MXPA00005354A - Polypeptides and nucleic acids encoding the same - Google Patents

Abstract

The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Description

POLYPEPTIDES AND ACIDS NUCLEAR ICOS THAT CODE THE SAME FIELD OF THE INVENTION The present invention generally concerns the identification and isolation of a new DNA and the recombinant production of new polypeptides encoded by said DNA.

BACKGROUND OF THE INVENTION Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, for example, proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (eg, itogenic factors, survival factors, cytotoxic factors, differentiating factors, neuropeptides, and hormones) which are, in turn, received and interpreted by various cellular or cellular proteins. membrane bond. REF.120346 These secreted polypeptides or indicator molecules normally pass through the cellular secretory process to reach their site of action in the extracellular environment.

The secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors.

Most of the drug proteins available to date, such as thrombolytic agents, interferons, interleukins erythropoietins, colony stimulation factors, and other cytokines, are secretory proteins. Its receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents. They have strived to achieve new identifications of both native, industrial and academic secreted proteins. Numerous efforts have focused on the screening of recombinant mammalian DNA pools to identify the sequences encoding new secreted proteins. Examples of screening methods and techniques are described in the literature (see, for example, Klein et al, Proc. Nati, Acad. Sci. 93: 7108-7113 (1996), US Patent No. 5,536,637)].

Proteins and membrane binding receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, for example, proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiating factors, neuropeptides and hormones) which are in turn received and interpreted by various cellular receptors or membrane binding proteins. . Such membrane binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules similar to selectins and integrins. For example, signal transduction that regulates cell growth and differentiation is regulated in part by the phosphorylation of several cellular proteins. Tyrosine kinase proteins, enzymes that catalyze this process, can also act as growth factor receptors. Examples include the fibroblast growth factor receptor and the nerve growth factor receptor.

The membrane binding proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents. Immunoadhesin receptors, for example, can be used as therapeutic agents to block the receptor-ligand interaction. The membrane binding proteins can also be used for screening of potential peptides or small molecule inhibitors of the relevant ligand / receptor interaction. Efforts have been made for new identifications of both native, industrial and academic receptor proteins. Many efforts have focused on the screening of mammalian recombinant DNA pools to identify the sequences that code for new receptor proteins.

The identification and characterization of new secreted and transmembrane polypeptides and novel nucleic acids encoding these polypeptides are described herein. 1. PR0241 Cartilage is a specialized connective tissue with a large extracellular matrix that contains a dense network of collagen fibers and high proteoglycan content. While most of the proteoglycan in the cartilage is acquired, which contains many chains of chondroitin sulfate and keratin sulfate and multimolecularly aggravated form by binding with protein bonds to hyaluronan, the cartilage also contains a number of more molecular weight proteoglycans. little. One of these smaller molecular weight proteoglycans is a protein called biglycan, a proteoglycan that is widely distributed in the extracellular matrix of other connective tissues including, tendon, sclera, skin, and the like. It is known that biglycan possesses repeated sequences rich in leucine and two chains of chondroitin sulfate / dermatan sulfate and functions to bind to the fibronectin binding cell region as well as to inhibit cell attachment thereof. It is speculated that small molecular weight proteoglycans may play an important role in the growth and / or repair of cartilage and in degenerative diseases such as arthritis. Also, there is an interest in identifying and characterizing new polypeptides having homology with the biglycan protein.

The identification and characterization of new polypeptides having homology with the biglycan protein is described herein, these polypeptides are called PR0241 polypeptides. 2. PRQ243 Chordin (Xenopus, Xchd) is a soluble factor secreted by the Spemann organizer that has powerful dorsalizing activity (Sacia et al., Cell 79: 779-90 (1994); Sacia et al., Nature 376: 333-36 (nineteen ninety five). Other dorsalizing factors secreted by the organizer are (Smith and Harian, Cell 70: 829-840 (1992); Lamb et al., Science 262: 713-718 (1993) and follistatin (Hemmanti- Brivanlou et al., Cell 77: 283-295 (1994).) Chordin subdivides primitive ectoderm in neural compared to non-neural regions, and induces notoordium and muscle formation by mesodermal dorsalization This makes it function as an antagonist of BM-4 ventralization signals, this inhibition is by direct binding of the chordin to BPM-4 in the extracellular space, thereby preventing activation of the BPM-4 receptor by BMP- 4 (Piccolo et al., Develop Biol. 182: 5- 20 (1996).

BMP-4 is expressed in a gradient from the ventral side of the embryo, while chordin is expressed in a complementary gradient that that of BMP-4 chordin antagonizes with BMP-4 to establish the lower end of the BMP-4 gradient. Thus, the balance between the cchordin signal and other factors derived from the organizer against the BMP signal gives the germinal ectodermal layer with its information in dorsal-ventral position. Chordin may also be involved in the dorsal-ventral behavior of the central nervous system (Sacia et al., Cell 79: 779-9Q (1994).) It also induces exclusively anterior neural tissues (anterior-cerebral type, thus preceding the neural type (Sacia and collaborators, Cell 79: 779-90 (1997) Given its role in neuronal induction and pattern of behavior, chordin can prove its usefulness in the treatment of neurodegenerative disorders and neural damage, for example due to trauma or after chemotherapy.

Disclosed herein is the identification and characterization of novel polypeptides having homology to the chordin protein, wherein the polypeptides are herein designated PR0243 polypeptides. 3. PR0299 Notch proteins are involved in signaling during development. They can effect asymmetric potential development and can indicate the expression of other proteins involved in development. aVer Robey, E., Curr. Opin. Genet Dev. 7 (4): 551 (1997), Simpson, P., Curr. Opin Genet. Dev., 7 (4): 537 (1997), Blobel, CP., Cell 90 (4): 589 (1997)].

Nakayama, H. and collaborators, Dev. Genet, 21 (1): 21 (1997), Nakayama, H., and collaborators, Dev. Genet., 2JL (1): 21 (1997), Sullivan, S.A. and collaborators, Dev.

Genet 20 (3): 208 (1997) and Hayashi, H. et al., Int. J. Dev. Biol. 40 (6): 1089 (1996).] Activation by means of thinning of notch proteins has been observed in the dorsal compartment on the side of the imaginal disc of Drosophila, Fleming et al., Developement, 124 (15): 2973 (1997). The notch protein is of interest to both their role in development as well as their indicator abilities. Also of interest are the new polypeptides that may have a role in the development and / or signaling.

The identification and characterization of new polypeptides having notch protein homology are described herein, said polypeptides are designated for the purposes of the present PR0299 polypeptides. 4. PR0323 Dipeptidases are enzymatic proteins whose function is to divide a large variety of different dipeptides and which are involved in a huge number of very important biological processes in mammalian and non-mammalian organisms. Numerous dipeptidase enzymes different from a variety of different mammalian and non-mammalian organisms have been identified and characterized. Mammalian dipeptidase enzymes play important roles in many different biological processes including, for example, protein digestion, activation, inactivation, or modulation of dipeptide hormone activity, and altered alteration of the physical properties of proteins and enzymes.

In few of the important physiological roles played by dipeptidase enzymes, efforts have been developed by industry and by academics to identify new, native dipeptidase homologs. Many efforts have focused on the screening of recombinant DNA pools to identify the sequences that code for new proteins of membrane binding and secreted receptors. Examples of screening methods and techniques are described in the literature [see for example, Klein et al., Proc. Nati Acad. Sci., 93: 7108-7113 (1996); U.S. Patent No. 5,536,637)].

Disclosed herein is the identification and characterization of novel polypeptides having homology to various dipeptidase enzymes, designated herein as PR0323 polypeptides.

. PR0327 The prolactin hormone of the anterior pyruvate is encoded by a member of the gene family of growth hormone / prolactin / placental lactogen. In mammals, prolactin is primarily responsible for the development of the mammary gland and lactation. The functions of prolactin is to stimulate the expression of milk protein genes by increasing both gene transcription and mRNA half-life.

The physiological effects of the prolactin protein are through the ability of prolactin to bind to a prolactin receptor on the cell surface. The prolactin receptor is found in a variety of cell types, has a molecular mass of ab40,000 and is apparently not linked by disulfide bond to itself or to other subunits. The levels of prolactin receptors are di fferentially regulated depending on the tissue studied.

Given the important physiological roles played by the cell surface of receptor molecules in vivo, efforts have been made both in industry and by academics to identify novel, native membrane binding receptor proteins, including those that disrupt the homology of sequence with the prolactin receptor. Many of these efforts are focused on the screening of mammalian recombinant DNA pools to identify the sequences that encode membrane binding receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Nati Acad Sci, 93: 7108-7113 (1996); US Patent No. 5,536,637)].

Disclosed herein is the identification and characterization of novel polypeptides having significant homology to the prolactin receptor protein, designated herein as polypeptides.

PR0327. 6. R0233 Studies have been reported in which the redox state of the cell is an important determinant of the fate of the cell. In addition, reactive oxygen species have been reported to be cytotoxic, causing inflammatory diseases, which include tissue necrosis, organ failure, arteriosclerosis, infertility, birth defects, premature aging, mutations and malignancies.

Thus, control of oxidation and reduction is important for a number of reasons, including the control and prevention of shocks, heart attacks, fatigue and oxidative hypertension.

The free oxygen of the radicals and antioxidants seem to play an important role in the central nervous system after reperfusion and cerebral ischemia. In addition, cardiac damage, related to reperfusion and ischemia has been reported to be caused by the action of free radicals. In this regard, reductases and particularly oxidoreductases are of interest. In addition, the transcription factors, NF-kappa B and AP-1, are known to be regulated by the redox state and affect the expression of a wide variety of genes even when they are involved in the pathogenesis of AIDS, cancer, arteriosclerosis and complications. Diabetics Publications that further describe this subject include Kelsey et al., Br., J. Cancer, 76 (7): 852-854 (1997); Friedrich and eiss, J. Theor. Biol. 187 (4): 529-540 (1997) and Pieulle et al., J. Bacteriol., 179 (18): 5684-5692 (1997). Given the physiological importance of redox reactions in vivo, efforts have been developed daily to identify new, native proteins that are involved in redox reactions. The identification and characterization of new polypeptides having homology with reductase, designated herein PR0233 polypeptides, is described herein. 7. PR0344 Complememto proteins comprise a broad group of serum proteins some of which act in the enzyme stream, producing effector molecules involved in inflammation. Complement proteins are of particular physiological importance in regulating the movement and function of the cells involved in inflammation. Since the physiological importance of inflammation and relative mechanisms in vivo, efforts have been developed to identify novel, native proteins that are involved in inflammation. The identification and characterization of novel polypeptides having homology for complement proteins is described herein, whereby these polypeptides are designated herein as PR0344 polypeptides. 8. PR03 7 Cysteine-rich proteins are generally proteins that have complicated three-dimensional structures and / or exist in multimeric forms due to the presence of numerous cysteine residues that are capable of forming disulfide bridges.

A well-known cysteine-enriched protein is the mannose receptor that is expressed in, among other tissues, the liver where it serves to bind the mannose and transport it in the cells of the liver. Other proteins rich in cysteine are known to play an important role in many other physiological and biochemical processes. Whereas, there is an interest in identifying new proteins rich in cysteine. In this regard, the applicant describes herein the identification and characterization of novel cysteine-rich polypeptides having significant sequence homology to secretory protein-3 rich in cysteine, designated herein as PR0347 polypeptides. 9. PR0354 The Inter-alpha-trypsin (ITT) inhibitor is a widely circulating protease inhibitor (measuring approximately 240,000) found in the plasma of many mammalian species. The intact inhibitor is a glycoprotein and consists of three glycosylated subunits that interact directly on a strong glycosaminoglycan linker. The anti-trypsin activity of ITT is located on the smallest subunit (e.g., the light chain) of the complex, in the present light chain is known as the bikunin protein.

The natural light chain consists of an N-terminal sequence of 21 amino acids, glycosylated in Ser-10, followed by tandem Kunitz type regions, the first of which is glycosylated in Asn.45 and the second of which is capable of inhibiting trypsin, qu otripsin and plasmin. The remaining two chains of the ITT complex are heavy chains whose function interacts with the enzymatically active light chain of the complex.

Efforts have been made by industry and academics to identify new, native proteins. Many efforts have focused on the screening of recombinant DNA pools to identify the sequences that code for new membrane binding and secreted receptor proteins. Examples of screening methods and techniques are described in. the literature [see, for example, Klein et al., Proc. Nati Acad. Sci., 93: 7108-7113 (1996); U.S. Patent No. 5,536,637)]. The identification and characterization of new polypeptides having significant homology with the ITT heavy chain, designated in the present application as PR0354 polypeptides are described herein.

. PRO355 Cytotoxic or regulatory T cells associated with the molecule or protein "CRTAM" are structurally related to the immunoglobulin superfamily. The CRTAM protein might be able to intervene in several immune responses. Antibodies typically bind to CRTAM proteins with high affinity. Zlotnik, A., Faseb, 10 (6): A1037, Apr. 216, June 1996. Given the physiological importance of the immune and antigenic processes of T cells in vivo, efforts have been made to identify new, native proteins that are involved in immune responses. See also Kennedy et al., US Patent No. 5,686,257 (1997). The identification and characterization of new polypeptides having homology with CRTAM, designated in the present application as PR0355 polypeptides are described herein. 11. PR0357 The protein-protein interaction includes receptor and antigen complexes and indicator mechanisms. As much as we know about the structural and functional mechanisms subordinated to protein-protein interactions, protein-protein interactions can be more easily manipulated to regulate the particular rescripts of the protein-protein interaction. Thus, the subordinate mechanisms of protein-protein interactions are of interest to the medical and scientific community. All proteins that contain leucine-rich repeats are, however, involved in protein-protein interactions. Leucine-rich repeats are motifs of short sequences present in a number of proteins with diverse cellular functions and locations. The crystallized structure of the ribonuclease inhibitor protein has revealed that the leucine-rich repeats correspond to beta-alpha structural units. These units are arranged in such a way that they form a parallel beta sheet with a surface exposed to solvent, so that the protein acquires an unusual, non-globular shape. These two characteristics have been indicated as responsible for the protein-binding functions of proteins that contain leucine-rich repeats. See, Kobe and Deisenhofer, Trends Biochem. Sci., 19 (10): 415-421 (Oct. 1994).

One study has reported on leucine-rich proteoglycans that serve as organizing tissues, which orient and order collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and stroma formation in tumors, Iozo, R .. V., Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies involving proteins rich in leucine in wound healing and tissue repair are De La Salle, C, et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995), which reports mutations in the leucine-rich motifs in a complex associated with the Bernard-Soulier syndrome., Chlemetson, K. J., Thromb. Haemost. (Germany), 74 (1): 111-116 (July 1995), which reports that platelets have rich repeats in leucine and Ruoslahti, EI et al., WO 9110727-A by La Jolla Cancer Research Foundation which reports which links decorin to transform the growth factor-β is involved in a treatment for cancer, healing and wound healing. Related to the function of this group of proteins is the typical growth factor of insulin (IGF), which is used in wound healing and associated with therapies related to tissue re-growth, such as connective tissue, skin and bone.; in promotion of body growth in humans and animals; and in stimulation of other processes related to growth. The labile acid subunit (ALS) of IGF is also of interest because it increases the half-life of IGF and is part of the IGF complex in vivo.

Other proteins that have been reported to have leucine-rich repeats is the SLIT protein that has been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for diagnosis of Cancer, see, Artavanistsakonas, S. and Rothberg, JM, WO 92105118-A1 by Yale University. Also of interest is LIG-1, a membrane glycoprotein that is expressed specifically in mouse cells in the mouse brain, and has repeats in leucine and immunoglobulin-like regions. Suzuki et al., J. Biol. Chem. (USA), 271 (37): 252 (1996). Other studies that report on the biological functions of proteins that have leucine-rich repeats include: Tayar, N. et al., Mol. Cell. Endocrinol., (Ireland), 125 (1-2): 65-70 / December 1996) (which involves gonadotropin receptors); Miura, Y., and collaborators, Nipón Rinsho (Japan), 54 (7): 1784-1789 (July 1996) (involves apoptosis); Harris, P.C., et al., J. Am. Nephrol., 6 (4): 1125-1133 (Oct. 1995) (involving kidney diseases). However, efforts have been made by both the indus trial and the academic sector to identify novel proteins that have leucine-rich repeats and known proteins that have leucine-rich repeats such as labile acid subunits of the growth factor typical of the Insulin. Many efforts have focused on the screening of mammalian recombinant DNA pools to identify sequences that encode new membrane-bound and secreted proteins that have leucine-rich repeats. Examples of methods and techniques of screening are described in the literature [see, for example, Klein et al., Proc. Nati Acad. Sci. 93: 7108-7113 (1996): U.S. Patent No. 5,536,637)].

The identification and characterization of new polypeptides having homology with the labile acid subunit of the typical insulin growth factor, designated in the present application as PR0357 polypeptides are described herein. 12. PR0715 The control of the number of cells in mammals is believed to be determined in part, by a balance between proliferation and cell death. A form of cell death, sometimes referred to as necrotic cell death, is typically characterized as a pathological form of cell death that results from some trauma or cell damage. In contrast, there is another physiological form of cell death that usually proceeds in a controlled or orderly manner. This controlled or orderly form of cell death is often referred to as "apoptosis" [see, for example, Barr et al., Bio / Technology, 12: 487-493 (1994); Séller et al., Science, 267: 1445-1449 (1995)]. Apoptotic cell death occurs naturally in many physiological processes, including embryonic development and clonal selection in the immune system [Itoh et al., Cell, 66: 233-243 (1991)]. The decrease in apoptotic cell death levels has been associated with a variety of pathological conditions, including cancer, lupus, and herpes virus infection [Thompson, Science, 267: 1456-1462 (1995)]. Increased levels of apoptotic cell death may be associated with a variety of other pathological conditions, including AIDS, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, retinitis pigmentosa, cerebellar degeneration, aplastic anemia, infarctus al myocardium, collisions, reperfusion damage, and toxin-induced liver diseases [see, Thompson, supra].

Apoptotic cell death is typically accompanied by one or more characteristic morphological and biochemical changes, such as condensation of the cytoplasm, loss of the plasma microvilli membrane, segmentation of the nuclei, chromosomal DNA degradation or loss of mitochondrial function. A variety of extrinsic and intrinsic indicators are believed to induce or induce such morphological and biochemical cellular changes [Raff, Nature, 356: 397-400 (1992); Séller, supra; Sachs et al., Blood, 82: 15 (1993)]. For example, they can be triggered by hormonal stimulation, such as glucocorticoid hormones by immature thymocytes, as well as abstinence from certain growth factors [Watanabe-Fukunaga et al., Nature, 356: 314-317 (1992)]. Also, some oncogenes identified as myc, ret, and EIA, and tumor suppressors, similar to p53, have been reported to play a role in inducing apoptosis. Certain chemotherapies with drugs and some forms of radiation have also been observed to have apoptosis-inducing activity [hompson, supra].

Several molecules, such as tumor necrosis factor -a ("TNFa"), tumor necrosis factor-ß ("TNF-ß" "or" lymphotoxin-a "), lymphotoxin-ß (" LT-ß "), ligand CD30, ligand CD27, ligand CD40, ligand OX40, ligand 4-1BB, ligand Apo-1 Also called ligand Fas or ligand CD95), and ligand Apo-2 (also called TRAIL) have been identified as members of the tumor necrosis factor ("TNF") family of cytokines [see, eg, Gruss and Dower, Blood, 85: 3378-3404 (1995); Pitti et al., J. Bio3, Chem. 271: 12687- 12690 (1996), Wiley et al., Immunity, 3: 673-682 (1995), Browning et al., Cell, 72: 847-856 (1993), Armitage et al., Nature, 357: 80-82 (1992). Among these molecules, it has been reported that TNF-α, TNF-β, CD30 ligand, 4-1BB ligand, Apo-1 ligand, and Apo-2 ligand (TRAIL) that are involved in apoptotic cell death. both TNF-a and TNF-β induce apoptotic death in susceptible tumor cells [Schmid et al., Proc. Nati Acad. Sci. 83: 1881 (1986); Dealtry et al., Eur. J. Immunol. 17: 689 (1987). Zheng and colleagues have reported that TNF-a is involved in post-stimulation apoptosis of CD8-positive T cells [Zheng et al., Nature, '377: 348-351 (1995)]. Other investigators have reported that the CD30 ligand may be involved in deletions of reactive T cells by themselves in the timus [Amakawa et al., Cold Spring Harbor Laboratory Symposium on Programmed Cell Death. Abstr. No. 10 (1995)]. Mutations in the mouse Fas / Apo-1 receptor or ligand genes (called lpr and gld, respectively) have been associated with some immune disorders, which indicate that the Apo-1 ligand may play a role in regulating the clonal elimination of autoreactive lymphocytes in the periphery [Krammer et al., Curr. Op. Immunol. 6: 279-289 (1994); Nagata et al., Science, 267: 1449-1456 (nineteen ninety five)]. The Apo-1 ligand has also been reported to induce post-stimulation apoptosis in T lymphocytes CD4-positive and B lymphocytes, and may be involved in the elimination of activated lymphocytes when their function is no longer necessary [Krammer et al., Supra; Nagata et al., Supra]. Monoclonal mouse agonist antibodies that bind specifically to the Apo-1 receptor have been reported to exhibit cell death activity that is comparable to or similar to that of TNF-α [Yonchara et al., J. Exp. Med. 169: 1747- 1756 (1989)]. The induction of several cell responses mediated by such TNFs of the cytokine family is believed to be initiated by their binding to specific cellular receptors. Two TNF receptors other than approximately 55-kDa (TNFR1) and 75-kDa (TNFR2) have been identified [Hohman et al., J. Biol. Chem., 264: 14927-14934 (1989); Brockhaus et al., Proc. Nati Acad. Sci. 87: 3127-3131 (1990); EP 417, 563, published March 20, 1991] and human and mouse cDNAs corresponding to both types of receptors have been isolated and characterized [Loetscher et al., Cell. 61: 351 (1990); Schall et al., Cell, 61: 361 (1990); Smith et al., Science, 248: 1019-1023 (1990); Lewis et al., Proc. Nati Acad. Sci. 88: 2830-2834 (1991); Goodwin et al., Mol. Cell. Biol., 11: 3020-3026 (1991)]. Ligands of the TNF family identified to date, with the exception of lymphotoxin-a, are transmembrane type II proteins, whose C-terminus is extracellular. In contrast, most of the receptors in the family of TNF receptors (TNFR) identified to date are transmembrane type I proteins. In both families of TNF ligands and receptors, however, homology was identified among the members of the family that were found mainly in the extracellular region ("ECD"). Several of the TNFs of the cytokine family, which include TNF-α, Apo-1 ligand and CD40 ligand, are proteolytically divided at the cell surface; the protein that results in each case typically forms a homotrimeric molecule that functions as a soluble cytosine. The proteins of the TNF receptor family are usually also proteolytically divided to liberate soluble ECD receptors that can function as inhibitors of known cytokines.

Recently, other members of the TNFR family have been identified. Such newly identified members of the TNFR family include CARI, HVEM and osteoprotegerin (OPG) [Brojatsch et al., Cell, 87: 845-855 (19961; Montgomery et al., Cell, 87: 427-436 (1996); and collaborators, J. Biol. Chem. 272: 14029-14032 (1997), Simonet et al., Cell, 89: 309-319 (1997).] Unlike other known TNFR-like molecules, Simonet et al., supra, reports that OPG contains tarnsmembrane-extended non-hydrophobic sequence.

For a review of the TNF family of cytokines and their receptors, see Grus and Dower, supra.

Applicants hereby describe the identification and characterization of novel polypeptides having homology to members of the polypeptide tumor necrosis factor family, designated in the present as PR0715 polypeptides. 13. PRQ353 Complememnto proteins comprise a large group of serum proteins some of which act in an enzymatic torrent, producing effector molecules involved in inflammation. The complement proteins are of particular importance in regulating the movement and function of the cells involved in inflammation. Given the physiological importance of the inlamation and related mechanisms in vivo, an effort is made daily to identify new, native proteins that. they are involved in inflammation. Disclosed herein is the identification and characterization of novel polypeptides having homology with the complement proteins, herein referred to as PR0353 polypeptides. 14. PRQ361 Mucins comprise a family of glycoproteins that have been implicated in carcinogenesis.Mucine and ucine-like proteins are secreted by both normal and transformed cells.Moint and qualitative changes in mucin have been implicated in several types of cancer Given the medical importance of cancer, efforts are being made to identify new, native proteins that may be useful for the diagnosis or treatment of cancer.

The chitinase protein comprises a family which has been implicated in plant pathogenesis responses. Chitinase proteins are produced by plants and microorganisms and can play a role in protecting plants from damage. Given the importance of the plant defense mechanism, efforts have been made to identify new, native proteins that may be useful for the modulation of responses related to plant pathogenesis. The identification and characterization of new polypeptides having homology with mucin and chitinase, designated in the present application as polypeptides PR0361, is described herein.

. PRQ365 Polypeptides such as human protein 2-19 can function as cytokines. Cytokines are low molecular weight proteins whose function is to stimulate or inhibit the differentiation, proliferation or function of immune cells. Cytokines often act as intercellular messengers and have multiple physiological effects. Given the physiological importance of immune mechanisms in vivo, efforts are made to identify new, native proteins which are involved in effecting the immune system. Disclosed herein is the identification and characterization of novel polypeptides having homology to human 2-19 protein, designated herein as PR0365 polypeptides.

BRIEF DESCRIPTION OF THE INVENTION 1.PR0241 Applicants have identified a cDNA clone encoding a new polypeptide having homology to the biglycan protein, wherein the polypeptide is designated in the present application as "PR0241".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0241 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0241 polypeptide having amino acid residues 1 to 379 of Figure 2 (SEQ ID NO: 2), or is complementary to those encoding the nucleic acid sequence, and remains stably linked under at least moderate, and optionally, under conditions of high severity.

In another embodiment, the invention provides the isolated PR0241 polypeptide. In particular, the invention provides PR0241 polypeptide of the isolated asilated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 379 of Figure 2 (SEQ ID NO: 2). Another embodiment of the present invention is directed towards a PR0241 polypeptide lacking the N-terminal indicator peptide, in the present PR0241 polypeptide comprises approximately amino acids 16 to 379 of the total extension of amino acid sequence PR0241 (SEQ ID NO: 2). ). 2. PRQ243 Applicants have identified a cDNA clone (DNA35917-1207) encoding a new polypeptide, designated in the present application as "PR0243".

In another embodiment, the invention provides an isolated nucleic acid molecule having at least about 80% sequence identity with (a) a DNA molecule encoding a PR0243 polypeptide comprising amino acid sequence 24 through 954 of FIG. 4 (SEQ ID NO: 7), or (b) the complement of the DNA molecule of (a) The sequence identity preferably is about 85%, more preferably about 90%, more preferably about 95%. In one aspect, the isolated nucleic acid has at least about 80, preferably at least 85%, more preferably at least 90%, and more preferably at least about 95% sequence identity with a polypeptide having amino acid residues 1 through 954 of Fig. 4 (SEQ ID NO: 7). Preferably, the highest degree of sequence identity occurs in the four conserved cysteine groups (amino acids 51 to 325; amino acids 705 to 761; amino acids 784 to 849; and amino acids 897 to 931) of Fig. 4 ( SEQ ID NO: 7). In a further embodiment, the isolated nucleic acid molecule comprises DNA encoding PR0243 polypeptide having amino acid residues 24 through 954 of FIG. 4 (SEQ ID NO: 7), or is complementary to, such that it encodes the nucleic acid sequence, and remains stably linked to the at least moderate low, and optionally under high stringency conditions. In another aspect, the invention provides a nucleic acid of the total extension protein of the DNA clone 35917-1207, deposited with the ATCC under accession number of ATCC 209508, alternatively the coding sequence of the DNA clone 35917-1207, deposited under the ATCC access number 209508.

In yet another embodiment, the invention provides the isolated PR0243 polypeptide. In particular, the invention provides the PR0243 polypeptide of the isolated asilated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 24 to 954 of FIG. 4 (SEQ ID NO: 7). Native PR0243 polypeptides with or without the native indicator sequence (amino acids 1 to 23 in Fig. 4 (SEQ ID NO: 7), and with or without the initiator methionine are especially included. Alternatively, the invention provides a PR0243 polypeptide encoded by the nucleic acid deposited under accession number ATCC 209508. 3. PR0299 Applicants have identified a cDNA clone encoding a new polypeptide, wherein the polypeptide is designated in the present application as "PR02999".

In one embodiment, the invention provides an asylated nucleic acid molecule comprising DNA encoding a PR0299 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0299 polypeptide having amino acid residues 1 to 737 of FIG. 9 (SEQ ID NO: 15), or is complementary such that it encodes the acid sequence nucleic acid, and remains stably bound to it under at least moderate conditions, and optionally of high severity.

In another embodiment, the invention provides the isolated PR0299 polypeptide. In particular, the invention provides PR0299 polypeptide of the isolated asilated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 737 of Figure 9 (SEQ ID NO: 15). A further embodiment of the present invention is directed towards an isolated extracellular region of a PR0299 polypeptide. 4. PR0323 Applicants have identified a cDNA clone encoding a new polypeptide having homology to a microsomal dipeptidase protein, wherein the polypeptide is designated in the present application as "PR0323".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0323 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0323 polypeptide having amino acid residues 1 through 433. of Figure 13 (SEQ ID NO: 24), or is complementary such that it encodes the acid sequence nucleic acid, and remains stably linked to it under at least moderate conditions, and optionally of high severity.

In another embodiment, the invention provides the isolated PR0323 polypeptide. In particular, the invention provides the PR0323 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 433 of Figure 13 (SEQ ID NO: 24).

. PRQ327 Applicants have identified a cDNA clone encoding a new polypeptide having homology to the prolactin receptor, wherein the polypeptide is designated in the present application as "PR0327".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0327 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0327 polypeptide having amino acid residues 1 through 422 of FIG. 117 (SEQ ID NO: 32), or is complementary such that it encodes the acid sequence nucleic acid, and remains stably bound to it under at least moderate conditions, and optionally of high severity.

In another embodiment, the invention provides the isolated PR0327 polypeptide. In particular, the invention provides PR0327 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 422 of FIG. 17 (SEQ ID NO: 32). 6. PR0233 Applicants have identified a cDNA clone encoding a new polypeptide, wherein the polypeptide is designated in the present application as "PR0233".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0233 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0233 polypeptide having amino acid residues 1 through 300 of FIG. 19 (SEQ ID NO: 37), or is complementary such that it encodes the nucleic acid sequence , and remains stably attached to it under at least moderate conditions, and optionally of high severity.

