the PRO1387 polypeptide.   50. The method of claim 49, wherein the PRO363 or PRO5723 polypeptide is labeled with a detectable label.   50. The method of claim 49, wherein the PRO363 or PRO5723 polypeptide is attached to a solid support.   In a method for detecting a PRO1114 polypeptide from a sample suspected of containing a PRO1114 polypeptide, the sample is contacted with a PRO3301 or PRO9940 polypeptide, and the formation of a PRO1114 / PRO3301 or PRO9940 polypeptide conjugate in the sample is measured. Wherein the formation of said conjugate indicates the presence of PRO1114 polypeptide in said sample.   54. The method of claim 53, wherein the sample comprises cells suspected of expressing the PRO1114 polypeptide.   54. The method of claim 53, wherein the PRO3301 or PRO9940 polypeptide is labeled with a detectable label.   54. The method of claim 53, wherein the PRO3301 or PRO9940 polypeptide is attached to a solid support.   In a method for detecting a PRO3301 or PRO9940 polypeptide from a sample presumed to contain a PRO3301 or PRO9940 polypeptide, the sample is contacted with a PRO1114 polypeptide to form a PRO3301 or PRO9940 / PRO1114 polypeptide conjugate in the sample. Measuring, wherein formation of said conjugate indicates the presence of PRO3301 or PRO9940 polypeptide in said sample.   58. The method of claim 57, wherein the sample comprises cells suspected of expressing the PRO3301 or PRO9940 polypeptide.   58. The method of claim 57, wherein the PRO1114 polypeptide is labeled with a detectable label.   58. The method of claim 57, wherein the PRO1114 polypeptide is attached to a solid support.   In a method for detecting a PRO1181 polypeptide from a sample suspected of containing a PRO1181 polypeptide, the sample is contacted with a PRO7170, PRO361 or PRO846 polypeptide, and the PRO1181 / PRO7170, PRO361 or PRO846 polypeptide conjugate in the sample is contacted. Measuring the formation, wherein the formation of said conjugate indicates the presence of PRO1181 polypeptide in said sample.   62. The method of claim 61, wherein the sample comprises cells suspected of expressing the PRO1181 polypeptide.   62. The method of claim 61, wherein the PRO7170, PRO361 or PRO846 polypeptide is labeled with a detectable label.   62. The method of claim 61, wherein the PRO7170, PRO361 or PRO846 polypeptide is attached to a solid support.   In a method for detecting PRO7170, PRO361 or PRO846 polypeptide from a sample presumed to contain PRO7170, PRO361 or PRO846 polypeptide, the sample is contacted with PRO1181 polypeptide, and PRO1181 / PRO7170, PRO361 or PRO846 polypeptide in the sample is detected. Measuring the formation of a peptide conjugate, wherein said conjugate formation indicates the presence of a PRO7170, PRO361 or PRO846 polypeptide in said sample.   66. The method of claim 65, wherein the sample comprises cells suspected of expressing the PRO7170, PRO361, or PRO846 polypeptide.   66. The method of claim 65, wherein the PRO1181 polypeptide is labeled with a detectable label.   66. The method of claim 65, wherein the PRO1181 polypeptide is attached to a solid support.   In a method of associating a bioactive molecule with a cell expressing a PRO943 polypeptide, the cell is contacted with a PRO183, PRO184 or PRO185 polypeptide associated with the bioactive molecule, and the PRO943 and PRO183, PRO184 or PRO185 are contacted. Allowing the polypeptides to bind to each other, thereby associating the bioactive molecule with the cell.   70. The method of claim 69, wherein the bioactive molecule is a toxin, radioisotope or antibody.   70. The method of claim 69, wherein the bioactive molecule causes the cell to die.   A method of associating a bioactive molecule with a cell that expresses a PRO183, PRO184 or PRO185 polypeptide, wherein the cell is contacted with a PRO943 polypeptide associated with the bioactive molecule, and the PRO943 and PRO183, PRO184 or PRO185 polypeptide are contacted. Allowing the molecules to bind to each other, thereby associating the bioactive molecule with the cell.   73. The method of claim 72, wherein the bioactive molecule is a toxin, radioisotope or antibody.   