EP1735460A1 - Procede d'analyse pour determiner la methylation de la cytoseine - Google Patents

Procede d'analyse pour determiner la methylation de la cytoseine

Info

Publication number
EP1735460A1
EP1735460A1 EP05716469A EP05716469A EP1735460A1 EP 1735460 A1 EP1735460 A1 EP 1735460A1 EP 05716469 A EP05716469 A EP 05716469A EP 05716469 A EP05716469 A EP 05716469A EP 1735460 A1 EP1735460 A1 EP 1735460A1
Authority
EP
European Patent Office
Prior art keywords
dna
rna
methylation
analysis
amplification
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05716469A
Other languages
German (de)
English (en)
Inventor
Dimo Dietrich
Philipp Schatz
Matthias Schuster
Antje Kluth
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Epigenomics AG filed Critical Epigenomics AG
Priority to EP05716469A priority Critical patent/EP1735460A1/fr
Publication of EP1735460A1 publication Critical patent/EP1735460A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification

Definitions

  • the present invention relates to a method for the analysis of methylated cytosine positions in DNA.
  • 5-Methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. It plays an important biological role, e.g. in transcription regulation, in genetic imprinting and in tumorigenesis (for an overview: Millar et al.: Five not four: History and significance of the fifth base. In: Ttie Epigenome, S. Beck and A. Olek (eds .), Wiley-VCH Verlag Weinheim 2003, pp. 3-20).
  • the identification of 5-methylcytosine as a component of genetic information is therefore of considerable interest. Detection of the methylation is difficult, however, since cytosine and 5-methylcytosine have the same base pairing behavior. Many of the conventional detection methods based on hybridization are therefore unable to differentiate between cytosine and methylcytosine. In addition, the methylation information is completely lost during PCR amplification.
  • methylation-specific restriction enzymes are used, on the other hand, there is a selective chemical conversion of unmethylated cytosines into uracil (so-called: bisulfite treatment, see for example: DE 101 54 317 AI; DE 100 29 915 AI). Since the treatment with methylation-specific restriction enzymes is limited to certain sequences by the sequence specificity of the enzymes, bisulfite treatment is carried out for most applications (for an overview, see DE 100 29 915 AI p. 2, lines 35-46). The chemically pretreated DNA is then mostly amplified and can be analyzed in different ways (for an overview: WO 02/072880 p.
  • a selective amplification of only the methylated (or in the reverse approach: unmethylated) DNA can be carried out using methylation-specific primers or blockers (so-called methylation-sensitive PCR / MSP or heavy methyl method, see: Herman et al.: Methylation-specific PCR: a novel PCR assay for methylation Status of CpG islands. Proc Natl Acad Sei US A.
  • RNA is more suitable than DNA for mass spectrometric analysis (see below). Detection via hybridization can also be carried out more easily due to the single-stranded nature of the RNA (see below).
  • RNA - but not the DNA - can be chemically or enzymatically fragmented so that the fragmentation pattern depends on the original methylation status of the DNA (see below).
  • the conversion to RNA also allows the use of transcription-based amplification methods. This has several advantages (see below).
  • a particular embodiment of the method for methylation analysis according to the invention is characterized in that the bisulfited DNA is converted into RNA by means of a transcription-based amplification method (TAS-transcription-based amplification system).
  • TAS-transcription-based amplification system a transcription-based amplification method
  • NASBA TM Characteristics and applications of nucleic acid sequence-based amplification (NASBA). Mol Biotechnol 2002 Feb; 20 (2): 163-79 with further evidence).
  • TAS amplification methods has several advantages over the known PCR methods, which are described in detail in the publications cited above. This includes in particular the isothermal course of the reaction.
  • the amplification takes place in the presence of so-called blocker oligonucleotides.
  • the blockers bind to the so-called “background nucleic acids” and make their amplification more difficult. In this way, an increase in the specificity of the methylation analysis can be achieved.
  • Background nucleic acid means that RNA or DNA that carries the same base sequence as the DNA that is detected.
  • blocker oligonucleotides according to the invention leads to an increased specificity and a reduced risk of false-positive results.
  • methylation-specific blocker oligonucleotides in methylation-specific PCR is already known (so-called HeavyMethyl TM method, Cottrell et al 2004, op. Cit.).
  • HeavyMethyl TM method Cottrell et al 2004, op. Cit.
  • blockers in an isothermal amplification process for methylation analysis has not yet been described.
  • a further particular embodiment of the method for methylation analysis according to the invention is characterized in that the bisulfited DNA is converted into RNA and the RNA is then chemically or enzymatically fragmented such that the fragmentation pattern is dependent on the original methylation status of the DNA.
  • the fragments can then be detected chromatographically or mass spectrometrically (see below).
  • This method has several advantages over the known methods for methylation analysis. This makes it possible to elucidate detailed methylation patterns within a CpG island in an allele.
  • the common methods for methylation-specific detection are hardly able to detect the methylation states of several cytosine positions at the same time. Only bisulfite sequencing methods allow the detection of individual cytosine methylations.
  • bisulfite sequencing has the disadvantage that positions in the immediate vicinity of the sequencing primer are difficult to can be pointed. The same applies to positions that are far from the start of sequencing.
  • the method according to the invention is faster, cheaper and easier to automate than sequencing.
  • the transcripts are analyzed by mass spectroscopy.
  • RNA is better suited for mass spectrometric analysis than DNA.
  • the 2 'OH group of the ribose ring thus stabilizes the N-glycosidic bond between the nucleus base and ribose. This prevents the typical depurination in a mass spectrometric analysis.
  • RNA is more suitable than DNA for this type of analysis (see: Kirpekar et al.: Matrix assisted laser desorption / ionization mass spectrometry of enzymatically synthesized RNA up to 150 kDa. Nucl. Acids. Res.
  • a particularly preferred embodiment of the embodiments of the method according to the invention combines a methylation-specific enzymatic fragmentation (see above) with a subsequent mass spectrometric analysis.
  • the RNA is preferably fragmented using the enzyme RNAase T1 and then analyzed using MALDI. Similar methods for the detection of single nucleotide polymorphisms (SNP) or short tandem repetitions (STR) have already been described (Krebs et al.: RNaseCut: a MALDI mass spectrometry-based method for SNP discovery. Nucleic Acids Res. 2003 Apr 1; 31 (7): e37. ; Seichter et al.