In another embodiment, the invention provides the isolated PR0233 polypeptide. In particular, the invention provides PR0233 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 300 of Figure 19 (SEQ ID NO: 37). 7. PRQ344 Applicants have identified a cDNA clone encoding a new polypeptide, the polypeptides are designated for purposes of the present application as "PR0344".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0344 polypeptide. in one aspect, the isolated nucleic acid comprises DNA encoding the PR0344 polypeptide having amino acid residues 1 through 243 of Figure 21 (SEQ ID NO: 42), or is complementary such that it encodes the nucleic acid sequence , and remains stably attached to it under at least moderate conditions, and optionally of high severity.

In another embodiment, the invention provides the isolated PR0344 polypeptide. In particular, the invention provides the PR0344 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 243 of Figure 21 (SEQ ID NO: 42). 8. PRQ3 7 Applicants have identified a cDNA clone encoding a new polypeptide having homology to the secretory protein-3 rich in cysteine, wherein the polypeptide is designated in the present application as "PR0347".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising the DNA encoding a PR0347 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0347 polypeptide having amino acid residues 1 through 455 of Figure 23 (SEQ ID NO: 50), or is complementary such that it encodes the nucleic acid sequence , "and remains stably linked to it under at least moderate conditions, and optionally, of high severity.

In another embodiment, the invention provides the isolated PR0347 polypeptide. In particular, the invention provides the PR0347 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 455 of Figure 23 (SEQ ID NO: 50). 9. PRQ35 Applicants have identified a cDNA clone encoding a new polypeptide having homology to the heavy chain of the Inter-alpha-trypsin (ITI) inhibitor, herein the polypeptide is designated for purposes of the present application as "PR0354".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0354 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0354 polypeptide having amino acid residues 1 through 694 of Figure 25 (SEQ ID NO: 55), or is complementary such that it encodes the nucleic acid sequence , and remains attached to it under at least moderate conditions, and optionally, of high severity.

In another embodiment, the invention provides the isolated PR0354 polypeptide. In particular, the invention provides the PR0354 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 694 of Figure 25 (SEQ ID NO: 55).

. PRO355 Applicants have identified a cDNA clone encoding a new polypeptide, herein the polypeptide is designated for purposes of the present application as "PR0355".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0355 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0355 polypeptide having amino acid residues 1 to 440 of Figure 27 (SEQ ID NO: 61), or is complementary such that it encodes the nucleic acid sequence , and remains stably attached to it under moderate conditions, and optionally, of high severity.

In another embodiment, the invention provides the PR0355 polypeptide isolated. In particular, the invention provides PR0355 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 440 of Figure 27 (SEQ ID NO: 61). A further embodiment of the present invention is directed towards an isolated extracellular region of a PR0355 polypeptide. 11. PR0357 The applicants have identified a cDNA clone encoding a new polypeptide having homology to the labile acid subunit (ALS) of the similar insulin growth factor (IGF), in the present the polypeptide is designated for purposes of the present application as " PR0357".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0357 polypeptide. In one aspect, the asylated nucleic acid comprises DNA encoding PR0357 polypeptide having amino acid residues 1 through 598 of Figure 29 (SEQ ID NO: 69), or is complementary such that it encodes the nucleic acid sequence , and remains stably attached to it under at least moderate conditions, and optionally, of high severity.

In another embodiment, the invention provides the PR0357 polypeptide isolated. In particular, the invention provides PR0357 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 598 of Figure 29 (SEQ ID NO: 69). A further embodiment of the present invention is directed towards the isolated extracellular region of a PR0357 polypeptide. 12. PR0715 Applicants have identified cDNA clones encoding new polypeptides having homology to the polypeptides of the tumor necrosis factor family, herein the polypeptides will be designated for purposes of the present application as "PR0715".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0715 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0715 polypeptide having amino acid residues 1 to 250 of FIG. 31 (SEQ ID NO: 76) or is complementary such that it encodes the nucleic acid sequence, and it remains stably attached to it under at least moderate conditions, and optionally, high severity.

In another embodiment, the invention provides the isolated PR0715 polypeptide. In particular, the invention provides PR0715 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 250 of Figure 31 (SEQ ID NO: 76). A further embodiment of the present invention is directed towards an isolated extracellular region of a PR0715 polypeptide. 13. PR0353 Applicants have identified a cDNA clone encoding a new polypeptide, herein the polypeptides are designated for purposes of this application as "PR0353".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0353 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0353 polypeptide having amino acid residues 1 through 281 of Figure 35 (SEQ ID NO: 86), or is complementary such that it encodes the nucleic acid sequence , and remains stably attached to it under at least moderate conditions, and optionally of high severity.

In another embodiment, the invention provides an isolated PR0353 polypeptide. In particular, the invention provides the polypeptide PR0353 of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 281 of Figure 35 (SEQ ID NO: 86). 14. PR0361 Applicants have identified a cDNA clone encoding a "new polypeptide", herein the polypeptide is designated for purposes of this application as "PR0361".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0361 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding PR0361 polypeptide having the amino acid residues 1 through 431 of Figure 37 (SEQ ID NO: 91), or is complementary such that it encodes the nucleic acid sequence , and remains stably attached to them under at least moderate conditions, and optionally of high severity. The isolated nucleic acid sequence may comprise the cDNA insert of the vector deposited on February 5, 1998 as ATCC 209621 which includes the nucleotide sequence encoding PR0361.

In another embodiment, the invention provides the isolated PR0361 polypeptide. In particular, the invention provides PR0361 polypeptide of the isolated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 to 431 of Figure 37 / SEQ ID NO: 91). A further embodiment of the present invention is directed toward an isolated extracellular region of a PR0361 polypeptide having amino acids 1- 379 of the amino acid sequence set forth in Figure 37 (SEQ ID NO: 91). Optionally, PR0361 polypeptide is obtained or is obtainable by expression of the polypeptide encoded by the cDNA insert of the vector deposited on February 5, 1998 as ATCC 209621.15. PR0365 Applicants have identified a cDNA clone encoding a new polypeptide, in the present invention the polypeptide is designated for purposes of this application co or "PR0365".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0365 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0365 polypeptide having amino acid residues 1 through 235 of Figure 39 (SEQ ID NO: 99), or is complementary such that it encodes the nucleic acid sequence , and remains stably attached to it under moderate conditions, and optionally of high severity. In another aspect, the isolated nucleic acid comprises DNA encoding the PR0365 polypeptide having amino acid residues 21 through 235 of Figure 39 (SEQ ID NO: 99), or is complementary such that it encodes the nucleic acid sequence , and remains stably attached to it under moderate conditions, and optionally of high severity.

In another embodiment, the invention provides the isolated PR0365 polypeptide. In particular, the invention provides the PR0365 polypeptide of the isolated asilated native sequence, which in one embodiment, includes an amino acid sequence comprising residues 1 through 235 of Figure 39 (SEQ ID NO: 99). A further embodiment of the present invention is directed toward an amino acid sequence comprising residues 21 to 235 of Figure 39 (SEQ ID NO: 99). 16. Additional modalities In other embodiments of the present invention, the invention provides vectors comprising DNA encoding any of the polypeptides above or subsequently described. A host cell comprising any such vector is also provided. By way of example, the host cell can be CHO cells, E. Coli, or yeasts. A process for producing any of the above or subsequently described polypeptides is further provided and comprises culturing host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture.

In other embodiments, the invention provides chimeric molecules comprising any of the above or subsequently described polypeptides fused to a heterologous polypeptide or an amino acid sequence. An example of such a chimeric molecule comprises any of the above or subsequently described polypeptides fused to an epitope tag sequence or to an Fe region of an immunoglobulin.

In another embodiment, the invention provides an antibody, which specifically binds to any of the polypeptides above or subsequently described. Optionally, the antibody is a monoclonal antibody.

In yet another embodiment, the invention provides oligonucleotides useful for isolating cDNA and genomic nucleotide sequences, in which the tests can be derived from any of the nucleotide sequences above or subsequently described.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 sets forth a nucleotide sequence (SEQ ID NO: 1) of PR0241 cDNA of a native sequence, wherein SEQ ID NO: 1 is a clone designated herein as "UNQ2115" and / or "DNA34392-1170" Figure 2 sets forth the amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEQ ID NO: 1 set forth in Figure 1. Also depicted in Figure 2 are the locations of a putative reporter peptide, a region of close potential leucine and a potential N-glycosylation site.

Figure 3 sets forth a nucleotide sequence (SEQ ID NO: 6) of PR0243 cDNA from a native sequence, wherein SEQ ID NO: 6 is a clone designated herein as "UNQ217" and / or "DNA35917-1207" .

Figure 4 sets forth the amino acid sequence (SEQ ID NO: 7) derived from the coding sequence of SEQ ID NO: 6 set forth in Figure 3.

Figure 5 shows the organization of genomic clones in the THPO region of human chromosome 3q27-q28.

Figure 6A-B exposes the expression of PR0243 in fetal and adult human tissues. Figure 6a is a northern blot of adult human and fetal tissue hybridized from a human chordin cDNA (PR0243) test. The lower plate exposes an actinic control. Figure 6B is a diagram of the human chordin cDNA (PR0243) with the positions of the codons encoding the cysteine conserved in the blocks that are exposed. The extent of the test used is exposed on the solid line.

Figure 7 shows the in-situ hybridization of PR0243 of adult human tissues that give a positive signal in the dividing line of the development of the synovial joint that is formed between the femoral head and the acetabulum.

Figure 8 exposes a nucleotide sequence (SEQ ID NO: 14) of PR0299 cDNA from a native sequence, wherein SEQ ID NO: 14 is a clone designated herein as "UNQ262" and / or "DNA339976-1215" Figure 9 sets forth the amino acid sequence (SEQ ID NO: 15) derived from the coding sequence of SEQ ID NO: 14 set forth in Figure 8.

Figure 10 sets forth a nucleotide sequence designated herein as DNA28847 (SEQ ID NO: 18).

Figure 11 sets forth a nucleotide sequence designated herein as DNA35877 (SEQ ID NO: 19).

Figure 12 sets forth a nucleotide sequence (SEQ ID NO: 23) of native sequence PR0323 cDNA, wherein SEQ ID NO: 23 is a clone designated herein as "UNQ284" and / or "DNA35595-1228".

Figure 13 sets forth an amino acid sequence (SEQ ID NO: 24) derived from the coding sequence of SEQ ID NO: 23 set forth in Figure 12.

Figure 14 depicts a single-stranded nucleotide sequence (SEQ ID NO: 29) containing the nucleotide sequence (nucleotides 79-1416) of a chimeric fusion protein between a polypeptide derived from PR0323 and a portion of a region IgG constant, wherein the chimeric fusion protein is designated herein as "PR00454". The single-stranded nucleotide sequence (SEQ ID NO: 29) encoding PR0324 fusion protein "PR0454" / IgG is designated herein as "DNA35872".

Figure 15 sets forth the amino acid sequence (SEQ ID NO: 30) derived from nucleotides 79-1416 of the nucleotide sequence set forth in Figure 14. Fusion in the amino acid sequence PR0454 between the sequences derived from PR0323 and sequences derived from IgG appears between amino acids 415-4116 in the figure.

Figure 16 sets forth a nucleotide sequence (SEQ ID NO: 31) of a PR00327 cDNA of the native sequence, wherein SEQ ID NO: 31 is a clone designated "UNQ327" and / or "DNA38113-1230".

Figure 17 sets forth the amino acid sequence (SEQ ID NO: 32) derived from the coding sequence of (SEQ ID NO: 31 set forth in Figure 16.

Figure 18 sets forth a nucleotide sequence / SEQ ID NO: 36) of the native PR0233 cDNA sequence, wherein SEQ ID NO: 36 is a clone designated herein as "UNQ207" and / or "DNA34436-1238".

Figure 19 sets forth the amino acid sequence (SEQ ID NO: 37) derived from the coding sequence of SEQ ID NO: 36 set forth in Figure 18.

Figure 20 sets forth a nucleotide sequence (SEQ ID NO: 41) of a native PR0344 cDNA sequence, wherein S'EC ID NO: 41 is a clone designated herein as "UNQ303" and / or "DNA40592-1242" Figure 21 sets forth the amino acid sequence (SEQ ID NO: 42) derived from the coding sequence of SEQ ID NO: 41 set forth in Figure 20.

Figure 22 sets forth a nucleotide sequence (SEQ ID NO: 49) of a native PR0347 cDNA sequence, wherein SEQ ID NO: 49 is a clone designated herein as "UNQ3306" and / or "DNA44176-1244" .

Figure 23 sets forth the amino acid sequence (SEQ ID NO: 50) derived from the coding sequence of SEQ ID NO: 49 set forth in Figure 22.

Figure 24 sets forth a nucleotide sequence (SEQ ID NO: 54) of a native PR0354 cDNA sequence, wherein SEQ ID NO: 54 is a clone designated herein as "UNQ311" and / or "DNA44192-1246" .

Figure 25 sets forth the amino acid sequence (SEQ ID NO: 55) derived from the coding sequence of SEQ ID NO: 54 set forth in Figure 24.

Figure 26 sets forth a nucleotide sequence (SEQ ID NO: 60) of a native PR0355 cDNA sequence, wherein SEQ ID NO: 60 is a clone designated herein as "UNQ312" and / or "DNA39518-1247" .

Figure 27 shows the amino acid sequence (SEQ ID NO: 61) derived from the coding sequence of SEQ ID NO: 60 set forth in Figure 26.

Figure 28 sets forth a nucleotide sequence (SEQ ID NO: 68) of a native PR0357 cDNA sequence, wherein SEQ ID NO: 68 is a clone designated herein as "UNQ314" and / or "DNA44804-1248" .

Figure 29 sets forth the amino acid sequence (SEQ ID NO: 69) derived from the coding sequence of SEQ ID NO: 68 set forth in Figure 28.

Figure 30 sets forth a nucleotide sequence (SEQ ID NO: 75) of the native PR0715 cDNA sequence, wherein SEQ ID NO: 75 is a clone designated "UNQ383" and / or "DNA52722-1229".

Figure 31 sets forth the amino acid sequence (SEQ ID NO: 76) derived from the coding sequence of SEQ ID NO: 75 set forth in Figure 30.

Figure 32 sets forth a comparison of the amino acid sequences of human tumor necrosis factor-a (TNFA HUMAN) (SEQ ID NO: 77) with the amino acid sequence (SEQ ID NO: 76) derived from nucleotides 114-863 of DNA52722-1229. The identical amino acids are enclosed in a box.

Figure 33 sets forth a comparison of the amino acid sequence (SEQ ID NO: 76) derived from nucleotides 114-863 of DNA52722-1229 with the amino acid sequences of a variety of members of the protein tumor necrosis family (SEQ. ID NOS: 78-84). The identical amino acids are enclosed in a box.

Figure 34 sets forth a nucleotide sequence (SEQ ID NO: 85) of the native PR0353 cDNA sequence, wherein SEQ ID NO: 85 is a clone designated herein as "UNQ310" and / or "DNA41234-1242" .

Figure 35 sets forth the amino acid sequence (SEQ ID NO: 86) derived from the coding sequence of SEQ ID NO: 85 set forth in Figure 34.

Figure 36 sets forth a sequence of nucleotides (SEQ ID NO: 90) of a native PR0361 cDNA sequence, wherein SEQ ID NO: 90 is a clone designated herein as "UNQ316" and / or "DNA45410-1250" .

Figure 37 sets forth the amino acid sequence (SEQ ID NO: 91) derived from the coding sequence of SEQ ID NO: 90 set forth in Figure 36.

Figure 38 sets forth a nucleotide sequence (SEQ ID NO: 98) of "the PR0365 native cDNA sequence, wherein SEQ ID NO: 98 is a clone designated" UNQ320"and / or" DNA46777-1253".

Figure 39 sets forth the amino acid sequence (SEQ ID NO: 99) derived from the coding sequence of SEQ ID NO: 98 set forth in Figure 38.

DETAILED DESCRIPTION OF THE PREFERRED MODALITIES Definitions The terms "PRO polypeptide" and "PRO" as used herein and when immediately followed by a numerical designation refers to several piolypeptides, wherein the full designation (eg, PRO / number) refers to specific polypeptide sequences as described herein. The terms "PRO / number polypeptide" and "PRO / number" as used herein encompasses polypeptides of native sequence and polypeptide variants (which are further defined herein). The PRO polypeptides described in the present may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods.

A "native sequence PRO polypeptide" 'comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such PRO polypeptides of native sequence can be isolated from nature or can be produced by recombinant or synthetic means. The term "native sequence PRO polypeptide" specifically encompasses truncated forms as found naturally or secreted from the specific PRO polypeptide (e.g., a sequence of extracellular region), variant forms are found naturally (e.g., alternatively linked forms) and allelic variants of the polypeptide as found naturally. In other embodiments of the invention, the PR0241 native sequence polypeptide is a PRO 241 polypeptide of a mature or full-length native sequence comprising amino acids 1 to 379 of Figure 2 (SEQ ID NO: 2), the native PR0243 sequence. is a mature or full-length native sequence polypeptide. Comprising amino acids 24 to 954 of Figure 4 (SEQ ID NO: 7), with or without the N-terminal indicator sequence (residues 1 to approximately 23), and with or without the initiating methionine in position 1, the polypeptide PR0299 of native sequence is a PR0299 polypeptide of mature native sequence or of otal extension comprising amino acids 1 to 737 of Figure 9 (SEQ ID NO: 15) or native sequence PR0299 polypeptide is an extracellular region of PR0299 protein of total extent, wherein the putative transmembrane region of the full length PR0299 protein is encoded by nucleotides starting at nucleotide 2022 as set forth in Figure 8, the PR0323 native sequence polypeptide is a PR0323 polypeptide of full length native sequence that comprising amino acids 1 to 43 of Figure 13 (SEQ ID NO: 24), PR0327 polypeptide of native sequence is a PR0327 polypeptide of mature native sequence or extension to such that comprising amino acids 1 to 422 of Figure 17 (SEQ ID NO: 32), the PR0233 native sequence polypeptide is a PR0233 polypeptide of mature or full length native sequence comprising amino acids 1 to 300 of Figure 19 ( SEQ ID NO: 37), the PR0344 polypeptide of native sequence is a polypeptide PR0344 of mature native sequence or of total extension comprising amino acids 1 to 243 of Figure 21 (SEQ ID NO: 42), the PR0347 native sequence polypeptide is a PR0347 polypeptide of mature or full length native sequence comprising amino acids 1-455 of Figure 23 (SEQ ID NO: 50), sequence polypeptide PR0354 native is a mature or full-length native sequence polypeptide comprising amino acids 1 to 694 of Figure 25 (SEQ ID NO: 55), PR0355 native sequence polypeptide, is a PR0355 polypeptide of mature or full length native sequence comprising amino acids 1 to 440 of Figure 27 (SEQ ID NO: 61) or the PR0355 native sequence polypeptide is an extracellular region of the full-length PR0355 protein, wherein the putative transmembrane region of the PR0355 protein extends is encoded by nucleotides starting at nucleotide 1138 as set forth in FIG. 26, PR0357 polypeptide of native sequence is a PR0357 polypeptide of mature native sequence or of extension t which comprises amino acids 1 to 598 of Figure 29 (SEQ ID NO: 69) or the PR0357 native sequence polypeptide is an extracellular region of the PR0357 protein of otal extension, wherein the putative transmembrane region of the full length PR0357 protein is encoded by SEC nucleotides 15118-1572. ID NO: 68, or alternatively, 1491-1572 of SEQ ID NO: 68, PR0715 polypeptide of native sequence is a PR0715 polypeptide of mature or full length native sequence comprising amino acids 1 to 250 of Figure 31 (SEC ID NO: 76), the PR0353 native sequence polypeptide is a PR0353 polypeptide of mature or full length native sequence comprising amino acids 1 to 281 of Figure 35 (SEQ ID NO: 86) or PR0361 polypeptide of native sequence is a PR0361 polypeptide of mature or full-length native sequence comprising amino acids 1 to 431 of Figure 37 (SEQ ID NO: 91) or the PR0361 polypeptide of the native sequence is an extracellular region of the protein i0 PR0361 of total extension, wherein the putative transmembrane region of the full-length PR0361 protein is encoded by nucleotides starting at nucleotide 1363 as set forth in FIG. 36 and the native sequence PR0365 polypeptide is a PR0365 polypeptide of mature native sequence or of total extension comprising amino acids 1 to 235 of Figure 39 (SEQ ID NO: 99).

The "extracellular region" or "ECD" of the PRO polypeptide refers to a form of the PRO polypeptide that is essentially free of the transmembrane or cytoplasmic regions. Ordinarily, a PRO polypeptide ECD will have less than 1% of such transmembrane or cytoplasmic regions and preferably, will have less than 0.5% of such regions. It will be understood that any transmembrane regions identified by the PRO polypeptides of the present invention are identified following criteria routinely employed in the art to identify that type of hydrophobic region. The exact boundary of a transmembrane region may vary but more likely in no more than about 5 amino acids identified both at the end of the region and initially.

"PRO polypeptide variant" means an active PRO polypeptide as defined above or below having at least about 80% amino acid sequence identity with the PRO polypeptide of full length native sequence as set forth herein. Such a PRO polypeptide variant includes, for example, PRO polypeptides in which one or more amino acid residues are added or deleted, in the N- or C-terminus of the full length native amino acid sequence. Ordinarily a PRO polypeptide variant will have at least about 80% amino acid sequence identity, more preferably at least 85% amino acid sequence identity, and even more preferably at least about 90% amino acid sequence identity, even more preferably at least about 95% amino acid sequence identity and more preferably at least 99% amino acid sequence identity with the amino acid sequence of the full length native amino acid sequence as set forth in the present.

With respect to the PR0243 variants, the phrase "variant PR0243" means an active PR0243 as defined below having at least 80% amino acid sequence identity with (a) a DNA molecule encoding a PR0243 polypeptide, with or without its native indicator sequence, or (b) the complement of the DNA molecule of (a). In a particular embodiment, variant PR0243 has at least about 80% amino acid sequence homology with PR0243 having the deduced amino acid sequence set forth in FIG. 4 (SEQ ID NO: 7) of a full length native sequence PR0243. Such variants of PR0243 include, for example, PR0243 polypeptides in which one or more amino acid residues are added, or deleted, in N- or C-terminus of the sequence of Fig. 4 (SEQ ID NO: 7). Preferably, the amino acid or nucleic acid sequence identity is at least about 85%, more preferably at least 90%, and still more preferably at least about 95%.

"Percent (%) amino acid sequence identity" with respect to the PRO polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues in the polypeptide sequence Specific PRO, after aligning the sequences and introducing spaces, if necessary, to achieve the maximum by 'percent sequence identity, and not considering some conservative substitutions as part of the identity of sequences. The alignment for the purpose of determining percent identity of amino acid sequences can be achieved in various ways that are in the experience in the field, for example, using advertising available in computer programs such as BLAST, BLAST-2, ALIGN programs. or Megalign (DNASTAR). The preferred alignment program is BLAST. Those skilled in the art can determine the appropriate parameters for measuring the alignment, which include some algorithms needed to achieve maximum alignment on the total extent of the sequences that are compared.

"Percent (%) of identity of nucleic acid sequences" with respect to the nucleic acid sequences encoding PRO identified in the present is defined as the percentage of nucleotides in a candidate sequence that are identical to the nucleotides in the sequence of PRO nucleic acids of interest, after aligning the candidate sequences and introducing spaces, if necessary, to achieve maximum percent identity of sequences. The alignment for determining the identity portion of nucleic acid sequences can be achieved in various ways that are in the subject matter experience, for example, using advertising available in computer programs such as the BLAST, BLAST-2, ALIGN programs. or Megalign (DNASTAR). Those skilled in the art can determine the proper parameters for measuring the alignment, which include some algorithms needed to achieve maximum alignment over the full extent of the sequences being compared.

"Isolated", when used to describe the various polypeptides disclosed herein, means the polypeptide that has been identified and separated and / or recovered from a component of its natural environment. Components contaminating their natural environment sor-materials that would typically interfere with the therapeutic and diagnostic uses of the polypeptide, and may include enzymes, hormones and other proteinaceous and non-proteinaceous solutes. In preferred embodiments, the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid residues by use of a rotary cup sequence former, or (2) up to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver tin. The isolated polypeptide includes the polypeptide in situ in recombinant cells, since at least one component of the natural environment of the PRO polypeptide will not be present. Ordinarily, however, the isolated polypeptide will be prepared by at least one purification step.

A nucleic acid encoding the PRO polypeptide "isolated" is a nucleic acid molecule that is identified and separated from at least one contaminating nucleic acid molecule with which it is ordinarily associated in the natural source of the PRO polypeptide nucleic acid. An isolated PRO polypeptide nucleic acid molecule is different than in the form or environment in which it is found in nature. The PRO polypeptide nucleic acid molecules isolated however are different from the specific PRO polypeptide nucleic acid molecule as they exist in natural cells. However, a PRO polypeptide nucleic acid molecule includes PRO polypeptide nucleic acid molecules contained in cells that ordinarily express a PRO polypeptide wherein, for example, the nucleic acid molecule is in a chromosomal location different from that of the natural cells.

The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to use promoters, polyadenylation indicators, and enhancers.

The nucleic acid is "operably linked" when placed in a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a rep ein than in the secretion of the polypeptide; a promoter or improver is operably added to a coding sequence if it affects the transcription of the sequence; or a binding site or binding site is operably linked to a coding sequence if it is positioned in a manner that facilitates translation. Generally "operably linked" means that the DNA sequences that are linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, breeders do not have to be contiguous. The link is achieved by linking at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotides adapters or linkers are used. according to the concentration practice.

The term "antibody" is used in the broadest sense and specifically covers only anti-PRO polypeptide monoclonal antibodies (including agonists, antagonists, and neutralizing antibodies) and the anti-PRO polypeptide antibody compositions with polyepitopic specificity. The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, for example, the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in smaller quantities.

"Active" or "activity" for the purposes herein refers to forms of PRO polypeptide that retain the biological and / or immunological activities of the specific native polypeptide or as found naturally. Cerno for PR0243, a preferred activity is the ability to bind and affect, for example, block or otherwise modulate, a chordin activity, in the present activity preferably involves the regulation of notocordio and muscle building.

"Treatment" or "treat" refers to both therapeutic and prophylactic treatment or preventive measures. Those in need of treatment include those already with the disorder as well as those "prone to have the disorder of those in whom the disorder is being prevented.

"Mammal" for treatment purposes refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as sheep, dogs, horses, cats, cows, and the similar ones. Preferably the mammal in the present is a human.

"Vehicles" as used herein includes pharmaceutically acceptable carriers, excipients, or stabilizers that are non-toxic to the cell or molecule that is being exposed thereto at the doses and concentrations employed. Often the pharmaceutically acceptable carrier is an aqueous solution at regulated pH. Examples of pharmaceutically acceptable carriers include regulators such as phosphate, citrate, and other organic acids; antioxidants that include ascorbic acid; low molecular weight polypeptides (less than about 10 residues); proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, aspargin, arginine or lysine; manosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as dosium; and / or non-ionic surfactants such as TWEEN ™, polyethylene glycol (PEG), and PLÜRONICS ™.

The term "agonist" is used to refer to the peptide and non-peptide analogues of the native PRO polypeptides (wherein native PRO polypeptide refers to the pro-PRO polypeptide, pre-PRO polypeptide, preppro-PRO polypeptide, or mature PRO polypeptide) of the present invention and to antibodies that specifically bind such native PRO polypeptides, provided that they retain at least one biological activity of a native PRO polypeptide. Preferably, the agonist of the presenti - pi nttrrpQrn? R r * '1? 1"1 retains the qualitative linkage recognition properties and activation properties of the native PRO polypeptide receptor.

The term "antagonist" is used to refer to a molecule that inhibits a biological activity of a native PRO polypeptide of the present invention wherein the native PRO polypeptide refers to the pro-PRO polypeptide, pre-PRO polypeptide, prepro-PRO polypeptide, or mature PRO polypeptide. Preferably, the antagonist of the present inhibits the binding of a native PRO polypeptide of the present invention to a binding partner. An "PRO polypeptide antagonist" is a molecule that prevents, or interferes with, the effector function of the PRO antagonist (e.g., a molecule that prevents or interferes with the binding and / or activation of a PRO polypeptide receptor by the polypeptide PRO). Such molecules can be screened for their ability to competitively inhibit the activation of the PRO polypeptide receptor by monitoring the binding of the PRO polypeptide in the presence or absence of the test antagonist molecule, for example. An antagonist of the invention also encompasses an antisense polynucleotide against the PRO polypeptide gene, which antisense polynucleotide blocks the transcription or translation of the PRO polypeptide gene, thereby inhibiting its expression and biological activity.

"Severity conditions" means (1) employing low ionic strength and high temperature for lav r, eg, sodium chloride 0.015 / sodium citrate 0.0015 M / sodium dodecyl sulfate 0.% at 50 ° C, or (2) employ during denaturation a denaturing agent, such as formamide, for example, 50% (v /) formamide with 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5 with 750 M sodium chloride, 75 mM sodium citrate at 42 ° C. Another example is using 50% formamide, 5 X SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6/8), 0.1% sodium pyrophosphate, 5 X solution of Denhardt, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate at 42 ° C, washed at 42 ° C in 0.2 X SSC and 0.1% SDS. Yet another example is to hybridize using a 10% dextran sulfate buffer, 2 X SSC (sodium chloride / sodium citrate) and 50% formamide at 55 ° C, followed by a high severity wash consisting of 0.1 x SSC containing? DTA at 55 ° C.

"Moderately severe conditions" are described in Sambrook et al., Supra, and include the use of a wash solution and hybridization conditions (e.g., temperature, ionic strength, and% SDS) less severe than those described above. An example of moderately severe conditions is a condition such as overnight incubation at 37 ° C in a solution comprising: 20 I formamide, 5 X SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM phosphate sodium (pH 7.6), 5 X Denhardt's solution, 10% dextran sulfate, and 20 mg / ml denatured purified salmon sperm DNA, followed by washing the filters in 1 X SSC at approximately 37-50 ° DC. The person skilled in the art will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as duration of tests and the like.

"Southern analysis" or "Southern staining" is a method whereby the presence of DNA sequences in a solution containing DNA or a restriction endonuclease digester of DNA is confirmed by hybridization of a known DNA fragment or labeled oligonucleotide. Southern analysis, typically involves electrophoretic separation of digested DNA on agarose gels, denaturation of DNA after electrophoretic separation, and transfer of DNA to nitrocellulose, nylon, or other suitable membrane support for analysis with an enzymatically labeled, radiolabelled or biontinylated probe as was described in section 9.37-9.52 of Sambrook et al., Molecular Cloning: a Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).