74. The method of claim 73, wherein the bioactive molecule causes the cell to die.   In a method of associating a bioactive molecule with a cell expressing a PRO331 polypeptide, contacting the cell with a PRO1133 polypeptide bound to the bioactive molecule, wherein the PRO331 and PRO1133 polypeptide bind to each other. Enabling, thereby associating the bioactive molecule with the cell.   76. The method of claim 75, wherein the bioactive molecule is a toxin, radioisotope or antibody.   76. The method of claim 75, wherein the bioactive molecule causes the cell to die.   In a method of associating a bioactive molecule with a cell expressing a PRO1133 polypeptide, the cell is contacted with a PRO331 polypeptide bound to the bioactive molecule, wherein the PRO331 and PRO1133 polypeptide bind to each other. Enabling, thereby associating the bioactive molecule with the cell.   79. The method of claim 78, wherein the bioactive molecule is a toxin, radioisotope or antibody.   79. The method of claim 78, wherein the bioactive molecule causes the cell to die.   In a method of associating a bioactive molecule with a cell expressing a PRO1387 polypeptide, the cell is contacted with a PRO363 or PRO5723 polypeptide associated with the bioactive molecule, and the PRO1387 and PRO363 or PRO5733 polypeptide are in contact with each other. Allowing the binding, thereby associating the bioactive molecule with the cell.   82. The method of claim 81, wherein the bioactive molecule is a toxin, radioisotope or antibody.   92. The method of claim 81, wherein the bioactive molecule causes the cell to die.   In a method of associating a bioactive molecule with a cell that expresses a PRO363 or PRO5733 polypeptide, the cell is contacted with a PRO1387 polypeptide bound to the bioactive molecule, and the PRO1387 and PRO363 or PRO5723 polypeptide bind to each other. Allowing the bioactive molecule to associate with the cell.   85. The method of claim 84, wherein the bioactive molecule is a toxin, radioisotope or antibody.   85. The method of claim 84, wherein the bioactive molecule causes the cell to die.   In a method of associating a bioactive molecule with a cell expressing a PRO1114 polypeptide, the cell is contacted with a PRO3301 or PRO9940 polypeptide associated with the bioactive molecule, and the PRO1114 and PRO3301 or PRO9940 polypeptide are attached to each other. Allowing the binding, thereby associating the bioactive molecule with the cell.   88. The method of claim 87, wherein the bioactive molecule is a toxin, radioisotope or antibody.   90. The method of claim 87, wherein the bioactive molecule causes the cell to die.   In a method of associating a bioactive molecule with a cell expressing a PRO3301 or PRO9940 polypeptide, the cell is contacted with a PRO1114 polypeptide bound to the bioactive molecule, and the PRO1114 and PRO3301 or PRO9940 polypeptide are attached to each other. Allowing the binding, thereby associating the bioactive molecule with the cell.   92. The method of claim 90, wherein the bioactive molecule is a toxin, radioisotope or antibody.   94. The method of claim 90, wherein the bioactive molecule causes the cell to die.   In a method of associating a bioactive molecule with a cell expressing a PRO1181 polypeptide, the cell is contacted with a PRO7170, PRO361 or PRO846 polypeptide bound to the bioactive molecule, and the PRO1181 and PRO7170, PRO361 or PRO846. Allowing the polypeptides to bind to each other, thereby associating the bioactive molecule with the cell.   94. The method of claim 93, wherein the bioactive molecule is a toxin, radioisotope or antibody.   94. The method of claim 93, wherein the bioactive molecule causes the cell to die.   In a method of associating a bioactive molecule with a cell expressing a PRO7170, PRO361 or PRO846 polypeptide, the cell is contacted with a PRO1181 polypeptide associated with the bioactive molecule, and the PRO1181 and PRO7170, PRO361 or PRO846 are contacted. Allowing the polypeptides to bind to each other, thereby associating the bioactive molecule with the cell.   99. The method of claim 96, wherein the bioactive molecule is a toxin, radioisotope or antibody.   