  • the invention is a method for the analysis of cytosine methylations in DNA, in which the following steps are carried out:
  • the DNA to be examined is implemented in such a way that 5-methylcytosine remains unchanged, while unmethylated cytosine in uracil or in another base which differs in the base pairing behavior of cytosine, 2) a promoter sequence is introduced into the DNA, 3) RNA is transcribed, 4) the RNA is analyzed, 5) the methylation status of the investigated DNA is inferred.
  • the DNA to be examined is reacted with a chemical or with an enzyme such that 5-methylcytosine remains unchanged, while unmethylated cytosine is converted into uracil or into another base which differs from cytosine in the base pairing behavior .
  • the DNA to be examined can come from different sources.
  • tissue samples are preferred as the starting material, but also body fluids, especially serum. It is also possible to use the DNA from sputum, stool, urine or brain spinal fluid.
  • the DNA is preferably first isolated from the biological sample. DNA is extracted using standard methods, for example from blood using the Qiagen UltraSens DNA Extraction Kit.
  • the isolated DNA can then be fragmented, for example, by reacting with restriction enzymes.
  • the reaction conditions and the enzymes in question are known to the person skilled in the art and result, for example, from the protocols supplied by the manufacturers.
  • the DNA is then converted chemically or enzymatically. Chemical conversion using bisulfite is preferred.
  • the Bisulfite conversion is known to the person skilled in the art in different variations (see, for example: Frommer et al.: A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sei US A. 1992 Mar 1; 89 (5): 1827-31; Olek, A modified and improved method for bisulphite based cytosine methylation analysis.
  • the bisulfite conversion is particularly preferably carried out in the presence of denaturing solvents, for example dioxane, and a radical scavenger (cf. DE 100 29 915).
  • the DNA is not converted chemically, but enzymatically. This is conceivable, for example, through the use of cytidine deaminases, which convert unmethylated cyidines faster than methylated cytidines.
  • a promoter is introduced into the pretreated DNA, which enables the DNA to be examined to be converted into RNA.
  • a PCR is carried out in which one of the primers carries a promoter sequence.
  • the NASBA method or another transcription-based amplification method is used, in which starting from DNA RNA- Amplificates can be produced (see below for details).
  • the amplification is preferably non-specific to methylation.
  • RNA transcription enables a mixture of different DNAs to be used to first increase the subpopulation methylated in the primer binding sequence and to examine it more closely for its methylation. This allows special methylation patterns to be examined more closely, for example when examining sequences which are methylated at their 5 ⁇ end and unmethylated at their 3 'end. These sequences are particularly interesting for the spread of DNA methylation.
  • promoter sequences are also conceivable to ligate the promoter sequences to the DNA independently of an amplification. This is possible, for example, if the bisulfite DNA is cloned into a vector that already carries a promoter. A ligation without prior amplification then has the advantage that the amount of RNA which is later generated by the transcription is linearly dependent on the DNA used. In contrast, the PCR-based methods lead to exponential amplification, which could make quantification more difficult. 17, T3 or SP6 sequences are preferably used as promoters. However, other RNA polymerase promoters can also be used. The promoter sequences are known to the person skilled in the art.
  • the transcription takes place.
  • the RNA polymerases required for this depend on the built-in promoter sequences.
  • the transcription conditions depend on the polymerase used. Details are known to the person skilled in the art.
  • the transcripts are analyzed. From the results, the original methylation status of the examined DNA can then be concluded in the fifth step.
  • the transcripts can be analyzed using a large number of known molecular biological methods, for example via hybridization or sequencing.
  • the detection takes place via hybridization to a microarray. Microarray-based detection can be easier with transcripts than with DNA, since the RNA is already in single-stranded form and therefore no longer has to be denatured before hybridization. Measures which prevent degradation of the RNA are known to the person skilled in the art.
  • the RNA is previously provided with a label, preferably a fluorescent label.
  • RNA polymerase a transcription kit in which amino allyl-labeled nucleotides are incorporated into the RNA
  • the amino allyl nucleotides are used by RNA polymerases with almost the same efficiency as natural nucleotides.
  • a dye is coupled to the modified nucleotides.
  • Further methods for labeling RNA are part of the prior art (see, for example: Monnot et al.: Labeling during cleavage (L.DC), a new labeling approach for RNA. Nucleosides Nucleotides Nucleic Acids. 2001 Apr-Jul; 20 (4 - 7): 1177-9. Proudnilko and Mirzabekov: Chemical methods of DNA and RNA fluorescent labeling. Nucleic Acids Res. 1996 Nov 15; 24 (22): 4535-42).
  • the analysis of the RNA takes place via mass spectrometric methods, for example via electrospray or PSD mass spectrometry (cf. Little et al .: verification of 50 to 100-mer DNA and RNA sequences with high -resolution mass spectrometry.Proc Natl Acad Sei US A. 1995 Mar 14; 92 (6): 2318-22).
  • the use of RNA instead of DNA has the advantage that the RNA is more stable during the mass spectrometric analysis and has better flight characteristics than DNA.
  • the RNA is analyzed using an RNA protection assay. Details are known to the person skilled in the art. Further analysis methods are conceivable which take advantage of the single-strandedness d x RNA or their special chemical or physical properties and are therefore more advantageous than a direct detection of the DNA. The use of these methods is also part of this invention.
  • the RNA is chemically or enzymatically fragmented before analysis.
  • mass spectrometric analysis can be facilitated (see: Krebs et al. 2003, ibid; Seichter et al. 2004, loc. Cit.; Hartmer et al.
  • the promoter sequence and the transcription are carried out in parallel by means of an amplification method based on transcription. Accordingly, this embodiment can be described as follows: Method for the analysis of cytosine methylations in DNA, characterized in that the following steps are carried out: 1) the DNA to be examined is implemented in such a way that 5-methylcytosine remains unchanged, while unmethylated cytosine in uracil or is converted into another base which differs in the base pairing behavior from cytosine, 2) the converted DNA is amplified by means of an aixf transcription-based amplification method, 3) the amplificates are analyzed, 4) the methylation status of the examined DNA is inferred.