"Northern analysis" or "Northern blotting" is a method, used to identify RJA sequences that hybridize to a known test such as an oligonucleotide, DNA fragment, cDNA or fragment thereof, or fragment of RNA. The probe is labeled with a radioisotope such as 32P, or by biotinylation, or with an enzyme. The RNA to be analyzed is usually electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon or other suitable membrane, and hybridized with the probe, using standard techniques known in the art such as those described in Sections 7.39- 7.52 of Sambrook et al., Supra.

Compositions and Methods of the Invention 1. Full length PR0241 polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned in the present application as PR0241. In particular, applicants have identified and isolated cDNA encoding a PR024 polypeptide, as discussed in further detail in the following Examples. Using computer programs for BLAST and FastA sequence alignment, applicants found that portions of PR0241 polypeptide have significant homology to several biglycan proteins. Accordingly, it is currently believed that the PR0241 polypeptide set forth in the present application is a recently identified biglycan homolog polypeptide and may possess typical activity of biglycan proteins. 2. PRQ243 oligopeptides of total extension The present invention provides recently identified and isolated nucleotide sequences encoding polypeptides mentioned in the present application as PR0243. In particular, the Applicants have identified and isolated cDNA encoding a PR0243 polypeptide, as discussed in further detail in the following examples. Using the BLAST, BLAST-2 and FastA computation programs of sequence alignment, the applicants found that a full-length native sequence PR0243 (shown in Figure 4 and SEQ ID NO: 7) had 50% sequence identity. amino acids with African spider toad and Chordin of Xenopus and 77% homology with rat chordin. Accordingly, it is currently believed that PR0243 disclosed in the present application is a newly identified member of the chordin protein family and may possess the ability to influence the notocordium and the formation of the muscle by the mesoderm backsizing. 3. PR0299 of total extension The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned in the present application as PR0299. In particular, applicants have identified and isolated cDNA encoding a PR0299 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA computer programs for sequence alignment, the applicants found that several portions of the PR0299 polypeptide have significant homology to the notch protein. Accordingly, it is currently believed that the PR0299 polypeptide set forth in the present application is a newly identified member of the notch family protein and possesses indicator properties typical of the notch protein family. 4. PRQ323 polypeptides of total extension The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned in the present invention as PR0323. In particular, the Applicants have identified and isolated cDNA encoding a PR0323 polypeptide, as set forth in additional detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that several portions of the PR0323 polypeptide have significant homology to several dipeptidase proteins. Accordingly, it is currently believed that the PR0323 polypeptide set forth in the present application is a recently identified dipeptidase homolog having dipeptidase activity.

. Full length PR0327 polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR0327. in particular, the Applicants have identified and isolated cDNA encoding a PR0327 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that portions of the PR0327 polypeptide have significant homology to several prolactin receptor proteins. Accordingly, it is currently believed that the PR0327 polypeptide set forth in the present application is a recently identified prolactin receptor homologue and has activity typical of a prolactin receptor protein. 6. Full length PRQ233 polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR0233. In particular, the Applicants have identified and isolated cDNA encoding a PR0233 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that portions of the PR0233 polypeptide have significant homology to Caenorhabdi tis elegans proteins. Accordingly, it is currently believed that the PR0233 polypeptide set forth in the present application is a newly identified member of the reductase family and possesses the ability to effect redox states in a typical cell of the reductase family. 7. Full length PR0344 polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR0344. In particular, the Applicants have identified and isolated cDNA encoding a PR0344 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA computer programs for sequence alignment, the Applicants found that portions of the PR0344 polypeptide have significant homology with the human and mouse complement proteins. Accordingly, it is currently believed that the PR0344 polypeptide set forth in the present application is a newly identified member of the family of compounds and possesses the ability to affect the inflammation process as is typical of the protein complement family. 8. PRQ347 polypeptides of total extension The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR.0347. In particular, the Applicants have identified and isolated cDNA encoding a PR0347 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that portions of the PR0347 polypeptide have significant homology to several secretory proteins rich in cysteine. Accordingly, it is currently believed that the PR0347 polypeptide set forth in the present application is a newly identified cysteine-rich secretory protein and may possess activity typical of the family of secretory cysteine-rich proteins, 9. Full length PRQ354 polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR0354. In particular, the Applicants have identified and isolated cDNA encoding a PR0354 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that portions of the PR0354 polypeptide have significant homology to the heavy chain of the Inter-alpha-trypsin inhibitor protein. Accordingly, it is currently believed that the PR0354 polypeptide set forth in the present application is a homolog of the recently identified inter-alpha-trypsin heavy chain inhibitor.

. Full-length PRQ355 polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR0355. In particular, the Applicants have identified and isolated cDNA encoding a PR0355 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that portions of the PR0355 polypeptide have significant homology to the CRTAM protein. The Applicants also found that the DNA encoding the PR0355 polypeptide also has homology with the development and activation protein of the thymocyte, the H20A receptor, the H20B receptor, the poliovirus receptor and the AGM delta 1 protein from Cercopi thecus aethiops. Accordingly, it is currently believed that the PR0355 polypeptide set forth in the present application is a newly identified member of the CRTAM family of proteins. 11. PRQ357 polypeptides of total extension The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR0357. In particular, the Applicants have identified and isolated cDNA encoding a PR0357 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that portions of the PR0357 polypeptide have significant homology to the labile acid subunit of insulin growth factor. The Applicants have also found that non-coding regions of DNA44804-1248 align with a human gene signature as described in WO 95/14772. Applicants have additionally found that non-coding regions of DNA44804-1248 align with type 12 adenovirus / human recombinant viral DNA as described in Deuring and Doerfler, Gene, 26: 283-289 (1983). Based on the homology of the coding region, it is currently believed that the PR0357 polypeptide set forth in the present application is a newly identified member of the family of leucine-rich repeat proteins, and particularly, is related to the labile acid subunit of the growth of insulin. In such a way that PR0357 is probably involved in the link mechanisms, and can be part of a complex. 12. PRQ715 oligopeptides of total extension The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR0715. In particular, the Applicants have identified and isolated cDNA molecules encoding PR0715 polypeptides, as discussed in further detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the applicants found that several portions of the PR0715 polypeptides have significant homology to several members of the tumor necrosis protein family. Accordingly, it is currently believed that the PR0715 polypeptides set out in the present application are newly identified members of the tumor necrosis factor protein family. 13. PRQ353 oligopeptides of total extension The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned in the present application as PR0353. In particular, applicants have identified and isolated cDNA encoding the PR0353 polypeptides, as discussed in further detail in the following Examples. Using the BLAST and FastA computation programs for sequence alignment, the Applicants found several portions of the PR0353 p'olypeptides that have significant homology with human and mouse complement proteins. Accordingly, it is currently believed that the PR0353 polypeptides set forth in the present application are newly identified members of the complement protein family and possess the ability to effect the process of inflammation as is typical of the protein complement family. 14. PRQ361 polypeptides of total extension The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned in the present application as PR0361. In particular, the Applicants have identified and isolated cDNAs encoding a PR0361 polypeptide, as discussed in detail further in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that several portions of the PR0361 polypeptide have significant homology to the mucin and chitinase proteins. Accordingly, it is recently believed that the PR0361 polypeptide set forth in the present application is a newly identified member of the families of the mucin and / or proteinase proteins and may be associated with cancer, plant pathogenesis or receptor functions typical of the mucin and chitinase families. of proteins, respectively.

. Full-length PR0365 polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides mentioned herein as PR0365. In particular, the Applicants have identified and isolated cDNA encoding a PR0365 polypeptide, as discussed in further detail in the following Examples. Using the BLAST and FastA counting programs for sequence alignment, the Applicants found that several portions of the PR0365 polypeptide have significant homology to the human 2-19 protein. Accordingly, it is currently believed that the PR0365 polypeptide set out in the present application is a newly identified member of the human 2-19 protein family. 16. PROTETIVE POLYPEPTIDE ARYANTS In addition to the full-length native sequence PRO polypeptides described herein, it is contemplated that variants of the PRO polypeptide may be prepared.

Variants of the PRO polypeptide can be prepared by appropriate introduction of changes in the nucleotides in the PRO polypeptide DNA, or by synthesis of the desired PRO polypeptide. Those skilled in the art will appreciate that changes in amino acids can alter post-translational processes of the PRO polypeptides, such as changing the number or position of glycosylation sites or altering the characteristics of anchorage in the membrane.

Variations in the PRO native polypeptides of full extension sequence or in various regions of the PRO polypeptides described herein, can be made for example, using some of the techniques and guides for conservative and non-conservative mutations exposed, for example, in U.S. Patent No. 5,364,934. The variations may be a substitution, deletion or insertion of one or more codons encoding the PRO polypeptide that results in a change in the amino acid sequence of the PRO polypeptide as compared to the native sequence PRO polypeptide. Optionally, the variation is by substitution of at least one amino acid with any other amino acid in one or more of the PRO polypeptide regions. Directions in determining which amino acid residues can be inserted, substituted or deleted without adversely affecting the desired activity can be found by comparing the PRO polypeptide sequence with that of known homologues of protein molecules and minimizing the number of changes in proteins. the sequence of amino acids made in regions of high homology. The amino acid substitutions can be the result of replacing an amino acid with another amino acid which has similar structural and / or gumanic properties, such as the replacement of a leucine with a serine, for example, conservative amino acid replacements. Insertions or deletions may optionally be in the range of 1 to 5 amino acids. The allowed variations can be determined by insertions, deletions or substitutions of amino acids made systematically in the sequence and examine the resulting variants by activity in the in vitro assay described in the following Examples.

In particular embodiments, conservative substitutions of interest are shown in Table 1 under the heading of preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, termed exemplary substitutions in Table 1, or as further described below with reference to the amino acid classes, are introduced and the products screened.

Table 1 Residue Substitutions Substitutions Original E Emplares Preferidos Wing (A) val; leu; ile val Arg (R) lys; gln; asn lys Asn ((N) gln;; his; lys; arg gln; Asp (D) glu glu Cys (C) be be Gln (Q) asn asn Glu (E) asp asp Gly (G) pro; wing wing Table 1 (continued) Residue Substitutions Substitutions Original Preferred Items His (H) asn; gln; lys; arg arg He (I) leu; al; met; ala; phe; Norleucina leu Leu (L) norleucine; ile; Met val; ala; phe ile Lys (K) arg; gln; asn arg Met (M) leu; phe; ile leu Phe (F) leu; to the; ile; to; tyr leu Pro (P) wing wing Ser (s; thr thr Thr (T) be be Table 1 Residue Substitutions Substitutions Original Exemplary Preferred Trp (W) tyr; phe tyr Tyr (Y) trp; phe; thr; be phe Val (V) ile; leu; met; phe Ala; norleucina leu Substantial modifications in function or immunological identity of the PRO polypeptide are achieved by selection of substitutions that differ significantly in their effect or by maintaining (a) the structure of the main stencil of the polypeptide in the area of the substitution, for example, as a laminar conformation or helical, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the density of the side chain. Naturally there are residues that are divided into groups based on common properties of the side chains. (1) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr; (3) acid: asp, glu; (4) basic: asn, gln, his, lys, arg; (5) residues that influence the orientation of the chain: gly, pro; Y (6) aromatic: trp, tyr, phe.

Non-conservative substitutions will cause exchange of a member of one of these classes for another class. Such substituted residues may also be introduced at the sites of conservative substitutions or, more preferably, at the remaining (non-conserved) sites.

The variations can be made using methods known in the art such as mutagenesis by means of oligonucleotide (in directed site), alanine scan, and PCR mutagenesis. Mutagenesis in directed ditium [Cárter et al., Nucí., Acids, Res., 13: 4331 (1986); 'Zoller and collaborators, Nucí. Acids Res., 10: 6487 (1987)], cartridge mutagenesis [Wells et al., Gene, 34: 315 (1985) J, mutagenesis with restriction selection [Wells et al., Philos, Trans., R. Soc. London SerA, 317-415 (1986) (1986) or other known techniques can be performed on the cloned DNA to produce the DNA of the desired PRO polypeptide variant.

Analysis of amino acids by scanning can also be used to identify one or more amino acids along a contiguous sequence. Among the preferred amino acids by screening are the relatively small, neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically an amino acid by screening preferred among this group because it removes the side chain in addition to the beta-carbon and less likely alters the conformation of the main chain of the variant. Alanine is also typically preferred because it is the most common amino acid. Additionally, it is frequently found in both occult or exposed positions [Creighton, The Proteins, (W.H. Freeman &Co. N.Y.);. Chothia, J. Mol. Biol., 150: 1 (1976)]. If the alanine substitution does not produce adequate amounts of variant, an esoteric amino acid can be used. 17. Modification of PRO Polypeptides Covalent modifications of PRO polypeptides are included in the scope of this invention. One type of covalent modification includes objectified reaction of amino acid residues of the PRO polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or N- or C-terminal residues of the PRO polypeptide. Derivatization with bifunctional agents is useful, for example, for crosslinking a PRO polypeptide in a water-soluble matrix or surface support for use in the anti-PRO polypeptide antibody purification method, and vice-versa. Commonly used crosslinking agents include, for example, 1, 1- bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disucciny idyl esters such as 3'-dithiobis (succinimidylpropionate), bifunctional maleimides such as bis-N-maleimido-1, 8-octane and agents such as methyl-3- [(p-azidophenyl) dithio] propioimidate.

Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the a-amino groups of the side chains of lysine, arginine , and histidine [T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.

Another type of covalent modifications of the PRO polypeptides included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is intended for purposes of the present which means eliminating one or more carbohydrate moieties found. in a native sequence PRO polypeptide, and / or adding one or more glycosylation sites that are not present in the polypeptide PRO of native sequence, and / or alteration of the proportion and / or composition of the sugar residues fixed in the glycosylation sites.

The addition of glycosylation sites in the PRO polypeptide can be achieved by altering the amino acid sequence. The alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the PRO polypeptide of the native sequence (by O-linked glycosylation sites). The amino acid sequence of the PRO polypeptide can optionally be altered through changes in the DNA level, particularly by mutation of the DNA encoding the PRO polypeptide in preselected bases such that codons are generated that will carry over to the desired amino acids.

Other means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides in the polypeptide. Such methods are described in the art, for example, in WO 87/05330 published on September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., Pp, 259-306 (1981).

The removal of carbohydrate portions present in the PRO polypeptide can be achieved chemically or enzymatically or by mutational substitution of codons coding for amino acid residues that serve as glycosylation targets. Chemical deglycosylation techniques are known in the art and described for example, by Hakimuddin, et al., Arch. Biochem. Biophys., 259: 52 (1987) and by Edge et al., Anal Bioche. , 118: 131 (1981). The enzymatic cleavage of carbohydrate moieties into polypeptides can be achieved by the use of a variety of endo- and oxoglycosidases as described by Thotakura et al., Meth., Enzymol., 138: 350 (1987).

Another type of covalent modifications of PRO polypeptides of the invention comprises linking the PRO polypeptide to one of a variety of non-proteinaceous polymers, for example, polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, of the kind set forth in US Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4, 670, 417; 4, 791, 192; or 4,179,337.

The PRO polypeptides of the present invention can also be modified so as to form a chimeric molecule comprising a PRO polypeptide fused to another, heterologous polypeptide or amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of the PRO polypeptide with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. The tag epitope is generally placed on the amino- or carboxyl-terminus of the PRO polypeptide. The presence of such epitope-tagged forms of the PRO polypeptide can be detected using an antibody against the tag polypeptide. Also, the tag epitope condition facilitates the PRO polypeptide to be easily purified by affinity purification using an anti-tag antibody or another type of affinity matrix which binds to the tag epitope. In an alternative embodiment, the chimeric molecule may comprise a fusion of the PRO polypeptide with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimeric molecule, such a fusion could be in the Fe region of an IgG molecule.

Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the HA tag polypeptide and its 12CAS antibodies [Field et al., Mol. Cell. Biol., 8: 2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies of these [Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)]; and the Herpes simplex (gD) t g virus glycoprotein and its antibodies [Paborsky et al., Protein Engineering, 3 (6): 547-553 (1990)]. Other tag polypeptides include the Flag-peptide [Hopp et al., Biotechnology, 6: 1204-1210 (1988)]; the KT3 epitope peptide [Martin et al., science, 255: 192-194 (1992)]; an epitope peptide of a-tubukin [Skinner et al., J. Biol. Chem. 266: 15163-15166 (1991)]; and the peptide tag of protein 10 of the T7 gene [Lutz-Freyermuth et al., Proc. Nati Acad. Sci. USA, 87: 6393-6397 (1990) J. 18. Preparation of PRO polypeptides The subsequent description concerns primarily the production of PRO polypeptides by culturing cells transformed or transfected with a vector containing the desired PRO polypeptide nucleic acid. This is, of course, contemplated that alternative methods, which are known in the art, can be employed to prepare the PRO polypeptide. For example, the PRO polypeptide sequence, or portions thereof, can be produced by direct synthesis of the peptide using solid phase techniques [see, for example, Stewart et al., Solid-Phase Peptide Synthesis, W. H., Freeman Co. , San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc., 85-2149-2144 (1963) J. Synthesis of proteins in vi tro can be carried out using manual techniques or by automation. Automated synthesis can be achieved, for example, by using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using the manufacturer's instructions. Various portions of the desired PRO polypeptide can be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full length PRO polypeptide.

A. Isolation of the DNA that Codifies PRO Polypeptides The DNA encoding the PRO polypeptides can be obtained from a cDNA library prepared from tissue that is believed to possess the desired PRO polypeptide mRNA and expresses it at a detectable level. Accordingly, the DNA of the human PRO polypeptide can be conveniently obtained from a stock of cDNA prepared from human tissue, as described in the Examples. The gene encoding the PRO polypeptide can also be obtained from a genomic pool or by synthesis of oligonucleotides.

The pools can be screened with probes (such as antibodies of the desired PRO polypeptide or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic pool with the selected probe can be carried out using standard procedures, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratiry Press, 1989). An alternative means to isolate the gene encoding the desired PRO polypeptide is to use PCR methodology [Sambrook et al., Supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995) J.

The following Examples describe techniques for screening a cDNA stock. The sequences of oligonucleotides selected as probes should be of sufficient length and sufficiently unambiguous that false positives be minimized. The oligonucleotide is preferably labeled such that it can be detected in the hybridization of DNA in the pool being screened. Marking methods are known in the art, and include the use of radiolabels such as 32 P-labeled ATP, biotinylation or enzyme labels. Hybridization conditions, which include moderate severity and high severity, are provided in Sambrook et al., Supra.

The sequences identified in such screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private databases. The identity of the sequences (either at the nucleotide or amino acid level) in defined regions of the molecule or through the total extension of the sequence can be determined through the alignment of the sequence using computer programs such as BLAST, ALIGN, DNAstar, and INHERIT that use several algorithms to measure homologies.

The protein having the nucleic acid encoding the sequence can be obtained by screening selected DNA or genomic pools using the deduced amino acid sequence set forth in the test for the first time, and, if necessary, using primer extension methods conventional as described in Sambrook et al., supra, to detect precursors and intermediate mRNA processes that may not have been reverse transcribed into cDNA.

B. Selection and Transformation of Guest Cells The host cells are transfected or transformed with expression or cloning vectors described herein for production and culture of PRO polypeptides in modified conventional nutrient media as appropriate to induce promoters, select transformants, or amplify the genes that encode the desired sequences. The culture conditions, such as medium, temperature, pH, and the like, can be selected by those skilled in the art without undue experimentation. In general, principles, protocols, and practical techniques to maximize the productivity of cell cultures can be found in Mamalian Cell Biotechnology; a Practical Approach, M. Butler, ed. (IRL, Press, 1991) and Sambrook et al., Supra.

Transfection methods are known to experts in the field, for example, CaP04 and electroporation. Depending on the host cell used, the transformation is effected using standard techniques appropriate for such cells. The calcium treatment employing calcium chloride, as described by Sambrook et al., Supra, or electroporation is generally used for prokaryotic cells and others which contain cells with barrier walls substantially. Infection with Agroba ct erium turne faciens is used for transformation of certain plant cells, as described by Shaw et al., Gene, 23: 315 (1983) and WO 89/05859 published on June 29, 1989. For cells of mammals without such cell walls, the calcium phosphate precipitation method of Graham and Van der Eb, Virológy, 52: 456-457 (1978)) can be employed. General aspects of transformations in mammalian host cell systems have been described in US Pat. No. 4,399,216. Transformations in yeast are typically carried out according to the method of Van Solinger et al., J. Bact. 130-946 (1977) and Hsiao et al., Proc. Nati Acad. Sci.

(USA), 76: 3829 (1979). However, other methods for introducing DNA into cells, such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycation, eg, polybrene, polyornithine, can be used. For several techniques for mammalian cell transformation, see Kéown et al., Methods in Enzymology, 185; 525-537 (1990) and Mansour et al., Nature, 336: 348-352 (1988).

Suitable host cells for cloning or expressing the DNA in vectors herein include prokaryotic, yeast, or higher eukaryotic cells. Suitable prokaryotes include but are not limited to eubacteria, such as gram-negative or gram-positive organisms, for example, Enterobacteriaceae such as E. Coli. Several strains of E coli are publicly available, such as E. Coli K12 strain MM294 (ATCC 31, 446); E. Coli X1776 (ATCC 31.537); E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635). Other suitable prokaryotic host cells include Entetobacteriaceae such as Escherichia, for example E. coli, Enterobacter, Erwinia, Klebsiella, Proteuss, Salmonella, for example, Salmonella typhimurium, Serratia, for example Ser at ia Marcescans, and Shigella, as well as Bacill such as B. Subtilis and B. Lichenformis (for example, B. Lichenformis 41P reported in DD 266,710 published April 12, 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. Several strains of E. Coli are publicly available, such as E. Coli K12 strain MM294 (ATCC 31,446); E. Coli X1776 (ATCC 31,537); E. coli strain W3110 (ATCC 27,325); and K5 772 (ATCC 53,635). These examples are illustrative rather than limiting. Strain W3110 is a particularly preferred host or host patient because it is a common host strain for fermentations of recombinant DNA products. Preferably, the host cells secrete minimal amounts of proteolytic enzymes. For example, strain W3110 can be modified to effect a genetic mutation of genes encoding endogenous proteins in the host, with examples of such hosts including E. coli W3110 strain 1A2, which has the complete genotype tonA; E. Coli W3110 epa 9E4, which has the complete genotype tonA ptr3; E. coli W3110 strain 27C7 (ATCC 55.244), which has the complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degP ampT kanr; E. coli W3101 strain 37D6, which has the complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degP a pT rbs7 ilvG kanr; E. Coli W31100 strain 40B4, which is strain 37D6 with a deletion mutation degP not resistant to kanamycin; and an E. Coli strain having mutant periplasmic protease disclosed in US Patent No. 4,946,783 filed August 7, 1990. Alternatively cloning methods, eg, PCR or other nucleic acid polymerase reactions, are suitable.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeasts are suitable cloning or expression hosts for vectors encoding the PRO polypeptide. Saccharomyces cerevisiae is a lower eukaryotic host microorganism commonly used. Others included are Schizosacharomyces pombe (beach and Nurse, nature, 290: 140 [1981], EP 139, 383 published on May 2, 1985); guests Kluyveromyces (U.S. Patent No. 4,943,529; Fleer et al.

Bio / Technology, 9: 968-975 (1991)) such as for example K. Lactis (MW98-8C, CBS683, CBS4574; Louvenccourt et al., J. Bacteriol., 737 [1983]), K. Fragilis (ATCC 12,424), K. Bulgaricus (ATCC 16,045), K. Wickeramii (ATCC 24,178), K. wal tii (ATCC 56,500), K. Drosophilarum (ATCC 36,906; Van der Beerg et al .; Bio / Technology, 8: 135 (1990)), K. Thermotol erans, and K. Marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et al., J. Basic Microbiol., 28: 265-278 [1988]); candida; Trichoderma recia (EP 244,234); Neurospora crassa (Case et al., Proc. Nati, Acad. Sci. USA, 76: 5259-5263 [1979]); Schwanniomyces such as accidental Schwaniomyces (EP 394,538 published October 31, 1990); and filamentous fungi such as, for example, neurospora, penicillium, Tolypocladium (WO 91/00357 published January 10, 1991), and Aspergillus hosts such as A. Nidulans (Ballance et al., Biochem. Biophys., Res. Common., 112 : 284-289 [1983], Tilburn et al., Gene, 26: 205-221 [1983], Yelton et al., Proc. Nati, Acad. Sci. USA, 81: 1470-1474 [11984]) and A. Niger (Kelly and Inés, EMBO J. 4: 475-479 [1985J). Methylotropic yeasts are suitable herein and include, but are not limited to, yeasts capable of growing in methanol selected from the genus consisting of hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotorula. A list of specific species that are examples of this class of yeast can be found in C. anthony, The Biochemistry of Methylotrophs, 269 (1982).

Suitable host cells for the expression of glycosylated PRO polypeptides are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples of mammalian host cell lines include Chinese hamster ovary (COS) cells and CHO cells. More specific examples include the monkey kidney CVl line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned by growth in suspension culture, Graham et al., J. Gen. Virol., 36-59 (1977)); Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Nati. Acad. Sci. USA, 77: 4216 (1980)); Mouse Sertolli cells (TM4, Maather, Biol. Reprod., 23: 243-251 (1980)); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse mammary tumor (MMT 060562, ATCC CCL51). The selection of the appropriate host cell is in the judgment of those skilled in the art.

C. Selection and Use of a Replicable Vector The nucleic acid (e.g., genomic DNA or cDNA) that encodes a desired PRO polypeptide can be inserted into a replicable vector for cloning (DNA amplification) or for expression. Several vectors are publicly available. The vector can, for example, be in the form of a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence can be inserted into the vector by a variety of methods. In general, the DNA is inserted into a restriction endonuclease site using techniques known in the art. The vector components generally include, but are not limited to, one or more reporter sequences, a replication origin, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. The construction of suitable vectors containing one or more of these components employs standard bonding techniques that are known to those skilled in the art.

The PRO polypeptide of interest can be recombinantly produced not only directly, but also as a polypeptide fusion with a heterologous polypeptide, which can be an indicator sequence or another polypeptide having a specific cleavage site on the N-terminus of the mature protein or polypeptide. In general, the reporter sequence may be a component of the vector, or it may be part of the PRO polypeptide DNA that is inserted into the vector. The indicator sequence may be selected prokaryotic indicator sequence, for example, from the group of alkaline phosphatase, penicillinase, lpp, heat-stable enterotoxin II leaders. For secretion yeasts the indicator sequence may be, for example, the yeast invertase leader, the alpha factor leader (which includes the alpha factor leaders Saccharomyces and Kluyveromyces, subsequently described in US Patent No. 5,010,182), or leader of the acid phosphatase, the leader of the glucoamylase of C. albicans (EP 36179 published on April 4, 1990), or the signal described in WO 90 // 13646 published on November 15, 1990. In cell expression of mammals, mammalian indicator sequences can be used to direct secretion of the protein, such as polypeptide signal sequences secreted therefrom or related species, as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence which facilitates the replication of the vector in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeasts and viruses. The origin of replication of plasmid pBR322 is suitable for most gram-negative bacteria, the origin of plasmid 2μ is suitable for yeast, and various viral origins (SV40), polyoma, adenovirus, VSV or BPv), are useful as cloning vectors in mammalian cells.

The expression and cloning vectors will typically contain a selection gene, a term also applied to a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, eg, ampicillin, neomycin, methotrexate, or tetracycline, (b) auxotrophic complement deficiencies, or (c) provide critical nutrients not available from the medium complex, for example, the gene that codes for D-alanine racemase for Bacilli.

An example of selectable markers suitable for mammalian cells are those that facilitate the identification of cells competent to take on the nucleic acid of the PRO polypeptide, such as DHFR or thymidine kinase. A suitable host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al., Proc., Nati. Acad. Sci ._ USA, 77: 4216 (1980), A suitable selection gene for use in yeast is the trpl gene present in yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (1979); Kingsman et al., Gene /: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)]. The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85: 12 (1977)].

Expression and cloning vectors usually contain a promoter operably linked to the nucleic acid sequence of the PRO polypeptide to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include β-lactamase and lactose promoter systems [Chang et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res. 8: 44057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [de Boer et al., Proc. Nati Acad. Sci. USA, 80: 21-25 (1993)]. The promoters for use in bacterial systems will also contain a Shine-Dalgarno sequence (S-D.) Operably linked to the DNA encoding the desired PRO polypeptide. Examples of promoter sequences suitable for use with yeast hosts include promoters for 3-phosphoglycerate kinase [Hian et al., J. Biol. Chem. 255: 2073 (1980)] or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg., 7: 149 (1968), Holland, Biochemistry, 17: 490 (1978)], such as enolase, glyceraldehyde-3-phosphatase dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3 -phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.

Other yeast promoters, which are inducible promoters that have the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocitochrome C, acid phosphatase, degrading enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde - 3-phosphate dehydrogenase, and enzymes responsible for the use of maltose and galactose. Vectors and promoters suitable for use in the expression of yeast are further described in EP 73,657.

Transcription of the PRO polypeptide from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published July 5, 1989), adenoviruses (such as Aenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis B virus and 40 siian virus (SV40), from the promoters of heterologous mammals, for example, the promoter of actin, or an immunoglobulin promoter, and promoters that are impacted by heat, provided that such promoters are compatible with host cell systems.

The transcription of DNA encoding the desired PRO polypeptide by higher eukaryotes can be increased by insertion of a better sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 bpp, which act on a promoter to increase transcription. Many enhancer sequences are currently known from mammalian genes (globin, elastase, albumin, α-fetoprotein, and insulin). Typically, however, one will use a virus enhancer of eukaryotic cells. Examples include the SV40 enhancer on the final side of the replication origin (bp 100-270), the enhancer of the cytomegalovirus forward promoter, the polyoma enhancer on the final chain of the replication origin, and adenovirus enhancers. The enhancer may be attached to the vector 5 'or 3' to the PRO polypeptide encoding the sequence, but is preferably located at the 5 'site of the promoter.

Expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, human, or nucleated cells of other multicellular organisms) will also contain sequences necessary for the termination of transcription and for mRNA stabilization. Such sequences are commonly available from the 5 'and, occasionally 3' regions, untranslated from eukaryotic, or viral DNAs or cDNAs. These regions contain segments of nucleotides transcribed as polyadenylation fragments in the untranslated portion of the mRNA encoding the PRO polypeptides.