99. The method of claim 96, wherein the bioactive molecule causes the cell to die.   A method of modulating at least one biological activity of a cell expressing a PRO943 polypeptide comprising contacting said cell with a PRO183, PRO184 or PRO185 polypeptide or anti-PRO943 antibody, whereby said PRO183, A method wherein the PRO184 or PRO185 polypeptide or the anti-943 antibody binds to the PRO943 polypeptide and modulates at least one biological activity of the cell.   100. The method of claim 99, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO183, PRO184 or PRO185 polypeptide, comprising contacting said cell with a PRO943 polypeptide or an anti-PRO183, anti-PRO184 or anti-PRO185 antibody. Wherein the PRO943 polypeptide or the anti-PRO183, anti-PRO184 or anti-PRO185 antibody binds to the PRO183, PRO184 or PRO185 polypeptide and modulates at least one biological activity of the cell.   102. The method of claim 101, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO331 polypeptide comprising contacting the cell with a PRO1133 polypeptide or an anti-PRO331 antibody, whereby the PRO1133 polypeptide or the anti-PRO331 polypeptide is contacted. A method wherein the PRO331 antibody binds to the PRO331 polypeptide and modulates at least one biological activity of the cell.   104. The method of claim 103, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO1133 polypeptide comprising contacting the cell with a PRO331 polypeptide or an anti-PRO1133 antibody, whereby the PRO331 polypeptide, or A method wherein the anti-PRO1133 antibody binds to the PRO1133 polypeptide and modulates at least one biological activity of the cell.   106. The method of claim 105, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO1387 polypeptide comprising contacting said cell with a PRO363 or PRO5723 polypeptide or an anti-PRO1387 antibody, whereby said PRO363 or PRO5723 poly A method wherein the peptide or the anti-1387 antibody binds to the PRO1387 polypeptide and modulates at least one biological activity of the cell.   108. The method of claim 107, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO363 or PRO5733 polypeptide comprising contacting said cell with a PRO1387 or anti-PRO363 or anti-PRO5723 antibody, whereby said PRO1387 poly A method wherein a peptide or anti-PRO363 or said anti-PRO5723 antibody binds to said PRO363 or PRO5723 polypeptide and modulates at least one biological activity of said cell.   110. The method of claim 109, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO1114 polypeptide comprising contacting said cell with a PRO3301 or PRO9940 polypeptide or anti-PRO1114 antibody, whereby said PRO3301 or PRO9940 poly A method wherein the peptide or the anti-PRO1114 antibody binds to the PRO1114 polypeptide and modulates at least one biological activity of the cell.   112. The method of claim 111, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO3301 or PRO9940 polypeptide comprising contacting said cell with a PRO1114 polypeptide, or an anti-PRO3301 or anti-PRO9940 antibody, thereby A method wherein said PRO1114 polypeptide, or said anti-PRO3301 or anti-PRO9940 antibody binds to said PRO3301 or PRO9940 polypeptide and modulates at least one biological activity of said cell.   114. The method of claim 113, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO1181 polypeptide comprising contacting said cell with a PRO7170, PRO361 or PRO846 polypeptide or an anti-PRO1181 antibody, whereby said PRO7170, A method of modulating at least one biological activity of said cell, wherein PRO361 or PRO846 polypeptide or said anti-PRO1181 antibody binds to said PRO1181 polypeptide.   116. The method of claim 115, wherein the cell is killed.   A method of modulating at least one biological activity of a cell expressing a PRO7170, PRO361 or PRO846 polypeptide comprising contacting the cell with a PRO1181 polypeptide or an anti-PRO7170, anti-PRO361 or anti-PRO846 antibody. A method wherein said PRO1181 polypeptide or said anti-PRO7170, anti-PRO361 or anti-PRO846 antibody binds to said PRO7170, PRO361 or PRO846 polypeptide and modulates at least one biological activity of said cell .   118. The method of claim 117, wherein the cell is killed.

Images