  • the samples described in more detail above can serve as the starting material for the method according to the invention.
  • the bisulfite conversion is also carried out as above shown.
  • the converted DNA is amplified using an amplification method based on transcription, in particular using NASBA TM, 3SR TM or TMA TM.
  • the transcription-based amplification methods are n-mimicked for retroviral replication.
  • the amplification of the target sequence is usually carried out using two primers and three enzymes.
  • a T7 pzromotor sequence is introduced into the target sequence via one of the primers, via which RNA can then be generated using a T7 polymerase.
  • the RNA is again converted into DNA via a reverse transcriptase, and RNA-DNA internals that occur in the meantime are broken down by means of an RNAse-H.
  • the amplification is isothermal, usually at 41 ° C.
  • the generated amplificates can be detected using a large number of different methods, for example gel electrophoresis, various chromatographic methods or the use of labeled, in particular fluorescence-maximized, probes.
  • the use of real-time probes (l olecular beacon) has also been described (cf. Deiman et al 2002, loc. Cit.).
  • the detection is carried out using methylation-specific probes which specifically bind only to amplificates with a specific methylation status.
  • the person skilled in the art knows how to carry out the methods described above. In particular, it the reaction conditions, the reaction components, the design of the primers and the Analyseverfahr t s known (for Ü overview see: Deiman et al 2002, a.a_o).
  • the transcription-based amplification methods are used to specifically detect the DNA of a particular methylation status.
  • this is possible via a methylation-specific amplification using methylation-specific primers or methylation-specific blocker oligonucleotides (for the blockers see in detail below).
  • methylation-specific primers preferably only bind to the DNA which has the methylation status Accordingly, the methylation-specific primers carry at least one CpG dinucleotide (for the detection of methylated DNA) or one methylation-specific TG or CA dinucleotide (for the detection of unmethylated DNA on the two possible DNA strands.
  • CpG dinucleotide for the detection of methylated DNA
  • TG or CA dinucleotide for the detection of unmethylated DNA on the two possible DNA strands
  • the principles for the design of the methyl- tion-specific primers are known to the person skilled in the art: the higher the number of methylation-specific dinucleotides and the shorter the length of the primers, the higher the specificity of the amplification.
  • the scope of the methods is restricted the more due to the sequence requirements, the more methylation-specific dinucleotides are to be contained in the primers.
  • 1 to 4 methylation-specific dinucleotides are used in MSP primers.
  • the criteria for primer design known from the MSP also apply to the method according to the invention.
  • the primers must contain more methylation-specific dinucleotides compared to MSP in order to achieve a comparable specificity.
  • both primers are methylation specific.
  • Particularly preferred embodiments use of transcription-based amplification methods in combination with methylation-specific blocker molecules.
  • methylation-specific blocker molecules bind specifically to the background DNA and thus prevent their amplification.
  • HeavyMethyl TM method PCT / EP02 / 02572
  • the use of methylation-specific blockers has several advantages compared to the use of methylation-specific primers (see: Cottrell et al 2004).
  • Process for the analysis of cytosine methylation in DNA characterized in that the following steps are carried out: 1) the DNA to be examined is converted in such a way that 5-methylcytosine remains unchanged, while unmethylated cytosine is converted into uracil or into another base which changes in the base pairing behavior different from cytosine, 2) the converted DNA is amplified by means of a transcription-based amplification process, the amplification taking place in the presence of at least one methylation-specific block molecule that binds specifically to the background nucleic acid and hinders its amplification, 3) the amplificates are analyzed, 4) the methylation status of the investigated DNA is inferred.
  • Background nucleic acid is understood to mean a nucleic acid that can be attributed to a DNA that has the same sequence but a different methylation status than the DNA to be detected. Since the transcription-based amplification is predominantly via RNA Intermediates can bind methylation-specific blockers to the background RNA and prevent their amplification. Nevertheless, the amplification cycle also takes place via a primer extension. This step would be blocked for the background DNA if the blockers attached to the Background DNA binds In the optimal Fs.ll the blocker blocks the amplification via both the RNA and the DNA.
  • Blockers are preferably oligonucleotides, but they can also other molecules, especially PNA, can be used.
  • RNA blockers can also be used in the method according to the invention, since RNA-RNA hybrids are particularly stable.
  • the blockers are methylation-specific, ie they carry at least one CpG or a methylation-specific TG or CA dinucleotide (see above for the primers).
  • the primers are preferably added in excess to the reaction mixture.
  • two or more blockers are used, which preferably overlap with the binding parts of the primers, so as to additionally prevent amplification.
  • the blockers can be chemically modified in such a way that the blockers are not lengthened or broken down by the polymerase in the course of the amplification (see in particular: PCT / EP02 / 02572; Cottrell et al. 2004, op. Cit.). It is known to the person skilled in the art that all known embodiments of the blocker technology, particularly those described in the publications cited above, can largely also be applied to the combination according to the invention of transcription-based amplification methods and use of blockers. The corresponding embodiments are therefore also part of this invention.
  • blockers in methylation-specific PCR
  • the blocker oligonucleotides bind to the background RNA and thus form RNA-DNA hybrids.
  • the RNA part of these hybrids can be broken down by the RNAse H enzyme in the reaction cycle and thus finally removed from the entire amplification reaction.
  • the use of blockers here does not only lead to a blocking of the amplification of the background nucleic acid, as in the known Heavy-Methyl TM method, but also to a degradation of the background nucleic acid. This results in an increased specificity of the reaction.
  • the amplification can take place both using methylation-specific primers (see above) and also using non-methylation-specific primers.
  • non-methylation-specific primers are used.
  • the amplification takes place in the presence of at least one methylation-specific blocker oligomer. Accordingly, these carry at least one CpG position or a methylation-specific TG or CA position.