Still other methods, vectors, and host cells suitable for adeptation of the synthesis of PRO polypeptides in cell cultures of recombinant vertebrates are described in Gething et al., Nature, 293: 620-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.

D.Detection of Gene Amplification / Expression The amplification / exporesion of geen can be measured in a sample directly, for example, by Southern blotting, conventional Northern blotting to quantitate mRNA transcription [Thomas, Proc. Nati Acad. Sci. USA, 77: 5201-5205 (1980)], spotting dot (DNA analysis), or hybridization in itself, using a suitably labeled probe, based on the sequences provided herein. Alternatively, antibodies that can recognize specific doublets including doublets of DNA, doublets of RNA, and hybrid doublets DNA-RNA or DNA-protein doublets can be employed. The antibodies in turn can be labeled and the assay carried out when the doublet is bound to a surface, so that in the formation of the doublet on the surface, the presence of the antibody bound to the doublet can be detected.

The expression of the gene, alternatively, can be measured by immunological methods, such as immunohistochemical staining of cells or sections of tissues and cell culture assay or body fluids, to directly quantify the product of gene expression. Antibodies useful for immunohistochemical staining and / or fluid sample assays can be either monoclonal or polyclonal, and can be prepared in any mammal. Conveniently, the antibodies can be prepared against a PRO polypeptide of native sequence or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequences fused to a PRO polypeptide DNA and encoding a specific antibody epitope.

E. Purification of the Polypeptide The PRO polypeptide forms can be recovered from the culture medium or those used from host cells. If the membrane-bond can be released from the membrane using suitable detergent solutions (for example, Triton-X 100) or by enzymatic cleavage. Cells used in the expression of PRO polypeptides can be broken by various physical or chemical means, such as freeze-thaw cycles, sonication, mechanical break, or cell lysate agents.

Purification of the polypeptides may be desired PRO from recombinant cells of proteins or polypeptides. The following procedures are exemplary of suitable purification procedures; by fractionation on an ion exchange column; precipitation with ethanol; HPLC in reverse phase; chromatography on silica or on a cationic interchange resin such as DEAE, chromatofocusing; SDS-PAGE; ammonium sulfate precipitation, gel filtration, using, for example, Sephadex. G-75; A Sepharose protein columns to remove contaminants such as IgG; and metal chelating columns to link the taigated forms of the PRO polypeptide epitope. Various methods of protein purification can be employed and such methods are known in the art and described for example in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principies and 'Practice, Springer-Verlag, New York (1982). The purification steps selected will depend, for example, on the nature of the production process used and the particular PRO polypeptide produced. 19. Uses for PRO Polypeptides The nucleotide sequences (or their complement) encoding the PRO polypeptides of the present invention have various applications in the field of molecular biology, including uses as hybridization probes, in chromosomal and gene mapping and in the generation of DNA and RNA. anti-senses The nucleic acid encoding the PRO polypeptides will also be useful for the preparation of pRO polypeptides by the recombinant techniques described herein.

The nucleic acid encoding the PRO polypeptide of full-length native sequence or portions thereof can be used as hybridization probes to isolate the full-length polypeptide gene or even isolate other genes (eg, those encoding the vareliants as naturally occurring PRO polypeptide or PRO polypeptide from other species) of a cDNA pool. Optionally, the length of the probes will be approximately 20 to 50 bases. Hybridization probes can be derived from the nucleotide sequence of any of the DNA molecules exposed herein or genomic sequences which include promoters, enhancer elements and introdes of the native sequence PRO polypeptide encoding the DNA. By way of example, a screening method will comprise isolating the coding region of the PRO polypeptide gene using the known DNA sequence to synthesize a selected probe of about 40 bases. Hybridization probes can be labeled by a variety of labels, including radionucleotides such as 32P or 5S, or enzymatic labels such as alkaline phosphatase coupled to the avidin / biotin coupling system probe. The labeled probes having a complementary sequence so that the specific PRO polypeptide gene of the present invention can be used to screen pools of human cDNA, genomic DNA or mRNA to determine which members of such pools hybridize to the probe. Hybridization techniques are described in further detail in the following examples.

The ESTs set forth in the present application may similarly be employed as probes, using the methods set forth herein.

The probes can also be used in PCR techniques to generate a group of sequences for identification of very closely related PRO polypeptide sequences.

The nucleotide sequences encoding a PRO polypeptide can also be used to construct hybridization probes to map the gene encoding the PRO polypeptide and for genetic analyzes of individuals with genetic disorders. The nucleotide sequences provided herein may be mapped to a chromosome and specific regions of a chromosome using known techniques, such as hybridization in itself, analysis of binding against known marker chromosomes, screened by hybridization with stocks.

When the sequence encoding the PRO polypeptide encodes a protein that binds to another protein, the PRO polypeptide can be used in assays to identify its ligands. Similarly, inhibitors of the receptor / ligand binding interaction can be identified. The protein involved in such interactions can also be used to screen for inhibition of peptides or small molecules or agonists of the binding interaction. Screening assays have been reported to lead to compounds that mask the biological activity of a native PRO polypeptide or a ligand for the PRO polypeptide. Such screening assays will include conductive assays for superior screening products from chemical pools, making them particularly suitable for identifying candidates for small molecule drugs. The contemplated small molecules include organic and inorganic compounds. Assays can be carried out in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell-based assays, which are well characterized in the art. .

The nucleic acids encoding a PRO polypeptide or its modified forms can also be used to generate either transgenic animals or "depleted" animals which, in turn, are useful in the development and screening of therapeutically useful reagents. A transgenic animal (e.g., a mouse or rat) is an animal that has cells that contain a transgene, said transgene was introduced into the animal or an ancestor of the animal in a prenatal state, e.g., an embryonic stage. A transgene is a DNA that is integrated into the genome of a cell from which a transgenic animal develops. In one embodiment, cDNA encoding a PRO polypeptide of interest can be used to clone genomic DNA encoding the PRO polypeptide according to established techniques and the genomic DNA sequences used to generate transgenic animals that contain cells that express DNA encoding the PRO polypeptide. Methods for generating transgenic animals, particularly animals, particularly animals such as mice or rats, become conventional in the art and are described, for example, in US Patent Nos. 4,736,866 and 4,870,009. Typically, particular cells would be targets for incorporation of frangen into the PRO polypeptide with tissue-specific enhancers. Transgenic animals that include a copy of a transgene encoding a PRO polypeptide introduced into the germ line of an animal at an embryonic stage can be used to examine the effect of increased expression of the DNA encoding the PRO polypeptide. Such animals can be used as tester animals for reagents however to confer protection from, for example, pathological conditions associated with their overexpression. According to this facet of the invention, an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals presenting the transgene, would indicate a potential therapeutic intervention for the pathological conditions.

Alternatively, non-human homologs of PRO polypeptides can be used to construct a PRO polypeptide in an "exhausted" animal having a defective or altered gene encoding the PRO polypeptide of interest as a result of homologous recombination between the endogenous gene encoding the PRO polypeptide and altered genomic DNA encoding the PRO polypeptide introduced into an embryonic cell of the animal. For example, cDNA encoding a PRO polypeptide can be used to clone genomic cDNA encoding the PRO polypeptide according to established techniques. A portion of the genomic DNA encoding a PRO polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used as an integration monitor. Typically, several kilosbase of unaltered lateral DNA (both of the 5 'and 3' ends) are included in the vector [see for example, Thomas and Capecchi, Cell 51: 503 (1987) for a description of heterologous recombination vectors]. The vector is introduced into a cell line of embryonic origin (eg, by electroporation) and the cells in which the introduced DNA is homologously recombined with the endogenous DNA are selected [see for example, Li et al., Cell, 69: 915 (1992)]. The selected cells are then injected into a blastocyst of an animal (eg, a mouse or rat) to form aggregation chimeras [see for example, Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113- 152]. A chimeric embryo can then be implanted in a suitable pseudopregnant female adoptive animal and the embryo brings to term to create an "exhausted" animal. Progeny containing homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain homologously recombined DNA. Depleted animals can be characterized, for example, by their ability to defend against certain pathological conditions and by their development of pathological conditions due to the absence of the PRO polypeptide.

When the in vivo administration of a PRO polypeptide is employed, the amounts of the normal doses may vary from 10 ng / kg to 100 mg / kg of body but mammalian or more per day, preferably about 1 μg / kg / day to 10 mg / kg. mg / kg / day, depending on the route of administration. Indications such as dosage and particular methods of release are provided in the literature; see, for example, US Pat. Nos. 4,657,760; 5,206,344; or 5,225,212. It is anticipated that different formulations will be effective for compounds for different treatments and different disorders, whose administration which is directed towards an organ or tissue, for example, may need release in a manner different from that of another organ or tissue.

When the administration of a PRO polypeptide is sustained release is desired in a formulation with characteristic release suitable for the treatment of any disease or disorder requiring administration of the PRO polypeptide, microencapsulation of the PRO polypeptide is contemplated. Protein microencapsulation for sustained release has been successfully performed with human growth hormone (rhGH), interferon- (rhIFN-), interleukin-2, and MN rgpl20. Jonson et al., Nat. Med., 2: 795-799 (1996) 9; Yasuda, Biomed. Ther., 27: 1221-1223 (1993); Hora et al., Bio / Technology, 8: 755-758 (1990); Cleland, "Design and Production of Single Immunization Vaccines Using Polylactide Plycolide Microsphere Systems", in Vaccine Design: The Subunit and Adjuvant Approach, Powell and Newman, eds, (Plenum Press: New York, 1995), pp. 439-462; WO 97/03692, WO96 / 40072, WO 96/07399; and U.S. Patent No. 5,654,010.

The formulations for sustained release of these proteins were developed using a polymer of polylactic-coglycolic acid (PLGA) due to its biocompatibility and wide range of biodegradable properties. The degradation products of PLGA, lactic and glycolic acids, can be clarified rapidly in the human body. In addition, the degradability of this polymer can be adjusted from months to years depending on its composition and molecular weight. Lewis, "Controlled release of bioactive agents from lactide / glycolide polymer". In: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Deker: New York, 1990), p. 1- 41 For example, for a formulation that can provide a dose of about 80 g / Kg / day in mammals with a maximum body weight of 85 Kg, the largest dose would be approximately 6.8 mg of the PRO polypeptide per day. In order to achieve this dose level, a sustained release formulation containing a maximum possible loaded protein (15-20% by weight of PRO polypeptide) with lowest possible initial outputs (<20%) is necessary. A continuous release (of the order of zero) of the PRO polypeptide from microparticles for 1 to 2 weeks is desirable. In addition, the encapsulated protein to be released would maintain its integrity and stability during the desired release period.

The PRO polypeptides of the present invention that possess biological activity related to that of the endogenous biglycan protein can be employed in both forms in vivo for therapeutic and in vi tro purposes. Those skilled in the art will know how to use the PR0241 polypeptides of the present invention for such purposes.

Chordin is a candidate gene for a dysmorphic syndrome known as Cornelia de Lange Syndrome (CDL) which is characterized by distinctive facial features (low anterior hairline, sinofris, antennal nostrils, progantism in the maxilla, mouth in tent), delay in prenatal and postnatal development, mental retardation and, often but not always abnormalities in the upper limbs. There are also rare cases in which CDL is present in association with contrombocytopenia. The gene for CDL has been mapped by linkage to 3q26.3 (OMIM # 122470). The Xchd intervention in the Xenopus front model and the nervous system causes CHD to develop in candidate genes. The mapping of CHD in the appropriate region of chromosome 3. It is very close to THPO, and eliminations that encompass both THPO and CHD could result in rare cases of thrombocytopenia and development of abnormalities. In situ analysis of CD revealed that almost all adult tissues are negative for the expression of CHD, the only positive signal was observed in the dividing line when developing the synovial joints that are formed between the femoral head and the acetabulum (joint axis) which implies CHD in the development and supposed growth of bones. If such a function is interrupted, growth retardation would result.

The human CHD amino acid sequence predicted from the cDNA is 50% identical (and 66% conserved) to Xchd. Of all the 40 cysteines, the 4 regions rich in cysteine are conserved. These regions rich in cysteine are similar to those observed in the factor thrombospondin, procollagen and von Willebrand. Bornstein, P. FASEB J 6: 3290-3299 (1992); Hunt, L. & Barker, W. Biochem. Biophys, Res. Commun. 144: 876-882 (1987). The CHD human locus (genomic PR0243) comprises 23 exons in 9.6 kb of genomic DNA. The initiating methionine is in exon 1 and the stop codon in exon 23. An ailated CpG is located at the 5 'end of the gene, starting approximately 100 bp in 5' of exon 1 and extending through the first exon and ends in the first intron. The THPO and CHD loci are organized into a head-to-head shape with approximately 2.2 kb that separate their transcription start sites. At the level of the protein, PR0243 is 51% identical to chordin Xenopus (Xchd). All forty cysteines in amino acid 1 and three carboxy terminal groups are conserved rich in cysteine.

PR0243 is a 954 amino acid polypeptide having an indicator sequence at residues 1 to approximately 23. There are four groupings of cysteine: (1) residues approximately 51 to 125; (2) residues about 705 to about 761; (3) residues approximately 784 to 3396, and N-glycosylation sites in residues 217, 351, 365 and 434.

The PR0299 polypeptides and portions thereof that have homology to the notch protein may be useful for therapeutic purposes in vi, as well as for several other applications. The identification of new notch proteins and related molecules may be relevant for a number of human disorders such as those that affect development. Thus the identification of new notch proteins and notch-like molecules is of special importance in that such proteins can serve as potential therapeutics for a variety of different human disorders. Such polypeptides can also play important roles in biotechnological and medical research as well as various industrial applications. As a result of this, there is particular scientific and medical interest in new molecules, such as PR0299.

The PR0323 polypeptides of the present invention which possess biological activity related to that of one or more dipeptidase proteins can be used both in vivo for therapeutic and in vitro purposes. Those skilled in the art are well aware of how to use the PR0323 polypeptides of the present invention for such purposes.

The PR0327 polypeptides of the present invention that possess activity related to that of the endogenous prolactin receptor protein can be used both in vivo for therapeutic and in vitro purposes. Those skilled in the art know well how to employ the polypeptides of the present invention for such purposes. PR0327 polypeptides that possess the ability to bind to prolactin can function both in vitro and in vivo as prolactin antagonists.

PR0233 polypeptides and portions thereof that have reductase homology may also be useful for therapeutic purposes in vivo, as well as for several other applications. The identification of new reductase proteins and related molecules may be relevant to a number of human disorders such as inflammatory diseases, organ deficiencies, arteriosclerosis, cardiac damage, infertility, birth defects, premature aging, AIDS, cancer, diabetic complications and mutations in general. Since free oxygen radicals and antioxidants seem to play important roles in a number of disease processes, the identification of new reductase and reductase-like protein molecules is of particular importance because such proteins can serve as potential therapeutics for a variety of different human disorders. Such polypeptides can also play important roles in biotechnological and medical research, as well as in various industrial applications.

As a result, there is particular scientific and medical interest in new molecules, such as PR0233.

The PR0344 polypeptides and portions thereof which have homology with complement proteins may also be useful for therapeutic purposes in vivo, as well as for several other applications. The identification of new complement proteins and related molecules may be relevant to a number of human disorders such as those that affect the inflammatory response of cells of the immune system. Thus, the identification of new molecules complement and complement-like proteins is of particular importance because such proteins can serve as potential therapeutics for a variety of different human disorders. Such polypeptides can also play important roles in biotechnological and medical research as well as in various industrial applications. As a result of this, there is particular scientific and medical interest in new molecules, such as PR0344.

The PR03 7 polypeptides of the present invention possessing biological activity related to that of cysteine-rich secretory proteins can be employed in both forms in vivo for therapeutic and in vitro purposes. Those skilled in the art know well how to employ the PR0347 polypeptides of the present invention for such purposes.

The PR0354 polypeptides of the present invention possessing biological activity related to the heavy chain inhibitor protein Inter-alpha-trypsin can be used both in vivo for therapeutic and in vitro purposes.

Those skilled in the art know well how to employ the PRO polypeptides of the present invention for such purposes.

PR0355 polypeptides and PR0355 polypeptides having homology to CRTAM may be useful for therapeutic purposes in vivo, as well as for several other applications. The identification of new molecules associated with T cells may be relevant to. a number of human disorders such as conditions that involve the immune system in general. Since the CRTAM protein elaza antibodies that play important roles in a number of disease processes, the identification of new CRTAM and cRTAM-like protein molecules is of particular importance because such proteins can serve as potential therapeutics for a variety of different disorders. humans. Such polypeptides can also play important roles in medical and biotechnological research, as well as various industrial applications. As a result of this there is particular scientific and medical interest in new molecules, such as PR0355.

PR0357 can be used in comparative binding assays with ALS to determine its activity with respect to ALS. In addition, PR0357 can be used in assays to determine if it prolongs polypeptides with which it can form complexes to have longer half-lives in vivo. PR0357 can be used similarly in tests with carboxypeptides, with which it also has homology. Therefore the results can be applied.

The PR0715 polypeptides of the present invention which possess biological activity related to that of the tumor necrosis factor protein family can both be used in vivo for therapeutic and in vitro purposes. Those skilled in the art know well how to employ the polypeptides of the present invention for such purposes. PR0715 polypeptides are expected to bind to their specific receptors, thereby activating such receptors. Variants of PR0715 polypeptides of the present invention can function as agonists or antagonists of their specific prescription activity.

PR0353 polypeptides and portions thereof that have homology to the complement protein may also be useful for therapeutic purposes in vivo, as well as for several other applications. The identification of new complement proteins and related molecules may be relevant to a number of human disorders such as affecting the immune response of cells of the immune system. A) Yes, the identification of new complement and complement-like protein molecules is of special importance because such proteins can serve as potential therapeutics for a variety of different human disorders. Such polypeptides can also play important roles in biotechnological and medical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0353.

PR0361 polypeptides and portions thereof having homology to the mucin and / or chitinin proteins may also be useful for therapeutic purposes in vivo, as well as for several other applications. The identification of new mucin and / or chitinase proteins and related molecules may be relevant for a number of human disorders such as cancer or those involving the cell surface of the molecules or receptors. Thus, the identification of novel mucin and / or chitinase proteins is of special importance because such proteins can serve as potential therapeutics for a variety of different human disorders. Such polypeptides can also play important roles in medical and biotechnological research as well as in various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0361.

PR0365 polypeptides and portions thereof that have homology to the human 2-19 protein may also be useful for therapeutic purposes in vivo, as well as for several other applications. The identification of new human proteins and related molecules can be relevant for a number of human disorders such as modulating the binding or activity of cells of the immune system. Thus, the identification of new human proteins 2-19 and similar human protein molecules 2-19- is of particular importance because such proteins can serve as potential therapeutics for a variety of different human disorders. Such polypeptides can also play important roles in biotechnological and medical research as well as in various industrial applications. As a result, there is particular scientific and medical interest in new molecules, such as PR0365.

. Anti-PRO polypeptide antibodies The present invention further provides antibodies to the anti-PRO polypeptide. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific and hetroconjugate antibodies.

A. Polyclonal antibodies Anti-PRO polypeptide antibodies can comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to those skilled in the art. Polyclonal antibodies can be produced in an example mammal, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and / or the adjuvant will be injected into the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the PROO polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to serum inhibitors of albumin, bovine thyroglobulin, and soy trpsin. Examples of adjuvants that can be employed include Freund's complete adjuvant and the MPL-TDM adjuvant (monophosphoryl of Lipid A, synthetic dichloromethane trehalose). The immunization protocol can be selected by the person skilled in the art without undue experimentation.

B. Monoclonal antibodies Anti-PRO polypeptide antibodies can alternatively be monoclonal antibodies. Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256: 495 (1975). In a hybridoma method, a mouse, a hamster, or other appropriate host animal, is typically immunized with an immunizing agent to induce lymphocytes that produce or are capable of producing antibodies that will bind specifically to the immunizing agent. Alternatively, the lymphocyte can be immunized in vitro.

The immunizing agent will typically include the PRO polypeptide of interest or a fusion protein thereof. Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusion agent, such as polyethylene glycol, to form a hybridoma cell [Gooding, Monoclonal Antibodies: Principies and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell lines are usually transformed into mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, mouse or rat myeloma cell lines are employed. The hybridoma cells can be cultured in a suitable culture medium which preferably contains one or more substances that inhibit the growth or survival of unfused, immortalized cells. For example, if the parenteral cells lack the hypoxanthine enzyme guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas will typically include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent cell growth. HGPRT- deficient.

Immortalized cell lines are those that fuse efficiently, stably support high levels of antibody expression by the selected antibody producing cells, and are sensitive to media such as HAT. More preferred immortalized cell lines are murine myeloma lines, which are obtained, for example, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Rockville, Maryland. Human myeloma and human-mouse heteromyeloma cell lines have also been described for the production of human monoclonal antibodies [Kozbor, J. Immunol. 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, 'Marcel Dekker, Inc. New York, (1987) p. 51-63].

The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against the PRO polypeptide of interest. Preferably, the binding specificity of the monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as immunoassays (RIA) or the enzyme-linked immunosorbent assay (ELISA). Such techniques and assays are known in the art. The binding affinity of monoclonal antibodies can, for example, be determined by the Scatchard analysis of Munson and Pollard, anal. Biochem., 107: 220 (1980).

After the hybridoma cells are identified, the clones can be sub-cloned by limiting dilution procedures and developed by standard methods [Goding, supra]. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMII-1640 medium. alternatively, the hybridoma cells can be developed in vivo as ascites in a mammal.

The monoclonal antibodies secreted by the subclones can be isolated or purified from the ascites culture medium or fluid by conventional immunoglobulin purification methods such as, for example, hydroxylapatite chromatography, protein A-Sepharose, gel electrophoresis, dialysis, or chromatography by affinity.

Monoclonal antibodies can also be made by recombinant DNA methods, such as the losses described in US Patent No. 4,816,567. The DNA encoding the monoclonal antibodies of the invention can easily be isolated and sequenced using conventional methods (for example by using oligonucleotide probes that are capable of specifically binding to genes encoding the heavy and light chains of murine antibodies. ). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA can be placed in expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or dimer cells that do not otherwise produce the immunoglobulin protein. , to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA can also be modified, for example, by substitution of the sequence coding for the heavy chain and light chain constant regions in place of the homologous murine sequences [US Patent No. 4,816,567; Morrison et al., Supra] or by covalently binding to the immunoglobulin encoding the sequence, all or part of the coding sequence by a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be replaced by the constant regions of an antibody of the invention, or it can be substituted by the variable regions of an antigen-combining site of an antibody of the invention to create a bivalent chimeric antibody.

- The antibodies can be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of light chain and modified heavy chain immunoglobulin. The heavy chain is truncated generally at any point of the Fe region in order to prevent cross-linking of the light chain. Alternatively, the relevant cysteine residues are substituted with another amino acid residue or are eliminated in order to prevent crosslinking.

In vi tro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be achieved using routine techniques known in the art.

C. Humanized antibodies The anti-PRO polypeptide antibodies of the invention can additionally comprise humanized antibodies or human antibodies. Humanized forms of non-human antibodies (eg, murine) are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab ', F (ab') 2 or other subsequences of antigen-binding antibodies) which contain minimal sequences derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibodies) in which residues of a complementary determinant region (CDR) of the container are replaced by residues of a CDR of non-human species (donor antibody) such as mouse, rat or rabbit which have the specificity , affinity and capacity desired. In some examples, residues of the Fv structure of human immunoglobulin are replaced by the corresponding non-human residues. Humanized antibodies can also comprise resides which none are found in the recipient antibodies or in the imported CDR or the structure of the sequences. In general, the humanized antibody will substantially comprise all or at least one, and typically two, variable regions, in which all or substantially all regions of CDR correspond to those of a non-human immunoglobulin and all or substantially all regions of FR are those of a consensus immunoglobulin sequence. The humanized antibody optimally will also comprise at least a portion of an immunoglobulin constant region (Fe), typically that of a human immunoglobulin [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332; 323-329 (1988); and Presta, Curr Op. Struct. Biol., 2: 593-596 (1992)].

Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced therein from a source that is non-human. These non-human amino acid residues are often referred to as "imported" residues, which are optionally taken from an "imported" variable region. Humanization can be essentially effected following the method of Winter et al. [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al. Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)], by substitution of rodent CDrs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are guimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable region has been replaced by the corresponding sequence from non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are replaced by residues of the analogous sites in rodent antibodies.

Human antibodies can also be produced using various techniques known in the art, which include collections with phage display [Hoogenboom and Wimer, J. Mol. Biol. 227: 381 (1991); Marks et al., J. Mol. Biol. 222: 581 (1991)]. The techniques of Colé et al. And Boerner et al. Are also available for the preparation of human monoclonal antibodies (Colé et al., Monoclonal antibodies and Cancer Therapy, Alan R. Liss, p.77 (1985) and Boerneer et al., J. Immunol. 147 (I): 86-95 (1991)].

D. Bispecific antibodies • Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificity for at least two different antigens. In the present case, one of the binding specificities is by the PRO polypeptide, the other is by any other antigen, and preferably by a cell surface protein, or receptor or receptor subunit.

Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the coexpression of two pairs of heavy chain / light chain immunoglobulins, where the two heavy chains have different specificities [Milstein and Cuello, nature, 305: 537-53 (1983 )]. Because of the orange blossom selection of heavy chain and light chain immunoglobulins, these hybridomas (guadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct biospecificity structure. The purification of the correct molecule is usually achieved by affinity chromatography steps. Similar procedures are set forth in WO 93/08829, published May 13, 1993, and in Traunecker et al., EMBO J. 10: 3655-3659 (1991).

Variable regions of antibodies with the desired binding specificities (antigen-antibody combining sites) can be fused to the immunoglobulin constant region sequences. The fusion preferably is with a heavy chain immunoglobulin constant region, comprising at least part of the axis, CH2, and CH3 regions. It is preferred to have the first heavy chain constant region (CH1) containing the necessary site for the light chain linkage presente in at least one of the fusions. The DNA encoding the heavy chain immunoglobulin fusions and, if desired, the light chain immunoglobulin, are inserted into separate expression vectors, and are co-transfected into a suitable host organism. For further details of bispecific antibody generation see, for example, Zurce et al., Methods in Enzymology, 121: 210 (1986).

E. Heteroconjugate antibodies Heteroconjugate antibodies are also within the scope of this invention. Heteroconjugate antibodies are composed of two antibodies covalently linked. Such antibodies have, for example, been proposed for targeting cells of the immune system as undesirable cells [US Pat. No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. It is contemplated that the antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins can be constructed using disulfide exchange reactions or thioether bond formation. Examples of suitable reagents for these purposes include iminothiolate and methyl-4-mercaptobutyrimidate and those discussed, for example, in US Patent No. 4,676,980. 21. Uses for the Anti-PRO Polypeptide Antibody The anti-PRO polypeptide antibodies of the invention have various uses. For example, anti-PRO polypeptide antibodies can be used in diagnostic assays for a PRO polypeptide, for example, detecting their expression in specific cells, tissues, or serum. Various diagnostic assay techniques known in the art can be used, such as comparative binding assay, direct or indirect sandwich assays and immunoprecipitation assays conducted either in heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual of Techniques. CRC Press, Inc. (11987) pp. 147-158]. The antibodies used in the diagnostic assays can be labeled with a detectable portion. The detectable portion would be able to produce, already directly or indirectly, a detectable signal. For example, the detectable portion can be a radioisotope, such as 3H, 14C, 35S, or 125I, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin, or an enzyme, such as alkaline phosphatase, beta-glucogalactosidase or horseradish peroxidase. Any method known in the art for conjugating the antibody to the detectable portion can be employed, including the methods described by Hunter et al., Nature, 144: 945 (1962).; David et al., Biochemistry, 13: 1014 (1974); Pain et al., J. Immunol-Meth., 40: 219 (1981); and Nygren, J. Histochem, and Cytochem, 30-407 (1982).

Anti-PRO polypeptide antibodies are also useful for affinity purification of the PRO polypeptide from recombinant cell cultures or natural sources. In this process, antibodies against the PRO polypeptide are immobilized on a suitable support, such as Sephadex resin or filter paper, using methods well known in the art. The immobilized antibody is then contacted with a sample containing the PRO polypeptide to be purified, and thereafter the support is washed with a suitable solvent that will substantially remove all the material in the sample except the PRO polypeptide, which is bound to the antibody. immobilized. Finally, the support is washed with another suitable solvent that will release the PRO polypeptide from the antibody.

Chordin (CHD) is a candidate gene for a dysmorphic syndrome known as Cornelia de Lange Syndrome (CDL) that is characterized by distinctive facial features (anterior line of low hair, ssinofris, nasal orifices, prognathism in the maxilla, mouth of the carp), delay in prenatal and postnatal development, mental retardation and, often but not always, abnormalities in the upper limbs. There are rare cases where CDL is presented in association with thrombocytopenia. The gene for CDL has been mapped by linkage to 3q26.3 (OMIM # 122470). Xchd (Chordin Xenopus) involves the development of CHD in complicated candidate genes in early patterns of Xenopus and nervous system development. CHD maps over the appropriate region of chromosome 3. It is very close to THPO, and eliminations involving both THPO and CHD could result in rare cases of thrombocytopenia and development of abnormalities. In situ analysis of CD revealed that almost all adult tissues are negative for CHD expression, the only positive signal that was observed in the dividing line of the development of the synovial junction forming between the femoral head and acetabulum (union axis ) that involves CHD in the development and presumable growth of long bones. Such a function, if interrupted, could result in growth retardation.

The amino acid sequence of human CHD predicted from the cDNA is 50% identical (and 66% conserved) to Xchd. All forty cysteines from the 4 regions rich in cysteine are conserved. These regions rich in cysteine are similar to those observed in the thrombospondin, procollagen and von Willebrand factors. Bornstein, P. FASEB J 6: 3290: 3299 (1992); Hunt, L. Barker, W. Biochem Biophys. Res. Commun. 144: 876-882 (1987).

Chordin PR0243 antibodies can be made which bind to the polypeptide under conditions characterized by overexpression of PR0243.

The following examples are offered for purposes of illustration only, and are not an attempt to limit the scope of the present invention in any way.

All references to patents and literature cited in the present specification are incorporated herein by reference in their entirety.

EXAMPLES Commercially available reagents mentioned in the examples were used according to the manufacturer's instructions unless otherwise indicated. The source of the cells identified in the following examples, and the product specifications, by ATCC access numbers is the American Type Culture Collection, Rockville, Maryland.

EXAMPLE 1: Screening by Homology of Extracellular Regions to Identify New Polypeptides and cDNA encoding them.