  • the oligomers preferably have 3-5 methylation-specific positions.
  • Oligonucleotides are preferably used because the corresponding hybrids of blockers and RNA can be recognized particularly effectively by the RNAse-H.
  • the blocker oligonucleotides are preferably between 10 and 25 nucleotides long.
  • the blockers are added in excess to the primers in the reaction mixture, particularly preferably in a concentration which is 3 to 15 times higher.
  • the blockers can be chemically modified at the 3 'and / or 5' end in order to prevent the blockers from being extended or degraded. Details are known to the person skilled in the art (PCT / EP02 / 02572).
  • the amplification then takes place under the conditions described above.
  • a NASBA reaction is preferably carried out.
  • one of the primers carries a T7 promoter which serves as the starting point for transcription for the RNA polymerase.
  • the primer hybridizes to the (+) strand of the target sequence.
  • a short heating step is usually carried out for this.
  • the primer is extended by the reverse transcriptase to form a DNA double strand. After a further heating step, the second primer can bind to the (-) DNA strand just generated.
  • a further double extension then forms a DNA double strand which bears a complete T7 promoter.
  • the binding of the methylation-specific blockers to the background DNA blocks an extension of the background DNA here.
  • Transcripts are then generated from the T7 promoter, which in turn are converted into DNA double strands via RNA-DNA hybrids.
  • the methylation-specific blocker oligonucleotides in turn bind to the background RNA and thus prevent their amplification.
  • the RNA part of the blocker-RNA hybrids formed is degraded by the RNAse H.
  • the background RNA is therefore no longer available as template for further rounds of amplification.
  • DNA / RNA is not affected by the blockers.
  • the amplicates are detected with the aid of real-time probes.
  • Real-time detection of NASBA amplificates using molecular beacons has already been described (Deiman et al 2002, loc. Cit.). But it is also the use of other real Time probes are conceivable, especially the use of Lightcycler TM probes.
  • These probes are preferably methylation-specific, ie they carry at least one methylation-specific dinucleotide (see above). Details of the construction of corresponding probes are known to the person skilled in the art (see: PCT / EP02 / 02572; US 6,331,393)
  • the RNA is chemically or enzymatically fragmented before analysis.
  • mass spectrometric analysis can be facilitated (see: Krebs et al. 2003, op. Cit .; Seichter et al. 2004, op. Cit .; Hartmer et al. 2003, op. Cit.).
  • the RNA is fragmented depending on the methylation status of the DNA before the analysis.
  • the methylation pattern can then be concluded from the fragmentation pattern.
  • the basis for the possibility of methylation-dependent fragmentation is the bisulfite conversion (or an analogous chemical or enzymatic conversion) in combination with an amplification. This makes it possible to add nucleic acids generate cytosine or guanine exactly where the original DNA contained methyl cytosine.
  • the nucleic acids are then cut specifically at the C or G positions. This results in specific fragmentation patterns for the original methylation state, which can be analyzed using different methods.
  • RNAse Tl is particularly preferably used for the specific enzymatic cleavage at G positions (cf. Hartmer et al. 2003, loc. Cit.; Krebs et al. 2003, loc. Cit.).
  • the enzyme is commercially available from various manufacturers (for example Röche Diagnostics Mannheim, Germany).
  • RNAse-A A specific cleavage of RNA at C positions is possible using RNAse-A, provided that chemically modified uracil ribonucleotides are used in the transcription (see: Krebs et al. 2003, loc. Cit.).
  • a specific chemical cleavage at C or G positions is possible with the help of different reagents (see: Peattie: Direct chemical method for sequencing RNA. Proc Natl Acad Sei US A. 1979 Apr; 76 (4): 1760-49); Krebs et al. 2003, aao).
  • the cleavages result in specific fragmentation patterns which correspond to the local distribution of the methylcytins on the DNA to be originally examined.
  • Each resulting fragment represents the area between two methylated cytosines in the original DNA.
  • the number of fragments that arise correlates directly with the number of methylated cytosines.
  • the property that only the originally methylated positions are the point of attack for fragmentation represents a crucial feature of this particularly preferred embodiment.
  • the number of fragmentation sites is independent of the sequence of the starting sample. The result of a fragmentation is always the same number of fragments, which do not differ in the number of nucleotides, but only in the base composition.
  • each resulting fragment represents the sequence between the neighboring methylated cytosines. If, for example, there are unmethylated CpG sites, a coupled statement can be made about the measurement for a single starting DNA molecule. thylation of these CpGs are taken. Furthermore, fragmentation at an originally methylated site also affects the neighboring fragment, since obviously two neighboring fragments provide information about the same CpG site. This neighboring fragment and the methylation state reflected thereby can also be assigned to a single starting DNA molecule.
  • This method can therefore be multiplexed, which is a decisive advantage if only a limited amount of starting sample material is available.
  • Other .fragmentation methods generate a large number of small fragments, these can no longer be assigned to the individual loci in a multiplex reaction.
  • the methylation status of all cytosines contained in the DNA amplificate can be determined by means of a suitable analysis of the fragments formed (cf. Fig. 1). Different methods are available for this. In a preferred embodiment, mass spectrometric methods, in particular MALDI-TOF, are used. The exact mass of the fragments and the knowledge of the sequence of the original DNA can thus be used to determine exactly which two cytosines - namely those which delimit the fragment - were methylated. Details of the MALDI-TOF analysis are known to the person skilled in the art. In particular, a large number of possibilities for mass spectrometric analysis are specified in the US patent application US20030129589, which in many cases are corresponding for the inventive method are applicable.
  • the fragmentation pattern of the RNA is analyzed by electrophoretic or chromatographic methods (for example capillary gel electrophoresis or HPLC). These methods enable the resulting RNA fragments to be quantified by integrating the signal intensities (this is known to the person skilled in the art). If the DNA to be examined is present as a mixture of differently methylated species, this quantification can be used to draw conclusions about the mixture ratio of these species.
  • electrophoretic or chromatographic methods for example capillary gel electrophoresis or HPLC.
  • fragmentation-based methods are only conditionally suitable for such electrophoretic and chromatographic analysis methods, since only the base composition and not the number of bases in a fragment differs in the methylation-sun-specific fragmentation. This can e.g. cannot be resolved with capillary gel electrophoresis. This is another advantage of the method described.
  • control sequences are also introduced into the DNA, by means of which the completeness of the fragmentation can be checked.
  • the G-rich primer bears the control sequence "TCTTTTC”
  • an RNA with the additional sequence "GAAAAGA” results. All other guanines in this RNA originate from methylated cytosines in the original DNA.
  • the control sequence fragment can be used to detect this Check completeness of the fragmentation reaction (see: Examples; Figure 2).
  • the methods described above are particularly preferably used for the diagnosis or prognosis of cancer diseases or other diseases associated with a change in the methylation status.
  • CNS malfunctions aggression symptoms or behavioral disorders; clinical, psychological and social consequences of G brain damage; psychotic disorders and personality disorders; Dementia and / or associated syndromes; cardiovascular disease, malfunction and damage; Malfunction, damage or disease of the gastrointestinal tract; Malfunction, damage or disease of the respiratory system; Injury, inflammation, infection, immunity and / or convalescence; Malfunction, damage or illness of the body as a deviation in the development process; Malfunction, damage or disease of the skin, muscles, connective tissue or bones; endocrine and metabolic dysfunction, injury or illness; Headache or sexual malfunction.
  • the method according to the invention is also suitable for predicting undesirable drug effects and for differentiating cell types or tissues or for examining cell differentiation.
  • kits are also according to the invention:
  • kits that consist of a bisulfite reagent and at least one primer that carries a promoter. Such a kit, which additionally contains enzymes and / or further components for carrying out an amplification process based on transcription.
  • Such a kit which additionally contains at least one blocker-specific oligomer specific for metabolism.
  • a kit that consists of a bisulfite reagent, primers and an enzyme that cuts RNA nucleotide-specifically and optionally contains a polymerase and other reagents required for amplification.
  • Example 1 Examination of the promoter region of the human adenomatosis polyposis coli (APC) gene
  • the methylation status of the promoter region of the human adenomatosis poly osis coli (APC) gene should be examined.
  • a DNA was used that was artificially methylated by an enzyme that methylates all cytosines in the CpG context (Sssl methyltransferase). After a bisulfite treatment of the DNA, an area of the promoter was amplified by means of a PCR.
  • the following two primers were used for this amplification: TCTTTTCGGTTAGGGTTAGGTAGGTTGT (G-rich) (Seq ID1) and GTAATAC ACTCACTATAGGGAGACTACAC-CAATACAACCACATATC (C-rich) (Seq ID 2).
  • the underlined part of the C-rich primer represents the promoter for the T7 polymerase.
  • the G-rich primer also contains (underlined) an additional sequence which, after transcription of the PCR product into an RNA molecule on the 3rd 'End of this product is reversely complementarily located and thus gives a signal after cleavage by the RNase T1, which indicates the completeness of the transcription.
  • This sequence thus represents a control fragment after the endomuclease treatment, which always arises regardless of the methylation status.
  • the following conditions were chosen for the transcription of the PCR product: 10 p ⁇ . PCR product, 5 ⁇ l 5-fold T7 RNA polymerase buffer (Fermentas), 1 ⁇ l T7 polymerase (20 U / ⁇ l, Fermentas), 0.5 ⁇ l NTP mix (Fermentas, 25 mmol / 1 each), 8, 5 ul water. Incubation took place at 37 ° C for 1.5 h. The RNase was then digested by adding 2.5 ⁇ l RNase Tl (10 ⁇ l / p.1, Fermentas) with a 45-minute incubation at 37 ° C.
  • the sequence" GAAAAGA "at the end of the R - NA molecule results from the control sequence additionally attached to the G-rich primer. All other guanines in this molecule resulted from methylated Cytosines in the original DNA. If this DNA had not been methylated at these sites, adenines would have been found instead of the guanine.
  • the RNase Tl now cleaves the RNA behind the guanine and leads to a fragmentation pattern r, which reflects the methylation status of the original DNA The resulting fragments are listed in Table 2 with their corresponding m / z values.
  • Table 2 Fragments and their m / z values of the RNA after digestion of the APC-198 transcript with RNase T1.
  • Figure 3 shows the fragments detected by Maldi-TOF mass spectrometry, which resulted from the RNase T1 digestion of the transcript. It can be seen there that almost all fragments could be detected which, according to Table 2, are characteristic of the fully methylated DNA. Only fragments smaller than m / z 980 could not be detected because in this area the matrix used for the Maldi-TOF analysis generates a background signal that is too large. Using this spectrum, it could now be clearly proven that the original DNA was methylated on all cytosines in the CpG context.
  • Example 2 Examination of the methylation state of the CDH13 gene The methylation state of the CDH13 gene should be examined. For this purpose, Sssl-methylated DNA was unmethylated Phi-DNA and a cloned methylated PCR amplificate were examined. A sequencing was carried out as a control. The method according to the invention was applied as described above. The following sequences were used as primers: TCTTTTTCTTTGTATTAGGTTGGAAGTGGT (Seq ID4);
  • Figure 4 shows the fragments detected by means of Maldi-TOF mass spectrometry, which resulted from the RNase Tl vertex of the transcript. All fragments that are characteristic of completely methylated DISTA (Table 3, Columns 1 and 2) could be detected in the artificially methylated DNA, only fragments smaller than 980 (m / z) and larger than 15250 (m / z) could not be detected due to the device become. Table 3 (columns 3 and 4) additionally shows the fragmentation of the cloned DNA. Here are those described below Differences to the artificially methylated DNA visible. The 8619.3 (m / z) fragment is no longer detectable.
  • Table 3 Fragments and their m / z values of the RNA after digestion of the CDH13 transcript with RNase T1.
  • Example 3 Analysis of Clinical Samples
  • two tumor DNA samples with a high methyl- degree and two normal colon samples with a low degree of methylation were analyzed as described in Example 2 and compared with sequencing data (Fig. 5).
  • sequencing data Fig. 5
  • Tl, T2 the predominantly methylated
  • Nl, N2 the predominantly unmethylated samples
  • sequencing was unable to detect the methylation status in positions 32, 258 and 269. These positions are either close to the sequencing primer or at the end of the sequence.
  • the limited measuring range of the MALDI spectrometer used did not allow all CpG positions to be clearly assigned.