The sequences of extracellular regions (ECD) (which include the indicator report sequence, if any) of approximately 950 known secreted proteins from the Swiss-Prot public database were used to investigate EST databases. EST databases include public databases (eg, Daayoff, Genbank), and proprietary databases (eg LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The investigation was carried out using the BLAST and BLAST2 computation programs (Altschul and Gish, Methods in Enzyzymology 266: 460-480 (1996) as a comparison of the sequences of ECD proteins up to a translation structure 6 of the EST sequences. These comparisons with a BLAST score of 70 (or in some cases 90) or greater than those that did not encode known proteins were agglomerated and joined in consensus DNA sequences with the "phrap" program (Phil Green, University of Washington, Seattle, WA; (http: / bozeman .mbt .wshington.edu / phrap.docs / phrap.html).

Using this homology structure of extracellular regions, consensuss DNA sequences were co-assembled in relation to other EST sequences identified using phrap. In addition, the consensus DNA sequences obtained were often (but not always) extended using repeated cycles of BLAST and phraap to extend the consensus sequence as much as possible, using the sources of the EST sequences discussed above.

Based on the consensus sequences obtained as described above, oligonucleotides were then synthesized and used to identify by PCR a stock of cDNA which contained the sequence of interest and for use as a probe to isolate a clone of the total extension coding sequence for a polypeptide. PRO. Front (.f) and reverse (.r) PCR primers generally in the range of 20 to 30 nucleotides and are often designated to give a PCR product of approximately 100-1000 bp in length. The probe (.p) sequences are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1- 1.5 kbp. In order to screen several collections for a full extension clone, the DNA of the collections was screened by PCR amplification, as by Ausubel et al., Current Protocols in Molecular Biology, with the PCR primer pair. A positive pool was then used to isolate clones that encode the gene of interest using the probe oligonucleotide and one of the primer pairs.

The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligodT containing a NotI site, bound directly to the hemicinized Sali adapters, divided with NotI, appropriately divided by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector (such as pRKB or pRKD; pRKB is a precursor of PRK5D that does not contain the Sfil site, see Holmes et al., Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.

EXAMPLE 2: Isolation of cDNA clones by amylase screening 1. Preparation of oligo dT priming of the cDNA stock mRNA was isolated from a human tissue of interest using reagents and protocols from Invritogen, San Diego, CA (Fast Track 2). This RNA was used to generate a primed oligo dT from the cDNA pool in the pRK5D vector using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). In this procedure, the double-stranded cDNA was selected for sizes greater than 1000 bp and the cDNA bound to Sall / Notl was cloned into the divided vetor Xhol / Notl. PRK5D is a cloning vector having an sp6 transcription initiation site followed by a Sfil restriction enzyme site that precedes the cloning sites of the Xhol / Notl cDNA. 2. Preparation of cDNA stock randomly primed A secondary cDNA pool was generated in order to preferentially represent the 5 'end of the primary cDNA clones. Sp6 RNA was generated from the primary pool (described above), and this RNA was used to generate a pool of orange-blossomed cDNA in the vector pSST-AMY.O using reagents and protocols from Life Technologies (Super Script Plasmid System, mentioned above) . In this procedure, the double-stranded cDNA was selected for size of 500-1000 bp, bound directly to the NotI adapters, divided with SIIII, and cloned into the divided SfilI / NotII vector. PSST-AMY.O is a cloning vector that has a yeast alcohol promoter dehydrogenase that precedes the cloning sites of the cDNA and the mouse amylase sequence (the natural sequence without the secretion signal) followed by the yeast alcohol dehydrogenase terminator, after the cloning sites. Thus, cDNAs cloned in this vector that are fused in structure with the amylase sequence will lead to the secretion of amylase from appropriately transfected yeast colonies. 3. Transformation and Detection The DNA of the stock described in paragraph 2 above was chilled on ice to which was added electrocompetent DH10B bacteria (Life Technologies, 20 ml). The mixture of bacteria and vector was then electroporated as recommended by the manufacturer. Subsequently, SOC medium (Life Technologies, 1 ml) was added and the mixture was incubated at 37 ° C for 30 minutes. The transformants were then plated on 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37 ° C). The positive colonies were scraped from the plates and the DNA was isolated from the bacterial paste using standard protocols, for example, gradient of ClCs. The purified DNA was then carried over the protocols of subsequent yeast.

The yeast methods were divided into three categories: (1) Transformation of the yeast with the combined plasmid / cDNA vector; (2) Detection and isolation of amylase-secreting yeast clones; and (3) PCR amplification of the insert directly from the yeast colony and DNA purification for sequencing and further analysis.

The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotype: MAT alpha, ura3-52, leu2-3, leu2-112, his3-ll, his3-15, MAL *, SUC *, GAL *. Preferably, mutant yeasts can be used that have poor post-translational performance. Such mutants can have translocation of alleles deficient in sec71, sec72, sec62, with truncated sec71 which is most preferred. Alternatively, antagonists (including antisense and / or ligand nucleotides) which interfere with the normal operation of these genes, other proteins involved in this post-translational procedure may also be preferably employed in combination with the yeast expressing the amylase.

The transformation was carried out based on the protocol outlined by Gietz et al., Nucí. Acid Res., 20: 1425 (1992). Transformed cells were then inoculated from agar in broth of YEPD compmedium (100 ML) and grown overnight at 30 ° c. The YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). The overnight culture was then diluted to approximately 2 X 106 cells / ml (approximately OD600 = 0.1) in freshly prepared YEPD broth (500 ml) and re-developed to 1 X 107 cells / ml (approx OD6oo = 0.4-0 -5) .

The cells were then harvested and prepared for transformation by transfer in GS3 rotating bottles in a Sorval GS3 rotor at 5,000 rpm for 5 minutes, the supernatant discharged, and then resuspended in sterile water, and centrifuged again in 50 ml tubes at 3500 rpm. in a Beckman GS-6KR centrifuge. The supernatant was discharged and the cells were subsequently washed with LiAc / TE (10 ml, 10 mM Tris-HCL, 1 mM EDTA pH 7.5, 100 mM LÍ200CH3), and resuspended in LiAc / TE (2.5 ml).

Transformation took place by mixing the prepared cells (100 μl) with freshly denatured single-strand salmon testis DNA (Lofstrand Labs., Gaitherssburg, MD) and transforming the DNA (1 8g, vol <10 μl) in microfuge tubes. The mixture was mixed briefly by vortex, then 40% PEG / TE (600 μl, 40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM LICH200 CH3, pH 7.5) were added. This mixture was gently mixed and incubated at 30 ° C while stirring for 30 minutes. The cells were then heated abruptly at 42 ° C for 15 minutes, and the reaction vessel centrifuged in a microfuge at 12,000 rpm for 5-10 seconds, decanted and resuspended in TE (500 μl, 10 mM Tris-HCL, lmM EDTA pH 7.5) followed by recentrifugation. The cells were then diluted in TE (1 ml) and aliquots (200 μl) were spread on the selective media previously prepared in 15 mm growth plates (VWR).

Alternatively, instead of multiple small reactions, the transformation was effected using a single, large-scale reaction, in which the amounts of reagents were conveniently staggered.

The selective medium used was a synthetic complete dextrose agar lacking uracil (SCD-Ura) prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994). The transformants were developed at 30 ° C for 2- 3 days.

The detection of amylase-secreting colonies was carried out by inclusion of red starch in the selective growth emdio. The starch was coupled to the red dye (reagent Red-120, Sigma)) by means of the procedure described by Biely et al., Anal. Biochem. 172: 176-179 (1988). The coupled starch was incorporated into the SCD-Ura Agar plates at a final concentration of 0.15% (w / v), and was regulated with potassium phosphate at a pH of 7.0 (50-100 mM final concentration).

The positive colonies were minced and traced on freshly prepared culture medium (on 150 mm plates) in order to obtain well isolated and identifiable colonies alone. Well isolated and single colonies positive for amylase secretion were detected by direct incorporation of red starch on SCD-Ura regulated agar. The positive colonies were determined by their ability to destroy the resulting starch in a clear halo around the positive colony directly visualized. 4. DNA isolation by PCR amplification When a positive colony was isolated, a portion of it was chopped "by one gram and diluted in sterile water (30 μl) in a 96-well plate.At this time, the positive colonies were either frozen and stored for subsequent or immediately amplified analysis An aliquot of cells (5 μl) was used as a hardened PCR reaction in a 25 μl volume containing: 0.5 μl Klentaq (Clontech, Palo Alto, CA), 4.0 μl 10 mM dNTP's (Perkin Elmer-Cetus), 2.5 μl of Kentaq regulator (Clontech), 0.25 μl of forward oligo 1, 0.25 μl of inverse oligo 2, 12.5 μl of distilled water The sequence of forward oligonucleotide 1 was: 'TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT-3' [SEQ ID NO: 16) The reverse oligonucleotide 2 sequence was: '-CAGGAAACAGCTATGACCACCTGCACACCTGCAAATCCATT-3' (SEQ ID NO: 17) The PCR was then carried out as follows: to. Denaturation, 92 ° C, 5 minutes b. 3 cycles of: denaturation, 92 ° C, 30 seconds; cooling, 59 ° C, 30 seconds; extended, 72 ° C, 60 seconds c. 3 cycles of: denaturation, 92 ° C, 30 seconds; cooling, 57 ° C, 30 seconds; extended, 72 ° C, 60 seconds d. 25 cycles of: denaturation, 92 ° C, 30 seconds; cooling, 55 ° C, 30 seconds; extended, 72 ° C, 60 seconds and. Store, 4 ° C.

The underlined regions of the oligonucleotides cooled in the ADH promoter region and the amylase region, respectively, and the amplified region at 307 bp of the pST-AMY vector when the insert was not present. Typically, the first 18 nucleotides of the 5 'end of these oligonucleotides contained in cooling sites for the sequencing primers. Thus, the total product of the PCR reaction of an empty vector was 343 bp. However, the reporter sequence fused to the cDNA resulted in considerably longer nucleotide sequences.

Continuing with the PCR, one liter of the reaction (5 μl) was examined by electrophoresis on agarose gel on a 1% agarose gel using Tris-borate-EDTA (TBE) regulating the system as described in Sambrook et al. supra. Clones that resulted in a single strong PCR product larger than 400 bp were further analyzed by DNA sequence formation after purification with a Qiaquick PCR 96 Column (Qiagen Inc. Chatsworth, CA).

EXAMPLE 3: Isolation of cDNA Clones Encoding Human PR0241.

A DNA consensus sequence was linked relatively to other EST sequences as described in Example 1 above. This consensus sequence is designated in the present DNA30876. Based on the DNA30876 consensus sequence, the oligonucleotide was synthesized; 1) to identify by PCR a cDNA cDNA containing the sequence of interest, and 2) to be used as probes to isolate a clone of the full length coding sequence for PR0241.

PCR primers (forward and reverse) were synthesized: Primer for front PCR: '-GGAAATGAGTGCAAACCCTC-3 '(SEQ ID NO: 3) Primer for reverse PCR: '-TCCCAAGCTAACACTATTCTGC-3 '(SEQ ID NO: 4) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA30876 consensus sequence that had the following nucleotide sequence: Hybridization probe 'GGGGGTGACGGTGTTCCATATCAGAATTGCAGAAGCAAAACTGACCTCAG TT-3' (SEQ ID NO: 5) In order to screen several collections for a source of full extension clones, the DNA of the stock was screened by PCR amplification with the primer pair for PCR identified above. A positive stock was then used to isolate clones encoding the PR0241 gene using the oligonucleotide probe and one of the primers for PCR. RNA for construction of cDNA aceervos was stained from human fetal kidney tissue (LIB29).

The formation of DNA sequences of the isolated clones as described above gave the full length DNA sequence for PR0241 [herein designated as UNQ215 (DNA34392-1179)] (SEQ ID NO: 1) and the derived protein sequence for PR0241.

The complete nucleotide sequence of UNQ2155 (DNAA34392-1170) is shown in Figure 1 (SEQ ID NO: 1). The clone UNQ215 (DNA34392-1170) contains a single-opening reading structure with a translational initiation site apareentee at the nucleotides at position 234-236 and ending at the stop codon at the positions of nucleotides 1371-1373 ( Figure 1) . The precursor of the aforementioned polypeptide has 379 amino acid extension (Figure 2). The total extension protein PR0241 set forth in Figure 2 has an estimated molecular weight of 43,302 daltons and a pH of about 7.30. The clone UNQ215 (DNA34392-1170) has been deposited with ATCC and assigned the no. ATCC deposit ATCC 209526.

Analysis of the amino acid sequence of the full-length PR0241 polypeptide suggests that it possesses significant homology with several proteoglycan proteins biglycans, thus indicating that PR0241 is a new polypeptide homolog biglycan.

EXAMPLE 4: Isolation of cDNA clones encoding human PR0243 by the Genomic Procedure Introduction: Human thrombopoietin (THPO) is a glycosylated hormone of 352 amino acids consisting of two regions. The N-terminal region, sharing 50% similarity with erythropoietin, is responsible for the biological activity. The C-terminal region is required for secretion. The gene for thrombopoietin (THPO) maps to the human chromosome 3q27-q28 where the 6 exons of this gene extend over 7 pairs of kilosbase of genomic DNA (Gurney et al., Blood 85: 981-988 (1995).) if there is a gene encoding the THPO homologs located in close proximity to THPO, genomic DNA fragments from this region were identified and sequenced.Three cl clones Pl and one clone PAC (Genome Systems Inc., St. Louis, MO; Nos. Pl-2535"and PAC-6539) encompassing the THPO locus were isolated and a 140-kb region was sequenced using the strategy known as shotgun (Chen et al., Genomics 17: 651-656 (1993)), coupled with PCR based on filling approximately one space, the analysis reveals that the region is gene-enriched with four additional genes located very close to THPO, the receptor type I-tumor necrosis factor associated with the protein _ 2 (TRAP2) and the elongation initiation factor g amma (elF4g), channel 2 chloride (CLCN2) RNA polymerase II subunit hRPB17. While non-homologous THPO was found in the region, four new genes have been predicted by computer-supported gene detection (GRAIL) (Xu et al., Gen. Engin., 16: 241-253 (1994)), the presence of CpG islets. (Cross, S. Y Bird, A. Curr. Opin. Genet. &; Devel. 5: 109-314 (1995), and homology of known genes (as detected by WU-BLAST2.0)) (Altschul and Gish, Methods enzymol. 266: 460-480 (1996) (http: // blast. Ustl edu / blast / README .html).

Pl and PAC clones: The initial human Pl clone was isolated from a pool of genomic Pl (Genoma Systems Inc., St. Louis, MO, cat. No. Pl-2535) screened with PCR primers designated from the THPO genomic sequence ( AI, Gurney, et al., Blood 85: 981-88 (1995). The primers for PCR were designated from the end of the sequences derived from this Plfueron clone then used to screen PI and PAC libraries (Genome Systems, Cat. .; Pl-2535 &PAC-6539) to identify overlapping clones.

Strategy called Shotgun: The Shotgun Strategy (OSS) (Chen et al., Genomics 17: 651-656 (1993)) involves mapping and sequencing large clones of genomic DNA with a hierarchical approach. Pl or PAC clones were sonicated and fragments subcloned into the lambda vector (? Buestar) (Novagen, Inc., madison, Wl; cat.no. 69242-3). The lambda subclone inserts were isolated by wide-range PCR (Barnes, W. Proc. Nati, Acad. Sci. USA 91: 2216-2220 (1994) and the sequenced ends.The sequences at the lambda ends were superimposed to create a partial map of the original clone The lambda clones with the superimposed end sequences were identified, the inserts subcloned in a plasmid vector (pUC9 or pUCld) and the ends of the plasmid subclones were sequenced and combined to generate a contiguous sequence. Structured sequence formation minimizes the redundancy required while retaining one to explore for and concentrate regions of interest.

In order to better define the THPO locus and investigate for other genes related to hematopoietin family, four genomic clones were isolated from this region by PCR screening of the human PAC and PAC assemblages (Genome System, Inc., Cat. Nos .: Pl- 2535 and PAC-6539). The sizes of the genomic fragments are as follows: Pl.t is 40 kb; Pl. g is 70 kb; Pl.u is 70 kb; and PAC.z is 200 kb. The relationship between these four clones is illustrated in Figure 5. Approximately 80% of the 200 kb of the genomic DNA region was sequenced by the strategy called Shotgun (OSS) (Chen et al., Genomics 17: 651-56 (1993 ), and assembled into groups using the AutoAssembler ™ (Aapplied Biosystems, Perkin Elmer, Foster City, CA, cat.No. 903227.) The preliminary order of these groups was determined by manual analysis, 46 groups were employed and filled in the spaces Table 2 concentrates the number and size of the spaces.

Table Summary of the spaces in the 140 kb region Space size Number < 50 bp 13 50- 150 bp 150-300 bp 300- 1000 bp 10 1000- 5000 bp > 5000 bp (15,000 bp) DNA sequence formation: The ABI DYE-primer ™ (Applied Biosystems, Foster City, CA; CA; Cat. No .: 402112) guímico product was used at the end of the sequence of the lambda and plasmid subclones. The chemical ABI DYE-terminator ™ (PE Applied Biosystems, Foster City, CA, Cat. No .: 403044) was used to sequence the PCR products with their respective PCR primers. The sequences were collected with an ABI377 instrument. For PCR products larger than 1 kb, the primers procedure was used. The sequences of the groups generated by the OSS strategy in an AutoAssembler ™ (PE applied Biosystems, Foster City, CA, Cat. No .: 903227) and the traces of rows forming the sequences filling spaces were imported into Sequencher ™ (Gene Codes). Corp., Ann Harbor, MI) by overlap and editing.

PCR-based space filling strategy: The primers were designated based on the 5 'and 3' extermos sequenced from each group, avoiding repetitive and low quality regions of the sequence. All primers were mentioned to be 19-24 months with 50-70% G / C content. The oligos were synthesized and gel purified by standard methods.

Since the orientation and order of the groups were unknown, permutations of the primers were used in the amplification reactions. Two PCR products were used; first XL PCR equipment (perkin elmer, Norwalk, CT; Cat. No .: N80802205), with time extensions of approximately 10 minutes: and secondly, the Taq polymerase PCR equipment (Qiagen Inc., Valencia, CA; Cat. : 201223) was used under conditions of high severity if impurities or multiple products were observed with the XL PCR equipment. The main PCR product of each successful reaction was extracted from a 0.9% low-melting agarose gel and purified with the GeneClean DNA Purification kit before forming the sequences.

Analysis: The identification and characterization of coding regions was carried out as follows: First, the respective sequences were disguised using the RepeatMasker (AFA Smit &P. Green, http // ftp. Genome .Washington. Edu / RM / RM_details. html) that screens DNA sequences in FastA format against a collection of repetitive elements and returns a covert dubious sequence. Non-concealed repeats were identified by comparison of the sequence in the GenBank database using WUBLAST (Altschul, S &Gish, W., Methods Enzymol 266: 460-480 (1996) and were manually coverted.

Then the known genes were revealed by comparing the genomic regions against proteins from the Genentech database using the WUBLAST2.0 algorithm and annotated it by aligning the sequences of 'genomic cDNA for each gene, respectively, using an algorithm of Needleman-Wunch (Needleman and Wunsch, J. Mol. Biol .. 48: 443-453 (1970) to find regions of local identity between sequences that are otherwise widely dissimilar.) The strategy resulted in the detection of all exons of the five known genes in the region, THPO, TRAP2, elF4g, CLCN2 and hRPB17 (Table 3).

Table 3 Brief description of the known genes in the 140 kb region analyzed Known genes Position on the map Gamma factor 4 initiation 3q27-qter Eukaryotic translation Thrombopoietin 3q26-q27 Table 3 (continued) Known genes Position on the map Channel 2 chloride 3q26-qter Associated TNF receptor not mapped to protein 2 previously subunit hRPB17 of non-mapped RNA polymerase II previous Finally, new transcription units were predicted using a number of approximations. The CpG islets (S. Cross &Bird, A., Curr Opin. Genet Dev. 5: 109-314 (1995) were used to define promoter regions and were identified as agglomerations of cleavage sites by enzymes that recognize G- C-enriched, 6 6 8 mer palidromic sequences CpG islets are usually associated with gene promoter regions WUBLAST analysis of short genomic regions (10-20 kb) versus Genbank have revealed pairing to ESTs. or where possible, its sequence chromatogram rows) were recovered and combined with the Seguencher to provide a theoretical cDNA sequence (designated herein as DNA344115). The GRAIL2 program (ApoCom Inc., Knoxville, TN, version of the master line for DEC alpha) to predict a new exon.The five known genes in the region served as internal controls for the success of the GRAIL algorithm.

Isolation: chordin cDNA clones were isolated from a human fetal lung pool of oligo-dT-primed human Eel poly * human fetal lung RNA was purchased from Clontech (cat # 6528-1, lot # 43777) and 5 mg used for construct a cDNA library in pKKR5B (Genentecch, LIBB26). The 3 'primer (PGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTT) (SEQ ID NO: 8) and the 5'-junction (PCGGACGCGTGGGGCCGTCGCACCCAGCT) (SEQ ID NO: 9) were designated to introduce SalI and NotI restriction sites. The clones were screened with oligonucleotide probes designated from the putative human chordin cDNA sequence (DNA34415) deduced by "splicing" together with the genomic exons of geen. The lateral primers of the PCR probes were used to confirm the identity of the cDNA clones before forming the sequences.

The oligonucleotide probes screened were the following: OLI5640 34415.pl 5'- GCCCCGCCTCCCCGGAACGGGCAGCGGCTCCTTCTCAGAA-3 '(SEQ ID NO: 10) and OLI5642 34415.p2 5'- GGCGCACAGCCACGCAGCGCATCACCCCGAATGGCTTC-3 '(SEQ ID NO: eleven); and the lateral probes used were the following.

OLI5639 34415. fl 5'- GTGCTGCCCATCCGTTCTGAGAAGGA-3 '(SEQ ID NO: 12) and OLI5643 34415. r 5'- GCCAGGGTGCTCAAACAGGACAC-3 '(SEQ ID NO: 13).

EXAMPLE '5: Analysis by Northern staining and in situ RNA hybridization of PR0243 The expression of PR0243 mRNA in human tissues was examined by Northern blot analysis. Patches of I polyA + human RNA derived from adult and human fetal tissues (Clontecch, Palo Alto, CA; Cat. Nos. 7760-1 and 7756-1) were hybridized in probes of 32P-labeled cDNA fragments based on Pro2433 cDNA extension totaall. The smears were incubated with the probes in hybridization regulators (5 X SSPE, 2 X Denhardt's solution, 100 mg / ml sperm DNA extracted from denatured salmon, 50% formamide, 2% SDS) for 60 hours at 42 ° C. the spotted ones were washed several times in 2 X SSC; 0.05% SDS for 1 hour at room temperature, followed by a high severity wash 30 minutes in 0.1 X SSC; 0.1% SDS at 50 ° C and autoradiographed. The stains were developed after exposure overnight by phosphorus (Fuji) imaging analysis.

As shown in Fig. 6 the transcripts of the PR0243 mRNA were detected. Analysis of 1 expression pattern exposed the stronger than expected signal transcribed from 44.0 kb in adult and fetal liver and a very light I signal in the adult kidney Brain, lung, and fetal kidney were negative, as it was in heart, brain , lung and adult pancreas. Small transcripts were observed in placenta (2.0 kb), adult skeletal muscle (1.8 kb) and fetal liver (2.0 kb).

In situ hybridization of human adult tissue from PR0243 gave a positive signal in the line dividing the development of the synovial joint that forms between the femoral head and the acetabulum. All other tissues were negative. Additional sections of face, head, human fecal limbs and mouse embryos were examined. The expression in human fetal tissues was observed adjacent in the development of limbs and facial bones in the periosteal mesenchyme. The expression was highly specific and was often adjacent to areas subject to vascularization. The expression was also observed in the development of the temporal and occipital lobes of the fetal brain, but was not observed elsewhere in the brain. In addition, the expression was seen in the ganglion of the development of the inner ear. No expression was seen in any of the mouse tissues with the human probes (see figure 7).

In situ hybridization was carried out using an optimized protocol, using PCR-generant of labeled 33P riboprobes. (Lu and Gillet, Cell Vision 1: 169-176 (1994)). Fetal human and adult tissues fixed to formalin, embedded with paraffin were sectioned, deparaffinized, deproteinated in proteinase K (220 g / ml) for 15 minutes at -37 ° C and further processed by in situ hybridization as described in Lu et al. Gillet (1994). An [33 P] -UTP-labeled antisense riboprobe was generated from the PCR product and hybridized overnight at 55 ° C. The plates were submerged in the Kodak NTB2 nuclear emulsion track and exposed for 4 weeks.

EXAMPLE 6: Isolation of cDNA Clones Encoding Human PR0299 A cDNA sequence designated in the presente as DNA28847 (Figure 10; SEQ ID NO: 18) was isolated as described in Example 2 above. After further analysis, a truncated 3 'version of DNA28847 was found and designated DNA35877 (Figure 11; SEQ ID NO: 19). Based on the sequence of DNA35877, the oligonucleotides were synthesized: 1) to identify by PCR a stock of cDNA containing the sequence of interest, and 2) to be used as probes to isolate a clone of the total extension coding sequence for PR0299. Primers for front and rear PCR are generally in the range of 20 to 30 nucleotides and are often designated to give a PCR product of approximately 100-1000 bp in length. The probe sequences are typically 40-55 bp in extension. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than approximately 1- 1.5 kbp. In order to screen several collections for a full extension clone, DNA from the collections was screened by PCR amplification, as by Ausubel et al., Current Protocols in Molecular Biology, with the PCR primer pair. A positive pool was then used to isolate clones that encode the gene of interest using the oligonucleotide probe and one of the primer pairs The forward and reverse PCR primers were synthesized: Front PCR Primer (35877 .fl) '-CTCTGGAAGGTCACGGCCACAGG-3 '(SEQ ID NO: 20) Reverse PCR primer (35877, rl '-CTCAGTTCGGTTGGCAAAGCTCTC-3 '(SEQ ID NO: 21) Additionally, a synthetic hybridization oligonucleotide probe was constructed from the DNA sequence 35877 which had the following nucleotide sequence.

Hybridization probe (35877.pl) 5 'CAGTGCTCCCTCATAGATGGACGAAAGTGTGACCCCCCTTTCAGGCGAGA GCTTTGCCAACCGAACTGA-3' (SEQ ID NO: 22) In order to screen several collections for a source of a full-length clone, DNA from the collections was screened by PCR amplification with one of the pairs of PCR primers identified above. A positive stock was then used to isolate clones encoding the PR0299 sequence using the probe oligonucleotide.

RNA for construction of cDNA stocks was isolated from human fetal brain tissues. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, bound to the Sali hemicinase adapter, divided with NotI, suitably measured by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector (such as pRKB or pRKD; is a precursor of pRK5D that does not contain the Sffil site, see Holmes, et al., Science, 253: 1278-1280 (1991)) in the only Xhol and Notl sites.

The formation of DNA sequences of the isolated clones as described above gave the full-length DNA sequence for PR0299 [herein designated as UNQ262 (DNA39976-1215)] (SEQ ID NO: 14) and the desired protein sequence for PR.0 299.

The complete nucleotide sequence of UNQ262 (DNA39976-1215) is set forth in Figure 8 (SEQ ID NO: 14). The clone UNQ262 (DNA39976-1215) contains a structure of a single reading aperture with an apparent translational initiation site at nucleotides at position 111-113 and ending at the stop codon at nucleotides at position 2322-2324 (FIG. ). The predicted polypeptide precursor is in the extension of amino acid 737 (Figure 9). Important regions r of the polypeptide sequence encoded by clone UNQ262 (DNA39976-1215) have been identified and include the following. A reporter polypeptide corresponding to amino acids 1-28, a putative transmembrane region corresponding to amino acids 638-662, 10 EGF repeats, corresponding to amino acids 80-106, 121-203, 336- 360, 378- '415 , 415. 441, 454- 490, 491- 528, 529-548, 567-604, and 605-622, respectively, and 10 potential N-glycosylation sites, corresponding to amino acids 107-120, 204-207, 208 - 222, 223-285, 286-304, 361-37, 375-377, 442-453, 549-56, and 564-56, respectively. The clone unq262 (dna39976- 1215) has been deposited with ATCC and assigned the deposit No. ATCC 209524.

Analysis of the amino acid sequence of the full length PR0299 polypeptide suggests that portions of it have significant homology to the notch protein, thus indicating that PR0299 may be a new homolog of the notch protein and has typical protein activity notch. .

EXAMPLE 7: Isolation of cDNA clones encoding human PR0323 A DNA consensus sequence was linked in relation to other EST sequences as described in Example 1 above. This consensus sequence is designated in the present DNA330875. Based on the DNA330875 consensus sequence, the oligonucleotide was synthesized: 1) to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a full length sequence clone encoding PR0323.

The primers (two forwards and one inverse) were synthesized: PCR Primer 1: '- AGTTCTGGTCCAGCCTATGTGCC-3 '(SEQ ID NO: 25) PCR Primer 2: '-CGTGATTGGTGTCTTTGTCCATGGG.3 '(SEQ ID NO: 26) Reverse PCR primer: '-CTCCACCAATCCCGATGAACTTGG-3 '(SEQ ID NO: 27) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA30875 consensus sequence that had the following nucleotide sequence Hybridization probe '-GAGCAGATTGACCTCATACGCCGCATGTGTGCCTCCTATT CTGAGCTGGA-3 '(SEQ ID NO: 11) In order to screen multiple pools for a source of a full-length clone, DNA from the pools was screened by PCR ampolification with the pair of PCR primers identified above . A positive stock was then used to isolate the clones encoding the PR0323 gene using the oligonucleotide probe and one of the PCR primers. RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB6). The DNA-forming sequences of the isolated clones as described above gave the full-length DNA sequence for PR0323. [designated herein as UNQ284 (DNA35595-1228)] (SEQ ID NO: 23) and the protein sequence derived for PR0323.

The complete nucleotide sequence of UNQ284 (DNA35595-1228) is set forth in Figure 12 (SEQ ID NO: 23). The clone UNQ284 (DNA35595-1228) contains a single-opening reading structure with an apparent translational initiation site at nucleotides at position 110-112 and ending at the stop codon at nucleotides at position 1409-1411 (Figure 12). ). The predicted polypeptide precursor is in the extension of amino acid 433 (Figure 13). The PR0323 protein of full extension is shown in Figure 13 has an estimated molecular weight of about 47,787 daltons and a pll of about 6.11. The clone UNQ284 (DNA35595-1228) has been deposited with ATCC and assigned the deposit No. 209528.