  • the absence of a fragment cannot necessarily be interpreted as the absence of methylation at the investigated position, unless this statement is justified by the evidence of a longer fragment.
  • the strong signal for fragments 6, 8, 9, 13 and 14 in the tumor sample T1 shows a relatively high degree of comethylation in the position ions 122, 136, 138, 145, 152, 154, 258 and 269. These are exactly the positions that show comethylation in most of the analyzed cases (Fig. 5). The normalized relative intensities show a minimum of 50% methylation in these positions. In contrast, the absence of a signal or the presence of only a weak signal for fragments 1, 3, 4 and 5 is due to the fact that there is only a slight degree of comethylation at positions 32, 81, 96 and 104. These observations correspond to the clone data from Example 2.
  • Comethylation of promoter regions is of crucial importance for many clinical questions.
  • the method according to the invention can detect the presence of comethylations in two or more adjacent positions. This selectivity is a great advantage over direct bisulfite sequencing. It is unable to differentiate between specific methylation patterns and random methylation without clinical significance (see: Song et al.: Hypermethylation trigger of the glutathione-S-transferase gene (GSTP1) in prostate cancer cells. Oncog-ene, 21, 1048-1061, 2002).
  • PCR program 95 ° C, 15 min; 95 ° C, 1 min; 55 ° C, 45 S; 72 ° C, 1:30 min; 72 ° C, 10 min; 41 repetitions. These PCR products were analyzed on an agarose gel (see Figure 7). After the PCR reaction, 10 ⁇ l of the PCR mix was mixed with 15 ⁇ l transcription mix. This mix was such that the following final concentrations were used in a 25 ⁇ l reaction: 1 ⁇ MBI Fermentas T7 buffer, 0.8 U / ⁇ l T7 RNA polymerase, 0.5 mmol / 1 NTPs (each).
  • Table 4 Fragments and their m / z values of the RNA from Example 3 after digestion with RNase T1.
  • Figure 1 shows schematically the principle of a particular embodiment of the method according to the invention.
  • a promoter is inserted into the chemically converted DNA, from which a C-rich RNA is transcribed.
  • Tl RNase digestion creates a methylation-specific fragmentation pattern.
  • Figure 2 shows schematically the principle of the embodiment according to the invention described in Figure 1 with the additional use of a "control tag”.
  • Figure 3 shows the MALDI-TOF mass spectrum of the transcript of the artificially methylated APC gene (Example 1) digested with RNase T1. The numbering of the peaks corresponds to that from Table 2.
  • Figure 4 shows the MALDI-TOF mass spectrum of example 2.
  • FIG. 5 shows the result of Example 3.
  • CpG methylations were carried out in 10 clones (AJ) on the two bisulfite-converted colon tumor DNA samples (T1, T2) and two normal colon DNA samples (N1, N2). analyzed. The results are shown after RNA cleavage and MALDI-TOF (left) or -v. Sequencing (right). The black circles indicate the methylated CpG positions, the white ones
  • Circles indicate the unmethylated CpG positions, the gray circles indicate fragments that could not be clearly assigned, and the crosses indicate CpG-
  • FIG. 6 shows the result of Example 4.
  • T1, T2 bisulfite-converted colon tumor DNA samples
  • N1, N2 normal colon DNA samples
  • FIG 7 shows the agarose gel of Example 3. The amplification of bisulfited DNA from methylated and unmethylated DNA using methylation-specific T7 domain primers is shown. The primers are chosen so that they do not form a product on genomic DNA and on bisulfited DNA - from unmethylated DNA. Sssl methylase treated bisulfited DNA, however, can be amplified
  • Figure 8 shows the MALDI-TOF spectrum of example 3.
  • Components should consist of a base sequence that consists of the one that the promoter sequence of the T7 ensures that the promoter sequence the T7 DNA-dependent RNA - DNA-dependent RNA polymerase corresponds to the DNA double helix and all polymerase (T7DdRp), and corresponds in its 3 'region (T7DdRp), and in its 3' region secondary structures consist of a sequence which Reverse complementary consist of a sequence that are reversibly broken, to the (+) - strand of the target sequence within the template complementary to the se ⁇ se strand, which is an important DNA (typically 15 to 30 bp).
  • the latter sequence target sequence within the template DNA The requirement for (target sequence in the template) must not be a CpG or TpG (typically 15 to 30 bp). specific bindings of the position contain - DNA oligonucleotides (2 nd pnmer) which have a primer on their reverse - - DNA oligonucleotides (2 "pnmer) which contain a base sequence which contain reverse-complementary base sequence which are reverse-complementary to complementary to one Target sequence Sequences in which a sequence region (typically 15 to 30 bp) of the (typically 15 to 30 bp) of the antisense template DNA in the (-) strand of the target sequence within the template DNA is strand within the template DNA and is attached and 50 to 500 bp below (downstream) the 50 to 500 bp below (downstream) the 41 ° C.
  • target sequence of the T7-ta ⁇ led oligonucleotide is also the target sequence of the T7-ta ⁇ led oligonucleotide.
  • this target sequence must not contain any CpG or TPG Position is the composition that is included - if the detection by means of a detector by - DNA-NuKleotide (Blocker), which contain a sequence, specific probe Heating an optional reverse complementary to a region in the (-) - strand oligonucleotides (typically molecular step, which is not necessarily the target sequence which TpG positions and Beacon, or LightCycler probes) which is necessary typically 4-30 bp long These sequences are also contained (typically 15 to blockers by a modification of their 3 'end before 30 bp), which are reverse-complementarily protected for an extension.
  • the sense region of the target DNA is phosphoryherization.
  • This sequence can be limited by the number (one of each described above overlap with the sequence of the second primer) - if the detection by means of a specific probe - NASBA reaction buffer (typically takes place: probe oligonucleotides (typically molecular containing Tris, MgCl 2 , KCI, dithiothreitol, beacon, or LightCycler probes) which contain sequences DMSO, each dNTP, each NTP) (typically 15 to 30 bp), which are reverse-complementary to a (+) - region of the target DNA, - device for Heat incubation which is limited by the reaction tubes (each one of the above described) and has 1-4 CpG dinucleotides.
  • Appropriate amounts of the components described above - NASBA reaction buffer are mixed in suitable reaction vessels and - Apparatus for heat incubating the reaction vessels for a short time (typically 2 min) at high temperatures (typically 95 ° C.) Approp ⁇ ate amounts of components described above and subsequently mixed in a suitable reaction vessel and incubated fora ⁇ typically 2 min) at medium short fjme (typically 2 min) at high temperatures (typically temperatures (typically 41 ° C) 95 ° C) and subsequently for a short time (typically 2 min) at incubated medium temperatures (typically 41 ° C)

Abstract

L'invention concerne un procédé d'analyse pour déterminer la méthylation de la cytosine dans l'ADN. Selon ce procédé, l'ADN soumis à l'analyse est d'abord converti chimiquement ou enzymatiquement. Ensuite, un promoteur est introduit dans l'ADN qui est alors transformé en ARN. Le motif de méthylation de l'ADN peut être déterminé de différentes façons par analyse de l'ARN. L'ARN est de préférence, chimiquement ou enzymatiquement fragmenté avant l'analyse, cette fragmentation se faisant en fonction du motif de méthylation de l'ADN. Ledit procédé convient en particulier pour le diagnostic et pour le pronostic relatifs à des maladies cancéreuses et à d'autres maladies associées à une modification du motif de méthylation.
EP05716469A 2004-03-24 2005-03-24 Procede d'analyse pour determiner la methylation de la cytoseine Withdrawn EP1735460A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP05716469A EP1735460A1 (fr) 2004-03-24 2005-03-24 Procede d'analyse pour determiner la methylation de la cytoseine

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
EP04090117 2004-03-24
EP04090431 2004-11-12
US63482004P 2004-12-10 2004-12-10
PCT/EP2005/003366 WO2005093095A1 (fr) 2004-03-24 2005-03-24 Procede d'analyse pour determiner la methylation de la cytoseine
EP05716469A EP1735460A1 (fr) 2004-03-24 2005-03-24 Procede d'analyse pour determiner la methylation de la cytoseine

Publications (1)

Publication Number Publication Date
EP1735460A1 true EP1735460A1 (fr) 2006-12-27

Family

ID=56290677

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05716469A Withdrawn EP1735460A1 (fr) 2004-03-24 2005-03-24 Procede d'analyse pour determiner la methylation de la cytoseine