Analysis of the amino acid sequence of the full-length PR0323 polypeptide suggests that portions thereof possess significant homology to various dipeptidase proteins, thus indicating that PR0323 may be a novel dipeptidase protein.

EXAMPLE 8: Isolation of cDNA Clones Encoding Human PR0327 An expressed tag sequence (EST) DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) was invested and several EST sequences were identified that showed certain degrees of homology with the human prolactin receptor protein. These EST sequences were aligned using phrap and a consensus sequence was obtained. This consensus DNA sequence was then extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of the EST sequences discussed above. The extended assembled sequence is designated in the present DNA38110. Previous investigations were performed using the BLAST or BLAST2 computation program (Alsshul et al., Methods in Enzymology 266: 460-480 (1996)). Comparisons that resulted from a BLAST score of 70 (or in some cases 90) or greater than those that did not encode known proteins were agglomerated and matched in DNA consensus sequences with the "phrap" program (Phil Green, University of Washington, Seattle, Washington; http: /bozeman.mbt .Washington.edu/ phrap.docs / phrap.html).

Based on the DNA38110 consensus sequence obtained as described above, oligonucleotides were synthesized: 1) to identify by PCR a stock of cDNA containing the sequence of interest, and 2) to be used as probes to isolate a clone from the extension sequence total that codes for PR0327.

The primers (forward and reverse) were synthesized as follows: Front PCR primer: 'CCCGCCCGACGTGCACGTGAGCC-3 '(SEQ ID NO: 33) Reverse PCR primer '-TGAGCCAGCCCAGGAACTGCTTG-3 '(SEQ ID NO: 34) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA38110 consensus sequence which had the following nucleotide sequence: Hybridization probe 'CAAGTGCGCTGCAACCCCCTTTGGCATCTATGGCTCCAAGAAAAGCCGGG AT-3 '(SEQ ID NO: 35) In order to screen several collections for a source of total extension clones, DNA from the collections was screened by PCR amplification with the pair of PCR primers identified above. A positive pool was then used to isolate clones encoding PR0327 using the oligonucleotide probe and one of the PCR primers, RNA for construction of the cDNA pools was isolated from human fetal pumeloon tissue (LIB26).

The formation of DNA sequences of the isolated cco clones or described above gave the full length DNA sequences for PR0327 [in the present designated as UNQ288 (DNA38113-1230)] (SEQ ID NO: 16) and the protein sequence derivative for PR0327.

The complete nucleotide sequence of UNQ288 (DNA38113-1230) is shown in Figure 16 (SEQ ID NO: 3). The clone UNQ288 (DNA38113-1230) contains a structure with a single reading opening with an apparent transcriptional initiation site at the position of nucleotides 119-121 and ending at the stop codon at the position of nucleotides 1385-1387 ( Figure 16). The predicted polypeptide precursor is 422 amino acids in length (Figure 17). The protein PR0327 of total extension set forth in Figure 17 had an estimated molecular weight of approximately 46,302 daltons and a pl of approximately 9.42. The clone UNQ288 (DNA38113-1230) has been deposited with ATCC, it was assigned the no. ATCC deposit 209530.

Analysis of the amino acid sequence of the full-length PR0327 polypeptide suggests that it possesses significant homology to the human prolactin receptor protein, thus indicating that PR0327 may be a novel prolactin-binding protein.

EXAMPLE 9: Isolation of cDNA Clones Encoding Human PR0233 A consensuss DNA sequence was linked in relation to other EST sequences as described in Example 1 above. This consensus sequence is designated in the present DNA30945. Based on the DNA30945 consensus sequence, oligonucleotides were synthesized. l) to identify by PCR a stock of cDNA which contained the sequence of interest, and 2) to be used as probes to isolate a clone from the total coding sequence of PR0233.

PCR primers were synthesized as follows: Front PCR primer: '-GGTGAAGGCAGAAATTGGAGATG-3 '(SEQ ID NO: 38) Reverse PCR primer: '-ATCCCATGCATCAGCCTGTTTACC-3 '(SEQ ID NO: 39) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA30945 consensus sequence that had the following nucleotide sequence Hybridization probe '-GCTGGTGTAGTCTATACATCAGATTTGTTTGCTACACAAGATCCTGAC-3' (SEQ ID NO: 40) In order to screen several collections for a source of a full-length clone, DNA from the collections was screened by PCR amplification with the pair of PCR primers identified above. A positive pool was then used to isolate clones encoding the PR0233 gene using the probe oligonucleotide. RNA for construction of cDNA stocks was isolated from human fetal brain tissue.

The formation of DNA sequences of the isolated clones as described above gave the full-length DNA sequence for PR0233 [in the presnete designated as UNQ207 (DNA34436-1238)] (SEQ ID NO: 36) and the derived protein sequence for PR0233.

The complete nucleotide sequence of UNQ207 (DNA34436-1238) is set forth in Figure 18 (SEQ ID NO: 36). The clone UNQ207 (DNA34436-1238) contains a structure of a single reading aperture with a translational initiation site apparent at the position of nucleotides 101-103 and ending at the stop codon at the position of nucleotides 1001-1003 ( figure 8) '. The predicted polypeptide precursor is 300 amino acids in length (Figure 19). The total extension protein PR0233 shown in Figure 19 had an estimated molecular weight of approximately 32, 964 daltons and a pl of approximately 9.52. In addition, regions of interest that include the indicator peptide and a putative oxidoreductase site are designated in Figure 19. Clone UNQ2207 (DNA34436-1238)) has been deposited with ATCC and assigned no. of deposit ATCC 209523.

Analysis of the amino acid sequence of the full-length PR0233 polypeptide suggests that portions of it have significant homology with several reductase proteins, thereby indicating that PR0233 may be a new reductase.

EXAMPLE 10: Isolation of the cDNA Clones encoding the Human PR0344 A DNA consensus sequence was linked in relation to other EST sequences as described in Example 1 above. This consensus sequence is in the present designated DNA34398. based on consensus DNA34398 sequences, oligonucleotides were synthesized: l) to identify by PCR a stock of cDNA that contained the sequence of interest, and 2) to be used as probes to isolate a clone of the total coding sequence sequence of PR0344 .

Based on the DNA34398 consensus sequence, forward and reverse PCR primers were synthesized as follows: Front PCR primer (34398. fl) '- TACAGGCCCAGTCAGGACCAGGGG-3 '(SED ID No. 43¡ Front PCR primer (34398. f2) '- AGCCAGCCTCGCTCTCGG-3 '(SEQ ID NO: 44) Front PCR primer (34398. f3) '- GTCTGCGATCAGGTCTGG-3 '(SEQ ID NO: 45) Reverse PCR primer (34398. rl) '- GAAAAGAGGCAATGGATTCGC- 3 '(SEQ ID NO: 46) Reverse PCR primer (34398. r2) GACTTACACTTGCCAGCACAGCAC- 3 '(SEQ ID NO: 47) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA34398 consensus sequence which had the following nucleotide sequence: '-GGAGGGGCACCACCAACTGGAGGGTCCGGAGTAGCGAGCGCCCCGAAG-3' (SEQ ID NO: 48) In order to screen several collections for a source of a full extension clone, the DNA of the stock was screened by PCR amplification with one of the pairs of PCR primers identified above. A positive pool was then used to isolate clones encoding the PR0344 genes using the oligonucleotide probe and one of the PCR primers. RNA for the construction of cDNA libraries was isolated from human fetal kidney tissue.

The formation of DNA sequences of the isolated clones as described above gave the full length DNA sequence for PR0344 herein designated as UNQ303 (DNA40592-1242)] (SEQ ID NO: 41) and the derived protein sequence.

The complete nucleotide sequence of UNQ303 (DNA440592-1242) is set forth in Figure 20 (SEQ ID NO: 41). The clone UNQ303 (DNA40592-1242) contains a structure of a single reading aperture with an apparent translational initiation site at the position of nucleotides 227-229 and ending at the stop codon at the position of nucleotides 956-958 (Figure 20). The predicted precursor polypeptide is in the extension of amino acid 243 (Figure 21). Important regions of the amino acid sequence encoded by nucleotides 1 through 729 of PR0344 include the indicator peptide, the start of the mature protein, and two potential N-myristoylation sites as set forth in Figure 21. The clone UNQ303 (DNA40592- 1242) has been deposited with the ATCC and assigned the no. of deposit ATCC 209492.

Analysis of the amino acid sequence of the PR0344 full-length polypepides suggests that portions of them possess significant homology with several murine and human complement proteins, indicating with this that PR0344 can be a new protein complement.

EXAMPLE 11: Isolation of cDNA Clones Encoding Human PR0347.

A consensus DNA sequence was linked in relation to other EST sequences as described in Example 1 above.

This consensus sequence is designated in the present DNA39499. Based on the DNA39499 consensus sequence, oligonucleotides were synthesized: l) to identify by PCR a stock of cDNA containing the sequence of interest, and 2) to be used as probes to isolate a clone of the total extension sequence coding for PR0347 .

The PCR primers (forward and reverse) were synthesized as follows: Front PCR Primer: ? GGGAACTTCTGGATCGGGCTCACC-3 '(SEQ ID NO: 51) Reverse PCR primer: '-GGGTCTGGGCCAGGTGGAAGAGAG-3 '(SEQ ID NO: 52) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA39499 consensus sequence which had the following nucleotide sequence Hybridization probe '- GCCAAGGACTCCTTCCGCTGGGCCACAGGGGAGCACCAGGCCTTC-3' (SEQ ID NO: 53) In order to screen several stocks for a full-length clone source, the DNA of the stock was screened by PCR amplification with the pair of PCR primers identified above. A positive pool was then used to isolate clones encoding the PR0347 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of cDNA libraries was isolated from human fetal kidney tissue (LIB228).

The formation of DNA sequences of the isolated clones as described above gave the full-length DNA sequence for PR0347 [hereinafter referred to as UNQ306 (DNA44176-1244)] (SEQ ID NO: 49) and the derived protein sequence for PR0347.

The complete nucleotide sequence of UNQ306 (DNA44176-1244) is set forth in Figure 22 (SEQ ID NO: 49).

The clone UNQ306 (DNA44176-1244) contains a single-opening structure with an apparent translational initiation site at positions of nucleotides 123-125 and ending at the stop codon at the nucleotides of positions 1488-1490 t (Figure 22). The predicted polypeptide precursor is 455 amino acids in length (Figure 23). The total extension protein PR0347 shown in Figure 23 has an estimated molecular weight of approximately 50,478 daltons and a pl of approximately 8.44. clone UNQ306 (DNA44176- 1244) has been deposited with ATCC and assigned no. of ATCC 209532.

Analysis of the amino acid sequence of the PR0347 polypeptide of total extension suggests that portions of it possess significant homology with several secretory proteins rich in cysteine, indicating thereby that PR0347 may be a novel secretory protein rich in cysteine.

EXAMPLE 12: Isolation of the cDNA Clones that encode Human PR0354 A tag sequence expressed from the DNA database (EST). { LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) was investigated and several EST sequences were identified that possessed certain degrees of homology with the heavy chain inhibitor Inter-Alpha-Trypsin and with some other. These EST homologous sequences were then aligned and a consensus sequence was obtained. The DNA consensus sequence obtained was then extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using homologous EST sequences derived from both public EST databases (for example GenBank) and a base of I data from Private EST DNA (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The extended sequence set is designated in the present DNA39633. The above investigation was carried out using the BLAST or BLAST2 computation program (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). These comparisons resulted in a BLAST score of 70 (or in some cases 90) or greater than that of the known non-codified proteins were agglomerated and matched in DNA consensus sequences with the "phrap" program (Phil Green University of Washington, Seattele, Washington, http: // bozeman.mbt.Washington.edu/phrap.docs/ phrap.html).

Based on the DNA consensus sequence, oligonucleotides were synthesized; 1) to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a clone of the full-length coding sequence for PR0354. Front and reverse PCR primers generally in the range of 20 to 30 nucleotides and are often designated to give a PCR product of about 10-1000 bp in length. The probe sequences are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is about 1- 1.5 kbo. In order to screen several cervos for a full extension clone, DNA from the collections was screened by PCR amplification, as in Ausubel et al., Current Protocols in Molecular Biology, with the pair of PCR primers. A positive pool was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.

The PCR primers were synthesized as follows: PCR PCR primer 1 (39633. fl) '- GTGGGAACCAAACTCCGGCAGACC-3 '(SEQ ID NO: 56) PCR Primer 2 forward (39633. f2) '- CACATCGAGCGTCTCTGG-3 '(SEQ ID NO: 57) Inverse PCR primer (399633. ri; AGCCGCTCCTTCTCCGGTTCATCG-3 '(SEQ ID NO: 58; Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA39633 consensus sequence which had the following nucleotide sequence.

Hybridization probe: '- TGGAAGGACCACTTGATATCAGTCACTCCAGACAGC ATCAGGGATGGG-3' (SEQ ID NO: 59) In order to screen several collections for a source of total extension clone, DNA from the collections was screened by PCR amplification with the pairs of PCR primers identified above. A positive stock was then used to isolate clones encoding the PR0354 gene using the probe oligonucleotide and one of the PCR primers.

RNA for the construction of cDNA stocks was isolated from human fetal kidney tissue (LIB227). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, bound directly to the hemicinaseated SalI adapters, divided with NotI, appropriately sized by gel electrophoresis, and cloned in a defined orientation in a suitable cloning vector (such as pRKB or pRKD; pRK5B is a depRK5D precursor that does not contain the Sfil site, see Holmes et al., Science, 253: 1278-1280 (1991)) in the only Xhol and Notl sites.

The formation of DNA sequences of the isolated clones as described above gave the full-length DNA sequence for PR0354 [herein designated as UNQ311 (DNA44192-1246] (SEQ ID.

NO: 54) and the derived protein sequence for PR0354.

The complete nucleotide sequence of UNQ311 (DNA44192-1246) is exposed in Figure 24 (SEQ ID NO: 54). The clone UNQ311 (DNA44192- 1246) contains a structure of a single reading aperture with an apparent translational initiation site at the positions of nucleotides 72-74 and ending at the stop codon at nucleotides at position 2154-2166 (Figure 24). The predicted polypeptide precursor is 694 amino acids in length (Figure 25). The total extension PR0354 protein set forth in Figure 25 has an estimated molecular weight of about 77,400 daltons and a pl of about 9.54. The clone UNQ311 (DNA44192-1246) has been deposited with ATCC and assigned the no. of deposit ATCC 209531.

Analysis of the amino acid sequence of the PR0354 polypeptide of total extension suggests that it has significant homology with the heavy chain inhibitor protein Inter-alpha-trypsin, indicating thereby that PR0354 can be a new homolog of the inter-heavy chain inhibitor protein. -alfa-trypsin.

EXAMPLE 13: Isolation of the cDNA clones that encode Human PR0344 A DNA consensus sequence was matched in relation to other EST sequences using the BLAST and phrap computation programs as described in the previous example. This consensus sequence is in the present designated DNA35702. Based on the consensus sequence DAN35702, oligonucleotides were synthesized: l) to identify by PCR a stock of cDNA that contains the sequence of interest, and 2) to use as probes to isolate a clone of the total coding sequence sequence of PR0355 .

Front and reverse PCR primers were synthesized as follows: Front PCR primer (.fl) '-GGCTTCTGCTGTTGCTCTTCTCCG-3 '(SEQ ID NO: 62) Front PCR primer (.f2) '- GTACACTGTGACCAGTCAGC-3 '(SEQ ID NO: 63) Front PCR primer (.f3¡ ATCATCACAGATTCCCGAGC-3 '(SEQ ID NO: 64) Reverse PCR primer (.rl) '-TTCAATCTCCTCACCTTCCACCGC-3 '(SEQ ID NO: 65) reverse PCR primer (.r2) '-ATAGCTGTGTCTGCGTCTGCTGCG-3 '(SEQ ID NO: 66) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA35702 consensus sequence, which had the following nucleotide sequence: Hybridization probe: '-CGCGGCACTGATCCCCAACAGGTGATGGGCAGAATCTGTT TACGAAAGACG-3' (SEQ ID NO: 67) In order to screen several collections for a source of a full-length clone, DNA was screened from the pools by PCR amplification with one of the pairs of PCR primers identified above. A positive pool was then used to isolate clones encoding the PR0355 gene using the oligonucleotide probe. RNA for construction of cDNA stocks was isolated from human fetal liver tissue.

The formation of DNA sequences of the isolated clones as described above gave the full length DNA sequence for PR0355 [herein designated as UNQ312 (DNA39518)] (SEQ ID NO: 60) and the protein sequence described for PR0355 . The clone UNQ312 (DNA39518-1247) contains a structure of a single reading aperture with a transcription initiation site at the positions of nucleotides 22-24 and ending at the stop codon at the position of nucleotides 1342-1344 (Figure 26). The predicted polypeptide precursor is 440 amino acids in length (Figure 27). The PR0355 proteins of total extension i set forth in Figure 27 have an estimated molecular weight of approximately 48,240 daltons and a pl of approximately 4.93. In addition, regions of interest that include the indicator peptide, Ig replay in the extracellular region, potential N-glycosylation sites, and the potential transmembrane region, are designated in Figure 27. The clone UNQ312 (DNA39518-1247) has been deposited with ATCC and was assigned the no. of deposit ATCC 209529.

Analysis of the amino acid sequence of the full-length PR0355 polypeptide suggests that portions of it possess significant homology to the CRTAM protein, indicating thereby that PR0355 can be CRTAM protein.

EXAMPLE 14: Isolation of cDNA clones encoding Human PR0357.

\ The clone no. "2452972" of the tag expression sequence by Incyte Pharmaceutical, Palo Alto, CA was used to begin a database investigation. The extracellular region sequences (which include the secretory indicator, if any) of approximately 950 known proteins secreted from the Swiss-Prot public protein database were used to investigate in the databases (EST) the expressed sequence tag which is superimposed with a portion of the clone EST Incyte no. "2452972". The EST database that includes public EST databases (for example GenBank) and a private EST DNA database (LIFESEQ ™, Inccyte Pharmaceuticals, Palo Alto, CA). The investigation was carried out using the BLAST or BLAST2 computation programs (Altshul et al., Methods in Enzymology 266: 460-480 (1996) as a comparison of ECD protein sequences up to 6 translation structures of the EST sequence. that resulted in a BLAST score of 70 (or in some cases 90) or greater than the known non-codified proteins were agglomerated and matched in consensus DNA sequences with the "ptrap" program (Phil Green, University of Washington, Seattle, Washington, http: //bozeman.iti t.Washington.edu/phrap.docs/ phrap.html).

A consensus DNA sequence was then combined in relation to other EST sequences using phrap. This consensus sequence in the present designated DNA37162. In this case, the DNA consensus sequence was extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above.

Based on the DNA37162 consensus sequence, oligonucleotides were synthesized: l) to identify by PCR a stock of cDNA that contained the sequence of interest, and 2) for one of the probes to isolate a clone from the total coding sequence for PR0357. PCR forward and reverse primers generally in the rando from 20 to 30 nucleotides and are often designated to give a PCR product of approximately 100-1000 extension. The probe sequences are typically 40-55 bp in extension. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1- 1.5 kbp-. In order to screen several collections for a full extension clone, DNA from the collections was screened by PCR amplification, as by Ausubel et al., Current Protocols in Molecular Biology, with the pair of PCR primers. A positive pool was then used to isolate clones that encode the gene of interest using the oligonucleotide probe and one of the primer pairs.

The PCR primers were synthesized as follows: Front primer 1: '-CCCTCCACTGCCCCACCGACTG-3 '(SEQ ID NO: 70) Reverse primer 1: -CGGGTTCTTTTGGGGACGTTAGGGCTCG-3 '(SEQ ID NO: 71) and front choke 2 '- CTTGCCCACCGTCCACCTGCCTCAAT-3 '(SEQ ID NO: 72).

Additionally, two synthetic oligonucleotide hybridization probes were constructed from the DNA37162 consensus sequence which had the following nucleotide sequences: Hybridization probe 1: 'AGGACTTGCCCACCGTCCACCTGCCTCAATGGGGGCACATGCCACC-3 '(SEQ ID NO: 73); Y 2: 5 'Hybridization probe - ACGCAAAGCCCTACATCTAAGCCAGAGAGAGACAGGGCAGCTGGG-3' (SEQ ID NO: 74).

In order to screen several stocks for a source of a full-length clone, DNA from the stock was screened by PCR amplification with a pair of PCR primers identified above. A positive pool was then used to isolate clones encoding the PR0357 gene using the oligonucleotide probe and one of the PCR primers.

RNA for construction of cDNA stocks were isolated from human liver tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a NotI site, bound to the Hemicinized Sali adapter, divided with NotIll, appropriately sized by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB and pRKD). pRK5B is a precursor of pRK5D that does not contain the Sfil site, see Holmes et al., Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.

The formation of DNA sequences of the isolated clones as described above gave the full-length DNA sequence for PR0357 [hereinafter referred to as UNQ314 (DNA44804-1248) (SEQ ID NO: 68) and the sequence of proteins derived for PR0357.

The complete nucleotide sequence of UNQ314 (DNA44804-1248) is set forth in Figure 28 (SEQ ID NO: 68). Clone UNQ314 (DNA44804-12-48) contains a single-reading structure of an apparent translational site at the position of nucleotides 137-139 and ending at the stop codon at the position of nucleotides 1931-1933 ( Figure 28). The predicted polypeptide precursor is 598 amino acids in length (Figure 29). The clone UNQ314 (DNA44804-1248) has been deposited with ATCC and assigned the no. of deposit ATCC 209527.

Further analysis shows a number of characteristics that is set forth in Figure 29. Figure 29 sets forth the amino acid sequence (SEQ ID NO: 69) derived from nucleotides 17 through 19330 of SEQ ID NO: 68). The molecular weight is 63,030 Daltons; pl is 7.24; and NX (S / T) is 3. The putative transmembrane region is set forth in Figure 29 of amino acids 506 through 524. Alternatively, the transmembrane region begins with "G" at amino acid 497. The potential N-glycosylation sites are underlined in Figure 29. The signature of the cysteine pattern of the EGF-like region appears at amino acids 355 to 366. This region can also be found in the protein of the fat globules of rat milk, notch or growth factor hepatocyte that converts the protease. The indicator peptide is also at amino acids 1- 22 of Figure 29. The onset of homology in ALS and other repeating-rich proteins leucine in the extracellular region starts at the amino acid at position 24.

Analysis of the amino acid sequence of the full length PR0357 polypeptide suggests that portions of it possess significant homology with ALS, indicating thereby that PR0357 can be a new protein with rich repeats n leucine related to ALS.

EXAMPLE 15; Isolation of cDNA Clones that encode Human PR0715 A priovaa ESTDNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA) was investigated for EST sequences encoding polypeptides which have homology to human TNF-α. This search resulted in the identification of the Tag Sequence expressed Incyte No. 2099855.

A DNA consensus sequence was then combined in relation to other EST sequences using segex't and "pharp" (Phil Green, University of Washington, Seattle,. Washington; http: // bozeman .mbt .Washington. edu / phrap. docs / phrap. html).

This consensus sequence is designated in the present DNA52092. based on the alignment of the various clones ESTs identified in this set, a single EST clone from the e-type of the Merck / Washington University EST (clone EST No. 725887, Accession No. AA292358) was obtained and its inserts sequenced. The DNA52722-1229 sequence of total extension was then obtained from the formation of inserted DNA sequences from the clone EST no. 725887.

The complete nucleotide sequence of UNQ383 (DNA52722-1229) is set forth in Figure 30 (SEQ ID NO: 75). The clone UNQ383 (DNA52722-1229) contains a single-reading reading structure with an apparent translational initiation site at the position of nucleotide 114-116 and ending at the stop codon at the position of nucleotides 864- 866 (Figure 30). The predicted polypeptide is 250 amino acids in length (Figure 31). The total extension PR0715 protein set forth in Figure 31 has an estimated molecular weight of about 27,433 daltons and a pl of about 9.85.

Analysis of the amino acid sequence of the full-length PR0715 polypeptide suggests that it possesses significant homology to the members of the tumor necrosis factor protein family, thereby indicating that PR0715 is a novel protein of the tumor necrosis factor.

EXAMPLE 16: Isolation of the cDNA clones encoding Human PR0353 A DNA consensus sequence was pooled in relation to other EST sequences using phrap as described in Example 1 above. These consensus sequences are designated in the present DNA36363. The consensus DNA sequence was extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of the EST sequences discussed above. Based on the DNA36363 consensus sequence, oligonucleotides were synthesized: l) to identify by PCR a cDNA library containing the sequence of interest, and 2) to be used as probes to isolate a clone of the full-length coding sequence for PR0353.

Based on the DNA36363 consensus sequence, forward and reverse PCR primers were synthesized as follows: Front PCR primer (36363. fl) '-TACAGGCCCAGTCAGGACCAGGGG-3 '(SEQ ID NO: 87) Reverse PCR primer (36363.rl) 5'-CTGAAAGAAGTAGAGGCCGGGCACG-3 '(SEQ ID NO: 88) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the csnsensus sequence of DNA36363 which had the following nucleotide sequence: Hybridization probe 36363.pl 'CCCGGTGCTTGCGCTGCTGTGACCCCGGTACCTCCATGTACCCGG-3' (SEQ ID NO: 89) In order to screen several collections for a source of a full extension clone, DNA from the collections was screened by PCR amplification with one of the pairs of PCR primers identified above. A positive pool was then used to isolate clones encoding the PR0353 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of cDNA collections isolated from human fetal kidney tissue.

The formation of DNA sequences of the isolated clones as described above gave the full-length DNA sequence for PR0353 [herein designated as UNQ310 (DNA41234-12429 (SEQ ID NO: 85) and the derived protein sequence for PR0353 .

The complete nucleotide sequence of UNQ310 (DNA41234-1242) is set forth in Figure 34 (SEQ ID NO: 85). The clone UNQ310 (DNA41234-1242) contains a structure of a single reading aperture with an apparent translational initiation site at the position of nucleotides 305-307 and ending at the deposition stop codon of nucleotides 1148-1150.

(Figure 34). The predicted polypeptide precursor is 281 amino acids extension (Figure 35). Important regions of the amino acid sequence encoded by PR0353 includes the indicator peptide, which corresponds to amino acids 1-26, the start of the mature protein in the. amino acid in position 27, a potential N-glycosylation site, corresponding to amino acids 93-98 and a region that has homology to the adipose-related protein precursor of 30"kd, corresponding to amino acids 90- 281. Clone UNQ310 (DNA41234-1242) has been deposited with the ATCC and assigned to the ATCC deposit No. 209618.

Analysis of the amino acid sequence of the PR0353 full length polypeptides suggest that portions of them have significant homology with the portions of the murine and human complement proteins, indicating with this that PR0353 can be a new protein complement.

EXAMPLE 17: Isolation of cDNA Clones Encoding Human PR0361 A DNA consensus sequence was pooled in relation to other EST sequences using phrap as described in Example 1 above. This consensus sequence is designated in the present DNA40654. Based on the DNA40654 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library containing the sequence of interest, and 2) for use as probes to isolate a clone from the full-length coding sequence for PR036I ' .

Front and reverse PCR primers were synthesized as follows: PCR front primer (.fl) 5'-AGGGAGGATTATCCTTGACCTTTGAAGACC-3 '(SEQ ID NO: 92) Front PCR primer (.f2) '-GAAGCAAGTGCCCAGCTC-3 '(SEQ ID NO: 93) Front PCR primer (.f3) '-CGGGTCCCTGTCTCTTTGG-3 '(SEQ ID NO: 94) Reverse PCR primer (.rl) '-CACCGTAGCTGGGAGCGCACTCAC-3r (SEQ ID NO: 95) Reverse PCR primer (.r2) ? GTGTAAGTCAAGCTCCC-3 '(SEQ ID NO: 96) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA40654 consensus sequence which had the following nucleotide sequence: Hybridization probe: 5 '-GCTTTCCTGACACTAAGGCTGTCTGCTAGTCAGAAT TGCCTCAAAAGAG-3' (SEQ ID NO: 97) A. In order to screen several collections for a source of a full extension clone, DNA from the collections was screened by PCR amplicidation with one of the pairs of primers identified above. A positive stock was then used to isolate clones encoding the PR0361 gene using the probe oligonucleotide. RNA for construction of cDNA stocks was isolated from human fetal tissue.

The formation of DNA sequences of the isolated clones as described. previously resulted in the full-length DNA sequence for PR0361 [designated herein as UNQ316 (DNA45410-1250)] (SEQ ID NO: 90) and the protein sequence derived for PR0361.

The complete nucleotide sequence of UNQ316 (DNA45410-1250) is set forth in Figure 36 (SEQ ID NO: 90). The UNQ316 coln (DNA45410-1250) contains a single reading opening structure with an apparent transcriptional initiation site at the position of nucleotides 226-228 and ending at the stop codon at nucleotides at position 1519-1521.

(Figure 36). The predicted polypeptide precursor is 431 amino acids extension (Figure 37). The protein Total extension PR0361 shown in Figure 37 has an estimated molecular weight of about 46,810 daltons and a pl of about 6.45. In addition, regions of interest that include the transmembrane region (amino acids 380-409) and sequences typical of the arginase protein family (amino acids 3- 14 and 39-57) are designated in Figure 37. The clone UNQ316 (DNA45410-1250) has been deposited with ATCC and assigned no. of deposit ATCC 209621.

Analysis of the amino acid sequence of the full-length PR0361 polypeptide suggests that portions of it have significant homology with the chitinase and / or mucin proteins, thus indicating that PR0361 may be a new protein mucin and / or chitinase.

EXAMPLE 18: Isolation of cDNA clones encoding Human PR0365 A DNA consensus sequence was pooled in relation to other EST sequences using phrap as described in Example 1 above. The consensus sequence is in the present designated DNA35613. Based on the DNA35613 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a stock of cDNA containing the sequence of interest, and 2) for use as probes to isolate a clone of the total extension coding sequence for PR0365.

Front and reverse PCR primers were synthesized as follows: Front PCR primer (.f1-35613) '-AATGTGACCACTGGACTCCC-3 '(SEQ ID NO: 100) Front PCR primer (.f2-35613) '- AGGCTTGGAACTCCCTTC-3 '(SEQ ID NO: 101) Reverse PCR primer (.rl-35613) AAGATTCTTGAGCGATTCCAGCTG- 3 '(SEQ ID NO: 102) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA35613 consensus sequence which had the following nucleotide sequence Hybridization probe: '-AATCCCTGCTCTTCATGGTGACCTATGACGACGGAAGC ACAAGACTG- 3' (SEQ ID NO 103) In order to screen several collections for a source of a clone of total extension, from the collections, was screened DNA by PCR amplification with one of the pairs of primers identified above. A positive pool i was then used to isolate clones encoding the PR0365 gene using the probe oligonucleotide and one of the PCR primers. RNA for construction of the cDNA stock was isolated from human fetal kidney tissue.