Country Status (3)

Country Link
US (1) US20090075251A1 (fr)
EP (1) EP1735460A1 (fr)
WO (1) WO2005093095A1 (fr)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005024068A2 (fr) 2003-09-05 2005-03-17 Sequenom, Inc. Analyse de variations de sequences alleles specifiques
CA2561381C (fr) 2004-03-26 2015-05-12 Sequenom, Inc. Clivage specifique de base de produits d'amplification specifiques de la methylation en combinaison avec une analyse de masse
US7906288B2 (en) * 2006-01-04 2011-03-15 The Johns Hopkins University Compare-MS: method rapid, sensitive and accurate detection of DNA methylation
WO2009115313A1 (fr) * 2008-03-19 2009-09-24 Oryzon Genomics, S.A. Procédé et composition pour analyse de méthylation

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001049877A1 (fr) * 2000-01-05 2001-07-12 Johnson & Johnson Research Pty Ltd. Procede d'amplification simultanee et de detection en temps reel de sequences d'acides nucleiques polymorphes
WO2004050839A2 (fr) * 2002-11-27 2004-06-17 Sequenom, Inc. Procedes et systemes de detection et d'analyse de variations de sequences bases sur la fragmentation

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5914229A (en) * 1996-06-14 1999-06-22 Sarnoff Corporation Method for amplifying a polynucleotide
US6117635A (en) * 1996-07-16 2000-09-12 Intergen Company Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
CA2439795A1 (fr) * 2001-03-07 2002-09-12 Biomerieux B.V. Procede d'amplification et de detection d'adn au moyen d'une amplification fondee sur la transcription
DE10112515B4 (de) * 2001-03-09 2004-02-12 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungsmustern mit hoher Sensitivität
US20050164193A1 (en) * 2002-03-25 2005-07-28 Epigenomics Ag Method for the analysis of methylation patterns within nucleic acids by means of mass spectrometry
US20070117093A1 (en) * 2003-06-24 2007-05-24 Reimo Tetzner Heavymethyl assay for the methylation analysis of the gstpi gene

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001049877A1 (fr) * 2000-01-05 2001-07-12 Johnson & Johnson Research Pty Ltd. Procede d'amplification simultanee et de detection en temps reel de sequences d'acides nucleiques polymorphes
WO2004050839A2 (fr) * 2002-11-27 2004-06-17 Sequenom, Inc. Procedes et systemes de detection et d'analyse de variations de sequences bases sur la fragmentation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of WO2005093095A1 *

Also Published As

Publication number Publication date
US20090075251A1 (en) 2009-03-19
WO2005093095A1 (fr) 2005-10-06

Similar Documents

Publication Publication Date Title
EP1423533B1 (fr) Procede tres sensible pour detecter la methylation de la cytosine
EP1370691B1 (fr) Procede de detection de structures de methylation de la cytosine a haute sensibilite
EP1432828B1 (fr) Procede de detection de la cytosine dans des ilots cpg
DE10331107B3 (de) Verfahren zum Nachweis von Cytosin-Methylierungen in DNA mittels Cytidin-Deaminasen
DE102005034628B4 (de) Verfahren zur Untersuchung von Cytosin-Methylierungen in DNA
WO2003057909A2 (fr) Procede de detection de modeles de methylation de la cytosine par ligation exponentielle d'oligonucleotides sondes hybrides (mla)
EP1654388B1 (fr) Procede de detection de methylation de cytosine dans de l'adn
DE19853398C1 (de) Verfahren zur Identifikation von Cytosin-Methylierungsmustern in genomischer DNA
EP1438437B1 (fr) Procede de detection de methylation de la cytosine dans des echantillons d'adn immobilise
EP1853724B1 (fr) Procédé d'analyse des méthylations de la cytosine dans l'adn
EP1735460A1 (fr) Procede d'analyse pour determiner la methylation de la cytoseine
EP1746169B1 (fr) Procédé de quantification d'ADN méthylé
DE10304219B3 (de) Verfahren zum Nachweis von Cytosin-Methylierungsmustern mit hoher Sensitivität
EP2087137B1 (fr) Molécule pour élaborer un étalon d'analyse quantitative de l'état de méthylation d'un acide nucléique
DE10392538B4 (de) Verfahren zur Analyse von methylierten Nukleinsäuren
EP1711628B1 (fr) Procede pour calibrer et controler des methodes d'analyse de methylation au moyen d'adn non methyle
DE10346363B4 (de) Verfahren zur Methylierungsanalyse von DNA
EP1432827B1 (fr) Procede pour detecter la methylation de l'adn au moyen d'analogues marques de la s-adenosylmethionine
EP1882747A1 (fr) Procédé d'analyse de l'état de méthylation d'une acide nucléique
DE102006035600B3 (de) Verfahren zum Nachweis eines Methylierungsmusters
DE102004002257B4 (de) Verfahren zur Untersuchung von Cytosin-Methylierungen in DNA mit Hilfe von DNA-Reparaturenzymen
DE10158283A1 (de) Verfahren zum Nachweis von Cytosin-Methylierungsmustern mit hoher Sensitivität
WO2007141034A1 (fr) protection rémanente dans SYSTÈMES d'amplification d'ADN à base enzymatique pour analyse de méthylation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20061023

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: KLUTH, ANTJE

Inventor name: SCHUSTER, MATTHIAS

Inventor name: DIETRICH, DIMO

Inventor name: SCHATZ, PHILIPP

17Q First examination report despatched

Effective date: 20070522

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090721