The formation of DNA sequences of the isolated clones as described above gave the total extension sequence for PR0365 [herein designated as UNQ320 (DNA46777-1253)] (SEQ ID NO: 98) and the derived protein sequence for PR0365 . The complete nucleotide sequence of UNQ320 (DNA46777-1253) is set forth in Figure 38 (SEQ ID NO: 98). The clone UNQ320 (DNA46777-1253) contains a structure of a single reading aperture with an apparent translational initiation site at the position of nucleotides 15-17 and ending at the stop codon at the position of nucleotides 720-722 ( Figure 38). The precursor of the predicted polypeptide is 235 amino-acid extension (Figure 39). Important regions of the polypeptide sequence encoded by clone UNQ320 (DNA46777-1253) have been identified and include the following: a reporter peptide corresponding to amino acids 1- 20, the start of the mature protein corresponding to amino acid 21, and multiple sites of potential N-glycosylation as shown in Figure 39. Clone UNQ320 (DNA46777-1253) was deposited with ATCC and assigned no. of deposit ATCC 209619.

Analysis of the amino acid sequence of the full-length PR0365 polypeptide suggests that portions of it possess significant homology to the human 2-19 protein, thereby indicating that it may be a novel homologue of the human 2-19 protein.

EXAMPLE 19: Use of the Nucleic Acid encoding the PRO Polypeptide as Hybridization Probes The following methods describe the use of a nucleotide sequence encoding a PRO polypeptide of interest as a hybridization probe.

DNA comprising the coding sequence of a PRO polypeptide of interest as set forth herein may be employed as a probe or used as a base from which probes are prepared for screening for homologous DNAs (such as those encoding variants as found). of the PRO polypeptide) in cDEA collections of human tissue or genomic collections of human tissue.

Hybridization and washing of filters that contain one or the other, stock of DNAs are carried out under the following conditions of high severity. Hybridization of the probe derived from the nucleic acid encoding the radiolabeled PRO polypeptide in the filters is carried out in a solution of 50% formamide, 5 X SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate , pH 6.8, 2 X Denhardt's solution, and 10% dextran sulfate at 42 ° C for 20 hours. The filters are washed in an aqueous solution of 0.1 X SSC and 0.1% SDS at 42 ° C.

DNAs having a desired sequence identity with DNA encoding the full length native sequence PRO polypeptide can then be identified using standard techniques known in the art. I EXAMPLE 20: Expression of PRO Polypeptides in E. Coli These examples illustrate the preparation of a non-glycosylated form I of a desired PRO polypeptide by recombinant expression in E. coli.

The DNA sequence encoding the desired PRO polypeptide is initially amplified using selected PCR primers. The primers could contain restriction enzyme sites corresponding to the restriction enzyme sites on the selected expression vector. A variety of expression vectors can be employed. An example of a suitable vector is pBR322 (derived from E. coli, see Bolivar et al., Gene, 2: 95 (1977)) which contains genes for ampicillin and tetracycline resistance. The vector is digested with the restriction enzyme and dephosphorylated. The sequences amplified by PCR are then ligated into the vector. The vector will preferably include sequences encoding a gene with antibiotic resistance, a trp promoter, poly-his leaders (including the first six STII codons, poly-his sequence, and enterokinase cleavage site), the specific region encoding the PRO polypeptide, the lambda transcriptional terminator, and an argU gene.

The ligand mixture is then used to transform a strain of E. coli selected using the methods described in Sambrook et al., Supra). Transformants are identified by their ability to grow on LB plates and antibiotic resistant colonies are then selected. Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequence formation.

Selected clones can be developed overnight in liquid culture medium and as LB broth supplemented with antibiotics. The overnight culture can be subsequently used to inoculate a large-scale culture. The cells are then developed to a desired optical density, during which the expression promoter acts.

After culturing the cells for several more hours, the cells can be harvested by centrifugation. The compacted cells obtained by centrifugation can be solubilized using various agents known in the art, and the solubilized PRO polypeptide can then be purified using a metal chelating column under conditions that allow tight binding of the protein.

PR0241 was successively expressed in E. coli in a tailed poly-His form, using the following procedure. The DNA encoding PR0241 was initially amplified using the selected PCR primers. The primers contained in the restriction enzyme sites corresponding to the restriction enzyme sites on the selected expression vector, and other useful sequences that provide for reliable and efficient initiation of translation, rapid purification on a metal chelation column and Proteolytic removal with enterokinase. The tailed poly-Hisss sequences amplified by PCR were then ligated into an expression vector, which was used to transform an E. Coli host based on strain 52 (W3110 fuhA (tonA) Ion galE rppoHts (htpRts) clpP (laclq) The transformants were first developed in LB containing 50 g / ml of carbecillin at 30 ° C with agitation up to 0. D. 600 of 3-5 was allcanzaddo.The cultures were then diluted 50-100 times in CRAP medium (prepared by mixing 3.57 g (NH4) 2S04, 0.71 g of sodium citrate.2H20, 1.07 g of KC11, 5.36 g of Difco yeast extract, 5.36 g of Icaza SF Sheffield in 500 ml of water, as well as 10 mM of MPOS, pH 7.3, 0.55% glucose (weight / volume) and 7 mM MgSO4) and developed for approximately 20-30 hours at 30 ° C with shaking.The samples were removed to verify expression by SDS-PAGE analysis, and The dense culture is centrifuged to compact the cells. purification and bending.

The E. Coli paste from fermentations of 0.5 to 1 L (6-10 compacted) were resuspended in 10 volumes (weight / volume) in 7 M of guanidine, 20 mM of Tris, regulator of pH 8. Sodium sulfite is added solid and tetrathionate of sodium to make final concentrations of 0.1 M and 0.02 M respectively, and the solution was stirred overnight at 4 ° C. This step resulted in denatured proteins with all the cysteine residues blocked by sulfitolization. The solution was centrifuged at 40,000 rpm in a Beckman Ultracentrifuge for 30 minutes. The supernatant was diluted with 3-5 volumes of regulator for chelate metal column (6 M guanidine, 20 mM Triss, pH 7.4) and filtered through filters, 0.22 icrones to clarify. Depending on the clarified extract, it was loaded onto a 5 ml Ni-NTA Qiagen chelate metal column equilibrated in the regulator for the metal chelate column. The column was washed with additional regulator containing 50 mM imidazol (Calbiochem, Utrol grade), pH 7.4. the protein was eluted with a regulator containing 250 mM of imidazole. The firactions containing the desired protein were pooled and stored at 4 ° C. The concentration of the protein was estimated by its absorbance at 280 nm using the calculated extinction coefficient based on its amino acid sequence.

The protein was concentrated by diluting the sample slowly in freshly prepared concentrate buffer consisting of: 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 M cysteine, 20 mM glycine and 1 mM EDTA . The reconcentration of the volumes was selected so that the final protein concentration was between 50 to 100 microorganisms / ml. The reconcentrated solution was slowly stirred at 4 ° C for 12-36 hours. The reconcentration reaction * was quenched by the addition of TFA to a final concentration of 0.4% (pH of about 3). Before further purification of the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added to a final concentration of 2-10%.

The reconcentrated protein was chromatographed on a Poros / Rl / H reversed phase column using a mobile regulator of 0.1% TFA with elution with an acetonitrile gradient from 10 to 80%. Aliquots of the fractions with A280 absorbance were analyzed on SDS polyacrylamide gels and fractions containing the homogeneous reconcentrated protein were pooled. Generally, appropriately reconcentrated species of most proteins are eluted at the lowest concentrations of acetonitrile since these species are more compact than their hydrophobic interiors protected from interaction with the reverse phase resin. Aggregated species are usually eluted at higher concentrations of acetonitrile. In addition to resolving the forms of poor reconcentration of proteins from the desired form, the reverse phase stage also removes endotoxins from the samples.

The fractions containing the concordant PR0241 protein were combined and the acetonitrile removed using a slow stream of nitrogen directed to the solution. The proteins were formulated in 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25 Superfine resins (Pharmacia) equilibrated in the regulatory formulation and sterile filtered.

EXAMPLE 21: Expression of PRO Polypeptides in Mammalian Cells This example illustrates the preparation of glycosylated forms of a desired PRO polypeptide by recombinant expression in mammalian cells.

The vector, pRK5 (see EP 307,247, published March 15, 1989), is used as an expression vector. Optionally, the DNA encoding the PRO polypeptide is inherited in pRK5 with selected restriction enzymes to allow insertion of the PRO polypeptide DNA using binding methods such as those described in Sambrook et al., Supra. The resulting vector is called PRO-PRK5 polypeptide.

In one embodiment, the selected host cells can be 293 cells. Human 293 cells (ATCC CL 1573) are developed for confluence in mature tissue culture plates such as DMEM supplemented with fetal calf lees and optionally, nutrient components. and / or antibiotics. Approximately 10 μg of PRO-pRKS polypeptide DNA is mixed with approximately 1 μg of DNA encoding the VA RNA gene [Thimmappaya et al., Cell, 31: 543 (1982)] and dissolved in 500 μl of 1 mM Tris-HCl, 0.1? of EDTA, CaCl2 0.227 M. "To this mixture is added, dropwise, 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1. 5 mM NaaP04, and the formation of a precipitate is allowed for 10 minutes at 25 ° C. The precipitate is suspended and added to the 293 cells and sedimentation is allowed for approximately four hours at 37 ° C. The culture medium is removed by aspiration and 2 ml of 20% glyceroi in PBS is added for 30 seconds. The 293 cells are then washed with lean-free medium, freshly prepared medium is added and the cells are incubated for approximately 5 days.

Approximately 24 hours after the transfections, the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 μCi / mL of 35S-cysteine and 2200 μCi / mL of 35S-pipf onion. After 12 hours of initialization, the harmonized medium is collected, concentrated on a rotary filter, and loaded on the 15% SDS gel. The processed gel can be dried and exposed on film for selected periods of time until the presence of the PRO polypeptide is revealed. The cultures containing transfected cells can be further subjected to incubation (in serum-free medium) and the medium is examined in selected bi-assays.

In an alternative technique, the PRO polypeptide can be introduced into transient 293 cells using the dextraho sulfate method described by Somparyrac et al., Proc. Nati Acad. Sci., 12: 7575 (1981).

The 2293 cells are developed to maximum density in a rotating flask and 700 μg of PR0-pRK5 polypeptide DNA is added. The cells are first concentrated from the spinning flask by centrifugation and washed with PBS. The DNA-dexphrine precipitate is incubated on the cell tablet for four hours. Cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 μl / ml bovine insulin and 0.1 μg / ml of bovine transferin. After about four days, the conditioned medium is centrifuged and filtered to remove the cells and debris. The sample containing the expressed PRO polypeptide can then be concentrated and purified by any selected method, such as dialysis and / or column chromatography.

In another embodiment, PRO polypeptides can be expressed in CHO cells. The PRQ-pRK5 polypeptide can be transfected into CHO cells using known reagents such as co or CaP? or dextran-DEAE. As described above, the cultured cells can be incubated, and the medium replaced with culture medium (alone) or medium containing a radiolabel such as 3 &S-methionine. After determining the presence of the PROO polypeptide, the culture medium can be replaced with serum-free medium. Preferably, the cultures are incubated for approximately 6 days, and then the conditioned medium is harvested. The medium containing the expressed PRO polypeptide can then be concentrated and purified by any selected method.

The tagged epitope of the PRO polypeptide can also be expressed in CHO host cells. The PRO polypeptide can be subcloned out of the pRK5 vector. The subclone insert can be subjected to PCR to fuse in structure with a selected epitope tag such as poly-his tag in a Baculovirus expression vector. The poly-histo tagged PRO Polypeptide insert can then be subcloned into a SV40 driver vector containing a marker for selection such as DHFR for selection of stable clones. Finally, CHO cells can be transfected (as described above) with the SV40 driver vector. The marking can be done as described above, to verify the expression. The culture medium containing the PRO-poly-His tagged polypeptide can then be concentrated and purified by any selected method, such as by chelate-Ni2 + affinity chromatography.

The PRO polypeptide was successfully expressed in CHO cells by both transient and one stable expression methods. In addition, PR0243, PR0323 and PR0233 were successfully expressed transiently in CHO cells.

Stable expression in CHO cells was effected using the following procedure. The proteins were expressed as an IgG construct (immunoadhesin), in which the coding sequences of the soluble forms (for example extracellular regions) of the respective proteins were fused in an IgG1 constant region sequence containing the axis, CH2 and CH2 regions and / or a poly-His form tagueada.

Following PCR amplification, the respective DNAs were subcloned into an expression vector CHO using standard techniques described in Ausubel et al., Current Protocols of Molecular Biology, Unit 3.16 John Wileey and Sons (1997). CHO expression vectors are constructed to have 5 'and 3' restriction sites compatible with the DNA of interest to allow convenient disruption of cDNAs. The vector used in the expression in CHO cells is as described in Lucas et al., Nucí. Acids Res. 24: 9 (1774-1779 (1996), and the uses of the preco / enhancer promoter of SV4.0 to drive the expression of the cDNA of interest and dihydrofolate reductase (DHFR) .The DHFR expression allows selection to keep stable the next transfection of the plasmid.

Twelve micrograms of the desired plasmid DNA were introduced into approximately 10 million CHO cells using commercially available transfection reagents Superfect * (Qiagen), Dossier * or Fugene * I (Boehringer Mannheim). The cells were developed and described in Lucas et al., Supra. Approximately 3 X 10 ~ 7 cells are frozen in an ampule for further development and production as described below.

The ampules containing the plasmid DNA were thawed by placing in a water bath and mixed by vortex. The contents were pipetted into a centrifuge tube containing 10 ml of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated and the cells were resuspended in 10 ml of selective medium (0.2 μm of PS20 filtrate with 0.2 μm of 5% diafiltered fetal bovine serum). The cells were then aliquoted in a 100 ml rotating vessel containing 90 ml of selective medium. After 1-2 days, the cells were transferred into a 250 ml rotary vessel filled with 150 ml of selective development medium and incubated at 37 ° C. After another 2-3 days, 250 ml, 500 ml and 2000 ml rotary bottles were seeded with 3 X 105 cells / ml. the cell medium was exchanged with freshly prepared medium by centrifugation and resuspension in production medium. However, any suitable medium can be employed, a production medium described in US Pat. No. 5,122,469, registered on June 16, 1992, was currently used. The 3 L production of the rotary bottles is seeded at 1.2 X 106 cel / ml. On day 0, the number of cells and pH were determined. On day 1, the rotating bottle was sampled and spraying was started with an air filter. On day 2, the rotating bottle was sampled, the temperature moved to 33 ° C, and 30 ml of 500 g / 1 of glucose and 0.6 ml of 10% antifoam (for example, 35% polydimethylsiloxane emulsion, Dow Corning 365 Emulsion Medical Grade) .. During the course of production, the pH was adjusted as necessary to keep it around 7.2. After 10 days, or no drip reliability below 70%, the cell culture was harvested by centrifugation and filtered through a 0.22 μm filter. The filtrate was either stored at 4 ° C or immediately loaded into columns for purification.

For the poly-His Tagueadas constructs, the proteins were purified using a Ni-NTA column (Qiagen). Imidazole was added before the purification in the conditioned medium at a concentration of 5 mM. The conditioned medium was pumped on a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, regulator containing 0.3 M NaCl and 5 mM imidazole at a flow of 4.5 ml / min, at 4 ° C. After loading, the column was washed with buffer for additional equilibrium and the protein eluted with equilibrium regulator containing 0.25 M imidazole. The highly purified protein was subsequently desalted in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine column (Pharmacia) and stored at -80 ° C.

The immunoadhesin constructs (containing Fe) were purified from the conditioning medium as follows: The conditioning medium was pumped on a 5 ml Protein A column (Pharmacia) which has been equilibrated in 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with regulator for equilibration before elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collection of 1 ml fractions in tubes containing 275 μl of 1M Tris buffer / pH 9, The highly purified protein was subsequendesalted in buffer for storage as described above for the tailed poly-His proteins. The homogeneity was evaluated by SDS polyacrylamide angels and by formation of N-terminal amino acid sequences by Edman degradation.

PR0241, PR0243, PR0299, PR0323, PR0327, PR0233, PR0344, PR0347, PR0354, PR0355, PR0357, PR0353, PR0361 and PR0365 were also successfully transitotically expressed in CHO cells.

EXAMPLE 22: Expression of PRO Polypeptides in Yeasts.

The following methods describe the recombinant expression of a desired PRO polypeptide in yeast.

First, yeast expression vectors are constructed by intracellular production or secretion of PRO polypeptides from the ADHH2 / GAPDH promoter. The DNA encoding a desired PRO polypeptide, a selected reporter peptide and the promoter are inserted into any suitable restriction enzyme site at. the plasmid selected for the direct intracellular expression of the PRO polypeptide. For secretion, the DNA encoding the PRO polypeptide can be cloned into the selected plasmid, together with the DNA encoding the ADH2 / GAPDH promoter, the leader sequence / yeast alpha secretory factor and linker sequences (if necessary) for expression of the PRO polypeptide.

Yeast cells, such as yeast strain AB110, can then be transformed with the expression plasmids described above and cultured in selected fermentation medium. Transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gels with Coomassie Blue stain.

The recombinant PRO polypeptide can subsequenbe isolated and purified by removal of the yeast cells from the fermentation medium by centrifugation and concentration of the medium using selected cartridge filters. The concentrate containing the PRO polypeptide can be further purified using selected resins on a chromatography column.

EXAMPLE 23: Expression of PRO Polypeptides in Insect Cells Infected with Baculovirus The following methods describe the recombinant expression of PRO polypeptides in insect cells infected with Baculovirus.

The desired PRO polypeptide is fused to the start of the chain of a tag epitope contained in a baculovirus expression vector. Epitopes tag such include poly-His tag and immunoglobulin tags (regions Similar Fe of IgG). A variety of plasmids can be employed, which include plasmids derived from commercially available plasmids such as pVL1393 (Novagen).

Briefly, the PRO polypeptide or the desired portions of the PRO polypeptide (such as the sequence encoding the extracellular regions of a transmembrane protein) is amplified by PCR with complementary primers for the 5 'and 3' regions. The 5 'primer can incorporate sites of lateral restriction enzymes (selected). The product is then digested with the restriction enzymes selected and subcloned into the expression vector.

Recombinant baculovirus is generated by co-transfection of the above plasmid and BaculoGold ™ virus DNA (Pharmigen) in spodoptera fugiperda ("S19") cells (ATCC CRL 1711) using lipfectin (commercially available from GIBCO-BRL). After 4-5 days of incubation at 28 ° C, the released viruses are collected and used for further amplifications. Viral infection and protein expression is carried out as described by O'Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual, Oxford: Oxford University Press (1994).

The expressed PRO pli-His tagged polypeptide can be purified, for example, by chelate-Ni2 + affinity chromatography as follows. Extracts are prepared from Sf9 cells infected with recombinant virus as described in Rupert et al. Nature, 362: 175-179 (1993). Briefly, the Sf9 cells are washed, resuspended in sonication buffer (25 ml of Hepes, pH 7.9, 12.5 mM of MgC12, 0.1 mM of EDTA; % glycerol; NP-40 at 0.1%; KC1 0.4 M), and sonicated twice for 20 seconds on ice. The sonicates are clarified by centrifugation, and the supernatant is diluted 50-fold in charge buffer (50 mM phosphate, 300 mM NaCl, glycerol at 10, pH 7.8) and filtered through 0.45 μm filters. A Ni2 + NTA agarose column (commercially available from Qiagen) is prepared with a bed volume of 5 ml, washed with 25 ml of water and equilibrated with 25 ml of loading buffer. The filtered cell extract is loaded onto the column at 0.5 ml per minute. The column is washed for base line of A ^ s with charge regulator, at the point where the collection of the fractions is initiated. The column is then washed with a secondary rinse buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 6.0), which elutes nonspecifically binding proteins. After achieving again a baseline of A28O? the column is developed with a gradient of imidazole from 0 to 500 mM in the secondary washing regulator. Fractions of 1 ml are collected and analyzed by SDS-PAGE and stained with silver or Western staining with Ni2 + -NTA- conjugated to alkaline phosphatase (Qiagen). The fractions containing the Hisio-tagged PRO polypeptide are combined and dialyzed against charge buffer.

Alternatively, purification of the polypeptide PRO Tagged IgG (or tated Fe) can be performed using known chromatography techniques, including for example, Protein A or Protein G column chromatography, PRQ241, PRQ327 and PR0344 were successfully expressed in Sf9 insect cells infected with Baaculovirus. While the expression was currently performed on a 0.5-2 L scale, it can be easily staggered for larger preparations. The proteins were expressed as an IgG construct (immunoadhesin), in which the extracellular region of the protein was fused to an IgG1 constant region sequence containing the axis, CH2 and CH3 regions and / or tailed poly-His forms.

For expression in Sfl9 cells of insects infected by Baculovirus, following PCR amplification, the respective coding sequences were subcloned into a Baculovirus expression vector. (pb.PH.IgG for fusions of IgG and pb.PH.His.c for tailed poly-His proteins), and Baculogold® baculovirus vector and DNA (Pharmigen) were co-transfected into 105 cells of Spodoptera fugiperda ( "S19"). { ATCC CRL 1711), using Lipofectin (Gibco BRL), pb.PH.IgG and pb.PH.His are modifications of the commercially available Baculovirus expression vectors pVL393 (Pharmigen), with modified poiyne linker regions to include the sequences His or Fe tag. The cells were developed in Hink TNM-FH medium supplemented with 10% FBS (Hyclone). The cells were incubated for 5 days at 28 ° C. The supernatant was collected and subsequently used for the first viral amplification by infection of Sf9 cells in Hink TNM-FH medium supplemented with 10% FBS for an appropriate multiplicity of infections (MOI) of 10. The cells were incubated for 3 days at 28 ° C, The supernatant was collected and the expression of the constructs in the baculovirus expression vector was determined by binding bath of 1 ml of supernatant in 25 ml of Ni-NTA beads (QIAGEN) in tainted histidine proteins or Protein beads. A Sepharose CL4B (Pharmacia) for taigated IgG proteins followed by SDS-PAGE analysis comparing with a known concentration of standard protein by spotting with Coomassie Blue.

The first viral amplification of supernatant was used to infect a rotary vessel culture (500 ml) of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an MOI of approximately 0.1. The cells were incubated for 3 days at 28 ° C. The supernatant was collected and filtered. The binding bath and the SDS-PAGE analysis were repeated, as necessary, until the expression of the rotary culture was confirmed.

The conditioned medium from the transfected cells (0.5 to 3 L) was harvested by centrifugation to remove the cells and filtered through 0.22 micron filters. For the tailed poly-His construct, the protein construct was purified using a Ni-NTA column (Qiagen). Before purification, imidazole was added to the conditioning medium at a concentration of 5 mM. The acidic medium was pumped over a 6 ml column of NiNTA equilibrated in 20 mM Hepes, pH 7.4, regulator containing 0.3 M NaCl and 5 mM imidazole at a flow of 4-5 ml / minute, at 4 ° C. After loading, the column was washed with additional equilibrium regulator and the protein eluted with equilibrium regulator contained 0.25 M imidazole. The highly purified protein was subsequently desalted in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine column (Pharmacia) and stored at -80 ° C. .

The immunoadhesin (containingFc) constructs of proteins were purified from the conditioning medium as follows. The conditioning medium was pumped over a 5 ml Protein A column (Parmacia) which had been equilibrated in 20 mM of regulating sodium phosphate, pH 6.8. After loading, the column was extensively washed with equilibrium buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collection of 1 ml fractions in tubes containing 275 ml of 1M Tris buffer, pH 9. The highly purified protein was subsequently desalted in storage buffer as described above for the tailed poly-His proteins. The homogeneity of the proteins was verified by SDS polyacrylamide gel electrophoresis (PEG) and formation of N-terminal amino acid sequences by Edman degradation.

PR0243, PR0323, PR0344 and PR0355 were strongly expressed in cells of Hi5 insects infected with baculovirus. While the expression was currently performed on a scale of 0.5-2 L, it can be easily staggered to larger preparations (eg 8 L).

For expression in Baculovirus infected Hi5 insect cells, the DNA encoding the PRO polypeptide can be modified with the appropriate systems, such as Pfu (Stratagene), or fused towards the start of the cedena (5 'excluded) of an epitope tag content with a baculovirus expression vector. Such tag epitopes include poly-His tags and immunological tags (similar Fe regions or IgG). A variety of plasmids can be employed, which include plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, the PRO polypeptide or the desired PRO polypeptide potion (such as the sequence encoding the extracellular region of a tranmembrane protein) is amplified by PCR with complementary primers in the 5 'and 3' regions. The 5 'primer was incorporated into lateral restriction enzyme sites (selected). The product is then digested with the selected restriction enzymes and subcloned into the expression vector. For example, derivatives of pVL1393 may include the Fe regions of human IgG (pb.PH.IgG) or an 8 histidine (pb.PH..His) tag at the end of the chain (outside of 3 ') the sequence AME. Preferably, the construction of the vector is sequenced for confirmation.

Hi5 cells are developed at a confluence of 50% under the conditions of 27 ° C, not C02, not penicillin / streptomycin. For each 150 mm plate, 30 μg of pIE based on the vector containing the PRO polypeptide is mixed with 1 ml of ExCell medium (Medium: ExCell 401 + 1/100 L-Glu JRH Biosciences # 14401-78P (note: this medium is slightly sensitive)), and in a separate tube, 100 μl of CellFectin (CellFECTIN (GibcoBRL # 10362-010) (vortexed to mix)) is mixed with 1 ml of medium ExCell. The two solutions are combined and kept in incubation at room temperature for 15 minutes. 8 ml of ExCell medium is added to the 2 ml of the DNA / CellFECTIN mixture and it is extended in layer on the Hi5 cells that have been washed once with ExCell medium. The plate is then incubated in the dark for 1 hour at room temperature. The DNA / CellFECTIN knob is then aspirated, and the cells are washed once with ExCell to remove excess CellFECTIN, 30 ml of freshly prepared ExCell medium is added and the cells are incubated for 30 days at 28 ° C. The supernatant is collected and the expression of the PRO polypeptide in the baculovirus expression vector can be determined by binding bath of 1 ml of supernatant in 25 ml of Ni-NTA beads (QIAGEN) for stripped histidine proteins or Protein-A beads. Sepharose CL-4BB (Pharmacia) for taigated IgG proteins followed by SDS-PAGE analysis comparing to a known concentration of standard protein by spotting with Coomassie Blue.

The conditioned medium from the transfected cells (0.5 to 3 L) is collected by centrifugation to remove the cells and filtered through filters of 0.22 icrones. For the tailed poly-His construct, the protein comprising the PRO polypeptide is purified using a Ni-NTA column (Qiagen). Prior to purification, imidazole is added to the conditioned medium at a concentration of 5 mM. The conditioned medium is pumped on a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, regulator containing 0.3 M NaCl and 5 mM imidazole at a flow of 4-5 ml / min, at 4 ° C . After loading, the column is washed with an additional equilibrium regulator and the protein eluted with imbalance equilibrium regulator containing 0.25 M imidazole. The highly purified protein is subsequently desalted in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and mannitol. at 4%, pH 6.8, with a 25 ml G25 Superfine column (Pharmacia) and stored at -80 ° C.

Protein immunoadhesin constructs are purified from the conditioning medium as follows: The conditioning medium is pumped on a 5 ml Protein A column (Pharmacia) which has been equilibrated in 20 mM sodium phosphate buffer, pH 6.8. After loading, the column is extensively washed with equilibrium buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately neutralized by collection of 1 ml fractions in tubes containing 275 ml of 1 M Tris buffer, pH 9. The highly purified protein is subsequently desalted in storage buffer as described above for the poly-His proteins tagueada . The homogeneity of the PRO polypeptide can be evaluated by SDS on polyacrylamide eles and by formation of N-terminal amino acid sequences by Edman degradation and other analysis procedures as desired or necessary.

EXAMPLE 24; Preparation of antibodies that bind to PRO Polypeptides This example illustrates the preparation of monoclonal antibodies that can specifically bind to a PRO polypeptide. I i Techniques for producing monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be employed include the purified PRO polypeptide, fusion proteins containing the PRO polypeptide, and cells expressing the recombinant PRO polypeptide on the cell surface. The selection of the immunogen can be made by those skilled in the art without undue experimentation.

Mice such as Balb / c are immunized with the PRO polypeptide immunogen emulsified in the complete Freund's adjuvant and injected subcutaneously or intraperitoneally in an amount of 1-100 micrograms. Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemicaal Research, Hamilton, MI) and injected into the pads of the animal's hind legs. The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. From there for several weeks, the mice can also be reinforced with additional immunization injections. Serum samples can be periodically obtained from the mice by retro-orbital bleeding to be tested in ELISA assays to detect antibodies to the anti-PRO polypeptide.

After the titer a suitable antibody has been detected, the animals "positive" for antibodies can be injected with a final intravenous injection of PRO polypeptide. Three to four days later, the mice are sacrificed and the lung cells are harvested. The lung cells are then fused (using 35 I polyethylene glycol) to a selected murine myeloma cell line such as P3X63AgU.I, available from ATCC, No. CRL 1597. The fusions generate hybridoma cells which can then be plaqueated into plates of 96 tissue culture wells containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit the proliferation of non-fused cells, hybrid myelones, and hybrid lung cells.

The hybridoma cells will be screened in an ELISA for reactivity against the PRO polypeptide. The "positive" determination of hybridoma cells secrete the desired monoclonal antibodies against the PRO polypeptide, is in the experience in the art.

Hybridoma positive cells can be injected intraperitoneally into syngeneic Balb / c mice to produce ascites containing monoclonal antibodies to the anti-PRO polypeptide. Alternatively, hybridoma cells can be developed in tissue culture flasks or cylinder bottles. The purification of monoclonal antibodies produced in the ascites can be achieved by using ammonium sulfate precipitation, followed by gel-exclusion chromatography. Alternatively, affinity chromatography based on the binding of the antibody to protein A or protein G may be employed.

EXAMPLE 25: Chimeric PRO polypeptides PRO polypeptides can be expressed as chimeric proteins with one or more additional polypeptide regions added to facilitate the purification of the protein. Such regions that facilitate purification include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, regions of protein A that allow purification on immobilized immunoglobulins, and the region used in the FLAGS. ™ Extension / affinity purification system (Immunex Corp.), Seattle Wash). The inclusion of a divisible annealing sequence such as factor XA or enterokinase (Invitrogen, San Diego, Calif.) Between the purification region and the PROO polypeptide sequence may be useful to facilitate the expression of DNA encoding the PRO polypeptide.

EXAMPLE 26: Purification of PRO Polypeptides using specific antibodies.

Recombinant or native PRO polypeptides can be purified by a variety of standard techniques in the art of protein purification. For example, pro-PRO polypeptide, mature PRO polypeptide, or the pre-PRO polypeptide are purified by immunoaffinity chromatography using antibodies specific for the PRO polypeptide of interest. In general, an immunoaffinity column is constructed by covalently coupling the anti-PRO polypeptide antibody to an activated chromatographic resin.

Polyclonal immunoglobulins are prepared from immune serum either by precipitation with ammonium sulfate or by purification on immobilized protein A (Pharmacia LKB Biotechnology, Piscataway, N.J.).

Similarly, monoclonal antibodies are prepared from mouse ascites fluid by precipitation with ammonium sulfate or chromatography on immobilized Protein A. The partially purified immunoglobulin is covalently bound to a chromatographic resin such as SEPHAROSE ™ CnBr-activated (Pharmacia LKB Biotechnology). The antibody is coupled to the resin, the resin is blocked, and the derived resin is washed in accordance with. the manufacturer's instructions. Such an immunoaffinity column is used in the purification of PRO polypeptide by preparation of a fraction of PRO polypeptide-containing cells in a soluble form. This preparation is derived by solubilization of whole cells or of a subcellular fraction obtained via differential centrifugation by the addition of detergents or by other methods well known in the art. Alternatively, the soluble PRO polypeptide, which contains an indicator sequence can be secreted in useful amounts in the medium in which the cells are developed.

A PRO polypeptide-containing preparation is passed over the immunoaffinity column, and the column is washed under conditions that allow preferential absorbance of the PRO polypeptide (eg, ionic strength can regulators in the presence of detergent). The column is then eluted under conditions that disrupt the antibody / PRO polypeptide linkage (e.g., a low pH regulator such as about 2-3, or a high concentration of chaotropes such as urea or thiocyanate ion), and the PRO polypeptide. It is collected.

EXAMPLE 27: Drug Screening This invention is particularly useful for screening compounds by using PRO polypeptides or binding fragments thereof in any of a variety of drug screening techniques. The PRO polypeptide or fragments used in such test urn may either be free in solution, fixed to a solid support, supported on a cell surface, or located intraceiularly. A method of screening drugs uses eukaryotic or prokaryotic host cells that are stably transformed with recombinant nucleic acids that express the PRO polypeptide or fragment. The drugs are screened against such transformed cells in comparative binding assays. Such cells, either in a viable or fixed form, can be used for standard binding assays. One can measure for example, the formation of complexes between the PRO polypeptide or a fragment and the agent being tested. Alternatively, one can examine the decrease in complex formation between the PRO polypeptide and its target cell or target receptors caused by the agent being tested.

Thus the present invention provides cribasso methods for drugs or other agents that can affect a disease or disorder associated with the PRO polypeptide. These methods comprise contacting such an agent with a PRO polypeptide or fragment thereof and assaying (1) for the presence of a complex between the agent and the PRO polypeptide or fragment, or (ii) for the presence of a complex between the polypeptide. PRO ófragmento and the cell, by methods well known in the art. In such comparative binding assays, the PRO polypeptide or fragment is typically labeled. After adequate incubation, the free PRO polypeptide or fragment is separated from that which "occurs in bound form, and the amount of free or uncomplexed marker is a measure of the ability of the particular agent to bind to the PRO polypeptide or to interfere with the PRO cell / polypeptide complex.

Another technique for screening drugs provides a high screening product for compounds that have adequate binding affinity to a polypeptide and is described in detail in WOO 84/03564, published on September 13, 1984. Briefly stated, large number of different small test compounds Peptides are synthesized on a solid substrate, such as plastic needles or some other surface. As applied to a PRQ polypeptide, the peptide test compounds are reacted with the PRO polypeptide and washed. The bound PRO polypeptide is detected by methods well known in the art. The purified PRO polypeptide can also be directly coated on plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on the solid support.

This invention also contemplates the use of comparative drug screening assays in which neutralizing antibodies capable of binding specifically to the PRO polypeptide competes with a test compound to bind to the PRO polypeptide or fragments thereof. In this manner, the antibodies can be used to detect the presence of some peptide which shares one or more antigenic determinants with the PRO polypeptide.

EXAMPLE 28: Rational Drug Design The objective of rational drug design is to produce structural analogs of biologically active polypeptides of interest (eg a PRO polypeptide) or of small molecules with which they interact, for example, agonists, antagonists, or inhibitors,. Some of these examples can be used for fashionable drugs that are more active or stable forms of the PRO polypeptide or that improve or interfere with the function of the PRO polypeptide in vivo (see, Hodgson, Bio / Technology, 9: 19: 21 (1991 )).

In one approach, the three-dimensional structure of the inhibitor-PRO polypeptide complex is determined by X-ray crystallography, by co-putational models or, more typically, by a combination of the two approaches. Both, the shape and loading of the PRO polypeptide must be successful to elucidate the structure and determine the active sites of the molecule. Less often, useful information regarding the. Structure of the PRO polypeptide can be gained by modeling based on the structure of homologous proteins. In both cases, relevant structural information is used to design analogs of PRO-like polypeptide molecules or to identify efficient inhibitors. Useful examples of rational drug design may include molecules that have improved activity or stability as disclosed by Braxton and Wells, Biochemistry, 31: 7796-7801 (1992) or which act as inhibitors, agonists, or antagonists of native peptides as discussed by Athauda et al. , J. Biochem., 113: 742-746 (1993).

It is also possible to isolate a target-specific antibody, selected by functional assay, as described above, and then resolve its crystallographic structure. This approach, in principle, produces a farmacore in which subsequent drug designs can be based. It is possible to deviate the crystallography of the protein altogether by generating anti-idiotypic antibodies (anti-ids) for a functional, pharmacologically active antibody. Like a mirror image of a mirror image, the binding site of the anti-ids would be expected to be an analogue of the original receiver. The anti-id could then be used to identify and isolate peptides from libraries of chemically or biologically produced peptides. The isolated peptides would then act as the farmacore.

By virtue of the present invention, sufficient quantities of the PRO polypeptide can be made available to perform such analytical studies as X-ray crystallography. In addition, knowledge of the amino acid sequence of the PRO polypeptide provided herein will provide a guide for those employing computer model techniques instead of or in addition to X-ray crystallography.

EXAMPLE 20; Ability of PR0241 to Stimulate the Release of Proteoglycans from Cartilage The ability of PR0241 to stimulate the release of proteoglycans from cartilage tissue was examined as follows.

The metacarpophalangeal joint of pigs 4-6 months of age was aseptically dissected, and the articular cartilage was removed by free-hand cutting with the immediate bone carefully avoided. The cartilage was slurried and grown in bulk for 24 hours in a humidified atmosphere of 95% air, 5% C02 is medium (DME / F12 1: 1) serum free (SF); BSA 0.1% and 100 U / ml of penicillin and 100 μg / ml of streptomycin. After washing several times, approximately 100 mg of articular cartilage was aliquoted in micron tubes and incubated for an additional 24 hours in the previous SF medium. PR0241 polypeptides were then added to 1% either alone or in combination with 18 ng / ml of interleukin-1, a known simulator of proteoglycan release from cartilage tissue. The supernatant was then harvested and assayed for the amount of proteoglycans using the colorimetric assay for 1, 9-dimethymethylene blue (DMB) (Farndale and Buttle, Biochem Biophys, Acta 883: 173-177 (1985)). A positive result in this assay indicates that the test polypeptide will find use, for example, in the treatment of joint-related sports problems, articular cartilage defects, osteoarthritis or rheumatoid arthritis.

When the PRO polypeptides were examined in the previous test, the polypeptides showed a marked ability to stimulate the release of proteoglycans from the cartilage tissue bothbasically and by stimulation with interleukin-la and in 24 to 72 hours after treatment, thereby indicating that PR0241 polypeptides are useful to stimulate the release of proteoglycans from cartilage tissue.

EXAMPLE 30: In Situ Hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences in cell and tissue preparations. It may be useful, for example, to identify gene expression sites, analyze the tissue transcript distribution, identify and localize viral infection, track changes in specific mRNA synthesis and help in chromosome mapping.

The in situ hybridisation was carried out following an optimized version of the protocol by Lu and Gillett, Cell Vision 1: 169-176 (1994), using 35P-labeled riboprobes generated by PCR. Briefly, human tissues fixed to formalin, embedded in paraffin were sectioned, deparaffinized, and deproteinated. proteinace K (20 'g / ml) for 15 minutes at 37 ° C, and i further processed for in situ hybridization as described in Lu and Gillett. [35-P] UTP-labeled antisense riboprobes were gen- erated from a PCR product and hybridized at 55 ° C overnight. The plates were immersed in the Kodak NTB2 nuclear emulsion and track and exposed for four weeks.

Synthesis of Ribosonde- '35t 6. 0 μl (125 mCi) of 35P-UTP (Amersham BF 1002, SA <2000 Ci / moles) were dried by vacuum centrifugation. 'To each tube containing the dried 35P-UTP, the following ingredients were added: 2. 0 μl 5 X Transcription Regulatory Solution 1. 0 μl of DTT (100 mM) 2. 0 μl of NTP mixture (2.5 mM: 10 μ, each of 10 mM of GTP, CTP &ATP + 10 μl of H20) 1. 0 μl of UTP (50 μM) 1-0 μl of Rnasin 1-0 μl of hardened DNA (1 μg) 1.0 μl H20 1-0 μl of RNA polymerase (for PCR products T3 = AS, T7 = S, usually) The tubes were incubated at 37 ° C for one hour. 1.0 μl of RQ1 Dnasa were added, followed by incubation at 37 ° C for 15 minutes. 90 μl of TE (10 mM Tris pH 7.6 / 1 mM EDTA pH 8.0) were added, and the mixture was pipetted onto DE81 paper. The remaining solution was loaded in a Microcon-50 ultrafiltration unit, and turned on using program 10 (6 minutes). The filtration unit was inverted during a second tube and agitated using program 2 (3 minutes). After final recovery of the rotated product, 100 μl of TE was added. 1 μl of the final product was pipetted on DE81 paper and counted in 6 ml of Bíofluor II.

The probe was run on a urea / TBE gel. 1- 3 μl of the probe or 5 μl of RNA Mrk III were added to 3 μl of charge regulator. After heating on a block of heat at 95 ° C for three minutes, the gel was immediately placed on ice. The gel wells were discharged, the sample loaded, and run at 180-250 volts for 45 minutes. The gel was wrapped in sarin wrap and exposed to the XAR film with an intensifying freezer screen at -70 ° C for one hour overnight.

Hybridization - 35t A. Pre-treatment of frozen sections The plates were removed from the freezer, placed on an aluminum tray and thawed at room temperature for 5 minutes. The trays were placed in an incubator at 55 ° C for 5 minutes to reduce condensation. The plates were fixed for 10 minutes in 4% paraformaldehyde on ice in the cap vapor, and washed in 0.5 X SSC for 5 minutes, at room temperature (25 ml 20 X SSC + 975 ml SQ H20). After deproteination in 0.5 μg / ml protein K for 10 minutes at 37 ° C (12.5 μl of 10 mg / ml of stock in 250 ml of RNase-free RNase buffer preheated), the sections were washed in 0.5 X SSC by 10 minutes at room temperature. The sections were dehydrated in 70% ethanol, 95%, 100%, 2 minutes each.

B. Pretreatment of Paraffin-embedded Sections The plates were dewaxed, placed in SQ H20, and rinsed twice in 2 X SSC at room temperature, for five minutes each time. Sections were deproteinated in 20 μg / ml K proteinase (500 μl 10 mg / ml in 250 ml of Rnasa-free Rnasa buffer, 37 ° C, 15 minutes) - human embryo, or 8 X proteinaza K (100 μl in 250 ml of Rnasa regulator, 37 ° C, 30 minutes) -made in formalin. Subsequent rinses in 0.5 X SSC and dehydration were performed as described above.

C. Pre-hybridization The plates were deactivated in a plastic box I aligned with a regulating box (4 X SSC, 50% formamide) - saturated filter paper. The tissue was covered with 50 μl of hybridization buffer (3.75 g of dextran sulfate + 6 ml of SQ H20), vortexed and heated in the microwave for 2 minutes with the cap off. After cooling on ice, 18.75 ml of formamide, 3.75 ml of 20 X SSC and 9 ml of SQ H ^ O were scored, the tissue vortexed well, and incubated at 42 ° C for 1-4 hours.

D. Hybridization 1. 0 X 106 cpm of probe and 1.0 μl of tRNA (50 mg / ml of stock solution) per plate were heated at 95 ° C for 3 minutes. The plates were cooled on ice, and 48 μl of hybridization buffer were added per plate. After vortexing, 50 μl of 35P mixture was added to 50 μl of prehybridization on the plate. The plates were incubated overnight at 55 ° C.

F. Washes Washes were given 2 X 10 minutes with 2 X SSC, EDTA at room temperature (400 ml 20 X SSC + 16 ml EDTA 0.25 M, Vf = 4L), followed by Rnasa treatment at 37 ° C for 30 minutes (500 (1 of 10 mg / ml in 250 ml of Rnasa regulator = 20 μg / ml) The plates were washed 2 X 10 minutes with 2 X SSC, EDTA at room temperature The conditions of wash severity were as follows: hours at 55 ° C, 0.1 X SSC, EDTA (20 ml 20 X SSC + 16 ml EDTA, Vf = 4L).

F. Oligonucleotides In situ analysis was performed on a variety of DNA sequences set forth herein. The oligonucleotides used for these analyzes are as follows.

DNA 48 (V 248 (»RQ357> S'-GGATTCTAATACGACTCACTATAGGGCTGCCCGCAACCCCTTCAACTG-S ^ Sec. No .: I04) S'-CTATGAAATTAACCCTCACTAAAGGGACCGCAGCTGGGTGACCGTGTA-S'Í SecIdNo: IOS) ñNA52722-1229 rPR071S 5'-GGATTCTAATACGACTCACtATAGGGCCGCCCCGCCACCTCCT-3 '(SecIdNo:' 106) S'-CTATGAAAT AACCCTCACTAAAGGGACTCGAGACACCACCTGACCCA-S Sec IdNo: 107) 5 * -GGATrCTAATACGACTCACTATAGGGCCCAAGGAAGGCAGGAGACTCT-3 SecIdNo: > : 108) S'-CTATGAAATTAACCCTCACTAAAGGGACTAGGGGGTGGGAATGAAAAG-S ^ SecIdNo:: 109) P A381 13-123Q (TR0327) 5'-GGATTCTAATACGACTCACTATAGGGCCCCCCTGAGCTCTCCCGTGTA-3 (SecIdNo: i: 110) 5'-CTATGAAATrAACCCTCACTA? AGGGAAGGCTCGCCACTGGTCGTAGA-3 $ (SacIdNo c 111) DNA3S917.1207 fl RO243 ^ 5'-GGATTCTAATACGACTCACTATAGGGCA? GGAGCCGGGACCCAsGAGA-3 '(SecIdNO: = 112) S'-CTATGAAATTAACCCTCACTAAAGGGAGGGGGCCCTTGGTGCTGAGt-S SecIdNo:: 113) G.Results In situ analyzes were performed on a variety of DNA sequences set forth herein. The results of these analyzes are as follows.

(DDNA44804-1248 (PR0357) Low to moderate level of expression in bone formation sites in fetal tissues and in malignant cells of an osteosarcoma. Possible signal in placenta and cord. All other negative tissues.

Fetal tissues examined EI12-E16 weeks, include: liver, kidney, suprarenal glands, lungs, heart, large vessels, esophagus, stomach, spleen, gonads, brain, spinal cord and body walls.

Adult human tissues examined: liver, stomach, spleen, suprarenal glands, pancreas, lung, colon carcinoma, carcinoma and renal cell osteosarcoma. Liver damage induced by acetaminophen and liver cirrhosis. Chimpanzee tissues examined: thyroid, parathyroid, two lymphatics, nerves, tongue, thymus, adrenal glands, gastric mucosa and salivary glands. I, Rhesus monkey: brain and cerebellum. (2) DNA52722-1229 (PRQ715) High generalized signal appears on tissues-higher signal appears on placenta, osteoblast, damaged renal tubules, damaged liver, metastasiss of colorectal liver and gallbladder.

Fetal tissues examined: (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, suprarenal glands, thyroid, lungs, heart, large vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body walls, pelvis and lower limbs.

Adult human tissues examined: liver, kidney, suprarenal glands, myocardium, aorta, spleen, lung, skin, chondrosarcoma, eye, stomach, colon, colonic carcinoma, prostate, gall bladder and gallbladder, liver damage induced by acetaminophen, hepatic cirrhosis.

Rehsus tissues examined: cerebral cortex (rm), hippocampus (rm) Chi p tissues examined: thyroid, parathyroid, lymph nodes, nerves, tongue, thymus, suprarenal glands, gastric mucosa and salivary glands. (3) DNA38113-1230 (PR0327) High level of expression observed in human fetal lung and developed mice. Normal human adult lung, which. It includes bronchial epithelium, they were negative. Expression in the submucosa of the human fetal trachea, possibly in cells of the buccal mucosa. Expression also observed in non-thromboblastic cells of uncertain histogenesis in the human placenta t. In the expression of the mouth development of the muzzle and in the development of the tongue was observed. All other tissues were negative. Speculated function: Probable role in bronchial development.

Fetal tissues examined (E12-E16 weeks) include; placenta, umbilical cord, liver, kidney, suprarenal glands, thyroid, lungs, heart, large vessels, esophagus, small intestine stomach, spleen, thymus, pancreas, brain, eye, spinal cord, body walls, pelvis, and lower limbs. I Examined adult tissues: liver, kidney, suprarenal glands, myocardium, aorta, spleen, nodes. lymphatics, pancreas, lung, skin, cerebral cortex (rm), hippocampus (r), cerebellum (rm), penis, eye, gallbladder, stomach, gastric carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid (chimp) ovary (chi p) and chondrosarcoma, (4 DNA35917-1207 (PR0243) Cornelia de Lange syndrome (CdLS) is a congenital syndrome. This means that it is present from birth. CdLS is a disorder that causes a retraction in physical, intellectual, and language development. The vast majority of children with CdLS are mentally retarded, with the degree of mental retardation in the range from medium to severe. IQs reported from 30 to 85. The average IQ is 53. Head and facial features include small head size, thin eyebrows, which are often found in the midline, long eyelashes, short nose bend , thin sagging lips, low ears and high or cracked palatal arch. Other characteristics may include delay in language, even in the most mildly affected, retarded growth and small stature, low scream tone, small hands and feet, five fingers without curve, simian wrinkles, and excessive body hair. The diagnosis depends on the presence of a combination of these characteristics. Many of these characteristics appear in various degrees. In some cases these characteristics may not be present or be so light that they will be recognized only when observed by a trained geneticist or another person familiar with the syndrome. Although much is known about CdLS, recent reports suggest that there is much more to learn.

In this additional section of the study, face, fetal head, limbs and embryo mouths were examined. No expression was seen in any of the tissues of the mouth. Expression was only seen with an antisense probe.

The expression was observed adjacent to the developed limb and facial bones in the periosteal mesenchyme. The expression was highly specific and was often adjacent to areas subject to vascularization. The distribution is consistent with the skeletal abnormalities observed in the Cornelia de Lange Syndrome, Expression was also observed in the development of the temporal and occipital lobes of the fetal brain, but was not observed elsewhere. In addition, expression was seen in the ganglion of the development of the inner ear; the meaning of this meeting is not clear, Although this data does not provide functional information, the distribution is consistent with the sites that are known to be most severely affected in this syndrome.

Additionally, slight expression was observed in the line of division in the development of the synovial joint that is formed between the femoral head and the acetabulum (joint axis). If this pattern of expression was observed in joint formation sites elsewhere, this would explain the facial and limb abnormalities observed in Cornelia de Lange syndrome.

EXAMPLE 31; activity of PRQ243 mRNA in Xenopus Oocytes In order to demonstrate that the human chordin clone (DNA35917-1207) coding for PR0243 is functional and acts in a manner predicted by the Xenopus Chordin and Drosophila sog genes, DNA from superspiral plasmids from DNA35917-1207 was prepared by Qiagen and used for injection in Xenopus lavéis embryos. Micro-injection of Xenopus chordin mRNA in blastomeres ventrovegetal.es induces secondary (paired) axes (Sacia et al., Cell 79: 779-790 (1994) and Drosophila sog also induces a secondary axis when it is expressed ectopically on the ventral side of the Xenopus embryo (Holleey et al., Nature 376: 249-253 (1995) and Schmidt et al., Developement 121: 43119-4328 (1995)). The ability of sog to function in Xenopus oocytes suggests that the process involved in the dorsoventral pattern It has been observed during evolution.

Methods Manipulation of the Xenopus embryo: Adult female toads were reinforced with 200 I I.U. of pregnant mare serum 3 days before use and with 800 IU of human chorionic gonadotropin the night before injection. Freshly prepared oocytes were squeezed from female toads the following morning and in vitro and oocyte fertilization was performed by mixing the oocytes with shredded testis of male toads slaughtered. The developed embryos were maintained and organized according to Nieuwkoop and Faber, Normal Table of Xenopus laecis, N. -H. P. Co. Ed. (Amsterdam, 1967).

The fertilized eggs were degelatinized with 2% cysteine (pH 7.8) for 10 minutes, washed once with distilled water and transferred to 0.1 X MBS with 5% Ficoll. The fertilized eggs were aligned on injection trays in 0.1 X MBS with 5% Ficoll. Stage two of cells that developed Xenopus embryos were injected with 200 pg of pRK containing wild type ccchordin (DNA35917-1207) or 200 pg of pRK5 without an insert as control. The injected embryos were kept on trays for another 6 hours, after which they were transferred to 0.1 X MBS with 50 mg / ml of gentamicin until reaching stages 37-38 of Nieukwkoop.

Results The injection of human chordin cDNA into blastomeres alone resulted in ventralization of the tadpole. The ventralization of the tadpole is visible in the shortening and small class of the tail and expansion of the consolidated gland. The ability of the human chordin to function as a ventralizing agent ex Xenopus shows that the protein encoded by DNA35917-1207 is functional and influences the ventral dorsal behavior in toads and suggests that the process involved in dorsoventral behavior has been conserved during evolution, with mechanisms in common between humans, flies and toads.

Deposit of material The following materials have been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD, USA (ATCC): Material Deposit No. Date of ATCC Deposit DNA34392-1170 ATCC 209526 December 10, 1997 DNA35917-1207 ATCC 209508 December 3, 1997 DNA39976-1215 ATCC 209524 December 10, 1997 DNA35595-1228 ATCC 209528 December 10, 1997 DNA38113-1230 ATCC 209530 December 10, 1997 DNA34436-1238 ATCC 209523 December 10, 1997 DNA40592-1242 ATCC 209492 November 21, 1997 DNA44176-1244 ATCC 209532 December 10, 1997 DNA44192-1246 ATCC 209531 December 10, 1997 DNA39518-1247 ATCC 209529 December 10, 1997 DNA44804-1248 ATCC 209527 December 10, 1997 Material Deposit No. Date of ATCC Deposit DNA57722-1229 ATCC 209570 January 7 of 199I DNA41234-1242 ATCC 209618 February 5 of 199? DNA45410-1250 ATCC 209621 February 5 of 199? DNA46777-1253 ATCC 209619 February 5, 1998 These facts were made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedures and the Regulations of the Treaties (Budapest Treaty). This ensures the maintenance of a viable deposit culture for 30 years from the date of deposit. Deposits will be available by ATCC under the terms of the Budapest Treaty., and subject to an approval between Genentech, Inc. and ATCC, which ensures permanent and unrestricted availability of the crop progeny to the public from the issuance of the relevant US Patent or from the open placement of any application to the public. of US or foreign patent, whichever occurs first, and ensures the availability of the progeny for one determined by the US Patent and Trademark Commission to be holders of it pursuant to 35 USC paragraph 122 and the Commission Rules that continue with these (which include 37 CFR incisso 1.14 with particular reference to 886 OG 638).

The assignee of the present application has authorized that if the cultivation of the materials in deposit died or were lost or destroyed when they were cultivated under suitable conditions, the materials will be promptly replaced upon notification with other equals. Availability of the deposited material is not constructed as a license to practice the invention in contravention of the rights guaranteed under the authority of any government in accordance with its patent laws.

The above-written specification is considered sufficient to enable an expert in the field to practice the invention. The present invention is not limited to scope by the deposited construction, since the deposited mode is intended as a single illustration of certain aspects of the invention and any construction that is functionally equivalent is within the scope of this invention. Material deposits do not constitute an admission that the written description contained herein is inadequate to facilitate the practice of any aspect of the invention, including the best mode thereof, nor is it constructed to limit the scope of claims to The specific illustrations that it represents, indeed, various modifications of the invention in addition to those set forth and described herein will be apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

It is noted that in relation to this date the best method known by the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Having described the invention as above, it is claimed as property in the following:

Claims (18)

1. Isolated nucleic acid having at least 80% sequence identity with a nucleotide sequence encoding a polypeptide, which is characterized in that it comprises an amino acid sequence selected from the group consisting of the amino acid sequence set forth in Figure 2 ( SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 15), Figure 11 (SEQ ID NO: 19), Figure 13 (SEQ ID NO: 24), Figure 15 ( SEQ ID NO: 30), Figure 17 (SEQ ID NO: 32), Figure 19 (SEQ ID NO: 337), Figure 21 (SEQ ID NO: 42), Figure 23 (SEQ ID NO: 50), Figure 25 ( SEQ ID NO: 55), Figure 27 (SEQ ID NO: 61), Figure 29 (SEQ ID NO: 69), Figure 31 (SEQ ID NO: 76), Figure 35 (SEQ ID NO: 86), Figure 37 ( SEQ ID NO: 91), and Figure 39 (SEQ ID NO: 99).

2. The nucleic acid of Claim 1, which is characterized in that said nucleotide sequence comprises a nucleotide sequence selected from the group consisting of the sequence set forth in Fig. 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 14), Figure 10 (SEQ ID NO: 18), Figure 12 (SEQ ID NO: 23), Figure 14 (SEQ ID NO: 29), Figure 16 (SEQ ID NO: 31), Figure 18 (SEQ ID NO: 36), Figure 20 (SEC 10 NO: 41), Figure. 22 _ (SEQ ID NO: 49), Figure 24 (SEQ ID NO: 54), Figure 26 (SEQ ID BO: 60), Figure 28 (SEQ ID NO: 68), Figure 30 (SEQ ID NO: 75), Figure 34 (SEQ ID NO: 85), Figure 36 (SEQ ID NO: 90), and Figure 38 (SEQ ID NO: 98), or the complement thereof.

3. The nucleic acid of Claim 1, which is characterized in that said nucleotide sequence comprises a nucleotide sequence selected from the group consisting of the coding sequence of total extension of the sequence set forth in Figure 1. (SEQ ID NO: l), Figure 3 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 6) NO: 14), Figure 10 (SEQ ID NO: 18), Figure 12 (SEQ ID NO: 23), Figure 14 (SEQ ID NO: 29), Figure 16 (SEQ ID NO: 31), Figure 18 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 41), Figure 22 (SEQ ID NO: 49), Figure 24 (SEQ ID NO: 54), Figure 26 (SEQ ID NO: 60), Figure 228 (SEQ ID NO: 68), Figure 30 (SEQ ID NO: 75), Figure 34 (SEQ ID NO: 85), Figure 36 (SEQ ID NO: 90) and Figure 38 (SEQ ID NO: 98), or the complement thereof.

4. Isolated nucleic acid which is characterized in that it comprises the total DNA coding sequence deposited under the accession numbers ATCC 209526, ATCC 209508, ATCC 209524, ATCC 209528, ATCC 209530, ATCC 209523, ATCC 209492, ATCC 209532, ATCC 209531, ATCC 209529, ATCC 209527, ATCC 209570, ATCC 209618, ATCC 209621 or ATCC 209619.

5. A vector comprising the nucleic acid of Claim 1.

6. The vector of Claim 5 is operably linked to control sequences recognized by a human cell transformed with the vector.

7. A host cell comprising the vector of Claim 5.

8. The host cell of Claim 7 which is characterized in that said cell is a CHO cell.

9. The host cell of Claim 7 which is characterized in that said cell is an E. coli.

10. The host cell of Claim 7 which is characterized in that said cell is a yeast cell.

11. A process for producing the PRO polypeptides which is characterized in that it comprises culturing the host cell of Claim 7 under conditions suitable for expression of said PRO polypeptide and recovery of said PRO polypeptide from cell culture.

12- Isolated native sequence PRO polypeptide that is characterized by having at least 80% sequence identity with an amino acid sequence selected from the group consisting of the amino acid sequence set forth in Figure 2 (SRC ID NO: 2) , Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 15), Figure 11 (SEQ ID NO: 19), Figure 13 (SEQ ID NO: 24), Figure 15 (SEQ ID NO: 30), Figure 17 (SEQ ID NO; 32), Figure 19 (SEQ ID NO: 37), Figure 21 (SEQ ID NO: 42), Figure 23 (SEQ ID NO: 50), Figure 25 (SEQ ID NO: 55), Figure 27 (SEQ ID NO: 61), Figure 29 (SEQ ID NO: 69), Figure 31 (SEQ ID NO: 76), Figure 35 (SEQ ID NO: 86), Figure 37 (SEQ ID NO: 91), and Figure, 39 (SEQ ID NO: 99).

13. Isolated PRO polypeptide which is characterized by having at least 80% sequence identity with the amino acid sequence encoded by the nucleotide deposited under the accession numbers ATCC 209526, ATCC 209508, ATCC 209524, ATCC 209528, ATCC 222095330, ATCC 2209523, ATCC 209492, ATCC 209532, ATCC209531, ATCC 209529, ATCC 209527, ATCC 209570, ATCC 209618, ATCC 209621 or ATCC 209619.

14, A chimeric molecule that is characterized in that it comprises a polypeptide according to claim 12 fused to a heterologous amino acid sequence.

15- The chimeric molecule of Claim 14 which is characterized in that said heterologous amino acid sequence is an epitope tag sequence.

16. The chimeric molecule of Claim 14 which is characterized in that said heterologous amino acid sequence is an Fe region of an immunoglobulin.

17. An antibody that is characterized in that it specifically s to a PRO polypeptide according to Claim 12.

18. The antibody of Claim 17 which is characterized in that said antibody is a monoclonal antibody.